WorldWideScience

Sample records for break repair activity

  1. The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells

    International Nuclear Information System (INIS)

    Highly hazardous DNA double-strand breaks can be induced in eukaryotic cells by a number of agents including pathogenic bacterial strains. We have investigated the genotoxic potential of Pseudomonas aeruginosa, an opportunistic pathogen causing devastating nosocomial infections in cystic fibrosis or immunocompromised patients. Our data revealed that infection of immune or epithelial cells by P. aeruginosa triggered DNA strand breaks and phosphorylation of histone H2AX (γH2AX), a marker of DNA double-strand breaks. Moreover, it induced formation of discrete nuclear repair foci similar to gamma-irradiation-induced foci, and containing γH2AX and 53BP1, an adaptor protein mediating the DNA-damage response pathway. Gene deletion, mutagenesis, and complementation in P. aeruginosa identified ExoS bacterial toxin as the major factor involved in γH2AX induction. Chemical inhibition of several kinases known to phosphorylate H2AX demonstrated that Ataxia Telangiectasia Mutated (ATM) was the principal kinase in P. aeruginosa-induced H2AX phosphorylation. Finally, infection led to ATM kinase activation by an auto-phosphorylation mechanism. Together, these data show for the first time that infection by P. aeruginosa activates the DNA double-strand break repair machinery of the host cells. This novel information sheds new light on the consequences of P. aeruginosa infection in mammalian cells. As pathogenic Escherichia coli or carcinogenic Helicobacter pylori can alter genome integrity through DNA double-strand breaks, leading to chromosomal instability and eventually cancer, our findings highlight possible new routes for further investigations of P. aeruginosa in cancer biology and they identify ATM as a potential target molecule for drug design. (authors)

  2. Positive regulation of DNA double strand break repair activity during differentiation of long life span cells: the example of adipogenesis.

    Directory of Open Access Journals (Sweden)

    Aline Meulle

    Full Text Available Little information is available on the ability of terminally differentiated cells to efficiently repair DNA double strand breaks (DSBs, and one might reasonably speculate that efficient DNA repair of these threatening DNA lesions, is needed in cells of long life span with no or limited regeneration from precursor. Few tissues are available besides neurons that allow the study of DNA DSBs repair activity in very long-lived cells. Adipocytes represent a suitable model since it is generally admitted that there is a very slow turnover of adipocytes in adult. Using both Pulse Field Gel Electrophoresis (PFGE and the disappearance of the phosphorylated form of the histone variant H2AX, we demonstrated that the ability to repair DSBs is increased during adipocyte differentiation using the murine pre-adipocyte cell line, 3T3F442A. In mammalian cells, DSBs are mainly repaired by the non-homologous end-joining pathway (NHEJ that relies on the DNA dependent protein kinase (DNA-PK activity. During the first 24 h following the commitment into adipogenesis, we show an increase in the expression and activity of the catalytic sub-unit of the DNA-PK complex, DNA-PKcs. The increased in DNA DSBs repair activity observed in adipocytes was due to the increase in DNA-PK activity as shown by the use of DNA-PK inhibitor or sub-clones of 3T3F442A deficient in DNA-PKcs using long term RNA interference. Interestingly, the up-regulation of DNA-PK does not regulate the differentiation program itself. Finally, similar positive regulation of DNA-PKcs expression and activity was observed during differentiation of primary culture of pre-adipocytes isolated from human sub-cutaneous adipose tissue. Our results show that DNA DSBs repair activity is up regulated during the early commitment into adipogenesis due to an up-regulation of DNA-PK expression and activity. In opposition to the general view that DNA DSBs repair is decreased during differentiation, our results demonstrate

  3. Mre11 ATLD17/18 mutation retains Tel1/ATM activity but blocks DNA double-strand break repair

    NARCIS (Netherlands)

    O. Limbo (Oliver); D. Moiani (Davide); A. Kertokalio (Aryandi); C. Wyman (Claire); J.A. Tainer (John); P. Russell (Paul)

    2012-01-01

    textabstractThe Mre11 complex (Mre11-Rad50-Nbs1 or MRN) binds double-strand breaks where it interacts with CtIP/Ctp1/Sae2 and ATM/Tel1 to preserve genome stability through its functions in homology-directed repair, checkpoint signaling and telomere maintenance. Here, we combine biochemical, structur

  4. DNA double strand break repair pathway choice following ionizing radiation

    International Nuclear Information System (INIS)

    A DNA double strand break (DSB) is one of the critical DNA lesions leading to cell death if unrepaired. DSB is repaired by two distinct repair pathways, i.e. non-homologous end-joining (NHEJ) or homologous recombination (HR). NHEJ contributes to DSB repair throughout the cell cycle, while HR is active during S/G2 phase following DNA replication. We aim to elucidate the molecular mechanisms underlying DSB repair pathway choice at two ended DSBs in G2 phase following ionizing radiation (IR). Here, we discuss recent work that provides new insights into DSB repair pathways choice including our study. (author)

  5. Reduced Activity of Double-Strand Break Repair Genes in Prostate Cancer Patients With Late Normal Tissue Radiation Toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Oorschot, Bregje van, E-mail: b.vanoorschot@amc.uva.nl [Laboratory for Experimental Oncology and Radiobiology (LEXOR), Center for Molecular Medicine (CEMM), Department of Radiation Oncology, Academic Medical Center, University of Amsterdam, Amsterdam (Netherlands); Hovingh, Suzanne E. [Laboratory for Experimental Oncology and Radiobiology (LEXOR), Center for Molecular Medicine (CEMM), Department of Radiation Oncology, Academic Medical Center, University of Amsterdam, Amsterdam (Netherlands); Moerland, Perry D. [Bioinformatics Laboratory, Department of Clinical Epidemiology, Biostatistics and Bioinformatics, Academic Medical Center, University of Amsterdam, Amsterdam (Netherlands); Medema, Jan Paul; Stalpers, Lukas J.A. [Laboratory for Experimental Oncology and Radiobiology (LEXOR), Center for Molecular Medicine (CEMM), Department of Radiation Oncology, Academic Medical Center, University of Amsterdam, Amsterdam (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Franken, Nicolaas A.P. [Laboratory for Experimental Oncology and Radiobiology (LEXOR), Center for Molecular Medicine (CEMM), Department of Radiation Oncology, Academic Medical Center, University of Amsterdam, Amsterdam (Netherlands)

    2014-03-01

    Purpose: To investigate clinical parameters and DNA damage response as possible risk factors for radiation toxicity in the setting of prostate cancer. Methods and Materials: Clinical parameters of 61 prostate cancer patients, 34 with (overresponding, OR) and 27 without (non-responding, NR) severe late radiation toxicity were assembled. In addition, for a matched subset the DNA damage repair kinetics (γ-H2AX assay) and expression profiles of DNA repair genes were determined in ex vivo irradiated lymphocytes. Results: Examination of clinical data indicated none of the considered clinical parameters to be correlated with the susceptibility of patients to develop late radiation toxicity. Although frequencies of γ-H2AX foci induced immediately after irradiation were similar (P=.32), significantly higher numbers of γ-H2AX foci were found 24 hours after irradiation in OR compared with NR patients (P=.03). Patient-specific γ-H2AX foci decay ratios were significantly higher in NR patients than in OR patients (P<.0001). Consequently, NR patients seem to repair DNA double-strand breaks (DSBs) more efficiently than OR patients. Moreover, gene expression analysis indicated several genes of the homologous recombination pathway to be stronger induced in NR compared with OR patients (P<.05). A similar trend was observed in genes of the nonhomologous end-joining repair pathway (P=.09). This is congruent with more proficient repair of DNA DSBs in patients without late radiation toxicity. Conclusions: Both gene expression profiling and DNA DSB repair kinetics data imply that less-efficient repair of radiation-induced DSBs may contribute to the development of late normal tissue damage. Induction levels of DSB repair genes (eg, RAD51) may potentially be used to assess the risk for late radiation toxicity.

  6. Important DNA repair proteins in DNA double-strand break repair pathways

    International Nuclear Information System (INIS)

    DNA double-strand break repair pathway is one of DNA damage repair pathways. DNA repair genes can repair DNA damage, maintain the integrity of the genetic information and inhibit the formation of tumors. There are two mechanisms-non-homologous end joining and homologous recombination to repair DNA double-strand break. In this review, an overview of important repair proteins of non--homologous end joining and homologous recombination pathways was introduced. (authors)

  7. Phosphorylation: The Molecular Switch of Double-Strand Break Repair

    Directory of Open Access Journals (Sweden)

    K. C. Summers

    2011-01-01

    Full Text Available Repair of double-stranded breaks (DSBs is vital to maintaining genomic stability. In mammalian cells, DSBs are resolved in one of the following complex repair pathways: nonhomologous end-joining (NHEJ, homologous recombination (HR, or the inclusive DNA damage response (DDR. These repair pathways rely on factors that utilize reversible phosphorylation of proteins as molecular switches to regulate DNA repair. Many of these molecular switches overlap and play key roles in multiple pathways. For example, the NHEJ pathway and the DDR both utilize DNA-PK phosphorylation, whereas the HR pathway mediates repair with phosphorylation of RPA2, BRCA1, and BRCA2. Also, the DDR pathway utilizes the kinases ATM and ATR, as well as the phosphorylation of H2AX and MDC1. Together, these molecular switches regulate repair of DSBs by aiding in DSB recognition, pathway initiation, recruitment of repair factors, and the maintenance of repair mechanisms.

  8. The RSC and INO80 chromatin-remodeling complexes in DNA double-strand break repair.

    Science.gov (United States)

    Chambers, Anna L; Downs, Jessica A

    2012-01-01

    In eukaryotes, DNA is packaged into chromatin and is therefore relatively inaccessible to DNA repair enzymes. In order to perform efficient DNA repair, ATP-dependent chromatin-remodeling enzymes are required to alter the chromatin structure near the site of damage to facilitate processing and allow access to repair enzymes. Two of the best-studied remodeling complexes involved in repair are RSC (Remodels the Structure of Chromatin) and INO80 from Saccharomyces cerevisiae, which are both conserved in higher eukaryotes. RSC is very rapidly recruited to breaks and mobilizes nucleosomes to promote phosphorylation of H2A S129 and resection. INO80 enrichment at a break occurs later and is dependent on phospho-S129 H2A. INO80 activity at the break site also facilitates resection. Consequently, both homologous recombination and nonhomologous end-joining are defective in rsc mutants, while subsets of these repair pathways are affected in ino80 mutants.

  9. Modulation of DNA double-strand break repair activity in cell-free extracts of gamma-irradiated mouse testicular cells

    International Nuclear Information System (INIS)

    DNA double-strand breaks (DSBs) are potentially mutagenic lesions demanding effective damage recognition and repair. Even a single DSB can be detrimental if left unrepaired or misrepaired, and if present in gamete, it can cause foetal wastage or malformations/congenital defects in the offspring. The threats posed by DSBs have triggered the evolution of two major pathways of DSB repair, homologous recombination-mediated repair (HRR) and non-homologous end-joining (NHEJ), conserved from bacteria to mammals. Though HRR is more predominant in bacteria and yeast, NHEJ is more efficient in mammalian somatic cells. Studies in our laboratory have shown that both the pathways are equally efficient in mammalian male germ cells

  10. Ghrelin Prevents Cisplatin-Induced Testicular Damage by Facilitating Repair of DNA Double Strand Breaks Through Activation of p53 in Mice.

    Science.gov (United States)

    Garcia, Jose M; Chen, Ji-an; Guillory, Bobby; Donehower, Lawrence A; Smith, Roy G; Lamb, Dolores J

    2015-07-01

    Cisplatin administration induces DNA damage resulting in germ cell apoptosis and subsequent testicular atrophy. Although 50 percent of male cancer patients receiving cisplatin-based chemotherapy develop long-term secondary infertility, medical treatment to prevent spermatogenic failure after chemotherapy is not available. Under normal conditions, testicular p53 promotes cell cycle arrest, which allows time for DNA repair and reshuffling during meiosis. However, its role in the setting of cisplatin-induced infertility has not been studied. Ghrelin administration ameliorates the spermatogenic failure that follows cisplatin administration in mice, but the mechanisms mediating these effects have not been well established. The aim of the current study was to characterize the mechanisms of ghrelin and p53 action in the testis after cisplatin-induced testicular damage. Here we show that cisplatin induces germ cell damage through inhibition of p53-dependent DNA repair mechanisms involving gamma-H2AX and ataxia telangiectasia mutated protein kinase. As a result, testicular weight and sperm count and motility were decreased with an associated increase in sperm DNA damage. Ghrelin administration prevented these sequelae by restoring the normal expression of gamma-H2AX, ataxia telangiectasia mutated, and p53, which in turn allows repair of DNA double stranded breaks. In conclusion, these findings indicate that ghrelin has the potential to prevent or diminish infertility caused by cisplatin and other chemotherapeutic agents by restoring p53-dependent DNA repair mechanisms. PMID:26019260

  11. G9a inhibition potentiates the anti-tumour activity of DNA double-strand break inducing agents by impairing DNA repair independent of p53 status.

    Science.gov (United States)

    Agarwal, Pallavi; Jackson, Stephen P

    2016-10-01

    Cancer cells often exhibit altered epigenetic signatures that can misregulate genes involved in processes such as transcription, proliferation, apoptosis and DNA repair. As regulation of chromatin structure is crucial for DNA repair processes, and both DNA repair and epigenetic controls are deregulated in many cancers, we speculated that simultaneously targeting both might provide new opportunities for cancer therapy. Here, we describe a focused screen that profiled small-molecule inhibitors targeting epigenetic regulators in combination with DNA double-strand break (DSB) inducing agents. We identify UNC0638, a catalytic inhibitor of histone lysine N-methyl-transferase G9a, as hypersensitising tumour cells to low doses of DSB-inducing agents without affecting the growth of the non-tumorigenic cells tested. Similar effects are also observed with another, structurally distinct, G9a inhibitor A-366. We also show that small-molecule inhibition of G9a or siRNA-mediated G9a depletion induces tumour cell death under low DNA damage conditions by impairing DSB repair in a p53 independent manner. Furthermore, we establish that G9a promotes DNA non-homologous end-joining in response to DSB-inducing genotoxic stress. This study thus highlights the potential for using G9a inhibitors as anti-cancer therapeutic agents in combination with DSB-inducing chemotherapeutic drugs such as etoposide. PMID:27431310

  12. Double strand break repair: two mechanisms in competition but tightly linked to cell cycle

    International Nuclear Information System (INIS)

    DNA double strand breaks (DSB) are highly toxic damage although they can be induced to create genetic diversity. Two distinct pathways can repair DSB: Homologous Recombination (HR) and Non Homologous End Joining (NHEJ). If un- or mis-repaired, this damage can lead to cancer. Thus, it is essential to investigate how these two pathways are regulated for DSB repair. NHEJ inhibition leads to HR DSB repair stimulation. However, this channeling to HR is tightly linked to cell cycle since NHEJ and HR are active in G1/early S and late S/G2, respectively. Our results suggest that G1-unrepaired DSB go through S phase to be repaired by HR in G2. Those results allow a better understanding of DSB repair mechanisms regulation. (author)

  13. FEN1 participates in repair of the 5'-phosphotyrosyl terminus of DNA single-strand breaks.

    Science.gov (United States)

    Kametani, Yukiko; Takahata, Chiaki; Narita, Takashi; Tanaka, Kiyoji; Iwai, Shigenori; Kuraoka, Isao

    2016-01-01

    Etoposide is a widely used anticancer drug and a DNA topoisomerase II (Top2) inhibitor. Etoposide produces Top2-attached single-strand breaks (Top2-SSB complex) and double-strand breaks (Top2-DSB complex) that are thought to induce cell death in tumor cells. The Top2-SSB complex is more abundant than the Top2-DSB complex. Human tyrosyl-DNA phosphodiesterase 2 (TDP2) is required for efficient repair of Top2-DSB complexes. However, the identities of the proteins involved in the repair of Top2-SSB complexes are unknown, although yeast genetic data indicate that 5' to 3' structure-specific DNA endonuclease activity is required for alternative repair of Top2 DNA damage. In this study, we purified a flap endonuclease 1 (FEN1) and xeroderma pigmentosum group G protein (XPG) in the 5' to 3' structure-specific DNA endonuclease family and synthesized single-strand break DNA substrates containing a 5'-phoshotyrosyl bond, mimicking the Top2-SSB complex. We found that FEN1 and XPG did not remove the 5'-phoshotyrosyl bond-containing DSB substrates but removed the 5'-phoshotyrosyl bond-containing SSB substrates. Under DNA repair conditions, FEN1 efficiently repaired the 5'-phoshotyrosyl bond-containing SSB substrates in the presence of DNA ligase and DNA polymerase. Therefore, FEN1 may play an important role in the repair of Top2-SSB complexes in etoposide-treated cells. PMID:26581212

  14. Double-strand break repair-adox: Restoration of suppressed double-strand break repair during mitosis induces genomic instability.

    Science.gov (United States)

    Terasawa, Masahiro; Shinohara, Akira; Shinohara, Miki

    2014-12-01

    Double-strand breaks (DSBs) are one of the severest types of DNA damage. Unrepaired DSBs easily induce cell death and chromosome aberrations. To maintain genomic stability, cells have checkpoint and DSB repair systems to respond to DNA damage throughout most of the cell cycle. The failure of this process often results in apoptosis or genomic instability, such as aneuploidy, deletion, or translocation. Therefore, DSB repair is essential for maintenance of genomic stability. During mitosis, however, cells seem to suppress the DNA damage response and proceed to the next G1 phase, even if there are unrepaired DSBs. The biological significance of this suppression is not known. In this review, we summarize recent studies of mitotic DSB repair and discuss the mechanisms of suppression of DSB repair during mitosis. DSB repair, which maintains genomic integrity in other phases of the cell cycle, is rather toxic to cells during mitosis, often resulting in chromosome missegregation and aberration. Cells have multiple safeguards to prevent genomic instability during mitosis: inhibition of 53BP1 or BRCA1 localization to DSB sites, which is important to promote non-homologous end joining or homologous recombination, respectively, and also modulation of the non-homologous end joining core complex to inhibit DSB repair. We discuss how DSBs during mitosis are toxic and the multiple safeguard systems that suppress genomic instability.

  15. Nampt is involved in DNA double-strand break repair

    Institute of Scientific and Technical Information of China (English)

    Bingtao Zhu; Xiaoli Deng; Yifan Sun; Lin Bai; Zhikai Xiahou; Yusheng Cong; Xingzhi Xu

    2012-01-01

    DNA double-strand break (DSB) is the most severe form of DNA damage,which is repaired mainly through high-fidelity homologous recombination (HR) or error-prone non-homologous end joining (NHEJ).Defects in the DNA damage response lead to genomic instability and ultimately predispose organs to cancer.Nicotinamide phosphoribosyltransferase (Nampt),which is involved in nicotinamide adenine dinucleotide metabolism,is overexpressed in a variety of tumors.In this report,we found that Nampt physically associated with CtlP and DNA-PKcs/Ku80,which are key factors in HR and NHEJ,respectively.Depletion of Nampt by small interfering RNA (siRNA) led to defective NHEJ-mediated DSB repair and enhanced HR-mediated repair.Furthermore,the inhibition of Nampt expression promoted proliferation of cancer cells and normal human fibroblasts and decreased β-galactosidase staining,indicating a delay in the onset of cellular senescence in normal human fibroblasts.Taken together,our results suggest that Nampt is a suppressor of HR-mediated DSB repair and an enhancer of NHEJ-mediated DSB repair,contributing to the acceleration of cellular senescence.

  16. Regulation of DNA double-strand break repair pathway choice

    Institute of Scientific and Technical Information of China (English)

    Meena Shrivastav; Leyma P De Haro; Jac A Nickoloff

    2008-01-01

    DNA double-strand breaks (DSBs) are critical lesions that can result in cell death or a wide variety of genetic alterations including large- or small-scale deletions, loss of heterozygosity, translocations, and chromosome loss. DSBs are repaired by non-homologous end-joining (NHEJ) and homologous recombination (HR), and defects in these pathways cause genome instability and promote tumorigenesis. DSBs arise from endogenous sources includ-ing reactive oxygen species generated during cellular metabolism, collapsed replication forks, and nucleases, and from exogenous sources including ionizing radiation and chemicals that directly or indirectly damage DNA and are commonly used in cancer therapy. The DSB repair pathways appear to compete for DSBs, but the balance between them differs widely among species, between different cell types of a single species, and during different cell cycle phases of a single cell type. Here we review the regulatory factors that regulate DSB repair by NHEJ and HR in yeast and higher eukaryotes. These factors include regulated expression and phosphorylation of repair proteins, chromatin modulation of repair factor accessibility, and the availability of homologous repair templates. While most DSB repair proteins appear to function exclusively in NHEJ or HR, a number of proteins influence both pathways, including the MRE11/RAD50/NBS1 (XRS2) complex, BRCA1, histone H2AX, PARP-1, RAD18, DNA-dependent protein kinase catalytic subunit (DNA-PKcs), and ATM. DNA-PKcs plays a role in mammalian NHEJ, but it also influences HR through a complex regulatory network that may involve crosstalk with ATM, and the regulation of at least 12 proteins involved in HR that are phosphorylated by DNA-PKcs and/or ATM.

  17. Analysis of DNA double-strand break repair pathways in mice

    International Nuclear Information System (INIS)

    During the last years significant new insights have been gained into the mechanism and biological relevance of DNA double-strand break (DSB) repair in relation to genome stability. DSBs are a highly toxic DNA lesion, because they can lead to chromosome fragmentation, loss and translocations, eventually resulting in cancer. DSBs can be induced by cellular processes such as V(D)J recombination or DNA replication. They can also be introduced by exogenous agents DNA damaging agents such as ionizing radiation or mitomycin C. During evolution several pathways have evolved for the repair of these DSBs. The most important DSB repair mechanisms in mammalian cells are nonhomologous end-joining and homologous recombination. By using an undamaged repair template, homologous recombination ensures accurate DSB repair, whereas the untemplated nonhomologous end-joining pathway does not. Although both pathways are active in mammals, the relative contribution of the two repair pathways to genome stability differs in the different cell types. Given the potential differences in repair fidelity, it is of interest to determine the relative contribution of homologous recombination and nonhomologous end-joining to DSB repair. In this review, we focus on the biological relevance of DSB repair in mammalian cells and the potential overlap between nonhomologous end-joining and homologous recombination in different tissues

  18. Distinct spatiotemporal patterns and PARP dependence of XRCC1 recruitment to single-strand break and base excision repair

    NARCIS (Netherlands)

    A. Campalans (Anna); R. Amouroux (Rachel); H. Menoni (Hervé); W. Vermeulen (Wim); J.P. Radicella (Pablo)

    2013-01-01

    textabstractSingle-strand break repair (SSBR) and base excision repair (BER) of modified bases and abasic sites share several players. Among them is XRCC1, an essential scaffold protein with no enzymatic activity, required for the coordination of both pathways. XRCC1 is recruited to SSBR by PARP-1,

  19. The Heterochromatic Barrier to DNA Double Strand Break Repair: How to Get the Entry Visa

    Directory of Open Access Journals (Sweden)

    Aaron A. Goodarzi

    2012-09-01

    Full Text Available Over recent decades, a deep understanding of pathways that repair DNA double strand breaks (DSB has been gained from biochemical, structural, biophysical and cellular studies. DNA non-homologous end-joining (NHEJ and homologous recombination (HR represent the two major DSB repair pathways, and both processes are now well understood. Recent work has demonstrated that the chromatin environment at a DSB significantly impacts upon DSB repair and that, moreover, dramatic modifications arise in the chromatin surrounding a DSB. Chromatin is broadly divided into open, transcriptionally active, euchromatin (EC and highly compacted, transcriptionally inert, heterochromatin (HC, although these represent extremes of a spectrum. The HC superstructure restricts both DSB repair and damage response signaling. Moreover, DSBs within HC (HC-DSBs are rapidly relocalized to the EC-HC interface. The damage response protein kinase, ataxia telangiectasia mutated (ATM, is required for HC-DSB repair but is dispensable for the relocalization of HC-DSBs. It has been proposed that ATM signaling enhances HC relaxation in the DSB vicinity and that this is a prerequisite for HC-DSB repair. Hence, ATM is essential for repair of HC-DSBs. Here, we discuss how HC impacts upon the response to DSBs and how ATM overcomes the barrier that HC poses to repair.

  20. Evaluation of DNA Double Strand Breaks Repair Efficiency in Head and Neck Cancer

    OpenAIRE

    Walczak, Anna; Rusin, Pawel; Dziki, Lukasz; Zielinska-Blizniewska, Hanna; Olszewski, Jurek; Majsterek, Ireneusz

    2012-01-01

    Head and neck cancers (head and neck squamous cell carcinomas [HNSCC]) are a heterogeneous group of neoplasms with varying presenting symptoms, treatment, and expected outcome. There is a need to find an effective way of its treatment at the molecular level. Thus, we should identify the mechanism of cancer cell response to damaging agents' activity, especially at DNA level. Our major goal was to evaluate the efficacy of DNA double strand breaks (DSBs) repair in HTB-43 and SCC-25 cancer cell l...

  1. Atypical Role for PhoU in Mutagenic Break Repair under Stress in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Janet L Gibson

    Full Text Available Mechanisms of mutagenesis activated by stress responses drive pathogen/host adaptation, antibiotic and anti-fungal-drug resistance, and perhaps much of evolution generally. In Escherichia coli, repair of double-strand breaks (DSBs by homologous recombination is high fidelity in unstressed cells, but switches to a mutagenic mode using error-prone DNA polymerases when the both the SOS and general (σS stress responses are activated. Additionally, the σE response promotes spontaneous DNA breakage that leads to mutagenic break repair (MBR. We identified the regulatory protein PhoU in a genetic screen for functions required for MBR. PhoU negatively regulates the phosphate-transport and utilization (Pho regulon when phosphate is in excess, including the PstB and PstC subunits of the phosphate-specific ABC transporter PstSCAB. Here, we characterize the PhoU mutation-promoting role. First, some mutations that affect phosphate transport and Pho transcriptional regulation decrease mutagenesis. Second, the mutagenesis and regulon-expression phenotypes do not correspond, revealing an apparent new function(s for PhoU. Third, the PhoU mutagenic role is not via activation of the σS, SOS or σE responses, because mutations (or DSBs that restore mutagenesis to cells defective in these stress responses do not restore mutagenesis to phoU cells. Fourth, the mutagenesis defect in phoU-mutant cells is partially restored by deletion of arcA, a gene normally repressed by PhoU, implying that a gene(s repressed by ArcA promotes mutagenic break repair. The data show a new role for PhoU in regulation, and a new regulatory branch of the stress-response signaling web that activates mutagenic break repair in E. coli.

  2. Parp1-XRCC1 and the repair of DNA double strand breaks in mouse round spermatids

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, Emad A. [Department of Endocrinology and Metabolism, Faculty of Science, Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Boer, Peter de [Department of Obstetrics and Gynaecology, Radboud University Nijmegen Medical Centre, 6500 HB Nijmegen (Netherlands); Philippens, Marielle E.P.; Kal, Henk B. [Department of Radiotherapy, University Medical Center Utrecht, Heidelberglaan 100, 3584 CX Utrecht (Netherlands); Rooij, Dirk G. de, E-mail: d.g.derooij@uu.nl [Department of Endocrinology and Metabolism, Faculty of Science, Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Center for Reproductive Medicine, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam (Netherlands)

    2010-01-05

    The repair of DNA double strand breaks (DSBs) in male germ cells is slower and differently regulated compared to that in somatic cells. Round spermatids show DSB repair and are radioresistant to apoptosis induction. Mutation induction studies using ionizing irradiation, indicated a high frequency of chromosome aberrations (CA) in the next generation. Since they are in a G1 comparable stage of the cell cycle, haploid spermatids are expected to repair DSBs by the non-homologous end-joining pathway (NHEJ). However, immunohistochemical evidence indicates that not all components of the classical NHEJ pathway are available since the presence of DNA-PKcs cannot be shown. Here, we demonstrate that round spermatids, as well as most other types of male germ cells express both Parp1 and XRCC1. Therefore, we have determined whether the alternative Parp1/XRCC1 dependent NHEJ pathway is active in these nuclei and also have tested for classical NHEJ activity by a genetic method. To evaluate DSB repair in SCID mice, deficient for DNA-PKcs, and to study the involvement of the Parp1/XRCC1 dependent NHEJ pathway in round spermatids, the loss of {gamma}-H2AX foci after irradiation has been determined in nucleus spreads of round spermatids of SCID mice and in nucleus spreads and histological sections of Parp1-inhibited mice and their respective controls. Results show that around half of the breaks in randomly selected round spermatids are repaired between 1 and 8 h after irradiation. The repair of 16% of the induced DSBs requires DNA-PKcs and 21% Parp1. Foci numbers in the Parp1-inhibited testes tend to be higher in spermatids of all epithelial stages reaching significance in stages I-III which indicates an active Parp1/XRCC1 pathway in round spermatids and a decreased repair capacity in later round spermatid stages. In Parp1-inhibited SCID mice only 14.5% of the breaks were repaired 8 h after irradiation indicating additivity of the two NHEJ pathways in round spermatids.

  3. Genetics of x-ray induced double strand break repair in saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Budd, M.E.

    1982-07-01

    The possible fates of x-ray-induced double-strand breaks in Saccharomyces cerevisiae were examined. One possible pathway which breaks can follow, the repair pathway, was studied by assaying strains with mutations in the RAD51, RAD54, and RAD57 loci for double-strand break repair. In order of increasing radiation sensitivity one finds: rad57-1(23/sup 0/)> rad51-1(30/sup 0/)> rad54-3(36/sup 0/). At 36/sup 0/, rad54-3 cells cannot repair double-strand breaks, while 23/sup 0/, they can. Strains with the rad57-1 mutation can rejoin broken chromosomes at both temperatures. However, the low survival at 36/sup 0/ shows that the assay is not distinguishing large DNA fragments which allow cell survival from those which cause cell death. A rad51-1 strain could also rejoin broken chromosomes, and was thus capable of incomplete repair. The data can be explained with the hypothesis that rad54-3 cells are blocked in an early step of repair, while rad51-1 and rad57-1 strains are blocked in a later step of repair. The fate of double-strand breaks when they are left unrepaired was investigated with the rad54-3 mutation. If breaks are prevented from entering the RAD54 repair pathway they become uncommitted lesions. These lesions are repaired slower than the original breaks. One possible fate for an uncommitted lesion is conversion into a fixed lesion, which is likely to be an unrepairable or misrepaired double-strand break. The presence of protein synthesis after irradiation increases the probability that a break will enter the repair pathway. Evidence shows that increased probability of repair results from enhanced synthesis of repair proteins shortly after radiation. (ERB)

  4. Genetics of x-ray induced double strand break repair in saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    The possible fates of x-ray-induced double-strand breaks in Saccharomyces cerevisiae were examined. One possible pathway which breaks can follow, the repair pathway, was studied by assaying strains with mutations in the RAD51, RAD54, and RAD57 loci for double-strand break repair. In order of increasing radiation sensitivity one finds: rad57-1(230)> rad51-1(300)> rad54-3(360). At 360, rad54-3 cells cannot repair double-strand breaks, while 230, they can. Strains with the rad57-1 mutation can rejoin broken chromosomes at both temperatures. However, the low survival at 360 shows that the assay is not distinguishing large DNA fragments which allow cell survival from those which cause cell death. A rad51-1 strain could also rejoin broken chromosomes, and was thus capable of incomplete repair. The data can be explained with the hypothesis that rad54-3 cells are blocked in an early step of repair, while rad51-1 and rad57-1 strains are blocked in a later step of repair. The fate of double-strand breaks when they are left unrepaired was investigated with the rad54-3 mutation. If breaks are prevented from entering the RAD54 repair pathway they become uncommitted lesions. These lesions are repaired slower than the original breaks. One possible fate for an uncommitted lesion is conversion into a fixed lesion, which is likely to be an unrepairable or misrepaired double-strand break. The presence of protein synthesis after irradiation increases the probability that a break will enter the repair pathway. Evidence shows that increased probability of repair results from enhanced synthesis of repair proteins shortly after radiation

  5. Double-strand break repair and G4 DNA stability in Caenorhabditis elegans

    NARCIS (Netherlands)

    Pontier, D.B.

    2010-01-01

    DNA double-strand breaks (DSBs) can be repaired by three canonical repair pathways. Homologous recombination (HR) uses the sister chromatid or homologous chromosome as a template to repair the DSB in an error-free manner. In non-homologous end-joining (NHEJ), the broken ends are ligated with little

  6. Split-dose recovery is due to the repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    DNA double-strand breaks are the molecular lesions the repair of which leads to the reappearance of the shoulder observed in split-dose experiments. This conclusion is based on results obtained with the help of a diploid yeast mutant rad54-3 which is temperature-conditional for the repair of DNA double-strand breaks. Two repair steps must be met to yield the reappearance of the shoulder on a split-dose survival curve: the repair of double-strand breaks during the interval between two doses and on the nutrient agar plate after the second dose. In yeast lethality may be attributable to either an unrepaired double-strand break (i.e. a double-strand break is a potentially lethal lesion) or to the interaction of two double-strand breaks (misrepair of double-strand breaks). Evidence is presented that the two cellular phenomena of liquid holding recovery (repair of potentially lethal damage) and of split-dose recovery (repair of sublethal damage) are based on the repair of the same molecular lesion, the DNA double-strand break. (author)

  7. Feedback inhibition of L1 and alu retrotransposition through altered double strand break repair kinetics

    Directory of Open Access Journals (Sweden)

    Wallace Nicholas A

    2010-10-01

    Full Text Available Abstract Background Cells adapt to various chronic toxic exposures in a multitude of ways to minimize further damage and maximize their growth potential. Expression of L1 elements in the human genome can be greatly deleterious to cells, generating numerous double strand breaks (DSBs. Cells have been reported to respond to chronic DSBs by altering the repair of these breaks, including increasing the rate of homology independent DSB repair. Retrotransposition is strongly affected by proteins involved in DSB repair. Therefore, L1 expression has the potential to be a source of chronic DSBs and thus bring about the changes in cellular environment that could ultimately restrict its own retrotransposition. Results We demonstrate that constitutive L1 expression leads to quicker DSB repair and decreases in the retrotransposition potential of L1 and other retrotransposons dependent on L1 expression for their mobility. This cellular adaptation results in reduced sensitivity to L1 induced toxicity. These effects can be induced by constitutive expression of the functional L1 ORF2 alone, but not by the constitutive expression of an L1 open reading frame 2 with mutations to its endonuclease and reverse transcriptase domains. This adaptation correlates with the relative activity of the L1 introduced into the cells. Conclusions The increased number of DSBs resulting from constitutive expression of L1 results in a more rapid rate of repair. The cellular response to this L1 expression also results in attenuation of retrotransposition and reduced sensitivity of the cells to negative consequences of L1 ORF2 expression. The influence does not appear to be through RNA interference. We believe that the increased rate of DSB repair is the most likely cause of the attenuation of retrotransposition. These alterations act as a fail safe mechanism that allows cells to escape the toxicity associated with the unchecked L1 expression. This gives cells that overexpress L1, such

  8. DNA polymerase θ (POLQ), double-strand break repair, and cancer.

    Science.gov (United States)

    Wood, Richard D; Doublié, Sylvie

    2016-08-01

    DNA polymerase theta (pol θ) is encoded in the genomes of many eukaryotes, though not in fungi. Pol θ is encoded by the POLQ gene in mammalian cells. The C-terminal third of the protein is a family A DNA polymerase with additional insertion elements relative to prokaryotic homologs. The N-terminal third is a helicase-like domain with DNA-dependent ATPase activity. Pol θ is important in the repair of genomic double-strand breaks (DSBs) from many sources. These include breaks formed by ionizing radiation and topoisomerase inhibitors, breaks arising at stalled DNA replication forks, breaks introduced during diversification steps of the mammalian immune system, and DSB induced by CRISPR-Cas9. Pol θ participates in a route of DSB repair termed "alternative end-joining" (altEJ). AltEJ is independent of the DNA binding Ku protein complex and requires DNA end resection. Pol θ is able to mediate joining of two resected 3' ends harboring DNA sequence microhomology. "Signatures" of Pol θ action during altEJ are the frequent utilization of longer microhomologies, and the insertion of additional sequences at joining sites. The mechanism of end-joining employs the ability of Pol θ to tightly grasp a 3' terminus through unique contacts in the active site, allowing extension from minimally paired primers. Pol θ is involved in controlling the frequency of chromosome translocations and preserves genome integrity by limiting large deletions. It may also play a backup role in DNA base excision repair. POLQ is a member of a cluster of similarly upregulated genes that are strongly correlated with poor clinical outcome for breast cancer, ovarian cancer and other cancer types. Inhibition of pol θ is a compelling approach for combination therapy of radiosensitization. PMID:27264557

  9. Double-strand break repair processes drive evolution of the mitochondrial genome in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Shedge Vikas

    2011-09-01

    Full Text Available Abstract Background The mitochondrial genome of higher plants is unusually dynamic, with recombination and nonhomologous end-joining (NHEJ activities producing variability in size and organization. Plant mitochondrial DNA also generally displays much lower nucleotide substitution rates than mammalian or yeast systems. Arabidopsis displays these features and expedites characterization of the mitochondrial recombination surveillance gene MSH1 (MutS 1 homolog, lending itself to detailed study of de novo mitochondrial genome activity. In the present study, we investigated the underlying basis for unusual plant features as they contribute to rapid mitochondrial genome evolution. Results We obtained evidence of double-strand break (DSB repair, including NHEJ, sequence deletions and mitochondrial asymmetric recombination activity in Arabidopsis wild-type and msh1 mutants on the basis of data generated by Illumina deep sequencing and confirmed by DNA gel blot analysis. On a larger scale, with mitochondrial comparisons across 72 Arabidopsis ecotypes, similar evidence of DSB repair activity differentiated ecotypes. Forty-seven repeat pairs were active in DNA exchange in the msh1 mutant. Recombination sites showed asymmetrical DNA exchange within lengths of 50- to 556-bp sharing sequence identity as low as 85%. De novo asymmetrical recombination involved heteroduplex formation, gene conversion and mismatch repair activities. Substoichiometric shifting by asymmetrical exchange created the appearance of rapid sequence gain and loss in association with particular repeat classes. Conclusions Extensive mitochondrial genomic variation within a single plant species derives largely from DSB activity and its repair. Observed gene conversion and mismatch repair activity contribute to the low nucleotide substitution rates seen in these genomes. On a phenotypic level, these patterns of rearrangement likely contribute to the reproductive versatility of higher plants.

  10. Pathway choice in DNA double strand break repair: observations of a balancing act

    Directory of Open Access Journals (Sweden)

    Brandsma Inger

    2012-11-01

    Full Text Available Abstract Proper repair of DNA double strand breaks (DSBs is vital for the preservation of genomic integrity. There are two main pathways that repair DSBs, Homologous recombination (HR and Non-homologous end-joining (NHEJ. HR is restricted to the S and G2 phases of the cell cycle due to the requirement for the sister chromatid as a template, while NHEJ is active throughout the cell cycle and does not rely on a template. The balance between both pathways is essential for genome stability and numerous assays have been developed to measure the efficiency of the two pathways. Several proteins are known to affect the balance between HR and NHEJ and the complexity of the break also plays a role. In this review we describe several repair assays to determine the efficiencies of both pathways. We discuss how disturbance of the balance between HR and NHEJ can lead to disease, but also how it can be exploited for cancer treatment.

  11. Induction and repair of DNA strand breaks in human tumor cells

    International Nuclear Information System (INIS)

    The presence of radioresistant or repair-proficient cells in a tumor is often associated with radiotherapy failure. The authors have begun to study the mechanisms of resistance in these tumor cells. Their initial studies focused on the induction and repair of DNA strand breaks as measured by DNA elution. Eight human tumor (5 squamous cell carcinomas, 2 melanomas, and 1 adenocarcinoma) and 2 nonmalignant cell lines have been examined. Their D/sub O/s range from 1.07 Gy to 2.81 Gy while their extrapolation numbers (n) range from 1.2 to 24.8. Three parameters are being investigated for X-ray-induced DNA single and double-strand breaks; 1) the initial number of breaks induced, 2) the residual DNA strand break frequency and 3) the time to repair 50% of the lesions. The kinetics of repair of DNA single-strand breaks were similar for all the lines studied. In 2 cases, radiosensitivity was associated with either a high residual DNA strand break frequency or a slower rate of repair. No single parameter or combination of parameters, however, consistently correlated with radiosensitivity or n. Thus, while differences in the induction and repair of DNA single-strand breaks might explain some of the observed differences in radiation responses, they are in general a poor predictor radiation sensitivity

  12. RecBCD Enzyme and the Repair of Double-Stranded DNA Breaks

    OpenAIRE

    Dillingham, Mark S.; Kowalczykowski, Stephen C.

    2008-01-01

    Summary: The RecBCD enzyme of Escherichia coli is a helicase-nuclease that initiates the repair of double-stranded DNA breaks by homologous recombination. It also degrades linear double-stranded DNA, protecting the bacteria from phages and extraneous chromosomal DNA. The RecBCD enzyme is, however, regulated by a cis-acting DNA sequence known as Chi (crossover hotspot instigator) that activates its recombination-promoting functions. Interaction with Chi causes an attenuation of the RecBCD enzy...

  13. The role of homologous recombination in radiation-induced double-strand break repair

    International Nuclear Information System (INIS)

    DNA double-strand breaks (DSBs) represent the most biologically significant lesions induced by ionizing radiation (IR). HR is the predominant pathway for repairing one-ended DSBs arising in S-phase when the replication fork encounters single-stranded breaks or base damages. Here, we discuss recent findings that two-ended DSBs directly induced by X- or γ-rays in late S- or G2-phase are repaired predominantly by NHEJ, with HR only repairing a sub-fraction of such DSBs. This sub-fraction represents DSBs which localize to heterochromatic DNA regions and, which in control cells, are repaired with slow kinetics over many hours post irradiation. The observation that defined DSB populations are repaired by either NHEJ or HR suggests an assignment of specific tasks for each of the two processes. Furthermore, heavy ion induced complex DSBs, which are in general more slowly repaired than X- or γ-ray induced breaks, are nearly always repaired by HR independent of chromatin localization suggesting that the speed of repair is an important factor determining the DSB repair pathway usage. Finally, NHEJ and HR can, under certain conditions, also compensate for each other such that DSBs normally repaired by one pathway can undergo repair by the other if genetic failures necessitate the pathway switch.

  14. Ultrafast chemical repair of DNA single and double strand break precursors in irradiated V79 cells

    International Nuclear Information System (INIS)

    The fast kinetics of reactions of free radical precursors of DNA single strand breaks (ssb) and double strand breaks (dsb) have been determined in Chinese hamster V79 cells by fast mixing and irradiation methods using the alkaline unwinding technique to assay breaks. Fast chemical repair of oxygen-dependent ssb and dsb precursors was observed and approached completion within 10 to 20 ms of irradiation. Treatment of cells with the glutathione synthesis blocking agent, buthionine sulphoximine, showed that approximately half of the chemical repair was attributable to intracellular non-protein thiols. The nature of the residual repair is obscure, but it is apparently not attributable to non-protein thiols. Similar repair rates and thiol dependences were also found for cell kill. With all three endpoints, oxygen competes with and blocks the chemical repair. 36 refs., 6 figs., 1 tab

  15. New tools to study DNA double-strand break repair pathway choice.

    Directory of Open Access Journals (Sweden)

    Daniel Gomez-Cabello

    Full Text Available A broken DNA molecule is difficult to repair, highly mutagenic, and extremely cytotoxic. Such breaks can be repaired by homology-independent or homology-directed mechanisms. Little is known about the network that controls the repair pathway choice except that a licensing step for homology-mediated repair exists, called DNA-end resection. The choice between these two repair pathways is a key event for genomic stability maintenance, and an imbalance of the ratio is directly linked with human diseases, including cancer. Here we present novel reporters to study the balance between both repair options in human cells. In these systems, a double-strand break can be alternatively repaired by homology-independent or -dependent mechanisms, leading to the accumulation of distinct fluorescent proteins. These reporters thus allow the balance between both repair pathways to be analyzed in different experimental setups. We validated the reporters by analyzing the effect of protein downregulation of the DNA end resection and non-homologous end-joining pathways. Finally, we analyzed the role of the DNA damage response on double-strand break (DSB repair mechanism selection. Our reporters could be used in the future to understand the roles of specific factors, whole pathways, or drugs in DSB repair pathway choice, or for genome-wide screening. Moreover, our findings can be applied to increase gene-targeting efficiency, making it a beneficial tool for a broad audience in the biological sciences.

  16. Repair of near-UV (365nm or 313 nm) induced DNA strand breaks

    International Nuclear Information System (INIS)

    The action of near-UV (365 nm or 313 nm) radiation in cellular inactivaton (biological measurements) and induction and repair of breaks (physical measurements) is studied in repair proficient strain and in pol A, rec A and uvr A deficient strains of Escherichia coli K-12. (M.A.C.)

  17. A role for small RNAs in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Wei, W.; Ba, Z.; Wu, Y.;

    2012-01-01

    Eukaryotes have evolved complex mechanisms to repair DNA double-strand breaks (DSBs) through coordinated actions of protein sensors, transducers, and effectors. Here we show that ∼21-nucleotide small RNAs are produced from the sequences in the vicinity of DSB sites in Arabidopsis and in human cel...... of protein complexes to DSB sites to facilitate repair. © 2012 Elsevier Inc....

  18. Pathway choice in DNA double strand break repair: Observations of a balancing act

    NARCIS (Netherlands)

    I. Brandsma (Inger); D.C. van Gent (Dik)

    2012-01-01

    textabstractProper repair of DNA double strand breaks (DSBs) is vital for the preservation of genomic integrity. There are two main pathways that repair DSBs, Homologous recombination (HR) and Non-homologous end-joining (NHEJ). HR is restricted to the S and G2 phases of the cell cycle due to the req

  19. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in...

  20. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways

    OpenAIRE

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, ...

  1. Repair and gamma radiation-induced single- and double-strand breaks in DNA of Escherichia coli

    International Nuclear Information System (INIS)

    Studies in the kinetics of repair of γ-radiation-induced single- and double-strand breaks in DNA of E. coli cells showed that double-strand DNA breaks are rejoined by the following two ways. The first way is conditioned by repair of single-strand breaks and represents the repair of ''oblique'' double-strand breaks in DNA, whereas the second way is conditioned by functioning of the recombination mechanisms and, to all appearance, represents the repair of ''direct'' double-strand breaks in DNA

  2. The radioresistance kinase TLK1B protects the cells by promoting repair of double strand breaks

    Directory of Open Access Journals (Sweden)

    De Benedetti Arrigo

    2005-09-01

    Full Text Available Abstract Background The mammalian protein kinase TLK1 is a homologue of Tousled, a gene involved in flower development in Arabidopsis thaliana. The function of TLK1 is not well known, although knockout of the gene in Drosophila or expression of a dominant negative mutant in mouse cells causes loss of nuclear divisions and missegregation of chromosomes probably, due to alterations in chromatin remodeling capacity. Overexpression of TLK1B, a spliced variant of the TLK1 mRNA, in a model mouse cell line increases it's resistance to ionizing radiation (IR or the radiomimetic drug doxorubicin, also likely due to changes in chromatin remodeling. TLK1B is translationally regulated by the availability of the translation factor eIF4E, and its synthesis is activated by IR. The reason for this mechanism of regulation is likely to provide a rapid means of promoting repair of DSBs. TLK1B specifically phosphorylates histone H3 and Asf1, likely resulting in changes in chromatin structure, particularly at double strand breaks (DSB sites. Results In this work, we provide several lines of evidence that TLK1B protects the cells from IR by facilitating the repair of DSBs. First, the pattern of phosphorylation and dephosphorylation of H2AX and H3 indicated that cells overexpressing TLK1B return to pre-IR steady state much more rapidly than controls. Second, the repair of episomes damaged with DSBs was much more rapid in cells overexpressing TLK1B. This was also true for repair of genomic damage. Lastly, we demonstrate with an in vitro repair system that the addition of recombinant TLK1B promotes repair of a linearized plasmid incubated with nuclear extract. In addition, TLK1B in this in vitro system promotes the assembly of chromatin as shown by the formation of more highly supercoiled topomers of the plasmid. Conclusion In this work, we provide evidence that TLK1B promotes the repair of DSBs, likely as a consequence of a change in chromatin remodeling capacity that

  3. Numt-mediated double-strand break repair mitigates deletions during primate genome evolution.

    Directory of Open Access Journals (Sweden)

    Einat Hazkani-Covo

    2008-10-01

    Full Text Available Non-homologous end joining (NHEJ is the major mechanism of double-strand break repair (DSBR in mammalian cells. NHEJ has traditionally been inferred from experimental systems involving induced double strand breaks (DSBs. Whether or not the spectrum of repair events observed in experimental NHEJ reflects the repair of natural breaks by NHEJ during chromosomal evolution is an unresolved issue. In primate phylogeny, nuclear DNA sequences of mitochondrial origin, numts, are inserted into naturally occurring chromosomal breaks via NHEJ. Thus, numt integration sites harbor evidence for the mechanisms that act on the genome over evolutionary timescales. We have identified 35 and 55 lineage-specific numts in the human and chimpanzee genomes, respectively, using the rhesus monkey genome as an outgroup. One hundred and fifty two numt-chromosome fusion points were classified based on their repair patterns. Repair involving microhomology and repair leading to nucleotide additions were detected. These repair patterns are within the experimentally determined spectrum of classical NHEJ, suggesting that information from experimental systems is representative of broader genetic loci and end configurations. However, in incompatible DSBR events, small deletions always occur, whereas in 54% of numt integration events examined, no deletions were detected. Numts show a statistically significant reduction in deletion frequency, even in comparison to DSBR involving filler DNA. Therefore, numts show a unique mechanism of integration via NHEJ. Since the deletion frequency during numt insertion is low, native overhangs of chromosome breaks are preserved, allowing us to determine that 24% of the analyzed breaks are cohesive with overhangs of up to 11 bases. These data represent, to the best of our knowledge, the most comprehensive description of the structure of naturally occurring DSBs. We suggest a model in which the sealing of DSBs by numts, and probably by other filler

  4. c-Myc Suppression of DNA Double-strand Break Repair

    Directory of Open Access Journals (Sweden)

    Zhaozhong Li

    2012-12-01

    Full Text Available c-Myc is a transcriptional factor that functions as a central regulator of cell growth, proliferation, and apoptosis. Overexpression of c-Myc also enhances DNA double-strand breaks (DSBs, genetic instability, and tumorigenesis. However, the mechanism(s involved remains elusive. Here, we discovered that γ-ray ionizing radiation-induced DSBs promote c-Myc to form foci and to co-localize with γ-H2AX. Conditional expression of c-Myc in HO15.19 c-Myc null cells using the Tet-Off/Tet-On inducible system results in down-regulation of Ku DNA binding and suppressed activities of DNA-dependent protein kinase catalytic subunit (DNA-PKcs and DNA end-joining, leading to inhibition of DSB repair and enhanced chromosomal and chromatid breaks. Expression of c-Myc reduces both signal and coding joins with decreased fidelity during V(DJ recombination. Mechanistically, c-Myc directly interacts with Ku70 protein through its Myc box II (MBII domain. Removal of the MBII domain from c-Myc abrogates its inhibitory effects on Ku DNA binding, DNA-PKcs, and DNA end-joining activities, which results in loss of c-Myc's ability to block DSB repair and V(DJ recombination. Interestingly, c-Myc directly disrupts the Ku/DNA-PKcs complex in vitro and in vivo. Thus, c-Myc suppression of DSB repair and V(DJ recombination may occur through inhibition of the nonhomologous end-joining pathway, which provides insight into the mechanism of c-Myc in the development of tumors through promotion of genomic instability.

  5. Polymorphisms in DNA Repair Genes, Recreational Physical Activity and Breast Cancer Risk

    OpenAIRE

    McCullough, Lauren E.; Santella, Regina M.; Cleveland, Rebecca J.; Millikan, Robert C.; Olshan, Andrew F.; North, Kari E; Bradshaw, Patrick T.; Eng, Sybil M.; Terry, Mary Beth; Shen, Jing; Crew, Katherine D.; Rossner, Pavel; Teitelbaum, Susan L.; Neugut, Alfred I.; Gammon, Marilie D.

    2013-01-01

    The mechanisms driving the inverse association between recreational physical activity (RPA) and breast cancer risk are complex. While exercise is associated with increased reactive oxygen species production it may also improve damage repair systems, particularly those that operate on single-strand breaks including base excision repair (BER), nucleotide excision repair (NER) and mismatch repair (MMR). Of these repair pathways, the role of MMR in breast carcinogenesis is least investigated. Pol...

  6. JNK Phosphorylates SIRT6 to Stimulate DNA Double-Strand Break Repair in Response to Oxidative Stress by Recruiting PARP1 to DNA Breaks.

    Science.gov (United States)

    Van Meter, Michael; Simon, Matthew; Tombline, Gregory; May, Alfred; Morello, Timothy D; Hubbard, Basil P; Bredbenner, Katie; Park, Rosa; Sinclair, David A; Bohr, Vilhelm A; Gorbunova, Vera; Seluanov, Andrei

    2016-09-01

    The accumulation of damage caused by oxidative stress has been linked to aging and to the etiology of numerous age-related diseases. The longevity gene, sirtuin 6 (SIRT6), promotes genome stability by facilitating DNA repair, especially under oxidative stress conditions. Here we uncover the mechanism by which SIRT6 is activated by oxidative stress to promote DNA double-strand break (DSB) repair. We show that the stress-activated protein kinase, c-Jun N-terminal kinase (JNK), phosphorylates SIRT6 on serine 10 in response to oxidative stress. This post-translational modification facilitates the mobilization of SIRT6 to DNA damage sites and is required for efficient recruitment of poly (ADP-ribose) polymerase 1 (PARP1) to DNA break sites and for efficient repair of DSBs. Our results demonstrate a post-translational mechanism regulating SIRT6, and they provide the link between oxidative stress signaling and DNA repair pathways that may be critical for hormetic response and longevity assurance. PMID:27568560

  7. JNK Phosphorylates SIRT6 to Stimulate DNA Double-Strand Break Repair in Response to Oxidative Stress by Recruiting PARP1 to DNA Breaks

    Directory of Open Access Journals (Sweden)

    Michael Van Meter

    2016-09-01

    Full Text Available The accumulation of damage caused by oxidative stress has been linked to aging and to the etiology of numerous age-related diseases. The longevity gene, sirtuin 6 (SIRT6, promotes genome stability by facilitating DNA repair, especially under oxidative stress conditions. Here we uncover the mechanism by which SIRT6 is activated by oxidative stress to promote DNA double-strand break (DSB repair. We show that the stress-activated protein kinase, c-Jun N-terminal kinase (JNK, phosphorylates SIRT6 on serine 10 in response to oxidative stress. This post-translational modification facilitates the mobilization of SIRT6 to DNA damage sites and is required for efficient recruitment of poly (ADP-ribose polymerase 1 (PARP1 to DNA break sites and for efficient repair of DSBs. Our results demonstrate a post-translational mechanism regulating SIRT6, and they provide the link between oxidative stress signaling and DNA repair pathways that may be critical for hormetic response and longevity assurance.

  8. Writers, Readers, and Erasers of Histone Ubiquitylation in DNA Double-Strand Break Repair

    DEFF Research Database (Denmark)

    Smeenk, Godelieve; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions, whose faulty repair may alter the content and organization of cellular genomes. To counteract this threat, numerous signaling and repair proteins are recruited hierarchically to the chromatin areas surrounding DSBs to facilitate...... accurate lesion repair and restoration of genome integrity. In vertebrate cells, ubiquitin-dependent modifications of histones adjacent to DSBs by RNF8, RNF168, and other ubiquitin ligases have a key role in promoting the assembly of repair protein complexes, serving as direct recruitment platforms for a...... integrity, as well as cell and organismal fitness....

  9. Differential requirement for SUB1 in chromosomal and plasmid double-strand DNA break repair.

    Directory of Open Access Journals (Sweden)

    Lijian Yu

    Full Text Available Non homologous end joining (NHEJ is an important process that repairs double strand DNA breaks (DSBs in eukaryotic cells. Cells defective in NHEJ are unable to join chromosomal breaks. Two different NHEJ assays are typically used to determine the efficiency of NHEJ. One requires NHEJ of linearized plasmid DNA transformed into the test organism; the other requires NHEJ of a single chromosomal break induced either by HO endonuclease or the I-SceI restriction enzyme. These two assays are generally considered equivalent and rely on the same set of NHEJ genes. PC4 is an abundant DNA binding protein that has been suggested to stimulate NHEJ. Here we tested the role of PC4's yeast homolog SUB1 in repair of DNA double strand breaks using different assays. We found SUB1 is required for NHEJ repair of DSBs in plasmid DNA, but not in chromosomal DNA. Our results suggest that these two assays, while similar are not equivalent and that repair of plasmid DNA requires additional factor(s that are not required for NHEJ repair of chromosomal double-strand DNA breaks. Possible roles for Sub1 proteins in NHEJ of plasmid DNA are discussed.

  10. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  11. Give me a better break: Choosing workday break activities to maximize resource recovery.

    Science.gov (United States)

    Hunter, Emily M; Wu, Cindy

    2016-02-01

    Surprisingly little research investigates employee breaks at work, and even less research provides prescriptive suggestions for better workday breaks in terms of when, where, and how break activities are most beneficial. Based on the effort-recovery model and using experience sampling methodology, we examined the characteristics of employee workday breaks with 95 employees across 5 workdays. In addition, we examined resources as a mediator between break characteristics and well-being. Multilevel analysis results indicated that activities that were preferred and earlier in the work shift related to more resource recovery following the break. We also found that resources mediated the influence of preferred break activities and time of break on health symptoms and that resource recovery benefited person-level outcomes of emotional exhaustion, job satisfaction, and organizational citizenship behavior. Finally, break length interacted with the number of breaks per day such that longer breaks and frequent short breaks were associated with more resources than infrequent short breaks. PMID:26375961

  12. Involvement of a periplasmic protein kinase in DNA strand break repair and homologous recombination in Escherichia coli.

    Science.gov (United States)

    Khairnar, Nivedita P; Kamble, Vidya A; Mangoli, Suhas H; Apte, Shree K; Misra, Hari S

    2007-07-01

    The involvement of signal transduction in the repair of radiation-induced damage to DNA has been known in eukaryotes but remains understudied in bacteria. This article for the first time demonstrates a role for the periplasmic lipoprotein (YfgL) with protein kinase activity transducing a signal for DNA strand break repair in Escherichia coli. Purified YfgL protein showed physical as well as functional interaction with pyrroloquinoline-quinone in solution and the protein kinase activity of YfgL was strongly stimulated in the presence of pyrroloquinoline-quinone. Transgenic E. coli cells producing Deinococcus radiodurans pyrroloquinoline-quinone synthase showed nearly four log cycle improvement in UVC dark survival and 10-fold increases in gamma radiation resistance as compared with untransformed cells. Pyrroloquinoline-quinone enhanced the UV resistance of E. coli through the YfgL protein and required the active recombination repair proteins. The yfgL mutant showed higher sensitivity to UVC, mitomycin C and gamma radiation as compared with wild-type cells and showed a strong impairment in homologous DNA recombination. The mutant expressing an active YfgL in trans recovered the lost phenotypes to nearly wild-type levels. The results strongly suggest that the periplasmic phosphoquinolipoprotein kinase YfgL plays an important role in radiation-induced DNA strand break repair and homologous recombination in E. coli. PMID:17630970

  13. Modeling the repair of DNA strand breaks caused by γ-radiation in a minichromosome

    International Nuclear Information System (INIS)

    The objective of the studies described here was the development of a mathematical model which would fit experimental data for the repair of single and double strand breaks induced in DNA in living cells by exposure to ionizing radiation, and which would allow to better understand the processes of DNA repair. DNA breaks are believed to play the major role in radiation-induced lethality and formation of chromosome deletions, and are therefore crucial to the response of cells to radiotherapy. In an initial model which we reported on the basis of data for the repair of Epstein–Barr minichromosomes in irradiated Raji cells, we assumed that DNA breaks are induced only at the moment of irradiation and are later removed by repair systems. This work gives a development of that mathematical model which fits the experimental results more precisely and suggests strongly that DNA breaks are generated not only by direct irradiation but also later, probably by systems engaged in repair of oxidative damage. (paper)

  14. The role of homologous recombination in mitotic and meiotic double-strand break repair

    OpenAIRE

    Vries, Femke Adriana Theodora de

    2007-01-01

    All organisms are composed of cells and the cell’s nucleus contains DNA. The induction of DNA damage is a threat to organisms. Signalling of DNA damage and subsequent repair is of substantial importance. Double-strand breaks (DSBs) in DNA can be induced by ionising radiation and DNA damaging agents but also arise as intermediates in several cellular processes (e.g. meiosis). DSBs are among the most genotoxic DNA lesions and their accurate repair is crucial. Genetic instability resulting from ...

  15. RecA bundles mediate homology pairing between distant sisters during DNA break repair

    OpenAIRE

    Lesterlin, Christian; Ball, Graeme; Schermelleh, Lothar; Sherratt, David J.

    2013-01-01

    DNA double-strand break (DSB) repair by homologous recombination (HR) has evolved to maintain genetic integrity in all organisms 1 . Although many reactions that occur during HR are known 1-3 , it is unclear where, when and how they occur in cells is lacking. Here, by using conventional and super-resolution microscopy we describe the progression of DSB repair in live Escherichia coli. Specifically, we investigate whether HR can occur efficiently between distant sister loci that have segregate...

  16. Break-induced replication repair of damaged forks induces genomic duplications in human cells

    OpenAIRE

    Costantino, L.; Sotiriou, S. K.; Rantala, J. K.; Magin, S.; Mladenov, E.; Helleday, T.; Haber, J E; Iliakis, G.; Kallioniemi, O P; Halazonetis, T D

    2013-01-01

    In budding yeast, one-ended DNA double-strand breaks (DSBs) and damaged replication forks are repaired by break-induced replication (BIR), a homologous recombination pathway that requires the Pol32 subunit of DNA polymerase delta. DNA replication stress is prevalent in cancer, but BIR has not been characterized in mammals. In a cyclin E overexpression model of DNA replication stress, POLD3, the human ortholog of POL32, was required for cell cycle progression and processive DNA synthesis. Segm...

  17. Chromosomal Integrity after UV Irradiation Requires FANCD2-Mediated Repair of Double Strand Breaks

    Science.gov (United States)

    Federico, María Belén; Vallerga, María Belén; Radl, Analía; Paviolo, Natalia Soledad; Bocco, José Luis; Di Giorgio, Marina; Soria, Gastón; Gottifredi, Vanesa

    2016-01-01

    Fanconi Anemia (FA) is a rare autosomal recessive disorder characterized by hypersensitivity to inter-strand crosslinks (ICLs). FANCD2, a central factor of the FA pathway, is essential for the repair of double strand breaks (DSBs) generated during fork collapse at ICLs. While lesions different from ICLs can also trigger fork collapse, the contribution of FANCD2 to the resolution of replication-coupled DSBs generated independently from ICLs is unknown. Intriguingly, FANCD2 is readily activated after UV irradiation, a DNA-damaging agent that generates predominantly intra-strand crosslinks but not ICLs. Hence, UV irradiation is an ideal tool to explore the contribution of FANCD2 to the DNA damage response triggered by DNA lesions other than ICL repair. Here we show that, in contrast to ICL-causing agents, UV radiation compromises cell survival independently from FANCD2. In agreement, FANCD2 depletion does not increase the amount of DSBs generated during the replication of UV-damaged DNA and is dispensable for UV-induced checkpoint activation. Remarkably however, FANCD2 protects UV-dependent, replication-coupled DSBs from aberrant processing by non-homologous end joining, preventing the accumulation of micronuclei and chromatid aberrations including non-homologous chromatid exchanges. Hence, while dispensable for cell survival, FANCD2 selectively safeguards chromosomal stability after UV-triggered replication stress. PMID:26765540

  18. RECQL4 Promotes DNA End Resection in Repair of DNA Double-Strand Breaks.

    Science.gov (United States)

    Lu, Huiming; Shamanna, Raghavendra A; Keijzers, Guido; Anand, Roopesh; Rasmussen, Lene Juel; Cejka, Petr; Croteau, Deborah L; Bohr, Vilhelm A

    2016-06-28

    The RecQ helicase RECQL4, mutated in Rothmund-Thomson syndrome, regulates genome stability, aging, and cancer. Here, we identify a crucial role for RECQL4 in DNA end resection, which is the initial and an essential step of homologous recombination (HR)-dependent DNA double-strand break repair (DSBR). Depletion of RECQL4 severely reduces HR-mediated repair and 5' end resection in vivo. RECQL4 physically interacts with MRE11-RAD50-NBS1 (MRN), which senses DSBs and initiates DNA end resection with CtIP. The MRE11 exonuclease regulates the retention of RECQL4 at laser-induced DSBs. RECQL4 also directly interacts with CtIP via its N-terminal domain and promotes CtIP recruitment to the MRN complex at DSBs. Moreover, inactivation of RECQL4's helicase activity impairs DNA end processing and HR-dependent DSBR without affecting its interaction with MRE11 and CtIP, suggesting an important role for RECQL4's unwinding activity in the process. Thus, we report that RECQL4 is an important participant in HR-dependent DSBR.

  19. Genetic and environmental influence on DNA strand break repair: a twin study

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander;

    2013-01-01

    Accumulation of DNA damage deriving from exogenous and endogenous sources has significant consequences for cellular survival, and is implicated in aging, cancer, and neurological diseases. Different DNA repair pathways have evolved in order to maintain genomic stability. Genetic and environmental...... factors are likely to influence DNA repair capacity. In order to gain more insight into the genetic and environmental contribution to the molecular basis of DNA repair, we have performed a human twin study, where we focused on the consequences of some of the most abundant types of DNA damage (single...... dizygotic). We did not detect genetic effects on the DNA-strand break variables in our study....

  20. Essential Roles for Polymerase θ-Mediated End Joining in the Repair of Chromosome Breaks.

    Science.gov (United States)

    Wyatt, David W; Feng, Wanjuan; Conlin, Michael P; Yousefzadeh, Matthew J; Roberts, Steven A; Mieczkowski, Piotr; Wood, Richard D; Gupta, Gaorav P; Ramsden, Dale A

    2016-08-18

    DNA polymerase theta (Pol θ)-mediated end joining (TMEJ) has been implicated in the repair of chromosome breaks, but its cellular mechanism and role relative to canonical repair pathways are poorly understood. We show that it accounts for most repairs associated with microhomologies and is made efficient by coupling a microhomology search to removal of non-homologous tails and microhomology-primed synthesis across broken ends. In contrast to non-homologous end joining (NHEJ), TMEJ efficiently repairs end structures expected after aborted homology-directed repair (5' to 3' resected ends) or replication fork collapse. It typically does not compete with canonical repair pathways but, in NHEJ-deficient cells, is engaged more frequently and protects against translocation. Cell viability is also severely impaired upon combined deficiency in Pol θ and a factor that antagonizes end resection (Ku or 53BP1). TMEJ thus helps to sustain cell viability and genome stability by rescuing chromosome break repair when resection is misregulated or NHEJ is compromised. PMID:27453047

  1. A single double-strand break system reveals repair dynamics and mechanisms in heterochromatin and euchromatin.

    Science.gov (United States)

    Janssen, Aniek; Breuer, Gregory A; Brinkman, Eva K; van der Meulen, Annelot I; Borden, Sean V; van Steensel, Bas; Bindra, Ranjit S; LaRocque, Jeannine R; Karpen, Gary H

    2016-07-15

    Repair of DNA double-strand breaks (DSBs) must be properly orchestrated in diverse chromatin regions to maintain genome stability. The choice between two main DSB repair pathways, nonhomologous end-joining (NHEJ) and homologous recombination (HR), is regulated by the cell cycle as well as chromatin context.Pericentromeric heterochromatin forms a distinct nuclear domain that is enriched for repetitive DNA sequences that pose significant challenges for genome stability. Heterochromatic DSBs display specialized temporal and spatial dynamics that differ from euchromatic DSBs. Although HR is thought to be the main pathway used to repair heterochromatic DSBs, direct tests of this hypothesis are lacking. Here, we developed an in vivo single DSB system for both heterochromatic and euchromatic loci in Drosophila melanogaster Live imaging of single DSBs in larval imaginal discs recapitulates the spatio-temporal dynamics observed for irradiation (IR)-induced breaks in cell culture. Importantly, live imaging and sequence analysis of repair products reveal that DSBs in euchromatin and heterochromatin are repaired with similar kinetics, employ both NHEJ and HR, and can use homologous chromosomes as an HR template. This direct analysis reveals important insights into heterochromatin DSB repair in animal tissues and provides a foundation for further explorations of repair mechanisms in different chromatin domains. PMID:27474442

  2. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways

    Science.gov (United States)

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, we show that PARP-1, probably together with DNA ligase III, operates in an alternative pathway of non-homologous end joining (NHEJ) that functions as backup to the classical pathway of NHEJ that utilizes DNA-PKcs, Ku, DNA ligase IV, XRCC4, XLF/Cernunnos and Artemis. PARP-1 binds to DNA ends in direct competition with Ku. However, in irradiated cells the higher affinity of Ku for DSBs and an excessive number of other forms of competing DNA lesions limit its contribution to DSB repair. When essential components of the classical pathway of NHEJ are absent, PARP-1 is recruited for DSB repair, particularly in the absence of Ku and non-DSB lesions. This form of DSB repair is sensitive to PARP-1 inhibitors. The results define the function of PARP-1 in DSB repair and characterize a candidate pathway responsible for joining errors causing genomic instability and cancer. PMID:17088286

  3. Repair Pathway Choices and Consequences at the Double-Strand Break.

    Science.gov (United States)

    Ceccaldi, Raphael; Rondinelli, Beatrice; D'Andrea, Alan D

    2016-01-01

    DNA double-strand breaks (DSBs) are cytotoxic lesions that threaten genomic integrity. Failure to repair a DSB has deleterious consequences, including genomic instability and cell death. Indeed, misrepair of DSBs can lead to inappropriate end-joining events, which commonly underlie oncogenic transformation due to chromosomal translocations. Typically, cells employ two main mechanisms to repair DSBs: homologous recombination (HR) and classical nonhomologous end joining (C-NHEJ). In addition, alternative error-prone DSB repair pathways, namely alternative end joining (alt-EJ) and single-strand annealing (SSA), have been recently shown to operate in many different conditions and to contribute to genome rearrangements and oncogenic transformation. Here, we review the mechanisms regulating DSB repair pathway choice, together with the potential interconnections between HR and the annealing-dependent error-prone DSB repair pathways.

  4. The role of homologous recombination in mitotic and meiotic double-strand break repair

    NARCIS (Netherlands)

    Vries, Femke Adriana Theodora de

    2007-01-01

    All organisms are composed of cells and the cell’s nucleus contains DNA. The induction of DNA damage is a threat to organisms. Signalling of DNA damage and subsequent repair is of substantial importance. Double-strand breaks (DSBs) in DNA can be induced by ionising radiation and DNA damaging agents

  5. Regulation of DNA double-strand break repair by ubiquitin and ubiquitin-like modifiers

    DEFF Research Database (Denmark)

    Schwertman, Petra; Bekker-Jensen, Simon; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions. The swift recognition and faithful repair of such damage is crucial for the maintenance of genomic stability, as well as for cell and organismal fitness. Signalling by ubiquitin, SUMO and other ubiquitin-like modifiers (UBLs...

  6. Repair and genetic consequences of DNA double strand breaks during animal development

    NARCIS (Netherlands)

    Lemmens, Bennie Benjamin Lodewijk Gerardus

    2014-01-01

    The genetic code of life is stored in DNA molecules that consist of two parallel strands of coupled nucleotides that form a DNA double helix. One of the most deleterious forms of DNA damage is a DNA double-strand break (DSB) in which both strands of the helix are broken. When not repaired adequately

  7. Deficiency of DNA double-strand break repair and enhanced radiosensitivity in Tip60 silenced cells

    International Nuclear Information System (INIS)

    Objective: To investigate the effect of Tip60 on the cellular radiosensitivity,and to explore the related mechanism. Methods: siRNA and anacardic acid (AA, an inhibitor of Tip60 acetyltransferase) were used to inhibit Tip60 expression and its acetyltransferase activity, respectively. Radiosensitivity was analyzed by colony-forming ability assay. γ-H2AX foci were detected to analyze the DNA double-strand break (DSB). Immunoprecipitation was used to determine the interaction of proteins. Results: siRNA-mediated silencing of Tip60 led to enhanced sensitivity of U2OS cells at 1, 2 Gy after γ-ray irradiation, but had no significant effect at 4 Gy post-irradiation (t=3.364, 3.979, P<0.05).γ-H2AX foci detection indicated that Tip60 silencing resulted in a decreased capability of DNA double-strand break repair at 1, 4 and 8 h after irradiation (t=3.875, 3.183 and 3.175, respectively, P<0.05). The interaction of Tip60 and DNA-PKcs was prompted by ionizing radiation. Anacardic acid largely abrogated the phosphorylation of DNA-PKcs at T2609 site induced by irradiation. Conclusions: Tip60 plays a role in the cellular response to ionizing radiation-induced DNA damage through, at least in part, interacting with DNA-PKcs and regulating its phosphorylation. (authors)

  8. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

    International Nuclear Information System (INIS)

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  9. Beyond repair foci: DNA double-strand break repair in euchromatic and heterochromatic compartments analyzed by transmission electron microscopy.

    Directory of Open Access Journals (Sweden)

    Yvonne Lorat

    Full Text Available PURPOSE: DNA double-strand breaks (DSBs generated by ionizing radiation pose a serious threat to the preservation of genetic and epigenetic information. The known importance of local chromatin configuration in DSB repair raises the question of whether breaks in different chromatin environments are recognized and repaired by the same repair machinery and with similar efficiency. An essential step in DSB processing by non-homologous end joining is the high-affinity binding of Ku70-Ku80 and DNA-PKcs to double-stranded DNA ends that holds the ends in physical proximity for subsequent repair. METHODS AND MATERIALS: Using transmission electron microscopy to localize gold-labeled pKu70 and pDNA-PKcs within nuclear ultrastructure, we monitored the formation and repair of actual DSBs within euchromatin (electron-lucent and heterochromatin (electron-dense in cortical neurons of irradiated mouse brain. RESULTS: While DNA lesions in euchromatin (characterized by two pKu70-gold beads, reflecting the Ku70-Ku80 heterodimer are promptly sensed and rejoined, DNA packaging in heterochromatin appears to retard DSB processing, due to the time needed to unravel higher-order chromatin structures. Complex pKu70-clusters formed in heterochromatin (consisting of 4 or ≥ 6 gold beads may represent multiple breaks in close proximity caused by ionizing radiation of highly-compacted DNA. All pKu70-clusters disappeared within 72 hours post-irradiation, indicating efficient DSB rejoining. However, persistent 53BP1 clusters in heterochromatin (comprising ≥ 10 gold beads, occasionally co-localizing with γH2AX, but not pKu70 or pDNA-PKcs, may reflect incomplete or incorrect restoration of chromatin structure rather than persistently unrepaired DNA damage. DISCUSSION: Higher-order organization of chromatin determines the accessibility of DNA lesions to repair complexes, defining how readily DSBs are detected and processed. DNA lesions in heterochromatin appear to be more

  10. Postreplication repair in ultraviolet-irradiated human fibroblasts: formation and repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    A neutral filter elution assay was used to determine if the post-replicational formation and repair of DNA double-strand breaks (DSB) occurs in u.v.-irradiated human cells. Excision-deficient XP12 cells were pulse-labeled with [3H]thymidine after u.v. irradiation (1.5-3J/m2), and the nascent DNA was followed during repair incubation. With increasing u.v. radiation fluences, an increasing fraction of DNA was eluted at a fast rate, indicating that DSB were produced. The maximum yield DSB was observed after about 24 h of post-irradiation incubation at 370C. Similar results were also obtained with repair-proficient VA13 cells when irradiated at much higher fluences (7.5-15J/m2). It is concluded that, at the u.v. radiation fluences used, the DSB produced in u.v.-irradiated human cells are the result of post-replication repair events, and at incubation times >24 h some of these DSB are repaired. (author)

  11. Induction and repair of DNA strand breaks in bovine lens epithelial cells after high LET irradiation

    Science.gov (United States)

    Baumstark-Khan, C.; Heilmann, J.; Rink, H.

    The lens epithelium is the initiation site for the development of radiation induced cataracts. Radiation in the cortex and nucleus interacts with proteins, while in the epithelium, experimental results reveal mutagenic and cytotoxic effects. It is suggested that incorrectly repaired DNA damage may be lethal in terms of cellular reproduction and also may initiate the development of mutations or transformations in surviving cells. The occurrence of such genetically modified cells may lead to lens opacification. For a quantitative risk estimation for astronauts and space travelers it is necessary to know the relative biological effectiveness (RBE), because the spacial and temporal distribution of initial physical damage induced by cosmic radiation differ significantly from that of X-rays. RBEs for the induction of DNA strand breaks and the efficiency of repair of these breaks were measured in cultured diploid bovine lens epithelial cells exposed to different LET irradiation to either 300 kV X-rays or to heavy ions at the UNILAC accelerator at GSI. Accelerated ions from Z=8 (O) to Z=92 (U) were used. Strand breaks were measured by hydroxyapatite chromatography of alkaline unwound DNA (overall strand breaks). Results showed that DNA damage occurs as a function of dose, of kinetic energy and of LET. For particles having the same LET the severity of the DNA damage increases with dose. For a given particle dose, as the LET rises, the numbers of DNA strand breaks increase to a maximum and then reach a plateau or decrease. Repair kinetics depend on the fluence (irradiation dose). At any LET value, repair is much slower after heavy ion exposure than after X-irradiation. For ions with an LET of less than 10,000 keV μ -1 more than 90 percent of the strand breaks induced are repaired within 24 hours. At higher particle fluences, especially for low energetic particles with a very high local density of energy deposition within the particle track, a higher proportion of non

  12. Repair of DNA strand breaks in progeric fibroblasts and aging human diploid cells

    International Nuclear Information System (INIS)

    The rate of rejoining of DNA strand breaks induced by 10 krad of γ-irradiation has been studied in normal human diploid skin fibroblasts and skin fibroblasts from six patients with symptoms of progeria. Although slightly more rapid in very early passage, the repair rate in normal cells was similar throughout most of their life span in vitro. The appearance of cells with reduced repair capacity was evident as the cultures became senescent. The progeric fibroblasts varied greatly in their response to irradiation. The rate of repair was greatly reduced in two strains, whereas in two others extensive DNA degradation was consistently observed in unirradiated cells. Degradation was apparently related to the radiation received from the incorporated radiolabel. Normal repair was seen in progeric fibroblasts transformed by SV40 virus

  13. Making ends meet: repairing breaks in bacterial DNA by non-homologous end-joining.

    Directory of Open Access Journals (Sweden)

    Richard Bowater

    2006-02-01

    Full Text Available DNA double-strand breaks (DSBs are one of the most dangerous forms of DNA lesion that can result in genomic instability and cell death. Therefore cells have developed elaborate DSB-repair pathways to maintain the integrity of genomic DNA. There are two major pathways for the repair of DSBs in eukaryotes: homologous recombination and non-homologous end-joining (NHEJ. Until very recently, the NHEJ pathway had been thought to be restricted to the eukarya. However, an evolutionarily related NHEJ apparatus has now been identified and characterized in the prokarya. Here we review the recent discoveries concerning bacterial NHEJ and discuss the possible origins of this repair system. We also examine the insights gained from the recent cellular and biochemical studies of this DSB-repair process and discuss the possible cellular roles of an NHEJ pathway in the life-cycle of prokaryotes and phages.

  14. Double-strand break repair by interchromosomal recombination: an in vivo repair mechanism utilized by multiple somatic tissues in mammals.

    Directory of Open Access Journals (Sweden)

    Ryan R White

    Full Text Available Homologous recombination (HR is essential for accurate genome duplication and maintenance of genome stability. In eukaryotes, chromosomal double strand breaks (DSBs are central to HR during specialized developmental programs of meiosis and antigen receptor gene rearrangements, and form at unusual DNA structures and stalled replication forks. DSBs also result from exposure to ionizing radiation, reactive oxygen species, some anti-cancer agents, or inhibitors of topoisomerase II. Literature predicts that repair of such breaks normally will occur by non-homologous end-joining (in G1, intrachromosomal HR (all phases, or sister chromatid HR (in S/G(2. However, no in vivo model is in place to directly determine the potential for DSB repair in somatic cells of mammals to occur by HR between repeated sequences on heterologs (i.e., interchromosomal HR. To test this, we developed a mouse model with three transgenes-two nonfunctional green fluorescent protein (GFP transgenes each containing a recognition site for the I-SceI endonuclease, and a tetracycline-inducible I-SceI endonuclease transgene. If interchromosomal HR can be utilized for DSB repair in somatic cells, then I-SceI expression and induction of DSBs within the GFP reporters may result in a functional GFP+ gene. Strikingly, GFP+ recombinant cells were observed in multiple organs with highest numbers in thymus, kidney, and lung. Additionally, bone marrow cultures demonstrated interchromosomal HR within multiple hematopoietic subpopulations including multi-lineage colony forming unit-granulocyte-erythrocyte-monocyte-megakaryocte (CFU-GEMM colonies. This is a direct demonstration that somatic cells in vivo search genome-wide for homologous sequences suitable for DSB repair, and this type of repair can occur within early developmental populations capable of multi-lineage differentiation.

  15. Multiple-pathway analysis of double-strand break repair mutations in Drosophila.

    Directory of Open Access Journals (Sweden)

    Dena M Johnson-Schlitz

    2007-04-01

    Full Text Available The analysis of double-strand break (DSB repair is complicated by the existence of several pathways utilizing a large number of genes. Moreover, many of these genes have been shown to have multiple roles in DSB repair. To address this complexity we used a repair reporter construct designed to measure multiple repair outcomes simultaneously. This approach provides estimates of the relative usage of several DSB repair pathways in the premeiotic male germline of Drosophila. We applied this system to mutations at each of 11 repair loci plus various double mutants and altered dosage genotypes. Most of the mutants were found to suppress one of the pathways with a compensating increase in one or more of the others. Perhaps surprisingly, none of the single mutants suppressed more than one pathway, but they varied widely in how the suppression was compensated. We found several cases in which two or more loci were similar in which pathway was suppressed while differing in how this suppression was compensated. Taken as a whole, the data suggest that the choice of which repair pathway is used for a given DSB occurs by a two-stage "decision circuit" in which the DSB is first placed into one of two pools from which a specific pathway is then selected.

  16. Break-induced ATR and Ddb1-Cul4(Cdt)² ubiquitin ligase-dependent nucleotide synthesis promotes homologous recombination repair in fission yeast

    DEFF Research Database (Denmark)

    Moss, Jennifer; Tinline-Purvis, Helen; Walker, Carol A;

    2010-01-01

    the Ddb1-Cul4(Cdt)² ubiquitin ligase complex and ribonucleotide reductase (RNR) to be required for HR repair of a DNA double-strand break (DSB). The Ddb1-Cul4(Cdt)² ubiquitin ligase complex is required for degradation of Spd1, an inhibitor of RNR in fission yeast. Accordingly, deleting spd1(+) suppressed...... through increasing Cdt2 nuclear levels in response to DNA damage. Our findings support a model in which break-induced Rad3 and Ddb1-Cul4(Cdt)² ubiquitin ligase-dependent Spd1 degradation and RNR activation promotes postsynaptic ssDNA gap filling during HR repair....

  17. Homologous recombination repairs secondary replication induced DNA double-strand breaks after ionizing radiation

    OpenAIRE

    Groth, Petra; Orta, Manuel Luís; Elvers, Ingegerd; Majumder, Muntasir Mamun; Lagerqvist, Anne; Helleday, Thomas

    2012-01-01

    Ionizing radiation (IR) produces direct two-ended DNA double-strand breaks (DSBs) primarily repaired by non-homologous end joining (NHEJ). It is, however, well established that homologous recombination (HR) is induced and required for repair of a subset of DSBs formed following IR. Here, we find that HR induced by IR is drastically reduced when post-DNA damage replication is inhibited in mammalian cells. Both IR-induced RAD51 foci and HR events in the hprt gene are reduced in the presence of ...

  18. The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Aymeric P Bailly

    2010-07-01

    Full Text Available DNA double-strand breaks (DSBs can be repaired by homologous recombination (HR, which can involve Holliday junction (HJ intermediates that are ultimately resolved by nucleolytic enzymes. An N-terminal fragment of human GEN1 has recently been shown to act as a Holliday junction resolvase, but little is known about the role of GEN-1 in vivo. Holliday junction resolution signifies the completion of DNA repair, a step that may be coupled to signaling proteins that regulate cell cycle progression in response to DNA damage. Using forward genetic approaches, we identified a Caenorhabditis elegans dual function DNA double-strand break repair and DNA damage signaling protein orthologous to the human GEN1 Holliday junction resolving enzyme. GEN-1 has biochemical activities related to the human enzyme and facilitates repair of DNA double-strand breaks, but is not essential for DNA double-strand break repair during meiotic recombination. Mutational analysis reveals that the DNA damage-signaling function of GEN-1 is separable from its role in DNA repair. GEN-1 promotes germ cell cycle arrest and apoptosis via a pathway that acts in parallel to the canonical DNA damage response pathway mediated by RPA loading, CHK1 activation, and CEP-1/p53-mediated apoptosis induction. Furthermore, GEN-1 acts redundantly with the 9-1-1 complex to ensure genome stability. Our study suggests that GEN-1 might act as a dual function Holliday junction resolvase that may coordinate DNA damage signaling with a late step in DNA double-strand break repair.

  19. Life forms employ different repair strategies of repair single- and double strand DNA breaks caused by different qualities of radiation: criticality of RecA mediated repair system

    International Nuclear Information System (INIS)

    Different qualities of radiation, either through direct or indirect pathway, induce qualitative different spectrum of damages in DNA, which are also different in in vitro and in vivo systems. The single- and double strand breaks of DNA are of special interest as they lead to serious biological consequences. The implications of such damage to DNA and their processing by various inherent repair pathways together decide the fate of the living form

  20. Identification of Saccharomyces cerevisiae DNA ligase IV: involvement in DNA double-strand break repair.

    OpenAIRE

    Teo, S H; Jackson, S P

    1997-01-01

    DNA ligases catalyse the joining of single and double-strand DNA breaks, which is an essential final step in DNA replication, recombination and repair. Mammalian cells have four DNA ligases, termed ligases I-IV. In contrast, other than a DNA ligase I homologue (encoded by CDC9), no other DNA ligases have hitherto been identified in Saccharomyces cerevisiae. Here, we report the identification and characterization of a novel gene, LIG4, which encodes a protein with strong homology to mammalian ...

  1. RNF4 is required for DNA double-strand break repair in vivo

    DEFF Research Database (Denmark)

    Vyas, R; Kumar, R; Clermont, F;

    2013-01-01

    Unrepaired DNA double-strand breaks (DSBs) cause genetic instability that leads to malignant transformation or cell death. Cells respond to DSBs with the ordered recruitment of signaling and repair proteins to the sites of DNA lesions. Coordinated protein SUMOylation and ubiquitylation have crucial...... in other key regulators of HR repair, Rnf4 deficiency leads to age-dependent impairment in spermatogenesis. These findings identify Rnf4 as a critical component of the DDR in vivo and support the possibility that Rnf4 controls protein localization at DNA damage sites by integrating SUMOylation...... roles in regulating the dynamic assembly of protein complexes at these sites. However, how SUMOylation influences protein ubiquitylation at DSBs is poorly understood. We show herein that Rnf4, an E3 ubiquitin ligase that targets SUMO-modified proteins, accumulates in DSB repair foci and is required...

  2. DNA double-strand break repair: a tale of pathway choices.

    Science.gov (United States)

    Li, Jing; Xu, Xingzhi

    2016-07-01

    Deoxyribonucleic acid double-strand breaks (DSBs) are cytotoxic lesions that must be repaired either through homologous recombination (HR) or non-homologous end-joining (NHEJ) pathways. DSB repair is critical for genome integrity, cellular homeostasis and also constitutes the biological foundation for radiotherapy and the majority of chemotherapy. The choice between HR and NHEJ is a complex yet not completely understood process that will entail more future efforts. Herein we review our current understandings about how the choice is made over an antagonizing balance between p53-binding protein 1 and breast cancer 1 in the context of cell cycle stages, downstream effects, and distinct chromosomal histone marks. These exciting areas of research will surely bring more mechanistic insights about DSB repair and be utilized in the clinical settings. PMID:27217474

  3. Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines

    OpenAIRE

    Jacob, Sandrine; Miquel, Catherine; Sarasin, Alain; Praz, Françoise

    2005-01-01

    Loss of a functional mismatch repair (MMR) system in colorectal cancer (CRC) cells is associated with microsatellite instability and increased sensitivity to topoisomerase inhibitors. In this study, we have investigated whether a defect in double-strand break (DSB) repair by non-homologous end-joining (NHEJ) could explain why MMR-deficient CRC cells are hypersensitive to camptothecin (CPT), a topoisomerase I inhibitor. To evaluate the efficiency and the fidelity of DSB repair, we have transie...

  4. Effects of chemopreventive natural products on non-homologous end-joining DNA double-strand break repair.

    Science.gov (United States)

    Charles, Catherine; Nachtergael, Amandine; Ouedraogo, Moustapha; Belayew, Alexandra; Duez, Pierre

    2014-07-01

    Double-strand breaks (DSBs) may result from endogenous (e.g., reactive oxygen species, variable (diversity) joining, meiotic exchanges, collapsed replication forks, nucleases) or exogenous (e.g., ionizing radiation, chemotherapeutic agents, radiomimetic compounds) events. DSBs disrupt the integrity of DNA and failed or improper DSBs repair may lead to genomic instability and, eventually, mutations, cancer, or cell death. Non-homologous end-joining (NHEJ) is the major pathway used by higher eukaryotic cells to repair these lesions. Given the complexity of NHEJ and the number of proteins and cofactors involved, secondary metabolites from medicinal or food plants might interfere with the process, activating or inhibiting repair. Twelve natural products, arbutin, curcumin, indole-3-carbinol, and nine flavonoids (apigenin, baicalein, chalcone, epicatechin, genistein, myricetin, naringenin, quercetin, sakuranetin) were chosen for their postulated roles in cancer chemoprevention and/or treatment. The effects of these compounds on NHEJ were investigated with an in vitro protocol based on plasmid substrates. Plasmids were linearized by a restriction enzyme, generating cohesive ends, or by a combination of enzymes, generating incompatible ends; plasmids were then incubated with a nuclear extract prepared from normal human small-intestinal cells (FHS 74 Int), either treated with these natural products or untreated (controls). The NHEJ repair complex from nuclear extracts ligates linearized plasmids, resulting in plasmid oligomers that can be separated and quantified by on-chip microelectrophoresis. Some compounds (chalcone, epicatechin, myricetin, sakuranetin and arbutin) clearly activated NHEJ, whereas others (apigenin, baicalein and curcumin) significantly reduced the repair rate of both types of plasmid substrates. Although this in vitro protocol is only partly representative of the in vivo situation, the natural products appear to interfere with NHEJ repair and warrant

  5. PML nuclear body disruption impairs DNA double-strand break sensing and repair in APL

    Science.gov (United States)

    di Masi, A; Cilli, D; Berardinelli, F; Talarico, A; Pallavicini, I; Pennisi, R; Leone, S; Antoccia, A; Noguera, N I; Lo-Coco, F; Ascenzi, P; Minucci, S; Nervi, C

    2016-01-01

    Proteins involved in DNA double-strand break (DSB) repair localize within the promyelocytic leukemia nuclear bodies (PML-NBs), whose disruption is at the root of the acute promyelocytic leukemia (APL) pathogenesis. All-trans-retinoic acid (RA) treatment induces PML-RARα degradation, restores PML-NB functions, and causes terminal cell differentiation of APL blasts. However, the precise role of the APL-associated PML-RARα oncoprotein and PML-NB integrity in the DSB response in APL leukemogenesis and tumor suppression is still lacking. Primary leukemia blasts isolated from APL patients showed high phosphorylation levels of H2AX (γ-H2AX), an initial DSBs sensor. By addressing the consequences of ionizing radiation (IR)-induced DSB response in primary APL blasts and RA-responsive and -resistant myeloid cell lines carrying endogenous or ectopically expressed PML-RARα, before and after treatment with RA, we found that the disruption of PML-NBs is associated with delayed DSB response, as revealed by the impaired kinetic of disappearance of γ-H2AX and 53BP1 foci and activation of ATM and of its substrates H2AX, NBN, and CHK2. The disruption of PML-NB integrity by PML-RARα also affects the IR-induced DSB response in a preleukemic mouse model of APL in vivo. We propose the oncoprotein-dependent PML-NB disruption and DDR impairment as relevant early events in APL tumorigenesis. PMID:27468685

  6. The production and repair of double strand breaks in cells from normal humans and patients with ataxia telangiectasia

    International Nuclear Information System (INIS)

    The production and repair of double strand breaks induced by γ-rays in the DNA of human fibroblasts have been measured by sedimentation in sucrose gradients under non-denaturing conditions. Unirradiated DNA formed a rapidly sedimenting gel. Low doses of radiation released freely sedimenting DNA molecules from this gel. Higher doses reduced the rate of sedimentation of the free DNA due to the introduction of double strand breaks. The breakage efficiency was 1 break/1.3x1010 daltons of DNA/krad. Postirradiation incubation after a high dose of radiation resulted in an increase in molecular weight of the free DNA molecules, and after a low dose the rapidly-sedimenting gel was reformed. These data suggest that double strand breaks are repaired in human fibroblasts. No significant differences were found between fibroblasts from two normal donors and four patients with the radiosensitive disorder, ataxia telangiectasia, in either the production or repair of double strand breaks

  7. Mitosis, double strand break repair, and telomeres: a view from the end: how telomeres and the DNA damage response cooperate during mitosis to maintain genome stability.

    Science.gov (United States)

    Cesare, Anthony J

    2014-11-01

    Double strand break (DSB) repair is suppressed during mitosis because RNF8 and downstream DNA damage response (DDR) factors, including 53BP1, do not localize to mitotic chromatin. Discovery of the mitotic kinase-dependent mechanism that inhibits DSB repair during cell division was recently reported. It was shown that restoring mitotic DSB repair was detrimental, resulting in repair dependent genome instability and covalent telomere fusions. The telomere DDR that occurs naturally during cellular aging and in cancer is known to be refractory to G2/M checkpoint activation. Such DDR-positive telomeres, and those that occur as part of the telomere-dependent prolonged mitotic arrest checkpoint, normally pass through mitosis without covalent ligation, but result in cell growth arrest in G1 phase. The discovery that suppressing DSB repair during mitosis may function primarily to protect DDR-positive telomeres from fusing during cell division reinforces the unique cooperation between telomeres and the DDR to mediate tumor suppression.

  8. Genetic polymorphisms of DNA double-strand break repair pathway genes and glioma susceptibility

    International Nuclear Information System (INIS)

    Genetic variations in DNA double-strand break repair genes can influence the ability of a cell to repair damaged DNA and alter an individual’s susceptibility to cancer. We studied whether polymorphisms in DNA double-strand break repair genes are associated with an increased risk of glioma development. We genotyped 10 potentially functional single nucleotide polymorphisms (SNPs) in 7 DNA double-strand break repair pathway genes (XRCC3, BRCA2, RAG1, XRCC5, LIG4, XRCC4 and ATM) in a case–control study including 384 glioma patients and 384 cancer-free controls in a Chinese Han population. Genotypes were determined using the OpenArray platform. In the single-locus analysis there was a significant association between gliomas and the LIG4 rs1805388 (Ex2 +54C>T, Thr9Ile) TT genotype (adjusted OR, 3.27; 95% CI, 1.87-5.71), as well as the TC genotype (adjusted OR, 1.62; 95% CI, 1.20-2.18). We also found that the homozygous variant genotype (GG) of XRCC4 rs1805377 (IVS7-1A>G, splice-site) was associated with a significantly increased risk of gliomas (OR, 1.77; 95% CI, 1.12-2.80). Interestingly, we detected a significant additive and multiplicative interaction effect between the LIG4 rs1805388 and XRCC4 rs1805377 polymorphisms with an increasing risk of gliomas. When we stratified our analysis by smoking status, LIG4 rs1805388 was associated with an increased glioma risk among smokers. These results indicate for the first time that LIG4 rs1805388 and XRCC4 rs1805377, alone or in combination, are associated with a risk of gliomas

  9. MOF Phosphorylation by ATM Regulates 53BP1-Mediated Double-Strand Break Repair Pathway Choice

    Directory of Open Access Journals (Sweden)

    Arun Gupta

    2014-07-01

    Full Text Available Cell-cycle phase is a critical determinant of the choice between DNA damage repair by nonhomologous end-joining (NHEJ or homologous recombination (HR. Here, we report that double-strand breaks (DSBs induce ATM-dependent MOF (a histone H4 acetyl-transferase phosphorylation (p-T392-MOF and that phosphorylated MOF colocalizes with γ-H2AX, ATM, and 53BP1 foci. Mutation of the phosphorylation site (MOF-T392A impedes DNA repair in S and G2 phase but not G1 phase cells. Expression of MOF-T392A also blocks the reduction in DSB-associated 53BP1 seen in wild-type S/G2 phase cells, resulting in enhanced 53BP1 and reduced BRCA1 association. Decreased BRCA1 levels at DSB sites correlates with defective repairosome formation, reduced HR repair, and decreased cell survival following irradiation. These data support a model whereby ATM-mediated MOF-T392 phosphorylation modulates 53BP1 function to facilitate the subsequent recruitment of HR repair proteins, uncovering a regulatory role for MOF in DSB repair pathway choice during S/G2 phase.

  10. DNA Double Strand Break Response and Limited Repair Capacity in Mouse Elongated Spermatids

    Directory of Open Access Journals (Sweden)

    Emad A. Ahmed

    2015-12-01

    Full Text Available Spermatids are extremely sensitive to genotoxic exposures since during spermiogenesis only error-prone non homologous end joining (NHEJ repair pathways are available. Hence, genomic damage may accumulate in sperm and be transmitted to the zygote. Indirect, delayed DNA fragmentation and lesions associated with apoptotic-like processes have been observed during spermatid elongation, 27 days after irradiation. The proliferating spermatogonia and early meiotic prophase cells have been suggested to retain a memory of a radiation insult leading later to this delayed fragmentation. Here, we used meiotic spread preparations to localize phosphorylate histone H2 variant (γ-H2AX foci marking DNA double strand breaks (DSBs in elongated spermatids. This technique enabled us to determine the background level of DSB foci in elongated spermatids of RAD54/RAD54B double knockout (dko mice, severe combined immunodeficiency SCID mice, and poly adenosine diphosphate (ADP-ribose polymerase 1 (PARP1 inhibitor (DPQ-treated mice to compare them with the appropriate wild type controls. The repair kinetics data and the protein expression patterns observed indicate that the conventional NHEJ repair pathway is not available for elongated spermatids to repair the programmed and the IR-induced DSBs, reflecting the limited repair capacity of these cells. However, although elongated spermatids express the proteins of the alternative NHEJ, PARP1-inhibition had no effect on the repair kinetics after IR, suggesting that DNA damage may be passed onto sperm. Finally, our genetic mutant analysis suggests that an incomplete or defective meiotic recombinational repair of Spo11-induced DSBs may lead to a carry-over of the DSB damage or induce a delayed nuclear fragmentation during the sensitive programmed chromatin remodeling occurring in elongated spermatids.

  11. A robust network of double-strand break repair pathways governs genome integrity during C. elegans development.

    NARCIS (Netherlands)

    Pontier, D.B.; Tijsterman, M.

    2009-01-01

    To preserve genomic integrity, various mechanisms have evolved to repair DNA double-strand breaks (DSBs). Depending on cell type or cell cycle phase, DSBs can be repaired error-free, by homologous recombination, or with concomitant loss of sequence information, via nonhomologous end-joining (NHEJ) o

  12. γ-ray dose rate effect in DNA double-strand break repair deficient murine cells

    International Nuclear Information System (INIS)

    Objective: To analyze the dose rate effect and potentially lethal damage repair in DNA double-strand break repair deficient murine cells (SCID) irradiated by γ-ray. Methods: The wild type (CB.17+/+) and SCID cells were exposed to γ-ray at high and low dose rates. The high dose rate exposure was fractionated into two equal doses at 24 h intervals. The survival rates of irradiated cells were calculated by clone-forming analysis. Results: When γ-ray was given to wild type (CB.17+/+) cells in two fractions at 24 h intervals, the survival rate was significantly higher than that when the same total dose was given singly. In contrast, there was no difference in the survival rates between the single and fractionated exposure in SCID cells. SCID cells were more sensitive than CB.17+/+ cells to both low and high dose rates γ-ray exposure for cell killing. The survival rate by low dose rate exposure was significantly higher than that by high dose rate exposure, not only in CB.17+/+ cells but also in SCID cells. Conclusions: SCID cells are deficient in repairing γ-ray induced double-strand breaks. There is dose rate effect in both SCID and CB.17+/+ cells

  13. DNA polymerases δ and λ cooperate in repairing double-strand breaks by microhomology-mediated end-joining in Saccharomyces cerevisiae.

    Science.gov (United States)

    Meyer, Damon; Fu, Becky Xu Hua; Heyer, Wolf-Dietrich

    2015-12-15

    Maintenance of genome stability is carried out by a suite of DNA repair pathways that ensure the repair of damaged DNA and faithful replication of the genome. Of particular importance are the repair pathways, which respond to DNA double-strand breaks (DSBs), and how the efficiency of repair is influenced by sequence homology. In this study, we developed a genetic assay in diploid Saccharomyces cerevisiae cells to analyze DSBs requiring microhomologies for repair, known as microhomology-mediated end-joining (MMEJ). MMEJ repair efficiency increased concomitant with microhomology length and decreased upon introduction of mismatches. The central proteins in homologous recombination (HR), Rad52 and Rad51, suppressed MMEJ in this system, suggesting a competition between HR and MMEJ for the repair of a DSB. Importantly, we found that DNA polymerase delta (Pol δ) is critical for MMEJ, independent of microhomology length and base-pairing continuity. MMEJ recombinants showed evidence that Pol δ proofreading function is active during MMEJ-mediated DSB repair. Furthermore, mutations in Pol δ and DNA polymerase 4 (Pol λ), the DNA polymerase previously implicated in MMEJ, cause a synergistic decrease in MMEJ repair. Pol λ showed faster kinetics associating with MMEJ substrates following DSB induction than Pol δ. The association of Pol δ depended on RAD1, which encodes the flap endonuclease needed to cleave MMEJ intermediates before DNA synthesis. Moreover, Pol δ recruitment was diminished in cells lacking Pol λ. These data suggest cooperative involvement of both polymerases in MMEJ. PMID:26607450

  14. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    Energy Technology Data Exchange (ETDEWEB)

    Hata, Kuniki [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Advanced Science Research Center, Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Urushibara, Ayumi; Yamashita, Shinichi; Shikazono, Naoya; Yokoya, Akinari [Advanced Science Research Center, Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Katsumura, Yosuke, E-mail: katsu@n.t.u-tokyo.ac.jp [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Nuclear Professional School, School of Engineering, The University of Tokyo, 2-22 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1188 (Japan)

    2013-05-03

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield of DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems.

  15. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    International Nuclear Information System (INIS)

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield of DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems

  16. Maintenance of genome stability in plants: repairing DNA double strand breaks and chromatin structure stability

    Directory of Open Access Journals (Sweden)

    Sujit eRoy

    2014-09-01

    Full Text Available Plant cells are subject to high levels of DNA damage resulting from plant’s obligatory dependence on sunlight and the associated exposure to environmental stresses like solar UV radiation, high soil salinity, drought, chilling injury and other air and soil pollutants including heavy metals and metabolic byproducts from endogenous processes. The irreversible DNA damages, generated by the environmental and genotoxic stresses affect plant growth and development, reproduction and crop productivity. Thus, for maintaining genome stability, plants have developed an extensive array of mechanisms for the detection and repair of DNA damages. This review will focus recent advances in our understanding of mechanisms regulating plant genome stability in the context of repairing of double stand breaks and chromatin structure maintenance.

  17. The liver DNA breaks and repair of the fish (carassius auratus) induced by the sublethal metal mixture

    International Nuclear Information System (INIS)

    The breaks and repair of the carassius auratus's liver DNA induced by the metal mixture were studied by using the gel electrophoresis technique and 3H-TdR incorporation experiment. The results demonstrated that DNA breaks were detected after treated by zine, lead and metal mixture, and the RNSB order was the metal mixture >Pb>Zn. The DNA repair was found among the zinc treatment, cadmium treatment, lead treatment as well as metal mixture treatment, and the order of the repair ability was the metal mixture >Pb>Zn>Cd. The mixture of the metals increased the damage to the DNA. The results also showed that the result of the DNA breaks was not conformed completely to that of the DNA repair

  18. DNA double strand break damage by radiation and behavioral imaging of DNA repair enzymes

    International Nuclear Information System (INIS)

    The theme in the title is described mainly on authors' studies. Finding of a jellyfish GFP (green fluorescent protein) and its genomic recombination technique with a target protein have made it possible to investigate the behavior of the protein (the repair enzymes in this review) within a cell by fluorescent microscopy. Double strand breaks (DSBs), the most severe damage of DNA leading to cell death and carcinogenesis, are induced by irradiation of ionizing radiation and/or ultraviolet light, and repair mechanisms of non homologous end-joining and homologous recombinant repair are known major in mammalian cells and in lower eukaryotes, respectively. Authors used UVA for inducing DSBs under the presence of benzo[a]pyrene in mammalian cells like Chinese hamster ovary (CHO)-K1 and xrs-5, the behaviors of Ku70/80 repair molecules tagged by GFP were imaged by confocal laser microscopy, and one of findings was that Ku80 moved to the level most intensely irradiated. Fluorescent molecular imaging technique will be employed widely in clinical diagnosis and new drug development as well as in basic bioscience. (S.I.)

  19. Rapid pairing and resegregation of distant homologous loci enables double-strand break repair in bacteria.

    Science.gov (United States)

    Badrinarayanan, Anjana; Le, Tung B K; Laub, Michael T

    2015-08-01

    Double-strand breaks (DSBs) can lead to the loss of genetic information and cell death. Although DSB repair via homologous recombination has been well characterized, the spatial organization of this process inside cells remains poorly understood, and the mechanisms used for chromosome resegregation after repair are unclear. In this paper, we introduced site-specific DSBs in Caulobacter crescentus and then used time-lapse microscopy to visualize the ensuing chromosome dynamics. Damaged loci rapidly mobilized after a DSB, pairing with their homologous partner to enable repair, before being resegregated to their original cellular locations, independent of DNA replication. Origin-proximal regions were resegregated by the ParABS system with the ParA structure needed for resegregation assembling dynamically in response to the DSB-induced movement of an origin-associated ParB away from one cell pole. Origin-distal regions were resegregated in a ParABS-independent manner and instead likely rely on a physical, spring-like force to segregate repaired loci. Collectively, our results provide a mechanistic basis for the resegregation of chromosomes after a DSB. PMID:26240183

  20. The structure of ends determines the pathway choice and Mre11 nuclease dependency of DNA double-strand break repair

    Science.gov (United States)

    Liao, Shuren; Tammaro, Margaret; Yan, Hong

    2016-01-01

    The key event in the choice of repair pathways for DNA double-strand breaks (DSBs) is the initial processing of ends. Non-homologous end joining (NHEJ) involves limited processing, but homology-dependent repair (HDR) requires extensive resection of the 5′ strand. How cells decide if an end is channeled to resection or NHEJ is not well understood. We hypothesize that the structure of ends is a major determinant and tested this hypothesis with model DNA substrates in Xenopus egg extracts. While ends with normal nucleotides are efficiently channeled to NHEJ, ends with damaged nucleotides or bulky adducts are channeled to resection. Resection is dependent on Mre11, but its nuclease activity is critical only for ends with 5′ bulky adducts. CtIP is absolutely required for activating the nuclease-dependent mechanism of Mre11 but not the nuclease-independent mechanism. Together, these findings suggest that the structure of ends is a major determinant for the pathway choice of DSB repair and the Mre11 nuclease dependency of resection. PMID:27084932

  1. Constitutional Chromothripsis Rearrangements Involve Clustered Double-Stranded DNA Breaks and Nonhomologous Repair Mechanisms

    Directory of Open Access Journals (Sweden)

    Wigard P. Kloosterman

    2012-06-01

    Full Text Available Chromothripsis represents a novel phenomenon in the structural variation landscape of cancer genomes. Here, we analyze the genomes of ten patients with congenital disease who were preselected to carry complex chromosomal rearrangements with more than two breakpoints. The rearrangements displayed unanticipated complexity resembling chromothripsis. We find that eight of them contain hallmarks of multiple clustered double-stranded DNA breaks (DSBs on one or more chromosomes. In addition, nucleotide resolution analysis of 98 breakpoint junctions indicates that break repair involves nonhomologous or microhomology-mediated end joining. We observed that these eight rearrangements are balanced or contain sporadic deletions ranging in size between a few hundred base pairs and several megabases. The two remaining complex rearrangements did not display signs of DSBs and contain duplications, indicative of rearrangement processes involving template switching. Our work provides detailed insight into the characteristics of chromothripsis and supports a role for clustered DSBs driving some constitutional chromothripsis rearrangements.

  2. Increased repair of {gamma}-induced DNA double-strand breaks at lower dose-rate in CHO cells

    Energy Technology Data Exchange (ETDEWEB)

    Boucher, D.; Hindo, J.; Averbeck, D. [Centre Universitaire d' Orsay, Inst. Curie-Section de Recherche, Orsay CEDEX (France)]. E-mail: dietrich.averbeck@curie.u-psud.fr

    2004-02-01

    DNA double-strand breaks (DSBs) are highly cell damaging. We asked whether for a given dose a longer irradiation time would be advantageous for the repair of DSBs. Varying the {gamma}-irradiation dose and its delivery time (0.05 Gy/min low dose-rate (LDR) compared with 3.5 Gy/min high dose-rate), confluent Chinese hamster ovary cells (CHO-K1) and Ku80 mutant cells (xrs-6) deficient in nonhomologous end-joining (NHEJ) were irradiated in agarose plugs at room temperature using a cesium-137 {gamma}-ray source. We used pulsed-field gel electrophoresis (PFGE) to measure DSBs in terms of the fraction of activity released (FAR). At LDR, one third of DSBs were repaired in CHO-K1 but not in xrs-6 cells, indicating the involvement of NHEJ in the repair of {gamma}-induced DSBs at a prolonged irradiation incubation time. To improve DSB measurements, we introduced in our PFGE protocol an antioxidant at the cell lysis step, thus avoiding free-radical side reactions on DNA and spurious DSBs. Addition of the metal chelator deferoxamine (DFO) decreased more efficiently the basal DSB level than did reduced glutathione (GSH), showing that measuring DSBs in the absence of DFO reduces precision and underestimates the role of NHEJ in the dose-rate effect on DSB yield. (author)

  3. Mathematical modelling of the automated FADU assay for the quantification of DNA strand breaks and their repair in human peripheral mononuclear blood cells

    International Nuclear Information System (INIS)

    Cells continuously undergo DNA damage from exogenous agents like irradiation or genotoxic chemicals or from endogenous radicals produced by normal cellular metabolic activities. DNA strand breaks are one of the most common genotoxic lesions and they can also arise as intermediates of DNA repair activity. Unrepaired DNA damage can lead to genomic instability, which can massively compromise the health status of organisms. Therefore it is important to measure and quantify DNA damage and its repair. We have previously published an automated method for measuring DNA strand breaks based on fluorimetric detection of alkaline DNA unwinding [1], and here we present a mathematical model of the FADU assay, which enables to an analytic expression for the relation between measured fluorescence and the number of strand breaks. Assessment of the formation and also the repair of DNA strand breaks is a crucial functional parameter to investigate genotoxicity in living cells. A reliable and convenient method to quantify DNA strand breakage is therefore of significant importance for a wide variety of scientific fields, e.g. toxicology, pharmacology, epidemiology and medical sciences

  4. Assembly and function of DNA double-strand break repair foci in mammalian cells

    DEFF Research Database (Denmark)

    Bekker-Jensen, Simon; Mailand, Niels

    2010-01-01

    DNA double-strand breaks (DSBs) are among the most cytotoxic types of DNA damage, which if left unrepaired can lead to mutations or gross chromosomal aberrations, and promote the onset of diseases associated with genomic instability such as cancer. One of the most discernible hallmarks of the cel...... of such DNA repair foci still remains limited. In this review, we focus on recent discoveries on the mechanisms that govern the formation of IRIF, and discuss the implications of such findings in light of our understanding of the physiological importance of these structures.......DNA double-strand breaks (DSBs) are among the most cytotoxic types of DNA damage, which if left unrepaired can lead to mutations or gross chromosomal aberrations, and promote the onset of diseases associated with genomic instability such as cancer. One of the most discernible hallmarks...... of the cellular response to DSBs is the accumulation and local concentration of a plethora of DNA damage signaling and repair proteins in the vicinity of the lesion, initiated by ATM-mediated phosphorylation of H2AX (¿-H2AX) and culminating in the generation of distinct nuclear compartments, so-called Ionizing...

  5. Alterations in the nuclear matrix protein mass correlate with heat-induced inhibition of DNA single-strand-break repair

    International Nuclear Information System (INIS)

    The total protein mass co-isolating with the nuclear matrix or nucleoid from Chinese hamster ovary (CHO) cells was observed to increase in heated cells as a function of increasing exposure temperature between 430C and 450C or of exposure time at any temperature. The sedimentation distance of the CHO cell nucleoid in sucrose gradients increased with increasing exposure time at 450C. Both these nuclear alterations correlated in a log-linear manner with heat-induced inhibition of DNA strand break repair. A two-fold threshold increase in nuclear matrix protein mass preceded any substantial inhibition of repair of DNA single-strand breaks. When preheated cells were incubated at 370C the nuclear matrix protein mass and nucleoid sedimentation recovered with a half-time of about 5 h, while DNA single-strand-break repair recovered with a half-time of about 2 h. When preheated cells were placed at 410C a further increase was observed in the nuclear matrix protein mass and the half-time of DNA strand break repair, while nucleoid sedimentation recovered toward control values. These results implicate alterations in the protein mass of the nuclear matrix in heat-induced inhibition of repair of DNA single-strand breaks. (author)

  6. Determination of human DNA polymerase utilization for the repair of a model ionizing radiation-induced DNA strand break lesion in a defined vector substrate

    Science.gov (United States)

    Winters, T. A.; Russell, P. S.; Kohli, M.; Dar, M. E.; Neumann, R. D.; Jorgensen, T. J.

    1999-01-01

    Human DNA polymerase and DNA ligase utilization for the repair of a major class of ionizing radiation-induced DNA lesion [DNA single-strand breaks containing 3'-phosphoglycolate (3'-PG)] was examined using a novel, chemically defined vector substrate containing a single, site-specific 3'-PG single-strand break lesion. In addition, the major human AP endonuclease, HAP1 (also known as APE1, APEX, Ref-1), was tested to determine if it was involved in initiating repair of 3'-PG-containing single-strand break lesions. DNA polymerase beta was found to be the primary polymerase responsible for nucleotide incorporation at the lesion site following excision of the 3'-PG blocking group. However, DNA polymerase delta/straightepsilon was also capable of nucleotide incorporation at the lesion site following 3'-PG excision. In addition, repair reactions catalyzed by DNA polymerase beta were found to be most effective in the presence of DNA ligase III, while those catalyzed by DNA polymerase delta/straightepsilon appeared to be more effective in the presence of DNA ligase I. Also, it was demonstrated that the repair initiating 3'-PG excision reaction was not dependent upon HAP1 activity, as judged by inhibition of HAP1 with neutralizing HAP1-specific polyclonal antibody.

  7. Regulation of ATM in DNA double strand break repair accounts for the radiosensitivity in human cells exposed to high linear energy transfer ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Xue Lian, E-mail: xuelian@suda.edu.cn [School of Radiation Medicine and Public Health, Medical College of Soochow University, No. 199, Ren' ai Road, Suzhou 215123 (China); Yu Dong, E-mail: ydong@ncc.go.jp [Tumor Endocrinology Project, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Furusawa, Yoshiya; Okayasu, Ryuichi [Heavy-Ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba-shi 263-8555 (Japan); Tong Jian; Cao Jianping; Fan Saijun [School of Radiation Medicine and Public Health, Medical College of Soochow University, No. 199, Ren' ai Road, Suzhou 215123 (China)

    2009-11-02

    High linear energy transfer (LET) radiation shows different biological effects from low-LET radiation. The complex nature of high LET radiation-induced damage, especially the clustered DNA damage, brings about slow repair of DNA double strand breaks (DSBs), which finally lead to higher lethality and chromosome aberration. Ionizing radiation (IR) induced DNA DSBs are repaired by both non-homologous end-joining (NHEJ) and homologous recombination repair (HRR) pathways in mammalian cells. The novel function of ataxia telangiectasia-mutated (ATM) protein is its involvement in the DSB repair of slow kinetics for 'dirty' breaks rejoining by NHEJ, this suggests that ATM may play a more important role in high LET radiation-induced DNA damage. We show here that KU55933, an ATM inhibitor could distinctly lower the clonogenic survival in normal human skin fibroblast cells exposed to carbon ion radiation and dramatically impair the normal process for DSB repair. We also implicated the involvement of ATM in the two pathways of DNA DSB repair, with DNA-PKcs and Rad51 as the representative proteins. The phosphorylation of DNA-PKcs at Thr-2609 with both immunoblotting and immunofluorescent staining indicated an ATM-dependent change, while for Rad51, KU55933 pretreatment could postpone the formation of nuclear Rad51 foci. Interestingly, we also found that pretreatment with chloroquine, an ATM stimulator could protect cells from carbon ion radiation only at lower doses. For doses over 1 Gy, protection was no longer observed. There was a dose-dependent increase for ATM kinase activity, with saturation at about 1 Gy. Chloroquine pretreatment prior to 1 Gy of carbon ion radiation did not enhance the autophosphorylation of ATM at serine 1981. The function of ATM in G2/M checkpoint arrest facilitated DSB repair in high-LET irradiation. Our results provide a possible mechanism for the direct involvement of ATM in DSB repair by high-LET irradiation.

  8. RecA bundles mediate homology pairing between distant sisters during DNA break repair

    Science.gov (United States)

    Lesterlin, Christian; Ball, Graeme; Schermelleh, Lothar; Sherratt, David J.

    2014-02-01

    DNA double-strand break (DSB) repair by homologous recombination has evolved to maintain genetic integrity in all organisms. Although many reactions that occur during homologous recombination are known, it is unclear where, when and how they occur in cells. Here, by using conventional and super-resolution microscopy, we describe the progression of DSB repair in live Escherichia coli. Specifically, we investigate whether homologous recombination can occur efficiently between distant sister loci that have segregated to opposite halves of an E. coli cell. We show that a site-specific DSB in one sister can be repaired efficiently using distant sister homology. After RecBCD processing of the DSB, RecA is recruited to the cut locus, where it nucleates into a bundle that contains many more RecA molecules than can associate with the two single-stranded DNA regions that form at the DSB. Mature bundles extend along the long axis of the cell, in the space between the bulk nucleoid and the inner membrane. Bundle formation is followed by pairing, in which the two ends of the cut locus relocate at the periphery of the nucleoid and together move rapidly towards the homology of the uncut sister. After sister locus pairing, RecA bundles disassemble and proteins that act late in homologous recombination are recruited to give viable recombinants 1-2-generation-time equivalents after formation of the initial DSB. Mutated RecA proteins that do not form bundles are defective in sister pairing and in DSB-induced repair. This work reveals an unanticipated role of RecA bundles in channelling the movement of the DNA DSB ends, thereby facilitating the long-range homology search that occurs before the strand invasion and transfer reactions.

  9. Enhancing repair of radiation-induced strand breaks in cellular DNA as a radiotherapeutic potential

    International Nuclear Information System (INIS)

    Protection of mammalian organisms including man from deleterious effects of ionizing radiation is of paramount importance and development of effective approaches to combat radiation damages using non-toxic radioprotectors is of considerable interest for defence, nuclear industries, radiation accidents, space travels, etc., besides the protection of normal tissues during radiotherapy of tumours. Many synthetic as well as natural compounds have been investigated in the recent past for their efficacy to protect the biological systems from radiation induced damages. They include sulfhydryl compounds, antioxidants, plant extracts, immune-modulators, and other agents. However, the inherent toxicity of many of the synthetic agents at the effective radio-protective concentration warranted further search for safer and more effective radio-protectors. In this context, therapeutic radioprotectors which are effective on post irradiation administration are of special relevance. One of the property that can be applied while screening for such radiation protective therapeutics is their ability to enhance repair of radiation-induced lesions in cellular DNA in terms of cellular repair index based on the parameters of the DNA following comet assay. Post irradiation administration of some natural and synthetic agents have shown their potential to enhance repair of radiation-induced strand breaks in cellular DNA in mice. These include phytoceuticals such as gallic acid, sesamol etc., extracts of medicinal plants such as Andrographis panniculata, and a few synthetic compounds such as tocopherol-mono-glucoside. The talk will give an overview of the work on DNA repair enhancement by a few natural and synthetic agents. (author)

  10. Lack of dependence on p53 for DNA double strand break repair of episomal vectors in human lymphoblasts

    Science.gov (United States)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.

  11. Microhomology-mediated end joining is the principal mediator of double-strand break repair during mitochondrial DNA lesions

    OpenAIRE

    Tadi, Satish Kumar; Sebastian, Robin; Dahal, Sumedha; Babu, Ravi K.; Choudhary, Bibha; Raghavan, Sathees C.

    2016-01-01

    Mitochondrial DNA (mtDNA) deletions are associated with various mitochondrial disorders. The deletions identified in humans are flanked by short, directly repeated mitochondrial DNA sequences; however, the mechanism of such DNA rearrangements has yet to be elucidated. In contrast to nuclear DNA (nDNA), mtDNA is more exposed to oxidative damage, which may result in double-strand breaks (DSBs). Although DSB repair in nDNA is well studied, repair mechanisms in mitochondria are not characterized....

  12. Repair of DNA double-strand breaks in Escherichia coli cells requires synthesis of proteins that can be induced by UV light

    International Nuclear Information System (INIS)

    The repair of DNA double-strand breaks in Escherichia coli cells irradiated with γ rays occurs only after new proteins are synthesized in response to damage introduced in the genome DNA. One protein whose synthesis is thus induced is the recA protein, and previous work has shown that recA- cells do not repair double-strand breaks. However, inducing recA protein by treating cells with nalidixic acid does not induce repair of double-strand breaks, so this repair requires more than the presence of the recA protein. When repair of double-strand breaks is blocked, the genome DNA is degraded by an endonuclease-like action. Evidence is presented to show that the inducible inhibition of DNA degradation after x-irradiation [Pollard, E.C. and Randall, E.P. (1973) Radiat. Res. 55, 265] is probably caused by the inducible repair of DNA double-strand breaks

  13. Roles of Nucleoid-Associated Proteins in Stress-Induced Mutagenic Break Repair in Starving Escherichia coli.

    Science.gov (United States)

    Moore, Jessica M; Magnan, David; Mojica, Ana K; Núñez, María Angélica Bravo; Bates, David; Rosenberg, Susan M; Hastings, P J

    2015-12-01

    The mutagenicity of DNA double-strand break repair in Escherichia coli is controlled by DNA-damage (SOS) and general (RpoS) stress responses, which let error-prone DNA polymerases participate, potentially accelerating evolution during stress. Either base substitutions and indels or genome rearrangements result. Here we discovered that most small basic proteins that compact the genome, nucleoid-associated proteins (NAPs), promote or inhibit mutagenic break repair (MBR) via different routes. Of 15 NAPs, H-NS, Fis, CspE, and CbpA were required for MBR; Dps inhibited MBR; StpA and Hha did neither; and five others were characterized previously. Three essential genes were not tested. Using multiple tests, we found the following: First, Dps, which reduces reactive oxygen species (ROS), inhibited MBR, implicating ROS in MBR. Second, CbpA promoted F' plasmid maintenance, allowing MBR to be measured in an F'-based assay. Third, Fis was required for activation of the SOS DNA-damage response and could be substituted in MBR by SOS-induced levels of DinB error-prone DNA polymerase. Thus, Fis promoted MBR by allowing SOS activation. Fourth, H-NS represses ROS detoxifier sodB and was substituted in MBR by deletion of sodB, which was not otherwise mutagenic. We conclude that normal ROS levels promote MBR and that H-NS promotes MBR by maintaining ROS. CspE positively regulates RpoS, which is required for MBR. Four of five previously characterized NAPs promoted stress responses that enhance MBR. Hence, most NAPs affect MBR, the majority via regulatory functions. The data show that a total of six NAPs promote MBR by regulating stress responses, indicating the importance of nucleoid structure and function to the regulation of MBR and of coupling mutagenesis to stress, creating genetic diversity responsively. PMID:26500258

  14. DNA double strand break repair enzymes function at multiple steps in retroviral infection

    Directory of Open Access Journals (Sweden)

    Agematsu Kazunaga

    2009-12-01

    Full Text Available Abstract Background DNA double strand break (DSB repair enzymes are thought to be necessary for retroviral infection, especially for the post-integration repair and circularization of viral cDNA. However, the detailed roles of DSB repair enzymes in retroviral infection remain to be elucidated. Results A GFP reporter assay showed that the infectivity of an HIV-based vector decreased in ATM- and DNA-PKcs-deficient cells when compared with their complemented cells, while that of an MLV-based vector was diminished in Mre11- and DNA-PKcs-deficient cells. By using a method based on inverse- and Alu-PCR, we analyzed sequences around 3' HIV-1 integration sites in ATM-, Mre11- and NBS1- deficient cells. Increased abnormal junctions between the HIV-1 provirus and the host DNA were found in these mutant cell lines compared to the complemented cell lines and control MRC5SV cells. The abnormal junctions contained two types of insertions: 1 GT dinucleotides, which are normally removed by integrase during integration, and 2 inserted nucleotides of unknown origin. Artemis-deficient cells also showed such abnormalities. In Mre11-deficient cells, part of a primer binding site sequence was also detected. The 5' host-virus junctions in the mutant cells also contained these types of abnormal nucleotides. Moreover, the host-virus junctions of the MLV provirus showed similar abnormalities. These findings suggest that DSB repair enzymes play roles in the 3'-processing reaction and protection of the ends of viral DNA after reverse transcription. We also identified both 5' and 3' junctional sequences of the same provirus by inverse PCR and found that only the 3' junctions were abnormal with aberrant short repeats, indicating that the integration step was partially impaired in these cells. Furthermore, the conserved base preferences around HIV-1 integration sites were partially altered in ATM-deficient cells. Conclusions These results suggest that DSB repair enzymes are

  15. Analysis of gene repair tracts from Cas9/gRNA double-stranded breaks in the human CFTR gene.

    Science.gov (United States)

    Hollywood, Jennifer A; Lee, Ciaran M; Scallan, Martina F; Harrison, Patrick T

    2016-01-01

    To maximise the efficiency of template-dependent gene editing, most studies describe programmable and/or RNA-guided endonucleases that make a double-stranded break at, or close to, the target sequence to be modified. The rationale for this design strategy is that most gene repair tracts will be very short. Here, we describe a CRISPR Cas9/gRNA selection-free strategy which uses deep sequencing to characterise repair tracts from a donor plasmid containing seven nucleotide differences across a 216 bp target region in the human CFTR gene. We found that 90% of the template-dependent repair tracts were >100 bp in length with equal numbers of uni-directional and bi-directional repair tracts. The occurrence of long repair tracts suggests that a single gRNA could be used with variants of the same template to create or correct specific mutations within a 200 bp range, the size of ~80% of human exons. The selection-free strategy used here also allowed detection of non-homologous end joining events in many of the homology-directed repair tracts. This indicates a need to modify the donor, possibly by silent changes in the PAM sequence, to prevent creation of a second double-stranded break in an allele that has already been correctly edited by homology-directed repair. PMID:27557525

  16. DNA repair activity in fish and interest in ecotoxicology: a review.

    Science.gov (United States)

    Kienzler, Aude; Bony, Sylvie; Devaux, Alain

    2013-06-15

    The knowledge of DNA repair in a target species is of first importance as it is the primary line of defense against genotoxicants, and a better knowledge of DNA repair capacity in fish could help to interpret genotoxicity data and/or assist in the choice of target species, developmental stage and tissues to focus on, both for environmental biomonitoring studies and DNA repair testing. This review focuses in a first part on what is presently known on a mechanistic basis, about the various DNA repair systems in fish, in vivo and in established cell lines. Data on base excision repair (BER), direct reversal with O⁶-alkylguanine transferase and double strand breaks repair, although rather scarce, are being reviewed, as well as nucleotide excision repair (NER) and photoreactivation repair (PER), which are by far the most studied repair mechanisms in fish. Most of these repair mechanisms seem to be strongly species and tissue dependent; they also depend on the developmental stage of the organisms. BER is efficient in vivo, although no data has been found on in vitro models. NER activity is quite low or even inexistent depending on the studies; however this lack is partly compensated by a strong PER activity, especially in early developmental stage. In a second part, a survey of the ecotoxicological studies integrating DNA repair as a parameter responding to single or mixture of contaminant is realized. Three main approaches are being used: the measurement of DNA repair gene expression after exposure, although it has not yet been clearly established whether gene expression is indicative of repair capacity; the monitoring of DNA damage removal by following DNA repair kinetics; and the modulation of DNA repair activity following exposure in situ, in order to assess the impact of exposure history on DNA repair capacity. Since all DNA repair processes are possible targets for environmental pollutants, we can also wonder at which extent such a modulation of repair capacities

  17. Rtt107 phosphorylation promotes localisation to DNA double-stranded breaks (DSBs and recombinational repair between sister chromatids.

    Directory of Open Access Journals (Sweden)

    Pranav Ullal

    Full Text Available Efficient repair of DNA double-stranded breaks (DSB requires a coordinated response at the site of lesion. Nucleolytic resection commits repair towards homologous recombination, which preferentially occurs between sister chromatids. DSB resection promotes recruitment of the Mec1 checkpoint kinase to the break. Rtt107 is a target of Mec1 and serves as a scaffold during repair. Rtt107 plays an important role during rescue of damaged replication forks, however whether Rtt107 contributes to the repair of DSBs is unknown. Here we show that Rtt107 is recruited to DSBs induced by the HO endonuclease. Rtt107 phosphorylation by Mec1 and its interaction with the Smc5-Smc6 complex are both required for Rtt107 loading to breaks, while Rtt107 regulators Slx4 and Rtt101 are not. We demonstrate that Rtt107 has an effect on the efficiency of sister chromatid recombination (SCR and propose that its recruitment to DSBs, together with the Smc5-Smc6 complex is important for repair through the SCR pathway.

  18. Poly(ADP-Ribose) Polymerase-1 and DNA-Dependent Protein Kinase Have Equivalent Roles in Double Strand Break Repair Following Ionizing Radiation

    International Nuclear Information System (INIS)

    Purpose: Radiation-induced DNA double strand breaks (DSBs) are predominantly repaired by nonhomologous end joining (NHEJ), involving DNA-dependent protein kinase (DNA-PK). Poly(ADP-ribose) polymerase-1 (PARP-1), well characterized for its role in single strand break repair, may also facilitate DSB repair. We investigated the activation of these enzymes by differing DNA ends and their interaction in the cellular response to ionizing radiation (IR). Methods and Materials: The effect of PARP and DNA-PK inhibitors (KU-0058684 and NU7441) on repair of IR-induced DSBs was investigated in DNA-PK and PARP-1 proficient and deficient cells by measuring γH2AX foci and neutral comets. Complementary in vitro enzyme kinetics assays demonstrated the affinities of DNA-PK and PARP-1 for DSBs with varying DNA termini. Results: DNA-PK and PARP-1 both promoted the fast phase of resolution of IR-induced DSBs in cells. Inactivation of both enzymes was not additive, suggesting that PARP-1 and DNA-PK cooperate within the same pathway to promote DSB repair. The affinities of the two enzymes for oligonucleotides with blunt, 3' GGG or 5' GGG overhanging termini were similar and overlapping (Kdapp = 2.6-6.4nM for DNA-PK; 1.7-4.5nM for PARP-1). DNA-PK showed a slightly greater affinity for overhanging DNA and was significantly more efficient when activated by a 5' GGG overhang. PARP-1 had a preference for blunt-ended DNA and required a separate factor for efficient stimulation by a 5' GGG overhang. Conclusion: DNA-PK and PARP-1 are both required in a pathway facilitating the fast phase of DNA DSB repair.

  19. "Old Dead Guys": Using Activity Breaks to Teach History

    Science.gov (United States)

    Holles, Joseph H.

    2009-01-01

    The people and history of chemical engineering surround us: Gibbs free energy, Arrhenius Equation, and Reynolds number. Since these seminal figures appear in almost every classroom lecture, they provide an opportunity for a historically focused activity break. Each activity break provides the students with an image of the historical figure along…

  20. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  1. Recombinational repair of radiation-induced double-strand breaks occurs in the absence of extensive resection

    Science.gov (United States)

    Westmoreland, James W.; Resnick, Michael A.

    2016-01-01

    Recombinational repair provides accurate chromosomal restitution after double-strand break (DSB) induction. While all DSB recombination repair models include 5′-3′ resection, there are no studies that directly assess the resection needed for repair between sister chromatids in G-2 arrested cells of random, radiation-induced ‘dirty’ DSBs. Using our Pulse Field Gel Electrophoresis-shift approach, we determined resection at IR-DSBs in WT and mutants lacking exonuclease1 or Sgs1 helicase. Lack of either reduced resection length by half, without decreased DSB repair or survival. In the exo1Δ sgs1Δ double mutant, resection was barely detectable, yet it only took an additional hour to achieve a level of repair comparable to WT and there was only a 2-fold dose-modifying effect on survival. Results with a Dnl4 deletion strain showed that remaining repair was not due to endjoining. Thus, similar to what has been shown for a single, clean HO-induced DSB, a severe reduction in resection tract length has only a modest effect on repair of multiple, dirty DSBs in G2-arrested cells. Significantly, this study provides the first opportunity to directly relate resection length at DSBs to the capability for global recombination repair between sister chromatids. PMID:26503252

  2. DNA single-strand breaks, double-strand breaks, and crosslinks in rat testicular germ cells: Measurements of their formation and repair by alkaline and neutral filter elution

    International Nuclear Information System (INIS)

    This work describes a neutral and alkaline elution method for measuring DNA single-strand breaks (SSBs), DNA double-strand breaks (DSBs), and DNA-DNA crosslinks in rat testicular germ cells after treatments in vivo or in vitro with both chemical mutagens and gamma-irradiation. The methods depend upon the isolation of testicular germ cells by collagenase and trypsin digestion, followed by filtration and centrifugation. 137Cs irradiation induced both DNA SSBs and DSBs in germ cells held on ice in vitro. Irradiation of the whole animal indicated that both types of DNA breaks are induced in vivo and can be repaired. A number of germ cell mutagens induced either DNA SSBs, DSBs, or cross-links after in vivo and in vitro dosing. These chemicals included methyl methanesulfonate, ethyl methanesulfonate, ethyl nitrosourea, dibromochlorpropane, ethylene dibromide, triethylene melamine, and mitomycin C. These results suggest that the blood-testes barrier is relatively ineffective for these mutagens, which may explain in part their in vivo mutagenic potency. This assay should be a useful screen for detecting chemical attack upon male germ-cell DNA and thus, it should help in the assessment of the mutagenic risk of chemicals. In addition, this approach can be used to study the processes of SSB, DSB, and crosslink repair in DNA of male germ cells, either from all stages or specific stages of development

  3. Ago2 facilitates Rad51 recruitment and DNA double-strand break repair by homologous recombination

    DEFF Research Database (Denmark)

    Gao, Min; Wei, Wei; Li, Ming Hua;

    2014-01-01

    (Ago) proteins and play an important role in DSB repair, though the mechanism through which they act remains unclear. Here, we report that the role of diRNAs in DSB repair is restricted to repair by homologous recombination (HR) and that it specifically relies on the effector protein Ago2 in mammalian...... to facilitate repair by HR....

  4. Approach to the classical radiation biology. Ionizing radiation effects and repair mechanism of DNA double strand breaks

    International Nuclear Information System (INIS)

    Split-dose recovery has been observed under a variety of experimental conditions in many cell systems and believed to be the recovery of sublethal damage (SLD). It is considered to be one of the most widespread and important cellular responses in clinical radiotherapy. To study the molecular mechanism of this recovery, we analyzed the knockout mutants KU70-/-, RAD54-/-, and KU70-/-/ RAD54-/- of the chicken B-cell line, DT40. Rad54 participates in the homologous recombinational (HR) repair of DNA double-strand breaks (DSB), while Ku proteins are involved in non-homologous end-joining (NHEJ). Split-dose recovery was observed in the parent DT40 and KU70-/- cells. Moreover the split-dose survival enhancement had all of the characteristics of SLD recovery that had been demonstrated earlier: e.g., the reappearance of the shoulder of the survival curve with dose fractionation; repair at 25degC; and inhibition by the antibiotic actinomycin D. These results strongly suggest that SLD recovery is due to DSB repair via or mediated by HR, and that these breaks constitute SLD. The tonicity-sensitive potentially lethal damage (PLD) recovery was also found only in DT40 and KU70 -/- cells. Delayed-plating PLD recovery may be controlled by NHEJ repair that works through the cell cycle. These results lead to the conclusion that the repair of DSBs could explain the classical operational recovery phenomena. We have also investigated RBE/LET using those mutants. (author)

  5. Human transcriptional coactivator PC4 stimulates DNA end joining and activates DSB repair activity.

    Science.gov (United States)

    Batta, Kiran; Yokokawa, Masatoshi; Takeyasu, Kunio; Kundu, Tapas K

    2009-01-23

    Human transcriptional coactivator PC4 is a highly abundant nuclear protein that is involved in diverse cellular processes ranging from transcription to chromatin organization. Earlier, we have shown that PC4, a positive activator of p53, overexpresses upon genotoxic insult in a p53-dependent manner. In the present study, we show that PC4 stimulates ligase-mediated DNA end joining irrespective of the source of DNA ligase. Pull-down assays reveal that PC4 helps in the association of DNA ends through its C-terminal domain. In vitro nonhomologous end-joining assays with cell-free extracts show that PC4 enhances the joining of noncomplementary DNA ends. Interestingly, we found that PC4 activates double-strand break (DSB) repair activity through stimulation of DSB rejoining in vivo. Together, these findings demonstrate PC4 as an activator of nonhomologous end joining and DSB repair activity.

  6. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    Science.gov (United States)

    Leem, S H; Ropp, P A; Sugino, A

    1994-08-11

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

  7. DNA Double Strand Break Repair and its Association with Inherited Predispositions to Breast Cancer

    Directory of Open Access Journals (Sweden)

    Scott Rodney J

    2004-02-01

    Full Text Available Abstract Mutations in BRCA1 account for the majority of familial aggregations of early onset breast and ovarian cancer (~70% and about 1/5 of all early onset breast cancer families; in contrast, mutations in BRCA2 account for a smaller proportion of breast/ovarian cancer families and a similar proportion of early onset breast cancer families. BRCA2 has also been shown to be associated with a much more pleiotropic disease spectrum compared to BRCA1. Since the identification of both BRCA1 and BRCA2 investigations into the functions of these genes have revealed that both are associated with the maintenance of genomic integrity via their apparent roles in cellular response to DNA damage, especially their involvement in the process of double strand DNA break repair. This review will focus on the specific roles of both genes and how functional differences may account for the diverse clinical findings observed between families that harbour BRCA1 or BRCA2 mutations.

  8. Detection and Repair of Ionizing Radiation-Induced DNA Double Strand Breaks: New Developments in Nonhomologous End Joining

    International Nuclear Information System (INIS)

    DNA damage can occur as a result of endogenous metabolic reactions and replication stress or from exogenous sources such as radiation therapy and chemotherapy. DNA double strand breaks are the most cytotoxic form of DNA damage, and defects in their repair can result in genome instability, a hallmark of cancer. The major pathway for the repair of ionizing radiation-induced DSBs in human cells is nonhomologous end joining. Here we review recent advances on the mechanism of nonhomologous end joining, as well as new findings on its component proteins and regulation

  9. In Vitro Expansion of Bone Marrow Derived Mesenchymal Stem Cells Alters DNA Double Strand Break Repair of Etoposide Induced DNA Damage

    Directory of Open Access Journals (Sweden)

    Ian Hare

    2016-01-01

    Full Text Available Mesenchymal stem cells (MSCs are of interest for use in diverse cellular therapies. Ex vivo expansion of MSCs intended for transplantation must result in generation of cells that maintain fidelity of critical functions. Previous investigations have identified genetic and phenotypic alterations of MSCs with in vitro passage, but little is known regarding how culturing influences the ability of MSCs to repair double strand DNA breaks (DSBs, the most severe of DNA lesions. To investigate the response to DSB stress with passage in vitro, primary human MSCs were exposed to etoposide (VP16 at various passages with subsequent evaluation of cellular damage responses and DNA repair. Passage number did not affect susceptibility to VP16 or the incidence and repair kinetics of DSBs. Nonhomologous end joining (NHEJ transcripts showed little alteration with VP16 exposure or passage; however, homologous recombination (HR transcripts were reduced following VP16 exposure with this decrease amplified as MSCs were passaged in vitro. Functional evaluations of NHEJ and HR showed that MSCs were unable to activate NHEJ repair following VP16 stress in cells after successive passage. These results indicate that ex vivo expansion of MSCs alters their ability to perform DSB repair, a necessary function for cells intended for transplantation.

  10. Development of Novel Visual-Plus Quantitative Analysis Systems for Studying DNA Double-Strand Break Repairs in Zebrafish

    Institute of Scientific and Technical Information of China (English)

    Jingang Liu; Lu Gong; Changqing Chang; Cong Liu; Jinrong Peng; Jun Chen

    2012-01-01

    The use of reporter systems to analyze DNA double-strand break (DSB) repairs,based on the enhanced green fluorescent protein (EGFP) and meganuclease such as I-Sce Ⅰ,is usually carried out with cell lines.In this study,we developed three visual-plus quantitative assay systems for homologous recombination (HR),non-homologous end joining (NHEJ) and single-strand annealing (SSA) DSB repair pathways at the organismal level in zebrafish embryos.To initiate DNA DSB repair,we used two I-Sce Ⅰ recognition sites in opposite orientation rather than the usual single site.The NHEJ,HR and SSA repair pathways were separately triggered by the injection of three corresponding I-Sce I-cut constructions,and the repair of DNA lesion caused by I-Sce Ⅰ could be tracked by EGFP expression in the embryos.Apart from monitoring the intensity of green fluorescence,the repair frequencies could also be precisely measured by quantitative real-time polymerase chain reaction (qPCR).Analysis of DNA sequences at the DSB sites showed that NHEJ was predominant among these three repair pathways in zebrafish embryos.Furthermore,while HR and SSA reporter systems could be effectively decreased by the knockdown of rad51 and rad52,respectively,NHEJ could only be impaired by the knockdown of ligaseⅣ (lig4) when the NHEJ construct was cut by I-Sce Ⅰ in vivo.More interestingly,blocking NHEJ with lig4-MO increased the frequency of HR,but decreased the frequency of SSA.Our studies demonstrate that the major mechanisms used to repair DNA DSBs are conserved from zebrafish to mammal,and zebrafish provides an excellent model for studying and manipulating DNA DSB repair at the organismal level.

  11. Active and break spells of the Indian summer monsoon

    Indian Academy of Sciences (India)

    M Rajeevan; Sulochana Gadgil; Jyoti Bhate

    2010-06-01

    In this paper, we suggest criteria for the identification of active and break events of the Indian summer monsoon on the basis of recently derived high resolution daily gridded rainfall dataset over India (1951–2007). Active and break events are defined as periods during the peak monsoon months of July and August, in which the normalized anomaly of the rainfall over a critical area, called the monsoon core zone exceeds 1 or is less than −1.0 respectively, provided the criterion is satisfied for at least three consecutive days. We elucidate the major features of these events. We consider very briefly the relationship of the intraseasonal fluctuations between these events and the interannual variation of the summer monsoon rainfall. We find that breaks tend to have a longer life-span than active spells. While, almost 80% of the active spells lasted 3–4 days, only 40% of the break spells were of such short duration. A small fraction (9%) of active spells and 32% of break spells lasted for a week or longer. While active events occurred almost every year, not a single break occurred in 26% of the years considered. On an average, there are 7 days of active and break events from July through August. There are no significant trends in either the days of active or break events. We have shown that there is a major difference between weak spells and long intense breaks. While weak spells are characterized by weak moist convective regimes, long intense break events have a heat trough type circulation which is similar to the circulation over the Indian subcontinent before the onset of the monsoon. The space-time evolution of the rainfall composite patterns suggests that the revival from breaks occurs primarily from northward propagations of the convective cloud zone. There are important differences between the spatial patterns of the active/break spells and those characteristic of interannual variation, particularly those associated with the link to ENSO. Hence, the

  12. Role of XRCC4 phosphorylation by DNA-PK in the regulation of NHEJ repair pathway of DNA double strand break

    International Nuclear Information System (INIS)

    Non-homologous end-joining (NHEJ) is the predominant pathway of DNA double strand breaks in higher eukaryotes and is active throughout the cell cycle. NHEJ repair includes many factors as Ku70/86, DNA-PKcs, XRCC4-Ligase IV complex and XLF (also known as Cernunnos). In these factors, DNA-PKcs acts as central regulator in NHEJ repair. It recruited at the DNA damages site after DNA damage and after association with Ku its kinase activity is activated. It phosphorylates many of important NHEJ proteins in vitro including XRCC4, Ku 70/86, Artemis, and even DNA-PKcs but till now, very less studies have been done to know the role and significance of phosphorylation in the NHEJ repair. Studies by other researchers identified various phosphorylation sites in XRCC4 by DNA-PK using mass spectrometry but these phosphorylation sites were shown to be dispensable for DSB repair. In the present investigation, we identified 3 serine and one new threonine phosphorylation sites in XRCC4 protein by DNA-PK. In vivo phosphorylation at these sites was verified by generating phosphorylation specific antibodies and the requirement for DNA-PK therein was verified by using DNA-PK inhibitor and DNA-PK proficient and deficient cell lines in response to radiation and zeocin treatment. We have also found that phosphorylation at these sites showed dose dependency in response to radiation treatment. The two serine and one threonine phosphorylation site is also biological important as their mutation into alanine significantly elevated radiosensitivity as measured by colony formation assay. Neutral comet assay showed delayed kinetics in DSB repair of these mutants. Furthermore, we have found a protein, with putative DSB repair function, which interacts with domain including the phosphorylation sites.These results indicate that these phosphorylation sites would mediate functional link between XRCC4 and DNA-PK. (author)

  13. More efficient repair of DNA double-strand breaks in skeletal muscle stem cells compared to their committed progeny

    Directory of Open Access Journals (Sweden)

    Leyla Vahidi Ferdousi

    2014-11-01

    Full Text Available The loss of genome integrity in adult stem cells results in accelerated tissue aging and is possibly cancerogenic. Adult stem cells in different tissues appear to react robustly to DNA damage. We report that adult skeletal stem (satellite cells do not primarily respond to radiation-induced DNA double-strand breaks (DSBs via differentiation and exhibit less apoptosis compared to other myogenic cells. Satellite cells repair these DNA lesions more efficiently than their committed progeny. Importantly, non-proliferating satellite cells and post-mitotic nuclei in the fiber exhibit dramatically distinct repair efficiencies. Altogether, reduction of the repair capacity appears to be more a function of differentiation than of the proliferation status of the muscle cell. Notably, satellite cells retain a high efficiency of DSB repair also when isolated from the natural niche. Finally, we show that repair of DSB substrates is not only very efficient but, surprisingly, also very accurate in satellite cells and that accurate repair depends on the key non-homologous end-joining factor DNA-PKcs.

  14. Single-stranded DNA oligomers stimulate error-prone alternative repair of DNA double-strand breaks through hijacking Ku protein.

    Science.gov (United States)

    Yuan, Ying; Britton, Sébastien; Delteil, Christine; Coates, Julia; Jackson, Stephen P; Barboule, Nadia; Frit, Philippe; Calsou, Patrick

    2015-12-01

    In humans, DNA double-strand breaks (DSBs) are repaired by two mutually-exclusive mechanisms, homologous recombination or end-joining. Among end-joining mechanisms, the main process is classical non-homologous end-joining (C-NHEJ) which relies on Ku binding to DNA ends and DNA Ligase IV (Lig4)-mediated ligation. Mostly under Ku- or Lig4-defective conditions, an alternative end-joining process (A-EJ) can operate and exhibits a trend toward microhomology usage at the break junction. Homologous recombination relies on an initial MRN-dependent nucleolytic degradation of one strand at DNA ends. This process, named DNA resection generates 3' single-stranded tails necessary for homologous pairing with the sister chromatid. While it is believed from the current literature that the balance between joining and recombination processes at DSBs ends is mainly dependent on the initiation of resection, it has also been shown that MRN activity can generate short single-stranded DNA oligonucleotides (ssO) that may also be implicated in repair regulation. Here, we evaluate the effect of ssO on end-joining at DSB sites both in vitro and in cells. We report that under both conditions, ssO inhibit C-NHEJ through binding to Ku and favor repair by the Lig4-independent microhomology-mediated A-EJ process. PMID:26350212

  15. DNA double-strand break repair: a theoretical framework and its application.

    Science.gov (United States)

    Murray, Philip J; Cornelissen, Bart; Vallis, Katherine A; Chapman, S Jon

    2016-01-01

    DNA double-strand breaks (DSBs) are formed as a result of genotoxic insults, such as exogenous ionizing radiation, and are among the most serious types of DNA damage. One of the earliest molecular responses following DSB formation is the phosphorylation of the histone H2AX, giving rise to γH2AX. Many copies of γH2AX are generated at DSBs and can be detected in vitro as foci using well-established immuno-histochemical methods. It has previously been shown that anti-γH2AX antibodies, modified by the addition of the cell-penetrating peptide TAT and a fluorescent or radionuclide label, can be used to visualize and quantify DSBs in vivo. Moreover, when labelled with a high amount of the short-range, Auger electron-emitting radioisotope, (111)In, the amount of DNA damage within a cell can be increased, leading to cell death. In this report, we develop a mathematical model that describes how molecular processes at individual sites of DNA damage give rise to quantifiable foci. Equations that describe stochastic mean behaviours at individual DSB sites are derived and parametrized using population-scale, time-series measurements from two different cancer cell lines. The model is used to examine two case studies in which the introduction of an antibody (anti-γH2AX-TAT) that targets a key component in the DSB repair pathway influences system behaviour. We investigate: (i) how the interaction between anti-γH2AX-TAT and γH2AX effects the kinetics of H2AX phosphorylation and DSB repair and (ii) model behaviour when the anti-γH2AX antibody is labelled with Auger electron-emitting (111)In and can thus instigate additional DNA damage. This work supports the conclusion that DSB kinetics are largely unaffected by the introduction of the anti-γH2AX antibody, a result that has been validated experimentally, and hence the hypothesis that the use of anti-γH2AX antibody to quantify DSBs does not violate the image tracer principle. Moreover, it provides a novel model of DNA damage

  16. A synopsis of experimental activities on small-break LOCA

    International Nuclear Information System (INIS)

    Through reactor safety studies like WASH 1400 or the ''Deutsche Risiko-Studie'' the attention has turned from large break loss of coolant accidents to small breaks because of the high contribution of this type of accidents to core meltdown. But only after the TMI-2 accident were also the main activities in the experimental fields shifted world-wide to the small break LOCAs. Since TMI numerous research programs have either been finished or are underway. This review paper presents: a classification of the various types of transients according to break size; a discussion of major physical phenomena associated with a small break LOCA, and a description of a few selected research programs and the most important results achieved. (author)

  17. Detection of DNA single-strand breaks during the repair of UV damage in xeroderma pigmentosum cells

    International Nuclear Information System (INIS)

    In this investigation, xeroderma pigmentosum (XP) fibroblasts, XP12BE, were uv-irradiated and then incubated with cytosine arabinoside and hydroxyurea for 4 hr to inhibit the polymerase step of DNA excision repair. By alkaline elution, DNA single-strand breaks (SSB) were detected in XP cells with this regimen with an efficiency of 0.1-0.2 SSB per 109 daltons of DNA per J m-2. There was an approximately linear relation between the SSB frequency and uv dose over a range of 0.2 to 25 J m-2. This effect was approximately two orders of magnitude greater in excision-proficient normal human fibroblasts than in XP cells. These results support the conclusion that a low residual level of DNA excision repair occurs in XP group A cells and that the SSB generated during this repair can be accumulated with this polymerase inhibitor

  18. A new powerful method for site-specific transgene stabilization based on chromosomal double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Artem Tkachuk

    Full Text Available Transgenic insects are a promising tool in sterile insect techniques and population replacement strategies. Such transgenic insects can be created using nonautonomous transposons, which cannot be transferred without a transposase source. In biocontrol procedures where large numbers of insects are released, there is increased risk of transgene remobilization caused by external transposase sources that can alter the characteristics of the transgenic organisms lead horizontal transgene transfer to other species. Here we describe a novel, effective method for transgene stabilization based on the introduction of directed double-strand breaks (DSB into a genome-integrated sequence and their subsequent repair by the single-strand annealing (SSA pathway. Due to the construct's organization, the repair pathway is predictable, such that all transposon and marker sequences can be deleted, while preserving integration of exogenous DNA in the genome. The exceptional conservation of DNA repair pathways makes this method suitable for a broad range of organisms.

  19. A New Powerful Method for Site-Specific Transgene Stabilization Based on Chromosomal Double-Strand Break Repair

    Science.gov (United States)

    Kravchuk, Oksana; Savitsky, Mikhail

    2011-01-01

    Transgenic insects are a promising tool in sterile insect techniques and population replacement strategies. Such transgenic insects can be created using nonautonomous transposons, which cannot be transferred without a transposase source. In biocontrol procedures where large numbers of insects are released, there is increased risk of transgene remobilization caused by external transposase sources that can alter the characteristics of the transgenic organisms lead horizontal transgene transfer to other species. Here we describe a novel, effective method for transgene stabilization based on the introduction of directed double-strand breaks (DSB) into a genome-integrated sequence and their subsequent repair by the single-strand annealing (SSA) pathway. Due to the construct's organization, the repair pathway is predictable, such that all transposon and marker sequences can be deleted, while preserving integration of exogenous DNA in the genome. The exceptional conservation of DNA repair pathways makes this method suitable for a broad range of organisms. PMID:22022613

  20. Sibling rivalry: competition between Pol X family members in V(D)J recombination and general double strand break repair.

    Science.gov (United States)

    Nick McElhinny, Stephanie A; Ramsden, Dale A

    2004-08-01

    The nonhomologous end-joining pathway is a major means for repairing double-strand breaks (DSBs) in all mitotic cell types. This repair pathway is also the only efficient means for resolving DSB intermediates in V(D)J recombination, a lymphocyte-specific genome rearrangement required for assembly of antigen receptors. A role for polymerases in end-joining has been well established. They are a major factor in determining the character of repair junctions but, in contrast to 'core' end-joining factors, typically appear to have a subtle impact on the efficiency of end-joining. Recent work implicates several members of the Pol X family in end-joining and suggests surprising complexity in the control of how these different polymerases are employed in this pathway. PMID:15242403

  1. Contribution of DNA double-strand break repair gene XRCC3 genotypes to oral cancer susceptibility in Taiwan.

    Science.gov (United States)

    Tsai, Chia-Wen; Chang, Wen-Shin; Liu, Juhn-Cherng; Tsai, Ming-Hsui; Lin, Cheng-Chieh; Bau, Da-Tian

    2014-06-01

    The DNA repair gene X-ray repair cross complementing protein 3 (XRCC3) is thought to play a major role in double-strand break repair and in maintaining genomic stability. Very possibly, defective double-strand break repair of cells can lead to carcinogenesis. Therefore, a case-control study was performed to reveal the contribution of XRCC3 genotypes to individual oral cancer susceptibility. In this hospital-based research, the association of XRCC3 rs1799794, rs45603942, rs861530, rs3212057, rs1799796, rs861539, rs28903081 genotypes with oral cancer risk in a Taiwanese population was investigated. In total, 788 patients with oral cancer and 956 age- and gender-matched healthy controls were genotyped. The results showed that there was significant differential distribution among oral cancer and controls in the genotypic (p=0.001428) and allelic (p=0.0013) frequencies of XRCC3 rs861539. As for the other polymorphisms, there was no difference between case and control groups. In gene-lifestyle interaction analysis, we have provided the first evidence showing that there is an obvious joint effect of XRCC3 rs861539 genotype with individual areca chewing habits on oral cancer risk. In conclusion, the T allele of XRCC3 rs861539, which has an interaction with areca chewing habit in oral carcinogenesis, may be an early marker for oral cancer in Taiwanese.

  2. An alternative mechanism for radioprotection by dimethyl sulfoxide. Possible facilitation of DNA double-strand break repair

    International Nuclear Information System (INIS)

    The radioprotective effects of dimethyl sulfoxide (DMSO) have been known for many years, and the suppression of hydroxyl (OH) radicals induced by ionizing radiation has been thought to be the main cause of this effect. However, the DMSO concentration used was very high, and might be toxic, in earlier studies. In the present study, we administered a lower, non-toxic concentration (0.5%, id est (i.e.), 64 mM) of DMSO before irradiation and examined its radioprotective effects. Colony formation assay and micronucleus assay showed significant radioprotective effects in Chinese hamster ovary (CHO), but not in xrs5, which is defective in the repair function of DNA double-strand breaks. The levels of phosphorylated H2AX and the formation of 53BP1 foci 15 minutes after irradiation, which might reflect initial DNA double-strand breaks, in DMSO-treated CHO cells were similar to those in non-treated cells, suggesting that the radioprotective effects were not attributable to the suppression of general indirect action in the lower concentration of DMSO. On the other hand, 2 hours after irradiation, the average number of 53BP1 foci, which might reflect residual DNA double-strand breaks, was significantly decreased in DMSO-treated CHO cells compared to non-treated cells. The results indicated that low concentration of DMSO exerts radioprotective effects through the facilitation of DNA double-strand break repair rather than through the suppression of indirect action. (author)

  3. Nonhomologous end joining of complex DNA double-strand breaks with proximal thymine glycol and interplay with base excision repair.

    Science.gov (United States)

    Almohaini, Mohammed; Chalasani, Sri Lakshmi; Bafail, Duaa; Akopiants, Konstantin; Zhou, Tong; Yannone, Steven M; Ramsden, Dale A; Hartman, Matthew C T; Povirk, Lawrence F

    2016-05-01

    DNA double-strand breaks induced by ionizing radiation are often accompanied by ancillary oxidative base damage that may prevent or delay their repair. In order to better define the features that make some DSBs repair-resistant, XLF-dependent nonhomologous end joining of blunt-ended DSB substrates having the oxidatively modified nonplanar base thymine glycol at the first (Tg1), second (Tg2), third (Tg3) or fifth (Tg5) positions from one 3' terminus, was examined in human whole-cell extracts. Tg at the third position had little effect on end-joining even when present on both ends of the break. However, Tg as the terminal or penultimate base was a major barrier to end joining (>10-fold reduction in ligated products) and an absolute barrier when present at both ends. Dideoxy trapping of base excision repair intermediates indicated that Tg was excised from Tg1, Tg2 and Tg3 largely if not exclusively after DSB ligation. However, Tg was rapidly excised from the Tg5 substrate, resulting in a reduced level of DSB ligation, as well as slow concomitant resection of the opposite strand. Ligase reactions containing only purified Ku, XRCC4, ligase IV and XLF showed that ligation of Tg3 and Tg5 was efficient and only partially XLF-dependent, whereas ligation of Tg1 and Tg2 was inefficient and only detectable in the presence of XLF. Overall, the results suggest that promoting ligation of DSBs with proximal base damage may be an important function of XLF, but that Tg can still be a major impediment to repair, being relatively resistant to both trimming and ligation. Moreover, it appears that base excision repair of Tg can sometimes interfere with repair of DSBs that would otherwise be readily rejoined. PMID:27049455

  4. Molecular Process Producing Oncogene Fusion in Lung Cancer Cells by Illegitimate Repair of DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Yoshitaka Seki

    2015-09-01

    Full Text Available Constitutive activation of oncogenes by fusion to partner genes, caused by chromosome translocation and inversion, is a critical genetic event driving lung carcinogenesis. Fusions of the tyrosine kinase genes ALK (anaplastic lymphoma kinase, ROS1 (c-ros oncogene 1, or RET (rearranged during transfection occur in 1%–5% of lung adenocarcinomas (LADCs and their products constitute therapeutic targets for kinase inhibitory drugs. Interestingly, ALK, RET, and ROS1 fusions occur preferentially in LADCs of never- and light-smokers, suggesting that the molecular mechanisms that cause these rearrangements are smoking-independent. In this study, using previously reported next generation LADC genome sequencing data of the breakpoint junction structures of chromosome rearrangements that cause oncogenic fusions in human cancer cells, we employed the structures of breakpoint junctions of ALK, RET, and ROS1 fusions in 41 LADC cases as “traces” to deduce the molecular processes of chromosome rearrangements caused by DNA double-strand breaks (DSBs and illegitimate joining. We found that gene fusion was produced by illegitimate repair of DSBs at unspecified sites in genomic regions of a few kb through DNA synthesis-dependent or -independent end-joining pathways, according to DSB type. This information will assist in the understanding of how oncogene fusions are generated and which etiological factors trigger them.

  5. MEIOTIC F-BOX Is Essential for Male Meiotic DNA Double-Strand Break Repair in Rice[OPEN

    Science.gov (United States)

    Wang, Chong; Yu, Junping; Zong, Jie; Lu, Pingli

    2016-01-01

    F-box proteins constitute a large superfamily in plants and play important roles in controlling many biological processes, but the roles of F-box proteins in male meiosis in plants remain unclear. Here, we identify the rice (Oryza sativa) F-box gene MEIOTIC F-BOX (MOF), which is essential for male meiotic progression. MOF belongs to the FBX subfamily and is predominantly active during leptotene to pachytene of prophase I. mof meiocytes display disrupted telomere bouquet formation, impaired pairing and synapsis of homologous chromosomes, and arrested meiocytes at late prophase I, followed by apoptosis. Although normal, programmed double-stranded DNA breaks (DSBs) form in mof mutants, foci of the phosphorylated histone variant γH2AX, a marker for DSBs, persist in the mutant, indicating that many of the DSBs remained unrepaired. The recruitment of Completion of meiosis I (COM1) and Radiation sensitive51C (RAD51C) to DSBs is severely compromised in mutant meiocytes, indicating that MOF is crucial for DSB end-processing and repair. Further analyses showed that MOF could physically interact with the rice SKP1-like Protein1 (OSK1), indicating that MOF functions as a component of the SCF E3 ligase to regulate meiotic progression in rice. Thus, this study reveals the essential role of an F-box protein in plant meiosis and provides helpful information for elucidating the roles of the ubiquitin proteasome system in plant meiotic progression. PMID:27436711

  6. Dynamics and Mechanism of Efficient DNA Repair Reviewed by Active-Site Mutants

    Science.gov (United States)

    Tan, Chuang; Liu, Zheyun; Li, Jiang; Guo, Xunmin; Wang, Lijuan; Zhong, Dongping

    2010-06-01

    Photolyases repair the UV-induced pyrimidine dimers in damage DNA via a photoreaction which includes a series of light-driven electron transfers between the two-electron-reduced flavin cofactor FADH^- and the dimer. We report here our systematic studies of the repair dynamics in E. coli photolyase with mutation of several active-site residues. With femtosecond resolution, we observed the significant change in the forward electron transfer from the excited FADH^- to the dimer and the back electron transfer from the repaired thymines by mutation of E274A, R226A, R342A, N378S and N378C. We also found that the mutation of E274A accelerates the bond-breaking of the thymine dimer. The dynamics changes are consistent with the quantum yield study of these mutants. These results suggest that the active-site residues play a significant role, structurally and chemically, in the DNA repair photocycle.

  7. Repair of adjacent single-strand breaks is often accompanied by the formation of tandem sequence duplications in plant genomes.

    Science.gov (United States)

    Schiml, Simon; Fauser, Friedrich; Puchta, Holger

    2016-06-28

    Duplication of existing sequences is a major mechanism of genome evolution. It has been previously shown that duplications can occur by replication slippage, unequal sister chromatid exchange, homologous recombination, and aberrant double-strand break-induced synthesis-dependent strand annealing reactions. In a recent study, the abundant presence of short direct repeats was documented by comparative bioinformatics analysis of different rice genomes, and the hypothesis was put forward that such duplications might arise due to the concerted repair of adjacent single-strand breaks (SSBs). Applying the CRISPR/Cas9 technology, we were able to test this hypothesis experimentally in the model plant Arabidopsis thaliana Using a Cas9 nickase to induce adjacent genomic SSBs in different regions of the genome (genic, intergenic, and heterochromatic) and at different distances (∼20, 50, and 100 bps), we analyzed the repair outcomes by deep sequencing. In addition to deletions, we regularly detected the formation of direct repeats close to the break sites, independent of the genomic context. The formation of these duplications as well as deletions may be associated with the presence of microhomologies. Most interestingly, we found that even the induction of two SSBs on the same DNA strand can cause genome alterations, albeit at a much lower level. Because such a scenario reflects a natural step during nucleotide excision repair, and given that the germline is set aside only late during development in plants, the repair of adjacent SSBs indeed seems to have an important influence on the shaping of plant genomes during evolution. PMID:27307441

  8. Histone deacetylase inhibitors decrease NHEJ both by acetylation of repair factors and trapping of PARP1 at DNA double-strand breaks in chromatin

    Science.gov (United States)

    Robert, Carine; Nagaria, Pratik K.; Pawar, Nisha; Adewuyi, Adeoluwa; Gojo, Ivana; Meyers, David J.; Cole, Philip A.; Rassool, Feyruz V.

    2016-01-01

    Histone deacetylase inhibitors (HDACi) induce acetylation of histone and non-histone proteins, and modulate the acetylation of proteins involved in DNA double-strand break (DSB) repair. Non-homologous end-joining (NHEJ) is one of the main pathways for repairing DSBs. Decreased NHEJ activity has been reported with HDACi treatment. However, mechanisms through which these effects are regulated in the context of chromatin are unclear. We show that pan-HDACi, trichostatin A (TSA), causes differential acetylation of DNA repair factors Ku70/Ku80 and poly ADP-ribose polymerase-1 (PARP1), and impairs NHEJ. Repair effects are reversed by treatments with p300/CBP inhibitor C646, with significantly decreased acetylation of PARP1. In keeping with these findings, TSA treatment significantly increases PARP1 binding to DSBs in chromatin. Notably, AML patients treated with HDACi entinostat (MS275) in vivo also show increased formation of poly ADP-ribose (PAR) that co-localizes with DSBs. Further, we demonstrate that PARP1 bound to chromatin increases with duration of TSA exposure, resembling PARP “trapping”. Knockdown of PARP1 inhibits trapping and mitigates HDACi effects on NHEJ. Finally, combination of HDACi with potent PARP inhibitor talazoparib (BMN673) shows a dose-dependent increase in PARP “trapping”, which correlates with increased apoptosis. These results provide a mechanism through which HDACi inhibits deacetylation and increases binding of PARP1 to DSBs, leading to decreased NHEJ and cytotoxicity of leukemia cells. PMID:27064363

  9. Approach to the classical radiation biology. Ionizing radiation effects and repair mechanism of DNA double strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Utsumi, Hiroshi [Kyoto Univ., Kumatori, Osaka (Japan). Research Reactor Inst

    2000-09-01

    Split-dose recovery has been observed under a variety of experimental conditions in many cell systems and believed to be the recovery of sublethal damage (SLD). It is considered to be one of the most widespread and important cellular responses in clinical radiotherapy. To study the molecular mechanism of this recovery, we analyzed the knockout mutants KU70{sup -/-}, RAD54{sup -/-}, and KU70{sup -/-}/ RAD54{sup -/-} of the chicken B-cell line, DT40. Rad54 participates in the homologous recombinational (HR) repair of DNA double-strand breaks (DSB), while Ku proteins are involved in non-homologous end-joining (NHEJ). Split-dose recovery was observed in the parent DT40 and KU70{sup -/-} cells. Moreover the split-dose survival enhancement had all of the characteristics of SLD recovery that had been demonstrated earlier: e.g., the reappearance of the shoulder of the survival curve with dose fractionation; repair at 25degC; and inhibition by the antibiotic actinomycin D. These results strongly suggest that SLD recovery is due to DSB repair via or mediated by HR, and that these breaks constitute SLD. The tonicity-sensitive potentially lethal damage (PLD) recovery was also found only in DT40 and KU70 {sup -/-} cells. Delayed-plating PLD recovery may be controlled by NHEJ repair that works through the cell cycle. These results lead to the conclusion that the repair of DSBs could explain the classical operational recovery phenomena. We have also investigated RBE/LET using those mutants. (author)

  10. An inverse switch in DNA base excision and strand break repair contributes to melphalan resistance in multiple myeloma cells.

    Directory of Open Access Journals (Sweden)

    Mirta M L Sousa

    Full Text Available Alterations in checkpoint and DNA repair pathways may provide adaptive mechanisms contributing to acquired drug resistance. Here, we investigated the levels of proteins mediating DNA damage signaling and -repair in RPMI8226 multiple myeloma cells and its Melphalan-resistant derivative 8226-LR5. We observed markedly reduced steady-state levels of DNA glycosylases UNG2, NEIL1 and MPG in the resistant cells and cross-resistance to agents inducing their respective DNA base lesions. Conversely, repair of alkali-labile sites was apparently enhanced in the resistant cells, as substantiated by alkaline comet assay, autoribosylation of PARP-1, and increased sensitivity to PARP-1 inhibition by 4-AN or KU58684. Reduced base-excision and enhanced single-strand break repair would both contribute to the observed reduction in genomic alkali-labile sites, which could jeopardize productive processing of the more cytotoxic Melphalan-induced interstrand DNA crosslinks (ICLs. Furthermore, we found a marked upregulation of proteins in the non-homologous end-joining (NHEJ pathway of double-strand break (DSB repair, likely contributing to the observed increase in DSB repair kinetics in the resistant cells. Finally, we observed apparent upregulation of ATR-signaling and downregulation of ATM-signaling in the resistant cells. This was accompanied by markedly increased sensitivity towards Melphalan in the presence of ATR-, DNA-PK, or CHK1/2 inhibitors whereas no sensitizing effect was observed subsequent to ATM inhibition, suggesting that replication blocking lesions are primary triggers of the DNA damage response in the Melphalan resistant cells. In conclusion, Melphalan resistance is apparently contributed by modulation of the DNA damage response at multiple levels, including downregulation of specific repair pathways to avoid repair intermediates that could impair efficient processing of cytotoxic ICLs and ICL-induced DSBs. This study has revealed several novel

  11. QUANTITATION OF INTRACELLULAR NAD(P)H IN LIVING CELLS CAN MONITOR AN IMBALANCE OF DNA SINGLE STRAND BREAK REPAIR IN REAL TIME

    Science.gov (United States)

    Quantitation of intracellular NAD(P)H in living cells can monitor an imbalance of DNA single strand break repair in real time.ABSTRACTDNA single strand breaks (SSBs) are one of the most frequent DNA lesions in genomic DNA generated either by oxidative stress or du...

  12. Reconstitution of initial steps of dsDNA break repair by the RecF pathway of E. coli.

    Science.gov (United States)

    Handa, Naofumi; Morimatsu, Katsumi; Lovett, Susan T; Kowalczykowski, Stephen C

    2009-05-15

    The RecF pathway of Escherichia coli is important for recombinational repair of DNA breaks and gaps. Here ;we reconstitute in vitro a seven-protein reaction that recapitulates early steps of dsDNA break repair using purified RecA, RecF, RecO, RecR, RecQ, RecJ, and SSB proteins, components of the RecF system. Their combined action results in processing of linear dsDNA and its homologous pairing with supercoiled DNA. RecA, RecO, RecR, and RecJ are essential for joint molecule formation, whereas SSB and RecF are stimulatory. This reconstituted system reveals an unexpected essential function for RecJ exonuclease: the capability to resect duplex DNA. RecQ helicase stimulates this processing, but also disrupts joint molecules. RecO and RecR have two indispensable functions: They mediate exchange of RecA for SSB to form the RecA nucleoprotein filament, and act with RecF to load RecA onto the SSB-ssDNA complex at processed ssDNA-dsDNA junctions. The RecF pathway has many parallels with recombinational repair in eukaryotes. PMID:19451222

  13. Conservation of the rad21 Schizosaccharomyces pombe DNA double-strand break repair gene in mammals

    International Nuclear Information System (INIS)

    Purpose/Objective: Genetic factors are likely to be major determinants of human cellular ionizing radiation sensitivity. DNA double strand breaks (dsbs) are significant ionizing radiation-induced lesions; cellular DNA dsb processing is also important in a number of other contexts. To further the understanding of DNA dsb processing in mammalian cells, we cloned and sequenced mammalian homologs of the rad21 Schizosaccharomyces pombe DNA dsb repair gene. Materials and Methods: The genes were cloned by evolutionary walking, exploiting sequence homology between the yeast and mammalian genes. Results: No major motifs indicative of a particular function were present in the predicted amino acid sequences of the mammalian genes. Alignment of the Rad21 amino acid sequence with its putative homologs showed that similarity was distributed across the length of the proteins, with more highly conserved regions at both termini. The mHR21sp (mouse homolog ofR ad21, S. pombe) and hHR21sp (humanh omolog of Rad21, S. pombe) predicted proteins were 96% identical, whereas the human and S. pombe proteins were 25% identical and 47% similar. RNA blot analysis showed that mHR21sp mRNA was abundant in all adult mouse tissues examined, with highest expression in testis and thymus. In addition to a 3.1kb mRNA transcript in all tissues, an additional 2.2kb transcript was present at a high level in post-meiotic spermatids, white expression of the 3.1kb mRNA in testis was confined to the meiotic compartment. hHR21sp mRNA was cell cycle regulated in human cells, increasing in late S phase to a peak in G2 phase. The level of hHR21sp transcripts was not altered by exposure of normal diploid fibroblasts to 10 Gy ionizing radiation. In situ hybridization showed mHR21sp resided on chromosome 15D3, whereashHR21sp localized to the syntenic 8q24 region. Conclusion: Cloning these novel mammalian genes and characterization of their protein products should contribute to the understanding of cellular DNA dsb

  14. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL−1 and 50 μg mL−1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  15. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    Energy Technology Data Exchange (ETDEWEB)

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier, E-mail: didier.gasparutto@cea.fr

    2014-02-17

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL{sup −1} and 50 μg mL{sup −1} of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair

  16. Double-Strand Break Repair by Interchromosomal Recombination: An In Vivo Repair Mechanism Utilized by Multiple Somatic Tissues in Mammals

    OpenAIRE

    White, Ryan R; Sung, Patricia; Vestal, C. Greer; Benedetto, Gregory; Cornelio, Noelle; Richardson, Christine

    2013-01-01

    Homologous recombination (HR) is essential for accurate genome duplication and maintenance of genome stability. In eukaryotes, chromosomal double strand breaks (DSBs) are central to HR during specialized developmental programs of meiosis and antigen receptor gene rearrangements, and form at unusual DNA structures and stalled replication forks. DSBs also result from exposure to ionizing radiation, reactive oxygen species, some anti-cancer agents, or inhibitors of topoisomerase II. Literature p...

  17. The influence of bromodeoxyuridine on the induction and repair of DNA double-strand breaks in glioblastoma cells

    International Nuclear Information System (INIS)

    Aims: To examine the dose response of DNA damage and its modification by the radiosensitizer, 5-bromo-2'-deoxyuridine (BrdU). The sensitizing mechanism is analyzed with regard to its influence on the induction and repair of DNA double-strand breaks (DSBs). Material and Methods: Cells from three different human glioblastoma lines, A7, LH and U87MG, were X-irradiated with and without exposure to BrdU. DNA fragments were separated by field-inversion gel electrophoresis (FIGE) and quantified by fluorometry immediately and 24 h after irradiation. Results: In all cell lines, the dose response followed a linear-quadratic rather than a purely linear function. BrdU-treated cells exhibited a significantly higher amount of mobile DNA. In repair experiments with and without BrdU, the amount of mobile DNA fell close to control values within 24 h. Conclusions: The linear-quadratic model appropriately describes the X-ray induced fragmentation of DNA. BrdU sensitizing acts predominantly by increasing DNA fragility, and not by impairing damage repair. The amount of DSBs persistent after 24 h of repair is minimal, even after highly cytotoxic doses. However, it appears to depend on the extent of initial damage, causing sensitized cells to retain more DSBs than unsensitized cells. (orig.)

  18. Nonrecurrent MECP2 duplications mediated by genomic architecture-driven DNA breaks and break-induced replication repair.

    Science.gov (United States)

    Bauters, Marijke; Van Esch, Hilde; Friez, Michael J; Boespflug-Tanguy, Odile; Zenker, Martin; Vianna-Morgante, Angela M; Rosenberg, Carla; Ignatius, Jaakko; Raynaud, Martine; Hollanders, Karen; Govaerts, Karen; Vandenreijt, Kris; Niel, Florence; Blanc, Pierre; Stevenson, Roger E; Fryns, Jean-Pierre; Marynen, Peter; Schwartz, Charles E; Froyen, Guy

    2008-06-01

    Recurrent submicroscopic genomic copy number changes are the result of nonallelic homologous recombination (NAHR). Nonrecurrent aberrations, however, can result from different nonexclusive recombination-repair mechanisms. We previously described small microduplications at Xq28 containing MECP2 in four male patients with a severe neurological phenotype. Here, we report on the fine-mapping and breakpoint analysis of 16 unique microduplications. The size of the overlapping copy number changes varies between 0.3 and 2.3 Mb, and FISH analysis on three patients demonstrated a tandem orientation. Although eight of the 32 breakpoint regions coincide with low-copy repeats, none of the duplications are the result of NAHR. Bioinformatics analysis of the breakpoint regions demonstrated a 2.5-fold higher frequency of Alu interspersed repeats as compared with control regions, as well as a very high GC content (53%). Unexpectedly, we obtained the junction in only one patient by long-range PCR, which revealed nonhomologous end joining as the mechanism. Breakpoint analysis in two other patients by inverse PCR and subsequent array comparative genomic hybridization analysis demonstrated the presence of a second duplicated region more telomeric at Xq28, of which one copy was inserted in between the duplicated MECP2 regions. These data suggest a two-step mechanism in which part of Xq28 is first inserted near the MECP2 locus, followed by breakage-induced replication with strand invasion of the normal sister chromatid. Our results indicate that the mechanism by which copy number changes occur in regions with a complex genomic architecture can yield complex rearrangements.

  19. XLS (c9orf142) is a new component of mammalian DNA double-stranded break repair

    OpenAIRE

    Craxton, A; J. Somers; Munnur, D; Jukes-Jones, R; Cain, K.; Malewicz, M

    2015-01-01

    Repair of double-stranded DNA breaks (DSBs) in mammalian cells primarily occurs by the non-homologous end-joining (NHEJ) pathway, which requires seven core proteins (Ku70/Ku86, DNA-PKcs (DNA-dependent protein kinase catalytic subunit), Artemis, XRCC4-like factor (XLF), XRCC4 and DNA ligase IV). Here we show using combined affinity purification and mass spectrometry that DNA-PKcs co-purifies with all known core NHEJ factors. Furthermore, we have identified a novel evolutionary conserved protei...

  20. Common and unique genetic interactions of the poly(ADP-ribose) polymerases PARP1 and PARP2 with DNA double-strand break repair pathways.

    Science.gov (United States)

    Ghosh, Rajib; Roy, Sanchita; Kamyab, Johan; Dantzer, Francoise; Franco, Sonia

    2016-09-01

    In mammalian cells, chromatin poly(ADP-ribos)ylation (PARylation) at sites of DNA Double-Strand Breaks (DSBs) is mediated by two highly related enzymes, PARP1 and PARP2. However, enzyme-specific genetic interactions with other DSB repair factors remain largely undefined. In this context, it was previously shown that mice lacking PARP1 and H2AX, a histone variant that promotes DSB repair throughout the cell cycle, or the core nonhomologous end-joining (NHEJ) factor Ku80 are not viable, while mice lacking PARP1 and the noncore NHEJ factor DNA-PKcs are severely growth retarded and markedly lymphoma-prone. Here, we have examined the requirement for PARP2 in these backgrounds. We find that, like PARP1, PARP2 is essential for viability in mice lacking H2AX. Moreover, treatment of H2AX-deficient primary fibroblasts or B lymphocytes with PARP inhibitors leads to activation of the G2/M checkpoint and accumulation of chromatid-type breaks in a lineage- and gene-dose dependent manner. In marked contrast to PARP1, loss of PARP2 does not result in additional phenotypes in growth, development or tumorigenesis in mice lacking either Ku80 or DNA-PKcs. Altogether these findings highlight specific nonoverlapping functions of PARP1 and PARP2 at H2AX-deficient chromatin during replicative phases of the cell cycle and uncover a unique requirement for PARP1 in NHEJ-deficient cells. PMID:27373144

  1. Coordination and processing of DNA ends during double-strand break repair: the role of the bacteriophage T4 Mre11/Rad50 (MR) complex.

    Science.gov (United States)

    Almond, Joshua R; Stohr, Bradley A; Panigrahi, Anil K; Albrecht, Dustin W; Nelson, Scott W; Kreuzer, Kenneth N

    2013-11-01

    The in vivo functions of the bacteriophage T4 Mre11/Rad50 (MR) complex (gp46/47) in double-strand-end processing, double-strand break repair, and recombination-dependent replication were investigated. The complex is essential for T4 growth, but we wanted to investigate the in vivo function during productive infections. We therefore generated a suppressed triple amber mutant in the Rad50 subunit to substantially reduce the level of complex and thereby reduce phage growth. Growth-limiting amounts of the complex caused a concordant decrease in phage genomic recombination-dependent replication. However, the efficiencies of double-strand break repair and of plasmid-based recombination-dependent replication remained relatively normal. Genetic analyses of linked markers indicated that double-strand ends were less protected from nuclease erosion in the depleted infection and also that end coordination during repair was compromised. We discuss models for why phage genomic recombination-dependent replication is more dependent on Mre11/Rad50 levels when compared to plasmid recombination-dependent replication. We also tested the importance of the conserved histidine residue in nuclease motif I of the T4 Mre11 protein. Substitution with multiple different amino acids (including serine) failed to support phage growth, completely blocked plasmid recombination-dependent replication, and led to the stabilization of double-strand ends. We also constructed and expressed an Mre11 mutant protein with the conserved histidine changed to serine. The mutant protein was found to be completely defective for nuclease activities, but retained the ability to bind the Rad50 subunit and double-stranded DNA. These results indicate that the nuclease activity of Mre11 is critical for phage growth and recombination-dependent replication during T4 infections.

  2. Physical Activity Breaks and Facilities in US Secondary Schools

    Science.gov (United States)

    Hood, Nancy E.; Colabianchi, Natalie; Terry-McElrath, Yvonne M.; O'Malley, Patrick M.; Johnston, Lloyd D.

    2014-01-01

    Background: Research on physical activity breaks and facilities (indoor and outdoor) in secondary schools is relatively limited. Methods: School administrators and students in nationally representative samples of 8th (middle school) and 10th/12th grade (high school) students were surveyed annually from 2008-2009 to 2011-2012. School administrators…

  3. H. pylori-Induced DNA Strand Breaks Are Introduced by Nucleotide Excision Repair Endonucleases and Promote NF-κB Target Gene Expression

    Directory of Open Access Journals (Sweden)

    Mara L. Hartung

    2015-10-01

    Full Text Available The human bacterial pathogen Helicobacter pylori exhibits genotoxic properties that promote gastric carcinogenesis. H. pylori introduces DNA double strand breaks (DSBs in epithelial cells that trigger host cell DNA repair efforts. Here, we show that H. pylori-induced DSBs are repaired via error-prone, potentially mutagenic non-homologous end-joining. A genome-wide screen for factors contributing to DSB induction revealed a critical role for the H. pylori type IV secretion system (T4SS. Inhibition of transcription, as well as NF-κB/RelA-specific RNAi, abrogates DSB formation. DSB induction further requires β1-integrin signaling. DSBs are introduced by the nucleotide excision repair endonucleases XPF and XPG, which, together with RelA, are recruited to chromatin in a highly coordinated, T4SS-dependent manner. Interestingly, XPF/XPG-mediated DNA DSBs promote NF-κB target gene transactivation and host cell survival. In summary, H. pylori induces XPF/XPG-mediated DNA damage through activation of the T4SS/β1-integrin signaling axis, which promotes NF-κB target gene expression and host cell survival.

  4. Androgen receptor in Sertoli cells regulates DNA double-strand break repair and chromosomal synapsis of spermatocytes partially through intercellular EGF-EGFR signaling.

    Science.gov (United States)

    Chen, Su-Ren; Hao, Xiao-Xia; Zhang, Yan; Deng, Shou-Long; Wang, Zhi-Peng; Wang, Yu-Qian; Wang, Xiu-Xia; Liu, Yi-Xun

    2016-04-01

    Spermatogenesis does not progress beyond the pachytene stages of meiosis in Sertoli cell-specific AR knockout (SCARKO) mice. However, further evidence of meiotic arrest and underlying paracrine signals in SCARKO testes is still lacking. We utilized co-immunostaining of meiotic surface spreads to examine the key events during meiotic prophase I. SCARKO spermatocytes exhibited a failure in chromosomal synapsis observed by SCP1/SCP3 double-staining and CREST foci quantification. In addition, DNA double-strand breaks (DSBs) were formed but were not repaired in the mutant spermatocytes, as revealed by γ-H2AX staining and DNA-dependent protein kinase (DNA-PK) activity examination. The later stages of DSB repair, such as the accumulation of the RAD51 strand exchange protein and the localization of mismatch repair protein MLH1, were correspondingly altered in SCARKO spermatocytes. Notably, the expression of factors that guide RAD51 loading onto sites of DSBs, including TEX15, BRCA1/2 and PALB2, was severely impaired when either AR was down-regulated or EGF was up-regulated. We observed that some ligands in the epidermal growth factor (EGF) family were over-expressed in SCARKO Sertoli cells and that some receptors in the EGF receptor (EGFR) family were ectopically activated in the mutant spermatocytes. When EGF-EGFR signaling was repressed to approximately normal by the specific inhibitor AG1478 in the cultured SCARKO testis tissues, the arrested meiosis was partially rescued, and functional haploid cells were generated. Based on these data, we propose that AR in Sertoli cells regulates DSB repair and chromosomal synapsis of spermatocytes partially through proper intercellular EGF-EGFR signaling.

  5. A histone H3K36 chromatin switch coordinates DNA double-strand break repair pathway choice.

    Science.gov (United States)

    Pai, Chen-Chun; Deegan, Rachel S; Subramanian, Lakxmi; Gal, Csenge; Sarkar, Sovan; Blaikley, Elizabeth J; Walker, Carol; Hulme, Lydia; Bernhard, Eric; Codlin, Sandra; Bähler, Jürg; Allshire, Robin; Whitehall, Simon; Humphrey, Timothy C

    2014-01-01

    DNA double-strand break (DSB) repair is a highly regulated process performed predominantly by non-homologous end joining (NHEJ) or homologous recombination (HR) pathways. How these pathways are coordinated in the context of chromatin is unclear. Here we uncover a role for histone H3K36 modification in regulating DSB repair pathway choice in fission yeast. We find Set2-dependent H3K36 methylation reduces chromatin accessibility, reduces resection and promotes NHEJ, while antagonistic Gcn5-dependent H3K36 acetylation increases chromatin accessibility, increases resection and promotes HR. Accordingly, loss of Set2 increases H3K36Ac, chromatin accessibility and resection, while Gcn5 loss results in the opposite phenotypes following DSB induction. Further, H3K36 modification is cell cycle regulated with Set2-dependent H3K36 methylation peaking in G1 when NHEJ occurs, while Gcn5-dependent H3K36 acetylation peaks in S/G2 when HR prevails. These findings support an H3K36 chromatin switch in regulating DSB repair pathway choice. PMID:24909977

  6. Xbp1-mediated histone H4 deacetylation contributes to DNA double-strand break repair in yeast

    Institute of Scientific and Technical Information of China (English)

    Ran Tao; Hua Chen; Chan Gao; Pcng Xue; Fuquan Yang; Jing-Dong J Han; Bing Zhou; Ye-Guang Chen

    2011-01-01

    Xbp1 has been shown to regulate the cell cycle as a transcriptional repressor in budding yeast Saccharomyces cerevisiae.In this study,we demonstrated that Xbp1 regulates DNA double-strand break (DSB) repair in S.cerevisiae.Xbp1 physically and genetically interacts with the histone deacetylase Rpd3 complex.Chromatin immunoprecipitation revealed that Xbp1 is required for efficient deacetylation of histone H4 flanking DSBs by the Rpd3 complex.Deletion of XBP1 leads to the delayed deacetylation of histone H4,which is coupled with increased nucleosome displacement,increased DNA end resection and decreased non-homologous end-joining (NHEJ).In response to DNA damage,Xbp1 is upregulated in a Mec1-Rad9-Rad53 checkpoint pathway-dependent manner and undergoes dephosphorylation.Cdk1,a central regulator of S.cerevisiae cell cycle,is responsible for Xbp1 phosphorylation at residues Ser146,Ser271 and Ser551.Substitution of these serine residues with alanine not only increases the association of Xbp1 with the Rpd3 complex and its recruitment to a DSB,but also promotes DSB repair.Together,our findings reveal a role for Xbp1 in DSB repair via NHEJ through regulation of histone H4 acetylation and nucleosome displacement in a positive feedback manner.

  7. XLS (c9orf142) is a new component of mammalian DNA double-stranded break repair.

    Science.gov (United States)

    Craxton, A; Somers, J; Munnur, D; Jukes-Jones, R; Cain, K; Malewicz, M

    2015-06-01

    Repair of double-stranded DNA breaks (DSBs) in mammalian cells primarily occurs by the non-homologous end-joining (NHEJ) pathway, which requires seven core proteins (Ku70/Ku86, DNA-PKcs (DNA-dependent protein kinase catalytic subunit), Artemis, XRCC4-like factor (XLF), XRCC4 and DNA ligase IV). Here we show using combined affinity purification and mass spectrometry that DNA-PKcs co-purifies with all known core NHEJ factors. Furthermore, we have identified a novel evolutionary conserved protein associated with DNA-PKcs-c9orf142. Computer-based modelling of c9orf142 predicted a structure very similar to XRCC4, hence we have named c9orf142-XLS (XRCC4-like small protein). Depletion of c9orf142/XLS in cells impaired DSB repair consistent with a defect in NHEJ. Furthermore, c9orf142/XLS interacted with other core NHEJ factors. These results demonstrate the existence of a new component of the NHEJ DNA repair pathway in mammalian cells. PMID:25941166

  8. The Over-expression of the β2 Catalytic Subunit of the Proteasome Decreases Homologous Recombination and Impairs DNA Double-Strand Break Repair in Human Cells

    Directory of Open Access Journals (Sweden)

    Anita Collavoli

    2011-01-01

    Full Text Available By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB. This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p.

  9. Increased DNA double-strand break was associated with downregulation of repair and upregulation of apoptotic factors in rat hippocampus after alcohol exposure.

    Science.gov (United States)

    Suman, Shubhankar; Kumar, Santosh; N'Gouemo, Prosper; Datta, Kamal

    2016-08-01

    Binge drinking is known to cause damage in critical areas of the brain, including the hippocampus, which is important for relational memory and is reported to be sensitive to alcohol toxicity. However, the roles of DNA double-strand break (DSB) and its repair pathways, homologous recombination (HR), and non-homologous end joining (NHEJ) in alcohol-induced hippocampal injury remain to be elucidated. The purpose of this first study was to assess alcohol-induced DNA DSB and the mechanism by which alcohol affects DSB repair pathways in rat hippocampus. Male Sprague-Dawley rats (8-10 weeks old) were put on a 4-day binge ethanol treatment regimen. Control animals were maintained under similar conditions but were given the vehicle without ethanol. All animals were humanely euthanized 24 h after the last dose of ethanol administration and the hippocampi were dissected for immunoblot and immunohistochemistry analysis. Ethanol exposure caused increased 4-hydroxynonenal (4-HNE) staining as well as elevated γH2AX and 53BP1 foci in hippocampal cells. Immunoblot analysis showed decreased Mre11, Rad51, Rad50, and Ku86 as well as increased Bax and p21 in samples from ethanol-treated rats. Additionally, we also observed increased activated caspase3 staining in hippocampal cells 24 h after ethanol withdrawal. Taken together, our data demonstrated that ethanol concurrently induced DNA DSB, downregulated DSB repair pathway proteins, and increased apoptotic factors in hippocampal cells. We believe these findings will provide the impetus for further research on DNA DSB and its repair pathways in relation to alcohol toxicity in brain. PMID:27565756

  10. RAD1 and RAD10, but not other excision repair genes, are required for double-strand break-induced recombination in Saccharomyces cerevisiae.

    Science.gov (United States)

    Ivanov, E L; Haber, J E

    1995-04-01

    HO endonuclease-induced double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae can be repaired by the process of gap repair or, alternatively, by single-strand annealing if the site of the break is flanked by directly repeated homologous sequences. We have shown previously (J. Fishman-Lobell and J. E. Haber, Science 258:480-484, 1992) that during the repair of an HO-induced DSB, the excision repair gene RAD1 is needed to remove regions of nonhomology from the DSB ends. In this report, we present evidence that among nine genes involved in nucleotide excision repair, only RAD1 and RAD10 are required for removal of nonhomologous sequences from the DSB ends. rad1 delta and rad10 delta mutants displayed a 20-fold reduction in the ability to execute both gap repair and single-strand annealing pathways of HO-induced recombination. Mutations in RAD2, RAD3, and RAD14 reduced HO-induced recombination by about twofold. We also show that RAD7 and RAD16, which are required to remove UV photodamage from the silent HML, locus, are not required for MAT switching with HML or HMR as a donor. Our results provide a molecular basis for understanding the role of yeast nucleotide excision repair gene and their human homologs in DSB-induced recombination and repair.

  11. Optimizing Computation of Repairs from Active Integrity Constraints

    DEFF Research Database (Denmark)

    Cruz-Filipe, Luís

    2014-01-01

    Active integrity constraints (AICs) are a form of integrity constraints for databases that not only identify inconsistencies, but also suggest how these can be overcome. The semantics for AICs defines different types of repairs, but deciding whether an inconsistent database can be repaired...... and finding possible repairs is a NP- or Σ2p-complete problem, depending on the type of repairs one has in mind. In this paper, we introduce two different relations on AICs: an equivalence relation of independence, allowing the search to be parallelized among the equivalence classes, and a precedence relation...

  12. DNA Ligase IV and Artemis Act Cooperatively to Suppress Homologous Recombination in Human Cells: Implications for DNA Double-Strand Break Repair

    OpenAIRE

    Aya Kurosawa; Shinta Saito; Sairei So; Mitsumasa Hashimoto; Kuniyoshi Iwabuchi; Haruka Watabe; Noritaka Adachi

    2013-01-01

    Nonhomologous end-joining (NHEJ) and homologous recombination (HR) are two major pathways for repairing DNA double-strand breaks (DSBs); however, their respective roles in human somatic cells remain to be elucidated. Here we show using a series of human gene-knockout cell lines that NHEJ repairs nearly all of the topoisomerase II- and low-dose radiation-induced DNA damage, while it negatively affects survival of cells harbouring replication-associated DSBs. Intriguingly, we find that loss of ...

  13. Heterozygous PALB2 c.1592delT mutation channels DNA double-strand break repair into error-prone pathways in breast cancer patients.

    Science.gov (United States)

    Obermeier, K; Sachsenweger, J; Friedl, T W P; Pospiech, H; Winqvist, R; Wiesmüller, L

    2016-07-21

    Hereditary heterozygous mutations in a variety of DNA double-strand break (DSB) repair genes have been associated with increased breast cancer risk. In the Finnish population, PALB2 (partner and localizer of BRCA2) represents a major susceptibility gene for female breast cancer, and so far, only one mutation has been described, c.1592delT, which leads to a sixfold increased disease risk. PALB2 is thought to participate in homologous recombination (HR). However, the effect of the Finnish founder mutation on DSB repair has not been investigated. In the current study, we used a panel of lymphoblastoid cell lines (LCLs) derived from seven heterozygous female PALB2 c.1592delT mutation carriers with variable health status and six wild-type matched controls. The results of our DSB repair analysis showed that the PALB2 mutation causes specific changes in pathway usage, namely increases in error-prone single-strand annealing (SSA) and microhomology-mediated end-joining (MMEJ) compared with wild-type LCLs. These data indicated haploinsufficiency regarding the suppression of error-prone DSB repair in PALB2 mutation carriers. To the contrary, neither reduced HR activities, nor impaired RAD51 filament assembly, nor sensitization to PARP inhibition were consistently observed. Expression of truncated mutant versus wild-type PALB2 verified a causal role of PALB2 c.1592delT in the shift to error-prone repair. Discrimination between healthy and malignancy-presenting PALB2 mutation carriers revealed a pathway shift particularly in the breast cancer patients, suggesting interaction of PALB2 c.1592delT with additional genomic lesions. Interestingly, the studied PALB2 mutation was associated with 53BP1 accumulation in the healthy mutation carriers but not the patients, and 53BP1 was limiting for error-prone MMEJ in patients but not in healthy carriers. Our study identified a rise in error-prone DSB repair as a potential threat to genomic integrity in heterozygous PALB2 mutation carriers

  14. The repair fidelity of restriction enzyme-induced double strand breaks in plasmid DNA correlates with radioresistance in human tumor cell lines

    International Nuclear Information System (INIS)

    The accuracy of DNA repair may play a role in determining the cytotoxic effect of ionizing radiation. Repair, as measured by DNA strand breakage, often shows little difference between tumor cell lines of widely different radiosensitivity. The mechanism by which DNA fragments are rejoined is poorly understood. This study used plasmid transfection as a probe to assess the balance between correct repair and misrepair. A general trend for sensitive cells to show lower repair fidelity relative to resistant cells was observed. The type of double-strand cleavage of the plasmid (staggered or blunt) made little difference to the measured repair fidelity, in contrast to published studies in which restriction-enzyme breaks had been introduced into DNA within chromatin. Specific comparison of parent lines and their radiosensitive clones showed significant differences in repair fidelity for a relatively small change in radiation response, which was in line with the overall correlation. These same pairs have previously been shown to have no difference in the loss of DNA fragmentation with time after irradiation, and Southern analysis had confirmed the integrated plasmid copy number was similar in the cell lines compared. The number of intact copies of the damaged gene relative to the undamaged gene mirrored the observed repair fidelity. However, in one cell line out of the 10 studied, an exception to the observed trend was found. In comparison of two equally radioresistant bladder cancer cell lines, large differences in repair fidelity were observed. Again, no difference in the integrated copy number was found, and the damaged gene was highly rearranged or deleted in the cell line with low repair fidelity. It is suggested that repair fidelity can be, but is not invariably, a measure of correct repair relative to misrepair, resulting from the processing of double-strand breaks and, hence, the response to ionizing radiation. 24 refs., 2 figs., 2 tabs

  15. Melatonin sensitizes human breast cancer cells to ionizing radiation by downregulating proteins involved in double-strand DNA break repair.

    Science.gov (United States)

    Alonso-González, Carolina; González, Alicia; Martínez-Campa, Carlos; Gómez-Arozamena, José; Cos, Samuel

    2015-03-01

    Radiation and adjuvant endocrine therapy are nowadays considered a standard treatment option after surgery in breast cancer. Melatonin exerts oncostatic actions on human breast cancer cells. In the current study, we investigated the effects of a combination of radiotherapy and melatonin on human breast cancer cells. Melatonin (1 mm, 10 μm and 1 nm) significantly inhibited the proliferation of MCF-7 cells. Radiation alone inhibited the MCF-7 cell proliferation in a dose-dependent manner. Pretreatment of breast cancer cells with melatonin 1 wk before radiation led to a significantly greater decrease of MCF-7 cell proliferation compared with radiation alone. Melatonin pretreatment before radiation also decreased G2 -M phase arrest compared with irradiation alone, with a higher percentage of cells in the G0 -G1 phase and a lower percentage of cells in S phase. Radiation alone diminished RAD51 and DNA-protein kinase (PKcs) mRNA expression, two main proteins involved in double-strand DNA break repair. Treatment with melatonin for 7 days before radiation led to a significantly greater decrease in RAD51 and DNA-PKcs mRNA expression compared with radiation alone. Our findings suggest that melatonin pretreatment before radiation sensitizes breast cancer cells to the ionizing effects of radiation by decreasing cell proliferation, inducing cell cycle arrest and downregulating proteins involved in double-strand DNA break repair. These findings may have implications for designing clinical trials using melatonin and radiotherapy. PMID:25623566

  16. ATM protein is indispensable to repair complex-type DNA double strand breaks induced by high LET heavy ion irradiation.

    Science.gov (United States)

    Sekine, Emiko; Yu, Dong; Fujimori, Akira; Anzai, Kazunori; Okayasu, Ryuichi

    ATM (ataxia telangiectasia-mutated) protein responsible for a rare genetic disease with hyperradiosensitivity, is the one of the earliest repair proteins sensing DNA double-strand breaks (DSB). ATM is known to phosphorylate DNA repair proteins such as MRN complex (Mre11, Rad50 and NBS1), 53BP1, Artemis, Brca1, gamma-H2AX, and MDC. We studied the interactions between ATM and DNA-PKcs, a crucial NHEJ repair protein, after cells exposure to high and low LET irradiation. Normal human (HFL III, MRC5VA) and AT homozygote (AT2KY, AT5BIVA, AT3BIVA) cells were irradiated with X-rays and high LET radiation (carbon ions: 290MeV/n initial energy at 70 keV/um, and iron ions: 500MeV/n initial energy at 200KeV/um), and several critical end points were examined. AT cells with high LET irradiation showed a significantly higher radiosensitivity when compared with normal cells. The behavior of DNA DSB repair was monitored by immuno-fluorescence techniques using DNA-PKcs (pThr2609, pSer2056) and ATM (pSer1981) antibodies. In normal cells, the phosphorylation of DNA-PKcs was clearly detected after high LET irradiation, though the peak of phosphorylation was delayed when compared to X-irradiation. In contrast, almost no DNA-PKcs phosphorylation foci were detected in AT cells irradiated with high LET radiation. A similar result was also observed in normal cells treated with 10 uM ATM kinase specific inhibitor (KU55933) one hour before irradiation. These data suggest that the phosphorylation of DNA-PKcs with low LET X-rays is mostly ATM-independent, and the phosphorylation of DNA-PKcs with high LET radiation seems to require ATM probably due to its complex nature of DSB induced. Our study indicates that high LET heavy ion irradiation which we can observe in the space environment would provide a useful tool to study the fundamental mechanism associated with DNA DSB repair.

  17. Opposing roles of RNF8/RNF168 and deubiquitinating enzymes in ubiquitination-dependent DNA double-strand break response signaling and DNA-repair pathway choice

    Science.gov (United States)

    Nakada, Shinichiro

    2016-01-01

    The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway. PMID:26983989

  18. Break for Physical Activity: Incorporating Classroom-Based Physical Activity Breaks into Preschools

    Science.gov (United States)

    Wadsworth, Danielle D.; Robinson, Leah E.; Beckham, Karen; Webster, Kip

    2012-01-01

    Engaging in moderate-to-vigorous physical activity is essential to lifelong health and wellness. Physical activity behaviors established in early childhood relate to physical activity behaviors in later years. However, research has shown that children are adopting more sedentary behaviors. Incorporating structured and planned physical activity…

  19. The repair of environmentally relevant DNA double strand breaks caused by high linear energy transfer irradiation--no simple task.

    Science.gov (United States)

    Moore, Shaun; Stanley, Fintan K T; Goodarzi, Aaron A

    2014-05-01

    High linear energy transfer (LET) ionising radiation (IR) such as radon-derived alpha particles and high mass, high energy (HZE) particles of cosmic radiation are the predominant forms of IR to which humanity is exposed throughout life. High-LET forms of IR are established carcinogens relevant to human cancer, and their potent mutagenicity is believed, in part, to be due to a greater incidence of clustered DNA double strand breaks (DSBs) and associated lesions, as ionization events occur within a more confined genomic space. The repair of such DNA damage is now well-documented to occur with slower kinetics relative to that induced by low-LET IR, and to be more reliant upon homology-directed repair pathways. Underlying these phenomena is the relative inability of non-homologous end-joining (NHEJ) to adequately resolve high-LET IR-induced DSBs. Current findings suggest that the functionality of the DNA-dependent protein kinase (DNA-PK), comprised of the Ku70-Ku80 heterodimer and the DNA-PK catalytic subunit (DNA-PKcs), is particularly perturbed by high-LET IR-induced clustered DSBs, rendering DNA-PK dependent NHEJ less relevant to resolving these lesions. By contrast, the NHEJ-associated DNA processing endonuclease Artemis shows a greater relevance to high-LET IR-induced DSB repair. Here, we will review the cellular response to high-LET irradiation, the implications of the chronic, low-dose modality of this exposure and molecular pathways that respond to high-LET irradiation induced DSBs, with particular emphasis on NHEJ factors. PMID:24565812

  20. Ser1778 of 53BP1 Plays a Role in DNA Double-strand Break Repairs

    OpenAIRE

    Lee, Jung-Hee; Cheong, Hyang-Min; Kang, Mi-Young; Kim, Sang-Young; Kang, Yoonsung

    2009-01-01

    53BP1 is an important genome stability regulator, which protects cells against double-strand breaks. Following DNA damage, 53BP1 is rapidly recruited to sites of DNA breakage, along with other DNA damage response proteins, including γ-H2AX, MDC1, and BRCA1. The recruitment of 53BP1 requires a tandem Tudor fold which associates with methylated histones H3 and H4. It has already been determined that the majority of DNA damage response proteins are phosphorylated by ATM and/or ATR after DNA dama...

  1. DNA ligase IV and artemis act cooperatively to suppress homologous recombination in human cells: implications for DNA double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Aya Kurosawa

    Full Text Available Nonhomologous end-joining (NHEJ and homologous recombination (HR are two major pathways for repairing DNA double-strand breaks (DSBs; however, their respective roles in human somatic cells remain to be elucidated. Here we show using a series of human gene-knockout cell lines that NHEJ repairs nearly all of the topoisomerase II- and low-dose radiation-induced DNA damage, while it negatively affects survival of cells harbouring replication-associated DSBs. Intriguingly, we find that loss of DNA ligase IV, a critical NHEJ ligase, and Artemis, an NHEJ factor with endonuclease activity, independently contribute to increased resistance to replication-associated DSBs. We also show that loss of Artemis alleviates hypersensitivity of DNA ligase IV-null cells to low-dose radiation- and topoisomerase II-induced DSBs. Finally, we demonstrate that Artemis-null human cells display increased gene-targeting efficiencies, particularly in the absence of DNA ligase IV. Collectively, these data suggest that DNA ligase IV and Artemis act cooperatively to promote NHEJ, thereby suppressing HR. Our results point to the possibility that HR can only operate on accidental DSBs when NHEJ is missing or abortive, and Artemis may be involved in pathway switching from incomplete NHEJ to HR.

  2. Collision of Trapped Topoisomerase 2 with Transcription and Replication: Generation and Repair of DNA Double-Strand Breaks with 5′ Adducts

    Directory of Open Access Journals (Sweden)

    Hong Yan

    2016-07-01

    Full Text Available Topoisomerase 2 (Top2 is an essential enzyme responsible for manipulating DNA topology during replication, transcription, chromosome organization and chromosome segregation. It acts by nicking both strands of DNA and then passes another DNA molecule through the break. The 5′ end of each nick is covalently linked to the tyrosine in the active center of each of the two subunits of Top2 (Top2cc. In this configuration, the two sides of the nicked DNA are held together by the strong protein-protein interactions between the two subunits of Top2, allowing the nicks to be faithfully resealed in situ. Top2ccs are normally transient, but can be trapped by cancer drugs, such as etoposide, and subsequently processed into DSBs in cells. If not properly repaired, these DSBs would lead to genome instability and cell death. Here, I review the current understanding of the mechanisms by which DSBs are induced by etoposide, the unique features of such DSBs and how they are repaired. Implications for the improvement of cancer therapy will be discussed.

  3. Collision of Trapped Topoisomerase 2 with Transcription and Replication: Generation and Repair of DNA Double-Strand Breaks with 5' Adducts.

    Science.gov (United States)

    Yan, Hong; Tammaro, Margaret; Liao, Shuren

    2016-01-01

    Topoisomerase 2 (Top2) is an essential enzyme responsible for manipulating DNA topology during replication, transcription, chromosome organization and chromosome segregation. It acts by nicking both strands of DNA and then passes another DNA molecule through the break. The 5' end of each nick is covalently linked to the tyrosine in the active center of each of the two subunits of Top2 (Top2cc). In this configuration, the two sides of the nicked DNA are held together by the strong protein-protein interactions between the two subunits of Top2, allowing the nicks to be faithfully resealed in situ. Top2ccs are normally transient, but can be trapped by cancer drugs, such as etoposide, and subsequently processed into DSBs in cells. If not properly repaired, these DSBs would lead to genome instability and cell death. Here, I review the current understanding of the mechanisms by which DSBs are induced by etoposide, the unique features of such DSBs and how they are repaired. Implications for the improvement of cancer therapy will be discussed. PMID:27376333

  4. Feasibility of measuring radiation-induced DNA double strand breaks and their repair by pulsed field gel electrophoresis in freshly isolated cells from the mouse RIF-1 tumor

    NARCIS (Netherlands)

    vanWaarde, MAWH; vanAssen, AJ; Konings, AWT; Kampinga, HH

    1996-01-01

    Purpose: To examine the technical feasibility of pulsed field gel electrophoresis (PFGE) as a predictive assay for the radioresponsiveness of tumors. Induction and repair of DNA double strand breaks (DSBs) in a freshly prepared cell suspension from a RIF-1 tumor (irradiated ex vivo) was compared wit

  5. Comparison of transformation, DNA single strand breaks and its repair in human blood lymphocytes stimulated with PHA, ConA and PWM following exposure to γ-rays

    International Nuclear Information System (INIS)

    The transformation, DNA single strand breaks and its repair in human peripheral blood lymphocytes stimulated with PHA, ConA and PWM respectively following exposure to 60Co γ-rays were analyzed by 3H-thymidine incorporation and hydroxylapatite chromatography. The transformation of lymphocytes stimulated with PHA, ConA and PWM were suppressed by γ-rays and the dose-effect curves were biphasic within the range of 0-8 Gy. The lymphocytes stimulated with PWM were the most resistant to γ-rays. The extent of DNA single strand breaks in lymphocytes induced by γ-rays was linearly related to the dose within the range of 0-30 Gy and there was no marked difference in the three kinds of lymphocytes. After a period of post-irradiation (15 Gy) incubation at 37 deg C, the DNA single strand breaks could be rejoined but incompletely. The rejoined strands broke again if the cells were incubated longer. The repair ratio of single strand breaks in the lymphocytes stimulated with PWM was the highest among the cells with three mitogens. The results suggest that the difference of the radiation effect on transformation in different lytphocytes is probably related to the repair ability of DNA single strand breaks

  6. Non-homologous end joining is the responsible pathway for the repair of fludarabine-induced DNA double strand breaks in mammalian cells

    International Nuclear Information System (INIS)

    Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by γH2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU-induced DSB

  7. Non-homologous end joining is the responsible pathway for the repair of fludarabine-induced DNA double strand breaks in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Campos-Nebel, Marcelo de [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)], E-mail: mnebel@hematologia.anm.edu.ar; Larripa, Irene; Gonzalez-Cid, Marcela [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)

    2008-11-10

    Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by {gamma}H2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU

  8. Frequent and efficient use of the sister chromatid for DNA double-strand break repair during budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Tamara Goldfarb

    Full Text Available Recombination between homologous chromosomes of different parental origin (homologs is necessary for their accurate segregation during meiosis. It has been suggested that meiotic inter-homolog recombination is promoted by a barrier to inter-sister-chromatid recombination, imposed by meiosis-specific components of the chromosome axis. Consistent with this, measures of Holliday junction-containing recombination intermediates (joint molecules [JMs] show a strong bias towards inter-homolog and against inter-sister JMs. However, recombination between sister chromatids also has an important role in meiosis. The genomes of diploid organisms in natural populations are highly polymorphic for insertions and deletions, and meiotic double-strand breaks (DSBs that form within such polymorphic regions must be repaired by inter-sister recombination. Efforts to study inter-sister recombination during meiosis, in particular to determine recombination frequencies and mechanisms, have been constrained by the inability to monitor the products of inter-sister recombination. We present here molecular-level studies of inter-sister recombination during budding yeast meiosis. We examined events initiated by DSBs in regions that lack corresponding sequences on the homolog, and show that these DSBs are efficiently repaired by inter-sister recombination. This occurs with the same timing as inter-homolog recombination, but with reduced (2- to 3-fold yields of JMs. Loss of the meiotic-chromosome-axis-associated kinase Mek1 accelerates inter-sister DSB repair and markedly increases inter-sister JM frequencies. Furthermore, inter-sister JMs formed in mek1Δ mutants are preferentially lost, while inter-homolog JMs are maintained. These findings indicate that inter-sister recombination occurs frequently during budding yeast meiosis, with the possibility that up to one-third of all recombination events occur between sister chromatids. We suggest that a Mek1-dependent reduction in

  9. Members of the RAD52 Epistasis Group Contribute to Mitochondrial Homologous Recombination and Double-Strand Break Repair in Saccharomyces cerevisiae.

    Science.gov (United States)

    Stein, Alexis; Kalifa, Lidza; Sia, Elaine A

    2015-11-01

    Mitochondria contain an independently maintained genome that encodes several proteins required for cellular respiration. Deletions in the mitochondrial genome have been identified that cause several maternally inherited diseases and are associated with certain cancers and neurological disorders. The majority of these deletions in human cells are flanked by short, repetitive sequences, suggesting that these deletions may result from recombination events. Our current understanding of the maintenance and repair of mtDNA is quite limited compared to our understanding of similar events in the nucleus. Many nuclear DNA repair proteins are now known to also localize to mitochondria, but their function and the mechanism of their action remain largely unknown. This study investigated the contribution of the nuclear double-strand break repair (DSBR) proteins Rad51p, Rad52p and Rad59p in mtDNA repair. We have determined that both Rad51p and Rad59p are localized to the matrix of the mitochondria and that Rad51p binds directly to mitochondrial DNA. In addition, a mitochondrially-targeted restriction endonuclease (mtLS-KpnI) was used to produce a unique double-strand break (DSB) in the mitochondrial genome, which allowed direct analysis of DSB repair in vivo in Saccharomyces cerevisiae. We find that loss of these three proteins significantly decreases the rate of spontaneous deletion events and the loss of Rad51p and Rad59p impairs the repair of induced mtDNA DSBs.

  10. Effect of Wortmannin on the repair profiles of DNA double-strand breaks in the whole genome and in interstitial telomeric sequences of Chinese hamster cells

    International Nuclear Information System (INIS)

    The DNA breakage detection-fluorescence in situ hybridization (DBD-FISH) procedure was applied to analyze the effect of Wortmannin (WM) in the rejoining kinetics of ionizing radiation-induced DNA double-strand breaks (DSBs) in the whole genome and in the long interstitial telomeric repeat sequence (ITRS) blocks from Chinese hamster cell lines. The results indicate that the ITRS blocks from wild-type Chinese hamster cell lines, CHO9 and V79B, exhibit a slower initial rejoining rate of ionizing radiation-induced DSBs than the genome overall. Neither Rad51C nor the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) activities, involved in homologous recombination (HR) and in non-homologous end-joining (NHEJ) pathways of DSB repair respectively, influenced the rejoining kinetics within ITRS in contrast to DNA sequences in the whole genome. Nevertheless, DSB removal rate within ITRS was decreased in the absence of Ku86 activity, though at a lower affectation level than in the whole genome, thus homogenizing both rejoining kinetics rates. WM treatment slowed down the DSB rejoining kinetics rate in ITRS, this effect being more pronounced in the whole genome, resulting in a similar pattern to that of the Ku86 deficient cells. In fact, no WM effect was detected in the Ku86 deficient Chinese hamster cells, so probably WM does not add further impairment in DSB rejoining than that resulted as a consequence of absence of Ku activity. The same slowing effect was also observed after treatment of Rad51C and DNA-PKcs defective hamster cells by WM, suggesting that: (1) there is no potentiation of the HR when the NHEJ is impaired by WM, either in the whole genome or in the ITRS, and (2) that this impairment may probably involve more targets than DNA-PKcs. These results suggest that there is an intragenomic heterogeneity in DSB repair, as well as in the effect of WM on this process

  11. Active DNA demethylation by DNA repair: Facts and uncertainties.

    Science.gov (United States)

    Schuermann, David; Weber, Alain R; Schär, Primo

    2016-08-01

    Pathways that control and modulate DNA methylation patterning in mammalian cells were poorly understood for a long time, although their importance in establishing and maintaining cell type-specific gene expression was well recognized. The discovery of proteins capable of converting 5-methylcytosine (5mC) to putative substrates for DNA repair introduced a novel and exciting conceptual framework for the investigation and ultimate discovery of molecular mechanisms of DNA demethylation. Against the prevailing notion that DNA methylation is a static epigenetic mark, it turned out to be dynamic and distinct mechanisms appear to have evolved to effect global and locus-specific DNA demethylation. There is compelling evidence that DNA repair, in particular base excision repair, contributes significantly to the turnover of 5mC in cells. By actively demethylating DNA, DNA repair supports the developmental establishment as well as the maintenance of DNA methylation landscapes and gene expression patterns. Yet, while the biochemical pathways are relatively well-established and reviewed, the biological context, function and regulation of DNA repair-mediated active DNA demethylation remains uncertain. In this review, we will thus summarize and critically discuss the evidence that associates active DNA demethylation by DNA repair with specific functional contexts including the DNA methylation erasure in the early embryo, the control of pluripotency and cellular differentiation, the maintenance of cell identity, and the nuclear reprogramming. PMID:27247237

  12. FACT Assists Base Excision Repair by Boosting the Remodeling Activity of RSC.

    Science.gov (United States)

    Charles Richard, John Lalith; Shukla, Manu Shubhdarshan; Menoni, Hervé; Ouararhni, Khalid; Lone, Imtiaz Nisar; Roulland, Yohan; Papin, Christophe; Ben Simon, Elsa; Kundu, Tapas; Hamiche, Ali; Angelov, Dimitar; Dimitrov, Stefan

    2016-07-01

    FACT, in addition to its role in transcription, is likely implicated in both transcription-coupled nucleotide excision repair and DNA double strand break repair. Here, we present evidence that FACT could be directly involved in Base Excision Repair and elucidate the chromatin remodeling mechanisms of FACT during BER. We found that, upon oxidative stress, FACT is released from transcription related protein complexes to get associated with repair proteins and chromatin remodelers from the SWI/SNF family. We also showed the rapid recruitment of FACT to the site of damage, coincident with the glycosylase OGG1, upon the local generation of oxidized DNA. Interestingly, FACT facilitates uracil-DNA glycosylase in the removal of uracil from nucleosomal DNA thanks to an enhancement in the remodeling activity of RSC. This discloses a novel property of FACT wherein it has a co-remodeling activity and strongly enhances the remodeling capacity of the chromatin remodelers. Altogether, our data suggest that FACT may acts in concert with RSC to facilitate excision of DNA lesions during the initial step of BER.

  13. Correlativity study between expression of DNA double-strand break repair protein and radiosensitivity of tumor cells

    Institute of Scientific and Technical Information of China (English)

    Liang ZHUANG; Shiying YU; Xiaoyuan HUANG; Yang CAO; Huihua XIONG

    2009-01-01

    DNA double-strand break (DSB) is generally regarded as the most lethal of all DNA lesions after radiation. KuS0, DNA-PK catalytic subunit (DNA-PKcs) and ataxia telangiectasia mutated (ATM) proteins are major DSB repair proteins. In this study, survival fraction at 2Gy (SF2) values of eight human tumor cell lines (including four human cervical carcinoma cell lines HeLa, SiHa, C33A, Caski, three human breast carcinoma cell lines MCF-7, MDA-MB-231, MDA-MB-453, and one human lung carcinoma cell line A549) were acquired by clone formation assay, and western blot was applied to detect the expressions of Ku80, DNA-PKcs and ATM protein. The correlativity of protein expression with SF2 value was analyzed by Pearson linear correlation analysis. We found that the expression of the same protein in different cell lines and the expression of three proteins in the same cell line had a significant difference. The SF2 values were also different in eight tumor cell lines and there was a positive correlativity between the expression of DNA-PKcs and SF2 (r=0.723, P =0.043), but Ku80 and ATM expression had no correlation with SF2 (P>0.05). These findings suggest that the expression level of DNA-PKcs protein can be an indicator for predicting the radiosensitivity of tumor cells.

  14. Haploid meiosis in Arabidopsis: double-strand breaks are formed and repaired but without synapsis and crossovers.

    Directory of Open Access Journals (Sweden)

    Marta Cifuentes

    Full Text Available Two hallmark features of meiosis are i the formation of crossovers (COs between homologs and ii the production of genetically-unique haploid spores that will fuse to restore the somatic ploidy level upon fertilization. In this study we analysed meiosis in haploid Arabidopsis thaliana plants and a range of haploid mutants to understand how meiosis progresses without a homolog. Extremely low chiasma frequency and very limited synapsis occurred in wild-type haploids. The resulting univalents segregated in two uneven groups at the first division, and sister chromatids segregated to opposite poles at the second division, leading to the production of unbalanced spores. DNA double-strand breaks that initiate meiotic recombination were formed, but in half the number compared to diploid meiosis. They were repaired in a RAD51- and REC8-dependent manner, but independently of DMC1, presumably using the sister chromatid as a template. Additionally, turning meiosis into mitosis (MiMe genotype in haploids resulted in the production of balanced haploid gametes and restoration of fertility. The variability of the effect on meiosis of the absence of homologous chromosomes in different organisms is then discussed.

  15. Post-irradiation chemical processing of DNA damage generates double-strand breaks in cells already engaged in repair

    Science.gov (United States)

    Singh, Satyendra K.; Wang, Minli; Staudt, Christian; Iliakis, George

    2011-01-01

    In cells exposed to ionizing radiation (IR), double-strand breaks (DSBs) form within clustered-damage sites from lesions disrupting the DNA sugar–phosphate backbone. It is commonly assumed that these DSBs form promptly and are immediately detected and processed by the cellular DNA damage response (DDR) apparatus. This assumption is questioned by the observation that after irradiation of naked DNA, a fraction of DSBs forms minutes to hours after exposure as a result of temperature dependent, chemical processing of labile sugar lesions. Excess DSBs also form when IR-exposed cells are processed at 50°C, but have been hitherto considered method-related artifact. Thus, it remains unknown whether DSBs actually develop in cells after IR exposure from chemically labile damage. Here, we show that irradiation of ‘naked’ or chromatin-organized mammalian DNA produces lesions, which evolve to DSBs and add to those promptly induced, after 8–24 h in vitro incubation at 37°C or 50°C. The conversion is more efficient in chromatin-associated DNA, completed within 1 h in cells and delayed in a reducing environment. We conclude that IR generates sugar lesions within clustered-damage sites contributing to DSB formation only after chemical processing, which occurs efficiently at 37°C. This subset of delayed DSBs may challenge DDR, may affect the perceived repair kinetics and requires further characterization. PMID:21745815

  16. DNA damage and repair activity after broccoli intake in young healthy smokers.

    Science.gov (United States)

    Riso, Patrizia; Martini, Daniela; Møller, Peter; Loft, Steffen; Bonacina, Gaia; Moro, Massimo; Porrini, Marisa

    2010-11-01

    Cruciferous vegetables contain compounds with antioxidant properties (e.g. carotenoids, vitamin C and folates) and can alter the activity of xenobiotic metabolism (i.e. isothiocyanates). These constituents may be particularly important for subjects who are exposed to free radicals and genotoxic compounds, including smokers. The aim of the study was to evaluate the effect of broccoli intake on biomarkers of DNA damage and repair. Twenty-seven young healthy smokers consumed a portion of steamed broccoli (250 g/day) or a control diet for 10 days each within a crossover design with a washout period. Blood was collected before and after each period. The level of oxidatively damaged DNA lesions (formamidopyrimidine DNA glycosylase-sensitive sites), resistance to ex vivo H(2)O(2) treatment and repair of oxidised DNA lesions were measured in peripheral blood mononuclear cells (PBMCs). We also measured mRNA expression levels of repair and defence enzymes: 8-oxoguanine DNA glycosylase (OGG1), nucleoside diphosphate linked moiety X-type motif 1 (NUDT1) and heme oxygenase 1 (HO-1). After broccoli consumption, the level of oxidised DNA lesions decreased by 41% (95% confidence interval: 10%, 72%) and the resistance to H(2)O(2)-induced DNA strand breaks increased by 23% (95% CI: 13%, 34%). Following broccoli intake, a higher protection was observed in subjects with glutathione S-transferase (GST) M1-null genotype. The expression level and activity of repair enzymes was unaltered. In conclusion, broccoli intake was associated with increased protection against H(2)O(2)-induced DNA strand breaks and lower levels of oxidised DNA bases in PBMCs from smokers. This protective effect could be related to an overall improved antioxidant status.

  17. DNA double strand break repair in mammalian cells: role of MRE11 and BLM proteins at the initiation of Non Homologous End Joining (NHEJ)

    International Nuclear Information System (INIS)

    DNA double strand breaks (DSBs) are highly cytotoxic lesions, which can lead to genetic rearrangements. Two pathways are responsible for repairing these lesions: homologous recombination (HR) and non homologous end joining (NHEJ). In our laboratory, an intrachromosomal substrate has been established in order to measure the efficiency and the fidelity of NHEJ in living cells (Guirouilh-Barbat 2004). This approach led us to identify a KU-independent alternative pathway, which uses micro homologies in the proximity of the junction to accomplish repair - the alternative NHEJ (Guirouilh-Barbat 2004, Guirouilh-Barbat et Rass 2007). The goal of my thesis consisted in identifying and characterising major actors of this pathway. In the absence of KU, alternative NHEJ would be initiated by ssDNA resection of damaged ends. We showed that the nuclease activity of MRE11 is necessary for this mechanism. MRE11 overexpression leads to a two fold stimulation of NHEJ efficiency, while the extinction of MRE11 by siRNA results in a two fold decrease. Our results demonstrate that the proteins RAD50 and CtIP act in the same pathway as MRE11. Moreover, in cells deficient for XRCC4, MIRIN - an inhibitor of the MRN complex - leads to a decrease in repair efficiency, implicating MRE11 in alternative NHEJ. We also showed that MRE11 can act in an ATM-dependent and independent manner (Rass et Grabarz Nat Struct Mol Biol 2009). The initiation of break resection needs to be pursued by a more extensive degradation of DNA, which is accomplished in yeast by the proteins Exo1 and Sgs1/Dna2. In human cells, in vitro studies have recently proposed a similar model of a two-step break resection. We chose to elucidate the role of one of the human homologs of Sgs1 - the RecQ helicase BLM - in the resection process. Our experiments show, that he absence of BLM decreases the efficiency of end joining by NHEJ, accompanied by an increase in error-prone events, especially long-range deletions (≥200 nt). This

  18. Comet assay to measure DNA repair: approach and applications

    OpenAIRE

    Azqueta, Amaya; SLYSKOVA, JANA; Langie, Sabine A. S.; O’Neill Gaivão, Isabel; Collins, Andrew

    2014-01-01

    Cellular repair enzymes remove virtually all DNA damage before it is fixed; repair therefore plays a crucial role in preventing cancer. Repair studied at the level of transcription correlates poorly with enzyme activity, and so assays of phenotype are needed. In a biochemical approach, substrate nucleoids containing specific DNA lesions are incubated with cell extract; repair enzymes in the extract induce breaks at damage sites; and the breaks are measured with the comet assay. The nature of ...

  19. Alkylation base damage is converted into repairable double-strand breaks and complex intermediates in G2 cells lacking AP endonuclease.

    Directory of Open Access Journals (Sweden)

    Wenjian Ma

    2011-04-01

    Full Text Available DNA double-strand breaks (DSBs are potent sources of genome instability. While there is considerable genetic and molecular information about the disposition of direct DSBs and breaks that arise during replication, relatively little is known about DSBs derived during processing of single-strand lesions, especially for the case of single-strand breaks (SSBs with 3'-blocked termini generated in vivo. Using our recently developed assay for detecting end-processing at random DSBs in budding yeast, we show that single-strand lesions produced by the alkylating agent methyl methanesulfonate (MMS can generate DSBs in G2-arrested cells, i.e., S-phase independent. These derived DSBs were observed in apn1/2 endonuclease mutants and resulted from aborted base excision repair leading to 3' blocked single-strand breaks following the creation of abasic (AP sites. DSB formation was reduced by additional mutations that affect processing of AP sites including ntg1, ntg2, and, unexpectedly, ogg1, or by a lack of AP sites due to deletion of the MAG1 glycosylase gene. Similar to direct DSBs, the derived DSBs were subject to MRX (Mre11, Rad50, Xrs2-determined resection and relied upon the recombinational repair genes RAD51, RAD52, as well as on the MCD1 cohesin gene, for repair. In addition, we identified a novel DNA intermediate, detected as slow-moving chromosomal DNA (SMD in pulsed field electrophoresis gels shortly after MMS exposure in apn1/2 cells. The SMD requires nicked AP sites, but is independent of resection/recombination processes, suggesting that it is a novel structure generated during processing of 3'-blocked SSBs. Collectively, this study provides new insights into the potential consequences of alkylation base damage in vivo, including creation of novel structures as well as generation and repair of DSBs in nonreplicating cells.

  20. A role for the malignant brain tumour (MBT domain protein LIN-61 in DNA double-strand break repair by homologous recombination.

    Directory of Open Access Journals (Sweden)

    Nicholas M Johnson

    Full Text Available Malignant brain tumour (MBT domain proteins are transcriptional repressors that function within Polycomb complexes. Some MBT genes are tumour suppressors, but how they prevent tumourigenesis is unknown. The Caenorhabditis elegans MBT protein LIN-61 is a member of the synMuvB chromatin-remodelling proteins that control vulval development. Here we report a new role for LIN-61: it protects the genome by promoting homologous recombination (HR for the repair of DNA double-strand breaks (DSBs. lin-61 mutants manifest numerous problems associated with defective HR in germ and somatic cells but remain proficient in meiotic recombination. They are hypersensitive to ionizing radiation and interstrand crosslinks but not UV light. Using a novel reporter system that monitors repair of a defined DSB in C. elegans somatic cells, we show that LIN-61 contributes to HR. The involvement of this MBT protein in HR raises the possibility that MBT-deficient tumours may also have defective DSB repair.

  1. Dynamics and Cell-Type Specificity of the DNA Double-Strand Break Repair Protein RecN in the Developmental Cyanobacterium Anabaena sp. Strain PCC 7120.

    Directory of Open Access Journals (Sweden)

    Sheng Hu

    Full Text Available DNA replication and repair are two fundamental processes required in life proliferation and cellular defense and some common proteins are involved in both processes. The filamentous cyanobacterium Anabaena sp. strain PCC 7120 is capable of forming heterocysts for N2 fixation in the absence of a combined-nitrogen source. This developmental process is intimately linked to cell cycle control. In this study, we investigated the localization of the DNA double-strand break repair protein RecN during key cellular events, such as chromosome damaging, cell division, and heterocyst differentiation. Treatment by a drug causing DNA double-strand breaks (DSBs induced reorganization of the RecN focus preferentially towards the mid-cell position. RecN-GFP was absent in most mature heterocysts. Furthermore, our results showed that HetR, a central player in heterocyst development, was involved in the proper positioning and distribution of RecN-GFP. These results showed the dynamics of RecN in DSB repair and suggested a differential regulation of DNA DSB repair in vegetative cell and heterocysts. The absence of RecN in mature heterocysts is compatible with the terminal nature of these cells.

  2. Dynamics and Cell-Type Specificity of the DNA Double-Strand Break Repair Protein RecN in the Developmental Cyanobacterium Anabaena sp. Strain PCC 7120.

    Science.gov (United States)

    Hu, Sheng; Wang, Jinglan; Wang, Li; Zhang, Cheng-Cai; Chen, Wen-Li

    2015-01-01

    DNA replication and repair are two fundamental processes required in life proliferation and cellular defense and some common proteins are involved in both processes. The filamentous cyanobacterium Anabaena sp. strain PCC 7120 is capable of forming heterocysts for N2 fixation in the absence of a combined-nitrogen source. This developmental process is intimately linked to cell cycle control. In this study, we investigated the localization of the DNA double-strand break repair protein RecN during key cellular events, such as chromosome damaging, cell division, and heterocyst differentiation. Treatment by a drug causing DNA double-strand breaks (DSBs) induced reorganization of the RecN focus preferentially towards the mid-cell position. RecN-GFP was absent in most mature heterocysts. Furthermore, our results showed that HetR, a central player in heterocyst development, was involved in the proper positioning and distribution of RecN-GFP. These results showed the dynamics of RecN in DSB repair and suggested a differential regulation of DNA DSB repair in vegetative cell and heterocysts. The absence of RecN in mature heterocysts is compatible with the terminal nature of these cells.

  3. Identification of defective illegitimate recombinational repair of oxidatively-induced DNA double-strand breaks in ataxia-telangiectasia cells

    Science.gov (United States)

    Dar, M. E.; Winters, T. A.; Jorgensen, T. J.

    1997-01-01

    Ataxia-telangiectasia (A-T) is an autosomal-recessive lethal human disease. Homozygotes suffer from a number of neurological disorders, as well as very high cancer incidence. Heterozygotes may also have a higher than normal risk of cancer, particularly for the breast. The gene responsible for the disease (ATM) has been cloned, but its role in mechanisms of the disease remain unknown. Cellular A-T phenotypes, such as radiosensitivity and genomic instability, suggest that a deficiency in the repair of DNA double-strand breaks (DSBs) may be the primary defect; however, overall levels of DSB rejoining appear normal. We used the shuttle vector, pZ189, containing an oxidatively-induced DSB, to compare the integrity of DSB rejoining in one normal and two A-T fibroblast cells lines. Mutation frequencies were two-fold higher in A-T cells, and the mutational spectrum was different. The majority of the mutations found in all three cell lines were deletions (44-63%). The DNA sequence analysis indicated that 17 of the 17 plasmids with deletion mutations in normal cells occurred between short direct-repeat sequences (removing one of the repeats plus the intervening sequences), implicating illegitimate recombination in DSB rejoining. The combined data from both A-T cell lines showed that 21 of 24 deletions did not involve direct-repeats sequences, implicating a defect in the illegitimate recombination pathway. These findings suggest that the A-T gene product may either directly participate in illegitimate recombination or modulate the pathway. Regardless, this defect is likely to be important to a mechanistic understanding of this lethal disease.

  4. The proteomic investigation reveals interaction of mdig protein with the machinery of DNA double-strand break repair.

    Science.gov (United States)

    Wang, Wei; Lu, Yongju; Stemmer, Paul M; Zhang, Xiangmin; Bi, Yongyi; Yi, Zhengping; Chen, Fei

    2015-09-29

    To investigate how mineral dust-induced gene (mdig, also named as mina53, MINA, or NO52) promotes carcinogenesis through inducing active chromatin, we performed proteomics analyses for the interacting proteins that were co-immunoprecipitated by anti-mdig antibody from either the lung cancer cell line A549 cells or the human bronchial epithelial cell line BEAS-2B cells. On SDS-PAGE gels, three to five unique protein bands were consistently observed in the complexes pulled-down by mdig antibody, but not the control IgG. In addition to the mdig protein, several DNA repair or chromatin binding proteins, including XRCC5, XRCC6, RBBP4, CBX8, PRMT5, and TDRD, were identified in the complexes by the proteomics analyses using both Orbitrap Fusion and Orbitrap XL nanoESI-MS/MS in four independent experiments. The interaction of mdig with some of these proteins was further validated by co-immunoprecipitation using antibodies against mdig and its partner proteins, respectively. These data, thus, provide evidence suggesting that mdig accomplishes its functions on chromatin, DNA repair and cell growth through interacting with the partner proteins. PMID:26293673

  5. TODRA, a lncRNA at the RAD51 Locus, Is Oppositely Regulated to RAD51, and Enhances RAD51-Dependent DSB (Double Strand Break) Repair

    Science.gov (United States)

    Renbaum, Paul; Zeligson, Sharon; Eini, Lital; Bashari, Dana; Smith, Yoav; Lahad, Amnon; Goldberg, Michal; Ginsberg, Doron; Levy-Lahad, Ephrat

    2015-01-01

    Expression of RAD51, a crucial player in homologous recombination (HR) and DNA double-strand break (DSB) repair, is dysregulated in human tumors, and can contribute to genomic instability and tumor progression. To further understand RAD51 regulation we functionally characterized a long non-coding (lnc) RNA, dubbed TODRA (Transcribed in the Opposite Direction of RAD51), transcribed 69bp upstream to RAD51, in the opposite direction. We demonstrate that TODRA is an expressed transcript and that the RAD51 promoter region is bidirectional, supporting TODRA expression (7-fold higher than RAD51 in this assay, p = 0.003). TODRA overexpression in HeLa cells induced expression of TPIP, a member of the TPTE family which includes PTEN. Similar to PTEN, we found that TPIP co-activates E2F1 induction of RAD51. Analysis of E2F1's effect on the bidirectional promoter showed that E2F1 binding to the same site that promotes RAD51 expression, results in downregulation of TODRA. Moreover, TODRA overexpression induces HR in a RAD51-dependent DSB repair assay, and increases formation of DNA damage-induced RAD51-positive foci. Importantly, gene expression in breast tumors supports our finding that E2F1 oppositely regulates RAD51 and TODRA: increased RAD51 expression, which is associated with an aggressive tumor phenotype (e.g. negative correlation with positive ER (r = -0.22, p = 0.02) and positive PR status (r = -0.27, p<0.001); positive correlation with ki67 status (r = 0.36, p = 0.005) and HER2 amplification (r = 0.41, p = 0.001)), correlates as expected with lower TODRA and higher E2F1 expression. However, although E2F1 induction resulted in TPIP downregulation in cell lines, we find that TPIP expression in tumors is not reduced despite higher E2F1 expression, perhaps contributing to increased RAD51 expression. Our results identify TPIP as a novel E2F1 co-activator, suggest a similar role for other TPTEs, and indicate that the TODRA lncRNA affects RAD51 dysregulation and RAD51

  6. The Impact of Individual In Vivo Repair of DNA Double-Strand Breaks on Oral Mucositis in Adjuvant Radiotherapy of Head-and-Neck Cancer

    International Nuclear Information System (INIS)

    Purpose: To evaluate the impact of individual in vivo DNA double-strand break (DSB) repair capacity on the incidence of severe oral mucositis in patients with head-and-neck cancer undergoing adjuvant radiotherapy (RT) or radiochemotherapy (RCT). Patients and Methods: Thirty-one patients with resected head-and-neck cancer undergoing adjuvant RT or RCT were examined. Patients underwent RT of the primary tumor site and locoregional lymph nodes with a total dose of 60–66 Gy (single dose 2 Gy, five fractions per week). Chemotherapy consisted of two cycles of cisplatin and 5-fluorouracil. To assess DSB repair, γ-H2AX foci in blood lymphocytes were quantified before and 0.5 h, 2.5 h, 5 h, and 24 h after in vivo radiation exposure (the first fraction of RT). World Health Organization scores for oral mucositis were documented weekly and correlated with DSB repair. Results: Sixteen patients received RT alone; 15 patients received RCT. In patients who developed Grade ≥ 3 mucositis (n = 18) the amount of unrepaired DSBs 24 h after radiation exposure and DSB repair half-times did not differ significantly from patients with Grade ≤2 mucositis (n = 13). Patients with a proportion of unrepaired DSBs after 24 h higher than the mean value + one standard deviation had an increased incidence of severe oral mucositis. Conclusions: Evaluation of in vivo DSB repair by determination of γ-H2AX foci loss is feasible in clinical practice and allows identification of patients with impaired DSB repair. The incidence of oral mucositis is not closely correlated with DSB repair under the evaluated conditions.

  7. Feasibility of measuring radiation-induced DNA double strand breaks and their repair by pulsed field gel electrophoresis in freshly isolated cells from the mouse RIF-1 tumor

    International Nuclear Information System (INIS)

    Purpose: To examine the technical feasibility of pulsed field gel electrophoresis (PFGE) as a predictive assay for the radio responsiveness of tumors. Induction and repair of DNA double strand breaks (DSBs) in a freshly prepared cell suspension from a RIF-1 tumor (irradiated ex vivo) was compared with DSB induction and repair in exponentially growing RIF-1 cells in culture (irradiated in vitro). Methods and Materials: A murine RIF-1 tumor grown in vivo was digested, and cells were exposed to x-rays (ex vivo) at doses of 1 to 75 Gy. DNA damage was measured using CHEF (clamped homogeneous electric fields) electrophoresis. Repair kinetics were studied at 37 deg. C for 4 h after irradiation. Radiosensitivity was determined by clonogenic assay, and cell cycle distributions by flow cytometry. For comparison, a trypsinized suspension of exponentially growing RIF-1 cells in vitro was run parallel with each ex vivo experiment. Results: Induction of DSBs, expressed as % DNA extracted from the plug, was similar in the in vitro and ex vivo irradiated cells. Compared to repair rates in in vitro cultured RIF-1 cells, repair kinetics in a freshly prepared cell suspension from the tumor were decreased, unrelated to differences in radiosensitivity. Differences in repair could not be explained by endogenous DNA degradation, nor by influences of enzymes used for digestion of the tumor. A lower plating efficiency and differences in ploidy (as revealed by flow cytometry) were the only reproducible differences between in vivo and in vitro grown cells that may explain the differences in repair kinetics. Conclusions: The current results do not support the idea that PFGE is a technique robust enough to be a predictive assay for the radiosensitivity of tumor cells

  8. Optimality in DNA repair.

    Science.gov (United States)

    Richard, Morgiane; Fryett, Matthew; Miller, Samantha; Booth, Ian; Grebogi, Celso; Moura, Alessandro

    2012-01-01

    DNA within cells is subject to damage from various sources. Organisms have evolved a number of mechanisms to repair DNA damage. The activity of repair enzymes carries its own risk, however, because the repair of two nearby lesions may lead to the breakup of DNA and result in cell death. We propose a mathematical theory of the damage and repair process in the important scenario where lesions are caused in bursts. We use this model to show that there is an optimum level of repair enzymes within cells which optimises the cell's response to damage. This optimal level is explained as the best trade-off between fast repair and a low probability of causing double-stranded breaks. We derive our results analytically and test them using stochastic simulations, and compare our predictions with current biological knowledge. PMID:21945337

  9. The MRE11 GAR motif regulates DNA double-strand break processing and ATR activation

    Institute of Scientific and Technical Information of China (English)

    Zhenbao Yu; Gillian Vogel; Yan Coulombe; Danielle Dubeau; Elizabeth Spehalski; Josée Hébert; David O Ferguson; Jean Yves Masson; Stéphane Richard

    2012-01-01

    The MRE11/RAD50/NBS1 complex is the primary sensor rapidly recruited to DNA double-strand breaks (DSBs).MRE11 is known to be arginine methylated by PRMT1 within its glycine-arginine-rich (GAR) motif.In this study,we report a mouse knock-in allele of Mre11 that substitutes the arginines with lysines in the GAR motif and generates the MRE11RK protein devoid of methylated arginines.The Mre11RK/RK mice were hypersensitive to γ-irradiation (IR) and the cells from these mice displayed cell cycle checkpoint defects and chromosome instability.Moreover,the Mre11RK/RK MEFs exhibited ATR/CHK1 signaling defects and impairment in the recruitment of RPA and RAD51 to the damaged sites.The MRKRN complex formed and localized to the sites of DNA damage and normally activated the ATM pathway in response to IR.The MRKRN complex exhibited exonuclease and DNA-binding defects in vitro responsible for the impaired DNA end resection and ATR activation observed in vivo in response to IR.Our findings provide genetic evidence for the critical role of the MRE11 GAR motif in DSB repair,and demonstrate a mechanistic link between post-translational modifications at the MRE11 GAR motif and DSB processing,as well as the ATR/CHK1 checkpoint signaling.

  10. Active and break events of Indian summer monsoon during 1901-2014

    Digital Repository Service at National Institute of Oceanography (India)

    Pai, D.S.; Sridhar, L.; RameshKumar, M.R.

    The study lists active and break monsoon events over India over a very long period (1901-2014) identified using criteria based on a rainfall index derived over a critical high rainfall region called core monsoon zone. The break and active spells...

  11. Signalization and repair of the DNA double-strand breaks of in the cerebral tumors: modulation of the radiation response with the chemotherapy treatments

    International Nuclear Information System (INIS)

    There are about 6000 new cases of nervous system tumours each year in France. However, the current radio chemotherapeutic approaches against brain tumours remain still insufficient to produce a satisfactory therapeutic index. In parallel, the knowledge of the early radiobiological events has considerably progressed in the last few years. This thesis aims to provide new insights in the molecular and cellular response of brain tumours to radio chemotherapy. This thesis was divided into four stages. Stage 1: a novel DNA double-strand breaks repair pathway depending on the MRE11 protein but independent of the phosphorylation of H2AX emerged from the study of artefacts of the immunofluorescence technique and a systematic analysis of the radiosensitivity of human cells. Stage 2: the radiobiological features of 3 rodent models of glioma among the most used in preclinical trials and of 7 human glioma cell lines were investigated. Functional impairments of the BRCA1 protein in response to radiation and/or cisplatin were observed in the majority of the models tested, raising the question of the role of this protein in the anti-glioma treatments and in glioma genesis. Stage 3: in order to extend our approach to genetic syndromes associated with cerebral tumours predisposition, the radiobiological characteristics of the fibroblasts resulting from patients suffering from neurofibromatosis type 1 (NF1), a pathology associated with a strong incidence of peripheral nervous system tumours, were investigated. NF1 appeared to be a syndrome with moderated radiosensitivity, associated with a weak deficiency of DNA end-joining repair but with a strong activity of MRE11. These results enabled us to propose a preliminary model involving both proteins BRCA1 and NF1. Stage 4: considering the role of BRCA1 in the inhibition of some tyrosine kinase activity and in the response to cisplatin, we tested the radiobiological effects of treatments combining radiation, cisplatin and tyrosine kinase

  12. Survey of Active Structural Control and Repair Using Piezoelectric Patches

    Directory of Open Access Journals (Sweden)

    Ahmed Abuzaid

    2015-05-01

    Full Text Available The piezoelectric actuator has gained popularity over the last few years. Attention has been directed towards the study of their electromechanical response in active repair and the control of damaged structures. This has been made possible through the development of various numerical and analytical techniques for such studies. The shift of focus towards the piezoelectric based approaches has been due to their advantages, which include strategic cost benefits in maintenance, as well as an increase in the life cycle of the repaired structures. Furthermore, adhesively bonded joints are widely used in the manufacturing and repairing of structures in many industries, especially automotive and aerospace engineering. This is due to the requirement for lightweight materials as well as the potential adhesive used to join materials with different characteristics. The piezoelectric actuator has also shown the capacity in controlling and lowering the shear stress concentration and joint edge peel in adhesively bonded joint systems. The structure’s control of stress and repair can generally be viewed as a reinforcement that influences the structure’s damage tolerance. Therefore, the interest of this review is on the applications of the piezoelectric actuators in both structural damage and the bonded adhesive joint system. The specific goal is to recognize the contemporary scientific challenges, including future opportunities.

  13. Comet assay analysis of repair of DNA strand breaks in normal and deficient human cells exposed to radiations and chemicals. Evidence for a repair pathway specificity of DNA ligation

    International Nuclear Information System (INIS)

    The induction and resealing of DNA strand breaks in a cell line with a proven defect in DNA ligase I, 46BR, and in two Bloom's syndrome cell lines. YBL6 and GM 1492, were compared to those observed in normal human 1BR/3 fibroblasts after treatment with a variety of genotoxic agents whose lesions are processed by different repair pathways. This analysis was performed using the single-cell gel electrophoresis assay. The three types of cells were found to have similar capabilities to recognize and incise ultraviolet photoproducts and also demonstrated similar amounts of DNA breaks immediately after γ irradiation. During post-treatment incubation, 46BR cells showed a marked DNA re-ligation defect after ultraviolet radiation damage, GM 1492 cells demonstrated a highly reduced DNA joining ability after relatively high doses of ultraviolet radiation, and YBL6 cells were particularly affected in DNA re-ligation after damage by 4-nitroquinoline-1-oxide. The two Bloom's syndrome cell lines and 46BR cells had a nearly normal ability to reseal breaks resulting from γ irradiation or treatment with xanthine plus xanthine oxidase. These findings suggest that different DNA ligases may be involved in different DNA repair pathways in human cells. 60 refs., 7 figs

  14. Kinetic analysis of Yersinia pestis DNA adenine methyltransferase activity using a hemimethylated molecular break light oligonucleotide.

    Directory of Open Access Journals (Sweden)

    Robert J Wood

    Full Text Available BACKGROUND: DNA adenine methylation plays an important role in several critical bacterial processes including mismatch repair, the timing of DNA replication and the transcriptional control of gene expression. The dependence of bacterial virulence on DNA adenine methyltransferase (Dam has led to the proposal that selective Dam inhibitors might function as broad spectrum antibiotics. METHODOLOGY/PRINCIPAL FINDINGS: Herein we report the expression and purification of Yersinia pestis Dam and the development of a continuous fluorescence based assay for DNA adenine methyltransferase activity that is suitable for determining the kinetic parameters of the enzyme and for high throughput screening against potential Dam inhibitors. The assay utilised a hemimethylated break light oligonucleotide substrate containing a GATC methylation site. When this substrate was fully methylated by Dam, it became a substrate for the restriction enzyme DpnI, resulting in separation of fluorophore (fluorescein and quencher (dabcyl and therefore an increase in fluorescence. The assays were monitored in real time using a fluorescence microplate reader in 96 well format and were used for the kinetic characterisation of Yersinia pestis Dam, its substrates and the known Dam inhibitor, S-adenosylhomocysteine. The assay has been validated for high throughput screening, giving a Z-factor of 0.71+/-0.07 indicating that it is a sensitive assay for the identification of inhibitors. CONCLUSIONS/SIGNIFICANCE: The assay is therefore suitable for high throughput screening for inhibitors of DNA adenine methyltransferases and the kinetic characterisation of the inhibition.

  15. Inter-individual variation in DNA double-strand break repair in human fibroblasts before and after exposure to low doses of ionizing radiation

    International Nuclear Information System (INIS)

    DNA double-strand breaks (DSB) are generally considered the most critical lesion induced by ionizing radiation (IR) and may initiate carcinogenesis and other disease. Using an immunofluorescence assay to simultaneously detect nuclear foci of the phosphorylated forms of histone H2AX and ATM kinase at sites of DSBs, we examined the response of 25 apparently normal and 10 DNA repair-deficient (ATM, ATR, NBN, LIG1, LIG4, and FANCG) primary fibroblast strains irradiated with low doses of 137Cs γ-rays. Quiescent G0/G1-phase cultures were exposed to 5, 10, and 25 cGy and allowed to repair for 24 h. The maximum level of IR-induced foci (0.15 foci per cGy, at 10 or 30 min) in the normal strains showed much less inter-individual variation (CV ∼ 0.2) than the level of spontaneous foci, which ranged from 0.2-2.6 foci/cell (CV ∼ 0.6; mean ± SD of 1.00 ± 0.57). Significantly slower focus formation post-irradiation was observed in seven normal strains, similar to most mutant strains examined. There was variation in repair efficiency measured by the fraction of IR-induced foci remaining 24 h post-irradiation, curiously with the strains having slower focus formation showing more efficient repair after 25 cGy. Interestingly, the ranges of spontaneous and residual induced foci levels at 24 h in the normal strains were as least as large as those observed for the repair-defective mutant strains. The inter-individual variation in DSB foci parameters observed in cells exposed to low doses of ionizing radiation in this small survey of apparently normal people suggests that hypomorphic genetic variants in genomic maintenance and/or DNA damage signaling and repair genes may contribute to differential susceptibility to cancer induced by environmental mutagens.

  16. Studies on the repair of double strand break of DNA and cellular carcinogenesis, and consideration on the concept of extinction of nuclear power

    International Nuclear Information System (INIS)

    This paper describes the relationship between the repair of double strand break (DSB) of DNA and cellular carcinogenesis mainly on author's investigations, and his recent thought aiming at the extinction of nuclear power. The molecular repairing system is explained about DNA DSB induced by radiation and chemicals. When DSB occurs, nucleosome consisting from 4 core-histones participates to link the broken ends and then repair mechanisms of homologous recombination (HRR) and non-homologous end joining (NHEJ) begin to work. The latter is dominant in mammalians. Thus the genetic defect in these systems of DSB response and repair is a course of disorders such as ataxia telangiectasia (AT) (DSB sensor defect), genetic breast cancer (HRR defect), and radiosensitive-severe combined immunodeficiency (RS-SCID) (NHEJ defect), all of which result in cancer formation. NHEJ repair is known to be error-prone. Against multi-step carcinogenesis where accumulated gene mutations lead to the cancer formation, the author thinks chromosomal instability is one of important carcinogenic causes: the instability can be a trigger of producing cancer stem cells because the cells can be yielded from mouse embryonic stem cells where DSB is shown to participate in the process. Low dose radiation produces a small amount of DSB, to which the repair response is less sensitive at G2/M checkpoint, ultimately leading to genomic instability. Considering effects of the low dose radiation exposure above, and of the internal exposure to 3H-thymidine beta ray in cells, of indoor Rn participating 16% of lung cancer incidence (Canadian epidemiological data) and so on, together with moral and social responsibility of scientist and technologist, the author says to have attained to the concept of the ''Extinction of Nuclear Power''. (T.T)

  17. Reduced DNA double-strand break repair capacity and risk of squamous cell carcinoma of the head and neck-A case-control study.

    Science.gov (United States)

    Liu, Zhensheng; Liu, Hongliang; Gao, Fengqin; Dahlstrom, Kristina R; Sturgis, Erich M; Wei, Qingyi

    2016-04-01

    Tobacco smoke and alcohol use play important roles in the etiology of squamous cell carcinoma of the head and neck (SCCHN). Smoking causes DNA damage, including double-strand DNA breaks (DSBs), that leads to carcinogenesis. To test the hypothesis that suboptimal DSB repair capacity is associated with risk of SCCHN, we applied a flow cytometry-based method to detect the DSB repair phenotype first in four EBV-immortalized human lymphoblastoid cell lines and then in human peripheral blood T-lymphocytes (PBTLs). With this blood-based laboratory assay, we conducted a pilot case-control study of 100 patients with newly diagnosed, previously untreated SCCHN and 124 cancer-free controls of non-Hispanic whites. We found that the mean DSB repair capacity level was significantly lower in cases (42.1%) than that in controls (54.4%) (P<0.001). When we used the median DSB repair capacity level in the controls as the cutoff value for calculating the odds ratios (ORs) with adjustment for age, sex, smoking and drinking status, the cases were more likely than the controls to have a reduced DSB repair capacity (adjusted OR=1.93; 95% confidence interval, CI=1.04-3.56, P=0.037), especially for those subjects who were ever drinkers (adjusted OR=2.73; 95% CI=1.17-6.35, P=0.020) and had oropharyngeal tumors (adjusted OR=2.17; 95% CI=1.06-4.45, P=0.035). In conclusion, these findings suggest that individuals with a reduced DSB repair capacity may be at an increased risk of developing SCCHN. Larger studies are warranted to confirm these preliminary findings. PMID:26963119

  18. Survey of Active Structural Control and Repair Using Piezoelectric Patches

    OpenAIRE

    Ahmed Abuzaid; Meftah Hrairi; M.S.I. Shaik Dawood

    2015-01-01

    The piezoelectric actuator has gained popularity over the last few years. Attention has been directed towards the study of their electromechanical response in active repair and the control of damaged structures. This has been made possible through the development of various numerical and analytical techniques for such studies. The shift of focus towards the piezoelectric based approaches has been due to their advantages, which include strategic cost benefits in maintenance, as well as an incr...

  19. DNA breaks caused by monochromatic 365 nm ultraviolet-A radiation or hydrogen peroxide and their repair in human epithelioid and xeroderma pigmentosum cells

    International Nuclear Information System (INIS)

    The induction and repair of DNA single-strand breaks (SSB) assayed by alkaline filter elution was compared in human epithelioid P3 and xeroderma pigmentosum (XP) cells exposed to monochromatic 365-nm UV-A radiation and H2O2. Initial yields of SSB were measured with the cells held at 0.5oC during exposure. The yield from exposure to 365-nm radiation was slightly greater in XP than in P3 cells, whereas H2O2 produced more than three times as many SSB in P3 compared with XP cells. o-Phenanthroline (50 mM) markedly inhibited the yields of SSB induced in XP cells by H2O2, but had no effect on those produced by 365-nm UV-A. These results are consistent with the fact that P3 cells, unlike XP cells, have undetectable levels of catalase. The measured production of trace amounts of H2O2 by the actual 365-nm UV0A exposures was not sufficient to account for the numbers of breaks that were observed. Single-strand breaks produced by both agents were completely repaired after 50 min in P3 cells, as were H2O2-induced SSB in XP cells. However, 25% of the 365-nm UV-A-induced SSB in XP cells remained refractory to repair after 60 min. The results show that SSB produced by these two agents are different and that 365 nm radiation produces most SSB in cells by mechanisms other than by production of H2O2. (author)

  20. DNA breaks caused by monochromatic 365 nm ultraviolet-A radiation or hydrogen peroxide and their repair in human epithelioid and xeroderma pigmentosum cells.

    Science.gov (United States)

    Peak, J G; Pilas, B; Dudek, E J; Peak, M J

    1991-08-01

    The induction and repair of DNA single-strand breaks (SSB) assayed by alkaline filter elution was compared in human epithelioid P3 and xeroderma pigmentosum (XP) cells exposed to monochromatic 365-nm UV-A radiation and H2O2. Initial yields of SSB were measured with the cells held at 0.5 degrees C during exposure. The yield from exposure to 365-nm radiation was slightly greater in XP than in P3 cells, whereas H2O2 produced more than three times as many SSB in P3 compared with XP cells. o-Phenanthroline (50 mM) markedly inhibited the yields of SSB induced in XP cells by H2O2, but had no effect on those produced by 365-nm UV-A. These results are consistent with the fact that P3 cells, unlike XP cells, have undetectable levels of catalase. The measured production of trace amounts of H2O2 by the actual 365-nm UV-A exposures was not sufficient to account for the numbers of breaks that were observed. Single-strand breaks produced by both agents were completely repaired after 50 min in P3 cells, as were H2O2-induced SSB in XP cells. However, 25% of the 365-nm UV-A-induced SSB in XP cells remained refractory to repair after 60 min. The results show that SSB produced by these two agents are different and that 365 nm radiation produces most SSB in cells by mechanisms other than by production of H2O2. PMID:1780357

  1. The role of the Mre11-Rad50-Nbs1 complex in double-strand break repair-facts and myths.

    Science.gov (United States)

    Takeda, Shunichi; Hoa, Nguyen Ngoc; Sasanuma, Hiroyuki

    2016-08-01

    Homologous recombination (HR) initiates double-strand break (DSB) repair by digesting 5'-termini at DSBs, the biochemical reaction called DSB resection, during which DSBs are processed by nucleases to generate 3' single-strand DNA. Rad51 recombinase polymerizes along resected DNA, and the resulting Rad51-DNA complex undergoes homology search. Although DSB resection by the Mre11 nuclease plays a critical role in HR in Saccharomyces cerevisiae, it remains elusive whether DSB resection by Mre11 significantly contributes to HR-dependent DSB repair in mammalian cells. Depletion of Mre11 decreases the efficiency of DSB resection only by 2- to 3-fold in mammalian cells. We show that although Mre11 is required for efficient HR-dependent repair of ionizing-radiation-induced DSBs, Mre11 is largely dispensable for DSB resection in both chicken DT40 and human TK6 B cell lines. Moreover, a 2- to 3-fold decrease in DSB resection has virtually no impact on the efficiency of HR. Thus, although a large number of researchers have reported the vital role of Mre11-mediated DSB resection in HR, the role may not explain the very severe defect in HR in Mre11-deficient cells, including their lethality. We here show experimental evidence for the additional roles of Mre11 in (i) elimination of chemical adducts from DSB ends for subsequent DSB repair, and (ii) maintaining HR intermediates for their proper resolution.

  2. The Vitamin A Derivative All-Trans Retinoic Acid Repairs Amyloid-β-Induced Double-Strand Breaks in Neural Cells and in the Murine Neocortex

    Directory of Open Access Journals (Sweden)

    Emmanuelle Gruz-Gibelli

    2016-01-01

    Full Text Available The amyloid-β peptide or Aβ is the key player in the amyloid-cascade hypothesis of Alzheimer’s disease. Aβ appears to trigger cell death but also production of double-strand breaks (DSBs in aging and Alzheimer’s disease. All-trans retinoic acid (RA, a derivative of vitamin A, was already known for its neuroprotective effects against the amyloid cascade. It diminishes, for instance, the production of Aβ peptides and their oligomerisation. In the present work we investigated the possible implication of RA receptor (RAR in repair of Aβ-induced DSBs. We demonstrated that RA, as well as RAR agonist Am80, but not AGN 193109 antagonist, repair Aβ-induced DSBs in SH-SY5Y cells and an astrocytic cell line as well as in the murine cortical tissue of young and aged mice. The nonhomologous end joining pathway and the Ataxia Telangiectasia Mutated kinase were shown to be involved in RA-mediated DSBs repair in the SH-SY5Y cells. Our data suggest that RA, besides increasing cell viability in the cortex of young and even of aged mice, might also result in targeted DNA repair of genes important for cell or synaptic maintenance. This phenomenon would remain functional up to a point when Aβ increase and RA decrease probably lead to a pathological state.

  3. The role of the Mre11-Rad50-Nbs1 complex in double-strand break repair-facts and myths.

    Science.gov (United States)

    Takeda, Shunichi; Hoa, Nguyen Ngoc; Sasanuma, Hiroyuki

    2016-08-01

    Homologous recombination (HR) initiates double-strand break (DSB) repair by digesting 5'-termini at DSBs, the biochemical reaction called DSB resection, during which DSBs are processed by nucleases to generate 3' single-strand DNA. Rad51 recombinase polymerizes along resected DNA, and the resulting Rad51-DNA complex undergoes homology search. Although DSB resection by the Mre11 nuclease plays a critical role in HR in Saccharomyces cerevisiae, it remains elusive whether DSB resection by Mre11 significantly contributes to HR-dependent DSB repair in mammalian cells. Depletion of Mre11 decreases the efficiency of DSB resection only by 2- to 3-fold in mammalian cells. We show that although Mre11 is required for efficient HR-dependent repair of ionizing-radiation-induced DSBs, Mre11 is largely dispensable for DSB resection in both chicken DT40 and human TK6 B cell lines. Moreover, a 2- to 3-fold decrease in DSB resection has virtually no impact on the efficiency of HR. Thus, although a large number of researchers have reported the vital role of Mre11-mediated DSB resection in HR, the role may not explain the very severe defect in HR in Mre11-deficient cells, including their lethality. We here show experimental evidence for the additional roles of Mre11 in (i) elimination of chemical adducts from DSB ends for subsequent DSB repair, and (ii) maintaining HR intermediates for their proper resolution. PMID:27311583

  4. DNA double-strand break repair, DNA-PK, and DNA ligases in two human squamous carcinoma cell lines with different radiosensitivity

    International Nuclear Information System (INIS)

    Purpose: Variation in sensitivity to radiotherapy among tumors has been related to the capacity of cells to repair radiation-induced DNA double-strand breaks (DSBs). DNA-dependent protein kinase (DNA-PK) and DNA ligases may affect DNA dsb rejoining. This study was performed to compare rate of rejoining of radiation-induced DSBs, DNA-PK, and DNA ligase activities in two human squamous carcinoma cell lines with different sensitivity to ionizing radiation. Methods and Materials: Cell survival of two human squamous carcinoma cell lines, UM-SCC-1 and UM-SCC-14A, was determined by an in vitro clonogenic assay. DSB rejoining was studied using pulsed field gel electrophoresis (PFGE). DNA-PK activity was determined using BIOTRAK DNA-PK enzyme assay system (Amersham). DNA ligase activity in crude cell extracts was measured using [5'-33P] Poly (dA)·(oligo (dT) as a substrate. Proteolytic degradation of proteins was analyzed by means of Western blotting. Results: Applying the commonly used linear-quadratic equation to describe cell survival, S = e-αD-βD2, the two cell lines roughly have the same α value (∼0.40 Gy-1) whereas the β value was considerably higher in UM-SCC-14A (0.067 Gy-2 ± 0.007 Gy-2 [SEM]) as compared to UM-SCC-1 (0.013 Gy-2 ± 0.004 Gy-2 [SEM]). Furthermore, UM-SCC-1 was more proficient in rejoining of X-ray-induced DSBs as compared to UM-SCC-14A as quantified by PFGE. The constitutive level of DNA-PK activity was 1.6 times higher in UM-SCC-1 as compared to UM-SCC-14A (p < 0.05). The constitutive level of DNA ligase activity was similar in the two cell lines. Conclusions: The results suggest that the proficiency in rejoining of DSBs is associated with DNA-PK activity but not with total DNA ligase activity

  5. Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Khong Bee, E-mail: dmskkb@nccs.com.sg [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore); Zhu Congju; Wong Yinling; Gao Qiuhan; Ty, Albert; Wong, Meng Cheong [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore)

    2012-05-01

    Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)-Akt-DNA-dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, {gamma}-H{sub 2}AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, {gamma}-H{sub 2}AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G{sub 2}/M arrest and increased {gamma}-H{sub 2}AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased {gamma}-H{sub 2}AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are

  6. Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

    International Nuclear Information System (INIS)

    Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)–Akt-DNA–dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, γ-H2AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, γ-H2AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G2/M arrest and increased γ-H2AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased γ-H2AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are resistant to irradiation-induced cytotoxicity, G2/M

  7. Complex formation in yeast double-strand break repair: participation of Rad51, Rad52, Rad55, and Rad57 proteins.

    OpenAIRE

    Hays, S L; Firmenich, A A; Berg, P

    1995-01-01

    The repair of DNA double-strand breaks in Saccharomyces cerevisiae requires genes of the RAD52 epistasis group, of which RAD55 and RAD57 are members. Here, we show that the x-ray sensitivity of rad55 and rad57 mutant strains is suppressible by overexpression of RAD51 or RAD52. Virtually complete suppression is provided by the simultaneous overexpression of RAD51 and RAD52. This suppression occurs at 23 degrees C, where these mutants are more sensitive to x-rays, as well as at 30 degrees C and...

  8. Depletion of tyrosyl DNA phosphodiesterase 2 activity enhances etoposide-mediated double-strand break formation and cell killing.

    Science.gov (United States)

    Kont, Yasemin Saygideger; Dutta, Arijit; Mallisetty, Apurva; Mathew, Jeena; Minas, Tsion; Kraus, Christina; Dhopeshwarkar, Priyanka; Kallakury, Bhaskar; Mitra, Sankar; Üren, Aykut; Adhikari, Sanjay

    2016-07-01

    DNA topoisomerase 2 (Top2) poisons, including common anticancer drugs etoposide and doxorubicin kill cancer cells by stabilizing covalent Top2-tyrosyl-DNA 5'-phosphodiester adducts and DNA double-strand breaks (DSBs). Proteolytic degradation of the covalently attached Top2 leaves a 5'-tyrosylated blocked termini which is removed by tyrosyl DNA phosphodiesterase 2 (TDP2), prior to DSB repair through non-homologous end joining (NHEJ). Thus, TDP2 confers resistance of tumor cells to Top2-poisons by repairing such covalent DNA-protein adducts, and its pharmacological inhibition could enhance the efficacy of Top2-poisons. We discovered NSC111041, a selective inhibitor of TDP2, by optimizing a high throughput screening (HTS) assay for TDP2's 5'-tyrosyl phosphodiesterase activity and subsequent validation studies. We found that NSC111041 inhibits TDP2's binding to DNA without getting intercalated into DNA and enhanced etoposide's cytotoxicity synergistically in TDP2-expressing cells but not in TDP2 depleted cells. Furthermore, NSC111041 enhanced formation of etoposide-induced γ-H2AX foci presumably by affecting DSB repair. Immuno-histochemical analysis showed higher TDP2 expression in a sub-set of different type of tumor tissues. These findings underscore the feasibility of clinical use of suitable TDP2 inhibitors in adjuvant therapy with Top2-poisons for a sub-set of cancer patients with high TDP2 expression. PMID:27235629

  9. Vaginal pressure during daily activities before and after vaginal repair

    DEFF Research Database (Denmark)

    Mouritsen, L; Hulbaek, M; Brostrøm, S;

    2007-01-01

    , pelvic floor contraction (PFC), coughing, Valsalva, rising from sitting to standing and lifting 2 and 5 kg with four different lifting techniques. VP was measured before, 1-5 days and 4-6 weeks after vaginal repair. Mean VP was four to five times higher during coughing and Valsalva compared to PFC...... and lifting 2 and 5 kg. Lifting in the walking position created a slightly higher VP compared to other lifting techniques, which did not differ. The VP did not increase when lifting 5 kg compared to 2 kg. Mean VP during coughing and Valsalva were significantly lower 1-5 days after the operation. VP...... was not related to the type of vaginal repair. The results imply that post-operative counselling should concentrate more on treating chronic cough and constipation than restrictions of moderate physical activities....

  10. Vaginal pressure during daily activities before and after vaginal repair

    DEFF Research Database (Denmark)

    Mouritsen, L; Hulbaek, M; Brostrøm, S;

    2007-01-01

    , pelvic floor contraction (PFC), coughing, Valsalva, rising from sitting to standing and lifting 2 and 5 kg with four different lifting techniques. VP was measured before, 1-5 days and 4-6 weeks after vaginal repair. Mean VP was four to five times higher during coughing and Valsalva compared to PFC and...... lifting 2 and 5 kg. Lifting in the walking position created a slightly higher VP compared to other lifting techniques, which did not differ. The VP did not increase when lifting 5 kg compared to 2 kg. Mean VP during coughing and Valsalva were significantly lower 1-5 days after the operation. VP was not...... related to the type of vaginal repair. The results imply that post-operative counselling should concentrate more on treating chronic cough and constipation than restrictions of moderate physical activities....

  11. DNA Strand Breaks, Photoproducts, and Repair in Analog Space and Mars Environments: Implications for Microbial Interplanetary Transfer

    Science.gov (United States)

    Nicholson, W. L.; Möller, R.; Douki, T.; Robles, J.; Bruno, G.; Fajardo-Cavazos, P.; Schuerger, A. C.

    2008-03-01

    Bacterial spores are considered good candidates for interplanetary transport by natural impacts or human spaceflight. In this work we consider the mechanisms of DNA damage and repair in spores subjected to a hypothetical Earth-to-Mars transfer.

  12. The roles of APE1, APE2, DNA polymerase β and mismatch repair in creating S region DNA breaks during antibody class switch

    OpenAIRE

    Schrader, Carol E.; Guikema, Jeroen E.J.; Wu, Xiaoming; Stavnezer, Janet

    2008-01-01

    Immunoglobulin class switch recombination (CSR) occurs by an intrachromosomal deletion requiring generation of double-stranded DNA breaks (DSBs) in immunoglobulin switch region DNA. The initial steps of DSB formation have been elucidated: cytosine deamination by activation-induced cytidine deaminase (AID) and the generation of abasic sites by uracil-DNA glycosylase (UNG). We show that abasic sites are converted into single-strand breaks (SSBs) by apurinic/apyrimidinic endonucleases (APE1 and ...

  13. Evaluation of a new range of light-activated surgical adhesives for tissue repair in a porcine model

    Science.gov (United States)

    Riley, Jill N.; Hodges, Diane E.; March, Keith L.; McNally-Heintzelman, Karen M.

    2001-05-01

    An in vitro study was conducted to determine the feasibility of using a new range of light-activated surgical adhesives for incision repair in a wide range of tissue types. Biodegradable polymer membranes of controlled porosity were fabricated with poly(L-lactic-co-glycolic acid) (PLGA) and salt particles using a solvent-casting and particulate- leaching technique. The porous membranes were doped with protein solder composed of 50%(w/v) bovine serum albumin solder and 0.5 mg/ml indocyanine green (ICG) dye mixed in deionized water. Tissue incisions were repaired using the surgical adhesive in conjunction with an 805-nm diode laser. Nine organs were tested ranging from skin to liver to the small intestine, as well as the coronary, pulmonary, carotid, femoral and splenetic arteries. Acute breaking strengths were measured and the data were analyzed by Student's T-test. Repairs formed on the small intestine were most successful followed by spleen, atrium, kidney, muscle and skin. The strongest vascular repairs were achieved in the carotid artery and femoral artery. The new surgical adhesive could possibly be used as a simple and effective method to stop bleeding and repair tissue quickly in an emergency situation, or as a substitute to mechanical staples or sutures in many clinical applications.

  14. MCM8 is required for a pathway of meiotic double-strand break repair independent of DMC1 in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Wayne Crismani

    Full Text Available Mini-chromosome maintenance (MCM 2-9 proteins are related helicases. The first six, MCM2-7, are essential for DNA replication in all eukaryotes. In contrast, MCM8 is not always conserved in eukaryotes but is present in Arabidopsis thaliana. MCM8 is required for 95% of meiotic crossovers (COs in Drosophila and is essential for meiosis completion in mouse, prompting us to study this gene in Arabidopsis meiosis. Three allelic Atmcm8 mutants showed a limited level of chromosome fragmentation at meiosis. This defect was dependent on programmed meiotic double-strand break (DSB formation, revealing a role for AtMCM8 in meiotic DSB repair. In contrast, CO formation was not affected, as shown both genetically and cytologically. The Atmcm8 DSB repair defect was greatly amplified in the absence of the DMC1 recombinase or in mutants affected in DMC1 dynamics (sds, asy1. The Atmcm8 fragmentation defect was also amplified in plants heterozygous for a mutation in either recombinase, DMC1 or RAD51. Finally, in the context of absence of homologous chromosomes (i.e. haploid, mutation of AtMCM8 also provoked a low level of chromosome fragmentation. This fragmentation was amplified by the absence of DMC1 showing that both MCM8 and DMC1 can promote repair on the sister chromatid in Arabidopsis haploids. Altogether, this establishes a role for AtMCM8 in meiotic DSB repair, in parallel to DMC1. We propose that MCM8 is involved with RAD51 in a backup pathway that repairs meiotic DSB without giving CO when the major pathway, which relies on DMC1, fails.

  15. Double-strand break repair and colorectal cancer: gene variants within 3′ UTRs and microRNAs binding as modulators of cancer risk and clinical outcome

    Science.gov (United States)

    Naccarati, Alessio; Rosa, Fabio; Vymetalkova, Veronika; Barone, Elisa; Jiraskova, Katerina; Di Gaetano, Cornelia; Novotny, Jan; Levy, Miroslav; Vodickova, Ludmila; Gemignani, Federica; Buchler, Tomas; Landi, Stefano

    2016-01-01

    Genetic variations in 3′ untranslated regions of target genes may affect microRNA binding, resulting in differential protein expression. microRNAs regulate DNA repair, and single-nucleotide polymorphisms in miRNA binding sites (miRSNPs) may account for interindividual differences in the DNA repair capacity. Our hypothesis is that miRSNPs in relevant DNA repair genes may ultimately affect cancer susceptibility and impact prognosis. In the present study, we analysed the association of polymorphisms in predicted microRNA target sites of double-strand breaks (DSBs) repair genes with colorectal cancer (CRC) risk and clinical outcome. Twenty-one miRSNPs in non-homologous end-joining and homologous recombination pathways were assessed in 1111 cases and 1469 controls. The variant CC genotype of rs2155209 in MRE11A was strongly associated with decreased cancer risk when compared with the other genotypes (OR 0.54, 95% CI 0.38–0.76, p = 0.0004). A reduced expression of the reporter gene was observed for the C allele of this polymorphism by in vitro assay, suggesting a more efficient interaction with potentially binding miRNAs. In colon cancer patients, the rs2155209 CC genotype was associated with shorter survival while the TT genotype of RAD52 rs11226 with longer survival when both compared with their respective more frequent genotypes (HR 1.63, 95% CI 1.06-2.51, p = 0.03 HR 0.60, 95% CI 0.41–0.89, p = 0.01, respectively). miRSNPs in DSB repair genes involved in the maintenance of genomic stability may have a role on CRC susceptibility and clinical outcome. PMID:26735576

  16. Either non-homologous ends joining or homologous recombination is required to repair double-strand breaks in the genome of macrophage-internalized Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Anna Brzostek

    Full Text Available The intracellular pathogen Mycobacterium tuberculosis (Mtb is constantly exposed to a multitude of hostile conditions and is confronted by a variety of potentially DNA-damaging assaults in vivo, primarily from host-generated antimicrobial toxic radicals. Exposure to reactive nitrogen species and/or reactive oxygen species causes different types of DNA damage, including oxidation, depurination, methylation and deamination, that can result in single- or double-strand breaks (DSBs. These breaks affect the integrity of the whole genome and, when left unrepaired, can lead to cell death. Here, we investigated the role of the DSB repair pathways, homologous recombination (HR and non-homologous ends joining (NHEJ, in the survival of Mtb inside macrophages. To this end, we constructed Mtb strains defective for HR (ΔrecA, NHEJ [Δ(ku,ligD], or both DSB repair systems [Δ(ku,ligD,recA]. Experiments using these strains revealed that either HR or NHEJ is sufficient for the survival and propagation of tubercle bacilli inside macrophages. Inhibition of nitric oxide or superoxide anion production with L-NIL or apocynin, respectively, enabled the Δ(ku,ligD,recA mutant strain lacking both systems to survive intracellularly. Complementation of the Δ(ku,ligD,recA mutant with an intact recA or ku-ligD rescued the ability of Mtb to propagate inside macrophages.

  17. DSB修复过程中的组蛋白修饰作用%Histone Modifications in DNA Double-Strand Breaks Damage Repair

    Institute of Scientific and Technical Information of China (English)

    贾兆君; 伍会健

    2013-01-01

    DNA doubled-strand breaks (DSBs) which is the most serious species in DNA damage can lead to the loss of genetic message or even cell death.To resist DSB damage,the organism has developed a DNA-damage response (DDR) mechanism for DNA damage repair to avoid the transfer of inaccurate genetic message.In this process,histone which is the main structural protein of chromatin is regulated by multi-modifications,such as phosphorylation,methylation,acetylation,ubiquitination and so on.These modifications of histones promote the recruitment of DDR-related protein to the site of DNA damage in the process of DNA damage repair,and change chromatin structure to facilitate repair progress in DDR.%DNA双键断裂(DNA doubled-strand breaks,DSBs)是目前已知DNA损伤中最为严重的一种,会造成遗传信息丢失,甚至细胞死亡.为了应对DSB损伤,生命体进化出DNA损伤应答(DNA-damage response,DDR)机制,进行损伤修复以防止错误遗传信息的传递.在这一过程中,作为染色质主要结构蛋白的组蛋白发生多种修饰,包括磷酸化、甲基化、乙酰化、泛素化等.这些组蛋白修饰促进DDR相关蛋白在DNA损伤处的招募,并改变染色质结构,以促进修复过程顺利进行.

  18. β-HPV 5 and 8 E6 disrupt homology dependent double strand break repair by attenuating BRCA1 and BRCA2 expression and foci formation.

    Directory of Open Access Journals (Sweden)

    Nicholas A Wallace

    2015-03-01

    Full Text Available Recent work has explored a putative role for the E6 protein from some β-human papillomavirus genus (β-HPVs in the development of non-melanoma skin cancers, specifically β-HPV 5 and 8 E6. Because these viruses are not required for tumor maintenance, they are hypothesized to act as co-factors that enhance the mutagenic capacity of UV-exposure by disrupting the repair of the resulting DNA damage. Supporting this proposal, we have previously demonstrated that UV damage signaling is hindered by β-HPV 5 and 8 E6 resulting in an increase in both thymine dimers and UV-induced double strand breaks (DSBs. Here we show that β-HPV 5 and 8 E6 further disrupt the repair of these DSBs and provide a mechanism for this attenuation. By binding and destabilizing a histone acetyltransferase, p300, β-HPV 5 and 8 E6 reduce the enrichment of the transcription factor at the promoter of two genes critical to the homology dependent repair of DSBs (BRCA1 and BRCA2. The resulting diminished BRCA1/2 transcription not only leads to lower protein levels but also curtails the ability of these proteins to form repair foci at DSBs. Using a GFP-based reporter, we confirm that this reduced foci formation leads to significantly diminished homology dependent repair of DSBs. By deleting the p300 binding domain of β-HPV 8 E6, we demonstrate that the loss of robust repair is dependent on viral-mediated degradation of p300 and confirm this observation using a combination of p300 mutants that are β-HPV 8 E6 destabilization resistant and p300 knock-out cells. In conclusion, this work establishes an expanded ability of β-HPV 5 and 8 E6 to attenuate UV damage repair, thus adding further support to the hypothesis that β-HPV infections play a role in skin cancer development by increasing the oncogenic potential of UV exposure.

  19. Role of 53BP1 in the regulation of DNA double-strand break repair pathway choice.

    Science.gov (United States)

    Gupta, Arun; Hunt, Clayton R; Chakraborty, Sharmistha; Pandita, Raj K; Yordy, John; Ramnarain, Deepti B; Horikoshi, Nobuo; Pandita, Tej K

    2014-01-01

    The p53-binding protein 1 (53BP1) is a well-known DNA damage response (DDR) factor, which is recruited to nuclear structures at the site of DNA damage and forms readily visualized ionizing radiation (IR) induced foci. Depletion of 53BP1 results in cell cycle arrest in G2/M phase as well as genomic instability in human as well as mouse cells. Within the DNA damage response mechanism, 53BP1 is classified as an adaptor/mediator, required for processing of the DNA damage response signal and as a platform for recruitment of other repair factors. More recently, specific 53BP1 contributions to DSB repair pathway choice have been recognized and are being characterized. In this review, we have summarized recent advances in understanding the role of 53BP1 in regulating DNA DSBs repair pathway choice, variable diversity joining [V(D)J] recombination and class-switch recombination (CSR). PMID:24320053

  20. DNA double strand break repair pathway plays a significant role in determining the radiotherapy induced normal tissue toxicity among head-and-neck and breast cancer

    International Nuclear Information System (INIS)

    The ability to predict individual risk of radiotherapy induced normal tissue complications prior to the therapy may give an opportunity to personalize the treatment aiming improved therapeutic effect and quality of life. Therefore, predicting the risk of developing acute reactions before the initiation of radiation therapy may serve as a potential biomarker. DNA double-strand break (DSB) induction and its repair kinetics in lymphocytes of Head-and-Neck (n = 183) and Breast cancer (n = 132) patients undergoing chemoradiation or radiation therapy alone were analyzed by performing γ-H2AX foci, neutral comet and a modified neutral filter elution assay. Candidate radioresponsive genes like DNA repair, antioxidant pathway, profibrotic cytokine genes were screened for the common variants for their association with normal tissue toxicity outcome. Patients were stratified as non-over responders (NOR) and over responders (OR) based on their Radiation Therapy Oncology Group grading for normal tissue adverse reactions. Our results suggest that DSB repair plays a major role in the development of normal tissue adverse reactions in H and N and Breast cancer patients. The cellular (γ-H2AX analysis) and SNP analysis may have the potential to be developed into a clinically useful predictive assay for identifying the normal tissue over reactors

  1. Active and break events of Indian summer monsoon during 1901-2014

    Science.gov (United States)

    Pai, D. S.; Sridhar, Latha; Ramesh Kumar, M. R.

    2016-06-01

    The study lists active and break monsoon events over India over a very long period (1901-2014) identified using criteria based on a rainfall index derived over a critical high rainfall region called core monsoon zone. The break and active spells identified in this study were mostly comparable with that identified in the earlier studies based on similar rainfall criteria during the common data period (1951-2007). However, some noticeable differences were observed in the rainfall anomaly pattern associated with the break monsoon spells identified in this study and that identified based on the synoptic criteria in the earlier studies. The stringent rainfall criteria used in this study seems to be better criteria for identifying the breaks. During the study period, both the active and break spells of short duration were more frequent than the long duration with about 63.4 % of the break spells and 94.3 % of the active spells falling in the range of 3-6 days. There were no active spells of duration ≥13 days. Whereas, about 8 % of the break spells were of duration ≥13 days. During both the halves of the data period (1901-1957 and 1958-2014), there was no change in the distribution of the break events. However, the number of active spells showed an increase of about 12 % in the in the second half, which was mainly in the short duration (3-6 days) spells. During the data period, decadal variations of break days showed an out phase of relationship with the number of days of monsoon depression (MD). Relatively stronger in phase relationship was observed between the decadal variation of MD days and that of the active days till around early 1980s which reversed later due to sudden decrease in the MD days. During the same period, both the active and break days were in the increasing phase. This was also coincided with the sudden and significant increase in the number of days of monsoon lows (LOW). The LOWs, which generally have short life helped in the occurrence of active

  2. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    Energy Technology Data Exchange (ETDEWEB)

    Zafar, Faria; Seidler, Sara B.; Kronenberg, Amy; Schild, David; Wiese, Claudia

    2010-06-29

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  3. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    International Nuclear Information System (INIS)

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  4. Histone chaperone Anp32e removes H2A.Z from DNA double-strand breaks and promotes nucleosome reorganization and DNA repair.

    Science.gov (United States)

    Gursoy-Yuzugullu, Ozge; Ayrapetov, Marina K; Price, Brendan D

    2015-06-16

    The repair of DNA double-strand breaks (DSBs) requires open, flexible chromatin domains. The NuA4-Tip60 complex creates these flexible chromatin structures by exchanging histone H2A.Z onto nucleosomes and promoting acetylation of histone H4. Here, we demonstrate that the accumulation of H2A.Z on nucleosomes at DSBs is transient, and that rapid eviction of H2A.Z is required for DSB repair. Anp32e, an H2A.Z chaperone that interacts with the C-terminal docking domain of H2A.Z, is rapidly recruited to DSBs. Anp32e functions to remove H2A.Z from nucleosomes, so that H2A.Z levels return to basal within 10 min of DNA damage. Further, H2A.Z removal by Anp32e disrupts inhibitory interactions between the histone H4 tail and the nucleosome surface, facilitating increased acetylation of histone H4 following DNA damage. When H2A.Z removal by Anp32e is blocked, nucleosomes at DSBs retain elevated levels of H2A.Z, and assume a more stable, hypoacetylated conformation. Further, loss of Anp32e leads to increased CtIP-dependent end resection, accumulation of single-stranded DNA, and an increase in repair by the alternative nonhomologous end joining pathway. Exchange of H2A.Z onto the chromatin and subsequent rapid removal by Anp32e are therefore critical for creating open, acetylated nucleosome structures and for controlling end resection by CtIP. Dynamic modulation of H2A.Z exchange and removal by Anp32e reveals the importance of the nucleosome surface and nucleosome dynamics in processing the damaged chromatin template during DSB repair.

  5. A major role of the RecFOR pathway in DNA double-strand-break repair through ESDSA in Deinococcus radiodurans.

    Science.gov (United States)

    Bentchikou, Esma; Servant, Pascale; Coste, Geneviève; Sommer, Suzanne

    2010-01-01

    In Deinococcus radiodurans, the extreme resistance to DNA-shattering treatments such as ionizing radiation or desiccation is correlated with its ability to reconstruct a functional genome from hundreds of chromosomal fragments. The rapid reconstitution of an intact genome is thought to occur through an extended synthesis-dependent strand annealing process (ESDSA) followed by DNA recombination. Here, we investigated the role of key components of the RecF pathway in ESDSA in this organism naturally devoid of RecB and RecC proteins. We demonstrate that inactivation of RecJ exonuclease results in cell lethality, indicating that this protein plays a key role in genome maintenance. Cells devoid of RecF, RecO, or RecR proteins also display greatly impaired growth and an important lethal sectoring as bacteria devoid of RecA protein. Other aspects of the phenotype of recFOR knock-out mutants paralleled that of a DeltarecA mutant: DeltarecFOR mutants are extremely radiosensitive and show a slow assembly of radiation-induced chromosomal fragments, not accompanied by DNA synthesis, and reduced DNA degradation. Cells devoid of RecQ, the major helicase implicated in repair through the RecF pathway in E. coli, are resistant to gamma-irradiation and have a wild-type DNA repair capacity as also shown for cells devoid of the RecD helicase; in contrast, DeltauvrD mutants show a markedly decreased radioresistance, an increased latent period in the kinetics of DNA double-strand-break repair, and a slow rate of fragment assembly correlated with a slow rate of DNA synthesis. Combining RecQ or RecD deficiency with UvrD deficiency did not significantly accentuate the phenotype of DeltauvrD mutants. In conclusion, RecFOR proteins are essential for DNA double-strand-break repair through ESDSA whereas RecJ protein is essential for cell viability and UvrD helicase might be involved in the processing of double stranded DNA ends and/or in the DNA synthesis step of ESDSA. PMID:20090937

  6. A major role of the RecFOR pathway in DNA double-strand-break repair through ESDSA in Deinococcus radiodurans.

    Directory of Open Access Journals (Sweden)

    Esma Bentchikou

    2010-01-01

    Full Text Available In Deinococcus radiodurans, the extreme resistance to DNA-shattering treatments such as ionizing radiation or desiccation is correlated with its ability to reconstruct a functional genome from hundreds of chromosomal fragments. The rapid reconstitution of an intact genome is thought to occur through an extended synthesis-dependent strand annealing process (ESDSA followed by DNA recombination. Here, we investigated the role of key components of the RecF pathway in ESDSA in this organism naturally devoid of RecB and RecC proteins. We demonstrate that inactivation of RecJ exonuclease results in cell lethality, indicating that this protein plays a key role in genome maintenance. Cells devoid of RecF, RecO, or RecR proteins also display greatly impaired growth and an important lethal sectoring as bacteria devoid of RecA protein. Other aspects of the phenotype of recFOR knock-out mutants paralleled that of a DeltarecA mutant: DeltarecFOR mutants are extremely radiosensitive and show a slow assembly of radiation-induced chromosomal fragments, not accompanied by DNA synthesis, and reduced DNA degradation. Cells devoid of RecQ, the major helicase implicated in repair through the RecF pathway in E. coli, are resistant to gamma-irradiation and have a wild-type DNA repair capacity as also shown for cells devoid of the RecD helicase; in contrast, DeltauvrD mutants show a markedly decreased radioresistance, an increased latent period in the kinetics of DNA double-strand-break repair, and a slow rate of fragment assembly correlated with a slow rate of DNA synthesis. Combining RecQ or RecD deficiency with UvrD deficiency did not significantly accentuate the phenotype of DeltauvrD mutants. In conclusion, RecFOR proteins are essential for DNA double-strand-break repair through ESDSA whereas RecJ protein is essential for cell viability and UvrD helicase might be involved in the processing of double stranded DNA ends and/or in the DNA synthesis step of ESDSA.

  7. A model of oncogenic rearrangements: differences between chromosomal translocation mechanisms and simple double-strand break repair

    OpenAIRE

    Weinstock, David M.; Elliott, Beth; Jasin, Maria

    2006-01-01

    Recurrent reciprocal translocations are present in many hematologic and mesenchymal malignancies. Because significant sequence homology is absent from translocation breakpoint junctions, non-homologous end-joining (NHEJ) pathways of DNA repair are presumed to catalyze their formation. We developed translocation reporters for use in mammalian cells from which NHEJ events can be selected after precise chromosomal breakage. Translocations were efficiently recovered with these reporters using mou...

  8. Long-range heterochromatin association is mediated by silencing and double-strand DNA break repair proteins

    OpenAIRE

    Jacob G Kirkland; Kamakaka, Rohinton T.

    2013-01-01

    The eukaryotic genome is highly organized in the nucleus, and this organization affects various nuclear processes. However, the molecular details of higher-order organization of chromatin remain obscure. In the present study, we show that the Saccharomyces cerevisiae silenced loci HML and HMR cluster in three-dimensional space throughout the cell cycle and independently of the telomeres. Long-range HML–HMR interactions require the homologous recombination (HR) repair pathway and phosphorylate...

  9. In normal human fibroblasts variation in DSB repair capacity cannot be ascribed to radiation-induced changes in the localisation, expression or activity of major NHEJ proteins

    DEFF Research Database (Denmark)

    Kasten-Pisula, Ulla; Vronskaja, Svetlana; Overgaard, Jens;

    2008-01-01

    BACKGROUND AND PURPOSE: The aim of the present study was to test whether for normal human fibroblasts the variation in double-strand break (DSB) repair capacity results from radiation-induced differences in localisation, expression or activity of major non-homologous end-joining (NHEJ) proteins...... in the nucleus with no detectable amount in the cytoplasm. This distribution was not altered upon irradiation. In non-irradiated cells the level of these proteins varied with a CV ranging between 16% and 20%, but there was no correlation with the respective cellular DSB repair capacity. Irradiation (3.5 and 15Gy...... in the activity of the DNA-PK complex induced upon irradiation. CONCLUSIONS: For normal human fibroblasts, the level or activity of NHEJ proteins measured prior to or after irradiation cannot be used to predict the DSB repair capacity or cellular radiosensitivity. Udgivelsesdato: 2008-Mar...

  10. Post-irradiation chemical processing of DNA damage generates double-strand breaks in cells already engaged in repair

    OpenAIRE

    Satyendra K Singh; Wang, Minli; Staudt, Christian; Iliakis, George

    2011-01-01

    In cells exposed to ionizing radiation (IR), double-strand breaks (DSBs) form within clustered-damage sites from lesions disrupting the DNA sugar–phosphate backbone. It is commonly assumed that these DSBs form promptly and are immediately detected and processed by the cellular DNA damage response (DDR) apparatus. This assumption is questioned by the observation that after irradiation of naked DNA, a fraction of DSBs forms minutes to hours after exposure as a result of temperature dependent, c...

  11. Heavy ion induced DNA strand breaks and their repair in diploid cells of the epithelium of the lens

    International Nuclear Information System (INIS)

    This diploma thesis investigates by means of alkaline unwinding and neutral elution the induction of DNA strand breaks and of rejoining processes as an effect of irradiation with very heavy, accelerated ions. It is found that: The effectiveness of very heavy ions (Z > 18) increases per particle with higher ordinal number, and with increasing velocities. The relative biological effectiveness increases with higher particle masses and lower velocities. The effects of very heavy ions are determined both by the LET and by the particle track extension (specific energy) of the various particles. Heavy ions are much more effective than X-rays with regard to inducing double strand breaks, as compared to DNA single strand breaks induced. Rejoining processes induced by heavy ions have been found to be delayed and incomplete, as compared to the X-ray effects. The number of rejoining processes decreases with rising ordinal number. The experiments indicate that the irradiation with lead or uranium ions most probably makes rejoining impossible. (orig./MG)

  12. Tousled kinase activator, gallic acid, promotes homologous recombinational repair and suppresses radiation cytotoxicity in salivary gland cells.

    Science.gov (United States)

    Timiri Shanmugam, Prakash Srinivasan; Nair, Renjith Parameshwaran; De Benedetti, Arrigo; Caldito, Gloria; Abreo, Fleurette; Sunavala-Dossabhoy, Gulshan

    2016-04-01

    Accidental or medical radiation exposure of the salivary glands can gravely impact oral health. Previous studies have shown the importance of Tousled-like kinase 1 (TLK1) and its alternate start variant TLK1B in cell survival against genotoxic stresses. Through a high-throughput library screening of natural compounds, the phenolic phytochemical, gallic acid (GA), was identified as a modulator of TLK1/1B. This small molecule possesses anti-oxidant and free radical scavenging properties, but in this study, we report that in vitro it promotes survival of human salivary acinar cells, NS-SV-AC, through repair of ionizing radiation damage. Irradiated cells treated with GA show improved clonogenic survival compared to untreated controls. And, analyses of DNA repair kinetics by alkaline single-cell gel electrophoresis and γ-H2AX foci immunofluorescence indicate rapid resolution of DNA breaks in drug-treated cells. Study of DR-GFP transgene repair indicates GA facilitates homologous recombinational repair to establish a functional GFP gene. In contrast, inactivation of TLK1 or its shRNA knockdown suppressed resolution of radiation-induced DNA tails in NS-SV-AC, and homology directed repair in DR-GFP cells. Consistent with our results in culture, animals treated with GA after exposure to fractionated radiation showed better preservation of salivary function compared to saline-treated animals. Our results suggest that GA-mediated transient modulation of TLK1 activity promotes DNA repair and suppresses radiation cytoxicity in salivary gland cells.

  13. Analysis of Repair Mechanisms following an Induced Double-Strand Break Uncovers Recessive Deleterious Alleles in the Candida albicans Diploid Genome

    Science.gov (United States)

    Feri, Adeline; Loll-Krippleber, Raphaël; Commere, Pierre-Henri; Maufrais, Corinne; Sertour, Natacha; Schwartz, Katja; Sherlock, Gavin; Bougnoux, Marie-Elisabeth

    2016-01-01

    ABSTRACT The diploid genome of the yeast Candida albicans is highly plastic, exhibiting frequent loss-of-heterozygosity (LOH) events. To provide a deeper understanding of the mechanisms leading to LOH, we investigated the repair of a unique DNA double-strand break (DSB) in the laboratory C. albicans SC5314 strain using the I-SceI meganuclease. Upon I-SceI induction, we detected a strong increase in the frequency of LOH events at an I-SceI target locus positioned on chromosome 4 (Chr4), including events spreading from this locus to the proximal telomere. Characterization of the repair events by single nucleotide polymorphism (SNP) typing and whole-genome sequencing revealed a predominance of gene conversions, but we also observed mitotic crossover or break-induced replication events, as well as combinations of independent events. Importantly, progeny that had undergone homozygosis of part or all of Chr4 haplotype B (Chr4B) were inviable. Mining of genome sequencing data for 155 C. albicans isolates allowed the identification of a recessive lethal allele in the GPI16 gene on Chr4B unique to C. albicans strain SC5314 which is responsible for this inviability. Additional recessive lethal or deleterious alleles were identified in the genomes of strain SC5314 and two clinical isolates. Our results demonstrate that recessive lethal alleles in the genomes of C. albicans isolates prevent the occurrence of specific extended LOH events. While these and other recessive lethal and deleterious alleles are likely to accumulate in C. albicans due to clonal reproduction, their occurrence may in turn promote the maintenance of corresponding nondeleterious alleles and, consequently, heterozygosity in the C. albicans species. PMID:27729506

  14. Rad52 promotes second-end DNA capture in double-stranded break repair to form complement-stabilized joint molecules.

    Science.gov (United States)

    Nimonkar, Amitabh V; Sica, R Alejandro; Kowalczykowski, Stephen C

    2009-03-01

    Saccharomyces cerevisiae Rad52 performs multiple functions during the recombinational repair of double-stranded DNA (dsDNA) breaks (DSBs). It mediates assembly of Rad51 onto single-stranded DNA (ssDNA) that is complexed with replication protein A (RPA); the resulting nucleoprotein filament pairs with homologous dsDNA to form joint molecules. Rad52 also catalyzes the annealing of complementary strands of ssDNA, even when they are complexed with RPA. Both Rad51 and Rad52 can be envisioned to promote "second-end capture," a step that pairs the ssDNA generated by processing of the second end of a DSB to the joint molecule formed by invasion of the target dsDNA by the first processed end. Here, we show that Rad52 promotes annealing of complementary ssDNA that is complexed with RPA to the displaced strand of a joint molecule, to form a complement-stabilized joint molecule. RecO, a prokaryotic homolog of Rad52, cannot form complement-stabilized joint molecules with RPA-ssDNA complexes, nor can Rad52 promote second-end capture when the ssDNA is bound with either human RPA or the prokaryotic ssDNA-binding protein, SSB, indicating a species-specific process. We conclude that Rad52 participates in second-end capture by annealing a resected DNA break, complexed with RPA, to the joint molecule product of single-end invasion event. These studies support a role for Rad52-promoted annealing in the formation of Holliday junctions in DSB repair. PMID:19204284

  15. Replication stress activates DNA repair synthesis in mitosis.

    Science.gov (United States)

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A; Bursomanno, Sara; Aleliunaite, Aiste; Wu, Wei; Mankouri, Hocine W; Shen, Huahao; Liu, Ying; Hickson, Ian D

    2015-12-10

    Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or breaks on metaphase chromosomes (termed CFS 'expression'), particularly when cells have been exposed to replicative stress. The MUS81-EME1 structure-specific endonuclease promotes the appearance of chromosome gaps or breaks at CFSs following replicative stress. Here we show that entry of cells into mitotic prophase triggers the recruitment of MUS81 to CFSs. The nuclease activity of MUS81 then promotes POLD3-dependent DNA synthesis at CFSs, which serves to minimize chromosome mis-segregation and non-disjunction. We propose that the attempted condensation of incompletely duplicated loci in early mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest that targeting this pathway could represent a new therapeutic approach.

  16. A Role for BLM in Double-Strand Break Repair Pathway Choice: Prevention of CtIP/Mre11-Mediated Alternative Nonhomologous End-Joining

    Directory of Open Access Journals (Sweden)

    Anastazja Grabarz

    2013-10-01

    Full Text Available The choice of the appropriate double-strand break (DSB repair pathway is essential for the maintenance of genomic stability. Here, we show that the Bloom syndrome gene product, BLM, counteracts CtIP/MRE11-dependent long-range deletions (>200 bp generated by alternative end-joining (A-EJ. BLM represses A-EJ in an epistatic manner with 53BP1 and RIF1 and is required for ionizing-radiation-induced 53BP1 focus assembly. Conversely, in the absence of 53BP1 or RIF1, BLM promotes formation of A-EJ long deletions, consistent with a role for BLM in DSB end resection. These data highlight a dual role for BLM that influences the DSB repair pathway choice: (1 protection against CtIP/MRE11 long-range deletions associated with A-EJ and (2 promotion of DNA resection. These antagonist roles can be regulated, according to cell-cycle stage, by interacting partners such as 53BP1 and TopIII, to avoid unscheduled resection that might jeopardize genome integrity.

  17. Breaking the Ice: Career Development Activities for Accounting Students

    Science.gov (United States)

    Kilpatrick, Bob G.; Wilburn, Nancy L.

    2010-01-01

    This paper describes two co-curricular career development activities, mock interviews and speed networking that we provide for accounting majors at our university. The driving force behind both activities was to increase comfort levels for students when interacting with professionals and to enhance their job interview and networking skills.…

  18. Nontoxic concentration of DNA-PK inhibitor NU7441 radio-sensitizes lung tumor cells with little effect on double strand break repair.

    Science.gov (United States)

    Sunada, Shigeaki; Kanai, Hideki; Lee, Younghyun; Yasuda, Takeshi; Hirakawa, Hirokazu; Liu, Cuihua; Fujimori, Akira; Uesaka, Mitsuru; Okayasu, Ryuichi

    2016-09-01

    High-linear energy transfer (LET) heavy ions have been increasingly employed as a useful alternative to conventional photon radiotherapy. As recent studies suggested that high LET radiation mainly affects the nonhomologous end-joining (NHEJ) pathway of DNA double strand break (DSB) repair, we further investigated this concept by evaluating the combined effect of an NHEJ inhibitor (NU7441) at a non-toxic concentration and carbon ions. NU7441-treated non-small cell lung cancer (NSCLC) A549 and H1299 cells were irradiated with X-rays and carbon ions (290 MeV/n, 50 keV/μm). Cell survival was measured by clonogenic assay. DNA DSB repair, cell cycle distribution, DNA fragmentation and cellular senescence induction were studied using a flow cytometer. Senescence-associated protein p21 was detected by western blotting. In the present study, 0.3 μM of NU7441, nontoxic to both normal and tumor cells, caused a significant radio-sensitization in tumor cells exposed to X-rays and carbon ions. This concentration did not seem to cause inhibition of DNA DSB repair but induced a significant G2/M arrest, which was particularly emphasized in p53-null H1299 cells treated with NU7441 and carbon ions. In addition, the combined treatment induced more DNA fragmentation and a higher degree of senescence in H1299 cells than in A549 cells, indicating that DNA-PK inhibitor contributes to various modes of cell death in a p53-dependent manner. In summary, NSCLC cells irradiated with carbon ions were radio-sensitized by a low concentration of DNA-PK inhibitor NU7441 through a strong G2/M cell cycle arrest. Our findings may contribute to further effective radiotherapy using heavy ions. PMID:27341700

  19. Examining the Knowledge and Capacity of Elementary Teachers to Implement Classroom Physical Activity Breaks

    Directory of Open Access Journals (Sweden)

    Danae M. DINKEL

    2016-09-01

    Full Text Available This study examined teachers’ zone of proximal development for classroom physical activity breaks by assessing teachers’ knowledge and capacity for implementing classroom physical activity breaks. Five school districts of various sizes (n=346 teachers took part in a short online survey. Descriptive statistics were calculated and chi-square analyses were used to identify differences between districts. Almost all teachers utilized classroom physical activity to some extent. A third of teachers who stated they implemented classroom physical activity, experienced barriers to implementation. A majority of teachers were interested in learning more about classroom physical activity. There were significant differences between districts on the number of days per week classroom physical activity was integrated, the frequency of collaboration that occurred between teachers, the percentage of teachers who experienced barriers, and preferred delivery method of professional development. These findings support the importance of identifying teachers’ zone of proximal development to increase the use of classroom physical activity breaks. Understanding teachers’ knowledge and capacity for implementing classroom physical activity breaks can allow educational professionals to shift the implementation of classroom physical activity beyond sporadic use by isolated teachers and schools to a more systematic and consistent delivery across classrooms and throughout districts.

  20. Extraction of Active Enzymes from "Hard-to-Break-Cells"

    DEFF Research Database (Denmark)

    Ottaviani, Alessio; Tesauro, Cinzia; Fjelstrup, S;

    We present the utilization of a rolling circle amplification (RCA) based assay to investigate the extraction efficiency of active enzymes from a class of “hard-to-break” cells, yeast Saccaramyces cerevisiae. Current analyses of microorganisms, such as pathogenic bacteria, parasites or particular...... life stages of microorganisms (e.g. spores from bacteria or fungi) is hampered by the lack of efficient lysis protocols that preserve the activity and integrity of the cellular content. Presented herein is a flexible scheme to screen lysis protocols for active enzyme extraction. We also report a gentle...... yet effective approach for extraction of active enzymes by entrapping cells in microdroplets. Combined effort of optimized extraction protocols and effective analytical approaches is expected to generate impact in future disease diagnosis and environmental safety....

  1. Nbs1 ChIP-Seq Identifies Off-Target DNA Double-Strand Breaks Induced by AID in Activated Splenic B Cells.

    Directory of Open Access Journals (Sweden)

    Lyne Khair

    2015-08-01

    Full Text Available Activation-induced cytidine deaminase (AID is required for initiation of Ig class switch recombination (CSR and somatic hypermutation (SHM of antibody genes during immune responses. AID has also been shown to induce chromosomal translocations, mutations, and DNA double-strand breaks (DSBs involving non-Ig genes in activated B cells. To determine what makes a DNA site a target for AID-induced DSBs, we identify off-target DSBs induced by AID by performing chromatin immunoprecipitation (ChIP for Nbs1, a protein that binds DSBs, followed by deep sequencing (ChIP-Seq. We detect and characterize hundreds of off-target AID-dependent DSBs. Two types of tandem repeats are highly enriched within the Nbs1-binding sites: long CA repeats, which can form Z-DNA, and tandem pentamers containing the AID target hotspot WGCW. These tandem repeats are not nearly as enriched at AID-independent DSBs, which we also identified. Msh2, a component of the mismatch repair pathway and important for genome stability, increases off-target DSBs, similar to its effect on Ig switch region DSBs, which are required intermediates during CSR. Most of the off-target DSBs are two-ended, consistent with generation during G1 phase, similar to DSBs in Ig switch regions. However, a minority are one-ended, presumably due to conversion of single-strand breaks to DSBs during replication. One-ended DSBs are repaired by processes involving homologous recombination, including break-induced replication repair, which can lead to genome instability. Off-target DSBs, especially those present during S phase, can lead to chromosomal translocations, deletions and gene amplifications, resulting in the high frequency of B cell lymphomas derived from cells that express or have expressed AID.

  2. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

    Energy Technology Data Exchange (ETDEWEB)

    Revaud, D.

    2009-06-15

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  3. RAD50 is required for efficient initiation of resection and recombinational repair at random, gamma-induced double-strand break ends.

    Directory of Open Access Journals (Sweden)

    Jim Westmoreland

    2009-09-01

    Full Text Available Resection of DNA double-strand break (DSB ends is generally considered a critical determinant in pathways of DSB repair and genome stability. Unlike for enzymatically induced site-specific DSBs, little is known about processing of random "dirty-ended" DSBs created by DNA damaging agents such as ionizing radiation. Here we present a novel system for monitoring early events in the repair of random DSBs, based on our finding that single-strand tails generated by resection at the ends of large molecules in budding yeast decreases mobility during pulsed field gel electrophoresis (PFGE. We utilized this "PFGE-shift" to follow the fate of both ends of linear molecules generated by a single random DSB in circular chromosomes. Within 10 min after gamma-irradiation of G2/M arrested WT cells, there is a near-synchronous PFGE-shift of the linearized circular molecules, corresponding to resection of a few hundred bases. Resection at the radiation-induced DSBs continues so that by the time of significant repair of DSBs at 1 hr there is about 1-2 kb resection per DSB end. The PFGE-shift is comparable in WT and recombination-defective rad52 and rad51 strains but somewhat delayed in exo1 mutants. However, in rad50 and mre11 null mutants the initiation and generation of resected ends at radiation-induced DSB ends is greatly reduced in G2/M. Thus, the Rad50/Mre11/Xrs2 complex is responsible for rapid processing of most damaged ends into substrates that subsequently undergo recombinational repair. A similar requirement was found for RAD50 in asynchronously growing cells. Among the few molecules exhibiting shift in the rad50 mutant, the residual resection is consistent with resection at only one of the DSB ends. Surprisingly, within 1 hr after irradiation, double-length linear molecules are detected in the WT and rad50, but not in rad52, strains that are likely due to crossovers that are largely resection- and RAD50-independent.

  4. Variability in AIRS CO2 during active and break phases of Indian summer monsoon.

    Science.gov (United States)

    Revadekar, J V; Ravi Kumar, K; Tiwari, Yogesh K; Valsala, Vinu

    2016-01-15

    Due to human activities, the atmospheric concentration of Carbon Dioxide (CO2) has been rising extensively since the Industrial Revolution. Indian summer monsoon (ISM) has a dominant westerly component from ocean to land with a strong tendency to ascend and hence may have role in CO2 distribution in lower and middle troposphere over Indian sub-continent. A substantial component of ISM variability arises from the fluctuations on the intra-seasonal scale between active and break phases which correspond to strong and weak monsoon circulation. In view of the above, an attempt is made in this study to examine the AIRS/AQUA satellite retrieved CO2 distribution in response to atmospheric circulation with focus on active and break phase. Correlation analysis indicates the increase in AIRS CO2 linked with strong monsoon circulation. Study also reveals that anomalous circulation pattern during active and break phase show resemblance with high and low values of AIRS CO2. Homogeneous monsoon regions of India show substantial increase in CO2 levels during active phase. Hilly regions of India show strong contrast in CO2 and vertical velocity during active and break phases. PMID:26476061

  5. Record-breaking Storm Activity on Uranus in 2014

    OpenAIRE

    De Pater, Imke; Sromovsky, L. A.; Fry, P. M.; Hammel, Heidi B.; Baranec, Christoph; Sayanagi, Kunio

    2015-01-01

    In spite of an expected decline in convective activity following the 2007 equinox of Uranus, eight sizable storms were detected on the planet with the near-infrared camera NIRC2, coupled to the adaptive optics system, on the 10-m W. M. Keck telescope on UT 5 and 6 August 2014. All storms were on Uranus's northern hemisphere, including the brightest storm ever seen in this planet at 2.2 $\\mu$m, reflecting 30% as much light as the rest of the planet at this wavelength. The storm was at a planet...

  6. Record-breaking Storm Activity on Uranus in 2014

    CERN Document Server

    de Pater, Imke; Fry, P M; Hammel, Heidi B; Baranec, Christoph; Sayanagi, Kunio

    2015-01-01

    In spite of an expected decline in convective activity following the 2007 equinox of Uranus, eight sizable storms were detected on the planet with the near-infrared camera NIRC2, coupled to the adaptive optics system, on the 10-m W. M. Keck telescope on UT 5 and 6 August 2014. All storms were on Uranus's northern hemisphere, including the brightest storm ever seen in this planet at 2.2 $\\mu$m, reflecting 30% as much light as the rest of the planet at this wavelength. The storm was at a planetocentric latitude of $\\sim$15$^{\\circ}$N and reached altitudes of $\\sim$330 mbar, well above the regular uppermost cloud layer (methane-ice) in the atmosphere. A cloud feature at a latitude of 32$^{\\circ}$N, that was deeper in the atmosphere (near $\\sim$2 bar), was later seen by amateur astronomers. We also present images returned from our HST ToO program, that shows both of these cloud features. We further report the first detection of a long-awaited haze over the north polar region.

  7. Individual repair of radiation-induced DNA double-strand breaks in lymphocytes. Implications for radiation-induced dermatitis in breast cancer

    International Nuclear Information System (INIS)

    Purpose: Adjuvant 'whole breast radiotherapy' (WBRT) is the standard of care after breast conserving surgery in women with breast cancer. Throughout different cancer stages the addition of WBRT leads to significantly improved rates of freedom from local failure and overall survival. WBRT is generally well tolerated. A 5-10%-rate of severe acute or long-term side effects is commonly observed. For both radiation-mediated tumor-cell-elimination and induction of side effects, DNA-double-strand-breaks (DSB) presumably play the decisive role. The intensity of normal tissue reactions in radiotherapy can, in part, be attributed to the intrinsic DSB repair-capacity. In this study in vivo and in vitro experiments are carried through in order to assess DSB repair-kinetics in blood lymphocytes of women with breast cancer. These findings are to be correlated with the degree of radiation-induced normal tissue toxicity. Patients and Methods: Eighteen patients with breast cancer, in whom WBRT was indicated, were examined. A total WBRT dose of 50 Gy (single dose 2 Gy) with an additional boost-radiotherapy to the initial tumor-region to a total dose of 60-66 Gy was administered. DSB repair was determined by means of counting γ-H2AX foci in blood lymphocytes at predefined points in time, i.e. before and 0.5 h; 2.5 h; 5 h and 24 h after in vivo irradiation (1st fraction of WBRT) and before and 0.5 h; 2.5 h and 5 h after in vitro irradiation with increasing radiation doses in the range of 10 - 500 mGy. Acute normal tissue toxicity was scored on the basis of a modified RTOG-classification (main aspects were erythema and dry or moist skin desquamation). Results: DSB repair-halflife-times did not differ between patients with a higher or lower than average incidence of acute side effects. In patients with 'above average' side effects larger irradiation volumes were treated (volume surrounded by the 50%-isodose). Adjusted for these, no single patients showed elevated residual γ-H2AX foci

  8. PAXX and XLF DNA repair factors are functionally redundant in joining DNA breaks in a G1-arrested progenitor B-cell line.

    Science.gov (United States)

    Kumar, Vipul; Alt, Frederick W; Frock, Richard L

    2016-09-20

    Classical nonhomologous end joining (C-NHEJ) is a major mammalian DNA double-strand break (DSB) repair pathway. Core C-NHEJ factors, such as XRCC4, are required for joining DSB intermediates of the G1 phase-specific V(D)J recombination reaction in progenitor lymphocytes. Core factors also contribute to joining DSBs in cycling mature B-lineage cells, including DSBs generated during antibody class switch recombination (CSR) and DSBs generated by ionizing radiation. The XRCC4-like-factor (XLF) C-NHEJ protein is dispensable for V(D)J recombination in normal cells, but because of functional redundancy, it is absolutely required for this process in cells deficient for the ataxia telangiectasia-mutated (ATM) DSB response factor. The recently identified paralogue of XRCC4 and XLF (PAXX) factor has homology to these two proteins and variably contributes to ionizing radiation-induced DSB repair in human and chicken cells. We now report that PAXX is dispensable for joining V(D)J recombination DSBs in G1-arrested mouse pro-B-cell lines, dispensable for joining CSR-associated DSBs in a cycling mouse B-cell line, and dispensable for normal ionizing radiation resistance in both G1-arrested and cycling pro-B lines. However, we find that combined deficiency for PAXX and XLF in G1-arrested pro-B lines abrogates DSB joining during V(D)J recombination and sensitizes the cells to ionizing radiation exposure. Thus, PAXX provides core C-NHEJ factor-associated functions in the absence of XLF and vice versa in G1-arrested pro-B-cell lines. Finally, we also find that PAXX deficiency has no impact on V(D)J recombination DSB joining in ATM-deficient pro-B lines. We discuss implications of these findings with respect to potential PAXX and XLF functions in C-NHEJ. PMID:27601633

  9. Repair of x-ray-induced DNA double-strand breaks in specific Not I restriction fragments in human fibroblasts: joining of correct and incorrect ends

    Science.gov (United States)

    Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1995-01-01

    An assay that allows measurement of absolute induction frequencies for DNA double-strand breaks (dsbs) in defined regions of the genome and that quantitates rejoining of correct DNA ends has been used to study repair of dsbs in normal human fibroblasts after x-irradiation. The approach involves hybridization of single-copy DNA probes to Not I restriction fragments separated according to size by pulsed-field gel electrophoresis. Induction of dsbs is quantitated from the decrease in the intensity of the hybridizing restriction fragment and an accumulation of a smear below the band. Rejoining of dsbs results in reconstitution of the intact restriction fragment only if correct DNA ends are joined. By comparing results from this technique with results from a conventional electrophoresis assay that detects all rejoining events, it is possible to quantitate the misrejoining frequency. Three Not I fragments on the long arm of chromosome 21 were investigated with regard to dsb induction, yielding an identical induction rate of 5.8 X 10(-3) break per megabase pair per Gy. Correct dsb rejoining was measured for two of these Not I fragments after initial doses of 80 and 160 Gy. The misrejoining frequency was about 25% for both fragments and was independent of dose. This result appears to be representative for the whole genome as shown by analysis of the entire Not I fragment distribution. The correct rejoining events primarily occurred within the first 2 h, while the misrejoining kinetics included a much slower component, with about half of the events occurring between 2 and 24 h. These misrejoining kinetics are similar to those previously reported for production of exchange aberrations in interphase chromosomes.

  10. 77 FR 10762 - Agency Information Collection Activities: Declaration of Person Who Performed Repairs

    Science.gov (United States)

    2012-02-23

    ... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: Declaration of Person... concerning the: Declaration of a Person Who Performed Repairs. This request for comment is being made... Person Who Performed Repairs. OMB Number: 1651-0048. Form Number: None. Abstract: The ``Declaration...

  11. DNA 双链断裂损伤修复的随机模型研究%A Stochastic Model on DNA Double Strand Breaks Repair

    Institute of Scientific and Technical Information of China (English)

    孙廷哲; 崔隽

    2015-01-01

    DNA double strand breaks (DSBs)pose serious threat to life.Efficient repair of DSBs is cru-cial for maintaining genomic integrity.Dynamic investigations of DSB repair have received intensive at-tention.However,previous models do not take into account the relation between extrinsic and intrinsic DNA damage.Therefore,a refined Monte Carlo model was constructed by considering spontaneous DNA damage and setting a threshold for cell cycle reentry.The refined model can better describe the dynamic DSB repair under stressed conditions.Extrinsic DSBs induced by irradiation were first fixed.When the level of damage falls below the threshold,intrinsic DNA damage will then emerge and both the extrinsic and intrinsic DSBs will possibly be simultaneously repaired during a specific period.The current model integrates both extrinsic and intrinsic DNA damage and sets a fertile ground for other models with DNA damage repair process.%DNA 双链断裂是一种非常严重的 DNA 损伤。对 DNA 双链断裂有效的修复对于维持基因组的稳定至关重要。对 DNA 双链断裂修复的动力学研究一直得到了广泛的关注。然而,以往的模型研究都没有充分考虑外源性和内源性 DNA 损伤修复之间的关联。因此,通过在细胞周期重启后引入自发生成的随机 DNA 双键断裂损伤,并设定触发细胞周期阻滞的阈值,一个精细化的 Monte Carlo 模型被构建并可以更好的模拟受迫状态下的损伤修复过程。细胞首先修复辐射刺激造成的 DNA 损伤,接着在总损伤水平低于特定阈值后产生内源性的 DNA 损伤并可能在某特定时间段内对两种来源损伤同时进行修复。本模型综合考虑了外源性和内源性 DNA 损伤修复的整合效应,为其它涵盖 DNA 损伤修复模块的模型研究提供了基础。

  12. RNA polymerase II transcription inhibits DNA repair by photolyase in the transcribed strand of active yeast genes.

    OpenAIRE

    Livingstone-Zatchej, M; Meier, A; Suter, B.; Thoma, F

    1997-01-01

    Yeast uses nucleotide excision repair (NER) and photolyase (photoreactivation) to repair cyclobutane pyrimidine dimers (CPDs) generated by ultraviolet light. In active genes, NER preferentially repairs the transcribed strand (TS). In contrast, we recently showed that photolyase preferentially repairs the non-transcribed strands (NTS) of the URA3 and HIS3 genes in minichromosomes. To test whether photoreactivation depends on transcription, repair of CPDs was investigated in the transcriptional...

  13. SELECTIVE-INHIBITION OF REPAIR OF ACTIVE GENES BY HYPERTHERMIA IS DUE TO INHIBITION OF GLOBAL AND TRANSCRIPTION COUPLED REPAIR PATHWAYS

    NARCIS (Netherlands)

    SAKKERS, RJ; FILON, AR; BRUNSTING, JF; KAMPINGA, HH; KONINGS, AWT; MULLENDERS, LHF

    1995-01-01

    Hyperthermia specifically inhibits the repair of UV-induced DNA photolesions in transcriptionally active genes, To define more precisely which mechanisms underlie the heat-induced inhibition of repair of active genes, removal of cyclobutane pyrimidine dimers (CPDs) was studied in human fibroblasts w

  14. A cell-cycle-stage-related chromosomal X-ray hypersensitivity in larval neuroblasts of Drosophila mei-9 and mei 41 mutants suggesting defective DNA double-strand break repair

    International Nuclear Information System (INIS)

    The authors have examined the chromosomal X-ray hypersensitivity in relation to the cell cycle in larval neuroblasts of the mutagen-sensitive and excision repair-defective mutant mei-9 and of the mutagen-sensitive and post-replication repair-defective mutant mei-41 of Drosophila melanogaster. When compared to wild-type cells, cells bearing the mei-9L1 allele produced unusually high levels in particular of chromatid deletions and to a lesser extent also of isochromatid deletions, but virtually no exchange aberrations. The chromosomal hypersensitivity is apparent at M1 when cells are irradiated in S or G2 but not when irradiated in G1. On the other hand, following irradiation cells bearing the mei-41D5 allele predominantly produce chromosome deletions. The phases of major sensitivity are the S and G1. Mei-9 and mei-41 mutants have been classified to date as proficient in DNA double-strand break repair. The data presented in this paper revealed an S-independent clastogenic hypersensitivity of mei-9 and mei-41 cells. They are interpreted as indicative evidence for the presence of impaired DNA double-strand break repair. The cell-cycle-related difference in the ratio of chromatid- versus chromosome-type deletions in both mutants suggests repair defects at partially different phases of the cell cycle in mei-9 and mei-41 mutant cells. (author). 47 refs.; 2 figs.; 5 tabs

  15. High Concentrations of Organic Contaminants in Air from Ship Breaking Activities in Chittagong, Bangladesh.

    Science.gov (United States)

    Nøst, Therese H; Halse, Anne K; Randall, Scott; Borgen, Anders R; Schlabach, Martin; Paul, Alak; Rahman, Atiqur; Breivik, Knut

    2015-10-01

    The beaches on the coast of Chittagong in Bangladesh are one of the most intense ship breaking areas in the world. The aim of the study was to measure the concentrations of organic contaminants in the air in the city of Chittagong, including the surrounding ship breaking areas using passive air samplers (N = 25). The compounds detected in the highest amounts were the polycyclic aromatic hydrocarbons (PAHs) and short-chain chlorinated paraffins (SCCPs), whereas dichlorodiphenyltrichloroethanes (DDTs), hexachlorobenzene (HCB), and polychlorinated biphenyls (PCBs) were several orders of magnitude lower in comparison. PCBs, PAHs, and HCB were highest at sites near the ship breaking activities, whereas DDTs and SCCPs were higher in the urban areas. Ship breaking activities likely act as atmospheric emission sources of PCBs, PAHs, and HCB, thus adding to the international emphasis on responsible recycling of ships. Concentrations of PAHs, PCBs, DDTs, HCB, and SCCPs in ambient air in Chittagong are high in comparison to those found in similar studies performed in other parts of Asia. Estimated toxic equivalent quotients indicate elevated human health risks caused by inhalation of PAHs at most sites. PMID:26351879

  16. An ocean-atmosphere interaction mechanism for the active break cycle of the Asian summer monsoon

    Energy Technology Data Exchange (ETDEWEB)

    Joseph, P.V.; Sabin, T.P. [Cochin University of Science and Technology, Department of Atmospheric Sciences, Cochin (India)

    2008-05-15

    A typical active-break cycle of the Asian summer monsoon is taken as beginning with maximum SST (pentad 0) over the north Bay of Bengal when the oceans to its west and east from longitude 40 -160 E, and between latitudes 10 and 25 N (area A) also has maximum SST. During this pentad the recently found 'Cold Pool' of the Bay of Bengal (between latitudes 3 N and 10 N) has its minimum SST. An area of convection takes genesis over the Bay of Bengal immediately after pentad 0 in the zone of large SST gradient north of the Cold Pool and it pulls the monsoon Low Level Jetstream (LLJ) through peninsular India. Convection and the LLJ westerlies then spread to the western Pacific Ocean during pentads 1-4 taken as the active phase of the monsoon during which convection and LLJ have grown in a positive feed back process. The cyclonic vorticity to the north of the LLJ axis is hypothesized to act as a flywheel maintaining the convection during the long active phase against the dissipating effect of atmospheric stabilization by each short spell of deep convection. By the end of pentad 4 the SST over area A has cooled and the convection weakens there, when the LLJ turns clockwise over the Arabian Sea and flows close to the equator in the Indian ocean. A band of convection develops at pentad 5 between the equator and latitude 10 S over the Indian ocean and it is nourished by the cyclonic vorticity of the LLJ now near the equator and the moisture supply through it. This is taken as the break monsoon phase lasting for about three to four pentads beginning from pentad 5 of a composite active-break cycle of 40 day duration. With reduced wind and convection over the area A during the break phase, solar radiation and light winds make the SST there warm rapidly and a new active-break cycle begins. SST, convection, LLJ and the net heat flux at the ocean surface have important roles in this new way of looking at the active-break cycle as a coupled ocean-atmosphere phenomenon. (orig.)

  17. Collision of Trapped Topoisomerase 2 with Transcription and Replication: Generation and Repair of DNA Double-Strand Breaks with 5′ Adducts

    OpenAIRE

    Hong Yan; Margaret Tammaro; Shuren Liao

    2016-01-01

    Topoisomerase 2 (Top2) is an essential enzyme responsible for manipulating DNA topology during replication, transcription, chromosome organization and chromosome segregation. It acts by nicking both strands of DNA and then passes another DNA molecule through the break. The 5′ end of each nick is covalently linked to the tyrosine in the active center of each of the two subunits of Top2 (Top2cc). In this configuration, the two sides of the nicked DNA are held together by the strong protein-prot...

  18. Inversion-symmetry-breaking-activated shear Raman bands in $T'$-MoTe$_2$

    OpenAIRE

    Chen, Shao-Yu; Goldstein, Thomas; Ramasubramaniam, Ashwin; Yan, Jun

    2016-01-01

    Type-II Weyl fermion nodes, located at the touching points between electron and hole pockets, have been recently predicted to occur in distorted octahedral ($T'$) transition metal dichalcogenide semimetals, contingent upon the condition that the layered crystal has the noncentrosymmetric orthorhombic ($T'_{or}$) stacking. Here, we report on the emergence of two shear Raman bands activated by inversion symmetry breaking in $T'$-MoTe$_2$ due to sample cooling. Polarization and crystal orientati...

  19. Suppression of Atlantic Tropical Cyclone Activity by Extratropical Rossby Wave Breaking

    Science.gov (United States)

    Zhang, G.; Wang, Z.

    2014-12-01

    With warm SST anomalies in the tropical Atlantic and cold SST anomalies in the East Pacific, the reduced Atlantic tropical cyclone activity from August to early September in 2013 was a surprise to the hurricane community. Our analyses suggest that the suppressed storm activity can be attributed to the frequent occurrence of dry air in the middle to upper troposphere along with strong vertical wind shear. Such unfavorable conditions are directly related to the equatorward propagation and breaking of midlatitude Rossby waves, which lead to the equatorward intrusions of cold and dry extratropical air. Further examination suggests the active anti-cyclonic Rossby wave breaking and frequent equatorward intrusions of extratropical air in August 2013 were associated with changes of the midlatitude jet stream (i.e., acceleration, eastward extension and greater strain rate). The EOF analysis of 200-hPa zonal wind identifies a recurrent mode of interannual variability over Atlantic, which is associated with the variations of the intensity and zonal extent of the mid-latitude jet. This mode is found significantly correlated to Atlantic hurricane frequency in August, with a coefficient higher than the Nino3.4 index and comparable to the (relative) SST of Major Development Region (MDR). Our analyses thus emphasize the extratropical impacts on Atlantic tropical cyclones via the Rossby wave breaking. This physical link is missing in most statistical and hybrid forecast schemes and may help explain the seasonal prediction bust in 2013.

  20. Complement activation in the context of stem cells and tissue repair

    Institute of Scientific and Technical Information of China (English)

    Ingrid; U; Schraufstatter; Sophia; K; Khaldoyanidi; Richard; G; DiScipio

    2015-01-01

    The complement pathway is best known for its role in immune surveillance and inflammation. However,its ability of opsonizing and removing not only pathogens,but also necrotic and apoptotic cells,is a phylogenetically ancient means of initiating tissue repair. The means and mechanisms of complement-mediated tissue repair are discussed in this review. There is increasing evidence that complement activation contributes to tissue repair at several levels. These range from the chemo-attraction of stem and progenitor cells to areas of complement activation,to increased survival of various cell types in the presence of split products of complement,and to the production of trophic factors by cells activated by the anaphylatoxins C3 a and C5 a. This repair aspect of complement biology has not found sufficient appreciation until recently. The following will examine this aspect of complement biology with an emphasis on the anaphylatoxins C3 a and C5 a.

  1. Cloud properties during active and break spells of the West African summer monsoon from CloudSat-CALIPSO measurements

    Science.gov (United States)

    Efon, E.; Lenouo, A.; Monkam, D.; Manatsa, D.

    2016-07-01

    High resolution of daily rainfall dataset from the Tropical Rainfall Measuring Mission (TRMM) was used to identify active and break cloud formation periods. The clouds were characterized based on CloudSat-CALIPSO satellite images over West Africa during the summer monsoon during the period 2006-2010. The active and break periods are defined as the periods during the peak monsoon months of June to August when the normalized anomaly of rainfall over the monsoon core zone is greater than 0.9 or less than -0.9 respectively, provided the criteria is satisfied for at least three consecutive days. It is found that about 90% of the break period and 66.7% of the active spells lasted 3-4 days. Active spells lasting duration of about a week were observed while no break spell had such a long span. Cloud macrophysical (cloud base height (CBH), cloud top height (CTH) and cloud geometric depth (∆H), microphysical (cloud liquid water content, (LWC), liquid number concentration (LNC), liquid effective radius, ice water content (IWC), ice number concentration (INC) and ice effective radius) and radiative (heating rate properties) over South Central West Africa (5-15°N; 15°W-10°E) during the active and break spells were also analyzed. High-level clouds are more predominant during the break periods compared to the active periods. Active spells have lower INC compared to the break spells. Liquid water clouds are observed to have more radiative forcing during the active than break periods while ice phase clouds bring more cooling effect during the break spells compared to the active spells.

  2. Laser-activated protein solder for peripheral nerve repair

    Science.gov (United States)

    Trickett, Rodney I.; Lauto, Antonio; Dawes, Judith M.; Owen, Earl R.

    1995-05-01

    A 100 micrometers core optical fiber-coupled 75 mW diode laser operating at a wavelength of 800 nm has been used in conjunction with a protein solder to stripe weld severed rat tibial nerves, reducing the long operating time required for microsurgical nerve repair. Welding is produced by selective laser denaturation of the albumin based solder which contains the dye indocyanine green. Operating time for laser soldering was 10 +/- 5 min. (n equals 20) compared to 23 +/- 9 min. (n equals 10) for microsuturing. The laser solder technique resulted in patent welds with a tensile strength of 15 +/- 5 g, while microsutured nerves had a tensile strength of 40 +/- 10 g. Histopathology of the laser soldered nerves, conducted immediately after surgery, displayed solder adhesion to the outer membrane with minimal damage to the inner axons of the nerves. An in vivo study is under way comparing laser solder repaired tibial nerves to conventional microsuture repair. At the time of submission 15 laser soldered nerves and 7 sutured nerves were characterized at 3 months and showed successful regeneration with compound muscle action potentials of 27 +/- 8 mV and 29 +/- 8 mW respectively. A faster, less damaging and long lasting laser based anastomotic technique is presented.

  3. Classroom-Based Physical Activity Breaks and Children's Attention: Cognitive Engagement Works!

    Science.gov (United States)

    Schmidt, Mirko; Benzing, Valentin; Kamer, Mario

    2016-01-01

    Classroom-based physical activity breaks are postulated to positively impact children's attention during their school day. However, empirical evidence for this claim is scarce and the role of cognitive engagement in enhancing children's attentional performance is unexplored in studies on physical activity breaks. The aim of the present study was therefore to disentangle the separate and/or combined effects of physical exertion and cognitive engagement induced by physical activity breaks on primary school children's attention. In addition, the role of children's affective reactions to acute interventions at school was investigated. Using a 2 × 2 between-subjects experimental design, 92 children between the ages of 11 and 12 years (M = 11.77, SD = 0.41) were randomly assigned to one of four experimental conditions: (1) combo group (physical activity with high cognitive demands), (2) cognition group (sedentary with high cognitive demands), (3) physical group (physical activity with low cognitive demands), and (4) control group (sedentary with low cognitive demands). Attention and affect were measured before and immediately after a 10-min intervention. ANCOVAs revealed that whereas physical exertion had no effect on any measure of children's attentional performance, cognitive engagement was the crucial factor leading to increased focused attention and enhanced processing speed. Mediational analyses showed that changes in positive affect during the interventions mediated the effect between cognitive engagement and focused attention as well as between cognitive engagement and processing speed. These surprising results are discussed in the light of theories predicting both facilitating and deteriorative effects of positive affect on attention.

  4. Repair of γ-irradiation-induced DNA single-strand breaks in human bone marrow cells. Analysis of unfractionated and CD34+ cells using single-cell gel electrophoresis

    International Nuclear Information System (INIS)

    Human bone marrow mononuclear cells (BMMNCs) were separated by density gradient centrifugation, and a subpopulation of progenitor cells was further isolated using anti-CD34-coated magnetic beads. The cells were irradiated with γ-rays (0.93-5.43 Gy) from a 137Cs source. The extent of DNA damage, i.e., single-strand breaks (SSBs) and alkali-labile lesions of individual cells, was investigated using the alkaline single-cell gel electrophoresis technique. The irradiation resulted in a dose-dependent increase in DNA migration, reflecting the number of detectable DNA lesions. An approximately similar extent of SSB formation was observed in BMMNCs and CD34+ cells. Damage was repaired when the cells were incubated at 37C: a fast initial repair phase was followed by a slower rejoining of SSBs in both BMMNC and CD34+ cell populations. A significantly longer time was required to repair the lesions caused by 5.43 Gy than those caused by 0.93 Gy. In the present work we report, for the first time, the induction and repair of DNA SSBs at the level of single human bone marrow cells when exposed to ionizing radiation at clinically relevant doses. These data, together with our previous results with human blood granulocytes and lymphocytes, indicate an approximately similar extent of formation and repair of γ-irradiation-induced DNA SSBs in immature and mature human hematopoietic cells

  5. Are valve repairs associated with better outcomes than replacements in patients with native active valve endocarditis?

    Science.gov (United States)

    Zhao, Dong; Zhang, Benqing

    2014-12-01

    A best evidence topic in cardiac surgery was written according to a structured protocol. The question addressed was whether valve replacement was associated with higher morbidity and mortality rates than valve repair in patients with native active valve endocarditis. Altogether 662 papers were found using the reported search, of which 7 represented the best evidence to answer the clinical question. The authors, journal, date and country of publication, patient group studied, study type, relevant outcomes and results of these papers are tabulated. Traditionally, valve replacement has been the standard therapy for valve endocarditis when surgical treatment is indicated. But now valve repair is increasingly used as an alternative, which may avoid disadvantages of anticoagulation, lower the risk of prosthetic infection and improve postoperative survival. To compare outcomes of these two treatments between studies can be difficult because most of related papers contain raw data on prosthetic valve endocarditis or healed endocarditis, which were excluded from our manuscript. Studies only analysing the outcomes of either of these treatments without the comparison of valve repair and replacement were also excluded. Finally, seven papers were identified. The American Heart Association/American College of Cardiology 2006 valvular guidelines recommended that mitral valve repair should be performed instead of replacement when at all possible. In three of the seven studies, there were significant differences between valve repair and replacement in long-term survival. One study found that aortic valve repair offered better outcomes in freedom from reoperation at 5 years (P = 0.021) and in survival at 4 years (repair vs replacement 88 vs 65%; P = 0.047). One study reported that there was improved event-free survival at 10 years in the mitral valve repair group (P = 0.015), although there was more previous septic embolization in this group. In one study, early and late mortality

  6. Laser-activated protein bands for peripheral nerve repair

    Science.gov (United States)

    Lauto, Antonio; Trickett, Rodney I.; Malik, Richard; Dawes, Judith M.; Owen, Earl R.

    1996-01-01

    A 100 micrometer core optical fiber-coupled 75 mW diode laser operating at a wavelength of 800 nm has been used in conjunction with a protein solder to stripe weld severed rat tibial nerves, reducing the long operating time required for microsurgical nerve repair. Welding is produced by selective laser denaturation of the protein based solder which contains the dye indocyanine green. Operating time for laser soldering was 10 plus or minus 5 min. (n equals 24) compared to 23 plus or minus 9 min (n equals 13) for microsuturing. The laser solder technique resulted in patent welds with a tensile strength of 15 plus or minus 5 g, while microsutured nerves had a tensile strength of 40 plus or minus 10 g. Histopathology of the laser soldered nerves, conducted immediately after surgery, displayed solder adhesion to the outer membrane with minimal damage to the inner axons of the nerves. An in vivo study, with a total of fifty-seven adult male wistar rats, compared laser solder repaired tibial nerves to conventional microsuture repair. Twenty-four laser soldered nerves and thirteen sutured nerves were characterized at three months and showed successful regeneration with average compound muscle action potentials (CMAP) of 2.4 plus or minus 0.7 mV and 2.7 plus or minus 0.8 mV respectively. Histopathology of the in vivo study, confirmed the comparable regeneration of axons in laser and suture operated nerves. A faster, less damaging and long lasting laser based anastomotic technique is presented.

  7. DNA apoptosis and stability in B-cell chronic lymphoid leukaemia: implication of the DNA double-strand breaks repair system by non homologous recombination

    International Nuclear Information System (INIS)

    After an introduction presenting the diagnosis and treatment of chronic lymphoid leukaemia, its molecular and genetic characteristics, and its cellular origin and clonal evolution, this research thesis describes the apoptosis (definition and characteristics, cancer and chemotherapy, apoptotic ways induced by gamma irradiation), the genotoxic stresses, the different repair mechanisms for different damages, and the DNA repair processes. It reports how human chronic lymphocytic leukaemia B cells can escape DNA damage-induced apoptosis through the non-homologous end-joining DNA repair pathway, and presents non-homologous end-joining DNA repair as a potent mutagenic process in human chronic lymphocytic leukaemia B cells

  8. Lipid raft-dependent plasma membrane repair interferes with the activation of B lymphocytes.

    Science.gov (United States)

    Miller, Heather; Castro-Gomes, Thiago; Corrotte, Matthias; Tam, Christina; Maugel, Timothy K; Andrews, Norma W; Song, Wenxia

    2015-12-21

    Cells rapidly repair plasma membrane (PM) damage by a process requiring Ca(2+)-dependent lysosome exocytosis. Acid sphingomyelinase (ASM) released from lysosomes induces endocytosis of injured membrane through caveolae, membrane invaginations from lipid rafts. How B lymphocytes, lacking any known form of caveolin, repair membrane injury is unknown. Here we show that B lymphocytes repair PM wounds in a Ca(2+)-dependent manner. Wounding induces lysosome exocytosis and endocytosis of dextran and the raft-binding cholera toxin subunit B (CTB). Resealing is reduced by ASM inhibitors and ASM deficiency and enhanced or restored by extracellular exposure to sphingomyelinase. B cell activation via B cell receptors (BCRs), a process requiring lipid rafts, interferes with PM repair. Conversely, wounding inhibits BCR signaling and internalization by disrupting BCR-lipid raft coclustering and by inducing the endocytosis of raft-bound CTB separately from BCR into tubular invaginations. Thus, PM repair and B cell activation interfere with one another because of competition for lipid rafts, revealing how frequent membrane injury and repair can impair B lymphocyte-mediated immune responses.

  9. Regional Heat Sources and the Active and Break Phases of Boreal Summer Intraseasonal Variability

    Energy Technology Data Exchange (ETDEWEB)

    Annamalai, H; Sperber, K R

    2003-12-15

    The boreal summer intraseasonal variability (BSISV) associated with the 30-50 day mode is represented by the co-existence of three components, poleward propagation of convection over the Indian and tropical west Pacific longitudes and eastward propagation along the equator. The hypothesis that the three components influence each other has been investigated using observed OLR, NCEP-NCAR reanalysis, and solutions from an idealized linear model. The null hypothesis is that the three components are mutually independent. Cyclostationary EOF (CsEOF) analysis is applied on filtered OLR to extract the life-cycle of the BSISV. The dominant mode of CsEOF is significantly tied to observed rainfall over the Indian subcontinent. The components of the heating patterns from CsEOF analysis serve as prescribed forcings for the linear model. This allows us to ascertain which heat sources and sinks are instrumental in driving the large-scale monsoon circulation during the BSISV life-cycle. We identify three new findings: (1) the circulation anomalies that develop as a Rossby wave response to suppressed convection over the equatorial Indian Ocean associated with the previous break phase of the BSISV precondition the ocean-atmosphere system in the western Indian Ocean and trigger the next active phase of the BSISV, (2) the development of convection over the tropical west Pacific forces descent anomalies to the west. This, in conjunction with the weakened cross-equatorial flow due to suppressed convective anomalies over the equatorial Indian Ocean reduce the tropospheric moisture over the Arabian Sea, and promote westerly wind anomalies that do not recurve over India. As a result the low-level cyclonic vorticity shifts from India to southeast Asia and break conditions are initiated over India, and (3) the circulation anomalies forced by equatorial Indian Ocean convective anomalies significantly influence the active/break phases over the tropical west Pacific. Our model solutions support

  10. Silibinin enhances the repair of ultraviolet B-induced DNA damage by activating p53-dependent nucleotide excision repair mechanism in human dermal fibroblasts.

    Science.gov (United States)

    Guillermo-Lagae, Ruth; Deep, Gagan; Ting, Harold; Agarwal, Chapla; Agarwal, Rajesh

    2015-11-24

    Ultraviolet radiation B (UVB) is the main cause of DNA damage in epidermal cells; and if not repaired, this DNA damage leads to skin cancer. In earlier studies, we have reported that natural flavonolignan silibinin exerts strong chemopreventive efficacy against UVB-induced skin damage and carcinogenesis; however mechanistic studies are still being actively pursued. Here, we investigated the role of nucleotide excision repair (NER) pathway in silibinin's efficacy to repair UVB-induced DNA damage. Normal human dermal fibroblasts (NHDFs) were exposed to UVB (1 mJ/cm2) with pre- or post- silibinin (100 μM) treatment, and cyclobutane pyrimidine dimers (CPDs) formation/repair was measured. Results showed that post-UVB silibinin treatment accelerates DNA repair via activating the NER pathway including the expression of XPA (xeroderma pigmentosum complementation group A), XPB, XPC, and XPG. In UVB exposed fibroblasts, silibinin treatment also increased p53 and GADD45α expression; the key regulators of the NER pathway and DNA repair. Consistently, post-UVB silibinin treatment increased the mRNA transcripts of XPA and GADD45α. Importantly, silibinin showed no effect on UVB-induced DNA damage repair in XPA- and XPB-deficient human dermal fibroblasts suggesting their key role in silibinin-mediated DNA damage repair. Moreover, in the presence of pifithrin-α, an inhibitor of p53, the DNA repair efficacy of silibinin was compromised associated with a reduction in XPA and GADD45α transcripts. Together, these findings suggest that silibinin's efficacy against UVB-induced photodamage is primarily by inhibiting NER and p53; and these findings further support silibinin's usage as a potential inexpensive, effective, and non-toxic agent for skin cancer chemoprevention. PMID:26447614

  11. Could a change in magnetic field geometry cause the break in the wind-activity relation?

    CERN Document Server

    Vidotto, A A; Jardine, M; See, V; Petit, P; Boisse, I; Saikia, S Boro; Hebrard, E; Jeffers, S V; Marsden, S C; Morin, J

    2015-01-01

    Wood et al suggested that mass-loss rate is a function of X-ray flux ($\\dot{M} \\propto F_x^{1.34}$) for dwarf stars with $F_x \\lesssim F_{x,6} \\equiv 10^6$ erg cm$^{-2}$ s$^{-1}$. However, more active stars do not obey this relation. These authors suggested that the break at $F_{x,6}$ could be caused by significant changes in magnetic field topology that would inhibit stellar wind generation. Here, we investigate this hypothesis by analysing the stars in Wood et al's sample that had their surface magnetic fields reconstructed through Zeeman-Doppler Imaging (ZDI). Although the solar-like outliers in the $\\dot{M}$ -- $F_x$ relation have higher fractional toroidal magnetic energy, we do not find evidence of a sharp transition in magnetic topology at $F_{x,6}$. To confirm this, further wind measurements and ZDI observations at both sides of the break are required. As active stars can jump between states with highly toroidal to highly poloidal fields, we expect significant scatter in magnetic field topology to exi...

  12. Association of ATM activation and DNA repair with induced radioresistance after low-dose irradiation

    International Nuclear Information System (INIS)

    Mammalian cells often exhibit a hyper-radiosensitivity (HRS) to radiation doses <20 cGy, followed by increased radioresistance (IRR) at slightly higher doses (∼20-30 cGy). Here, the influence of DNA double-strand break repair (DSBR) on IRR was examined. The failure of Ataxia telangiectasia (AT) cells to undergo IRR reported by others was confirmed. Flow cytometric analysis indicated that normal cells fail to show a measurable increase in serine 1981 phosphorylated AT-mutated (ATM) protein after 10 cGy up to 4 h post irradiation, but a two- to fourfold increase after 25 cGy. Similarly, more proficient reduction of phosphorylated histone H2AX was observed 24 h after 25 cGy than after 10 cGy, suggesting that DSBR is more efficient during IRR than HRS. A direct examination of the consequences of inefficient DNA repair per se (as opposed to ATM-mediated signal transduction/cell cycle responses), by determining the clonogenic survival of cells lacking the DNA repair enzyme polynucleotide kinase/phosphatase, indicated that these cells have a response similar to AT cells, i.e. HRS but no IRR, strongly linking IRR to DSBR. (authors)

  13. Absorbing aerosols facilitate transition of Indian monsoon breaks to active spells

    Energy Technology Data Exchange (ETDEWEB)

    Manoj, M.G.; Devara, P.C.S.; Safai, P.D.; Goswami, B.N. [Indian Institute of Tropical Meteorology, Pashan, Pune (India)

    2011-12-15

    While some long breaks of monsoon intraseasonal oscillations (MISOs) are followed by active spells (BFA), some others are not (BNFA). The circulation during BFA (BNFA) cases helps (prevents) accumulation of absorbing aerosols over central India (CI) resulting in almost three times larger Aerosol Index (AI) over CI, during BFA cases compared to BNFA cases. A seminal role played by the absorbing aerosols in the transition from break to active spells is unraveled through modification of the north-south temperature gradient at lower levels. The meridional gradient of temperature at low level ({nabla}T) between aerosol-rich CI and pristine equatorial Indian Ocean is large (>6 C) and sustains for long time (>10 days) during BFA leading to significant moisture convergence to CI. The stability effect arising from surface cooling by the aerosols is overcome by the enhanced moisture convergence creating a moist static unstable atmosphere conducive for the large-scale organized convection over the CI region leading to the resurgence of active spells. The moisture convergence induced by {nabla}T was also able to overcome possible aerosol indirect effect (Twomey effect) and initiate deep convection and transition to active condition. During BNFA cases, however the maximum {nabla}T, which was weaker than the BFA cases by more than 1.5 C, could not sustain required moisture convergence and failed to lead to a sustained active spell. Using data from MODIS (MODerate resolution Imaging Spectroradiometer) onboard Terra and several other input parameters from various satellites for the period 2000-2009, the aerosol induced radiative forcing representative of two regions - the CI to the north and the pristine ocean to the south - were estimated and support the differences in observed {nabla}T during the two cases. Our results highlight the need for proper inclusion of absorbing aerosols in dynamical models for simulation of the observed variability of MISOs and their extended range

  14. Chemical repair activity of free radical scavenger edaravone. Reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA

    International Nuclear Information System (INIS)

    Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 108 dm3 mol-1 s-1 and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10–1000 μmol dm-3) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. (author)

  15. Anthracyclines induce double-strand DNA breaks at active gene promoters.

    Science.gov (United States)

    Yang, Fan; Kemp, Christopher J; Henikoff, Steven

    2015-03-01

    Doxorubicin is a widely used chemotherapeutic drug that intercalates between DNA base-pairs and poisons Topoisomerase II, although the mechanistic basis for cell killing remains speculative. Doxorubicin and related anthracycline compounds have been shown to increase nucleosome turnover and/or eviction around promoters, which suggests that the resulting enhanced exposure of DNA might underlie cell killing. Previously, we showed that low doses of anthracyclines increase nucleosome turnover around active gene promoters, which suggests that loss of nucleosomes might contribute to cancer cell killing. Here we apply a genome-wide method to precisely map DNA double-strand breaks (DSBs) in cancer cells. We find that spontaneous DSBs occur preferentially around promoters of active genes, and that both anthracyclines and etoposide, a Topoisomerase II poison, increase DSBs around promoters, although CpG islands are conspicuously protected from DSBs. We propose that torsion-based enhancement of nucleosome turnover by anthracyclines exposes promoter DNA, ultimately causing DSBs around promoters.

  16. Genomically amplified Akt3 activates DNA repair pathway and promotes glioma progression.

    Science.gov (United States)

    Turner, Kristen M; Sun, Youting; Ji, Ping; Granberg, Kirsi J; Bernard, Brady; Hu, Limei; Cogdell, David E; Zhou, Xinhui; Yli-Harja, Olli; Nykter, Matti; Shmulevich, Ilya; Yung, W K Alfred; Fuller, Gregory N; Zhang, Wei

    2015-03-17

    Akt is a robust oncogene that plays key roles in the development and progression of many cancers, including glioma. We evaluated the differential propensities of the Akt isoforms toward progression in the well-characterized RCAS/Ntv-a mouse model of PDGFB-driven low grade glioma. A constitutively active myristoylated form of Akt1 did not induce high-grade glioma (HGG). In stark contrast, Akt2 and Akt3 showed strong progression potential with 78% and 97% of tumors diagnosed as HGG, respectively. We further revealed that significant variations in polarity and hydropathy values among the Akt isoforms in both the pleckstrin homology domain (P domain) and regulatory domain (R domain) were critical in mediating glioma progression. Gene expression profiles from representative Akt-derived tumors indicated dominant and distinct roles for Akt3, consisting primarily of DNA repair pathways. TCGA data from human GBM closely reflected the DNA repair function, as Akt3 was significantly correlated with a 76-gene signature DNA repair panel. Consistently, compared with Akt1 and Akt2 overexpression models, Akt3-expressing human GBM cells had enhanced activation of DNA repair proteins, leading to increased DNA repair and subsequent resistance to radiation and temozolomide. Given the wide range of Akt3-amplified cancers, Akt3 may represent a key resistance factor.

  17. De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks

    KAUST Repository

    Mahfouz, Magdy M.

    2011-01-24

    Site-specific and rare cutting nucleases are valuable tools for genome engineering. The generation of double-strand DNA breaks (DSBs) promotes homologous recombination in eukaryotes and can facilitate gene targeting, additions, deletions, and inactivation. Zinc finger nucleases have been used to generate DSBs and subsequently, for genome editing but with low efficiency and reproducibility. The transcription activator-like family of type III effectors (TALEs) contains a central domain of tandem repeats that could be engineered to bind specific DNA targets. Here, we report the generation of a Hax3-based hybrid TALE nuclease with a user-selected DNA binding specificity. We show that the engineered TALE nuclease can bind to its target sequence in vitro and that the homodimeric TALE nuclease can cleave double-stranded DNA in vitro if the DNA binding sites have the proper spacing and orientation. Transient expression assays in tobacco leaves suggest that the hybrid nuclease creates DSB in its target sequence, which is subsequently repaired by nonhomologous end-joining repair. Taken together, our data show the feasibility of engineering TALE-based hybrid nucleases capable of generating site-specific DSBs and the great potential for site-specific genome modification in plants and eukaryotes in general.

  18. Can cognitive activities during breaks in repetitive manual work accelerate recovery from fatigue? A controlled experiment.

    Directory of Open Access Journals (Sweden)

    Svend Erik Mathiassen

    Full Text Available Neurophysiologic theory and some empirical evidence suggest that fatigue caused by physical work may be more effectively recovered during "diverting" periods of cognitive activity than during passive rest; a phenomenon of great interest in working life. We investigated the extent to which development and recovery of fatigue during repeated bouts of an occupationally relevant reaching task was influenced by the difficulty of a cognitive activity between these bouts. Eighteen male volunteers performed three experimental sessions, consisting of six 7-min bouts of reaching alternating with 3 minutes of a memory test differing in difficulty between sessions. Throughout each session, recordings were made of upper trapezius muscle activity using electromyography (EMG, heart rate and heart rate variability (HRV using electrocardiography, arterial blood pressure, and perceived fatigue (Borg CR10 scale and SOFI. A test battery before, immediately after and 1 hour after the work period included measurements of maximal shoulder elevation strength (MVC, pressure pain threshold (PPT over the trapezius muscles, and a submaximal isometric contraction. As expected, perceived fatigue and EMG amplitude increased during the physical work bouts. Recovery did occur between the bouts, but fatigue accumulated throughout the work period. Neither EMG changes nor recovery of perceived fatigue during breaks were influenced by cognitive task difficulty, while heart rate and HRV recovered the most during breaks with the most difficult task. Recovery of perceived fatigue after the 1 hour work period was also most pronounced for the most difficult cognitive condition, while MVC and PPT showed ambiguous patterns, and EMG recovered similarly after all three cognitive protocols. Thus, we could confirm that cognitive tasks between bouts of fatiguing physical work can, indeed, accelerate recovery of some factors associated with fatigue, even if benefits may be moderate and some

  19. Protozoan ALKBH8 Oxygenases Display both DNA Repair and tRNA Modification Activities

    DEFF Research Database (Denmark)

    Zdżalik, Daria; Vågbø, Cathrine B; Kirpekar, Finn;

    2014-01-01

    1-8 and FTO. Mammalian and plant ALKBH8 are tRNA hydroxylases targeting 5-methoxycarbonylmethyl-modified uridine (mcm5U) at the wobble position of tRNAGly(UCC). In contrast, the genomes of some bacteria encode a protein with strong sequence homology to ALKBH8, and robust DNA repair activity...

  20. Conjugated linoleic acid inhibiting DNA repair damaged by x-ray

    International Nuclear Information System (INIS)

    Non-homologous end-joining is the most effective repair of DNA double strand break. Epidermal growth factor receptor activates DSB repairs. Integration of EGFR inhibitors with radiation or chemotherapy were used in lung cancer treatment. Radiosensitivity effect of conjugated linoleic acid on tumor cells and reduced metastasis are reported

  1. The evolution of activity breaks in the nest cycle of annual eusocial bees: a model of delayed exponential growth

    Directory of Open Access Journals (Sweden)

    Strohm Erhard

    2006-06-01

    Full Text Available Abstract Background Social insects show considerable variability not only in social organisation but also in the temporal pattern of nest cycles. In annual eusocial sweat bees, nest cycles typically consist of a sequence of distinct phases of activity (queen or workers collect food, construct, and provision brood cells and inactivity (nest is closed. Since the flight season is limited to the time of the year with sufficiently high temperatures and resource availability, every break reduces the potential for foraging and, thus, the productivity of a colony. This apparent waste of time has not gained much attention. Results We present a model that explains the evolution of activity breaks by assuming differential mortality during active and inactive phases and a limited rate of development of larvae, both reasonable assumptions. The model predicts a systematic temporal structure of breaks at certain times in the season which increase the fitness of a colony. The predicted pattern of these breaks is in excellent accordance with field data on the nest cycle of the halictid Lasioglossum malachurum. Conclusion Activity breaks are a counter-intuitive outcome of varying mortality rates that maximise the reproductive output of primitively eusocial nests.

  2. Outcome of early active mobilization after flexor tendons repair in zones II-V in hand

    Directory of Open Access Journals (Sweden)

    Saini Narender

    2010-01-01

    Full Text Available Background: The functional outcome of a flexor tendon injury after repair depends on multiple factors. The postoperative management of tendon injuries has paved a sea through many mobilization protocols. The improved understanding of splinting techniques has promoted the understanding and implication of these mobilization protocols. We conducted a study to observe and record the results of early active mobilization of repaired flexor tendons in zones II-V. Materials and Methods: 25 cases with 75 digits involving 129 flexor tendons including 8 flexor pollicis longus (FPL tendons in zones II-V of thumb were subjected to the early active mobilization protocol. Eighteen (72% patients were below 30 years of age. Twenty-four cases (96% sustained injury by sharp instrument either accidentally or by assault. Ring and little finger were involved in 50% instances. In all digits, either a primary repair (n=26 or a delayed primary repair (n=49 was done. The repair was done with the modified Kessler core suture technique with locking epitendinous sutures with a knot inside the repair site, using polypropylene 3-0/4-0 sutures. An end-to-end repair of the cut nerves was done under loupe magnification using a 6-0/8-0 polyamide suture. The rehabilitation program adopted was a modification of Kleinert′s regimen, and Silfverskiold regimen. The final assessment was done at 14 weeks post repair using the Louisville system of Lister et al. Results: Eighteen of excellent results were attributed to ring and little fingers where there was a flexion lag of < 1 cm and an extension lag of < 15o. FPL showed 75% (n=6 excellent flexion. 63% (n=47 digits showed excellent results whereas good results were seen in 19% (n=14 digits. Nine percent (n=7 digits showed fair and the same number showed poor results. The cases where the median (n=4 or ulnar nerve (n=6 or both (n=3 were involved led to some deformity (clawing/ape thumb at 6 months postoperatively. The cases with digital

  3. Effects of ara A and fresh medium on chromosome damage and DNA double-strand break repair in X-irradiated stationary cells

    Energy Technology Data Exchange (ETDEWEB)

    Bryant, P.E. (GSF-Abteilung fuer Biophysikalische Strahlenforschung, Frankfurt am Main (Germany, F.R.))

    1984-01-01

    The detailed kinetics of repair of dsb in Ehrlich ascites tumour cells over long repair intervals have been studied and compared under conditions simulating procedures known to cause large changes in cell survival, i.e. holding cells in stationary phase for 7 h after x-radiation, transference of cells to fresh growth medium immediately after x-radiation, and treatment with the DNA synthesis inhibitor 9-..beta..-D-arabinofuranosyladenine (ara A) for 30 min before, during and for 7 h after x-irradiation. These conditions have also been investigated for their effects on frequencies of chromosome abnormalities (anaphase bridges and fragments). Conditions leading to both an inhibition of dsb repair (in the presence of ara A) as well as an acceleration of dsb repair (by fresh growth medium) led to higher frequencies of chromosome abnormalities compared with those for cells under stationary conditions for 7 h after irradiation. Holding dsb open for long periods with ara A may maximize the probability of formation of aberrations, however, the data for fresh medium treatment showed it is not merely the rate at which dsb repair which determines the aberration frequency, and indicated the presence of other biochemical mechanisms in the cell determining the frequency of conversion of dsb into chromosome aberrations.

  4. Activation-induced cytidine deaminase induces reproducible DNA breaks at many non-Ig Loci in activated B cells.

    Science.gov (United States)

    Staszewski, Ori; Baker, Richard E; Ucher, Anna J; Martier, Raygene; Stavnezer, Janet; Guikema, Jeroen E J

    2011-01-21

    After immunization or infection, activation-induced cytidine deaminase (AID) initiates diversification of immunoglobulin (Ig) genes in B cells, introducing mutations within the antigen-binding V regions (somatic hypermutation, SHM) and double-strand DNA breaks (DSBs) into switch (S) regions, leading to antibody class switch recombination (CSR). We asked if, during B cell activation, AID also induces DNA breaks at genes other than IgH genes. Using a nonbiased genome-wide approach, we have identified hundreds of reproducible, AID-dependent DSBs in mouse splenic B cells shortly after induction of CSR in culture. Most interestingly, AID induces DSBs at sites syntenic with sites of translocations, deletions, and amplifications found in human B cell lymphomas, including within the oncogene B cell lymphoma11a (bcl11a)/evi9. Unlike AID-induced DSBs in Ig genes, genome-wide AID-dependent DSBs are not restricted to transcribed regions and frequently occur within repeated sequence elements, including CA repeats, non-CA tandem repeats, and SINEs.

  5. Fuzzy Activity Based Life Cycle Costing For Repairable Equipment

    Directory of Open Access Journals (Sweden)

    Mulubrhan Freselam

    2016-01-01

    Full Text Available Life-cycle cost (LCC is the much known method used for decision making that considers all costs in the life of a system or equipment. Predicting LCCs is fraught with potential errors, owing to the uncertainty in future events, future costs, interest rates, and even hidden costs. These uncertainties have a direct impact on the decision making. Activity based LCC is used to identify the activities and cost drivers in acquisition, operation and maintenance phase. This activity based LCC is integrated with fuzzy set theory and interval mathematics to model these uncertainties. Day–Stout–Warren (DSW algorithm and the vertex method are then used to evaluate competing alternatives. A case of two pumps (Pump A and Pump B are taken and their LCC is analysed using the developed model. The equivalent annual cost of Pump B is greater than Pump A, which leads the decision maker to choose Pump A over Pump B.

  6. Relationship Between Break-Time Physical Activity, Age, and Sex in a Rural Primary Schools, Wales, UK

    Science.gov (United States)

    Escalante, Yolanda; Backx, Karianne; Saavedra, Jose M.

    2014-01-01

    The aim of this study was to examine the physical activity during the break-times of primary school children in rural areas, and its relationship with age and sex. 380 children (192 boys and 188 girls; age=9.5±1.1 years) participated in the study. Break-time physical activity in the morning and lunch breaks was measured by accelerometry. An ANOVA was used to determine differences by sex in each age group, together with the respective confidence intervals and effect sizes. The results showed that 8-year-olds performed more physical exercise than 11-year-olds during the two breaks (p=0.005). For the boys, the 8-year-olds did more physical activity than the 10-year-olds, while, for the girls, those aged 8 and 9 years did more PA than girls aged 11 years (p<0.001). The only difference between boys and girls was for the 10-year-olds (p=0.043), with the boys doing more physical activity. Teachers might find it useful to take these findings into account to design physical activity programmes aimed at increasing the playground physical activity of older children. PMID:25031690

  7. Comparison of repair of DNA double-strand breaks in identical sequences in primary human fibroblast and immortal hamster-human hybrid cells harboring a single copy of human chromosome 11

    Science.gov (United States)

    Fouladi, B.; Waldren, C. A.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    2000-01-01

    We have optimized a pulsed-field gel electrophoresis assay that measures induction and repair of double-strand breaks (DSBs) in specific regions of the genome (Lobrich et al., Proc. Natl. Acad. Sci. USA 92, 12050-12054, 1995). The increased sensitivity resulting from these improvements makes it possible to analyze the size distribution of broken DNA molecules immediately after the introduction of DSBs and after repair incubation. This analysis shows that the distribution of broken DNA pieces after exposure to sparsely ionizing radiation is consistent with the distribution expected from randomly induced DSBs. It is apparent from the distribution of rejoined DNA pieces after repair incubation that DNA ends continue to rejoin between 3 and 24 h postirradiation and that some of these rejoining events are in fact misrejoining events, since novel restriction fragments both larger and smaller than the original fragment are generated after repair. This improved assay was also used to study the kinetics of DSB rejoining and the extent of misrejoining in identical DNA sequences in human GM38 cells and human-hamster hybrid A(L) cells containing a single human chromosome 11. Despite the numerous differences between these cells, which include species and tissue of origin, levels of TP53, expression of telomerase, and the presence or absence of a homologous chromosome for the restriction fragments examined, the kinetics of rejoining of radiation-induced DSBs and the extent of misrejoining were similar in the two cell lines when studied in the G(1) phase of the cell cycle. Furthermore, DSBs were removed from the single-copy human chromosome in the hamster A(L) cells with similar kinetics and misrejoining frequency as at a locus on this hybrid's CHO chromosomes.

  8. Efficacy of DNA double-strand breaks repair in breast cancer is decreased in carriers of the variant allele of the UBC9 gene c.73G>A polymorphism

    Energy Technology Data Exchange (ETDEWEB)

    Synowiec, Ewelina [Department of Molecular Genetics, University of Lodz, Lodz (Poland); Krupa, Renata [Laboratory of DNA Repair, Department of Molecular Genetics, University of Lodz, Banacha 12/16, Lodz (Poland); Morawiec, Zbigniew; Wasylecka, Maja [Department of Surgical Oncology, N. Copernicus Hospital, Lodz (Poland); Dziki, Lukasz; Morawiec, Jan [Department of General and Colorectal Surgery, Medical University of Lodz, Lodz (Poland); Blasiak, Janusz [Department of Molecular Genetics, University of Lodz, Lodz (Poland); Wozniak, Katarzyna, E-mail: wozniak@biol.uni.lodz.pl [Laboratory of DNA Repair, Department of Molecular Genetics, University of Lodz, Banacha 12/16, Lodz (Poland)

    2010-12-10

    UBC9 (E2) SUMO conjugating enzyme plays an important role in the maintenance of genome stability and integrity. In the present work we examined the association between the c.73G>A (Val25Met) polymorphism of the UBC9 gene (rs11553473) and efficacy of DNA double-strand breaks (DSBs) repair (DRE) in breast cancer patients. We determined the level of endogenous (basal) and exogenous (induced by {gamma}-irradiation) DSBs and efficacy of their repair in peripheral blood lymphocytes of 57 breast cancer patients and 70 healthy individuals. DNA damage and repair were studied by neutral comet assay. Genotypes were determined in DNA from peripheral blood lymphocytes by allele-specific PCR (ASO-PCR). We also correlated genotypes with the clinical characteristics of breast cancer patients. We observed a strong association between breast cancer occurrence and the variant allele carried genotypes in patients with elevated level of basal as well as induced DNA damage (OR 6.74, 95% CI 2.27-20.0 and OR 5.33, 95% CI 1.81-15.7, respectively). We also found statistically significant (p < 0.05) difference in DRE related to the c.73G>A polymorphism of the UBC9 gene in breast cancer patients. Carriers of variant allele have decreased DNA DRE as compared to wild type genotype carriers. We did not find any association with the UBC9 gene polymorphism and estrogen and progesterone receptor status. The variant allele of the UBC9 gene polymorphism was strongly inversely related to HER negative breast cancer patients (OR 0.03, 95% CI 0.00-0.23). Our results suggest that the c.73G>A polymorphism of the UBC9 gene may affect DNA DSBs repair efficacy in breast cancer patients.

  9. A study on the characteristics of temperature inversions in active and break phases of Indian summer monsoon

    Digital Repository Service at National Institute of Oceanography (India)

    Muraleedharan, P.M.; Mohankumar, K.; Sivakumar, K.U.

    The thermal inversion characteristics during active and break cycles of two consecutive and contrasting monsoon years were studied using GPS radiosonde profiles in Goa (15 degrees 46′ N; 73 degrees 08′ E), located on the west coast of India...

  10. Defective DNA repair increases susceptibility to senescence through extension of Chk1-mediated G2 checkpoint activation.

    Science.gov (United States)

    Johmura, Yoshikazu; Yamashita, Emiri; Shimada, Midori; Nakanishi, Keiko; Nakanishi, Makoto

    2016-01-01

    Susceptibility to senescence caused by defective DNA repair is a major hallmark of progeroid syndrome patients, but molecular mechanisms of how defective DNA repair predisposes to senescence are largely unknown. We demonstrate here that suppression of DNA repair pathways extends the duration of Chk1-dependent G2 checkpoint activation and sensitizes cells to senescence through enhancement of mitosis skipping. Extension of G2 checkpoint activation by introduction of the TopBP1 activation domain and the nondegradable mutant of Claspin sensitizes cells to senescence. In contrast, a shortening of G2 checkpoint activation by expression of SIRT6 or depletion of OTUB2 reduces susceptibility to senescence. Fibroblasts from progeroid syndromes tested shows a correlation between an extension of G2 checkpoint activation and an increase in the susceptibility to senescence. These results suggest that extension of G2 checkpoint activation caused by defective DNA repair is critical for senescence predisposition in progeroid syndrome patients. PMID:27507734

  11. Active Achilles tendon kinesitherapy accelerates Achilles tendon repair by promoting neurite regeneration☆

    OpenAIRE

    Jielile, Jiasharete; Aibai, Minawa; Sabirhazi, Gulnur; Shawutali, Nuerai; Tangkejie, Wulanbai; Badelhan, Aynaz; Nuerduola, Yeermike; Satewalede, Turde; Buranbai, Darehan; Hunapia, Beicen; Jialihasi, Ayidaer; Bai, Jingping; Kizaibek, Murat

    2012-01-01

    Active Achilles tendon kinesitherapy facilitates the functional recovery of a ruptured Achilles tendon. However, protein expression during the healing process remains a controversial issue. New Zealand rabbits, aged 14 weeks, underwent tenotomy followed immediately by Achilles tendon microsurgery to repair the Achilles tendon rupture. The tendon was then immobilized or subjected to postoperative early motion treatment (kinesitherapy). Mass spectrography results showed that after 14 days of mo...

  12. Laser-activated nano-biomaterials for tissue repair and controlled drug release

    Energy Technology Data Exchange (ETDEWEB)

    Matteini, P; Ratto, F; Rossi, F; Pini, R [Institute of Applied Physics ' Nello Carrara' , National Research Council, via Madonna del Piano 10 50019 Sesto Fiorentino (Italy)

    2014-07-31

    We present recent achievements of minimally invasive welding of biological tissue and controlled drug release based on laser-activated nano-biomaterials. In particular, we consider new advancements in the biomedical application of near-IR absorbing gold nano-chromophores as an original solution for the photothermal repair of surgical incisions and as nanotriggers of controlled drug release from hybrid biopolymer scaffolds. (laser biophotonics)

  13. The Vitamin A Derivative All-Trans Retinoic Acid Repairs Amyloid-β-Induced Double-Strand Breaks in Neural Cells and in the Murine Neocortex

    OpenAIRE

    Emmanuelle Gruz-Gibelli; Natacha Chessel; Clélia Allioux; Pascale Marin; Françoise Piotton; Geneviève Leuba; Herrmann, François R.; Armand Savioz

    2016-01-01

    The amyloid-β peptide or Aβ is the key player in the amyloid-cascade hypothesis of Alzheimer's disease. Aβ appears to trigger cell death but also production of double-strand breaks (DSBs) in aging and Alzheimer's disease. All-trans retinoic acid (RA), a derivative of vitamin A, was already known for its neuroprotective effects against the amyloid cascade. It diminishes, for instance, the production of Aβ peptides and their oligomerisation. In the present work we investigat...

  14. D-ribose inhibits DNA repair synthesis in human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zunica, G.; Marini, M.; Brunelli, M.A.; Chiricolo, M.; Franceschi, C.

    1986-07-31

    D-ribose is cytotoxic for quiescent human lymphocytes and severely inhibits their PHA-induced proliferation at concentrations (25-50 mM) at which other simple sugars are ineffective. In order to explain these effects, DNA repair synthesis was evaluated in PHA-stimulated human lymphocytes treated with hydroxyurea and irradiated. D-ribose, in contrast to other reducing sugars, did not induce repair synthesis and therefore did not apparently damage DNA in a direct way, although it markedly inhibited gamma ray-induced repair. Taking into account that lymphocytes must rejoin physiologically-formed DNA strand breaks in order to enter the cell cycle, we suggest that D-ribose exerts its cytotoxic activity by interfering with metabolic pathways critical for the repair of DNA breaks.

  15. Repair processes in diverse systems: overview

    International Nuclear Information System (INIS)

    Studies on DNA repair in several bacterial systems as well as in eukaryotes are reviewed. Some topics discussed are: excision repair of uv damage in Mycoplasma; repair replication in uv-irradiated Tetrahymena; repair of double-strand breaks in DNA of Micrococcus radiodurans; DNA repair in Neurospora; lack of dimer excision in x-irradiated Vicia faba; and DNA repair in Nicotiana, Haplopappus, and Chlamydomonas

  16. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    International Nuclear Information System (INIS)

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTεAGCGGGTACCGAGCTCGAAT; εA = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 ± 1.67 fmol/μg DNA/h vs 3.47 ± 1.35 fmol/μg DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  17. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Crosbie, Philip A.J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Watson, Amanda J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Agius, Raymond [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Barber, Philip V. [North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Margison, Geoffrey P. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Povey, Andrew C., E-mail: apovey@manchester.ac.uk [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom)

    2012-04-01

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [{sup 32}P]-based oligonucleotide cleavage assay (MPG substrate 5 Prime -CCGCT{epsilon}AGCGGGTACCGAGCTCGAAT; {epsilon}A = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 {+-} 1.67 fmol/{mu}g DNA/h vs 3.47 {+-} 1.35 fmol/{mu}g DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  18. Pars plana vitrectomy for the repair of primary, inferior rhegmatogenous retinal detachment associated to inferior breaks. A comparison of a 25-gauge versus a 20-gauge system

    OpenAIRE

    dell’Omo, Roberto; Barca, Francesco; Tan, H. Stevie; Bijl, Heico M.; Oberstein, Sarit Y Lesnik; Mura, Marco

    2012-01-01

    Background To compare anatomical, functional outcomes and complications of high-speed 25-gauge (G) pars plana vitrectomy (PPV) versus 20-G PPV for the management of primary inferior rhegmatogenous retinal detachment (RRD) associated to inferior breaks/holes. Methods Eighty-five eyes from 85 patients with a minimum follow-up of 3 months were retrospectively evaluated. Forty-one patients underwent 25-G and 44 patients underwent 20-G PPV. All patients underwent PPV with fluid-air exchange, sulfu...

  19. Radiation-induced DNA damage and DNA repair

    International Nuclear Information System (INIS)

    Although DNA undergoes various types of damage from radiation, active oxygen, and the like, a living body has a plurality of DNA repair mechanisms responding to the types of DNA damage. On the other hand, there are a system that results in cell death if the repair is impossible and a mechanism to lead to concretization if further repair is not accurately made. This paper explains the following items as the basic researches on these types of DNA damage and the repair mechanisms: (1) biological effects of DNA damage, (2) effect of DNA damage on DNA synthesis, and (3) effects of DNA damage on cells. It also explains the effects of radiation on cells with a focus on specific mechanism for (1) DNA damage caused by direct action due to radiation and by indirect action due mainly to active oxygen, and (2) DNA repair mechanism that works on DNA double-strand break (DSB). (A.O.)

  20. Nuclear Countermeasure Activity of TP508 Linked to Restoration of Endothelial Function and Acceleration of DNA Repair

    Science.gov (United States)

    Olszewska-Pazdrak, Barbara; McVicar, Scott D.; Rayavara, Kempaiah; Moya, Stephanie M.; Kantara, Carla; Gammarano, Chris; Olszewska, Paulina; Fuller, Gerald M.; Sower, Laurie E.; Carney, Darrell H.

    2016-01-01

    There is increasing evidence that radiation-induced damage to endothelial cells and loss of endothelial function may contribute to both acute radiation syndromes and long-term effects of whole-body nuclear irradiation. Therefore, several drugs are being developed to mitigate the effects of nuclear radiation, most of these drugs will target and protect or regenerate leukocytes and platelets. Our laboratory has demonstrated that TP508, a 23-amino acid thrombin peptide, activates endothelial cells and stem cells to revascularize and regenerate tissues. We now show that TP508 can mitigate radiation-induced damage to endothelial cells in vitro and in vivo. Our in vitro results demonstrate that human endothelial cells irradiation attenuates nitric oxide (NO) signaling, disrupts tube formation and induces DNA double-strand breaks (DSB). TP508 treatment reverses radiation effects on NO signaling, restores tube formation and accelerates the repair of radiation-induced DSB. The radiation-mitigating effects of TP508 on endothelial cells were also seen in CD-1 mice where systemic injection of TP508 stimulated endothelial cell sprouting from aortic explants after 8 Gy irradiation. Systemic doses of TP508 that mitigated radiation-induced endothelial cell damage, also significantly increased survival of CD-1 mice when injected 24 h after 8.5 Gy exposure. These data suggest that increased survival observed with TP508 treatment may be due to its effects on vascular and microvascular endothelial cells. Our study supports the usage of a regenerative drug such as TP508 to activate endothelial cells as a countermeasure for mitigating the effects of nuclear radiation. PMID:27388041

  1. Effects of post mortem interval and gender in DNA base excision repair activities in rat brains

    International Nuclear Information System (INIS)

    Most human tissues used in research are of post mortem origin. This is the case for all brain samples, and due to the difficulty in obtaining a good number of samples, especially in the case of neurodegenerative diseases, male and female samples are often included in the same experimental group. However, the effects of post mortem interval (PMI) and gender differences in the endpoints being analyzed are not always fully understood, as is the case for DNA repair activities. To investigate these effects, in a controlled genetic background, base excision repair (BER) activities were measured in protein extracts obtained from Wistar rat brains from different genders and defined PMI up to 24 hours, using a novel fluorescent-based in vitro incision assay. Uracil and AP-site incision activity in nuclear and mitochondrial extracts were similar in all groups included in this study. Our results show that gender and PMI up to 24 hours have no influence in the activities of the BER proteins UDG and APE1 in rat brains. These findings demonstrate that these variables do not interfere on the BER activities included in these study, and provide a security window to work with UDG and APE1 proteins in samples of post mortem origin

  2. Effects of post mortem interval and gender in DNA base excision repair activities in rat brains

    Energy Technology Data Exchange (ETDEWEB)

    Soltys, Daniela Tathiana; Pereira, Carolina Parga Martins; Ishibe, Gabriela Naomi; Souza-Pinto, Nadja Cristhina de, E-mail: nadja@iq.usp.br

    2015-06-15

    Most human tissues used in research are of post mortem origin. This is the case for all brain samples, and due to the difficulty in obtaining a good number of samples, especially in the case of neurodegenerative diseases, male and female samples are often included in the same experimental group. However, the effects of post mortem interval (PMI) and gender differences in the endpoints being analyzed are not always fully understood, as is the case for DNA repair activities. To investigate these effects, in a controlled genetic background, base excision repair (BER) activities were measured in protein extracts obtained from Wistar rat brains from different genders and defined PMI up to 24 hours, using a novel fluorescent-based in vitro incision assay. Uracil and AP-site incision activity in nuclear and mitochondrial extracts were similar in all groups included in this study. Our results show that gender and PMI up to 24 hours have no influence in the activities of the BER proteins UDG and APE1 in rat brains. These findings demonstrate that these variables do not interfere on the BER activities included in these study, and provide a security window to work with UDG and APE1 proteins in samples of post mortem origin.

  3. Breaking Bat

    Science.gov (United States)

    Aguilar, Isaac-Cesar; Kagan, David

    2013-01-01

    The sight of a broken bat in Major League Baseball can produce anything from a humorous dribbler in the infield to a frightening pointed projectile headed for the stands. Bats usually break at the weakest point, typically in the handle. Breaking happens because the wood gets bent beyond the breaking point due to the wave sent down the bat created…

  4. RAG-mediated DNA double-strand breaks activate a cell type-specific checkpoint to inhibit pre-B cell receptor signals.

    Science.gov (United States)

    Bednarski, Jeffrey J; Pandey, Ruchi; Schulte, Emily; White, Lynn S; Chen, Bo-Ruei; Sandoval, Gabriel J; Kohyama, Masako; Haldar, Malay; Nickless, Andrew; Trott, Amanda; Cheng, Genhong; Murphy, Kenneth M; Bassing, Craig H; Payton, Jacqueline E; Sleckman, Barry P

    2016-02-01

    DNA double-strand breaks (DSBs) activate a canonical DNA damage response, including highly conserved cell cycle checkpoint pathways that prevent cells with DSBs from progressing through the cell cycle. In developing B cells, pre-B cell receptor (pre-BCR) signals initiate immunoglobulin light (Igl) chain gene assembly, leading to RAG-mediated DNA DSBs. The pre-BCR also promotes cell cycle entry, which could cause aberrant DSB repair and genome instability in pre-B cells. Here, we show that RAG DSBs inhibit pre-BCR signals through the ATM- and NF-κB2-dependent induction of SPIC, a hematopoietic-specific transcriptional repressor. SPIC inhibits expression of the SYK tyrosine kinase and BLNK adaptor, resulting in suppression of pre-BCR signaling. This regulatory circuit prevents the pre-BCR from inducing additional Igl chain gene rearrangements and driving pre-B cells with RAG DSBs into cycle. We propose that pre-B cells toggle between pre-BCR signals and a RAG DSB-dependent checkpoint to maintain genome stability while iteratively assembling Igl chain genes. PMID:26834154

  5. Single-nucleotide polymorphisms in base excision repair, nucleotide excision repair, and double strand break genes as markers for response to radiotherapy in patients with Stage I to II head-and-neck cancer

    International Nuclear Information System (INIS)

    Purpose: Polymorphisms in DNA repair genes can influence response to radiotherapy. We analyzed single-nucleotide polymorphisms (SNP) in nine DNA repair genes in 108 patients with head-and-neck cancer (HNSCC) who had received radiotherapy only. Methods and Materials: From May 1993 to December 2004, patients with Stage I and II histopathologically confirmed HNSCC underwent radiotherapy. DNA was obtained from paraffin-embedded tissue, and SNP analysis was performed using a real-time polymerase chain reaction allelic discrimination TaqMan assay with minor modifications. Results: Patients were 101 men (93.5%) and 7 (6.5%) women, with a median age of 64 years (range, 40 to 89 years). Of the patients, 76 (70.4%) patients were Stage I and 32 (29.6%) were Stage II. The XPF/ERCC1 SNP at codon 259 and XPG/ERCC5 at codon 46 emerged as significant predictors of progression (p 0.00005 and 0.049, respectively) and survival (p = 0.0089 and 0.0066, respectively). Similarly, when variant alleles of XPF/ERCC1, XPG/ERCC5 and XPA were examined in combination, a greater number of variant alleles was associated with shorter time to progression (p = 0.0003) and survival (p 0.0002). Conclusions: Genetic polymorphisms in XPF/ERCC1, XPG/ERCC5, and XPA may significantly influence response to radiotherapy; large studies are warranted to confirm their role in HNSCC

  6. DNA damage and repair activity after broccoli intake in young healthy smokers

    DEFF Research Database (Denmark)

    Riso, Patrizia; Martini, Daniela; Møller, Peter;

    2010-01-01

    Cruciferous vegetables contain compounds with antioxidant properties (e.g. carotenoids, vitamin C and folates) and can alter the activity of xenobiotic metabolism (i.e. isothiocyanates). These constituents may be particularly important for subjects who are exposed to free radicals and genotoxic....... Blood was collected before and after each period. The level of oxidatively damaged DNA lesions (formamidopyrimidine DNA glycosylase-sensitive sites), resistance to ex vivo H(2)O(2) treatment and repair of oxidised DNA lesions were measured in peripheral blood mononuclear cells (PBMCs). We also measured...

  7. Neutrophil activation during acetaminophen hepatotoxicity and repair in mice and humans

    Energy Technology Data Exchange (ETDEWEB)

    Williams, C. David; Bajt, Mary Lynn [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Sharpe, Matthew R. [Department of Internal Medicine, University of Kansas Hospital, Kansas City, KS (United States); McGill, Mitchell R. [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Farhood, Anwar [Department of Pathology, St. David' s North Austin Medical Center, Austin, TX 78756 (United States); Jaeschke, Hartmut, E-mail: hjaeschke@kumc.edu [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States)

    2014-03-01

    Following acetaminophen (APAP) overdose there is an inflammatory response triggered by the release of cellular contents from necrotic hepatocytes into the systemic circulation which initiates the recruitment of neutrophils into the liver. It has been demonstrated that neutrophils do not contribute to APAP-induced liver injury, but their role and the role of NADPH oxidase in injury resolution are controversial. C57BL/6 mice were subjected to APAP overdose and neutrophil activation status was determined during liver injury and liver regeneration. Additionally, human APAP overdose patients (ALT: > 800 U/L) had serial blood draws during the injury and recovery phases for the determination of neutrophil activation. Neutrophils in the peripheral blood of mice showed an increasing activation status (CD11b expression and ROS priming) during and after the peak of injury but returned to baseline levels prior to complete injury resolution. Hepatic sequestered neutrophils showed an increased and sustained CD11b expression, but no ROS priming was observed. Confirming that NADPH oxidase is not critical to injury resolution, gp91{sup phox}−/− mice following APAP overdose displayed no alteration in injury resolution. Peripheral blood from APAP overdose patients also showed increased neutrophil activation status after the peak of liver injury and remained elevated until discharge from the hospital. In mice and humans, markers of activation, like ROS priming, were increased and sustained well after active liver injury had subsided. The similar findings between surviving patients and mice indicate that neutrophil activation may be a critical event for host defense or injury resolution following APAP overdose, but not a contributing factor to APAP-induced injury. - Highlights: • Neutrophil (PMN) function increases during liver repair after acetaminophen overdose. • Liver repair after acetaminophen (APAP)-overdose is not dependent on NADPH oxidase. • Human PMNs do not appear

  8. Replication Protein A (RPA) deficiency activates the Fanconi anemia DNA repair pathway.

    Science.gov (United States)

    Jang, Seok-Won; Jung, Jin Ki; Kim, Jung Min

    2016-09-01

    The Fanconi anemia (FA) pathway regulates DNA inter-strand crosslink (ICL) repair. Despite our greater understanding of the role of FA in ICL repair, its function in the preventing spontaneous genome instability is not well understood. Here, we show that depletion of replication protein A (RPA) activates the FA pathway. RPA1 deficiency increases chromatin recruitment of FA core complex, leading to FANCD2 monoubiquitination (FANCD2-Ub) and foci formation in the absence of DNA damaging agents. Importantly, ATR depletion, but not ATM, abolished RPA1 depletion-induced FANCD2-Ub, suggesting that ATR activation mediated FANCD2-Ub. Interestingly, we found that depletion of hSSB1/2-INTS3, a single-stranded DNA-binding protein complex, induces FANCD2-Ub, like RPA1 depletion. More interestingly, depletion of either RPA1 or INTS3 caused increased accumulation of DNA damage in FA pathway deficient cell lines. Taken together, these results indicate that RPA deficiency induces activation of the FA pathway in an ATR-dependent manner, which may play a role in the genome maintenance. PMID:27398742

  9. Complex DNA repair pathways as possible therapeutic targets to overcome temozolomide resistance in glioblastoma

    Directory of Open Access Journals (Sweden)

    Koji eYoshimoto

    2012-12-01

    Full Text Available Many conventional chemotherapeutic drugs exert their cytotoxic function by inducing DNA damage in the tumor cell. Therefore, a cell-inherent DNA repair pathway, which reverses the DNA-damaging effect of the cytotoxic drugs, can mediate therapeutic resistance to chemotherapy. The monofunctional DNA-alkylating agent temozolomide (TMZ is a commonly used chemotherapeutic drug and the gold standard treatment for glioblastoma. Although the activity of DNA repair protein O6-methylguanine-DNA methyltransferase (MGMT has been described as the main modulator to determine the sensitivity of glioblastoma to TMZ, a subset of glioblastoma does not respond despite MGMT inactivation, suggesting that another DNA repair mechanism may also modulate the tolerance to TMZ. Considerable interest has focused on MGMT, mismatch repair (MMR, and the base-excision repair (BER pathway in the mechanism of mediating TMZ resistance, but emerging roles for the DNA strand-break repair pathway have been demonstrated. In the first part of this review article, we briefly review the significant role of MGMT, MMR, and the BER pathway in the tolerance to TMZ; in the last part, we review the recent publications that demonstrate possible roles of DNA strand-break repair pathways, such as single-strand break (SSB repair and double-strand break (DSB repair, as well as the Fanconi anemia pathway in the repair process after alkylating agent-based therapy. It is possible that all of these repair pathways have a potential to modulate the sensitivity to TMZ and aid in overcoming the therapeutic resistance in the clinic.

  10. Flavonoid Compound Icariin Activates Hypoxia Inducible Factor-1α in Chondrocytes and Promotes Articular Cartilage Repair.

    Science.gov (United States)

    Wang, Pengzhen; Zhang, Fengjie; He, Qiling; Wang, Jianqi; Shiu, Hoi Ting; Shu, Yinglan; Tsang, Wing Pui; Liang, Shuang; Zhao, Kai; Wan, Chao

    2016-01-01

    Articular cartilage has poor capability for repair following trauma or degenerative pathology due to avascular property, low cell density and migratory ability. Discovery of novel therapeutic approaches for articular cartilage repair remains a significant clinical need. Hypoxia is a hallmark for cartilage development and pathology. Hypoxia inducible factor-1alpha (HIF-1α) has been identified as a key mediator for chondrocytes to response to fluctuations of oxygen availability during cartilage development or repair. This suggests that HIF-1α may serve as a target for modulating chondrocyte functions. In this study, using phenotypic cellular screen assays, we identify that Icariin, an active flavonoid component from Herba Epimedii, activates HIF-1α expression in chondrocytes. We performed systemic in vitro and in vivo analysis to determine the roles of Icariin in regulation of chondrogenesis. Our results show that Icariin significantly increases hypoxia responsive element luciferase reporter activity, which is accompanied by increased accumulation and nuclear translocation of HIF-1α in murine chondrocytes. The phenotype is associated with inhibiting PHD activity through interaction between Icariin and iron ions. The upregulation of HIF-1α mRNA levels in chondrocytes persists during chondrogenic differentiation for 7 and 14 days. Icariin (10-6 M) increases the proliferation of chondrocytes or chondroprogenitors examined by MTT, BrdU incorporation or colony formation assays. Icariin enhances chondrogenic marker expression in a micromass culture including Sox9, collagen type 2 (Col2α1) and aggrecan as determined by real-time PCR and promotes extracellular matrix (ECM) synthesis indicated by Alcian blue staining. ELISA assays show dramatically increased production of aggrecan and hydroxyproline in Icariin-treated cultures at day 14 of chondrogenic differentiation as compared with the controls. Meanwhile, the expression of chondrocyte catabolic marker genes

  11. Flavonoid Compound Icariin Activates Hypoxia Inducible Factor-1α in Chondrocytes and Promotes Articular Cartilage Repair.

    Directory of Open Access Journals (Sweden)

    Pengzhen Wang

    Full Text Available Articular cartilage has poor capability for repair following trauma or degenerative pathology due to avascular property, low cell density and migratory ability. Discovery of novel therapeutic approaches for articular cartilage repair remains a significant clinical need. Hypoxia is a hallmark for cartilage development and pathology. Hypoxia inducible factor-1alpha (HIF-1α has been identified as a key mediator for chondrocytes to response to fluctuations of oxygen availability during cartilage development or repair. This suggests that HIF-1α may serve as a target for modulating chondrocyte functions. In this study, using phenotypic cellular screen assays, we identify that Icariin, an active flavonoid component from Herba Epimedii, activates HIF-1α expression in chondrocytes. We performed systemic in vitro and in vivo analysis to determine the roles of Icariin in regulation of chondrogenesis. Our results show that Icariin significantly increases hypoxia responsive element luciferase reporter activity, which is accompanied by increased accumulation and nuclear translocation of HIF-1α in murine chondrocytes. The phenotype is associated with inhibiting PHD activity through interaction between Icariin and iron ions. The upregulation of HIF-1α mRNA levels in chondrocytes persists during chondrogenic differentiation for 7 and 14 days. Icariin (10-6 M increases the proliferation of chondrocytes or chondroprogenitors examined by MTT, BrdU incorporation or colony formation assays. Icariin enhances chondrogenic marker expression in a micromass culture including Sox9, collagen type 2 (Col2α1 and aggrecan as determined by real-time PCR and promotes extracellular matrix (ECM synthesis indicated by Alcian blue staining. ELISA assays show dramatically increased production of aggrecan and hydroxyproline in Icariin-treated cultures at day 14 of chondrogenic differentiation as compared with the controls. Meanwhile, the expression of chondrocyte catabolic

  12. Mitochondrial base excision repair assays

    DEFF Research Database (Denmark)

    Maynard, Scott; de Souza-Pinto, Nadja C; Scheibye-Knudsen, Morten;

    2010-01-01

    glycosylases, AP endonuclease, DNA polymerase (POLgamma in mitochondria) and DNA ligase. This article outlines procedures for measuring oxidative damage formation and BER in mitochondria, including isolation of mitochondria from tissues and cells, protocols for measuring BER enzyme activities, gene......The main source of mitochondrial DNA (mtDNA) damage is reactive oxygen species (ROS) generated during normal cellular metabolism. The main mtDNA lesions generated by ROS are base modifications, such as the ubiquitous 8-oxoguanine (8-oxoG) lesion; however, base loss and strand breaks may also occur....... Many human diseases are associated with mtDNA mutations and thus maintaining mtDNA integrity is critical. All of these lesions are repaired primarily by the base excision repair (BER) pathway. It is now known that mammalian mitochondria have BER, which, similarly to nuclear BER, is catalyzed by DNA...

  13. Role of polynucleotide kinase/phosphatase in mitochondrial DNA repair

    Science.gov (United States)

    Tahbaz, Nasser; Subedi, Sudip; Weinfeld, Michael

    2012-01-01

    Mutations in mitochondrial DNA (mtDNA) are implicated in a broad range of human diseases and in aging. Compared to nuclear DNA, mtDNA is more highly exposed to oxidative damage due to its proximity to the respiratory chain and the lack of protection afforded by chromatin-associated proteins. While repair of oxidative damage to the bases in mtDNA through the base excision repair pathway has been well studied, the repair of oxidatively induced strand breaks in mtDNA has been less thoroughly examined. Polynucleotide kinase/phosphatase (PNKP) processes strand-break termini to render them chemically compatible for the subsequent action of DNA polymerases and ligases. Here, we demonstrate that functionally active full-length PNKP is present in mitochondria as well as nuclei. Downregulation of PNKP results in an accumulation of strand breaks in mtDNA of hydrogen peroxide-treated cells. Full restoration of repair of the H2O2-induced strand breaks in mitochondria requires both the kinase and phosphatase activities of PNKP. We also demonstrate that PNKP contains a mitochondrial-targeting signal close to the C-terminus of the protein. We further show that PNKP associates with the mitochondrial protein mitofilin. Interaction with mitofilin may serve to translocate PNKP into mitochondria. PMID:22210862

  14. Induction and repair of DNA double-strand breaks in blood lymphocytes of patients undergoing 18F-FDG PET/CT examinations

    International Nuclear Information System (INIS)

    The purpose of this study was to evaluate DNA double-strand breaks (DSBs) in blood lymphocytes of patients undergoing positron emission tomography (PET)/CT using γ-H2AX immunofluorescence microscopy and to differentiate between 18F-fluorodeoxyglucose (FDG) and CT-induced DNA lesions. This study was approved by the local Ethics Committee and complies with Health Insurance Portability and Accountability Act (HIPAA) requirements. After written informed consent was obtained, 33 patients underwent whole-body 18F-FDG PET/CT (3 MBq/kg body weight, 170/100 reference mAs at 120 kV). The FDG PET and CT portions were performed as an initial CT immediately followed by the PET. Blood samples were obtained before, at various time points following 18F-FDG application and up to 24 h after the CT scan. Distinct foci representing DSBs were quantified in isolated lymphocytes using fluorescence microscopy after staining against the phosphorylated histone variant γ-H2AX. The DSB values at the various time points were significantly different (p 18F-FDG administration (median excess foci 0.11/cell, range 0.06-0.27/cell) and 5 min after CT (median excess foci 0.17/cell, range 0.05-0.54/cell). A significant correlation between CT-induced DSBs and dose length product was obtained (ρ = 0.898, p 18F-FDG injection and 5 min after CT. The radionuclide contributes considerably to the total DSB induction in this setting. (orig.)

  15. Bacillus subtilis polynucleotide phosphorylase 3'-to-5' DNase activity is involved in DNA repair.

    Science.gov (United States)

    Cardenas, Paula P; Carrasco, Begoña; Sanchez, Humberto; Deikus, Gintaras; Bechhofer, David H; Alonso, Juan C

    2009-07-01

    In the presence of Mn(2+), an activity in a preparation of purified Bacillus subtilis RecN degrades single-stranded (ss) DNA with a 3' --> 5' polarity. This activity is not associated with RecN itself, because RecN purified from cells lacking polynucleotide phosphorylase (PNPase) does not show the exonuclease activity. We show here that, in the presence of Mn(2+) and low-level inorganic phosphate (P(i)), PNPase degrades ssDNA. The limited end-processing of DNA is regulated by ATP and is inactive in the presence of Mg(2+) or high-level P(i). In contrast, the RNase activity of PNPase requires Mg(2+) and P(i), suggesting that PNPase degradation of RNA and ssDNA occur by mutually exclusive mechanisms. A null pnpA mutation (DeltapnpA) is not epistatic with Delta recA, but is epistatic with DeltarecN and Delta ku, which by themselves are non-epistatic. The addA5, Delta recO, Delta recQ (Delta recJ), Delta recU and Delta recG mutations (representative of different epistatic groups), in the context of DeltapnpA, demonstrate gain- or loss-of-function by inactivation of repair-by-recombination, depending on acute or chronic exposure to the damaging agent and the nature of the DNA lesion. Our data suggest that PNPase is involved in various nucleic acid metabolic pathways, and its limited ssDNA exonuclease activity plays an important role in RecA-dependent and RecA-independent repair pathways. PMID:19433509

  16. DNMT (DNA methyltransferase) inhibitors radiosensitize human cancer cells by suppressing DNA repair activity

    International Nuclear Information System (INIS)

    Histone modifications and DNA methylation are two major factors in epigenetic phenomenon. Unlike the histone deacetylase inhibitors, which are known to exert radiosensitizing effects, there have only been a few studies thus far concerning the role of DNA methyltransferase (DNMT) inhibitors as radiosensitizers. The principal objective of this study was to evaluate the effects of DNMT inhibitors on the radiosensitivity of human cancer cell lines, and to elucidate the mechanisms relevant to that process. A549 (lung cancer) and U373MG (glioblastoma) cells were exposed to radiation with or without six DNMT inhibitors (5-azacytidine, 5-aza-2'-deoxycytidine, zebularine, hydralazine, epigallocatechin gallate, and psammaplin A) for 18 hours prior to radiation, after which cell survival was evaluated via clonogenic assays. Cell cycle and apoptosis were analyzed via flow cytometry. Expressions of DNMT1, 3A/3B, and cleaved caspase-3 were detected via Western blotting. Expression of γH2AX, a marker of radiation-induced DNA double-strand break, was examined by immunocytochemistry. Pretreatment with psammaplin A, 5-aza-2'-deoxycytidine, and zebularine radiosensitized both A549 and U373MG cells. Pretreatment with psammaplin A increased the sub-G1 fraction of A549 cells, as compared to cells exposed to radiation alone. Prolongation of γH2AX expression was observed in the cells treated with DNMT inhibitors prior to radiation as compared with those treated by radiation alone. Psammaplin A, 5-aza-2'-deoxycytidine, and zebularine induce radiosensitivity in both A549 and U373MG cell lines, and suggest that this effect might be associated with the inhibition of DNA repair

  17. Active Achilles tendon kinesitherapy accelerates Achilles tendon repair by promoting neurite regeneration

    Institute of Scientific and Technical Information of China (English)

    Jiasharete Jielile; Beicen Hunapia; Ayidaer Jialihasi; Jingping Bai; Murat Kizaibek; Minawa Aibai; Gulnur Sabirhazi; Nuerai Shawutali; Wulanbai Tangkejie; Aynaz Badelhan; Yeermike Nuerduola; Turde Satewalede; Darehan Buranbai

    2012-01-01

    Active Achilles tendon kinesitherapy facilitates the functional recovery of a ruptured Achilles tendon. However, protein expression during the healing process remains a controversial issue. New Zealand rabbits, aged 14 weeks, underwent tenotomy followed immediately by Achilles tendon microsurgery to repair the Achilles tendon rupture. The tendon was then immobilized or subjected to postoperative early motion treatment (kinesitherapy). Mass spectrography results showed that after 14 days of motion treatment, 18 protein spots were differentially expressed, among which, 12 were up-regulated, consisting of gelsolin isoform b and neurite growth-related protein collapsing response mediator protein 2. Western blot analysis showed that gelsolin isoform b was up-regulated at days 7–21 of motion treatment. These findings suggest that active Achilles tendon kinesitherapy promotes the neurite regeneration of a ruptured Achilles tendon and gelsolin isoform b can be used as a biomarker for Achilles tendon healing after kinesitherapy.

  18. PHYSICAL PROPERTIES, STAR FORMATION, AND ACTIVE GALACTIC NUCLEUS ACTIVITY IN BALMER BREAK GALAXIES AT 0 < z < 1

    Energy Technology Data Exchange (ETDEWEB)

    Diaz Tello, J.; Donzelli, C. [IATE, Observatorio Astronomico de Cordoba, Universidad Nacional de Cordoba (Argentina); Padilla, N. [Departamento de Astronomia y Astrofisica, Pontificia Universidad Catolica de Chile (Chile); Fujishiro, N.; Yoshikawa, T. [Koyama Astronomical Observatory, Kyoto Sangyo University (Japan); Hanami, H. [Physics Section, Iwate University (Japan); Hatsukade, B., E-mail: jdiazt@oac.uncor.edu [Department of Astronomy, Kyoto University (Japan)

    2013-07-01

    We present a spectroscopic study with the derivation of the physical properties of 37 Balmer break galaxies, which have the necessary lines to locate them in star-forming-active galactic nuclei (AGNs) diagnostic diagrams. These galaxies span a redshift range from 0.045 to 0.93 and are somewhat less massive than similar samples of previous works. The studied sample has multiwavelength photometric data coverage from the ultraviolet to mid-infrared (MIR) Spitzer bands. We investigate the connection between star formation and AGN activity via optical, mass-excitation (MEx), and MIR diagnostic diagrams. Through optical diagrams, 31 (84%) star-forming galaxies, two (5%) composite galaxies, and three (8%) AGNs were classified, whereas from the MEx diagram only one galaxy was classified as AGN. A total of 19 galaxies have photometry available in all the IRAC/Spitzer bands. Of these, three AGN candidates were not classified as AGN in the optical diagrams, suggesting they are dusty/obscured AGNs, or that nuclear star formation has diluted their contributions. By fitting the spectral energy distribution of the galaxies, we derived the stellar masses, dust reddening E(B - V), ages, and UV star formation rates (SFRs). Furthermore, the relationship between SFR surface density ({Sigma}{sub SFR}) and stellar mass surface density per time unit ({Sigma}{sub M{sub */{tau}}}) as a function of redshift was investigated using the [O II] {lambda}3727, 3729, H{alpha} {lambda}6563 luminosities, which revealed that both quantities are larger for higher redshift galaxies. We also studied the SFR and specific SFR (SSFR) versus stellar mass and color relations, with the more massive galaxies having higher SFR values but lower SSFR values than less massive galaxies. These results are consistent with previous ones showing that, at a given mass, high-redshift galaxies have on average larger SFR and SSFR values than low-redshift galaxies. Finally, bluer galaxies have larger SSFR values than redder

  19. Star formation activity in Balmer break galaxies at $z$ < 1.5

    CERN Document Server

    Tello, J Díaz; Padilla, N; Akiyama, M; Fujishiro, N; Yoshikawa, T; Hanami, H

    2016-01-01

    Aims. We present a spectroscopic study of the properties of 64 Balmer break galaxies that show signs of star formation. The studied sample of star-forming galaxies spans a redshift range from 0.094 to 1.475 with stellar masses in the range 10$^{8}-$10$^{12}$ $M_{\\odot}$. The sample also includes eight broad emission line galaxies with redshifts between 1.5 $break in the correlation, which reveals the presence of massive galaxies with lower SFR values (i.e., decreasing star formation). We also note an anticorrelation for the SSFR with the stellar mass. Again in this case, our data is also consis...

  20. A scaffold-enhanced light-activated surgical adhesive technique: surface selection for enhanced tensile strength in wound repair

    Science.gov (United States)

    Soller, Eric C.; Hoffman, Grant T.; Heintzelman, Douglas L.; Duffy, Mark T.; Bloom, Jeffrey N.; McNally-Heintzelman, Karen M.

    2004-07-01

    An ex vivo study was conducted to determine the effect of the irregularity of the scaffold surface on the tensile strength of repairs formed using our Scaffold-Enhanced Biological Adhesive (SEBA). Two different scaffold materials were investigated: (i) a synthetic biodegradable material fabricated from poly(L-lactic-co-glycolic acid); and (ii) a biological material, small intestinal submucosa, manufactured by Cook BioTech. The scaffolds were doped with protein solder composed of 50%(w/v) bovine serum albumin solder and 0.5mg/ml indocyanine green dye mixed in deionized water, and activated with an 808-nm diode laser. The tensile strength of repairs performed on bovine thoracic aorta, liver, spleen, small intestine and lung, using the smooth and irregular surfaces of the above scaffold-enhanced materials were measured and the time-to-failure was recorded. The tensile strength of repairs formed using the irregular surfaces of the scaffolds were consistently higher than those formed using the smooth surfaces of the scaffolds. The largest difference was observed on repairs formed on the aorta and small intestine, where the repairs were, on average, 50% stronger using the irregular versus the smooth scaffold surfaces. In addition, the time-to-failure of repairs formed using the irregular surfaces of the scaffolds were between 50% and 100% longer than that achieved using the smooth surfaces of the scaffolds. It has previously been shown that distributing or dispersing the adhesive forces over the increased surface area of the scaffold, either smooth or irregular, produces stronger repairs than albumin solder alone. The increase in the absolute strength and longevity of repairs seen in this new study when the irregular surfaces of the scaffolds are used is thought to be due to the distribution of forces between the many independent micro-adhesions provided by the irregular surfaces.

  1. Electron Transfer Mechanisms of DNA Repair by Photolyase

    Science.gov (United States)

    Zhong, Dongping

    2015-04-01

    Photolyase is a flavin photoenzyme that repairs two DNA base damage products induced by ultraviolet (UV) light: cyclobutane pyrimidine dimers and 6-4 photoproducts. With femtosecond spectroscopy and site-directed mutagenesis, investigators have recently made significant advances in our understanding of UV-damaged DNA repair, and the entire enzymatic dynamics can now be mapped out in real time. For dimer repair, six elementary steps have been characterized, including three electron transfer reactions and two bond-breaking processes, and their reaction times have been determined. A unique electron-tunneling pathway was identified, and the critical residues in modulating the repair function at the active site were determined. The dynamic synergy between the elementary reactions for maintaining high repair efficiency was elucidated, and the biological nature of the flavin active state was uncovered. For 6-4 photoproduct repair, a proton-coupled electron transfer repair mechanism has been revealed. The elucidation of electron transfer mechanisms and two repair photocycles is significant and provides a molecular basis for future practical applications, such as in rational drug design for curing skin cancer.

  2. Beta-carotene suppression of benzophenone-sensitized lipid peroxidation in hexane through additional chain-breaking activities

    International Nuclear Information System (INIS)

    The aim of this work is to estimate the antioxidant activity of β-carotene in the presence of two different mixtures of phospholipids in hexane solution, under continuous UV-irradiation from three different ranges (UV-A, UV-B, and UV-C). β-Carotene is employed to control lipid peroxidation process generated by UV-irradiation, in the presence and in the absence of selected photosensitizer, benzophenone, by scavenging the involved, created free radicals. The results show that β-carotene undergoes to a substantial, probably structural dependent destruction (bleaching), highly dependent on UV-photons energy input, more expressed in the presence than in the absence of benzophenone. The additional bleaching is synchronized with the further increase in β-carotene antioxidant activity in the presence of benzophenone, implying the same cause: increase in (phospholipids peroxidation) chain-breaking activities.

  3. Early rehabilitation affects functional outcomes and activities of daily living after arthroscopic rotator cuff repair: a case report.

    Science.gov (United States)

    Shimo, Satoshi; Sakamoto, Yuta; Tokiyoshi, Akinari; Yamamoto, Yasuhiro

    2016-01-01

    [Purpose] The effect of early rehabilitation protocols after arthroscopic rotator cuff repair is currently unknown. We examined short-term effects of early rehabilitation on functional outcomes and activities of daily living after arthroscopic rotator cuff repair. [Subject and Methods] An 82-year-old male fell during a walk, resulting in a supraspinatus tear. Arthroscopic rotator cuff repair was performed using a single-row technique. He wore an abduction brace for 6 weeks after surgery. [Results] From day 1 after surgery, passive range of motion exercises, including forward flexion and internal and external rotation were performed twice per day. Starting at 6 weeks after surgery, active range of motion exercises and muscle strengthening exercises were introduced gradually. At 6 weeks after surgery, his active forward flexion was 150°, UCLA shoulder rating scale score was 34 points, and Quick Disabilities of the Arm, Shoulder, and Hand questionnaire disability/symptom score was 36 points. At 20 weeks after surgery, his active forward flexion was 120°, UCLA shoulder rating scale score was 34 points, and Quick Disabilities of the Arm, Shoulder, and Hand questionnaire disability/symptom score was 0 points. [Conclusion] These protocols are recommended to physical therapists during rehabilitation for arthroscopic rotator cuff repair to support rapid reintegration into activities of daily living. PMID:27064886

  4. Break-Induced Replication Requires DNA Damage-Induced Phosphorylation of Pif1 and Leads to Telomere Lengthening

    OpenAIRE

    Yulia Vasianovich; Harrington, Lea A.; Svetlana Makovets

    2014-01-01

    Broken replication forks result in DNA breaks that are normally repaired via homologous recombination or break induced replication (BIR). Mild insufficiency in the replicative ligase Cdc9 in budding yeast Saccharomyces cerevisiae resulted in a population of cells with persistent DNA damage, most likely due to broken replication forks, constitutive activation of the DNA damage checkpoint and longer telomeres. This telomere lengthening required functional telomerase, the core DNA damage signali...

  5. Break It

    Institute of Scientific and Technical Information of China (English)

    MATTHEW PLOWRIGHT; GWYNN GUILFORD

    2008-01-01

    @@ Resolutions are not natural - otherwise you wouldn't have to "resolve" to execute them. This year, instead of planning how to commit to a slew of unattainable goals, why not prepare for breaking your resolutions the right way?

  6. Genetic characterization of cells of homocystinuria patients with disrupted DNA repair system

    Energy Technology Data Exchange (ETDEWEB)

    Sinel' shchikova, T.A.; L' vova, G.N.; Shoniya, N.N.; Zasukhina, G.D.

    1986-08-01

    Fibroblasts obtained from biopsy material and lymphocytes of patients with homocystinuria were investigated for repair activity according to the following criteria: rejoined DNA breaks, induced by 4-nitroquinoline-1-oxide and ..gamma..-radiation; indices of reactivation and induced mutagenesis of smallpox vaccine virus treated with these mutagens. In lymphocytes a defect of DNA repair was observed according to all criteria investigated. During passage of fibroblast cultures, inhibition of repair activity of cells was preserved according to ..gamma..-type. Increase in the number of spontaneous and ..gamma..-induced mutations of virus was noted according to degree of passage of fibroblasts.

  7. 75 FR 13127 - Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied...

    Science.gov (United States)

    2010-03-18

    ... Exposure Reduction. In the Federal Register dated April 22, 2008 (73 FR 21692), EPA promulgated final TSCA... are conducted in target housing and child-occupied facilities: 1. Establish the discipline of lead... AGENCY Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child...

  8. Presence of base excision repair enzymes in the wheat aleurone and their activation in cells undergoing programmed cell death.

    Science.gov (United States)

    Bissenbaev, Amangeldy K; Ishchenko, Alexander A; Taipakova, Sabira M; Saparbaev, Murat K

    2011-10-01

    Cereal aleurone cells are specialized endosperm cells that produce enzymes to hydrolyze the starchy endosperm during germination. Aleurone cells can undergo programmed cell death (PCD) when incubated in the presence of gibberellic acid (GA) in contrast to abscisic acid (ABA) which inhibits the process. The progression of PCD in aleurone layer cells of wheat grain is accompanied by an increase in deoxyribonuclease (DNase) activities and the internucleosomal degradation of nuclear DNA. Reactive oxygen species (ROS) are increased during PCD in the aleurone cells owing to the β-oxidation of triglycerides and inhibition of the antioxidant enzymes possibly leading to extensive oxidative damage to DNA. ROS generate mainly non-bulky DNA base lesions which are removed in the base excision repair (BER) pathway, initiated by the DNA glycosylases. At present, very little is known about oxidative DNA damage repair in cereals. Here, we study DNA repair in the cell-free extracts of wheat aleurone layer incubated or not with phytohormones. We show, for the first time, the presence of 8-oxoguanine-DNA and ethenoadenine-DNA glycosylase activities in wheat aleurone cells. Interestingly, the DNA glycosylase and AP endonuclease activities are strongly induced in the presence of GA. Based on these data we propose that GA in addition to activation of nuclear DNases also induces the DNA repair activities which remove oxidized DNA bases in the BER pathway. Potential roles of the wheat DNA glycosylases in GA-induced oligonucleosomal fragmentation of DNA and metabolic activation of aleurone layer cells via repair of transcribed regions are discussed.

  9. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    Directory of Open Access Journals (Sweden)

    Erhong Meng

    2015-07-01

    Full Text Available Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair. Aberrant activation of the Hedgehog (Hh signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer.

  10. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Erhong; Hanna, Ann; Samant, Rajeev S.; Shevde, Lalita A., E-mail: lsamant@uab.edu [Department of Pathology, Comprehensive Cancer Center, University of Alabama at Birmingham, WTI320D, 1824 6th Avenue South, Birmingham, AL 35233 (United States)

    2015-07-21

    Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair). Aberrant activation of the Hedgehog (Hh) signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer.

  11. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    International Nuclear Information System (INIS)

    Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair). Aberrant activation of the Hedgehog (Hh) signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer

  12. Lamin A Is an Endogenous SIRT6 Activator and Promotes SIRT6-Mediated DNA Repair

    Directory of Open Access Journals (Sweden)

    Shrestha Ghosh

    2015-11-01

    Full Text Available The nuclear lamins are essential for various molecular events in the nucleus, such as chromatin organization, DNA replication, and provision of mechanical support. A specific point mutation in the LMNA gene creates a truncated prelamin A termed progerin, causing Hutchinson-Gilford progeria syndrome (HGPS. SIRT6 deficiency leads to defective genomic maintenance and accelerated aging similar to HGPS, suggesting a potential link between lamin A and SIRT6. Here, we report that lamin A is an endogenous activator of SIRT6 and facilitates chromatin localization of SIRT6 upon DNA damage. Lamin A promotes SIRT6-dependent DNA-PKcs (DNA-PK catalytic subunit recruitment to chromatin, CtIP deacetylation, and PARP1 mono-ADP ribosylation in response to DNA damage. The presence of progerin jeopardizes SIRT6 activation and compromises SIRT6-mediated molecular events in response to DNA damage. These data reveal a critical role for lamin A in regulating SIRT6 activities, suggesting that defects in SIRT6 functions contribute to impaired DNA repair and accelerated aging in HGPS.

  13. 76 FR 3151 - Agency Information Collection Activities: Record of Vessel Foreign Repair or Equipment Purchase

    Science.gov (United States)

    2011-01-19

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HOMELAND... Foreign Repair or Equipment Purchase AGENCY: U.S. Customs and Border Protection (CBP), Department of... requirement concerning the Record of Vessel Foreign Repair or Equipment Purchase (CBP Form 226). This...

  14. Influence of the OGG1 Ser326Cys polymorphism on oxidatively damaged DNA and repair activity

    DEFF Research Database (Denmark)

    Jensen, Annie; Løhr, Mille; Eriksen, Louise;

    2012-01-01

    Oxidatively damaged DNA base lesions are considered to be mainly repaired by 8-oxoguanine DNA glycosylase (OGG1) mediated pathways. We investigated the effect of the OGG1 Ser326Cys polymorphism on the level and repair of oxidatively damaged DNA in mononuclear blood cells (MNBC) by means of the co...

  15. MR imaging and T2 measurements in peripheral nerve repair with activation of Toll-like receptor 4 of neurotmesis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiang; Zhang, Fang; Lu, Liejing; Li, Haojiang; Wen, Xuehua; Shen, Jun [Sun Yat-Sen University, Department of Radiology, Sun Yat-Sen Memorial Hospital, Guangzhou, Guangdong (China)

    2014-05-15

    To investigate the role of MR imaging in neurotmesis combined with surgical repair and Toll-like receptor 4 (TLR4) activation. Forty-eight rats received subepineurial microinjection of the TLR4 agonist lipopolysaccharide (LPS, n = 24) or phosphate buffered saline (PBS, n = 24) immediately after surgical repair of the transected sciatic nerve. Sequential fat-suppressed T2-weighted imaging and quantitative T2 measurements were obtained at 3, 7, 14 and 21 days after surgery, with histologic assessments performed at regular intervals. T2 relaxation times and histological quantification of the distal stumps were measured and compared. The distal stumps of transected nerves treated with LPS or PBS both showed persistent enlargement and hyperintense signal. T2 values of the distal stumps showed a rapid rise to peak level followed by a rapid decline pattern in nerves treated with LPS, while exhibiting a slow rise to peak value followed by a slow decline in nerves treated with PBS. Nerves treated with LPS exhibited more prominent macrophage recruitment, faster myelin debris clearance and more pronounced nerve regeneration. Nerves treated with TLR4 activation had a characteristic pattern of T2 value change over time. Longitudinal T2 measurements can be used to detect the enhanced repair effect associated with TLR4 activation in the surgical repair of neurotmesis. (orig.)

  16. The Break

    DEFF Research Database (Denmark)

    Strand, Anete Mikkala Camille

    2016-01-01

    storytelling to enact fruitful breakings of patterns unbecoming. The claim being, that the hamster wheel of Work-life anno 2016 needs reconfiguration and the simple yet fruitful manner by which this is done is through acknowledging the benefits of bodies, spaces and artifacts – and the benefits of actually...... taking a break, discontinuing for a moment in order to continue better, wiser and more at ease. Both within and as part of the daily routines, and – now and then – outside these routines in the majesty of nature with time to explore and redirect the course of life in companionships with fellow man...

  17. String breaking

    CERN Document Server

    Bali, G S; Lippert, T; Neff, H; Prkacin, Z; Schilling, K; Bali, Gunnar S; Dussel, Thomas; Lippert, Thomas; Neff, Hartmut; Prkacin, Zdravko; Schilling, Klaus

    2006-01-01

    We numerically investigate the transition of the static quark-antiquark string into a static-light meson-antimeson system. Improving noise reduction techniques, we are able to resolve the signature of string breaking dynamics for Nf=2 lattice QCD at zero temperature. We discuss the lattice techniques used and present results on energy levels and mixing angle of the static two-state system. We visualize the action density distribution in the region of string breaking as a function of the static colour source-antisource separation. The results can be related to properties of quarkonium systems.

  18. Leakage of high active liquid waste into the thermowell of HALW evaporator (4/4). Repair work for leakage prevention

    International Nuclear Information System (INIS)

    Leakage of high active liquid waste into the thermowell of High Active Liquid Waste (HALW) Evaporator was confirmed when thermometers were replaced in Rokkasho Reprocessing Plant. We estimate that the cause of the leakage is tunnel corrosion at the bottom cap of the thermowell due to high temperature at the bottom of the evaporator. This paper deals with the repair work for the leakage prevention. (author)

  19. Nonhomologous Mechanisms of Repair of Chromosomal Breaks

    Energy Technology Data Exchange (ETDEWEB)

    Haber, J. E.

    2001-12-19

    Discovered three new proteins involved in DNA damage assessment. Interestingly they are all proteins involved in recombination, but they have very different roles in that process and other proteins that might be expected to be equivalently involved are not. This is developing into a very significant area of research.

  20. Targeting base excision repair as a sensitization strategy in radiotherapy.

    NARCIS (Netherlands)

    Vens, C.; Begg, A.C.

    2010-01-01

    Cellular DNA repair determines survival after ionizing radiation. Human tumors commonly exhibit aberrant DNA repair since they drive mutagenesis and chromosomal instability. Recent reports have shown alterations in the base excision repair (BER) and single strand break repair (SSBR) pathways in huma

  1. Supersymmetry breaking

    Indian Academy of Sciences (India)

    Emilian Dudas

    2009-01-01

    We review the various mechanisms of supersymmetry breaking and its trans-mission to the observable sector. We argue that hybrid models where gauge dominates over gravity mediation, but gravity provides the main contributions to the Higgs sector masses and the neutralino mass, are able to combine the advantages and reduce the disadvantages of the two transmission mechanisms.

  2. Mutagenicity of 2-amino-3-methylimidazo[4,5-f]quinoline in colon and liver of Big Blue rats: role of DNA adducts, strand breaks, DNA repair and oxidative stress

    DEFF Research Database (Denmark)

    Moller, P.; Wallin, H.; Vogel, U.;

    2002-01-01

    The contribution of oxidative stress, different types of DNA damage and expression of DNA repair enzymes in colon and liver mutagenesis induced by 2-amino-3-methylimidazo [4,5-f]quinoline (IQ) was investigated in four groups of six Big Blue rats fed diets with 0, 20, 70, and 200 mg IQ/kg for 3....... Investigations of oxidative stress biomarkers produced inconclusive results. Oxidative DNA damage detected by the endonuclease III enzyme and 7-hydro-8-oxo-2'-deoxyguanosine in colon, liver and/or urine was unaltered by IQ. However, there was increased level of gamma-glutamyl semialdehyde in liver proteins......, indicating a higher rate of protein oxidation in the liver following IQ administration. In plasma and erythrocytes there were unaltered levels of oxidized protein, malondialdehyde, and antioxidant enzyme activities (superoxide dismutase, glutathione peroxidase, catalase, glutathione reductase) indicating...

  3. Mutagenicity of 2-amino-3-methylimidazo[4,5-f]quinoline in colon and liver of Big Blue Rats: role of DNA adducts, strand breaks, DNA repair and oxidative stress

    DEFF Research Database (Denmark)

    Møller, Peter; Wallin, Håkan; Vogel, Ulla;

    2002-01-01

    The contribution of oxidative stress, different types of DNA damage and expression of DNA repair enzymes in colon and liver mutagenesis induced by 2-amino-3-methylimidazo [4,5-f]quinoline (IQ) was investigated in four groups of six Big Blue rats fed diets with 0, 20, 70, and 200 mg IQ/kg for 3....... Investigations of oxidative stress biomarkers produced inconclusive results. Oxidative DNA damage detected by the endonuclease III enzyme and 7-hydro-8-oxo-2'-deoxyguanosine in colon, liver and/or urine was unaltered by IQ. However, there was increased level of gamma-glutamyl semialdehyde in liver proteins......, indicating a higher rate of protein oxidation in the liver following IQ administration. In plasma and erythrocytes there were unaltered levels of oxidized protein, malondialdehyde, and antioxidant enzyme activities (superoxide dismutase, glutathione peroxidase, catalase, glutathione reductase) indicating...

  4. HCMV-infected cells maintain efficient nucleotide excision repair of the viral genome while abrogating repair of the host genome.

    Directory of Open Access Journals (Sweden)

    John M O'Dowd

    Full Text Available Many viruses subvert the host cell's ability to mount and complete various DNA damage responses (DDRs after infection. HCMV infection of permissive fibroblasts activates host DDRs at the time of viral deposition and during replication, but the DDRs remain uncompleted without arrest or apoptosis. We believe this was in part due to partitioning of the damage response and double strand break repair components. After extraction of soluble proteins, the localization of these components fell into three groups: specifically associated with the viral replication centers (RCs, diffused throughout the nucleoplasm and excluded from the RCs. Others have shown that cells are incapable of processing exogenously introduced damage after infection. We hypothesized that the inability of the cells to process damage might be due to the differential association of repair components within the RCs and, in turn, potentially preferential repair of the viral genome and compromised repair of the host genome. To test this hypothesis we used multiple strategies to examine repair of UV-induced DNA damage in mock and virus-infected fibroblasts. Comet assays indicated that repair was initiated, but was not completed in infected cells. Quantitative analysis of immunofluorescent localization of cyclobutane pyrimidine dimers (CPDs revealed that after 24 h of repair, CPDs were significantly reduced in viral DNA, but not significantly changed in the infected host DNA. To further quantitate CPD repair, we developed a novel dual-color Southern protocol allowing visualization of host and viral DNA simultaneously. Combining this Southern methodology with a CPD-specific T4 endonuclease V alkaline agarose assay to quantitate repair of adducts, we found efficient repair of CPDs from the viral DNA but not host cellular DNA. Our data confirm that NER functions in HCMV-infected cells and almost exclusively repairs the viral genome to the detriment of the host's genome.

  5. Quaternary ammonium silane-functionalized, methacrylate resin composition with antimicrobial activities and self-repair potential.

    Science.gov (United States)

    Gong, Shi-qiang; Niu, Li-Na; Kemp, Lisa K; Yiu, Cynthia K Y; Ryou, Heonjune; Qi, Yi-Pin; Blizzard, John D; Nikonov, Sergey; Brackett, Martha G; Messer, Regina L W; Wu, Christine D; Mao, Jing; Bryan Brister, L; Rueggeberg, Frederick A; Arola, Dwayne D; Pashley, David H; Tay, Franklin R

    2012-09-01

    The design of antimicrobial polymers to address healthcare issues and minimize environmental problems is an important endeavor with both fundamental and practical implications. Quaternary ammonium silane-functionalized methacrylate (QAMS) represents an example of antimicrobial macromonomers synthesized by a sol-gel chemical route; these compounds possess flexible Si-O-Si bonds. In present work, a partially hydrolyzed QAMS co-polymerized with 2,2-[4(2-hydroxy 3-methacryloxypropoxy)-phenyl]propane is introduced. This methacrylate resin was shown to possess desirable mechanical properties with both a high degree of conversion and minimal polymerization shrinkage. The kill-on-contact microbiocidal activities of this resin were demonstrated using single-species biofilms of Streptococcus mutans (ATCC 36558), Actinomyces naeslundii (ATCC 12104) and Candida albicans (ATCC 90028). Improved mechanical properties after hydration provided the proof-of-concept that QAMS-incorporated resin exhibits self-repair potential via water-induced condensation of organic modified silicate (ormosil) phases within the polymerized resin matrix. PMID:22659173

  6. A baculovirus photolyase with DNA repair activity and circadian clock regulatory function

    NARCIS (Netherlands)

    Biernat, M.A.; Eker, A.P.M.; Oers, van M.M.; Vlak, J.M.; Horst, van der G.T.J.; Chaves, I.

    2012-01-01

    Cryptochromes and photolyases belong to the same family of flavoproteins but, despite being structurally conserved, display distinct functions. Photolyases use visible light to repair ultraviolet-induced DNA damage. Cryptochromes, however, function as blue-light receptors, circadian photoreceptors,

  7. Active transcriptomic and proteomic reprogramming in the C. elegans nucleotide excision repair mutant xpa-1.

    Science.gov (United States)

    Kassahun, Henok; Nilsen, Hilde

    2013-10-01

    Oxidative stress promotes human aging and contributes to common neurodegenerative diseases. Endogenous DNA damage induced by oxidative stress is believed to be an important promoter of neurodegenerative diseases. Although a large amount of evidence correlates a reduced DNA repair capacity with aging and neurodegenerative disease, there is little direct evidence of causality. Moreover, the contribution of oxidative DNA damage to the aging process is poorly understood. We have used the nematode Caenorhabditis elegans to study the contribution of oxidative DNA damage and repair to aging. C. elegans is particularly well suited to tackle this problem because it has a minimum complexity DNA repair system, which enables us to circumvent the important limitation presented by the extensive redundancy of DNA repair enzymes in mammals. PMID:24744987

  8. DNA repair: Dynamic defenders against cancer and aging

    Energy Technology Data Exchange (ETDEWEB)

    Fuss, Jill O.; Cooper, Priscilla K.

    2006-04-01

    (UV) component of sunlight. NER can be divided into two classes based on where the repair occurs. NER occurring in DNA that is not undergoing transcription (i.e., most of the genome) is called global genome repair (GGR or GGNER), while NER taking place in the transcribed strand of active genes is called transcription-coupled repair (TCR or TC-NER). We will explore NER in more detail below. Mismatch repair (MMR) is another type of excision repair that specifically removes mispaired bases resulting from replication errors. DNA damage can also result in breaks in the DNA backbone, in one or both strands. Single-strand breaks (SSBs) are efficiently repaired by a mechanism that shares common features with the later steps in BER. Double-strand breaks (DSBs) are especially devastating since by definition there is no intact complementary strand to serve as a template for repair, and even one unrepaired DSB can be lethal [3]. In cells that have replicated their DNA prior to cell division, the missing information can be supplied by the duplicate copy, or sister chromatid, and DSBs in these cells are faithfully repaired by homologous recombination involving the exchange of strands of DNA between the two copies. However, most cells in the body are non-dividing, and in these cells the major mechanism for repairing DSBs is by non-homologous end joining (NHEJ), which as the name implies involves joining two broken DNA ends together without a requirement for homologous sequence and which therefore has a high potential for loss of genetic information.

  9. X-ray repair cross complementing protein 1 in base excision repair

    DEFF Research Database (Denmark)

    Hanssen-Bauer, Audun; Solvang-Garten, Karin; Akbari, Mansour;

    2012-01-01

    X-ray Repair Cross Complementing protein 1 (XRCC1) acts as a scaffolding protein in the converging base excision repair (BER) and single strand break repair (SSBR) pathways. XRCC1 also interacts with itself and rapidly accumulates at sites of DNA damage. XRCC1 can thus mediate the assembly of large...

  10. DNA repair in PHA stimulated human lymphocytes

    International Nuclear Information System (INIS)

    Damage an repair of radiation induced DNA strand breaks were measured by alkaline lysis and hydroxyapatite chromatography. PHA stimulated human lymphocytes show that the rejoining process is complete within the first 50 min., afterwords secondary DNA damage and chromatid aberration. DNA repair, in synchronized culture, allows to evaluate individual repair capacity and this in turn can contribute to the discovery of individual who, although they do not demonstrate apparent clinical signs, are carriers of DNA repair deficiency. Being evident that a correlation exists between DNA repair capacity and carcinogenesis, the possibility of evaluating the existent relationship between DNA repair and survival in tumor cells comes therefore into discussion

  11. Effect of low dose {gamma} radiation on the dormancy breaking and physiological activity of 'Dejima' seed potato

    Energy Technology Data Exchange (ETDEWEB)

    Kim, J. S.; Kim, D. H.; Baek, M. H.; Lee, Y. K. [KAERI, Taejon (Korea, Republic of); Lee, Y. B. [Chungnam National Univ., Taejon (Korea, Republic of)

    2001-05-01

    To observe the stimulating effects of low dose {gamma}-radiation on the dormancy breaking and physiological activity, potato (Solanum tuberosum L. cv. Dejima) were irradiated at the dose of 0.5 {approx} 30 Gy. Low dose {gamma}-radiation had promoting effects on the srouting rate the optimum dose of 1 Gy and 2 Gy and on the sprout length at the optimum dose of 2 Gy and 4 Gy. In case of number of sprouts, there were increased in all of the low dose irradiation groups and period storages, which showed very significant promoting effects at 4,8,16 Gy of 15 DAP. The field growth of 45 DAP were increased at all of the low dose irradiation group, which particularly were very significant promoting effect at 4 Gy irradiation group. Irradiation didn't have significant effects on the antioxidant enzyme activity of potato plantlet, but the peroxidase activity of 45 DAP plantlet increased at 4 Gy irradiation group.

  12. Global endometrial transcriptomic profiling: transient immune activation precedes tissue proliferation and repair in healthy beef cows

    Directory of Open Access Journals (Sweden)

    Foley Cathriona

    2012-09-01

    Full Text Available Abstract Background All cows experience bacterial contamination and tissue injury in the uterus postpartum, instigating a local inflammatory immune response. However mechanisms that control inflammation and achieve a physiologically functioning endometrium, while avoiding disease in the postpartum cow are not succinctly defined. This study aimed to identify novel candidate genes indicative of inflammation resolution during involution in healthy beef cows. Previous histological analysis of the endometrium revealed elevated inflammation 15 days postpartum (DPP which was significantly decreased by 30 DPP. The current study generated a genome-wide transcriptomic profile of endometrial biopsies from these cows at both time points using mRNA-Seq. The pathway analysis tool GoSeq identified KEGG pathways enriched by significantly differentially expressed genes at both time points. Novel candidate genes associated with inflammatory resolution were subsequently validated in additional postpartum animals using quantitative real-time PCR (qRT-PCR. Results mRNA-Seq revealed 1,107 significantly differentially expressed genes, 73 of which were increased 15 DPP and 1,034 were increased 30 DPP. Early postpartum, enriched immune pathways (adjusted P P SAA1/2, GATA2, IGF1, SHC2, and SERPINA14 genes were significantly elevated 30 DPP and are functionally associated with tissue repair and the restoration of uterine homeostasis postpartum. Conclusions The results of this study reveal an early activation of the immune response which undergoes a temporal functional change toward tissue proliferation and regeneration during endometrial involution in healthy postpartum cows. These molecular changes mirror the activation and resolution of endometrial inflammation during involution previously classified by the degree of neutrophil infiltration. SAA1/2, GATA2, IGF1, SHC2, and SERPINA14 genes may become potential markers for resolution of endometrial inflammation in

  13. Functional analysis of the RAD50/MRE11 protein complex through targeted disruption of the murine RAD50 genomic locus: implications for DNA double strand break repair. An astro research fellowship presentation

    International Nuclear Information System (INIS)

    Purpose/Objective: The products of the S. cerevisiae genes ScRAD50 and ScMRE11 act in a protein complex and are required for non-homologous end-joining, the predominant mechanism of DNA double strand break (dsb) repair in mammalian cells. Mutation of these genes results in sensitivity to ionizing radiation (IR), a defect in initiation of meiosis, increased and error-prone recombination during mitosis, and overall genomic instability. This resultant phenotype is reminiscent of that seen in mammalian syndromes of genomic instability such as ataxia-telangiectasia and Bloom syndrome, hallmarks of which are radiation sensitivity and predisposition to malignancy. The murine homologues to ScRAD50 and ScMRE11 have recently been identified; both demonstrate impressive primary sequence conservation with their yeast counterparts, and are expected to mediate conserved functions. The roles of muRAD50 in genomic maintenance and in dsb repair will be examined in two parts. The first will include a determination of normal muRAD50 expression patterns. Second, the effects of disruption of the muRAD50 gene will be assessed. A specific targeting event has introduced a conditional murad50 null mutation into the genome of murine embryonic stem (ES) cells. These mutant ES cells are being used to create mutant mice, thus allowing functional characterization of muRAD50 on both the cellular and organismic levels. Such analyses will contribute to the delineation of the mammalian dsb repair pathway and to the cellular response to IR, and will serve as a mammalian model system for genomic instability. Materials and Methods: Wild-type tissue expression patterns and protein-protein interactions were determined by standard biochemical techniques, including immunoprecipitation, polyacrylamide gel electrophoresis, and Western blotting. Molecular cloning techniques were used to create the gene targeting vectors, which were designed to result in either a deletion of exon 1 (equivalent to a null

  14. Signalization and repair of the DNA double-strand breaks of in the cerebral tumors: modulation of the radiation response with the chemotherapy treatments; Signalization et reparation des cassures double-brin de l'ADN dans les gliomes: modulation de la reponse aux traitements chimio-radiotherapeutiques

    Energy Technology Data Exchange (ETDEWEB)

    Marcinkova-Bencokova, Z

    2007-07-15

    There are about 6000 new cases of nervous system tumours each year in France. However, the current radio chemotherapeutic approaches against brain tumours remain still insufficient to produce a satisfactory therapeutic index. In parallel, the knowledge of the early radiobiological events has considerably progressed in the last few years. This thesis aims to provide new insights in the molecular and cellular response of brain tumours to radio chemotherapy. This thesis was divided into four stages. Stage 1: a novel DNA double-strand breaks repair pathway depending on the MRE11 protein but independent of the phosphorylation of H2AX emerged from the study of artefacts of the immunofluorescence technique and a systematic analysis of the radiosensitivity of human cells. Stage 2: the radiobiological features of 3 rodent models of glioma among the most used in preclinical trials and of 7 human glioma cell lines were investigated. Functional impairments of the BRCA1 protein in response to radiation and/or cisplatin were observed in the majority of the models tested, raising the question of the role of this protein in the anti-glioma treatments and in glioma genesis. Stage 3: in order to extend our approach to genetic syndromes associated with cerebral tumours predisposition, the radiobiological characteristics of the fibroblasts resulting from patients suffering from neurofibromatosis type 1 (NF1), a pathology associated with a strong incidence of peripheral nervous system tumours, were investigated. NF1 appeared to be a syndrome with moderated radiosensitivity, associated with a weak deficiency of DNA end-joining repair but with a strong activity of MRE11. These results enabled us to propose a preliminary model involving both proteins BRCA1 and NF1. Stage 4: considering the role of BRCA1 in the inhibition of some tyrosine kinase activity and in the response to cisplatin, we tested the radiobiological effects of treatments combining radiation, cisplatin and tyrosine kinase

  15. Symmetry Breaking in Chiral Ionic Liquids Evidenced by Vibrational Optical Activity.

    Science.gov (United States)

    Oulevey, Patric; Luber, Sandra; Varnholt, Birte; Bürgi, Thomas

    2016-09-19

    Ionic liquids (ILs) are receiving increasing interest for their use in synthetic laboratories and industry. Being composed of charged entities, they show a complex and widely unexplored dynamic behavior. Chiral ionic liquids (CILs) have a high potential as solvents for use in asymmetric synthesis. Chiroptical methods, owing to their sensitivity towards molecular conformation, offer unique possibilities to study the structure of these chiral ionic liquids. Raman optical activity proved particularly useful to study ionic liquids composed of amino acids and the achiral 1-ethyl-3-methylimidazolium counterion. We could substantiate, supported by selected theoretical methods, that the achiral counterion adopts an overall chiral conformation in the presence of chiral amino acid ions. These findings suggest that in the design of chiral ionic liquids for asymmetric synthesis, the structure of the achiral counter ion also has to be carefully considered.

  16. Positioning Effects of KillerRed inside of Cells correlate with DNA Strand Breaks after Activation with Visible Light

    Directory of Open Access Journals (Sweden)

    Waldemar Waldeck, Gabriele Mueller, Manfred Wiessler, Katalin Tóth, Klaus Braun

    2011-01-01

    Full Text Available Fluorescent proteins (FPs are established tools for new applications, not-restricted to the cell biological research. They could also be ideal in surgery enhancing the precision to differentiate between the target tissue and the surrounding healthy tissue. FPs like the KillerRed (KRED, used here, can be activated by excitation with visible day-light for emitting active electrons which produce reactive oxygen species (ROS resulting in photokilling processes. It is a given that the extent of the KRED's cell toxicity depends on its subcellular localization. Evidences are documented that the nuclear lamina as well as especially the chromatin are critical targets for KRED-mediated ROS-based DNA damaging. Here we investigated the damaging effects of the KRED protein fused to the nuclear lamina and to the histone H2A DNA-binding protein. We detected a frequency of DNA strand breaks, dependent first on the illumination time, and second on the spatial distance between the localization at the chromatin and the site of ROS production. As a consequence we could identify defined DNA bands with 200, 400 and (600 bps as most prominent degradation products, presumably representing an internucleosomal DNA cleavage induced by KRED. These findings are not restricted to the detection of programmed cell death processes in the therapeutic field like PDT, but they can also contribute to a better understanding of the structure-function relations in the epigenomic world.

  17. Positioning Effects of KillerRed inside of Cells correlate with DNA Strand Breaks after Activation with Visible Light

    Science.gov (United States)

    Waldeck, Waldemar; Mueller, Gabriele; Wiessler, Manfred; Tóth, Katalin; Braun, Klaus

    2011-01-01

    Fluorescent proteins (FPs) are established tools for new applications, not-restricted to the cell biological research. They could also be ideal in surgery enhancing the precision to differentiate between the target tissue and the surrounding healthy tissue. FPs like the KillerRed (KRED), used here, can be activated by excitation with visible day-light for emitting active electrons which produce reactive oxygen species (ROS) resulting in photokilling processes. It is a given that the extent of the KRED's cell toxicity depends on its subcellular localization. Evidences are documented that the nuclear lamina as well as especially the chromatin are critical targets for KRED-mediated ROS-based DNA damaging. Here we investigated the damaging effects of the KRED protein fused to the nuclear lamina and to the histone H2A DNA-binding protein. We detected a frequency of DNA strand breaks, dependent first on the illumination time, and second on the spatial distance between the localization at the chromatin and the site of ROS production. As a consequence we could identify defined DNA bands with 200, 400 and (600) bps as most prominent degradation products, presumably representing an internucleosomal DNA cleavage induced by KRED. These findings are not restricted to the detection of programmed cell death processes in the therapeutic field like PDT, but they can also contribute to a better understanding of the structure-function relations in the epigenomic world. PMID:21278894

  18. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage-induced cell senescence.

    Science.gov (United States)

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A; Kumar, Sheetal; Kalab, Petr

    2016-04-15

    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase-regulated nuclear-cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage-induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β-dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP-regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  19. The effects of over-expressing Tip60 on cellular DNA damage repair and cell cycle progression

    International Nuclear Information System (INIS)

    To investigate the effects of Tip60 on DNA damage repair, cell cycle and the related mechanism as well, the proliferative activity, DNA double strand break (DSB) repair competency and cell cycle arrest were analyzed in stable Tip60-overexpression U2OS cells established by transfecting with exogenous Tip60 gene. It was found that the overexpression of Tip60 inhibited the proliferative activity but increased the DNA damage repair competency. The radiation-induced G2/M arrest was prolonged in Tip60 over-expressed U2OS cells, which was associated with a decreasing level of cell cycle checkpoint protein Cyclin B/CDC2 complex. (authors)

  20. TECHNICAL NOTE: A real-time active smart patch system for monitoring the integrity of bonded repair on an aircraft structure

    Science.gov (United States)

    Qing, Xinlin P.; Beard, Shawn J.; Kumar, Amrita; Hannum, Robert

    2006-06-01

    There currently exists a need to develop a cost-effective, in-service structural health monitoring (SHM) system for determining the initial quality of a bonded repair and assessing the long-term durability of the bonded repair on an aircraft structure. In this paper, a real-time active smart patch system (SPS) based on SMART layer technology is introduced for monitoring the integrity of bonded repairs. First, an overview of the SPS is given for typical metal and composite repairs. To illustrate the capability of the SPS, three applications are presented: (1) monitoring of the cure progress of the bonded repair adhesive, (2) detection of the initial artificial disbond between the composite patch and the metal structure, and (3) monitoring of damage in and around a bonded repair during fatigue cycling. The results show that, through the use of a real-time active SPS approach of using sensors placed in, on or around the repair, the initial quality and long-term durability of the repair can be evaluated and monitored.

  1. The recombination protein RAD52 cooperates with the excision repair protein OGG1 for the repair of oxidative lesions in mammalian cells

    DEFF Research Database (Denmark)

    de Souza-Pinto, Nadja C; Maynard, Scott; Hashiguchi, Kazunari;

    2009-01-01

    activities and RAD52 stimulates OGG1 incision activity, likely increasing its turnover rate. RAD52 colocalizes with OGG1 after oxidative stress to cultured cells, but not after the direct induction of double-strand breaks by ionizing radiation. Human cells depleted of RAD52 via small interfering RNA...... to repair oxidative DNA damage and enhances the cellular resistance to oxidative stress. Our observations suggest a coordinated action between these proteins that may be relevant when oxidative lesions positioned close to strand breaks impose a hindrance to RAD52 catalytic activities....

  2. Breaking Routines

    DEFF Research Database (Denmark)

    Kesting, Peter; Jørgensen, Frances

    On some level, innovation begins when the current way of doing things is questioned and alternatives are sought. In cognitive terms, this can be conceptualized as the point at which an agent breaks with existing routine and returns to planning and decision-making. Thus far, however, very little...... is known about this cognitive structure or the factors that trigger the search for alternatives. In cooperation with the Danish Research Centre for Magnetic Resonance, University of Copenhagen, Denmark, we are in the process of designing an experimental study designed to gain insights into the triggers...

  3. Activation of New Raman Modes by Inversion Symmetry Breaking in Type II Weyl Semimetal Candidate T'-MoTe2.

    Science.gov (United States)

    Chen, Shao-Yu; Goldstein, Thomas; Venkataraman, Dhandapani; Ramasubramaniam, Ashwin; Yan, Jun

    2016-09-14

    We synthesized distorted octahedral (T') molybdenum ditelluride (MoTe2) and investigated its vibrational properties with Raman spectroscopy, density functional theory, and symmetry analysis. Compared to results from the high-temperature centrosymmetric monoclinic (T'mo) phase, four new Raman bands emerge in the low-temperature orthorhombic (T'or) phase, which was recently predicted to be a type II Weyl semimetal. Crystal-angle-dependent, light-polarization-resolved measurements indicate that all the observed Raman peaks belong to two categories: those vibrating along the zigzag Mo atomic chain (z-modes) and those vibrating in the mirror plane (m-modes) perpendicular to the zigzag chain. Interestingly, the low-energy shear z-mode and shear m-mode, absent from the T'mo spectra, become activated when sample cooling induces a phase transition to the T'or crystal structure. We interpret this observation as a consequence of inversion-symmetry breaking, which is crucial for the existence of Weyl fermions in the layered crystal. Our temperature-dependent Raman measurements further show that both the high-energy m-mode at ∼130 cm(-1) and the low-energy shear m-mode at ∼12 cm(-1) provide useful gauges for monitoring the broken inversion symmetry in the crystal. PMID:27517466

  4. Radiation Induced DNA Double Strand Break Studies of a Metal Sensitive Novel Bacterial Isolate from East Calcutta Wetland

    Directory of Open Access Journals (Sweden)

    Sanhita Chowdhury

    2009-01-01

    Full Text Available Problem statement: This study was an attempt to isolate anaerobic microbes with potential for DNA double strand break repair using methanogen specific medium (DSMZ 120 from East Calcutta Wetland in India. It also intended to verify the specificity of the medium for isolation of the desired family of microbe. Approach: Culture based technique was used to obtain the pure isolate that was further characterized in details. For double strand break repair studies, isolate was irradiated with different doses of 60Co gamma rays and its subsequent repair was observed using pulse field gel electrophoresis and asymmetric field inversion gel electrophoresis. Inhibitor was used to predict the mechanism of repair. Results: In this study we isolated and characterized a metal sensitive anaerobic microbial strain obtained using methanogen specific medium (DSMZ 120 from East Calcutta Wetland in India. The strain was one of the members of the group of uncultivated bacterium as evident from phylogenetic analysis, thus indicating the successful cultivation of an as yet uncultivable novel microbe (GenBank Acc. No. FJ 930097 and also the non-specific growth of microbes in prescribed medium. It was a Gram positive Bacilli, member of Fermicutes with optimum growth at 25°C and pH-7. The growth curve analysis showed a lag phase up to 24 h, log phase from 24-48 h, an early stationary phase from 96 h onwards. The strain could repair the DNA double strand break caused by irradiation with 60Co γ rays. The dose profile study revealed maximum repair at 60 Grays and thereafter a drop in repair ability with increase in irradiation dose. The time required for repair showed an essential incubation period of 4 h. The DNA polymerase inhibitor, Arabinose CTP inhibited the repair indicating the involvement of polymerase in the repair process and thus pointing towards homologous recombination as the underlying mechanism. Conclusion: In this study we were able to cultivate an as yet

  5. Use of a molecular beacon to track the activity of base excision repair protein OGG1 in live cells.

    Science.gov (United States)

    Mirbahai, Leda; Kershaw, Rachael M; Green, Richard M; Hayden, Rachel E; Meldrum, Rosalind A; Hodges, Nikolas J

    2010-02-01

    An abundant form of DNA damage caused by reactive oxygen species is 8-oxo-7,8-dihydroguanine for which the base excision repair protein 8-oxoguanine-DNA glycosylase 1 (OGG1) is a major repair enzyme. To assess the location and intracellular activity of the OGG1 protein in response to oxidative stress, we have utilised a fluorescence-quench molecular beacon switch containing a 8-oxo-dG:C base pair and a fluorescent and quencher molecule at opposite ends of a hairpin oligonucleotide. Oxidative stress was induced by treatment with potassium bromate. Flow cytometry demonstrated a concentration-dependent increase in the activity of OGG1 that was detected by the fluorescence produced when the oligonucleotide was cleaved in the cells treated with potassium bromate. This signal is highly specific and not detectable in OGG1 knock out cells. Induction of OGG1 activity is not a result of induction of OGG1 gene expression as assessed by qPCR suggesting a role for protein stabilisation or increased OGG1 catalytic activity. High resolution confocal microscopy pinpointed the location of the fluorescent molecular beacon in live cells to perinuclear regions that were identified as mitochondria by co-staining with mitotracker dye. There is no evidence of cut beacon within the nuclear compartment of the cell. Control experiments with a positive control beacon (G:C base pair and lacking the DAB quencher) did not result in mitochondrial localisation of fluorescence signal indicating that the dye does not accumulate in mitochondria independent of OGG1 activity. Furthermore, faint nuclear staining was apparent confirming that the beacon structure is able to enter the nucleus. In conclusion, these data indicate that the mitochondria are the major site for OGG1 repair activity under conditions of oxidative stress.

  6. Acetylation regulates WRN catalytic activities and affects base excision DNA repair

    DEFF Research Database (Denmark)

    Muftuoglu, Meltem; Kusumoto, Rika; Speina, Elzbieta;

    2008-01-01

    The Werner protein (WRN), defective in the premature aging disorder Werner syndrome, participates in a number of DNA metabolic processes, and we have been interested in the possible regulation of its function in DNA repair by post-translational modifications. Acetylation mediated by histone...

  7. Base excision repair activities differ in human lung cancer cells and corresponding normal controls

    DEFF Research Database (Denmark)

    Karahalil, Bensu; Bohr, Vilhelm A; De Souza-Pinto, Nadja C

    2010-01-01

    Oxidative damage to DNA is thought to play a role in carcinogenesis by causing mutations, and indeed accumulation of oxidized DNA bases has been observed in samples obtained from tumors but not from surrounding tissue within the same patient. Base excision repair (BER) is the main pathway for the...

  8. Breaking Symmetries

    CERN Document Server

    Peters, Kirstin

    2010-01-01

    A well-known result by Palamidessi tells us that {\\pi}mix (the {\\pi}-calculus with mixed choice) is more expressive than {\\pi}sep (its subset with only separate choice). The proof of this result argues with their different expressive power concerning leader election in symmetric networks. Later on, Gorla of- fered an arguably simpler proof that, instead of leader election in symmetric networks, employed the reducibility of "incestual" processes (mixed choices that include both enabled senders and receivers for the same channel) when running two copies in parallel. In both proofs, the role of breaking (ini- tial) symmetries is more or less apparent. In this paper, we shed more light on this role by re-proving the above result-based on a proper formalization of what it means to break symmetries-without referring to another layer of the distinguishing problem domain of leader election. Both Palamidessi and Gorla rephrased their results by stating that there is no uniform and reason- able encoding from {\\pi}mix i...

  9. Thimerosal induces DNA breaks, caspase-3 activation, membrane damage, and cell death in cultured human neurons and fibroblasts.

    Science.gov (United States)

    Baskin, David S; Ngo, Hop; Didenko, Vladimir V

    2003-08-01

    Thimerosal is an organic mercurial compound used as a preservative in biomedical preparations. Little is known about the reactions of human neuronal and skin cells to its micro- and nanomolar concentrations, which can occur after using thimerosal-containing products. A useful combination of fluorescent techniques for the assessment of thimerosal toxicity is introduced. Short-term thimerosal toxicity was investigated in cultured human cerebral cortical neurons and in normal human fibroblasts. Cells were incubated with 125-nM to 250-microM concentrations of thimerosal for 45 min to 24 h. A 4', 6-diamidino-2-phenylindole dihydrochloride (DAPI) dye exclusion test was used to identify nonviable cells and terminal transferase-based nick-end labeling (TUNEL) to label DNA damage. Detection of active caspase-3 was performed in live cell cultures using a cell-permeable fluorescent caspase inhibitor. The morphology of fluorescently labeled nuclei was analyzed. After 6 h of incubation, the thimerosal toxicity was observed at 2 microM based on the manual detection of the fluorescent attached cells and at a 1-microM level with the more sensitive GENios Plus Multi-Detection Microplate Reader with Enhanced Fluorescence. The lower limit did not change after 24 h of incubation. Cortical neurons demonstrated higher sensitivity to thimerosal compared to fibroblasts. The first sign of toxicity was an increase in membrane permeability to DAPI after 2 h of incubation with 250 microM thimerosal. A 6-h incubation resulted in failure to exclude DAPI, generation of DNA breaks, caspase-3 activation, and development of morphological signs of apoptosis. We demonstrate that thimerosal in micromolar concentrations rapidly induce membrane and DNA damage and initiate caspase-3-dependent apoptosis in human neurons and fibroblasts. We conclude that a proposed combination of fluorescent techniques can be useful in analyzing the toxicity of thimerosal.

  10. Equipment maintenance and repair

    Directory of Open Access Journals (Sweden)

    Walia DS

    2010-10-01

    Full Text Available The repair and maintenance of ophthalmic equipment, including surgical instruments and diagnostic devices, can be compared to the maintenance of a motor vehicle, something many of us understand well.If you had a car, would you drive it until the fuel runs out or until a tyre punctures, and then abandon it to buy a new car? Of course not. However, many eye care units purchase (or receive as a donation expensive and delicate equipment which, because of poor maintenance, ends up breaking down. If there is not a system in place to report breakdowns and to plan or carry out repairs, equipment can remain unusable for long periods of time. Sometimes, this equipment ends up being dumped. Good maintenance habits and an effective repair system will minimise the amount of time equipment is unusable.

  11. Autophagic UVRAG Promotes UV-Induced Photolesion Repair by Activation of the CRL4(DDB2) E3 Ligase.

    Science.gov (United States)

    Yang, Yongfei; He, Shanshan; Wang, Qiaoxiu; Li, Fan; Kwak, Mi-Jeong; Chen, Sally; O'Connell, Douglas; Zhang, Tian; Pirooz, Sara Dolatshahi; Jeon, YongHeui; Chimge, Nyam-Osor; Frenkel, Baruch; Choi, Younho; Aldrovandi, Grace M; Oh, Byung-Ha; Yuan, Zengqiang; Liang, Chengyu

    2016-05-19

    UV-induced DNA damage, a major risk factor for skin cancers, is primarily repaired by nucleotide excision repair (NER). UV radiation resistance-associated gene (UVRAG) is a tumor suppressor involved in autophagy. It was initially isolated as a cDNA partially complementing UV sensitivity in xeroderma pigmentosum (XP), but this was not explored further. Here we show that UVRAG plays an integral role in UV-induced DNA damage repair. It localizes to photolesions and associates with DDB1 to promote the assembly and activity of the DDB2-DDB1-Cul4A-Roc1 (CRL4(DDB2)) ubiquitin ligase complex, leading to efficient XPC recruitment and global genomic NER. UVRAG depletion decreased substrate handover to XPC and conferred UV-damage hypersensitivity. We confirmed the importance of UVRAG for UV-damage tolerance using a Drosophila model. Furthermore, increased UV-signature mutations in melanoma correlate with reduced expression of UVRAG. Our results identify UVRAG as a regulator of CRL4(DDB2)-mediated NER and suggest that its expression levels may influence melanoma predisposition. PMID:27203177

  12. Xeroderma pigmentosum, DNA repair and carcinogenesis

    International Nuclear Information System (INIS)

    The following topics are reviewed: Symptoms of xeroderma pigmentosum; xeroderma pigmentosum as a defect in the biochemistry of repair of radiation damage; major classes of DNA damage and repair mechanisms; excision repair in relation to biochemical steps and the XP defect; sensitivity of xeroderma pigmentosum cells; host-cell reactivation of UV-damaged viruses; excision of pyrimidine dimers from human cells; formation and sealing of single strand breaks during dimer excision; insertion of new bases to repair DNA; and DNA repair, carcinogens, and carcinogenesis

  13. Repair activities on the LHC cryogenic distribution line in charge of TS/MME

    CERN Document Server

    Atieh, S; CERN. Geneva. TS Department

    2005-01-01

    The Cryogenic Distribution Line (QRL), running inside the machine tunnel parallel to the regular lattice of superconducting quadrupole and dipole magnets of LHC, transports the refrigeration power produced by the refrigerators over long distances. With a total length of about 25.8 km, QRL consists of a modular set-up of pipe and Service Modules (SM), Vacuum Barriers (VB), Fixed Points (FP), steps and elbows. TS department was charged to replace non-conform sliding tables included in the Cryogenic Distribution Line QRL. For this repair work, based on technologically advanced methods, TS/MME imposed a high level of quality assurance and follow-up for mechanical repair works as well as for the metrological measurements carried out which an innovative polyarticulated arm, a portable measuring device, and leak testing by argon.

  14. Active transcriptomic and proteomic reprogramming in the C. elegans nucleotide excision repair mutant xpa-1

    OpenAIRE

    Kassahun, Henok; Nilsen, Hilde

    2013-01-01

    Oxidative stress promotes human aging and contributes to common neurodegenerative diseases. Endogenous DNA damage induced by oxidative stress is believed to be an important promoter of neurodegenerative diseases. Although a large amount of evidence correlates a reduced DNA repair capacity with aging and neurodegenerative disease, there is little direct evidence of causality. Moreover, the contribution of oxidative DNA damage to the aging process is poorly understood. We have used the nematode...

  15. Activation of Type II Cells into Regenerative Stem Cell Antigen-1+ Cells during Alveolar Repair

    Science.gov (United States)

    Kumar, Varsha Suresh; Zhang, Wei; Rehman, Jalees; Malik, Asrar B.

    2015-01-01

    The alveolar epithelium is composed of two cell types: type I cells comprise 95% of the gas exchange surface area, whereas type II cells secrete surfactant, while retaining the ability to convert into type I cells to induce alveolar repair. Using lineage-tracing analyses in the mouse model of Pseudomonas aeruginosa–induced lung injury, we identified a population of stem cell antigen (Sca)-1–expressing type II cells with progenitor cell properties that mediate alveolar repair. These cells were shown to be distinct from previously reported Sca-1–expressing bronchioalveolar stem cells. Microarray and Wnt reporter studies showed that surfactant protein (Sp)-C+Sca-1+ cells expressed Wnt signaling pathway genes, and inhibiting Wnt/β-catenin signaling prevented the regenerative function of Sp-C+Sca-1+ cells in vitro. Thus, P. aeruginosa–mediated lung injury induces the generation of a Sca-1+ subset of type II cells. The progenitor phenotype of the Sp-C+Sca-1+ cells that mediates alveolar epithelial repair might involve Wnt signaling. PMID:25474582

  16. Mating-type suppression of the DNA-repair defect of the yeast rad6 delta mutation requires the activity of genes in the RAD52 epistasis group.

    Science.gov (United States)

    Yan, Y X; Schiestl, R H; Prakash, L

    1995-06-01

    The RAD6 gene of Saccharomyces cerevisiae is required for post-replication repair of UV-damaged DNA, UV mutagenesis, and sporulation. Here, we show that the radiation sensitivity of a MATa rad6 delta strain can be suppressed by the MAT alpha 2 gene carried on a multicopy plasmid. The a1-alpha 2 suppression is specific to the RAD6 pathway, as mutations in genes required for nucleotide excision repair or for recombinational repair do not show such mating-type suppression. The a1-alpha 2 suppression of the rad6 delta mutation requires the activity of the RAD52 group of genes, suggesting that suppression occurs by channelling of post-replication gaps present in the rad6 delta mutant into the RAD52 recombinational repair pathway. The a1-alpha 2 repressor could mediate this suppression via an enhancement in the expression, or the activity, of recombination genes.

  17. Stripped-down DNA repair in a highly reduced parasite

    Directory of Open Access Journals (Sweden)

    Fast Naomi M

    2007-03-01

    Full Text Available Abstract Background Encephalitozoon cuniculi is a member of a distinctive group of single-celled parasitic eukaryotes called microsporidia, which are closely related to fungi. Some of these organisms, including E. cuniculi, also have uniquely small genomes that are within the prokaryotic range. Thus, E. cuniculi has undergone a massive genome reduction which has resulted in a loss of genes from diverse biological pathways, including those that act in DNA repair. DNA repair is essential to any living cell. A loss of these mechanisms invariably results in accumulation of mutations and/or cell death. Six major pathways of DNA repair in eukaryotes include: non-homologous end joining (NHEJ, homologous recombination repair (HRR, mismatch repair (MMR, nucleotide excision repair (NER, base excision repair (BER and methyltransferase repair. DNA polymerases are also critical players in DNA repair processes. Given the close relationship between microsporidia and fungi, the repair mechanisms present in E. cuniculi were compared to those of the yeast Saccharomyces cerevisiae to ascertain how the process of genome reduction has affected the DNA repair pathways. Results E. cuniculi lacks 16 (plus another 6 potential absences of the 56 DNA repair genes sought via BLASTP and PSI-BLAST searches. Six of 14 DNA polymerases or polymerase subunits are also absent in E. cuniculi. All of these genes are relatively well conserved within eukaryotes. The absence of genes is not distributed equally among the different repair pathways; some pathways lack only one protein, while there is a striking absence of many proteins that are components of both double strand break repair pathways. All specialized repair polymerases are also absent. Conclusion Given the large number of DNA repair genes that are absent from the double strand break repair pathways, E. cuniculi is a prime candidate for the study of double strand break repair with minimal machinery. Strikingly, all of the

  18. Role of ubiquitination in meiotic recombination repair

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Programmed and unprogrammed double-strand breaks (DSBs) often arise from such physiological requirements as meiotic recombination, and exogenous insults, such as ionizing radiation (IR). Due to deleterious impacts on genome stability, DSBs must be appropriately processed and repaired in a regulatory manner. Recent investigations have indicated that ubiquitination is a critical factor in DNA damage response and meiotic recombination repair. This review summarizes the effects of proteins and complexes associated with ubiquitination with regard to homologous recombination (HR)-dependent DSB repair.

  19. Coupling end resection with the checkpoint response at DNA double-strand breaks.

    Science.gov (United States)

    Villa, Matteo; Cassani, Corinne; Gobbini, Elisa; Bonetti, Diego; Longhese, Maria Pia

    2016-10-01

    DNA double-strand breaks (DSBs) are a nasty form of damage that needs to be repaired to ensure genome stability. The DSB ends can undergo a strand-biased nucleolytic processing (resection) to generate 3'-ended single-stranded DNA (ssDNA) that channels DSB repair into homologous recombination. Generation of ssDNA also triggers the activation of the DNA damage checkpoint, which couples cell cycle progression with DSB repair. The checkpoint response is intimately linked to DSB resection, as some checkpoint proteins regulate the resection process. The present review will highlight recent works on the mechanism and regulation of DSB resection and its interplays with checkpoint activation/inactivation in budding yeast. PMID:27141941

  20. Active skin perfusion and thermoregulatory response in the hand following nerve injury and repair in human upper extremities.

    Science.gov (United States)

    Deng, Aidong; Liu, Dan; Gu, Chen; Gu, Xiaosong; Gu, Jianhui; Hu, Wen

    2016-01-01

    Cutaneous vasoconstriction/vasodilatation occurs in response to whole body and local cooling/heating, and the vasomotor activities play a pivotal role in thermal control of the human body. The mechanisms underlying regulation of skin blood flow involve both neurogenic and humeral/local chemical influence, contributing to the initial response to thermal stimuli and the prolonged phase of response, respectively. Previous studies have suggested the impairment of cutaneous thermal regulation after nerve injury. However, the evidence regarding how the skin perfusion and thermoregulatory response evolve after nerve injury and repair remains limited. Here we observed, by utilizing laser-Doppler perfusion imaging, baseline skin perfusion and perfusion change in response to thermal stimuli after median and ulnar nerve injury, and the results showed that baseline perfusion in autonomous skin area profoundly decreased and active rewarming after clod stress dramatically diminished before sensory recovery of the skin became detectable. In addition, baseline cutaneous perfusion was recovered as the skin regained touch sensation, and exhibited positive correlation to touch sensibility of the skin. These data indicate that both active perfusion and thermoregulatory response of the skin are markedly compromised during skin denervation and can be recovered by re-innervation. This suggests the importance of timely repair of injured nerve, especially in the practice of replantation.

  1. Feasibility of externally activated self-repairing concrete with epoxy injection network and Cu-Al-Mn superelastic alloy reinforcing bars

    International Nuclear Information System (INIS)

    This paper studies the effectiveness of an externally activated self-repairing technique for concrete members with epoxy injection network and Cu-Al-Mn superelastic alloy (SEA) reinforcing bars (rebars). Compared to existing crack self-repairing and self-healing techniques, the epoxy injection network has the following strengths: (1) Different from the self-repairing methods using brittle containers or tubes for adhesives, the proposed self-repair process can be performed repeatedly and is feasible for onsite concrete casting. (2) Different from the autogenic self-healing techniques, full strength recovery can be achieved in a shorter time period without the necessity of water. This paper attempts to enhance the self-repairing capability of the epoxy injection network by reducing residual cracks by using cost-effective Cu-based SEA bars. The effectiveness of the present technique is examined using concrete beam specimens reinforced by 3 types of bars. The first specimen is reinforced by steel deformed bars, the second by steel threaded bars, and finally by SEA threaded rebars. The tests were performed with a 3 point cyclic loading with increasing amplitude. From the test results, effective self-repairing was confirmed for small deformation levels irrespective of the reinforcement types. Effective self-repairing was observed in the SEA reinforced specimen even under much larger deformations. Nonlinear finite element analysis was performed to confirm the experimental findings. (paper)

  2. A cell-free system for studying a priming factor involved in repair of bleomycin-damaged DNA.

    Directory of Open Access Journals (Sweden)

    Seki,Shuji

    1989-04-01

    Full Text Available A simple cell-free system for studying a priming factor involved in the repair of bleomycin-damaged DNA was established. The template-primer used for the repair DNA synthesis was prepared by treating the closed circular, superhelical form of pUC19 plasmid DNA with 2.2 microM bleomycin and 20 microM ferrous ions. Single-strand breaks were introduced into pUC19 DNA by the bleomycin treatment, and the DNA was consequently converted largely into the open circular form. A system for repair of this bleomycin-damaged DNA was constructed with a priming factor, DNA polymerase (DNA polymerase beta or Klenow fragment of DNA polymerase I, ATP, T4 DNA ligase and four deoxynucleoside triphosphates. After incubation, the conformation of the DNA was analyzed by agarose gel electrophoresis and electron microscopy. The open circular DNA was largely converted to the closed circular DNA, indicating that the single-strand breaks of DNA were repaired. When the priming factor was omitted, DNA repair did not occur. The present system seemed to be applicable to the study of priming factors involved in the repair of DNA with single-strand breaks caused not only by bleomycin but also by ionizing radiation or active oxygen.

  3. Experimental Study of Big Break Sports Activity in Primary School%开展体育大课间活动的实验研究

    Institute of Scientific and Technical Information of China (English)

    王浩龙

    2014-01-01

    长期以来,南京市琅琊路小学明发滨江分校大课间体育活动内容单一,流于形式,约束了学生的活动,运动方式不利于学生的全面发展。所以打破传统大课间活动方式,在大课间体育活动中开展橄榄球、健脑操、武术操、舞蹈、趣味游戏、冬季长跑等多种体育项目,增强学生体质,激发学生对体育的兴趣和爱好,培养学生坚持锻炼身体的习惯,便成为我们开展大课间体育活动研究的方向。%For a long time, the content of big break sport activities in Langya Road Primary School Mingfa Binjiang Campus is single and becomes a mere formality, which restrict students' activities, and the exercise is not conducive to the all-round development of students. So to break the traditional big break activities, carry out a variety of sports, like, football, brain gym, Wushu gymnastics, dance, fun games, winter long-distance running, enhance the physical fitness of students, stimulate students' interest in sports, and cultivate students' exercise habit has become the direction of the research on big break activities.

  4. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    OpenAIRE

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.

    2005-01-01

    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S](2+) cluster of MutY to [4Fe-4S](3+) and its decomposition product [3Fe-4S](1+). Flash/quench experiments monitored by EPR spec...

  5. XRCC1 and DNA polymerase β in cellular protection against cytotoxic DNA single-strand breaks

    Institute of Scientific and Technical Information of China (English)

    Julie K Horton; Mary Watson; Donna F Stefanick; Daniel T Shaughnessy; Jack A Taylor; Samuel H Wilson

    2008-01-01

    Single-strand breaks (SSBs) can occur in cells either directly, or indirectly following initiation of base excision re-pair (BER). SSBs generally have blocked termini lacking the conventional 5'-phosphate and 3'-hydroxyl groups and require further processing prior to DNA synthesis and ligation. XRCC1 is devoid of any known enzymatic activity, but it can physically interact with other proteins involved in all stages of the overlapping SSB repair and BER pathways, including those that conduct the rate-limiting end-tailoring, and in many cases can stimulate their enzymatic activities. XRCC1-/- mouse fibroblasts are most hypersensitive to agents that produce DNA lesions repaired by monofunctional glycosylase-initiated BER and that result in formation of indirect SSBs. A requirement for the deoxyribose phosphate lyase activity of DNA polymerase β (polβ) is specific to this pathway, whereas pol β is implicated in gap-filling during repair of many types of SSBs. Elevated levels of strand breaks, and diminished repair, have been demonstrated in MMS-treated XRCC1-/-, and to a lesser extent in polβ-/- cell lines, compared with wild-type cells. Thus a strong correlation is observed between cellular sensitivity to MMS and the ability of cells to repair MMS-induced damage. Exposure of wild-type andpolβ-/- cells to an inhibitor of PARP activity dramatically potentiates MMS-induccd cytotoxicity. XRCC1-/- cellsare also sensitized by PARP inhibition demonstrating that PARP-mediated poly(ADP-ribosyl)ation plays a role inmodulation of cytotoxicity beyond recruitment of XRCC1 to sites of DNA damage.

  6. DNA damage response and repair data with pharmacological modulators of Tousled

    Directory of Open Access Journals (Sweden)

    Prakash Srinivasan Timiri Shanmugam

    2016-06-01

    Full Text Available Human Tousled kinase 1 (TLK1 plays an important role in chromatin remodeling, replication, and DNA damage response and repair. TLK1 activity is immediately, but transiently, downregulated after genotoxic insult, and its recovery is important for exit from checkpoint arrest and cell survival after radiation. The data in this article compliments research presented in the paper titled, “Tousled kinase activator, gallic acid, promotes DNA repair and suppresses radiation cytotoxicity in salivary gland cells” [1]. The identification of small molecule activators and inhibitors of TLK1 provided an opportunity to pharmacologically alter the protein׳s activity to elucidate its role in DNA damage response pathways. TLK1 effectors, gallic acid (GA and thioridazine (THD activate and inhibit the kinase, respectively, and the data report on the impact of these compounds and the significance of TLK1 to DNA break repair and the survival of human salivary acinar cells.

  7. DNA repair and radiation sensitivity in mammalian cells

    International Nuclear Information System (INIS)

    Ionizing radiation induces various types of damage in mammalian cells including DNA single-strand breaks, DNA double-strand breaks (DSB), DNA-protein cross links, and altered DNA bases. Although human cells can repair many of these lesions there is little detailed knowledge of the nature of the genes and the encoded enzymes that control these repair processes. We report here on the cellular and genetic analyses of DNA double-strand break repair deficient mammalian cells. It has been well established that the DNA double-strand break is one of the major lesions induced by ionizing radiation. Utilizing rodent repair-deficient mutant, we have shown that the genes responsible for DNA double-strand break repair are also responsible for the cellular expression of radiation sensitivity. The molecular genetic analysis of DSB repair in rodent/human hybrid cells indicate that at least 6 different genes in mammalian cells are responsible for the repair of radiation-induced DNA double-strand breaks. Mapping and the prospect of cloning of human radiation repair genes are reviewed. Understanding the molecular and genetic basis of radiation sensitivity and DNA repair in man will provide a rational foundation to predict the individual risk associated with radiation exposure and to prevent radiation-induced genetic damage in the human population

  8. Sapacitabine, the prodrug of CNDAC, is a nucleoside analog with a unique action mechanism of inducing DNA strand breaks

    Institute of Scientific and Technical Information of China (English)

    Xiao-Jun Liu; Billie Nowak; Ya-Qing Wang; William Plunkett

    2012-01-01

    Sapacitabine is an orally bioavailable prodrug of the nucleoside analog 2'-C-cyano-2'-deoxy-1-β-D-arabino-pentofuranosylcytosine (CNDAC).Both the prodrug and active metabolite are in clinical trials for hematologic malignancies and/or solid tumors.CNDAC has a unique mechanism of action:after incorporation into DNA,it induces single-strand breaks (SSBs) that are converted into double-strand breaks (DSBs) when cells go through a second S phase.In our previous studies,we demonstrated that CNDAC-induced SSBs can be repaired by the transcription-coupled nucleotide excision repair pathway,whereas lethal DSBs are mainly repaired through homologous recombination.In the current work,we used clonogenic assays to compare the DNA damage repair mechanism of CNDAC with two other deoxycytidine analogs:cytarabine,which is used in hematologic malignacies,and gemcitabine,which shows activity in solid tumors.Deficiency in two Rad51 paralogs,Rad51D and XRCC3,greatly sensitized cells to CNDAC,but not to cytarabine or gemcitabine,indicating that homologous recombination is not a major mechanism for repairing damage caused by the latter two analogs.This study further suggests clinical activity and application of sapacitabine that is distinct from that of cytarabine or gemcitabine.

  9. Radiation damage and its repair in non-sporulating bacteria

    International Nuclear Information System (INIS)

    A review is given of radiation damage and its repair in non-sporulating bacteria. The identification and measurement of radiation damage in the DNA of the bacteria after exposure to ultraviolet radiation and ionizing radiation is described. Measuring the extent of DNA repair and ways of isolating repair mutants are also described. The DNA repair mechanisms for UV-induced damage are discussed including photoreactivation repair, excision repair, post-replication recombination repair and induced error-prone repair. The DNA repair mechanisms for ionizing radiation damage are also discussed including the repair of both single and double-strand breaks. Other aspects discussed include the effects of growth, irradiation medium and recovery medium on survival, DNA repair in humans, the commercial use of UV and ionizing radiations and the future of ionizing irradiation as a food treatment process. (U.K.)

  10. Endogenous repair by the activation of cell survival signalling cascades during the early stages of rat Parkinsonism.

    Directory of Open Access Journals (Sweden)

    Nga-Ping Lui

    Full Text Available Here we report a previously unknown self repair mechanism during extremely early stages of rat Parkinsonism. Two important cell survival signaling cascades, Phosphatidylinositol-3 kinases (PI3K/Akt pathway and extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/MAPK pathway, could be responsible for this potential endogenous rescue system. In the 6-hydroxydopamine-lesioned rat, the phosphorylated p44/42 MAPK and its downstream target, the phosphorylated Bad at Ser 112, were up-regulated at post-lesion day 3 and lasted for a couple of weeks. Although the change in the phosphorylated Akt kinase was negligible throughout the studied period, its downstream target, the phosphorylated Bad at 136, was increased from post-lesion day 3 to post-lesion day 14. In the mean time, nestin-positive reactive astrocytes with low levels of brain-derived neurotrophic factor (BDNF and glial cell line-derived neurotrophic factor (GDNF appeared at post-lesion day 3 in 6-hydroxydopamine-lesioned rat. BDNF was expressed in both striatum and substantia nigra whereas GDNF was displayed in striatum only. At post-lesion day 14, nestin, BDNF and GDNF expressions were diminished. These neurotrophic factors were believed to initiate the above anti-apoptotic signal transduction cascades as we could see that their expression patterns were similar. The data strongly suggest that there is an endogenous repair effort by evoking the cell survival signaling and possibly via the releases of BDNF and GDNF from nestin-immunoreactive reactive astrocytes. ERK/MAPK pathway was proposed to be the key endogenous neuroprotective mechanisms, particularly in early stages of rat Parkinsonism. However, the self repair effort is only functional within an extremely short time window immediately after onset.

  11. 46 CFR 176.704 - Breaking of safety valve seals.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Breaking of safety valve seals. 176.704 Section 176.704... TONS) INSPECTION AND CERTIFICATION Repairs and Alterations § 176.704 Breaking of safety valve seals... the seal on a boiler safety valve on a vessel is broken....

  12. 46 CFR 115.704 - Breaking of safety valve seals.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Breaking of safety valve seals. 115.704 Section 115.704... CERTIFICATION Repairs and Alterations § 115.704 Breaking of safety valve seals. The owner, managing operator, or master shall notify the cognizant OCMI as soon as practicable after the seal on a boiler safety valve...

  13. Proteinase-activated receptor-2 is required for normal osteoblast and osteoclast differentiation during skeletal growth and repair.

    Science.gov (United States)

    Georgy, S R; Pagel, C N; Ghasem-Zadeh, A; Zebaze, R M D; Pike, R N; Sims, N A; Mackie, E J

    2012-03-01

    Proteinase-activated receptor-2 (PAR(2)) is a G-protein coupled receptor expressed by osteoblasts and monocytes. PAR(2) is activated by a number of proteinases including coagulation factors and proteinases released by inflammatory cells. The aim of the current study was to investigate the role of PAR(2) in skeletal growth and repair using wild type (WT) and PAR(2) knockout (KO) mice. Micro computed tomography and histomorphometry were used to examine the structure of tibias isolated from uninjured mice at 50 and 90 days of age, and from 98-day-old mice in a bone repair model in which a hole had been drilled through the tibias. Bone marrow was cultured and investigated for the presence of osteoblast precursors (alkaline phosphatase-positive fibroblastic colonies), and osteoclasts were counted in cultures treated with M-CSF and RANKL. Polymerase chain reaction (PCR) was used to determine which proteinases that activate PAR(2) are expressed in bone marrow. Regulation of PAR(2) expression in primary calvarial osteoblasts from WT mice was investigated by quantitative PCR. Cortical and trabecular bone volumes were significantly greater in the tibias of PAR(2) KO mice than in those of WT mice at 50 days of age. In trabecular bone, osteoclast surface, osteoblast surface and osteoid volume were significantly lower in KO than in WT mice. Bone marrow cultures from KO mice showed significantly fewer alkaline phosphatase-positive colony-forming units and osteoclasts compared to cultures from WT mice. Significantly less new bone and significantly fewer osteoclasts were observed in the drill sites of PAR(2) KO mice compared to WT mice 7 days post-surgery. A number of activators of PAR(2), including matriptase and kallikrein 4, were found to be expressed by normal bone marrow. Parathyroid hormone, 1,25 dihydroxyvitamin D(3), or interleukin-6 in combination with its soluble receptor down-regulated PAR(2) mRNA expression, and fibroblast growth factor-2 or thrombin stimulated PAR(2

  14. Bladder exstrophy repair

    Science.gov (United States)

    Bladder birth defect repair; Everted bladder repair; Exposed bladder repair; Repair of bladder exstrophy ... Bladder exstrophy repair involves two surgeries. The first surgery is to repair the bladder and the second one is to attach ...

  15. Sharpening the ends for repair: mechanisms and regulation of DNA resection.

    Science.gov (United States)

    Paudyal, Sharad C; You, Zhongsheng

    2016-07-01

    DNA end resection is a key process in the cellular response to DNA double-strand break damage that is essential for genome maintenance and cell survival. Resection involves selective processing of 5' ends of broken DNA to generate ssDNA overhangs, which in turn control both DNA repair and checkpoint signaling. DNA resection is the first step in homologous recombination-mediated repair and a prerequisite for the activation of the ataxia telangiectasia mutated and Rad3-related (ATR)-dependent checkpoint that coordinates repair with cell cycle progression and other cellular processes. Resection occurs in a cell cycle-dependent manner and is regulated by multiple factors to ensure an optimal amount of ssDNA required for proper repair and genome stability. Here, we review the latest findings on the molecular mechanisms and regulation of the DNA end resection process and their implications for cancer formation and treatment. PMID:27174871

  16. Evidence for preferential repair of 3-carbethoxypsoralen plus UVA induced DNA lesions in the active MAT alpha locus in Saccharomyces cerevisiae using the UvrABC assay.

    Science.gov (United States)

    Méniel, V; Brouwer, J; Averbeck, D

    1993-09-01

    The occurrence of preferential repair in Saccharomyces cerevisiae of the active MAT alpha locus compared with the inactive HML alpha locus was confirmed after 254 nm UV irradiation. Experiments carried out using the UvrABC excinuclease assay with the monofunctional furocoumarin 3-carbethoxypsoralen (3-CPs) plus UVA radiation which induce mainly monoadducts in DNA demonstrated preferential repair of the active MAT alpha locus compared with the inactive HML alpha locus in a SIR+ strain. However, as after 254 nm UV irradiation, no difference in the rate of removal of 3-CPs plus UVA induced lesions was observed between the two loci in the sir-3 mutant in which both loci are active. Thus, it appears that 3-CPs plus UVA induced monoadducts as well as pyrimidine dimers are subject to preferential repair.

  17. The effect of acute dose charge particle radiation on expression of DNA repair genes in mice.

    Science.gov (United States)

    Tariq, Muhammad Akram; Soedipe, Ayodotun; Ramesh, Govindarajan; Wu, Honglu; Zhang, Ye; Shishodia, Shishir; Gridley, Daila S; Pourmand, Nader; Jejelowo, Olufisayo

    2011-03-01

    The space radiation environment consists of trapped particle radiation, solar particle radiation, and galactic cosmic radiation (GCR), in which protons are the most abundant particle type. During missions to the moon or to Mars, the constant exposure to GCR and occasional exposure to particles emitted from solar particle events (SPE) are major health concerns for astronauts. Therefore, in order to determine health risks during space missions, an understanding of cellular responses to proton exposure is of primary importance. The expression of DNA repair genes in response to ionizing radiation (X-rays and gamma rays) has been studied, but data on DNA repair in response to protons is lacking. Using qPCR analysis, we investigated changes in gene expression induced by positively charged particles (protons) in four categories (0, 0.1, 1.0, and 2.0 Gy) in nine different DNA repair genes isolated from the testes of irradiated mice. DNA repair genes were selected on the basis of their known functions. These genes include ERCC1 (5' incision subunit, DNA strand break repair), ERCC2/NER (opening DNA around the damage, Nucleotide Excision Repair), XRCC1 (5' incision subunit, DNA strand break repair), XRCC3 (DNA break and cross-link repair), XPA (binds damaged DNA in preincision complex), XPC (damage recognition), ATA or ATM (activates checkpoint signaling upon double strand breaks), MLH1 (post-replicative DNA mismatch repair), and PARP1 (base excision repair). Our results demonstrate that ERCC1, PARP1, and XPA genes showed no change at 0.1 Gy radiation, up-regulation at 1.0 Gy radiation (1.09 fold, 7.32 fold, 0.75 fold, respectively), and a remarkable increase in gene expression at 2.0 Gy radiation (4.83 fold, 57.58 fold and 87.58 fold, respectively). Expression of other genes, including ATM and XRCC3, was unchanged at 0.1 and 1.0 Gy radiation but showed up-regulation at 2.0 Gy radiation (2.64 fold and 2.86 fold, respectively). We were unable to detect gene expression for the

  18. Complex formation by the human Rad51B and Rad51C DNA repair proteins and their activities in vitro

    Science.gov (United States)

    Lio, Yi-Ching; Mazin, Alexander V.; Kowalczykowski, Stephen C.; Chen, David J.

    2003-01-01

    The human Rad51 protein is essential for DNA repair by homologous recombination. In addition to Rad51 protein, five paralogs have been identified: Rad51B/Rad51L1, Rad51C/Rad51L2, Rad51D/Rad51L3, XRCC2, and XRCC3. To further characterize a subset of these proteins, recombinant Rad51, Rad51B-(His)(6), and Rad51C proteins were individually expressed employing the baculovirus system, and each was purified from Sf9 insect cells. Evidence from nickel-nitrilotriacetic acid pull-down experiments demonstrates a highly stable Rad51B.Rad51C heterodimer, which interacts weakly with Rad51. Rad51B and Rad51C proteins were found to bind single- and double-stranded DNA and to preferentially bind 3'-end-tailed double-stranded DNA. The ability to bind DNA was elevated with mixed Rad51 and Rad51C, as well as with mixed Rad51B and Rad51C, compared with that of the individual protein. In addition, both Rad51B and Rad51C exhibit DNA-stimulated ATPase activity. Rad51C displays an ATP-independent apparent DNA strand exchange activity, whereas Rad51B shows no such activity; this apparent strand exchange ability results actually from a duplex DNA destabilization capability of Rad51C. By analogy to the yeast Rad55 and Rad57, our results suggest that Rad51B and Rad51C function through interactions with the human Rad51 recombinase and play a crucial role in the homologous recombinational repair pathway.

  19. Sublethal gamma irradiation affects reproductive impairment and elevates antioxidant enzyme and DNA repair activities in the monogonont rotifer Brachionus koreanus

    Energy Technology Data Exchange (ETDEWEB)

    Han, Jeonghoon; Won, Eun-Ji [Department of Biological Sciences, College of Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Kim, Il-Chan; Yim, Joung Han [Division of Life Sciences, Korea Polar Research Institute, Incheon 406-840 (Korea, Republic of); Lee, Su-Jae [Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Sciences, College of Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of)

    2014-10-15

    Highlights: • No mortality within 96 h even at a high intensity (1200 Gy). • A reduced fecundity of Brachionus koreanus at over 150 Gy with a decrease in lifespan. • Dose-dependent ROS increase with GST enzyme activity at sub-lethal doses. • Significant impact on life table parameters, particularly fecundity. • Significant up-regulation of DNA repair-associated genes at sublethal doses. - Abstract: To examine the effects of gamma radiation on marine organisms, we irradiated several doses of gamma ray to the microzooplankton Brachionus koreanus, and measured in vivo and in vitro endpoints including the survival rate, lifespan, fecundity, population growth, gamma ray-induced oxidative stress, and modulated patterns of enzyme activities and gene expressions after DNA damage. After gamma radiation, no individuals showed any mortality within 96 h even at a high intensity (1200 Gy). However, a reduced fecundity (e.g. cumulated number of offspring) of B. koreanus at over 150 Gy was observed along with a slight decrease in lifespan. At 150 Gy and 200 Gy, the reduced fecundity of the rotifers led to a significant decrease in population growth, although in the second generation the population growth pattern was not affected even at 200 Gy when compared to the control group. At sub-lethal doses, reactive oxygen species (ROS) levels dose-dependently increased with GST enzyme activity. In addition, up-regulations of the antioxidant and chaperoning genes in response to gamma radiation were able to recover cellular damages, and life table parameters were significantly influenced, particularly with regard to fecundity. DNA repair-associated genes showed significantly up-regulated expression patterns in response to sublethal doses (150 and 200 Gy), as shown in the expression of the gamma-irradiated B. koreanus p53 gene, suggesting that these sublethal doses were not significantly fatal to B. koreanus but induced DNA damages leading to a decrease of the population size.

  20. Sublethal gamma irradiation affects reproductive impairment and elevates antioxidant enzyme and DNA repair activities in the monogonont rotifer Brachionus koreanus

    International Nuclear Information System (INIS)

    Highlights: • No mortality within 96 h even at a high intensity (1200 Gy). • A reduced fecundity of Brachionus koreanus at over 150 Gy with a decrease in lifespan. • Dose-dependent ROS increase with GST enzyme activity at sub-lethal doses. • Significant impact on life table parameters, particularly fecundity. • Significant up-regulation of DNA repair-associated genes at sublethal doses. - Abstract: To examine the effects of gamma radiation on marine organisms, we irradiated several doses of gamma ray to the microzooplankton Brachionus koreanus, and measured in vivo and in vitro endpoints including the survival rate, lifespan, fecundity, population growth, gamma ray-induced oxidative stress, and modulated patterns of enzyme activities and gene expressions after DNA damage. After gamma radiation, no individuals showed any mortality within 96 h even at a high intensity (1200 Gy). However, a reduced fecundity (e.g. cumulated number of offspring) of B. koreanus at over 150 Gy was observed along with a slight decrease in lifespan. At 150 Gy and 200 Gy, the reduced fecundity of the rotifers led to a significant decrease in population growth, although in the second generation the population growth pattern was not affected even at 200 Gy when compared to the control group. At sub-lethal doses, reactive oxygen species (ROS) levels dose-dependently increased with GST enzyme activity. In addition, up-regulations of the antioxidant and chaperoning genes in response to gamma radiation were able to recover cellular damages, and life table parameters were significantly influenced, particularly with regard to fecundity. DNA repair-associated genes showed significantly up-regulated expression patterns in response to sublethal doses (150 and 200 Gy), as shown in the expression of the gamma-irradiated B. koreanus p53 gene, suggesting that these sublethal doses were not significantly fatal to B. koreanus but induced DNA damages leading to a decrease of the population size

  1. DNA Repair Defects and Chromosomal Aberrations

    Science.gov (United States)

    Hada, Megumi; George, K. A.; Huff, J. L.; Pluth, J. M.; Cucinotta, F. A.

    2009-01-01

    Yields of chromosome aberrations were assessed in cells deficient in DNA doublestrand break (DSB) repair, after exposure to acute or to low-dose-rate (0.018 Gy/hr) gamma rays or acute high LET iron nuclei. We studied several cell lines including fibroblasts deficient in ATM (ataxia telangiectasia mutated; product of the gene that is mutated in ataxia telangiectasia patients) or NBS (nibrin; product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase (DNA-PK) activity. Chromosomes were analyzed using the fluorescence in situ hybridization (FISH) chromosome painting method in cells at the first division post irradiation, and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma irradiation induced greater yields of both simple and complex exchanges in the DSB repair-defective cells than in the normal cells. The quadratic dose-response terms for both simple and complex chromosome exchanges were significantly higher for the ATM- and NBS-deficient lines than for normal fibroblasts. However, in the NBS cells the linear dose-response term was significantly higher only for simple exchanges. The large increases in the quadratic dose-response terms in these repair-defective cell lines points the importance of the functions of ATM and NBS in chromatin modifications to facilitate correct DSB repair and minimize the formation of aberrations. The differences found between ATM- and NBS-deficient cells at low doses suggest that important questions should with regard to applying observations of radiation sensitivity at high dose to low-dose exposures. For aberrations induced by iron nuclei, regression models preferred purely linear dose responses for simple exchanges and quadratic dose responses for complex exchanges. Relative biological effectiveness (RBE) factors of all of

  2. INTERNAL REPAIR OF PIPELINES

    Energy Technology Data Exchange (ETDEWEB)

    Bill Bruce; Nancy Porter; George Ritter; Matt Boring; Mark Lozev; Ian Harris; Bill Mohr; Dennis Harwig; Robin Gordon; Chris Neary; Mike Sullivan

    2005-07-20

    liners, indicating that this type of liner is only marginally effective at restoring the pressure containing capabilities of pipelines. Failure pressures for larger diameter pipe repaired with a semi-circular patch of carbon fiber-reinforced composite lines were also marginally greater than that of a pipe section with un-repaired simulated damage without a liner. These results indicate that fiber reinforced composite liners have the potential to increase the burst pressure of pipe sections with external damage Carbon fiber based liners are viewed as more promising than glass fiber based liners because of the potential for more closely matching the mechanical properties of steel. Pipe repaired with weld deposition failed at pressures lower than that of un-repaired pipe in both the virgin and damaged conditions, indicating that this repair technology is less effective at restoring the pressure containing capability of pipe than a carbon fiber-reinforced liner repair. Physical testing indicates that carbon fiber-reinforced liner repair is the most promising technology evaluated to-date. In lieu of a field installation on an abandoned pipeline, a preliminary nondestructive testing protocol is being developed to determine the success or failure of the fiber-reinforced liner pipeline repairs. Optimization and validation activities for carbon-fiber repair methods are ongoing.

  3. Parasympathetic nervous system activity predicts mood repair use and its effectiveness among adolescents with and without histories of major depression.

    Science.gov (United States)

    Yaroslavsky, Ilya; Rottenberg, Jonathan; Bylsma, Lauren M; Jennings, J Richard; George, Charles; Baji, Ildikó; Benák, István; Dochnal, Roberta; Halas, Kitti; Kapornai, Krisztina; Kiss, Enikő; Makai, Attila; Varga, Hedvig; Vetró, Ágnes; Kovacs, Maria

    2016-04-01

    Depressive disorders that onset in the juvenile years have been linked to far-reaching adverse consequences, making it imperative to elucidate key mechanisms and contributory factors. Excessive use of regulatory responses that exacerbate sadness (maladaptive mood repair) or insufficient use of regulatory responses that reduce it (adaptive mood repair) may reflect behavioral mechanisms of depression risk. Cardiac vagal control, indexed by patterns of respiratory sinus arrhythmia (RSA), has received attention as a putative physiological risk factor for depression. Although mood repair and RSA are related, the nature of this relationship is not well characterized in the context of depression risk. Therefore, we tested alternative models of the relationships between RSA patterns (at rest and in response to a sad film), trait mood repair, and the effectiveness of a mood repair response in the laboratory (state mood repair) among adolescents with depression histories (n = 210) and emotionally healthy peers (n = 161). In our data, a mediation model best explained the association between the key constructs: Adolescents with normative RSA patterns exhibited lower levels of depression and trait maladaptive mood repair, and benefited more from instructed (state) mood repair in the laboratory. By contrast, adolescents with atypical RSA patterns exhibited higher levels of depression and dispositional maladaptive mood repair, which, in turn, mediated the relations of RSA patterns and depression symptoms. Atypical RSA patterns also predicted reduced benefits from laboratory mood repair. PMID:26950752

  4. Polychlorinated biphenyl quinone induces oxidative DNA damage and repair responses: The activations of NHEJ, BER and NER via ATM-p53 signaling axis

    International Nuclear Information System (INIS)

    Our previous studies demonstrated that polychlorinated biphenyl (PCB) quinone induced oxidative DNA damage in HepG2 cells. To promote genomic integrity, DNA damage response (DDR) coordinates cell-cycle transitions, DNA repair and apoptosis. PCB quinone-induced cell cycle arrest and apoptosis have been documented, however, whether PCB quinone insult induce DNA repair signaling is still unknown. In this study, we identified the activation of DDR and corresponding signaling events in HepG2 cells upon the exposure to a synthetic PCB quinone, PCB29-pQ. Our data illustrated that PCB29-pQ induces the phosphorylation of p53, which was mediated by ataxia telangiectasia mutated (ATM) protein kinase. The observed phosphorylated histone H2AX (γ-H2AX) foci and the elevation of 8-hydroxy-2′-deoxyguanosine (8-OHdG) indicated that DDR was stimulated by PCB29-pQ treatment. Additionally, we found PCB29-pQ activates non-homologous end joining (NHEJ), base excision repair (BER) and nucleotide excision repair (NER) signalings. However, these repair pathways are not error-free processes and aberrant repair of DNA damage may cause the potential risk of carcinogenesis and mutagenesis. - Highlights: • Polychlorinated biphenyl quinone induces oxidative DNA damage in HepG2 cells. • The elevation of γ-H2AX and 8-OHdG indicates the activation of DNA damage response. • ATM-p53 signaling acts as the DNA damage sensor and effector. • Polychlorinated biphenyl quinone activates NHEJ, BER and NER signalings

  5. Activation of GLP-1 Receptor Enhances Neuronal Base Excision Repair via PI3K-AKT-Induced Expression of Apurinic/Apyrimidinic Endonuclease 1

    Science.gov (United States)

    Yang, Jenq-Lin; Chen, Wei-Yu; Chen, Yin-Ping; Kuo, Chao-Ying; Chen, Shang-Der

    2016-01-01

    Glucagon-like peptide-1 (GLP-1) is an intestinal-secreted incretin that increases cellular glucose up-take to decrease blood sugar. Recent studies, however, suggest that the function of GLP-1 is not only to decrease blood sugar, but also acts as a neurotrophic factor that plays a role in neuronal survival, neurite outgrowth, and protects synaptic plasticity and memory formation from effects of β-amyloid. Oxidative DNA damage occurs during normal neuron-activity and in many neurological diseases. Our study describes how GLP-1 affected the ability of neurons to ameliorate oxidative DNA damage. We show that activation of GLP-1 receptor (GLP-1R) protect cortical neurons from menadione induced oxidative DNA damage via a signaling pathway involving enhanced DNA repair. GLP-1 stimulates DNA repair by activating the cyclic AMP response element binding protein (CREB) which, consequently, induces the expression of apurinic/apyrimidinic endonuclease 1 (APE1), a key enzyme in the base excision DNA repair (BER) pathway. In this study, APE1 expression was down-regulated as a consequence phosphatidylinositol-3 kinase (PI3K) suppression by the inhibitor LY294002, but not by the suppression of MEK activity. Ischemic stroke is typically caused by overwhelming oxidative-stress in brain cells. Administration of exentin-4, an analogue of GLP-1, efficiently enhanced DNA repair in brain cells of ischemic stroke rats. Our study suggests that a new function of GLP-1 is to elevate DNA repair by inducing the expression of the DNA repair protein APE1.

  6. Polychlorinated biphenyl quinone induces oxidative DNA damage and repair responses: The activations of NHEJ, BER and NER via ATM-p53 signaling axis

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Hui; Shi, Qiong; Song, Xiufang; Fu, Juanli; Hu, Lihua; Xu, Demei; Su, Chuanyang; Xia, Xiaomin; Song, Erqun; Song, Yang, E-mail: songyangwenrong@hotmail.com

    2015-07-01

    Our previous studies demonstrated that polychlorinated biphenyl (PCB) quinone induced oxidative DNA damage in HepG2 cells. To promote genomic integrity, DNA damage response (DDR) coordinates cell-cycle transitions, DNA repair and apoptosis. PCB quinone-induced cell cycle arrest and apoptosis have been documented, however, whether PCB quinone insult induce DNA repair signaling is still unknown. In this study, we identified the activation of DDR and corresponding signaling events in HepG2 cells upon the exposure to a synthetic PCB quinone, PCB29-pQ. Our data illustrated that PCB29-pQ induces the phosphorylation of p53, which was mediated by ataxia telangiectasia mutated (ATM) protein kinase. The observed phosphorylated histone H2AX (γ-H2AX) foci and the elevation of 8-hydroxy-2′-deoxyguanosine (8-OHdG) indicated that DDR was stimulated by PCB29-pQ treatment. Additionally, we found PCB29-pQ activates non-homologous end joining (NHEJ), base excision repair (BER) and nucleotide excision repair (NER) signalings. However, these repair pathways are not error-free processes and aberrant repair of DNA damage may cause the potential risk of carcinogenesis and mutagenesis. - Highlights: • Polychlorinated biphenyl quinone induces oxidative DNA damage in HepG2 cells. • The elevation of γ-H2AX and 8-OHdG indicates the activation of DNA damage response. • ATM-p53 signaling acts as the DNA damage sensor and effector. • Polychlorinated biphenyl quinone activates NHEJ, BER and NER signalings.

  7. INTERNAL REPAIR OF PIPELINES

    Energy Technology Data Exchange (ETDEWEB)

    Robin Gordon; Bill Bruce; Ian Harris; Dennis Harwig; George Ritter; Bill Mohr; Matt Boring; Nancy Porter; Mike Sullivan; Chris Neary

    2004-12-31

    liners, indicating that this type of liner is only marginally effective at restoring the pressure containing capabilities of pipelines. Failure pressures for larger diameter pipe repaired with a semi-circular patch of carbon fiber-reinforced composite lines were also marginally greater than that of a pipe section with un-repaired simulated damage without a liner. These results indicate that fiber reinforced composite liners have the potential to increase the burst pressure of pipe sections with external damage Carbon fiber based liners are viewed as more promising than glass fiber based liners because of the potential for more closely matching the mechanical properties of steel. Pipe repaired with weld deposition failed at pressures lower than that of un-repaired pipe in both the virgin and damaged conditions, indicating that this repair technology is less effective at restoring the pressure containing capability of pipe than a carbon fiber-reinforced liner repair. Physical testing indicates that carbon fiber-reinforced liner repair is the most promising technology evaluated to-date. The first round of optimization and validation activities for carbon-fiber repairs are complete. Development of a comprehensive test plan for this process is recommended for use in the field trial portion of this program.

  8. Supplementary motor area and primary auditory cortex activation in an expert break-dancer during the kinesthetic motor imagery of dance to music.

    Science.gov (United States)

    Olshansky, Michael P; Bar, Rachel J; Fogarty, Mary; DeSouza, Joseph F X

    2015-01-01

    The current study used functional magnetic resonance imaging to examine the neural activity of an expert dancer with 35 years of break-dancing experience during the kinesthetic motor imagery (KMI) of dance accompanied by highly familiar and unfamiliar music. The goal of this study was to examine the effect of musical familiarity on neural activity underlying KMI within a highly experienced dancer. In order to investigate this in both primary sensory and motor planning cortical areas, we examined the effects of music familiarity on the primary auditory cortex [Heschl's gyrus (HG)] and the supplementary motor area (SMA). Our findings reveal reduced HG activity and greater SMA activity during imagined dance to familiar music compared to unfamiliar music. We propose that one's internal representations of dance moves are influenced by auditory stimuli and may be specific to a dance style and the music accompanying it. PMID:25301352

  9. The Trichoderma reesei Cry1 protein is a member of the cryptochrome/photolyase family with 6-4 photoproduct repair activity.

    Directory of Open Access Journals (Sweden)

    Jesús Guzmán-Moreno

    Full Text Available DNA-photolyases use UV-visible light to repair DNA damage caused by UV radiation. The two major types of DNA damage are cyclobutane pyrimidine dimers (CPD and 6-4 photoproducts (6-4PP, which are repaired under illumination by CPD and 6-4 photolyases, respectively. Cryptochromes are proteins related to DNA photolyases with strongly reduced or lost DNA repair activity, and have been shown to function as blue-light photoreceptors and to play important roles in circadian rhythms in plants and animals. Both photolyases and cryptochromes belong to the cryptochrome/photolyase family, and are widely distributed in all organisms. Here we describe the characterization of cry1, a member of the cryptochrome/photolyase protein family of the filamentous fungus Trichoderma reesei. We determined that cry1 transcript accumulates when the fungus is exposed to light, and that such accumulation depends on the photoreceptor Blr1 and is modulated by Envoy. Conidia of cry1 mutants show decreased photorepair capacity of DNA damage caused by UV light. In contrast, strains over-expressing Cry1 show increased repair, as compared to the parental strain even in the dark. These observations suggest that Cry1 may be stimulating other systems involved in DNA repair, such as the nucleotide excision repair system. We show that Cry1, heterologously expressed and purified from E. coli, is capable of binding to undamaged and 6-4PP damaged DNA. Photorepair assays in vitro clearly show that Cry1 repairs 6-4PP, but not CPD and Dewar DNA lesions.

  10. INGUINAL HERNIA REPAIR - ACTUAL STATUS

    Directory of Open Access Journals (Sweden)

    R.Van Hee

    2007-04-01

    Full Text Available Even in 2006, there are a lot of controversy about the best technique for inguinal hernia repair. The factors that influence the choice of the technique are: uni- or bilateral hernia, “Nyhus” type of hernia, complicated hernia, large inguino-scrotal hernia, recurrent hernia or previous surgery, preferred type of anaesthesia. Surgeon has to answer to three question when he choices a type of hernia repair: What are there specific indications for this repair? What are the specific complications of the repair technique? What are the results with the repair technique? In the literature there are a lot of studies which give comparisons about the techniques of hernia repair: type and rate of complications, recurrence rate, costs and economic impact. There are various types of evidence: retrospective studies, prospective randomized trials, meta-analyses. This paper reviews some of the literature studies about: techniques of open non-mesh hernia repair, types of open mesh repair, mesh vs non-mesh open techniques, open vs laparoscopique techniques and types of laparoscopic hernia repair techniques. Conclusion: Open non-mesh repairs should be avoided. Lichtenstein mesh repair is the best open technique. Laparoscopic techniques (TAPP &TEP induce: less pain, shorter hospital stay, earlier return to work, more rapid resumption of activities and lower recurrence rates but at a higher cost, especially in “non-working” population.

  11. Effect of gene modified mesenchymal stem cells overexpression human receptor activity modified protein 1 on inflammation and cardiac repair in a rabbit model of myocardial infarction

    Institute of Scientific and Technical Information of China (English)

    赵然尊

    2012-01-01

    Objective To investigate the effect of mesenchymal stem cells(MSCs) overexpressing human receptor activity modified protein 1(hRAMP1) by adenovirus vector on infarction related inflammation and cardiac repair in a rabbit model of myocardial infarction(MI)

  12. Complementary Roles of Yeast Rad4p and Rad34p in Nucleotide Excision Repair of Active and Inactive rRNA Gene Chromatin▿

    OpenAIRE

    Tremblay, Maxime; Teng, Yumin; Paquette, Michel; Waters, Raymond; Conconi, Antonio

    2008-01-01

    Nucleotide excision repair (NER) removes a plethora of DNA lesions. It is performed by a large multisubunit protein complex that finds and repairs damaged DNA in different chromatin contexts and nuclear domains. The nucleolus is the most transcriptionally active domain, and in yeast, transcription-coupled NER occurs in RNA polymerase I-transcribed genes (rDNA). Here we have analyzed the roles of two members of the xeroderma pigmentosum group C family of proteins, Rad4p and Rad34p, during NER ...

  13. Ku protein complex is involved in nucleotide excision repair of DNA

    International Nuclear Information System (INIS)

    The repair of ultraviolet light (UV-C, 254 nm) DNA lesions by nucleotide excision repair (NER) has been studied in the rodent cell line xrs6 belonging to complementation group 5 of ionising radiation sensitive (IRs) mutants. xrs6 cell line shows e defect in he DNA-end binding protein complex Ku which is involved in the repair of double-strand breaks (DSB) due to IR. In agreement with IR sensitivity, a bleomycin sensitive phenotype of xrs6 cell line was found as compared to the parental CHO-Kl line (factor> 8 fold). xrs6 exhibited also a slight (factor 2) but reproducible sensitivity to UV-C-light, while a revertant cell line for Ku DNA-end binding activity, xrs6rev, showed a restoration of both IR and UV-C sensitivities to the parental level. The NER activity of these cell lines was measured in vitro in nuclear protein extracts in the presence of plasmid DNA repair substrate damaged with UV-C lesions repaired by NER: xrs6 cell extracts exhibited only 55 % of NER activity as compared to the control CHO-Kl and xrs6rev cell extracts. These indicate that the Ku DSB repair protein in involved also in the NER process. (authors). 31 refs., 1 fig., 1 tab

  14. Craniosynostosis repair

    Science.gov (United States)

    ... will be asleep and will not feel pain. Traditional surgery is called open repair. It includes these ... helps keep the swelling down. Talking, singing, playing music, and telling stories may help soothe your child. ...

  15. Activation of pozzolanic and latent-hydraulic reactions by Alkalis in order to repair concrete cracks

    OpenAIRE

    Gruyaert, Elke; Van Tittelboom, Kim; Rahier, Hubert; De Belie, Nele

    2015-01-01

    The low degree of hydration of fly ash (FA) and slag (BFS) particles in high-volume FA and BFS concrete offers the possibility to activate the unreacted particles upon crack formation to close the crack. In this paper, a preliminary study is performed to evaluate the use of alkaline activators to stimulate the formation of reaction products in the crack. First, the reaction rates of crushed pastes mixed with alkaline solutions or water were monitored by calorimetry. These tests showed that al...

  16. Activated astrocytes enhance the dopaminergic differentiation of stem cells and promote brain repair through bFGF.

    Science.gov (United States)

    Yang, Fan; Liu, Yunhui; Tu, Jie; Wan, Jun; Zhang, Jie; Wu, Bifeng; Chen, Shanping; Zhou, Jiawei; Mu, Yangling; Wang, Liping

    2014-12-17

    Astrocytes provide neuroprotective effects against degeneration of dopaminergic (DA) neurons and play a fundamental role in DA differentiation of neural stem cells. Here we show that light illumination of astrocytes expressing engineered channelrhodopsin variant (ChETA) can remarkably enhance the release of basic fibroblast growth factor (bFGF) and significantly promote the DA differentiation of human embryonic stem cells (hESCs) in vitro. Light activation of transplanted astrocytes in the substantia nigra (SN) also upregulates bFGF levels in vivo and promotes the regenerative effects of co-transplanted stem cells. Importantly, upregulation of bFGF levels, by specific light activation of endogenous astrocytes in the SN, enhances the DA differentiation of transplanted stem cells and promotes brain repair in a mouse model of Parkinson's disease (PD). Our study indicates that astrocyte-derived bFGF is required for regulation of DA differentiation of the stem cells and may provide a strategy targeting astrocytes for treatment of PD.

  17. Transcriptomic analysis of tail regeneration in the lizard Anolis carolinensis reveals activation of conserved vertebrate developmental and repair mechanisms.

    Directory of Open Access Journals (Sweden)

    Elizabeth D Hutchins

    Full Text Available Lizards, which are amniote vertebrates like humans, are able to lose and regenerate a functional tail. Understanding the molecular basis of this process would advance regenerative approaches in amniotes, including humans. We have carried out the first transcriptomic analysis of tail regeneration in a lizard, the green anole Anolis carolinensis, which revealed 326 differentially expressed genes activating multiple developmental and repair mechanisms. Specifically, genes involved in wound response, hormonal regulation, musculoskeletal development, and the Wnt and MAPK/FGF pathways were differentially expressed along the regenerating tail axis. Furthermore, we identified 2 microRNA precursor families, 22 unclassified non-coding RNAs, and 3 novel protein-coding genes significantly enriched in the regenerating tail. However, high levels of progenitor/stem cell markers were not observed in any region of the regenerating tail. Furthermore, we observed multiple tissue-type specific clusters of proliferating cells along the regenerating tail, not localized to the tail tip. These findings predict a different mechanism of regeneration in the lizard than the blastema model described in the salamander and the zebrafish, which are anamniote vertebrates. Thus, lizard tail regrowth involves the activation of conserved developmental and wound response pathways, which are potential targets for regenerative medical therapies.

  18. The Transcriptional Response to DNA-Double-Strand Breaks in Physcomitrella patens

    Science.gov (United States)

    Kamisugi, Yasuko; Whitaker, John W.

    2016-01-01

    The model bryophyte Physcomitrella patens is unique among plants in supporting the generation of mutant alleles by facile homologous recombination-mediated gene targeting (GT). Reasoning that targeted transgene integration occurs through the capture of transforming DNA by the homology-dependent pathway for DNA double-strand break (DNA-DSB) repair, we analysed the genome-wide transcriptomic response to bleomycin-induced DNA damage and generated mutants in candidate DNA repair genes. Massively parallel (Illumina) cDNA sequencing identified potential participants in gene targeting. Transcripts encoding DNA repair proteins active in multiple repair pathways were significantly up-regulated. These included Rad51, CtIP, DNA ligase 1, Replication protein A and ATR in homology-dependent repair, Xrcc4, DNA ligase 4, Ku70 and Ku80 in non-homologous end-joining and Rad1, Tebichi/polymerase theta, PARP in microhomology-mediated end-joining. Differentially regulated cell-cycle components included up-regulated Rad9 and Hus1 DNA-damage-related checkpoint proteins and down-regulated D-type cyclins and B-type CDKs, commensurate with the imposition of a checkpoint at G2 of the cell cycle characteristic of homology-dependent DNA-DSB repair. Candidate genes, including ATP-dependent chromatin remodelling helicases associated with repair and recombination, were knocked out and analysed for growth defects, hypersensitivity to DNA damage and reduced GT efficiency. Targeted knockout of PpCtIP, a cell-cycle activated mediator of homology-dependent DSB resection, resulted in bleomycin-hypersensitivity and greatly reduced GT efficiency. PMID:27537368

  19. Antioxidant potential of curcumin-related compounds studied by chemiluminescence kinetics, chain-breaking efficiencies, scavenging activity (ORAC and DFT calculations

    Directory of Open Access Journals (Sweden)

    Adriana K. Slavova-Kazakova

    2015-08-01

    Full Text Available This study compares the ability to scavenge different peroxyl radicals and to act as chain-breaking antioxidants of monomers related to curcumin (1: dehydrozingerone (2, zingerone (3, (2Z,5E-ethyl 2-hydroxy-6-(4-hydroxy-3-methoxyphenyl-4-oxohexa-2,5-dienoate (4, ferulic acid (5 and their corresponding C2-symmetric dimers 6–9. Four models were applied: model 1 – chemiluminescence (CL of a hydrocarbon substrate used for determination of the rate constants (kA of the reactions of the antioxidants with peroxyl radicals; model 2 – lipid autoxidation (lipidAO used for assessing the chain-breaking antioxidant efficiency and reactivity; model 3 – oxygen radical absorbance capacity (ORAC, which yields the activity against peroxyl radicals generated by an azoinitiator; model 4 – density functional theory (DFT calculations at UB3LYP/6-31+G(d,p level, applied to explain the structure–activity relationship. Dimers showed 2–2.5-fold higher values of kA than their monomers. Model 2 gives information about the effects of the side chains and revealed much higher antioxidant activity for monomers and dimers with α,β-unsaturated side chains. Curcumin and 6 in fact are dimers of the same monomer 2. We conclude that the type of linkage between the two “halves” by which the molecule is made up does not exert influence on the antioxidant efficiency and reactivity of these two dimers. The dimers and the monomers demonstrated higher activity than Trolox (10 in aqueous medium (model 3. A comparison of the studied compounds with DL-α-tocopherol (11, Trolox and curcumin is made. All dimers are characterized through lower bond dissociation enthalpies (BDEs than their monomers (model 4, which qualitatively supports the experimental results.

  20. Functional Improvement Following Diastasis Rectus Abdominus Repair in an Active Duty Navy Female.

    Science.gov (United States)

    Gallus, Katerina M; Golberg, Kathy F; Field, Robert

    2016-08-01

    Return to physical activity following childbirth can be a difficult process complicated by structural changes during pregnancy. A common problem is the development of a diastasis of the rectus abdominus (DRA), defined as a horizontal separation of the abdominus muscles at the linea alba. Recent data indicate that the greater the distance of separation of the muscle, the worse the functional ability. We describe a 24-year-old active duty U.S. Navy female G1P2 with a diagnosis of DRA. At 2 months postpartum, she was referred to physical therapy because of back pain and inability to meet baseline activities of daily living. After 4 months of physical therapy, she was unable to complete curl ups as required by U.S. Navy physical fitness standards. Abdominoplasty with imbrication of the abdominal wall diastasis was performed followed by additional physical therapy, after which she returned to baseline functioning. The restoration of functional ability postoperatively suggests there is a therapeutic indication for surgical correction of DRA. In high-functioning military patients with DRA who fail to return to baseline level of activity following a trial of physical therapy, surgical intervention should be considered to obtain the optimal functional ability. PMID:27483541

  1. Physical activity modulates nerve plasticity and stimulates repair after Achilles tendon rupture.

    Science.gov (United States)

    Bring, Daniel K-I; Kreicbergs, Andris; Renstrom, Per A F H; Ackermann, Paul W

    2007-02-01

    In a rat model of tendon rupture using semiquantitative methodology, healing was assessed according to the diameter of newly organized collagen and the occurrence of the sensory neuropeptides (SP, CGRP) in relation to different levels of physical activity. Normally, innervation of the Achilles tendon is confined to the paratenon. After rupture new nerve fibers grow into the tendon proper, but disappear after healing. In a first experiment to establish peak tissue and nerve regeneration after rupture, tendon tissues from freely moving rats were collected consecutively over 16 weeks. A peak increase in organized collagen and nerve ingrowth was observed between week 2 to 4 post rupture. Therefore, in a second experiment week 4 was chosen to assess the effect of physical activity on tendon healing in three groups of rats, that is, wheel running, plaster treated, and freely moving (controls). In the wheel-running group, the diameter of newly organized collagen was 94% ( p = 0.001) greater than that in the plaster-treated group and 48% ( p = 0.02) greater than that in the controls. Inversely, the neuronal occurrence of CGRP in the tendon proper was 57% ( p = 0.02) lower in the wheel-running group than that in the plaster-treated group and 53% ( p = 0.02) lower than that in the controls, suggesting an earlier neuronal in-growth and disappearance in the more active group. Physical activity speeds up tendon healing, which may prove to be linked to accelerated neuronal plasticity.

  2. Of Heart & Kidneys: Hands-On Activities for Demonstrating Organ Function & Repair

    Science.gov (United States)

    Kao, Robert M.

    2014-01-01

    A major challenge in teaching organ development and disease is deconstructing a complex choreography of molecular and cellular changes over time into a linear stepwise process for students. As an entry toward learning developmental concepts, I propose two inexpensive hands-on activities to help facilitate learning of (1) how to identify defects in…

  3. Can the provision of games equipment at school break time increase the physical activity levels of adolescents?

    OpenAIRE

    Carter, Alice; Evans, Adam

    2013-01-01

    The promotion of physical activity to young people is currently a public health priority due to growing concerns that this group is not sufficiently physically active. Adolescence in particular is characterised with a decline in physical activity levels (Verstraete, et al 2006, Journal of Public Health, 16: 415-419). There exists an increased concern that Physical Education lessons within the National School Curriculum do not assist with this downward trend in activity levels, thus the notion...

  4. Formation of radiation-induced DNA breaks: the ratio of double-strand breaks to single-strand breaks

    International Nuclear Information System (INIS)

    Ionizing radiation causes the formation of strand breaks in cellular DNA, as well as other types of lesions in the chromatin of cells. Some of the earliest investigations of the molecular basis of radiation-induced damage and the implications of enzymatic repair were done by Dr. H. S. Kaplan. Because it is difficult to assay for DNA lesions in the large mammalian genome, the authors have developed a method of assaying for DNA double-strand breaks in the supercoiled nucleosome-complexed Simian virus 40 (SV40) genome, irradiated intracellularly. In this communication they present their measurements of the DNA double-strand breaks (DSBs) to single-strand breaks (SSBs) ratio obtained from the intracellularly irradiated SV40 genome. After cobalt gamma ray and X ray irradiations, this ratio is about 1/10. Their methods and results are compared with pertinent data in the literature. If the DSBs/SSBs ratio of 1/10 for cellular chromatin is correct, a substantial number of DNA double-strand breaks are formed in a mammalian cell after moderate doses (1 Gy) of radiation. The implications of different types of DNA double-strand breaks are discussed

  5. Pectus excavatum repair

    Science.gov (United States)

    Funnel chest repair; Chest deformity repair; Sunken chest repair; Cobbler's chest repair; Nuss repair; Ravitch repair ... There are two types of surgery to repair this condition -- open surgery ... surgery is done while the child is in a deep sleep and pain- ...

  6. Identification and characterization of RNA-binding activity in the ORF1-encoded replicase protein of Pelargonium flower break virus.

    Science.gov (United States)

    Martínez-Turiño, Sandra; Hernández, Carmen

    2010-12-01

    Pelargonium flower break virus (PFBV) belongs to the genus Carmovirus (family Tombusviridae) and, as with the remaining members of the group, possesses a monopartite genome of single-stranded, positive-sense RNA that contains five ORFs. The two 5'-proximal ORFs (ORFs 1 and 2) encode two polypeptides of 27 and 86 kDa (p27 and p86), respectively, that show homology with replication proteins. The p27 does not present any motif to explain its presumed involvement in replication, while p86 has the motifs conserved in RNA-dependent RNA polymerases. In this work, we have confirmed the necessity of p27 and p86 for PFBV replication. To gain insights into the function(s) of p27, we have expressed and purified the protein from Escherichia coli and tested its ability to bind RNA in vitro. The results have shown that p27 is able to bind ssRNA with high affinity and in a cooperative fashion and that it is also capable of binding other types of nucleic acids, though to a lesser extent. Additionally, competition experiments suggest that p27 has a preference for PFBV-derived ssRNAs. Using truncated forms of p27, it can be concluded that several regions of the protein contribute to its RNA-binding properties and that this contribution is additive. This study is the first to show nucleic acid-binding ability of the ORF1 product of a carmovirus and the data obtained suggest that this product plays an essential role in selection and recruitment of viral RNA replication templates.

  7. DNA damage and repair in human cells exposed to sunlight

    International Nuclear Information System (INIS)

    Cultured human cells were treated with direct sunlight under conditions which minimised the hypertonic, hyperthermic and fixative effects of solar radiation. Sunlight produced similar levels of DNA strand breaks as equitoxic 254 nm UV in two fibroblast strains and a melanoma cell line, but DNA repair synthesis and inhibition of semiconservative DNA synthesis and of DNA chain elongation were significantly less for sunlight-exposed cells. DNA breaks induced by sunlight were removed more rapidly. Thus, the repair of solar damage differs considerably from 254 nm UV repair. Glass-filtered sunlight (>320 nm) was not toxic to cells and did not induce repair synthesis but gave a low level of short-lived DNA breaks and some inhibition of DNA chain elongation; thymidine uptake was enhanced. Filtered sunlight slightly enhanced UV-induced repair synthesis and UV toxicity; photoreactivation of UV damage was not found. Attempts to transform human fibroblasts using sunlight, with or without phorbol ester, were unsuccessful. (author)

  8. Poly(ADP-ribose) polymerase inhibitor ABT-888 potentiates the cytotoxic activity of temozolomide in leukemia cells: influence of mismatch repair status and O6-methylguanine-DNA methyltransferase activity

    OpenAIRE

    Horton, Terzah M.; Jenkins, Gaye; Pati, Debananda; Zhang, Linna; Dolan, M. Eileen; Ribes-Zamora, Albert; Bertuch, Alison A.; Blaney, Susan M.; Delaney, Shannon L.; Hegde, Madhuri; Berg, Stacey L.

    2009-01-01

    The poly(ADP-ribose) polymerase (PARP) inhibitor ABT-888 potentiates the antitumor activity of temozolomide (TMZ). TMZ resistance results from increased O6-methylguanine-DNA methyltransferase (MGMT) activity and from mismatch repair (MMR) system mutations. We evaluated the relative importance of MGMT activity, MMR deficiency, nonhomologous end joining (NHEJ), and PARP activity in ABT-888 potentiation of TMZ. MMR-proficient and MMR-deficient leukemia cells with varying MGMT activity, as well a...

  9. Improvement of in vitro physicochemical properties and osteogenic activity of calcium sulfate cement for bone repair by dicalcium silicate

    International Nuclear Information System (INIS)

    Highlights: • Dicalcium silicate can improve osteogenic activity of calcium sulfate cement. • The higher the calcium sulfate content, the shorter the setting time in the composite cement. • The results were useful for designing calcium-based cement with optimal properties. -- Abstract: An ideal bone graft substitute should have the same speed of degradation as formation of new bone tissue. To improve the properties of calcium sulfate hemihydrate (CSH) featured for its rapid resorption, a low degradation material of dicalcium silicate (DCS) was added to the CSH cement. This study examined the effect of DCS (20, 40, 60 and 80 wt%) on the in vitro physicochemical properties and osteogenic activities of the calcium-based composite cements. The diametral tensile strength, porosity and weight loss of the composite cements were evaluated before and after soaking in a simulated body fluid (SBF). The osteogenic activities, such as proliferation, differentiation and mineralization, of human mesenchymal stem cells (hMSCs) seeded on cement surfaces were also examined. As a result, the greater the DCS amount, the higher the setting time was in the cement. Before soaking in SBF, the diametral tensile strength of the composite cements was decreased due to the introduction of DCS. On 180-day soaking, the composite cements containing 20, 40, 60 and 80 wt% DCS lost 80%, 69%, 61% and 44% in strength, respectively. Regarding in vitro bioactivity, the DCS-rich cements were covered with clusters of apatite spherulites after soaking for 7 days, while there was no formation of apatite spherulites on the CSH-rich cement surfaces. The presence of DCS could reduce the degradation of the CSH cements, as evidenced in the results of weight loss and porosity. More importantly, DCS may promote effectively the cell proliferation, proliferation and mineralization. The combination of osteogenesis of DCS and degradation of CSH made the calcium-based composite cements an attractive choice for

  10. Ebselen attenuates oxidative DNA damage and enhances its repair activity in the thalamus after focal cortical infarction in hypertensive rats.

    Science.gov (United States)

    He, Meixia; Xing, Shihui; Yang, Bo; Zhao, Liqun; Hua, Haiying; Liang, Zhijian; Zhou, Wenliang; Zeng, Jinsheng; Pei, Zhong

    2007-11-21

    Oxidative DNA damage has been proposed to be a major contributor to focal cerebral ischemic injury. However, little is known about the role of oxidative DNA damage in remote damage secondary to the primary infarction. In the present study, we investigated oxidative damage within the ventroposterior nucleus (VPN) after distal middle cerebral artery occlusion (MCAO) in hypertensive rats. We also examined the possible protective effect of ebselen, one glutathione peroxidase mimic, on delayed degeneration in the VPN after distal MCAO. Neuronal damage in the ipsilateral VPN was examined by Nissl staining. Oxidative DNA damage and base repair enzyme activity were assessed by analyzing immunoreactivity of 8-hydroxy-2'-deoxyguanosine (8-ohdG) and 8-oxoguanine DNA glycosylase (OGG1), respectively. The number of intact neurons in the ipsilateral VPN decreased by 52% compared to the contralateral side in ischemia group 2 weeks after distal cerebral cortical infarction. The immunoreactivity of 8-ohdG significantly increased while OGG1 immunoreactivity significantly decreased in the ipsilateral VPN 2 weeks after distal cortical infarction (all pVPN (all pVPN region following distal MCAO. Furthermore, ebselen protects against the delayed damage in the VPN when given at 24 h following distal MCAO.

  11. Shiga Toxin 1, as DNA Repair Inhibitor, Synergistically Potentiates the Activity of the Anticancer Drug, Mafosfamide, on Raji Cells

    Directory of Open Access Journals (Sweden)

    Piero Sestili

    2013-02-01

    Full Text Available Shiga toxin 1 (Stx1, produced by pathogenic Escherichia coli, targets a restricted subset of human cells, which possess the receptor globotriaosylceramide (Gb3Cer/CD77, causing hemolytic uremic syndrome. In spite of the high toxicity, Stx1 has been proposed in the treatment of Gb3Cer/CD77-expressing lymphoma. Here, we demonstrate in a Burkitt lymphoma cell model expressing this receptor, namely Raji cells, that Stx1, at quasi-non-toxic concentrations (0.05–0.1 pM, inhibits the repair of mafosfamide-induced DNA alkylating lesions, synergistically potentiating the cytotoxic activity of the anticancer drug. Conversely, human promyelocytic leukemia cells HL-60, which do not express Gb3Cer/CD77, were spared by the toxin as previously demonstrated for CD34+ human progenitor cells, and hence, in this cancer model, no additive nor synergistic effects were observed with the combined Stx1/mafosfamide treatment. Our findings suggest that Stx1 could be used to improve the mafosfamide-mediated purging of Gb3Cer/CD77+ tumor cells before autologous bone marrow transplantation.

  12. Carbinolamine formation and dehydration in a DNA repair enzyme active site.

    Directory of Open Access Journals (Sweden)

    M L Dodson

    Full Text Available In order to suggest detailed mechanistic hypotheses for the formation and dehydration of a key carbinolamine intermediate in the T4 pyrimidine dimer glycosylase (T4PDG reaction, we have investigated these reactions using steered molecular dynamics with a coupled quantum mechanics-molecular mechanics potential (QM/MM. We carried out simulations of DNA abasic site carbinolamine formation with and without a water molecule restrained to remain within the active site quantum region. We recovered potentials of mean force (PMF from thirty replicate reaction trajectories using Jarzynski averaging. We demonstrated feasible pathways involving water, as well as those independent of water participation. The water-independent enzyme-catalyzed reaction had a bias-corrected Jarzynski-average barrier height of approximately (6.5 kcal mol(-1 (27.2 kJ mol(-1 for the carbinolamine formation reaction and 44.5 kcal mol(-1 (186 kJ mol(-1 for the reverse reaction at this level of representation. When the proton transfer was facilitated with an intrinsic quantum water, the barrier height was approximately 15 kcal mol(-1 (62.8 kJ mol(-1 in the forward (formation reaction and 19 kcal mol(-1 (79.5 kJ mol(-1 for the reverse. In addition, two modes of unsteered (free dynamics carbinolamine dehydration were observed: in one, the quantum water participated as an intermediate proton transfer species, and in the other, the active site protonated glutamate hydrogen was directly transferred to the carbinolamine oxygen. Water-independent unforced proton transfer from the protonated active site glutamate carboxyl to the unprotonated N-terminal amine was also observed. In summary, complex proton transfer events, some involving water intermediates, were studied in QM/MM simulations of T4PDG bound to a DNA abasic site. Imine carbinolamine formation was characterized using steered QM/MM molecular dynamics. Dehydration of the carbinolamine intermediate to form the final imine product

  13. Yeast Rad5 Protein Required for Postreplication Repair Has a DNA Helicase Activity Specific for Replication Fork Regression

    OpenAIRE

    Blastyák, András; Pintér, Lajos; Unk, Ildiko; Prakash, Louise; Prakash, Satya; Haracska, Lajos

    2007-01-01

    Summary Lesions in the template DNA strand block the progression of the replication fork. In the yeast Saccharomyces cerevisiae, replication through DNA lesions is mediated by different Rad6-Rad18-dependent means, which include translesion synthesis and a Rad5-dependent postreplicational repair pathway that repairs the discontinuities that form in the DNA synthesized from damaged templates. Although translesion synthesis is well characterized, little is known about the mechanisms that modulat...

  14. Femoral hernia repair

    Science.gov (United States)

    Femorocele repair; Herniorrhaphy; Hernioplasty - femoral ... During surgery to repair the hernia, the bulging tissue is pushed back in. The weakened area is sewn closed or strengthened. This repair ...

  15. Undescended testicle repair

    Science.gov (United States)

    Orchidopexy; Inguinal orchidopexy; Orchiopexy; Repair of undescended testicle; Cryptorchidism repair ... first year of life without treatment. Undescended testicle repair surgery is recommended for patients whose testicles do ...

  16. A Stylistic Analysis of Break,Break,Break

    Institute of Scientific and Technical Information of China (English)

    李瑶

    2015-01-01

    Break, Break, Break is a poem by Alfred Lord Tennyson, the Poet Laureate during the Queen Victoria's reign. This exquisite little poem is wel known for the poet's grief-stricken feelings and heart-broken emotions over the premature death of his best friend, Arthur Henry Halam. Most of the previous studies on this poem focus on the emotional level to consider it as an elegy, expressing sorrow and lamentation for the death of a particular person. However, in order to have a deep understanding in general, this paper analyzes the poem based on the stylistic theory, concerning on the lexical level and the semantic level. It aims at helping the readers to cultivate a sense of appropriateness, to sharpen the understanding and appreciation of literary works and to achieve adaptation in translation.

  17. Operational maneuvers and pipelines activities repairs for the 32 inches scraper tool recovering

    Energy Technology Data Exchange (ETDEWEB)

    Valdivia, Jose; Salguero, Luis; Villanueva, Pedro [Compania Operadora del Gas Amazonas, Lima (Peru)

    2009-07-01

    Transportadora de Gas del Peru and the Compania Operadora de Gas del Amazonas, responsible companies of the transport, operation and maintenance of the pipelines who transport natural gas and natural gas liquids respectively of the Camisea Project - Peru, following the internal policies and the maintenance plan of the pipeline transportation system was planned the activities for the internal pipeline inspection of these activities for 729.3 Km of natural gas pipeline covering diameters of 32 inches, 24 inches and 18 inches. After the first run of the cleaning tool, was scheduled the launch of the dummy scraper (scraper tool) along to the first 210 Km of the 32 inches natural gas pipeline , given changes in elevation along the trace and the low flow of transport. This scraper tool could not reach the final destination. After many series operational maneuvers as venting, creation of differential pressure in valves, the scraper tool only reach the first 75 Km of the trace. After an exhaustive analysis of trending pressure variations, it was concluded that this scraper showed intermittent progress of short durations, concluding that this scraper had not reach the next check point. In this way was decided to conduct operational maneuvers in order to locate, relocated and retrieve the scrapper tool from de 32 inches natural gas pipeline. (author)

  18. Mismatch-mediated error prone repair at the immunoglobulin genes.

    Science.gov (United States)

    Chahwan, Richard; Edelmann, Winfried; Scharff, Matthew D; Roa, Sergio

    2011-12-01

    The generation of effective antibodies depends upon somatic hypermutation (SHM) and class-switch recombination (CSR) of antibody genes by activation induced cytidine deaminase (AID) and the subsequent recruitment of error prone base excision and mismatch repair. While AID initiates and is required for SHM, more than half of the base changes that accumulate in V regions are not due to the direct deamination of dC to dU by AID, but rather arise through the recruitment of the mismatch repair complex (MMR) to the U:G mismatch created by AID and the subsequent perversion of mismatch repair from a high fidelity process to one that is very error prone. In addition, the generation of double-strand breaks (DSBs) is essential during CSR, and the resolution of AID-generated mismatches by MMR to promote such DSBs is critical for the efficiency of the process. While a great deal has been learned about how AID and MMR cause hypermutations and DSBs, it is still unclear how the error prone aspect of these processes is largely restricted to antibody genes. The use of knockout models and mice expressing mismatch repair proteins with separation-of-function point mutations have been decisive in gaining a better understanding of the roles of each of the major MMR proteins and providing further insight into how mutation and repair are coordinated. Here, we review the cascade of MMR factors and repair signals that are diverted from their canonical error free role and hijacked by B cells to promote genetic diversification of the Ig locus. This error prone process involves AID as the inducer of enzymatically-mediated DNA mismatches, and a plethora of downstream MMR factors acting as sensors, adaptors and effectors of a complex and tightly regulated process from much of which is not yet well understood.

  19. Reliability measures of a computer system with priority to PM over the H/W repair activities subject to MOT and MRT

    Directory of Open Access Journals (Sweden)

    Ashish Kumar

    2015-01-01

    Full Text Available This paper concentrates on the evaluation of reliability measures of a computer system of two-identical units having independent failure of h/w and s/w components. Initially one unit is operative and the other is kept as spare in cold standby. There is a single server visiting the system immediately whenever needed. The server conducts preventive maintenance of the unit after a maximum operation time. If server is unable to repair the h/w components in maximum repair time, then components in the unit are replaced immediately by new one. However, only replacement of the s/w components has been made at their failure. The priority is given to the preventive maintenance over repair activities of the h/w. The time to failure of the components follows negative exponential distribution whereas the distribution of preventive maintenance, repair and replacement time are taken as arbitrary. The expressions for some important reliability measures of system effectiveness have been derived using semi-Markov process and regenerative point technique. The graphical behavior of the results has also been shown for a particular case.

  20. Polymorphisms in XRCC5, XRCC6, XRCC7 genes are involved in DNA double-strand breaks(DSBs) repair associated with the risk of acute myeloid leukemia(AML) in Chinese population

    Institute of Scientific and Technical Information of China (English)

    Guoqiang Wang; Shuyu Wang; Qun Shen; Shiwei Yin; Chunping Li; Aiping Li; Jianyong Li; Jianwei Zhou; Qizhan Liu

    2009-01-01

    Objective:To investigate the association between the X-ray repair cross complementing(XRCC) group 5, XRCC6 and XRCC7 polymorphisms and risk of acute myeloid leukemia(AML). Methods:This hospital-based case-control study included 120 AML patients and 210 cancer-free controls in a Chinese population. Three polymorphisms of XRCCS, XRCC6 and XRCC7 were genotyped using the polymerase chain reaction(PCR) or polymerase chain reaction-restriction fragment length polymorphism(PCR-RFLP) method. Results: We found that there was a significant decrease in risk of AML associated with the XRCC6-61 CG/GG genotype(adjusted odd ratio (OR)=0.55;95% confident interval(CI)=0.34-0.89) compared with the-61CC genotype. For the novel tandem repeat polymorphism (VNTR) in the XRCC5 promoter, we found when the XRCC5 six genotypes were dichotomized(i.e., 2R/2R, 2R/1R versus 2R/0R, 1R/1R, 1R/0R and 0R/0R), the latter group was associated with increased risk of AML(adjusted OR=1.67;95% CI=1.00-2.79) compared to 2R/ 2R+2R/1R genotype. However, the XRCC7 6721G>T polymorphism had no effect on risk of AML. Conclusion:The XRCC6-61C > G and XRCC5 2R/1R/0R polymorphisms, but not XRCC7 6721G > T polymorphism, could play an important role in the development of AML. Larger scale studies with more detailed data on environment exposure are needed to verify these findings.

  1. Code breaking in the pacific

    CERN Document Server

    Donovan, Peter

    2014-01-01

    Covers the historical context and the evolution of the technically complex Allied Signals Intelligence (Sigint) activity against Japan from 1920 to 1945 Describes, explains and analyzes the code breaking techniques developed during the war in the Pacific Exposes the blunders (in code construction and use) made by the Japanese Navy that led to significant US Naval victories

  2. The DNA repair complex DNA-PK, a pharmacological target in cancer chemotherapy and radiotherapy

    International Nuclear Information System (INIS)

    A line of investigation in the search for sensitizing tumor cells to chemotherapy or radiotherapy relies on the selection of DNA repair inhibitors. In the area of DNA repair mechanisms, DNA-dependent protein kinase (DNA-PK) represents a key complex. Indeed DNA-PK is involved in the non-homologous end joining (NHEJ) process that corresponds to the major activity responsible for cell survival after ionizing radiation or chemotherapeutic treatment producing DNA double strand breaks. DNA-PK belongs to the PI3-K related kinase family and specific inhibitors have been recently selected and evaluated as radio- and chemo-sensitizers. These drugs, along with other ways to inhibit the DSBs repair process, are presented and discussed. (authors)

  3. Positioning Effects of KillerRed inside of Cells correlate with DNA Strand Breaks after Activation with Visible Light

    OpenAIRE

    Waldeck, Waldemar; Mueller, Gabriele; Wiessler, Manfred; Tóth, Katalin; Braun, Klaus

    2011-01-01

    Fluorescent proteins (FPs) are established tools for new applications, not-restricted to the cell biological research. They could also be ideal in surgery enhancing the precision to differentiate between the target tissue and the surrounding healthy tissue. FPs like the KillerRed (KRED), used here, can be activated by excitation with visible day-light for emitting active electrons which produce reactive oxygen species (ROS) resulting in photokilling processes. It is a given that the extent of...

  4. Protein kinase CK2 localizes to sites of DNA double-strand break regulating the cellular response to DNA damage

    Directory of Open Access Journals (Sweden)

    Olsen Birgitte B

    2012-03-01

    Full Text Available Abstract Background The DNA-dependent protein kinase (DNA-PK is a nuclear complex composed of a large catalytic subunit (DNA-PKcs and a heterodimeric DNA-targeting subunit Ku. DNA-PK is a major component of the non-homologous end-joining (NHEJ repair mechanism, which is activated in the presence of DNA double-strand breaks induced by ionizing radiation, reactive oxygen species and radiomimetic drugs. We have recently reported that down-regulation of protein kinase CK2 by siRNA interference results in enhanced cell death specifically in DNA-PKcs-proficient human glioblastoma cells, and this event is accompanied by decreased autophosphorylation of DNA-PKcs at S2056 and delayed repair of DNA double-strand breaks. Results In the present study, we show that CK2 co-localizes with phosphorylated histone H2AX to sites of DNA damage and while CK2 gene knockdown is associated with delayed DNA damage repair, its overexpression accelerates this process. We report for the first time evidence that lack of CK2 destabilizes the interaction of DNA-PKcs with DNA and with Ku80 at sites of genetic lesions. Furthermore, we show that CK2 regulates the phosphorylation levels of DNA-PKcs only in response to direct induction of DNA double-strand breaks. Conclusions Taken together, these results strongly indicate that CK2 plays a prominent role in NHEJ by facilitating and/or stabilizing the binding of DNA-PKcs and, possibly other repair proteins, to the DNA ends contributing to efficient DNA damage repair in mammalian cells.

  5. Intestinal obstruction repair

    Science.gov (United States)

    Repair of volvulus; Intestinal volvulus - repair; Bowel obstruction - repair ... Intestinal obstruction repair is done while you are under general anesthesia . This means you are asleep and DO NOT feel pain. ...

  6. Aortic aneurysm repair - endovascular

    Science.gov (United States)

    EVAR; Endovascular aneurysm repair - aorta; AAA repair - endovascular; Repair - aortic aneurysm - endovascular ... Endovascular aortic repair is done because your aneurysm is very large, growing quickly, or is leaking or bleeding. You may have ...

  7. Motorcycle Repair.

    Science.gov (United States)

    Hein, Jim; Bundy, Mike

    This motorcycle repair curriculum guide contains the following ten areas of study: brake systems, clutches, constant mesh transmissions, final drives, suspension, mechanical starting mechanisms, electrical systems, fuel systems, lubrication systems, and overhead camshafts. Each area consists of one or more units of instruction. Each instructional…

  8. Hydrocele repair

    Science.gov (United States)

    ... small surgical cut in the fold of the groin, and then drains the fluid. The sac (hydrocele) holding the fluid may be removed. The surgeon strengthens the muscle wall with stitches. This is called a hernia repair. Sometimes the surgeon uses a laparoscope to do ...

  9. On breaks of the Indian monsoon

    Indian Academy of Sciences (India)

    Sulochana Gadgil; P V Joseph

    2003-12-01

    For over a century, the term break has been used for spells in which the rainfall over the Indian monsoon zone is interrupted. The phenomenon of `break monsoon' is of great interest because long intense breaks are often associated with poor monsoon seasons. Such breaks have distinct circulation characteristics (heat trough type circulation) and have a large impact on rainfed agriculture.Although interruption of the monsoon rainfall is considered to be the most important feature of the break monsoon, traditionally breaks have been identified on the basis of the surface pressure and wind patterns over the Indian region. We have defined breaks (and active spells) on the basis of rainfall over the monsoon zone. The rainfall criteria are chosen so as to ensure a large overlap with the traditional breaks documented by Ramamurthy (1969) and De et al (1998). We have identified these rainbreaks for 1901-89. We have also identified active spells on the basis of rainfall over the Indian monsoon zone. We have shown that the all-India summer monsoon rainfall is significantly negatively correlated with the number of rainbreak days (correlation coefficient −0.56) and significantly positively correlated with the number of active days (correlation coefficient 0.47).Thus the interannual variation of the all-India summer monsoon rainfall is shown to be related to the number of days of rainbreaks and active spells identified here. There have been several studies of breaks (and also active spells in several cases) identified on the basis of different criteria over regions differing in spatial scales (e.g., Webster et al 1998; Krishnan et al 2000; Goswami and Mohan 2000; and Annamalai and Slingo 2001). We find that there is considerable overlap between the rainbreaks we have identified and breaks based on the traditional definition. There is some overlap with the breaks identified by Krishnan et al (2000) but little overlap with breaks identified by Webster et al (1998). Further

  10. Poly(ADP-ribose polymerase (PARP-1 is not involved in DNA double-strand break recovery

    Directory of Open Access Journals (Sweden)

    Fernet Marie

    2003-07-01

    Full Text Available Abstract Background The cytotoxicity and the rejoining of DNA double-strand breaks induced by γ-rays, H2O2 and neocarzinostatin, were investigated in normal and PARP-1 knockout mouse 3T3 fibroblasts to determine the role of poly(ADP-ribose polymerase (PARP-1 in DNA double-strand break repair. Results PARP-1-/- were considerably more sensitive than PARP-1+/+ 3T3s to induced cell kill by γ-rays and H2O2. However, the two cell lines did not show any significant difference in the susceptibility to neocarzinostatin below 1.5 nM drug. Restoration of PARP-1 expression in PARP-1-/- 3T3s by retroviral transfection of the full PARP-1 cDNA did not induce any change in neocarzinostatin response. Moreover the incidence and the rejoining kinetics of neocarzinostatin-induced DNA double-strand breaks were identical in PARP-1+/+ and PARP-1-/- 3T3s. Poly(ADP-ribose synthesis following γ-rays and H2O2 was observed in PARP-1-proficient cells only. In contrast neocarzinostatin, even at supra-lethal concentration, was unable to initiate PARP-1 activation yet it induced H2AX histone phosphorylation in both PARP1+/+ and PARP-1-/- 3T3s as efficiently as γ-rays and H2O2. Conclusions The results show that PARP-1 is not a major determinant of DNA double-strand break recovery with either strand break rejoining or cell survival as an endpoint. Even though both PARP-1 and ATM activation are major determinants of the cell response to γ-rays and H2O2, data suggest that PARP-1-dependent poly(ADP-ribose synthesis and ATM-dependent H2AX phosphorylation, are not inter-related in the repair pathway of neocarzinostatin-induced DNA double-strand breaks.

  11. Turbine repair process, repaired coating, and repaired turbine component

    Energy Technology Data Exchange (ETDEWEB)

    Das, Rupak; Delvaux, John McConnell; Garcia-Crespo, Andres Jose

    2015-11-03

    A turbine repair process, a repaired coating, and a repaired turbine component are disclosed. The turbine repair process includes providing a turbine component having a higher-pressure region and a lower-pressure region, introducing particles into the higher-pressure region, and at least partially repairing an opening between the higher-pressure region and the lower-pressure region with at least one of the particles to form a repaired turbine component. The repaired coating includes a silicon material, a ceramic matrix composite material, and a repaired region having the silicon material deposited on and surrounded by the ceramic matrix composite material. The repaired turbine component a ceramic matrix composite layer and a repaired region having silicon material deposited on and surrounded by the ceramic matrix composite material.

  12. Direct Imaging by Cryo-TEM Shows Membrane Break-up by Phospholipase A2 Enzymatic Activity

    DEFF Research Database (Denmark)

    Callisen, Thomas Hønger; Talmon, Y.

    1998-01-01

    Phospholipid hydrolysis to free fatty acid and l-lyso-phospholipid by water-soluble phospholipase A(2) (PLA(2)) at the surface of lipid membranes exhibits a poorly understood transition from a low-activity lag phase to a burst regime of rapid hydrolysis. Understanding this kinetic phenomenon may ...

  13. The Effects of Preferred Activities during Academic Work Breaks on Task Engagement and Negatively Reinforced Destructive Behavior.

    Science.gov (United States)

    McComas, Jennifer J.; Goddard, Carol; Hoch, Hannah

    2002-01-01

    Destructive behavior of 9-year-old with learning disabilities was evaluated in a functional analysis. The effects of extinction, negative reinforcement, and negative reinforcement combined with access to preferred activities were compared on behavior and task engagement. Engagement occurred most and destructive behavior occurred least when…

  14. FISH comets show that the salvage enzyme TK1 contributes to gene-specific DNA repair

    Science.gov (United States)

    McAllister, Katherine A.; Yasseen, Akeel A.; McKerr, George; Downes, C. S.; McKelvey-Martin, Valerie J.

    2014-01-01

    Thymidine kinase 1 (TK1) is a salvage enzyme that phosphorylates thymidine, imported from surrounding fluids, to create dTMP, which is further phosphorylated to the DNA precursor dTTP. TK1 deficiency has for a long time been known to cause increased cellular sensitivity to DNA damage. We have examined preferential strand break repair of DNA domains in TK1+ and TK1- clones of the Raji cell line, by the Comet-FISH technique, in bulk DNA and in the actively transcribed tumor suppressor (TP53) and human telomerase reverse transcriptase (hTERT) gene regions, over 1 h after 5Gy γ-irradiation. Results showed that repair of the TP53 and hTERT gene regions was more efficient in TK1+ compared to TK1- cells, a trend also reflected to a lesser degree in genomic DNA repair between the cell-lines. The targeted gene-specific repair in TK+ cells occurred rapidly, mainly over the first 15 min repair-period. Therefore, TK1 is needed for preferential repair of actively transcribed regions, through a previously unsuspected mechanism. In principle, TK1 could exert its protective effects through supply of a supplementary dTTP pool for accurate repair of damaged genes; but Raji TK1+ cells in thymidine free media still show preferential repair of transcribed regions. TK1 therefore does not exert its protective effects through dTTP pools, but through another unidentified mechanism, which affects sensitivity to and mutagenicity by DNA damaging agents. PMID:25152750

  15. Breaking-off tissue specific activity of the oil palm metallothionein-like gene promoter in T(1) seedlings of tomato exposed to metal ions.

    Science.gov (United States)

    Kamaladini, Hossein; Nor Akmar Abdullah, Siti; Aziz, Maheran Abdul; Ismail, Ismanizan Bin; Haddadi, Fatemeh

    2013-02-15

    Metallothioneins (MTs) are cysteine-rich metal-binding proteins that are involved in cell growth regulation, transportation of metal ions and detoxification of heavy metals. A mesocarp-specific metallothionein-like gene (MT3-A) promoter was isolated from the oil palm (Elaeis guineensis Jacq). A vector construct containing the MT3-A promoter fused to the β-glucuronidase (GUS) gene in the pCAMBIA 1304 vector was produced and used in Agrobacterium-mediated transformation of tomato. Histochemical GUS assay of different tissues of transgenic tomato showed that the MT3-A promoter only drove GUS expression in the reproductive tissues and organs, including the anther, fruit and seed coat. Competitive RT-PCR and GUS fluorometric assay showed changes in the level of GUS mRNA and enzyme activity in the transgenic tomato (T(0)). No GUS mRNA was found in roots and leaves of transgenic tomato. In contrast, the leaves of transgenic tomato seedlings (T(1)) produced the highest GUS activity when treated with 150 μM Cu(2+) compared to the control (without Cu(2+)). However, Zn(2+) and Fe(2+) treatments did not show GUS expression in the leaves of the transgenic tomato seedlings. Interestingly, the results showed a breaking-off tissue-specific activity of the oil palm MT3-A promoter in T(1) seedlings of tomato when subjected to Cu(2+) ions. PMID:23290536

  16. Actomyosin pulsation and symmetry breaking flows in a confined active elastomer subject to affine and nonaffine deformations

    CERN Document Server

    Banerjee, Deb Sankar; Lecuit, Thomas; Rao, Madan

    2016-01-01

    Tissue remodelling in diverse developmental contexts require cell shape changes that have been associated with pulsation and flow of the actomyosin cytoskeleton. Here we describe the dynamics of the actomyosin cytoskeleton as a confined active elastomer embedded in the cytosol and subject to turnover of its components. Under affine deformations (homogeneous deformation over a spatially coarse-grained scale), the active elastomer exhibits spontaneous oscillations, propagating waves, contractile collapse and spatiotemporal chaos. The collective nonlinear dynamics shows nucleation, growth and coalescence of actomyosin-dense regions which, beyond a threshold, spontaneously move as a spatially localized traveling front towards one of the boundaries. However, large myosin-induced contractile stresses, can lead to nonaffine deformations due to actin turnover. This results in a transient actin network, that naturally accommodates intranetwork flows of the actomyosin dense regions as a consequence of filament unbindin...

  17. Inspection and Repair Techniques and Strategies for Alloy 600 PWSCC in Reactor Vessel Head CRD Nozzles and Welds

    International Nuclear Information System (INIS)

    As a result of the Alloy 600 PWSCC CRD nozzle leaks discovered in the fall of 2000 and spring of 2001 in several US plants, the NRC has recommended a more pro-active effort by U.S. utilities to inspect similarly susceptible nozzles in all US plants. The primary safety concern is circumferential cracks that can permit the nozzle to separate from the head at high velocity and produce a large-break leak in the reactor vessel. A secondary concern is head leakage from any through-wall cracks in the nozzle or J-groove weld area. Although the fundamental weld and seal design are similar for all US PWR plants, the various surrounding geometry and repair probability considerations require multiple inspection and repair alternatives. Geometry issues include the head insulation design that influences the ability to perform visual examinations from above the head, and the presence or absence of thermal sleeves and funnels governing the type of NDE probes than can be used. Repair probability considerations primarily include the likelihood for repair of a small or large number of nozzles and the length of time the repair must last before a head replacement. This paper discusses the various inspection and repair alternatives offered by one service vendor and discusses a decision process for planning the inspection and repair effort. (authors)

  18. An interaction between the Tfb1 and Ssl1 subunits of yeast TFIIH correlates with DNA repair activity.

    OpenAIRE

    Matsui, P; DePaulo, J; Buratowski, S

    1995-01-01

    Yeast transcription factor TFIIH (also known as factor b) is a component of the RNA polymerase II initiation complex. Several TFIIH subunits (RAD3, SSL2 and SSL1) have also been implicated in DNA repair. Ssl1 interacts directly with another TFIIH subunit, Tfb1, which has not previously been shown to have a role in DNA repair. We isolated mutations in TFB1 that lead to a temperature sensitive phenotype. These mutations result in C-terminal truncations of the Tfb1 protein and disrupt its intera...

  19. Activating Endogenous Neural Precursor Cells Using Metformin Leads to Neural Repair and Functional Recovery in a Model of Childhood Brain Injury

    Directory of Open Access Journals (Sweden)

    Parvati Dadwal

    2015-08-01

    Full Text Available The development of cell replacement strategies to repair the injured brain has gained considerable attention, with a particular interest in mobilizing endogenous neural stem and progenitor cells (known as neural precursor cells [NPCs] to promote brain repair. Recent work demonstrated metformin, a drug used to manage type II diabetes, promotes neurogenesis. We sought to determine its role in neural repair following brain injury. We find that metformin administration activates endogenous NPCs, expanding the size of the NPC pool and promoting NPC migration and differentiation in the injured neonatal brain in a hypoxia-ischemia (H/I injury model. Importantly, metformin treatment following H/I restores sensory-motor function. Lineage tracking reveals that metformin treatment following H/I causes an increase in the absolute number of subependyma-derived NPCs relative to untreated H/I controls in areas associated with sensory-motor function. Hence, activation of endogenous NPCs is a promising target for therapeutic intervention in childhood brain injury models.

  20. [Photoreactivating Activity of Bioluminescence: Repair of UV-damaged DNA of Escherichia coli Occurs with Assistance of lux-Genes of Marine Bacteria].

    Science.gov (United States)

    Zavilgelsky, G B; Melkina, O E; Kotova, V Yu; Konopleva, M N; Manukhov, I V; Pustovoit, K Ss

    2015-01-01

    The UV resistance of luminescent bacteria Escherichia coli AB1886 uvrA6 (pLeo1) containing the plasmid with luxCDABE genes of marine bacteria Photobacterium leiognathi is approximately two times higher than the UV resistance of non-luminous bacteria E. coli AB1886 uvrA6. Introduction of phr::kan(r) mutations (a defect in the functional activity of photolyase) into the genome of E. coli AB1886 uvrA6 (pLeo1) completely removes the high UV resistance of the cells. Therefore, photoreactivation that involves bacterial photolyase contributes mainly to the bioluminescence-induced DNA repair. It is shown that photoreactivating activity of bioluminescence of P. leiognathi is about 2.5 times lower compared with that one induced by a light source with λ > 385 nm. It is also shown that an increase in the bioluminescence intensity, induced by UV radiation in E. coli bacterial cells with a plasmid containing the luxCD ABE genes under RecA-LexA-regulated promoters, occurs only 25-30 min later after UV irradiation of cells and does not contribute to DNA repair. A quorum sensing regulatory system is not involved in the DNA repair by photolyase.

  1. Causes and consequences of plant radio-resistance. Formation of DNA basis lesions and self-repairing activity of one of them, the 8-oxo-7,8-dihydro-guanine in Arabidopsis thaliana

    International Nuclear Information System (INIS)

    In this research thesis, the author first explains how and why DNA is injured when it is submitted to an oxidizing stress, and describes precisely the formation and the biological consequences of lesions of DNA bases, the 8-oxo-7,8-dihydro-guanine (8-oxoGua). She describes the repairing activities of the oxidized DNA, and more particularly the repairing of 8-oxoGua, in prokaryotes as well as in yeast, mammals and plants. Methodologies used are described, together with the repair activities of the 8-oxo-7,8-dihydro-guanine following a biochemical type approach and a molecular biology approach

  2. Breaking Out of Surveillance Silos: Integrative Geospatial Data Collection for Child Injury Risk and Active School Transport.

    Science.gov (United States)

    Schuch, Laura; Curtis, Jacqueline W; Curtis, Andrew; Hudson, Courtney; Wuensch, Heather; Sampsell, Malinda; Wiles, Erika; Infantino, Mary; Davis, Andrew J

    2016-02-01

    The preponderance of active school transport (AST) and child injury research has occurred independently, yet they are inherently related. This is particularly true in urban areas where the environmental context of AST may pose risks to safety. However, it can be difficult to make these connections due to the often segregated nature in which these veins of research operate. Spatial video presents a geospatial approach for simultaneous data collection related to both issues. This article reports on a multi-sector pilot project among researchers, a children's hospital, and a police department, using spatial video to map child AST behaviors; a geographic information system (GIS) is used to analyze these data in the environmental context of child pedestrian injury and community violence.

  3. Conserved structural chemistry for incision activity in structurally non-homologous apurinic/apyrimidinic endonuclease APE1 and endonuclease IV DNA repair enzymes.

    Energy Technology Data Exchange (ETDEWEB)

    Tsutakawa, Susan E.; Shin, David S.; Mol, Clifford D.; Izum, Tadahide; Arvai, Andrew S.; Mantha, Anil K.; Szczesny, Bartosz; Ivanov, Ivaylo N.; Hosfield, David J.; Maiti, Buddhadev; Pique, Mike E.; Frankel, Kenneth A.; Hitomi, Kenichi; Cunningham, Richard P.; Mitra, Sankar; Tainer, John A.

    2013-03-22

    Non-coding apurinic/apyrimidinic (AP) sites in DNA form spontaneously and as DNA base excision repair intermediates are the most common toxic and mutagenic in vivo DNA lesion. For repair, AP sites must be processed by 5' AP endonucleases in initial stages of base repair. Human APE1 and bacterial Nfo represent the two conserved 5' AP endonuclease families in the biosphere; they both recognize AP sites and incise the phosphodiester backbone 5' to the lesion, yet they lack similar structures and metal ion requirements. Here, we determined and analyzed crystal structures of a 2.4 ? resolution APE1-DNA product complex with Mg(2+) and a 0.92 Nfo with three metal ions. Structural and biochemical comparisons of these two evolutionarily distinct enzymes characterize key APE1 catalytic residues that are potentially functionally similar to Nfo active site components, as further tested and supported by computational analyses. We observe a magnesium-water cluster in the APE1 active site, with only Glu-96 forming the direct protein coordination to the Mg(2+). Despite differences in structure and metal requirements of APE1 and Nfo, comparison of their active site structures surprisingly reveals strong geometric conservation of the catalytic reaction, with APE1 catalytic side chains positioned analogously to Nfo metal positions, suggesting surprising functional equivalence between Nfo metal ions and APE1 residues. The finding that APE1 residues are positioned to substitute for Nfo metal ions is supported by the impact of mutations on activity. Collectively, the results illuminate the activities of residues, metal ions, and active site features for abasic site endonucleases.

  4. Procedures for maintenance and repairs

    International Nuclear Information System (INIS)

    After a general review of the operation experience in the history of more than 12 operating years, the organization in the plant will be shown with special aspect to quality assurance, capacity of the workshops and connected groups as radiation protection, chemical laboratories etc. The number, time intervals and manpower effort for the repeating tests will be discussed. Reasons and examples for back-fitting activities in the plant are given. Besides special repair and maintenance procedures as repair of the steam generators, in-service inspection of the reactor pressure vessel, repair of a feed-water pipe and repair of the core structure in the pressure vessel, the general system to handle maintenance and repair-work in the KWO-plant will be shown. This includes also the detailed planning of the annual refueling and revision of the plant. (orig./RW)

  5. Symmetry-breaking magnetic fields create a vortex fluid that exhibits a negative viscosity, active wetting, and strong mixing.

    Science.gov (United States)

    Martin, James E; Solis, Kyle J

    2014-06-14

    There are many areas of science and technology where being able to generate vigorous, noncontact flow would be desirable. We have discovered that three dimensional, time-dependent electric or magnetic fields having key symmetries can be used to generate controlled fluid motion by the continuous injection of energy. Unlike natural convection, this approach does not require a thermal gradient as an energy source, nor does it require gravity, so space applications are feasible. The result is a highly active material we call a vortex fluid. The homogeneous torque density of this fluid enables it to climb walls, induce ballistic droplet motion, and mix vigorously, even in such complex geometries as porous media. This vortex fluid can also exhibit a negative viscosity, which can immeasurably extend the control range of the "smart fluids" used in electro- and magnetorheological devices and can thus significantly increase their performance. Because the applied fields are uniform and modest in strength, vortex fluids of any scale can be created, making applications of any size, from directing microdroplet motion to controlling damping in magnetorheological dampers that protect bridges and buildings from earthquakes, feasible. PMID:24733404

  6. No Evidence for “Break-Induced Replication” in a Higher Plant – But Break-Induced Conversion May Occur

    OpenAIRE

    Schubert, Ingo; Schubert, Veit; Fuchs, Jörg

    2011-01-01

    Break-induced replication” (BIR) is considered as one way to repair DNA double-strand breaks (DSBs). BIR is defined as replication of the proximal break-ends up to the end of the broken chromosome using an undamaged (homologous) double-stranded template and mimicking a non-reciprocal translocation. This phenomenon was detected by genetic experiments in yeast. BIR is assumed to occur also in mammals, but experimental evidence is not yet at hand. We have studied chromosomes of the field bean, ...

  7. No evidence for 'break-induced replication' in a higher plant – but break-induced conversion may occur

    OpenAIRE

    Ingo eSchubert; Veit eSchubert; Jörg eFuchs

    2011-01-01

    Break-induced replication’ (BIR) is considered as one way to repair DNA double-strand breaks (DSBs). BIR is defined as replication of the proximal break-ends up to the end of the broken chromosome using an undamaged homologous double-stranded template and mimicking a non-reciprocal translocation. This phenomenon was detected by genetic experiments in yeast. BIR is assumed to occur also in mammals, but experimental evidence is not yet at hand. We have studied chromosomes of the field bean, V...

  8. Human DNA repair and recombination genes

    International Nuclear Information System (INIS)

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs

  9. Checkpoint adaptation and recovery: back with Polo after the break

    NARCIS (Netherlands)

    Vugt, M.A.T.M. van; Medema, R.H.

    2004-01-01

    S. cerevisiae cells that are unable to repair a double strand break ultimately escape the DNA damage checkpoint arrest and enter mitosis. This process called 'adaptation' depends on functional Cdc5, a Polo-like kinase, and was long thought to be limited to single-cell organisms. However, the recent

  10. Checkpoint adaptation and recovery : back with Polo after the break

    NARCIS (Netherlands)

    van Vugt, Marcel A T M; Medema, René H

    2004-01-01

    S. cerevisiae cells that are unable to repair a double strand break ultimately escape the DNA damage checkpoint arrest and enter mitosis. This process called 'adaptation' depends on functional Cdc5, a Polo-like kinase, and was long thought to be limited to single-cell organisms. However, the recent

  11. Is the Oxidative DNA Damage Level of Human Lymphocyte Correlated with the Antioxidant Capacity of Serum or the Base Excision Repair Activity of Lymphocyte?

    Directory of Open Access Journals (Sweden)

    Yi-Chih Tsai

    2013-01-01

    Full Text Available A random screening of human blood samples from 24 individuals of nonsmoker was conducted to examine the correlation between the oxidative DNA damage level of lymphocytes and the antioxidant capacity of serum or the base excision repair (BER activity of lymphocytes. The oxidative DNA damage level was measured with comet assay containing Fpg/Endo III cleavage, and the BER activity was estimated with a modified comet assay including nuclear extract of lymphocytes for enzymatic cleavage. Antioxidant capacity was determined with trolox equivalent antioxidant capacity assay. We found that though the endogenous DNA oxidation levels varied among the individuals, each individual level appeared to be steady for at least 1 month. Our results indicate that the oxidative DNA damage level is insignificantly or weakly correlated with antioxidant capacity or BER activity, respectively. However, lymphocytes from carriers of Helicobacter pylori (HP or Hepatitis B virus (HBV tend to give higher levels of oxidative DNA damage (P<0.05. Though sera of this group of individuals show no particular tendency with reduced antioxidant capacity, the respective BER activities of lymphocytes are lower in average (P<0.05. Thus, reduction of repair activity may be associated with the genotoxic effect of HP or HBV infection.

  12. Genetics of repair of radiation damage to DNA in bacteria

    International Nuclear Information System (INIS)

    The goal of this project is to study the consequences to bacterial DNA of damage by radiation and chemical agents. By correlating the extent of physical and biological damage to DNA, as expressed in various mutants defective in specific DNA repair pathways, we hope to determine mechanisms of biological inactivation of DNA and ways in which the damage can be repaired. We have measured physical damage to DNA in Bacillus subtilis and Escherichia coli by use of alkaline sucrose gradient centrifugation, which indicates the distance between breaks or alkali-labile lesions in single strands of DNA. Biological damage is measured by loss of viability or by loss of transforming activity in treated DNA from B. subtilis, and by the production of sites for DNA repair synthesis by DNA polymerase I (Pol I) in toluene-treated E. coli. We have investigated effects of ultraviolet light (both far-uv and near-uv), ionizing radiation, and selected chemical agents, in the presence or absence of sensitizing or protective agents. A major goal was to characterize DNA repair processes in vivo in B. subtilis. A number of radiation-sensitive mutants were studied, with the result that we have learned a great many details about the repair of DNA in uv-irradiated cells: We have now also studied the induction of methyltransferase in B. subtilis exposed to low concentrations of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). In collaboration with Sankar Mitra and R.S. Foote (Biology Division), we have shown that the basal level of methyltransferase in B. subtilis is about ten-fold higher than in E. coli and that there is about a ten-fold increase during adaptation. Our future studies will focus on the radioprotective effects of alcohols that act as OH radical scavengers but also react to irradiation by the formation of a radical on the carbon alpha to the hydroxyl

  13. An 800-year record of terrestrial organic matter from the East China Sea shelf break: Links to climate change and human activity in the Changjiang Basin

    Science.gov (United States)

    Li, Zhong Qiao; Wu, Ying; Liu, Su Mei; Du, Jin Zhou; Zhang, Jing

    2016-02-01

    The East China Sea (ECS) is a large river dominated marginal sea and receives massive volumes of terrestrial material from the Changjiang (Yangtze River). As the ECS preserves a record of terrestrial material derived from the Changjiang Basin, cores collected from this region can be used to reconstruct paleoclimate change and human disturbance in the watershed. A core (P4) was collected from the ECS shelf break and analyzed for bulk parameters (organic carbon (OC), total nitrogen (TN), and stable carbon isotopes (δ13C)), lignin phenols, and 3,5-dihydroxy benzoic acid (DHBA). The depth profiles of these parameters indicate stable and consistent marine production. The lignin source indices, cinnamyl phenols vs. vanillyl phenols (C/V) and syringyl phenols vs. vanillyl phenols (S/V), were in agreement with previously reported results from ECS surface sediments, but differed markedly from Bohai Sea surface sediments. The ratio of acid to aldehyde in vanillyl phenols ((Ad/Al)v) indicated the terrestrial OC in this core was refractory. At the same time, the variation in lignin phenols is positively correlated with the strength of the Indian Summer Monsoon (ISM) over the last 800 years (phuman activity in the upper Changjiang Basin over this period.

  14. Effect of the Principle of Activating Blood Circulation to Break Stasis on GMP-140 and D2 Dimer in Patients with Acute Cerebral Infarction

    Institute of Scientific and Technical Information of China (English)

    WANG Ning

    2005-01-01

    Objective:To explore the clinical efficacy of the principle of activating blood circulation to break stasis (ABCBS) and its influence on platelet membranous protein particle (GMP-140) and D2 dimer (Ddimer) before and after treatment. Methods: Eighty-eight patients with blood stasis syndrome (BSS) of acute cerebral infarction (ACI) were randomly divided into two groups, both of which were treated with conventional treatment, i.e. with western medicine (WM), with Salvia injection added through intravenously dripping.One of the two groups was used as the control and the other group as the treated group who had ABCBS herbs orally taken in addition. The duration of treatment course for both groups was 3 weeks. Results: There were changes in both groups over clinical symptoms, nerve function deficit scoring and GMP-140, D-dimer, but the treated group showed significantly better than that of the control group, (P<0.05). Conclusion: ABCBS principle could serve as an important auxiliary treating method for BSS of ACI, as it can effectively alter the blood of ACI patients which was viscous, condense, coagulant and aggregating.

  15. Guided Data Repair

    CERN Document Server

    Yakout, Mohamed; Neville, Jennifer; Ouzzani, Mourad; Ilyas, Ihab F

    2011-01-01

    In this paper we present GDR, a Guided Data Repair framework that incorporates user feedback in the cleaning process to enhance and accelerate existing automatic repair techniques while minimizing user involvement. GDR consults the user on the updates that are most likely to be beneficial in improving data quality. GDR also uses machine learning methods to identify and apply the correct updates directly to the database without the actual involvement of the user on these specific updates. To rank potential updates for consultation by the user, we first group these repairs and quantify the utility of each group using the decision-theory concept of value of information (VOI). We then apply active learning to order updates within a group based on their ability to improve the learned model. User feedback is used to repair the database and to adaptively refine the training set for the model. We empirically evaluate GDR on a real-world dataset and show significant improvement in data quality using our user guided re...

  16. uv photobiology: excision repair

    International Nuclear Information System (INIS)

    The following topics are discussed: steps in nucleotide excision; damage to DNA by uv-endonuclease; use of complementation to study DNA repair in Escherichia coli and mammalian cells; role of BUDR photolysis in excision repair, relation between DNA repair defect and human disease; base excision repair; and excision repair by removal of damaged region of a base in DNA without excision

  17. Break the ice

    Institute of Scientific and Technical Information of China (English)

    2015-01-01

    Jacky:My sister is mad at me.She refuses(拒绝)to talk to me.What can I do to break the ice?Ella:You can buy her a little gift.Break的意思是"打破",ice是指"冰块"。冰是又冷又硬的东西,作为俗语break the ice是指"打破沉默(僵局)"。Jacky惹妹妹生气,妹妹不理他了,他能通过送小礼物break the ice吗?

  18. Break-induced replication requires DNA damage-induced phosphorylation of Pif1 and leads to telomere lengthening.

    Directory of Open Access Journals (Sweden)

    Yulia Vasianovich

    2014-10-01

    Full Text Available Broken replication forks result in DNA breaks that are normally repaired via homologous recombination or break induced replication (BIR. Mild insufficiency in the replicative ligase Cdc9 in budding yeast Saccharomyces cerevisiae resulted in a population of cells with persistent DNA damage, most likely due to broken replication forks, constitutive activation of the DNA damage checkpoint and longer telomeres. This telomere lengthening required functional telomerase, the core DNA damage signaling cascade Mec1-Rad9-Rad53, and the components of the BIR repair pathway - Rad51, Rad52, Pol32, and Pif1. The Mec1-Rad53 induced phosphorylation of Pif1, previously found necessary for inhibition of telomerase at double strand breaks, was also important for the role of Pif1 in BIR and telomere elongation in cdc9-1 cells. Two other mutants with impaired DNA replication, cdc44-5 and rrm3Δ, were similar to cdc9-1: their long telomere phenotype was dependent on the Pif1 phosphorylation locus. We propose a model whereby the passage of BIR forks through telomeres promotes telomerase activity and leads to telomere lengthening.

  19. Perspectives on the combination of radiotherapy and targeted therapy with DNA repair inhibitors in the treatment of pancreatic cancer.

    Science.gov (United States)

    Yang, Shih-Hung; Kuo, Ting-Chun; Wu, Hsu; Guo, Jhe-Cyuan; Hsu, Chiun; Hsu, Chih-Hung; Tien, Yu-Wen; Yeh, Kun-Huei; Cheng, Ann-Lii; Kuo, Sung-Hsin

    2016-08-28

    Pancreatic cancer is highly lethal. Current research that combines radiation with targeted therapy may dramatically improve prognosis. Cancerous cells are characterized by unstable genomes and activation of DNA repair pathways, which are indicated by increased phosphorylation of numerous factors, including H2AX, ATM, ATR, Chk1, Chk2, DNA-PKcs, Rad51, and Ku70/Ku80 heterodimers. Radiotherapy causes DNA damage. Cancer cells can be made more sensitive to the effects of radiation (radiosensitization) through inhibition of DNA repair pathways. The synergistic effects, of two or more combined non-lethal treatments, led to co-administration of chemotherapy and radiosensitization in BRCA-defective cells and patients, with promising results. ATM/Chk2 and ATR/Chk1 pathways are principal regulators of cell cycle arrest, following DNA double-strand or single-strand breaks. DNA double-stranded breaks activate DNA-dependent protein kinase, catalytic subunit (DNA-PKcs). It forms a holoenzyme with Ku70/Ku80 heterodimers, called DNA-PK, which catalyzes the joining of nonhomologous ends. This is the primary repair pathway utilized in human cells after exposure to ionizing radiation. Radiosensitization, induced by inhibitors of ATM, ATR, Chk1, Chk2, Wee1, PP2A, or DNA-PK, has been demonstrated in preclinical pancreatic cancer studies. Clinical trials are underway. Development of agents that inhibit DNA repair pathways to be clinically used in combination with radiotherapy is warranted for the treatment of pancreatic cancer. PMID:27621574

  20. Arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Xi; Zhou, Xixi [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States); Du, Libo [Center for Molecular Science, Institute of Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Liu, Wenlan [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States); Liu, Yang [Center for Molecular Science, Institute of Chemistry, Chinese Academy of Sciences, Beijing 100190 (China); Hudson, Laurie G. [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States); Liu, Ke Jian, E-mail: kliu@salud.unm.edu [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States)

    2014-01-15

    Inhibition of DNA repair is a recognized mechanism for arsenic enhancement of ultraviolet radiation-induced DNA damage and carcinogenesis. Poly(ADP-ribose) polymerase-1 (PARP-1), a zinc finger DNA repair protein, has been identified as a sensitive molecular target for arsenic. The zinc finger domains of PARP-1 protein function as a critical structure in DNA recognition and binding. Since cellular poly(ADP-ribosyl)ation capacity has been positively correlated with zinc status in cells, we hypothesize that arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair. To test this hypothesis, we compared the effects of arsenite exposure with zinc deficiency, created by using the membrane-permeable zinc chelator TPEN, on 8-OHdG formation, PARP-1 activity and zinc binding to PARP-1 in HaCat cells. Our results show that arsenite exposure and zinc deficiency had similar effects on PARP-1 protein, whereas supplemental zinc reversed these effects. To investigate the molecular mechanism of zinc loss induced by arsenite, ICP-AES, near UV spectroscopy, fluorescence, and circular dichroism spectroscopy were utilized to examine arsenite binding and occupation of a peptide representing the first zinc finger of PARP-1. We found that arsenite binding as well as zinc loss altered the conformation of zinc finger structure which functionally leads to PARP-1 inhibition. These findings suggest that arsenite binding to PARP-1 protein created similar adverse biological effects as zinc deficiency, which establishes the molecular mechanism for zinc supplementation as a potentially effective treatment to reverse the detrimental outcomes of arsenic exposure. - Highlights: • Arsenite binding is equivalent to zinc deficiency in reducing PARP-1 function. • Zinc reverses arsenic inhibition of PARP-1 activity and enhancement of DNA damage. • Arsenite binding and zinc loss alter the conformation of zinc finger