WorldWideScience

Sample records for break repair activity

  1. Cockayne syndrome group B protein regulates DNA double-strand break repair and checkpoint activation

    Science.gov (United States)

    Batenburg, Nicole L; Thompson, Elizabeth L; Hendrickson, Eric A; Zhu, Xu-Dong

    2015-01-01

    Mutations of CSB account for the majority of Cockayne syndrome (CS), a devastating hereditary disorder characterized by physical impairment, neurological degeneration and segmental premature aging. Here we report the generation of a human CSB-knockout cell line. We find that CSB facilitates HR and represses NHEJ. Loss of CSB or a CS-associated CSB mutation abrogating its ATPase activity impairs the recruitment of BRCA1, RPA and Rad51 proteins to damaged chromatin but promotes the formation of 53BP1-Rif1 damage foci in S and G2 cells. Depletion of 53BP1 rescues the formation of BRCA1 damage foci in CSB-knockout cells. In addition, knockout of CSB impairs the ATM- and Chk2-mediated DNA damage responses, promoting a premature entry into mitosis. Furthermore, we show that CSB accumulates at sites of DNA double-strand breaks (DSBs) in a transcription-dependent manner. The kinetics of DSB-induced chromatin association of CSB is distinct from that of its UV-induced chromatin association. These results reveal novel, important functions of CSB in regulating the DNA DSB repair pathway choice as well as G2/M checkpoint activation. PMID:25820262

  2. Cockayne syndrome group B protein regulates DNA double-strand break repair and checkpoint activation.

    Science.gov (United States)

    Batenburg, Nicole L; Thompson, Elizabeth L; Hendrickson, Eric A; Zhu, Xu-Dong

    2015-05-12

    Mutations of CSB account for the majority of Cockayne syndrome (CS), a devastating hereditary disorder characterized by physical impairment, neurological degeneration and segmental premature aging. Here we report the generation of a human CSB-knockout cell line. We find that CSB facilitates HR and represses NHEJ. Loss of CSB or a CS-associated CSB mutation abrogating its ATPase activity impairs the recruitment of BRCA1, RPA and Rad51 proteins to damaged chromatin but promotes the formation of 53BP1-Rif1 damage foci in S and G2 cells. Depletion of 53BP1 rescues the formation of BRCA1 damage foci in CSB-knockout cells. In addition, knockout of CSB impairs the ATM- and Chk2-mediated DNA damage responses, promoting a premature entry into mitosis. Furthermore, we show that CSB accumulates at sites of DNA double-strand breaks (DSBs) in a transcription-dependent manner. The kinetics of DSB-induced chromatin association of CSB is distinct from that of its UV-induced chromatin association. These results reveal novel, important functions of CSB in regulating the DNA DSB repair pathway choice as well as G2/M checkpoint activation. © 2015 The Authors.

  3. The Caenorhabditis elegans WRN helicase promotes double-strand DNA break repair by mediating end resection and checkpoint activation.

    Science.gov (United States)

    Ryu, Jin-Sun; Koo, Hyeon-Sook

    2017-07-01

    The protein associated with Werner syndrome (WRN), is involved in DNA repair, checkpoint activation, and telomere maintenance. To better understand the involvement of WRN in double-strand DNA break (DSB) repair, we analyzed the combinatorial role of WRN-1, the Caenorhabditis elegans WRN helicase, in conjunction with EXO-1 and DNA-2 nucleases. We found that WRN-1 cooperates with DNA-2 to resect DSB ends in a pathway acting in parallel to EXO-1. The wrn-1 mutants show an aberrant accumulation of replication protein A (RPA) and RAD-51, and the same pattern of accumulation is also observed in checkpoint-defective strains. We conclude that WRN-1 plays a conserved role in the resection of DSB ends and mediates checkpoint signaling, thereby influencing levels of RPA and RAD-51. © 2017 Federation of European Biochemical Societies.

  4. SETD2 is required for DNA double-strand break repair and activation of the p53-mediated checkpoint.

    Science.gov (United States)

    Carvalho, Sílvia; Vítor, Alexandra C; Sridhara, Sreerama C; Martins, Filipa B; Raposo, Ana C; Desterro, Joana M P; Ferreira, João; de Almeida, Sérgio F

    2014-05-06

    Histone modifications establish the chromatin states that coordinate the DNA damage response. In this study, we show that SETD2, the enzyme that trimethylates histone H3 lysine 36 (H3K36me3), is required for ATM activation upon DNA double-strand breaks (DSBs). Moreover, we find that SETD2 is necessary for homologous recombination repair of DSBs by promoting the formation of RAD51 presynaptic filaments. In agreement, SETD2-mutant clear cell renal cell carcinoma (ccRCC) cells displayed impaired DNA damage signaling. However, despite the persistence of DNA lesions, SETD2-deficient cells failed to activate p53, a master guardian of the genome rarely mutated in ccRCC and showed decreased cell survival after DNA damage. We propose that this novel SETD2-dependent role provides a chromatin bookmarking instrument that facilitates signaling and repair of DSBs. In ccRCC, loss of SETD2 may afford an alternative mechanism for the inactivation of the p53-mediated checkpoint without the need for additional genetic mutations in TP53.DOI: http://dx.doi.org/10.7554/eLife.02482.001. Copyright © 2014, Carvalho et al.

  5. Phosphorylation: The Molecular Switch of Double-Strand Break Repair

    Directory of Open Access Journals (Sweden)

    K. C. Summers

    2011-01-01

    Full Text Available Repair of double-stranded breaks (DSBs is vital to maintaining genomic stability. In mammalian cells, DSBs are resolved in one of the following complex repair pathways: nonhomologous end-joining (NHEJ, homologous recombination (HR, or the inclusive DNA damage response (DDR. These repair pathways rely on factors that utilize reversible phosphorylation of proteins as molecular switches to regulate DNA repair. Many of these molecular switches overlap and play key roles in multiple pathways. For example, the NHEJ pathway and the DDR both utilize DNA-PK phosphorylation, whereas the HR pathway mediates repair with phosphorylation of RPA2, BRCA1, and BRCA2. Also, the DDR pathway utilizes the kinases ATM and ATR, as well as the phosphorylation of H2AX and MDC1. Together, these molecular switches regulate repair of DSBs by aiding in DSB recognition, pathway initiation, recruitment of repair factors, and the maintenance of repair mechanisms.

  6. The transcription fidelity factor GreA impedes DNA break repair.

    Science.gov (United States)

    Sivaramakrishnan, Priya; Sepúlveda, Leonardo A; Halliday, Jennifer A; Liu, Jingjing; Núñez, María Angélica Bravo; Golding, Ido; Rosenberg, Susan M; Herman, Christophe

    2017-10-12

    Homologous recombination repairs DNA double-strand breaks and must function even on actively transcribed DNA. Because break repair prevents chromosome loss, the completion of repair is expected to outweigh the transcription of broken templates. However, the interplay between DNA break repair and transcription processivity is unclear. Here we show that the transcription factor GreA inhibits break repair in Escherichia coli. GreA restarts backtracked RNA polymerase and hence promotes transcription fidelity. We report that removal of GreA results in markedly enhanced break repair via the classic RecBCD-RecA pathway. Using a deep-sequencing method to measure chromosomal exonucleolytic degradation, we demonstrate that the absence of GreA limits RecBCD-mediated resection. Our findings suggest that increased RNA polymerase backtracking promotes break repair by instigating RecA loading by RecBCD, without the influence of canonical Chi signals. The idea that backtracked RNA polymerase can stimulate recombination presents a DNA transaction conundrum: a transcription fidelity factor that compromises genomic integrity.

  7. RNA-directed repair of DNA double-strand breaks.

    Science.gov (United States)

    Yang, Yun-Gui; Qi, Yijun

    2015-08-01

    DNA double-strand breaks (DSBs) are among the most deleterious DNA lesions, which if unrepaired or repaired incorrectly can cause cell death or genome instability that may lead to cancer. To counteract these adverse consequences, eukaryotes have evolved a highly orchestrated mechanism to repair DSBs, namely DNA-damage-response (DDR). DDR, as defined specifically in relation to DSBs, consists of multi-layered regulatory modes including DNA damage sensors, transducers and effectors, through which DSBs are sensed and then repaired via DNAprotein interactions. Unexpectedly, recent studies have revealed a direct role of RNA in the repair of DSBs, including DSB-induced small RNA (diRNA)-directed and RNA-templated DNA repair. Here, we summarize the recent discoveries of RNA-mediated regulation of DSB repair and discuss the potential impact of these novel RNA components of the DSB repair pathway on genomic stability and plasticity. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. DEK is required for homologous recombination repair of DNA breaks

    DEFF Research Database (Denmark)

    Smith, Eric A; Gole, Boris; Willis, Nicholas A

    2017-01-01

    DEK is a highly conserved chromatin-bound protein whose upregulation across cancer types correlates with genotoxic therapy resistance. Loss of DEK induces genome instability and sensitizes cells to DNA double strand breaks (DSBs), suggesting defects in DNA repair. While these DEK-deficiency pheno......DEK is a highly conserved chromatin-bound protein whose upregulation across cancer types correlates with genotoxic therapy resistance. Loss of DEK induces genome instability and sensitizes cells to DNA double strand breaks (DSBs), suggesting defects in DNA repair. While these DEK......-deficiency phenotypes were thought to arise from a moderate attenuation of non-homologous end joining (NHEJ) repair, the role of DEK in DNA repair remains incompletely understood. We present new evidence demonstrating the observed decrease in NHEJ is insufficient to impact immunoglobulin class switching in DEK knockout...

  9. Double strand break repair functions of histone H2AX

    Energy Technology Data Exchange (ETDEWEB)

    Scully, Ralph, E-mail: rscully@bidmc.harvard.edu; Xie, Anyong

    2013-10-15

    Chromosomal double strand breaks provoke an extensive reaction in neighboring chromatin, characterized by phosphorylation of histone H2AX on serine 139 of its C-terminal tail (to form “γH2AX”). The γH2AX response contributes to the repair of double strand breaks encountered in a variety of different contexts, including those induced by ionizing radiation, physiologically programmed breaks that characterize normal immune cell development and the pathological exposure of DNA ends triggered by telomere dysfunction. γH2AX also participates in the evolutionarily conserved process of sister chromatid recombination, a homologous recombination pathway involved in the suppression of genomic instability during DNA replication and directly implicated in tumor suppression. At a biochemical level, the γH2AX response provides a compelling example of how the “histone code” is adapted to the regulation of double strand break repair. Here, we review progress in research aimed at understanding how γH2AX contributes to double strand break repair in mammalian cells.

  10. Deletion-bias in DNA double-strand break repair differentially contributes to plant genome shrinkage.

    Science.gov (United States)

    Vu, Giang T H; Cao, Hieu X; Reiss, Bernd; Schubert, Ingo

    2017-06-01

    In order to prevent genome instability, cells need to be protected by a number of repair mechanisms, including DNA double-strand break (DSB) repair. The extent to which DSB repair, biased towards deletions or insertions, contributes to evolutionary diversification of genome size is still under debate. We analyzed mutation spectra in Arabidopsis thaliana and in barley (Hordeum vulgare) by PacBio sequencing of three DSB-targeted loci each, uncovering repair via gene conversion, single strand annealing (SSA) or nonhomologous end-joining (NHEJ). Furthermore, phylogenomic comparisons between A. thaliana and two related species were used to detect naturally occurring deletions during Arabidopsis evolution. Arabidopsis thaliana revealed significantly more and larger deletions after DSB repair than barley, and barley displayed more and larger insertions. Arabidopsis displayed a clear net loss of DNA after DSB repair, mainly via SSA and NHEJ. Barley revealed a very weak net loss of DNA, apparently due to less active break-end resection and easier copying of template sequences into breaks. Comparative phylogenomics revealed several footprints of SSA in the A. thaliana genome. Quantitative assessment of DNA gain and loss through DSB repair processes suggests deletion-biased DSB repair causing ongoing genome shrinking in A. thaliana, whereas genome size in barley remains nearly constant. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  11. Double-strand break repair-adox: Restoration of suppressed double-strand break repair during mitosis induces genomic instability.

    Science.gov (United States)

    Terasawa, Masahiro; Shinohara, Akira; Shinohara, Miki

    2014-12-01

    Double-strand breaks (DSBs) are one of the severest types of DNA damage. Unrepaired DSBs easily induce cell death and chromosome aberrations. To maintain genomic stability, cells have checkpoint and DSB repair systems to respond to DNA damage throughout most of the cell cycle. The failure of this process often results in apoptosis or genomic instability, such as aneuploidy, deletion, or translocation. Therefore, DSB repair is essential for maintenance of genomic stability. During mitosis, however, cells seem to suppress the DNA damage response and proceed to the next G1 phase, even if there are unrepaired DSBs. The biological significance of this suppression is not known. In this review, we summarize recent studies of mitotic DSB repair and discuss the mechanisms of suppression of DSB repair during mitosis. DSB repair, which maintains genomic integrity in other phases of the cell cycle, is rather toxic to cells during mitosis, often resulting in chromosome missegregation and aberration. Cells have multiple safeguards to prevent genomic instability during mitosis: inhibition of 53BP1 or BRCA1 localization to DSB sites, which is important to promote non-homologous end joining or homologous recombination, respectively, and also modulation of the non-homologous end joining core complex to inhibit DSB repair. We discuss how DSBs during mitosis are toxic and the multiple safeguard systems that suppress genomic instability. © 2014 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.

  12. Zebularine induces replication-dependent double-strand breaks which are preferentially repaired by homologous recombination.

    Science.gov (United States)

    Orta, Manuel Luis; Pastor, Nuria; Burgos-Morón, Estefanía; Domínguez, Inmaculada; Calderón-Montaño, José Manuel; Huertas Castaño, Carlos; López-Lázaro, Miguel; Helleday, Thomas; Mateos, Santiago

    2017-09-01

    Zebularine is a second-generation, highly stable hydrophilic inhibitor of DNA methylation with oral bioavailability that preferentially target cancer cells. It acts primarily as a trap for DNA methyl transferases (DNMTs) protein by forming covalent complexes between DNMT protein and zebularine-substrate DNA. It's well documented that replication-blocking DNA lesions can cause replication fork collapse and thereby to the formation of DNA double-strand breaks (DSB). DSB are dangerous lesions that can lead to potentially oncogenic genomic rearrangements or cell death. The two major pathways for repair of DSB are non-homologous end joining (NHEJ) and homologous recombination (HR). Recently, multiple functions for the HR machinery have been identified at arrested forks. Here we investigate in more detail the importance of the lesions induced by zebularine in terms of DNA damage and cytotoxicity as well as the role of HR in the repair of these lesions. When we examined the contribution of NHEJ and HR in the repair of DSB induced by zebularine we found that these breaks were preferentially repaired by HR. Also we show that the production of DSB is dependent on active replication. To test this, we determined chromosome damage by zebularine while transiently inhibiting DNA synthesis. Here we report that cells deficient in single-strand break (SSB) repair are hypersensitive to zebularine. We have observed more DSB induced by zebularine in XRCC1 deficient cells, likely to be the result of conversion of SSB into toxic DSB when encountered by a replication fork. Furthermore we demonstrate that HR is required for the repair of these breaks. Overall, our data suggest that zebularine induces replication-dependent DSB which are preferentially repaired by HR. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Regulation of repair pathway choice at two-ended DNA double-strand breaks.

    Science.gov (United States)

    Shibata, Atsushi

    2017-10-01

    A DNA double-strand break (DSB) is considered to be a critical DNA lesion because its misrepair can cause severe mutations, such as deletions or chromosomal translocations. For the precise repair of DSBs, the repair pathway that is optimal for the particular circumstance needs to be selected. Non-homologous end joining (NHEJ) functions in G1/S/G2 phase, while homologous recombination (HR) becomes active only in S/G2 phase after DNA replication. DSB end structure is another factor affecting the repair pathway. For example, one-ended DSBs in S phase are mainly repaired by HR due to the lack of a partner DSB end for NHEJ. In contrast, two-ended DSBs, which are mainly induced by ionizing radiation, are repaired by either NHEJ or HR in G2 cells. Under the current model in terms of DSB repair pathway usage in G2 phase, NHEJ repairs ∼70% of two-ended DSBs, whereas HR repairs only ∼30%. Recent studies propose that NHEJ factors can bind all the DSB ends and are then either used to progress that pathway of DSB repair, or the repair proceeds by HR. In addition, molecular regulation by BRCA1 and 53BP1 has also been proposed. At DSB sites, BRCA1 functions to alleviate the 53BP1 barrier to resection by promoting 53BP1 dephosphorylation, followed by RIF1 release and 53BP1 repositioning. This timely 53BP1 repositioning may be important for the establishment of a chromatin environment that promotes the recruitment of EXO1 for resection in HR. This review summarizes current knowledge on factors regulating DSB repair pathway choice in terms of spatiotemporal regulation by focusing on the repair events at two-ended DSBs in G2 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. The Heterochromatic Barrier to DNA Double Strand Break Repair: How to Get the Entry Visa

    Directory of Open Access Journals (Sweden)

    Aaron A. Goodarzi

    2012-09-01

    Full Text Available Over recent decades, a deep understanding of pathways that repair DNA double strand breaks (DSB has been gained from biochemical, structural, biophysical and cellular studies. DNA non-homologous end-joining (NHEJ and homologous recombination (HR represent the two major DSB repair pathways, and both processes are now well understood. Recent work has demonstrated that the chromatin environment at a DSB significantly impacts upon DSB repair and that, moreover, dramatic modifications arise in the chromatin surrounding a DSB. Chromatin is broadly divided into open, transcriptionally active, euchromatin (EC and highly compacted, transcriptionally inert, heterochromatin (HC, although these represent extremes of a spectrum. The HC superstructure restricts both DSB repair and damage response signaling. Moreover, DSBs within HC (HC-DSBs are rapidly relocalized to the EC-HC interface. The damage response protein kinase, ataxia telangiectasia mutated (ATM, is required for HC-DSB repair but is dispensable for the relocalization of HC-DSBs. It has been proposed that ATM signaling enhances HC relaxation in the DSB vicinity and that this is a prerequisite for HC-DSB repair. Hence, ATM is essential for repair of HC-DSBs. Here, we discuss how HC impacts upon the response to DSBs and how ATM overcomes the barrier that HC poses to repair.

  15. Ago2 facilitates Rad51 recruitment and DNA double-strand break repair by homologous recombination

    DEFF Research Database (Denmark)

    Gao, Min; Wei, Wei; Li, Ming Hua

    2014-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic lesions and pose a major threat to genome stability if not properly repaired. We and others have previously shown that a class of DSB-induced small RNAs (diRNAs) is produced from sequences around DSB sites. DiRNAs are associated with Argonaute...... cells. Interestingly, we show that Ago2 forms a complex with Rad51 and that the interaction is enhanced in cells treated with ionizing radiation. We demonstrate that Rad51 accumulation at DSB sites and HR repair depend on catalytic activity and small RNA-binding capability of Ago2. In contrast, DSB...

  16. Atypical Role for PhoU in Mutagenic Break Repair under Stress in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Janet L Gibson

    Full Text Available Mechanisms of mutagenesis activated by stress responses drive pathogen/host adaptation, antibiotic and anti-fungal-drug resistance, and perhaps much of evolution generally. In Escherichia coli, repair of double-strand breaks (DSBs by homologous recombination is high fidelity in unstressed cells, but switches to a mutagenic mode using error-prone DNA polymerases when the both the SOS and general (σS stress responses are activated. Additionally, the σE response promotes spontaneous DNA breakage that leads to mutagenic break repair (MBR. We identified the regulatory protein PhoU in a genetic screen for functions required for MBR. PhoU negatively regulates the phosphate-transport and utilization (Pho regulon when phosphate is in excess, including the PstB and PstC subunits of the phosphate-specific ABC transporter PstSCAB. Here, we characterize the PhoU mutation-promoting role. First, some mutations that affect phosphate transport and Pho transcriptional regulation decrease mutagenesis. Second, the mutagenesis and regulon-expression phenotypes do not correspond, revealing an apparent new function(s for PhoU. Third, the PhoU mutagenic role is not via activation of the σS, SOS or σE responses, because mutations (or DSBs that restore mutagenesis to cells defective in these stress responses do not restore mutagenesis to phoU cells. Fourth, the mutagenesis defect in phoU-mutant cells is partially restored by deletion of arcA, a gene normally repressed by PhoU, implying that a gene(s repressed by ArcA promotes mutagenic break repair. The data show a new role for PhoU in regulation, and a new regulatory branch of the stress-response signaling web that activates mutagenic break repair in E. coli.

  17. Repair of DNA strand breaks in a minichromosome in vivo: kinetics, modeling, and effects of inhibitors.

    Directory of Open Access Journals (Sweden)

    Slawomir Kumala

    Full Text Available To obtain an overall picture of the repair of DNA single and double strand breaks in a defined region of chromatin in vivo, we studied their repair in a ~170 kb circular minichromosome whose length and topology are analogous to those of the closed loops in genomic chromatin. The rate of repair of single strand breaks in cells irradiated with γ photons was quantitated by determining the sensitivity of the minichromosome DNA to nuclease S1, and that of double strand breaks by assaying the reformation of supercoiled DNA using pulsed field electrophoresis. Reformation of supercoiled DNA, which requires that all single strand breaks have been repaired, was not slowed detectably by the inhibitors of poly(ADP-ribose polymerase-1 NU1025 or 1,5-IQD. Repair of double strand breaks was slowed by 20-30% when homologous recombination was supressed by KU55933, caffeine, or siRNA-mediated depletion of Rad51 but was completely arrested by the inhibitors of nonhomologous end-joining wortmannin or NU7441, responses interpreted as reflecting competition between these repair pathways similar to that seen in genomic DNA. The reformation of supercoiled DNA was unaffected when topoisomerases I or II, whose participation in repair of strand breaks has been controversial, were inhibited by the catalytic inhibitors ICRF-193 or F11782. Modeling of the kinetics of repair provided rate constants and showed that repair of single strand breaks in minichromosome DNA proceeded independently of repair of double strand breaks. The simplicity of quantitating strand breaks in this minichromosome provides a usefull system for testing the efficiency of new inhibitors of their repair, and since the sequence and structural features of its DNA and its transcription pattern have been studied extensively it offers a good model for examining other aspects of DNA breakage and repair.

  18. Parp1-XRCC1 and the repair of DNA double strand breaks in mouse round spermatids

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, Emad A. [Department of Endocrinology and Metabolism, Faculty of Science, Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Boer, Peter de [Department of Obstetrics and Gynaecology, Radboud University Nijmegen Medical Centre, 6500 HB Nijmegen (Netherlands); Philippens, Marielle E.P.; Kal, Henk B. [Department of Radiotherapy, University Medical Center Utrecht, Heidelberglaan 100, 3584 CX Utrecht (Netherlands); Rooij, Dirk G. de, E-mail: d.g.derooij@uu.nl [Department of Endocrinology and Metabolism, Faculty of Science, Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Center for Reproductive Medicine, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam (Netherlands)

    2010-01-05

    The repair of DNA double strand breaks (DSBs) in male germ cells is slower and differently regulated compared to that in somatic cells. Round spermatids show DSB repair and are radioresistant to apoptosis induction. Mutation induction studies using ionizing irradiation, indicated a high frequency of chromosome aberrations (CA) in the next generation. Since they are in a G1 comparable stage of the cell cycle, haploid spermatids are expected to repair DSBs by the non-homologous end-joining pathway (NHEJ). However, immunohistochemical evidence indicates that not all components of the classical NHEJ pathway are available since the presence of DNA-PKcs cannot be shown. Here, we demonstrate that round spermatids, as well as most other types of male germ cells express both Parp1 and XRCC1. Therefore, we have determined whether the alternative Parp1/XRCC1 dependent NHEJ pathway is active in these nuclei and also have tested for classical NHEJ activity by a genetic method. To evaluate DSB repair in SCID mice, deficient for DNA-PKcs, and to study the involvement of the Parp1/XRCC1 dependent NHEJ pathway in round spermatids, the loss of {gamma}-H2AX foci after irradiation has been determined in nucleus spreads of round spermatids of SCID mice and in nucleus spreads and histological sections of Parp1-inhibited mice and their respective controls. Results show that around half of the breaks in randomly selected round spermatids are repaired between 1 and 8 h after irradiation. The repair of 16% of the induced DSBs requires DNA-PKcs and 21% Parp1. Foci numbers in the Parp1-inhibited testes tend to be higher in spermatids of all epithelial stages reaching significance in stages I-III which indicates an active Parp1/XRCC1 pathway in round spermatids and a decreased repair capacity in later round spermatid stages. In Parp1-inhibited SCID mice only 14.5% of the breaks were repaired 8 h after irradiation indicating additivity of the two NHEJ pathways in round spermatids.

  19. Regulation of hetDNA Length during Mitotic Double-Strand Break Repair in Yeast.

    Science.gov (United States)

    Guo, Xiaoge; Hum, Yee Fang; Lehner, Kevin; Jinks-Robertson, Sue

    2017-08-17

    Heteroduplex DNA (hetDNA) is a key molecular intermediate during the repair of mitotic double-strand breaks by homologous recombination, but its relationship to 5' end resection and/or 3' end extension is poorly understood. In the current study, we examined how perturbations in these processes affect the hetDNA profile associated with repair of a defined double-strand break (DSB) by the synthesis-dependent strand-annealing (SDSA) pathway. Loss of either the Exo1 or Sgs1 long-range resection pathway significantly shortened hetDNA, suggesting that these pathways normally collaborate during DSB repair. In addition, altering the processivity or proofreading activity of DNA polymerase δ shortened hetDNA length or reduced break-adjacent mismatch removal, respectively, demonstrating that this is the primary polymerase that extends both 3' ends. Data are most consistent with the extent of DNA synthesis from the invading end being the primary determinant of hetDNA length during SDSA. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Genetics of x-ray induced double strand break repair in saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Budd, M.E.

    1982-07-01

    The possible fates of x-ray-induced double-strand breaks in Saccharomyces cerevisiae were examined. One possible pathway which breaks can follow, the repair pathway, was studied by assaying strains with mutations in the RAD51, RAD54, and RAD57 loci for double-strand break repair. In order of increasing radiation sensitivity one finds: rad57-1(23/sup 0/)> rad51-1(30/sup 0/)> rad54-3(36/sup 0/). At 36/sup 0/, rad54-3 cells cannot repair double-strand breaks, while 23/sup 0/, they can. Strains with the rad57-1 mutation can rejoin broken chromosomes at both temperatures. However, the low survival at 36/sup 0/ shows that the assay is not distinguishing large DNA fragments which allow cell survival from those which cause cell death. A rad51-1 strain could also rejoin broken chromosomes, and was thus capable of incomplete repair. The data can be explained with the hypothesis that rad54-3 cells are blocked in an early step of repair, while rad51-1 and rad57-1 strains are blocked in a later step of repair. The fate of double-strand breaks when they are left unrepaired was investigated with the rad54-3 mutation. If breaks are prevented from entering the RAD54 repair pathway they become uncommitted lesions. These lesions are repaired slower than the original breaks. One possible fate for an uncommitted lesion is conversion into a fixed lesion, which is likely to be an unrepairable or misrepaired double-strand break. The presence of protein synthesis after irradiation increases the probability that a break will enter the repair pathway. Evidence shows that increased probability of repair results from enhanced synthesis of repair proteins shortly after radiation. (ERB)

  1. Differential usage of alternative pathways of double-strand break repair in Drosophila.

    Science.gov (United States)

    Preston, Christine R; Flores, Carlos C; Engels, William R

    2006-02-01

    Double-strand DNA breaks can be repaired by any of several alternative mechanisms that differ greatly in the nature of the final repaired products. We used a reporter construct, designated "Repair reporter 3" (Rr3), to measure the relative usage of these pathways in Drosophila germ cells. The method works by creating a double-strand break at a specific location such that expression of the red fluorescent protein, DsRed, in the next generation can be used to infer the frequency at which each pathway was used. A key feature of this approach is that most data come from phenotypic scoring, thus allowing large sample sizes and considerable precision in measurements. Specifically, we measured the proportion of breaks repaired by (1) conversion repair, (2) nonhomologous end joining (NHEJ), or (3) single-strand annealing (SSA). For conversion repair, the frequency of mitotic crossing over in the germ line indicates the relative prevalence of repair by double Holliday junction (DHJ) formation vs. the synthesis-dependent strand annealing (SDSA) pathway. We used this method to show that breaks occurring early in germ-line development were much more frequently repaired via single-strand annealing and much less likely to be repaired by end joining compared with identical breaks occurring later in development. Conversion repair was relatively rare when breaks were made either very early or very late in development, but was much more frequent in between. Significantly, the changes in relative usage occurred in a compensatory fashion, such that an increase in one pathway was accompanied by decreases in others. This negative correlation is interpreted to mean that the pathways for double-strand break repair compete with each other to handle a given breakage event.

  2. Adriamycin does not affect the repair of X-ray induced DNA single strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Cantoni, O.; Sestili, P.; Cattabeni, F.

    1985-06-01

    The ability of the antitumor antibiotic adriamycin (Ad) to inhibit the rejoining of DNA single strand breaks produced by X-rays was investigated in cultured cells. Chinese hamster ovary cells were given 400 rad and were allowed to repair in the presence or absence of Ad for 60 min at 37degC. The drug did not affect the ability of cells to repair DNA breaks and residual breaks found after the repair period were attributed to those induced by Ad alone. (author). 16 refs.

  3. Unsuitability of lymphoblastoid cell lines as surrogate of cryopreserved isolated lymphocytes for the analysis of DNA double-strand break repair activity

    Energy Technology Data Exchange (ETDEWEB)

    Zijno, Andrea [Department of Environment and Primary Prevention, Istituto Superiore di Sanita, Rome (Italy); Porcedda, Paola [Department of Clinical and Biological Sciences, University of Turin (Italy); Saini, Francesca [Department of Environment and Primary Prevention, Istituto Superiore di Sanita, Rome (Italy); Allione, Alessandra [Institute for Scientific Interchange (ISI) Foundation, Villa Gualino, Turin (Italy); Garofalo, Bruno; Marcon, Francesca [Department of Environment and Primary Prevention, Istituto Superiore di Sanita, Rome (Italy); Guarrera, Simonetta [Institute for Scientific Interchange (ISI) Foundation, Villa Gualino, Turin (Italy); Turinetto, Valentina; Minieri, Valentina [Department of Clinical and Biological Sciences, University of Turin (Italy); Funaro, Ada [Department of Genetics, Biology and Biochemistry, University of Turin (Italy); Crebelli, Riccardo [Department of Environment and Primary Prevention, Istituto Superiore di Sanita, Rome (Italy); Giachino, Claudia [Department of Clinical and Biological Sciences, University of Turin (Italy); Matullo, Giuseppe, E-mail: giuseppe.matullo@unito.it [Institute for Scientific Interchange (ISI) Foundation, Villa Gualino, Turin (Italy); Department of Genetics, Biology and Biochemistry, University of Turin (Italy)

    2010-02-03

    As first task of a comprehensive investigation on DNA repair genotype-phenotype correlations, the suitability of Epstein-Barr virus (EBV)-transformed lymphoblastoid cell lines (LCLs) as surrogate of cryopreserved peripheral blood mononuclear cells (PBMCs) in DNA repair phenotypic assays was evaluated. To this aim the amount of DNA damage induced by {gamma}-rays and DNA repair capacity were evaluated in unstimulated (G{sub 0}) and mitogen-simulated (G{sub 2}) PBMC from 20 healthy subjects and in EBV-transformed LCL obtained from the same individuals. Phosphorylation of histone H2AX, micronuclei and chromosomal aberrations were the end-points investigated. The results obtained show higher basal frequencies of binucleated cells bearing micronuclei and nucleoplasmic bridge (NPB) in LCL with respect to PBMC, suggesting that EBV transformation may be associated with chromosomal instability. After irradiation, higher levels of micronuclei were induced in G{sub 0}-treated PBMC compared to cycling LCL; conversely, NPB were more frequent in LCL than in PBMC. Moreover, higher levels of chromosomal aberrations were observed in G{sub 2}-treated PBMC compared to LCL. Concerning {gamma}-H2AX measurements, phosphorylation levels 1 h after treatment and dephosphorylation kinetics were basically similar in LCL and in PBMC. However, while Spearman's test showed a strong correlation between the results obtained in replicated experiments with PBMC, high inter-experimental variability and poor reproducibility was observed in the experiments performed with LCL, possibly due to the intrinsic instability of LCL. In summary, both the analysis of {gamma}-H2AX and the evaluation of chromosome damage highlighted a larger inter-experimental variability in the results obtained with LCL compared to PBMC. Noteworthy, the two set of results proved to lack any significant correlation at the individual level. These results indicate that LCL may be unsuitable for investigating genotype

  4. Development of a novel method to create double-strand break repair fingerprints using next-generation sequencing.

    Science.gov (United States)

    Soong, Chen-Pang; Breuer, Gregory A; Hannon, Ryan A; Kim, Savina D; Salem, Ahmed F; Wang, Guilin; Yu, Ruoxi; Carriero, Nicholas J; Bjornson, Robert; Sundaram, Ranjini K; Bindra, Ranjit S

    2015-02-01

    Efficient DNA double-strand break (DSB) repair is a critical determinant of cell survival in response to DNA damaging agents, and it plays a key role in the maintenance of genomic integrity. Homologous recombination (HR) and non-homologous end-joining (NHEJ) represent the two major pathways by which DSBs are repaired in mammalian cells. We now understand that HR and NHEJ repair are composed of multiple sub-pathways, some of which still remain poorly understood. As such, there is great interest in the development of novel assays to interrogate these key pathways, which could lead to the development of novel therapeutics, and a better understanding of how DSBs are repaired. Furthermore, assays which can measure repair specifically at endogenous chromosomal loci are of particular interest, because of an emerging understanding that chromatin interactions heavily influence DSB repair pathway choice. Here, we present the design and validation of a novel, next-generation sequencing-based approach to study DSB repair at chromosomal loci in cells. We demonstrate that NHEJ repair "fingerprints" can be identified using our assay, which are dependent on the status of key DSB repair proteins. In addition, we have validated that our system can be used to detect dynamic shifts in DSB repair activity in response to specific perturbations. This approach represents a unique alternative to many currently available DSB repair assays, which typical rely on the expression of reporter genes as an indirect read-out for repair. As such, we believe this tool will be useful for DNA repair researchers to study NHEJ repair in a high-throughput and sensitive manner, with the capacity to detect subtle changes in DSB repair patterns that was not possible previously. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. MTE1 Functions with MPH1 in Double-Strand Break Repair.

    Science.gov (United States)

    Yimit, Askar; Kim, TaeHyung; Anand, Ranjith P; Meister, Sarah; Ou, Jiongwen; Haber, James E; Zhang, Zhaolei; Brown, Grant W

    2016-05-01

    Double-strand DNA breaks occur upon exposure of cells to ionizing radiation and certain chemical agents or indirectly through replication fork collapse at DNA damage sites. If left unrepaired, double-strand breaks can cause genome instability and cell death, and their repair can result in loss of heterozygosity. In response to DNA damage, proteins involved in double-strand break repair by homologous recombination relocalize into discrete nuclear foci. We identified 29 proteins that colocalize with recombination repair protein Rad52 in response to DNA damage. Of particular interest, Ygr042w/Mte1, a protein of unknown function, showed robust colocalization with Rad52. Mte1 foci fail to form when the DNA helicase gene MPH1 is absent. Mte1 and Mph1 form a complex and are recruited to double-strand breaks in vivo in a mutually dependent manner. MTE1 is important for resolution of Rad52 foci during double-strand break repair and for suppressing break-induced replication. Together our data indicate that Mte1 functions with Mph1 in double-strand break repair. Copyright © 2016 by the Genetics Society of America.

  6. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in ...

  7. Mouse RAD54 affects DNA double-strand break repair and sister chromatid exchange

    NARCIS (Netherlands)

    H.B. Beverloo (Berna); R.D. Johnson (Roger); M. Jasin (Maria); R. Kanaar (Roland); J.H.J. Hoeijmakers (Jan); M.L.G. Dronkert (Mies)

    2000-01-01

    textabstractCells can achieve error-free repair of DNA double-strand breaks (DSBs) by homologous recombination through gene conversion with or without crossover. In contrast, an alternative homology-dependent DSB repair pathway, single-strand annealing (SSA), results in deletions. In this study, we

  8. Parp1-XRCC1 and the repair of DNA double strand breaks in mouse round spermatids.

    NARCIS (Netherlands)

    Ahmed, E.A.; Boer, P. de; Philippens, M.E.P.; Kal, H.B.; Rooij, D.G. de

    2010-01-01

    The repair of DNA double strand breaks (DSBs) in male germ cells is slower and differently regulated compared to that in somatic cells. Round spermatids show DSB repair and are radioresistant to apoptosis induction. Mutation induction studies using ionizing irradiation, indicated a high frequency of

  9. Genetic and environmental influence on DNA strand break repair: a twin study

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander

    2013-01-01

    Accumulation of DNA damage deriving from exogenous and endogenous sources has significant consequences for cellular survival, and is implicated in aging, cancer, and neurological diseases. Different DNA repair pathways have evolved in order to maintain genomic stability. Genetic and environmental......-strand breaks), and some of the most hazardous lesions (DNA double-strand breaks). DNA damage signaling response (Gamma-H2AX signaling), relative amount of endogenous damage, and DNA-strand break repair capacities were studied in peripheral blood mononuclear cells from 198 twins (94 monozygotic and 104...

  10. Phenotypic Analysis of ATM Protein Kinase in DNA Double-Strand Break Formation and Repair.

    Science.gov (United States)

    Mian, Elisabeth; Wiesmüller, Lisa

    2017-01-01

    Ataxia telangiectasia mutated (ATM) encodes a serine/threonine protein kinase, which is involved in various regulatory processes in mammalian cells. Its best-known role is apical activation of the DNA damage response following generation of DNA double-strand breaks (DSBs). When DSBs appear, sensor and mediator proteins are recruited, activating transducers such as ATM, which in turn relay a widespread signal to a multitude of downstream effectors. ATM mutation causes Ataxia telangiectasia (AT), whereby the disease phenotype shows differing characteristics depending on the underlying ATM mutation. However, all phenotypes share progressive neurodegeneration and marked predisposition to malignancies at the organismal level and sensitivity to ionizing radiation and chromosome aberrations at the cellular level. Expression and localization of the ATM protein can be determined via western blotting and immunofluorescence microscopy; however, detection of subtle alterations such as resulting from amino acid exchanges rather than truncating mutations requires functional testing. Previous studies on the role of ATM in DSB repair, which connects with radiosensitivity and chromosomal stability, gave at first sight contradictory results. To systematically explore the effects of clinically relevant ATM mutations on DSB repair, we engaged a series of lymphoblastoid cell lines (LCLs) derived from AT patients and controls. To examine DSB repair both in a quantitative and qualitative manners, we used an EGFP-based assay comprising different substrates for distinct DSB repair mechanisms. In this way, we demonstrated that particular signaling defects caused by individual ATM mutations led to specific DSB repair phenotypes. To explore the impact of ATM on carcinogenic chromosomal aberrations, we monitored chromosomal breakage at a breakpoint cluster region hotspot within the MLL gene that has been associated with therapy-related leukemia. PCR-based MLL-breakage analysis of HeLa cells

  11. Cell cycle-regulated centers of DNA double-strand break repair

    DEFF Research Database (Denmark)

    Lisby, Michael; Antúnez de Mayolo, Adriana; Mortensen, Uffe H

    2003-01-01

    In eukaryotes, homologous recombination is an important pathway for the repair of DNA double-strand breaks. We have studied this process in living cells in the yeast Saccharomyces cerevisiae using Rad52 as a cell biological marker. In response to DNA damage, Rad52 redistributes itself and forms...... foci specifically during S phase. We have shown previously that Rad52 foci are centers of DNA repair where multiple DNA double-strand breaks colocalize. Here we report a correlation between the timing of Rad52 focus formation and modification of the Rad52 protein. In addition, we show that the two ends...... of a double-strand break are held tightly together in the majority of cells. Interestingly, in a small but significant fraction of the S phase cells, the two ends of a break separate suggesting that mechanisms exist to reassociate and align these ends for proper DNA repair....

  12. Efficient repair of DNA breaks in Drosophila: evidence for single-strand annealing and competition with other repair pathways.

    Science.gov (United States)

    Preston, Christine R; Engels, William; Flores, Carlos

    2002-06-01

    We show evidence that DNA double-strand breaks induced in the Drosophila germ line can be repaired very efficiently by the single-strand annealing (SSA) mechanism. A double-strand break was made between two copies of a 1290-bp direct repeat by mobilizing a P transposon. In >80% of the progeny that acquired this chromosome, repair resulted in loss of the P element and loss of one copy of the repeat, as observed in SSA. The frequency of this repair was much greater than seen for gene conversion using an allelic template, which is only approximately 7%. A similar structure, but with a smaller duplication of only 158 bp, also yielded SSA-like repair events, but at a reduced frequency, and gave rise to some products by repair pathways other than SSA. The 1290-bp repeats carried two sequence polymorphisms that were examined in the products. The allele nearest to a nick in the putative heteroduplex intermediate was lost most often. This bias is predicted by the SSA model, although other models could account for it. We conclude that SSA is the preferred repair pathway in Drosophila for DNA breaks between sequence repeats, and it competes with gene conversion by the synthesis-dependent strand annealing (SDSA) pathway.

  13. Numt-mediated double-strand break repair mitigates deletions during primate genome evolution.

    Directory of Open Access Journals (Sweden)

    Einat Hazkani-Covo

    2008-10-01

    Full Text Available Non-homologous end joining (NHEJ is the major mechanism of double-strand break repair (DSBR in mammalian cells. NHEJ has traditionally been inferred from experimental systems involving induced double strand breaks (DSBs. Whether or not the spectrum of repair events observed in experimental NHEJ reflects the repair of natural breaks by NHEJ during chromosomal evolution is an unresolved issue. In primate phylogeny, nuclear DNA sequences of mitochondrial origin, numts, are inserted into naturally occurring chromosomal breaks via NHEJ. Thus, numt integration sites harbor evidence for the mechanisms that act on the genome over evolutionary timescales. We have identified 35 and 55 lineage-specific numts in the human and chimpanzee genomes, respectively, using the rhesus monkey genome as an outgroup. One hundred and fifty two numt-chromosome fusion points were classified based on their repair patterns. Repair involving microhomology and repair leading to nucleotide additions were detected. These repair patterns are within the experimentally determined spectrum of classical NHEJ, suggesting that information from experimental systems is representative of broader genetic loci and end configurations. However, in incompatible DSBR events, small deletions always occur, whereas in 54% of numt integration events examined, no deletions were detected. Numts show a statistically significant reduction in deletion frequency, even in comparison to DSBR involving filler DNA. Therefore, numts show a unique mechanism of integration via NHEJ. Since the deletion frequency during numt insertion is low, native overhangs of chromosome breaks are preserved, allowing us to determine that 24% of the analyzed breaks are cohesive with overhangs of up to 11 bases. These data represent, to the best of our knowledge, the most comprehensive description of the structure of naturally occurring DSBs. We suggest a model in which the sealing of DSBs by numts, and probably by other filler

  14. Persistent damaged bases in DNA allow mutagenic break repair in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Jessica M Moore

    2017-07-01

    Full Text Available Bacteria, yeast and human cancer cells possess mechanisms of mutagenesis upregulated by stress responses. Stress-inducible mutagenesis potentially accelerates adaptation, and may provide important models for mutagenesis that drives cancers, host pathogen interactions, antibiotic resistance and possibly much of evolution generally. In Escherichia coli repair of double-strand breaks (DSBs becomes mutagenic, using low-fidelity DNA polymerases under the control of the SOS DNA-damage response and RpoS general stress response, which upregulate and allow the action of error-prone DNA polymerases IV (DinB, II and V to make mutations during repair. Pol IV is implied to compete with and replace high-fidelity DNA polymerases at the DSB-repair replisome, causing mutagenesis. We report that up-regulated Pol IV is not sufficient for mutagenic break repair (MBR; damaged bases in the DNA are also required, and that in starvation-stressed cells, these are caused by reactive-oxygen species (ROS. First, MBR is reduced by either ROS-scavenging agents or constitutive activation of oxidative-damage responses, both of which reduce cellular ROS levels. The ROS promote MBR other than by causing DSBs, saturating mismatch repair, oxidizing proteins, or inducing the SOS response or the general stress response. We find that ROS drive MBR through oxidized guanines (8-oxo-dG in DNA, in that overproduction of a glycosylase that removes 8-oxo-dG from DNA prevents MBR. Further, other damaged DNA bases can substitute for 8-oxo-dG because ROS-scavenged cells resume MBR if either DNA pyrimidine dimers or alkylated bases are induced. We hypothesize that damaged bases in DNA pause the replisome and allow the critical switch from high fidelity to error-prone DNA polymerases in the DSB-repair replisome, thus allowing MBR. The data imply that in addition to the indirect stress-response controlled switch to MBR, a direct cis-acting switch to MBR occurs independently of DNA breakage

  15. Persistent damaged bases in DNA allow mutagenic break repair in Escherichia coli.

    Science.gov (United States)

    Moore, Jessica M; Correa, Raul; Rosenberg, Susan M; Hastings, P J

    2017-07-01

    Bacteria, yeast and human cancer cells possess mechanisms of mutagenesis upregulated by stress responses. Stress-inducible mutagenesis potentially accelerates adaptation, and may provide important models for mutagenesis that drives cancers, host pathogen interactions, antibiotic resistance and possibly much of evolution generally. In Escherichia coli repair of double-strand breaks (DSBs) becomes mutagenic, using low-fidelity DNA polymerases under the control of the SOS DNA-damage response and RpoS general stress response, which upregulate and allow the action of error-prone DNA polymerases IV (DinB), II and V to make mutations during repair. Pol IV is implied to compete with and replace high-fidelity DNA polymerases at the DSB-repair replisome, causing mutagenesis. We report that up-regulated Pol IV is not sufficient for mutagenic break repair (MBR); damaged bases in the DNA are also required, and that in starvation-stressed cells, these are caused by reactive-oxygen species (ROS). First, MBR is reduced by either ROS-scavenging agents or constitutive activation of oxidative-damage responses, both of which reduce cellular ROS levels. The ROS promote MBR other than by causing DSBs, saturating mismatch repair, oxidizing proteins, or inducing the SOS response or the general stress response. We find that ROS drive MBR through oxidized guanines (8-oxo-dG) in DNA, in that overproduction of a glycosylase that removes 8-oxo-dG from DNA prevents MBR. Further, other damaged DNA bases can substitute for 8-oxo-dG because ROS-scavenged cells resume MBR if either DNA pyrimidine dimers or alkylated bases are induced. We hypothesize that damaged bases in DNA pause the replisome and allow the critical switch from high fidelity to error-prone DNA polymerases in the DSB-repair replisome, thus allowing MBR. The data imply that in addition to the indirect stress-response controlled switch to MBR, a direct cis-acting switch to MBR occurs independently of DNA breakage, caused by ROS

  16. JNK Phosphorylates SIRT6 to Stimulate DNA Double-Strand Break Repair in Response to Oxidative Stress by Recruiting PARP1 to DNA Breaks

    Directory of Open Access Journals (Sweden)

    Michael Van Meter

    2016-09-01

    Full Text Available The accumulation of damage caused by oxidative stress has been linked to aging and to the etiology of numerous age-related diseases. The longevity gene, sirtuin 6 (SIRT6, promotes genome stability by facilitating DNA repair, especially under oxidative stress conditions. Here we uncover the mechanism by which SIRT6 is activated by oxidative stress to promote DNA double-strand break (DSB repair. We show that the stress-activated protein kinase, c-Jun N-terminal kinase (JNK, phosphorylates SIRT6 on serine 10 in response to oxidative stress. This post-translational modification facilitates the mobilization of SIRT6 to DNA damage sites and is required for efficient recruitment of poly (ADP-ribose polymerase 1 (PARP1 to DNA break sites and for efficient repair of DSBs. Our results demonstrate a post-translational mechanism regulating SIRT6, and they provide the link between oxidative stress signaling and DNA repair pathways that may be critical for hormetic response and longevity assurance.

  17. BRCA1 requirement for the fidelity of plasmid DNA double-strand break repair in cultured breast epithelial cells.

    Science.gov (United States)

    Thompson, Eric G; Fares, Hanna; Dixon, Kathleen

    2012-01-01

    The tumor suppressor breast cancer susceptibility protein 1 (BRCA1) protects our cells from genomic instability in part by facilitating the efficient repair of DNA double-strand breaks (DSBs). BRCA1 promotes the error-free repair of DSBs through homologous recombination and is also implicated in the regulation of nonhomologous end joining (NHEJ) repair fidelity. Here, we investigate the role of BRCA1 in NHEJ repair mutagenesis following a DSB. We examined the frequency of microhomology-mediated end joining (MMEJ) and the fidelity of DSB repair relative to BRCA1 protein levels in both control and tumorigenic breast epithelial cells. In addition to altered BRCA1 protein levels, we tested the effects of cellular exposure to mirin, an inhibitor of meiotic recombination enzyme 11 (Mre11) 3'-5'-exonuclease activity. Knockdown or loss of BRCA1 protein resulted in an increased frequency of overall plasmid DNA mutagenesis and MMEJ following a DSB. Inhibition of Mre11-exonuclease activity with mirin significantly decreased the occurrence of MMEJ, but did not considerably affect the overall mutagenic frequency of plasmid DSB repair. The results suggest that BRCA1 protects DNA from mutagenesis during nonhomologous DSB repair in plasmid-based assays. The increased frequency of DSB mutagenesis and MMEJ repair in the absence of BRCA1 suggests a potential mechanism for carcinogenesis. Copyright © 2011 Wiley Periodicals, Inc.

  18. Age and gender effects on DNA strand break repair in peripheral blood mononuclear cells

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander

    2013-01-01

    Exogenous and endogenous damage to DNA is constantly challenging the stability of our genome. This DNA damage increase the frequency of errors in DNA replication, thus causing point mutations or chromosomal rearrangements and has been implicated in aging, cancer, and neurodegenerative diseases....... Therefore, efficient DNA repair is vital for the maintenance of genome stability. The general notion has been that DNA repair capacity decreases with age although there are conflicting results. Here, we focused on potential age-associated changes in DNA damage response and the capacities of repairing DNA...... single-strand breaks (SSBs) and double-strand breaks (DSBs) in human peripheral blood mononuclear cells (PBMCs). Of these lesions, DSBs are the least frequent but the most dangerous for cells. We have measured the level of endogenous SSBs, SSB repair capacity, γ-H2AX response, and DSB repair capacity...

  19. Meiotic versus Mitotic Recombination: Two Different Routes for Double-Strand Break Repair

    Science.gov (United States)

    Andersen, Sabrina L.; Sekelsky, Jeff

    2011-01-01

    Summary Studies in the yeast Saccharomyces cerevisiae have validated the major features of the double-strand break repair (DSBR) model as an accurate representation of the pathway through which meiotic crossovers are produced. This success has led to this model being invoked to explain double-strand break (DSB) repair in other contexts. However, most non-crossover recombinants generated during S. cerevisiae meiosis do not arise via a DSBR pathway. Furthermore, and it is becoming increasing clear that DSBR is a minor pathway for recombinational repair of DSBs that occur in mitotically proliferating cells; rather, the synthesis-dependent strand annealing (SDSA) model appears to describe mitotic DSB repair more accurately. Fundamental dissimilarities between meiotic and mitotic recombination are not unexpected, since meiotic recombination serves a very different purpose (accurate chromosome segregation, which requires crossovers) than mitotic recombination (repair of DNA damage, which typically generates non-crossovers). PMID:20967781

  20. Impact of a stress-inducible switch to mutagenic repair of DNA breaks on mutation in Escherichia coli.

    Science.gov (United States)

    Shee, Chandan; Gibson, Janet L; Darrow, Michele C; Gonzalez, Caleb; Rosenberg, Susan M

    2011-08-16

    Basic ideas about the constancy and randomness of mutagenesis that drives evolution were challenged by the discovery of mutation pathways activated by stress responses. These pathways could promote evolution specifically when cells are maladapted to their environment (i.e., are stressed). However, the clearest example--a general stress-response-controlled switch to error-prone DNA break (double-strand break, DSB) repair--was suggested to be peculiar to an Escherichia coli F' conjugative plasmid, not generally significant, and to occur by an alternative stress-independent mechanism. Moreover, mechanisms of spontaneous mutation in E. coli remain obscure. First, we demonstrate that this same mechanism occurs in chromosomes of starving F(-) E. coli. I-SceI endonuclease-induced chromosomal DSBs increase mutation 50-fold, dependent upon general/starvation- and DNA-damage-stress responses, DinB error-prone DNA polymerase, and DSB-repair proteins. Second, DSB repair is also mutagenic if the RpoS general-stress-response activator is expressed in unstressed cells, illustrating a stress-response-controlled switch to mutagenic repair. Third, DSB survival is not improved by RpoS or DinB, indicating that mutagenesis is not an inescapable byproduct of repair. Importantly, fourth, fully half of spontaneous frame-shift and base-substitution mutation during starvation also requires the same stress-response, DSB-repair, and DinB proteins. These data indicate that DSB-repair-dependent stress-induced mutation, driven by spontaneous DNA breaks, is a pathway that cells usually use and a major source of spontaneous mutation. These data also rule out major alternative models for the mechanism. Mechanisms that couple mutagenesis to stress responses can allow cells to evolve rapidly and responsively to their environment.

  1. Repair on the go: E. coli maintains a high proliferation rate while repairing a chronic DNA double-strand break.

    Directory of Open Access Journals (Sweden)

    Elise Darmon

    Full Text Available DNA damage checkpoints exist to promote cell survival and the faithful inheritance of genetic information. It is thought that one function of such checkpoints is to ensure that cell division does not occur before DNA damage is repaired. However, in unicellular organisms, rapid cell multiplication confers a powerful selective advantage, leading to a dilemma. Is the activation of a DNA damage checkpoint compatible with rapid cell multiplication? By uncoupling the initiation of DNA replication from cell division, the Escherichia coli cell cycle offers a solution to this dilemma. Here, we show that a DNA double-strand break, which occurs once per replication cycle, induces the SOS response. This SOS induction is needed for cell survival due to a requirement for an elevated level of expression of the RecA protein. Cell division is delayed, leading to an increase in average cell length but with no detectable consequence on mutagenesis and little effect on growth rate and viability. The increase in cell length caused by chronic DNA double-strand break repair comprises three components: two types of increase in the unit cell size, one independent of SfiA and SlmA, the other dependent of the presence of SfiA and the absence of SlmA, and a filamentation component that is dependent on the presence of either SfiA or SlmA. These results imply that chronic checkpoint induction in E. coli is compatible with rapid cell multiplication. Therefore, under conditions of chronic low-level DNA damage, the SOS checkpoint operates seamlessly in a cell cycle where the initiation of DNA replication is uncoupled from cell division.

  2. Differential requirement for SUB1 in chromosomal and plasmid double-strand DNA break repair.

    Directory of Open Access Journals (Sweden)

    Lijian Yu

    Full Text Available Non homologous end joining (NHEJ is an important process that repairs double strand DNA breaks (DSBs in eukaryotic cells. Cells defective in NHEJ are unable to join chromosomal breaks. Two different NHEJ assays are typically used to determine the efficiency of NHEJ. One requires NHEJ of linearized plasmid DNA transformed into the test organism; the other requires NHEJ of a single chromosomal break induced either by HO endonuclease or the I-SceI restriction enzyme. These two assays are generally considered equivalent and rely on the same set of NHEJ genes. PC4 is an abundant DNA binding protein that has been suggested to stimulate NHEJ. Here we tested the role of PC4's yeast homolog SUB1 in repair of DNA double strand breaks using different assays. We found SUB1 is required for NHEJ repair of DSBs in plasmid DNA, but not in chromosomal DNA. Our results suggest that these two assays, while similar are not equivalent and that repair of plasmid DNA requires additional factor(s that are not required for NHEJ repair of chromosomal double-strand DNA breaks. Possible roles for Sub1 proteins in NHEJ of plasmid DNA are discussed.

  3. Homology Requirements and Competition between Gene Conversion and Break-Induced Replication during Double-Strand Break Repair.

    Science.gov (United States)

    Mehta, Anuja; Beach, Annette; Haber, James E

    2017-02-02

    Saccharomyces cerevisiae mating-type switching is initiated by a double-strand break (DSB) at MATa, leaving one cut end perfectly homologous to the HMLα donor, while the second end must be processed to remove a non-homologous tail before completing repair by gene conversion (GC). When homology at the matched end is ≤150 bp, efficient repair depends on the recombination enhancer, which tethers HMLα near the DSB. Thus, homology shorter than an apparent minimum efficient processing segment can be rescued by tethering the donor near the break. When homology at the second end is ≤150 bp, second-end capture becomes inefficient and repair shifts from GC to break-induced replication (BIR). But when pol32 or pif1 mutants block BIR, GC increases 3-fold, indicating that the steps blocked by these mutations are reversible. With short second-end homology, absence of the RecQ helicase Sgs1 promotes gene conversion, whereas deletion of the FANCM-related Mph1 helicase promotes BIR. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. DNA-PKcs structure suggests an allosteric mechanism modulating DNA double-strand break repair.

    Science.gov (United States)

    Sibanda, Bancinyane L; Chirgadze, Dimitri Y; Ascher, David B; Blundell, Tom L

    2017-02-03

    DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is a central component of nonhomologous end joining (NHEJ), repairing DNA double-strand breaks that would otherwise lead to apoptosis or cancer. We have solved its structure in complex with the C-terminal peptide of Ku80 at 4.3 angstrom resolution using x-ray crystallography. We show that the 4128-amino acid structure comprises three large structural units: the N-terminal unit, the Circular Cradle, and the Head. Conformational differences between the two molecules in the asymmetric unit are correlated with changes in accessibility of the kinase active site, which are consistent with an allosteric mechanism to bring about kinase activation. The location of KU80ct194 in the vicinity of the breast cancer 1 (BRCA1) binding site suggests competition with BRCA1, leading to pathway selection between NHEJ and homologous recombination. Copyright © 2017, American Association for the Advancement of Science.

  5. Rad52 and Ku bind to different DNA structures produced early in double-strand break repair.

    Science.gov (United States)

    Ristic, Dejan; Modesti, Mauro; Kanaar, Roland; Wyman, Claire

    2003-09-15

    DNA double-strand breaks are repaired by one of two main pathways, non-homologous end joining or homologous recombination. A competition for binding to DNA ends by Ku and Rad52, proteins required for non-homologous end joining and homologous recombination, respectively, has been proposed to determine the choice of repair pathway. In order to test this idea directly, we compared Ku and human Rad52 binding to different DNA substrates. How ever, we found no evidence that these proteins would compete for binding to the same broken DNA ends. Ku bound preferentially to DNA with free ends. Under the same conditions, Rad52 did not bind preferentially to DNA ends. Using a series of defined substrates we showed that it is single-stranded DNA and not DNA ends that were preferentially bound by Rad52. In addition, Rad52 aggregated DNA, bringing different single-stranded DNAs in close proximity. This activity was independent of the presence of DNA ends and of the ability of the single-stranded sequences to form extensive base pairs. Based on these DNA binding characteristics it is unlikely that Rad52 and Ku compete as 'gatekeepers' of different DNA double-strand break repair pathways. Rather, they interact with different DNA substrates produced early in DNA double-strand break repair.

  6. Expansions and contractions in a tandem repeat induced by double-strand break repair.

    Science.gov (United States)

    Pâques, F; Leung, W Y; Haber, J E

    1998-04-01

    Repair of a double-strand break (DSB) in yeast can induce very frequent expansions and contractions in a tandem array of 375-bp repeats. These results strongly suggest that DSB repair can be a major source of amplification of tandemly repeated sequences. Most of the DSB repair events are not associated with crossover. Rearrangements appear in 50% of these repaired recipient molecules. In contrast, the donor template nearly always remains unchanged. Among the rare crossover events, similar rearrangements are found. These results cannot readily be explained by the gap repair model of Szostak et al. (J. W. Szostak, T. L. Orr-Weaver, R. J. Rothstein, and F. W. Stahl, Cell 33:25-35, 1983) but can be explained by synthesis-dependent strand annealing (SDSA) models that allow for crossover. Support for SDSA models is provided by a demonstration that a single DSB repair event can use two donor templates located on two different chromosomes.

  7. DEK is required for homologous recombination repair of DNA breaks

    DEFF Research Database (Denmark)

    Smith, Eric A; Gole, Boris; Willis, Nicholas A

    2017-01-01

    mice. Furthermore, DEK knockout cells were sensitive to apoptosis with NHEJ inhibition. Thus, we hypothesized DEK plays additional roles in homologous recombination (HR). Using episomal and integrated reporters, we demonstrate that HR repair of conventional DSBs is severely compromised in DEK...

  8. TRF2 is required for repair of nontelomeric DNA double-strand breaks by homologous recombination

    OpenAIRE

    Mao, Zhiyong; Seluanov, Andrei; Jiang, Ying; Gorbunova, Vera

    2007-01-01

    TRF2 (telomeric repeat binding factor 2) is an essential component of the telomeric cap, where it forms and stabilizes the T-loop junctions. TRF2 forms the T-loops by stimulating strand invasion of the 3′ overhang into duplex DNA. TRF2 also has been shown to localize to nontelomeric DNA double-strand breaks, but its functional role in DNA repair has not been examined. Here, we present evidence that TRF2 is involved in homologous recombination (HR) repair of nontelomeric double-strand breaks. ...

  9. APOBEC3 cytidine deaminases in double-strand DNA break repair and cancer promotion.

    Science.gov (United States)

    Nowarski, Roni; Kotler, Moshe

    2013-06-15

    High frequency of cytidine to thymidine conversions was identified in the genome of several types of cancer cells. In breast cancer cells, these mutations are clustered in long DNA regions associated with single-strand DNA (ssDNA), double-strand DNA breaks (DSB), and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs, and clustered mutations. Cancer Res; 73(12); 3494-8. ©2013 AACR. ©2013 AACR.

  10. Breaking bad: The mutagenic effect of DNA repair

    Science.gov (United States)

    2015-01-01

    Species survival depends on the faithful replication of genetic information, which is continually monitored and maintained by DNA repair pathways thatcorrect replication errors and the thousands of lesions that arise daily from the inherent chemical lability of DNA and the effects of genotoxic agents. Nonetheless,neutrally evolving DNA (not under purifying selection) accumulates base substitutions with time (the neutral mutation rate). Thus, repair processes are not 100% efficient. The neutral mutation rate varies both between and within chromosomes. For example it is 10 – 50 fold higher at CpGsthan at non-CpG positions. Interestingly, the neutral mutation rate at non-CpG sites is positively correlated with CpG content. Althoughthe basis of this correlation was not immediately apparent,some bioinformatic results were consistent with the induction of non-CpGmutations byDNA repairat flanking CpG sites. Recent studies with a model system showed that in vivo repair of preformed lesions (mismatches, abasic sites, single stranded nicks) can in factinduce mutations in flanking DNA. Mismatch repair (MMR) is an essential component for repair-induced mutations, which can occur as distant as 5 kb from the introduced lesions. Most, but not all, mutations involved the C of TpCpN (G of NpGpA) which is the target sequence of the C-preferringsingle-stranded DNA specific APOBEC deaminases. APOBEC-mediated mutations are not limited to our model system: Recent studies by others showed that some tumors harbor mutations with the same signature, as can intermediates in RNA-guided endonuclease-mediated genome editing. APOBEC deaminases participate in normal physiological functions such as generating mutations that inactivate viruses or endogenous retrotransposons, or that enhance immunoglobulin diversity in B cells. The recruitment of normally physiological errorprone processes during DNA repairwould have important implications for disease, aging and evolution. This perspective briefly

  11. Repair Pathway Choices and Consequences at the Double-Strand Break

    Science.gov (United States)

    Ceccaldi, Raphael; Rondinelli, Beatrice; D’Andrea, Alan D.

    2016-01-01

    DNA double-strand breaks (DSBs) are cytotoxic lesions that threaten genomic integrity. Failure to repair a DSB has deleterious consequences, including genomic instability and cell death. Indeed, misrepair of DSBs can lead to inappropriate end-joining events, which commonly underlie oncogenic transformation due to chromosomal translocations. Typically, cells employ two main mechanisms to repair DSBs: homologous recombination (HR) and classical nonhomologous end joining (C-NHEJ). In addition, alternative error-prone DSB repair pathways, namely alternative end joining (alt-EJ) and single-strand annealing (SSA), have been recently shown to operate in many different conditions and to contribute to genome rearrangements and oncogenic transformation. Here, we review the mechanisms regulating DSB repair pathway choice, together with the potential interconnections between HR and the annealing-dependent error-prone DSB repair pathways. PMID:26437586

  12. Regulation of DNA double-strand break repair by ubiquitin and ubiquitin-like modifiers

    DEFF Research Database (Denmark)

    Schwertman, Petra; Bekker-Jensen, Simon; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions. The swift recognition and faithful repair of such damage is crucial for the maintenance of genomic stability, as well as for cell and organismal fitness. Signalling by ubiquitin, SUMO and other ubiquitin-like modifiers (UBLs...

  13. Repair and genetic consequences of DNA double strand breaks during animal development

    NARCIS (Netherlands)

    Lemmens, Bennie Benjamin Lodewijk Gerardus

    2014-01-01

    The genetic code of life is stored in DNA molecules that consist of two parallel strands of coupled nucleotides that form a DNA double helix. One of the most deleterious forms of DNA damage is a DNA double-strand break (DSB) in which both strands of the helix are broken. When not repaired adequately

  14. RECQL4 Promotes DNA End Resection in Repair of DNA Double-Strand Breaks

    DEFF Research Database (Denmark)

    Lu, Huiming; Shamanna, Raghavendra A; Keijzers, Guido

    2016-01-01

    The RecQ helicase RECQL4, mutated in Rothmund-Thomson syndrome, regulates genome stability, aging, and cancer. Here, we identify a crucial role for RECQL4 in DNA end resection, which is the initial and an essential step of homologous recombination (HR)-dependent DNA double-strand break repair (DSBR...... interacts with CtIP via its N-terminal domain and promotes CtIP recruitment to the MRN complex at DSBs. Moreover, inactivation of RECQL4's helicase activity impairs DNA end processing and HR-dependent DSBR without affecting its interaction with MRE11 and CtIP, suggesting an important role for RECQL4's......). Depletion of RECQL4 severely reduces HR-mediated repair and 5' end resection in vivo. RECQL4 physically interacts with MRE11-RAD50-NBS1 (MRN), which senses DSBs and initiates DNA end resection with CtIP. The MRE11 exonuclease regulates the retention of RECQL4 at laser-induced DSBs. RECQL4 also directly...

  15. Dynamic dependence on ATR and ATM for double-strand break repair in human embryonic stem cells and neural descendants.

    Directory of Open Access Journals (Sweden)

    Bret R Adams

    2010-04-01

    Full Text Available The DNA double-strand break (DSB is the most toxic form of DNA damage. Studies aimed at characterizing DNA repair during development suggest that homologous recombination repair (HRR is more critical in pluripotent cells compared to differentiated somatic cells in which nonhomologous end joining (NHEJ is dominant. We have characterized the DNA damage response (DDR and quality of DNA double-strand break (DSB repair in human embryonic stem cells (hESCs, and in vitro-derived neural cells. Resolution of ionizing radiation-induced foci (IRIF was used as a surrogate for DSB repair. The resolution of gamma-H2AX foci occurred at a slower rate in hESCs compared to neural progenitors (NPs and astrocytes perhaps reflective of more complex DSB repair in hESCs. In addition, the resolution of RAD51 foci, indicative of active homologous recombination repair (HRR, showed that hESCs as well as NPs have high capacity for HRR, whereas astrocytes do not. Importantly, the ATM kinase was shown to be critical for foci formation in astrocytes, but not in hESCs, suggesting that the DDR is different in these cells. Blocking the ATM kinase in astrocytes not only prevented the formation but also completely disassembled preformed repair foci. The ability of hESCs to form IRIF was abrogated with caffeine and siRNAs targeted against ATR, implicating that hESCs rely on ATR, rather than ATM for regulating DSB repair. This relationship dynamically changed as cells differentiated. Interestingly, while the inhibition of the DNA-PKcs kinase (and presumably non-homologous endjoining [NHEJ] in astrocytes slowed IRIF resolution it did not in hESCs, suggesting that repair in hESCs does not utilize DNA-PKcs. Altogether, our results show that hESCs have efficient DSB repair that is largely ATR-dependent HRR, whereas astrocytes critically depend on ATM for NHEJ, which, in part, is DNA-PKcs-independent.

  16. DNA repair goes hip-hop: SMARCA and CHD chromatin remodellers join the break dance.

    Science.gov (United States)

    Rother, Magdalena B; van Attikum, Haico

    2017-10-05

    Proper signalling and repair of DNA double-strand breaks (DSB) is critical to prevent genome instability and diseases such as cancer. The packaging of DNA into chromatin, however, has evolved as a mere obstacle to these DSB responses. Posttranslational modifications and ATP-dependent chromatin remodelling help to overcome this barrier by modulating nucleosome structures and allow signalling and repair machineries access to DSBs in chromatin. Here we recap our current knowledge on how ATP-dependent SMARCA- and CHD-type chromatin remodellers alter chromatin structure during the signalling and repair of DSBs and discuss how their dysfunction impacts genome stability and human disease.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Authors.

  17. CRISPR/Cas9-Induced Double-Strand Break Repair in Arabidopsis Nonhomologous End-Joining Mutants

    Science.gov (United States)

    Shen, Hexi; Strunks, Gary D.; Klemann, Bart J. P. M.; Hooykaas, Paul J. J.; de Pater, Sylvia

    2016-01-01

    Double-strand breaks (DSBs) are one of the most harmful DNA lesions. Cells utilize two main pathways for DSB repair: homologous recombination (HR) and nonhomologous end-joining (NHEJ). NHEJ can be subdivided into the KU-dependent classical NHEJ (c-NHEJ) and the more error-prone KU-independent backup-NHEJ (b-NHEJ) pathways, involving the poly (ADP-ribose) polymerases (PARPs). However, in the absence of these factors, cells still seem able to adequately maintain genome integrity, suggesting the presence of other b-NHEJ repair factors or pathways independent from KU and PARPs. The outcome of DSB repair by NHEJ pathways can be investigated by using artificial sequence-specific nucleases such as CRISPR/Cas9 to induce DSBs at a target of interest. Here, we used CRISPR/Cas9 for DSB induction at the Arabidopsis cruciferin 3 (CRU3) and protoporphyrinogen oxidase (PPO) genes. DSB repair outcomes via NHEJ were analyzed using footprint analysis in wild-type plants and plants deficient in key factors of c-NHEJ (ku80), b-NHEJ (parp1 parp2), or both (ku80 parp1 parp2). We found that larger deletions of >20 bp predominated after DSB repair in ku80 and ku80 parp1 parp2 mutants, corroborating with a role of KU in preventing DSB end resection. Deletion lengths did not significantly differ between ku80 and ku80 parp1 parp2 mutants, suggesting that a KU- and PARP-independent b-NHEJ mechanism becomes active in these mutants. Furthermore, microhomologies and templated insertions were observed at the repair junctions in the wild type and all mutants. Since these characteristics are hallmarks of polymerase θ-mediated DSB repair, we suggest a possible role for this recently discovered polymerase in DSB repair in plants. PMID:27866150

  18. CRISPR/Cas9-Induced Double-Strand Break Repair in Arabidopsis Nonhomologous End-Joining Mutants

    Directory of Open Access Journals (Sweden)

    Hexi Shen

    2017-01-01

    Full Text Available Double-strand breaks (DSBs are one of the most harmful DNA lesions. Cells utilize two main pathways for DSB repair: homologous recombination (HR and nonhomologous end-joining (NHEJ. NHEJ can be subdivided into the KU-dependent classical NHEJ (c-NHEJ and the more error-prone KU-independent backup-NHEJ (b-NHEJ pathways, involving the poly (ADP-ribose polymerases (PARPs. However, in the absence of these factors, cells still seem able to adequately maintain genome integrity, suggesting the presence of other b-NHEJ repair factors or pathways independent from KU and PARPs. The outcome of DSB repair by NHEJ pathways can be investigated by using artificial sequence-specific nucleases such as CRISPR/Cas9 to induce DSBs at a target of interest. Here, we used CRISPR/Cas9 for DSB induction at the Arabidopsis cruciferin 3 (CRU3 and protoporphyrinogen oxidase (PPO genes. DSB repair outcomes via NHEJ were analyzed using footprint analysis in wild-type plants and plants deficient in key factors of c-NHEJ (ku80, b-NHEJ (parp1 parp2, or both (ku80 parp1 parp2. We found that larger deletions of >20 bp predominated after DSB repair in ku80 and ku80 parp1 parp2 mutants, corroborating with a role of KU in preventing DSB end resection. Deletion lengths did not significantly differ between ku80 and ku80 parp1 parp2 mutants, suggesting that a KU- and PARP-independent b-NHEJ mechanism becomes active in these mutants. Furthermore, microhomologies and templated insertions were observed at the repair junctions in the wild type and all mutants. Since these characteristics are hallmarks of polymerase θ-mediated DSB repair, we suggest a possible role for this recently discovered polymerase in DSB repair in plants.

  19. Granulocytes affect double-strand break repair assays in primary human lymphocytes.

    Science.gov (United States)

    Lacoste, Sandrine; Bhatia, Ravi; Bhatia, Smita; O'Connor, Timothy R

    2014-01-01

    Patients who develop therapy-related myelodysplasia/acute myeloid leukemia after autologous-hematopoietic stem cell (aHCT) transplant show lower expression levels of DNA repair genes in their pre-aHCT CD34+ cells. To investigate whether this leads to functional differences in DNA repair abilities measurable in patients, we adapted two plasmid-based host-cell reactivation assays for use in primary lymphocytes. Prior to applying these assays to patients who underwent aHCT, we wanted first to verify whether sample preparation affected repair measurements, as patient samples were simply depleted of erythrocytes (with hetastarch) prior to freezing, which is not the classical way to prepare lymphocytes prior to DNA repair experiments (with a density gradient). We show here that lymphocytes from healthy donors freshly prepared with hetastarch show systematically a higher level of double-strand break repair as compared to when prepared with a density gradient, but that most of this difference disappears after samples were frozen. Several observations points to granulocytes as the source for this effect of sample preparation on repair: 1) removal of granulocytes makes the effect disappear, 2) DSB repair measurements for the same individual correlate to the percentage of granulocytes in the sample and 3) nucleofection in presence of granulocytes increases the level of reactive oxygen species (ROS) in neighboring lymphocytes in a dose-dependent manner (R2 of 0.95). These results indicate that co-purified granulocytes, possibly through the release of ROS at time of transfection, can lead to an enhanced repair in lymphocytes that obfuscates any evaluation of inter individual differences in repair as measured by host-cell reactivation. As a result, hetastarch-prepared samples are likely unsuitable for the assessment of DSB repair in primary cells with that type of assay. Granulocyte contamination that exists after a density gradient preparation, although much more limited, could

  20. A role for small RNAs in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Wei, W.; Ba, Z.; Wu, Y.

    2012-01-01

    Eukaryotes have evolved complex mechanisms to repair DNA double-strand breaks (DSBs) through coordinated actions of protein sensors, transducers, and effectors. Here we show that ∼21-nucleotide small RNAs are produced from the sequences in the vicinity of DSB sites in Arabidopsis and in human cells....... We refer to these as diRNAs for DSB-induced small RNAs. In Arabidopsis, the biogenesis of diRNAs requires the PI3 kinase ATR, RNA polymerase IV (Pol IV), and Dicer-like proteins. Mutations in these proteins as well as in Pol V cause significant reduction in DSB repair efficiency. In Arabidopsis, di...

  1. Mammalian RAD52 Functions in Break-Induced Replication Repair of Collapsed DNA Replication Forks

    DEFF Research Database (Denmark)

    Sotiriou, Sotirios K; Kamileri, Irene; Lugli, Natalia

    2016-01-01

    RNA or knockout of the gene by CRISPR/Cas9 compromised restart of collapsed forks and led to DNA damage in cells experiencing DRS. Furthermore, in cancer-prone, heterozygous APC mutant mice, homozygous deletion of the Rad52 gene suppressed tumor growth and prolonged lifespan. We therefore propose that mammalian......Human cancers are characterized by the presence of oncogene-induced DNA replication stress (DRS), making them dependent on repair pathways such as break-induced replication (BIR) for damaged DNA replication forks. To better understand BIR, we performed a targeted siRNA screen for genes whose...... RAD52 facilitates repair of collapsed DNA replication forks in cancer cells....

  2. SAW1 is Required for SDSA Double-Strand Break Repair in S. cerevisiae

    OpenAIRE

    Diamante, Graciel; Phan, Claire; Celis, Angie S.; Krueger, Jonas; Kelson, Eric P.; Fischhaber, Paula L.

    2014-01-01

    SAW1 , coding for Saw1, is required for single-strand annealing (SSA) DNA Double-strand Break (DSB) Repair in S. cerevisiae. Saw1 physically associates with Rad1 and Rad52 and recruits the Rad1-Rad10 endonuclease. Herein we show by fluorescence microscopy that SAW1 is similarly required for recruitment of Rad10 to sites of Synthesis-Dependent Strand Annealing (SDSA) and associates with sites of SDSA repair in a manner temporally overlapped with Rad10. The magnitude of induction of colocalized...

  3. Give me a better break: Choosing workday break activities to maximize resource recovery.

    Science.gov (United States)

    Hunter, Emily M; Wu, Cindy

    2016-02-01

    Surprisingly little research investigates employee breaks at work, and even less research provides prescriptive suggestions for better workday breaks in terms of when, where, and how break activities are most beneficial. Based on the effort-recovery model and using experience sampling methodology, we examined the characteristics of employee workday breaks with 95 employees across 5 workdays. In addition, we examined resources as a mediator between break characteristics and well-being. Multilevel analysis results indicated that activities that were preferred and earlier in the work shift related to more resource recovery following the break. We also found that resources mediated the influence of preferred break activities and time of break on health symptoms and that resource recovery benefited person-level outcomes of emotional exhaustion, job satisfaction, and organizational citizenship behavior. Finally, break length interacted with the number of breaks per day such that longer breaks and frequent short breaks were associated with more resources than infrequent short breaks. (c) 2016 APA, all rights reserved).

  4. The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.

    Science.gov (United States)

    Bailly, Aymeric P; Freeman, Alasdair; Hall, Julie; Déclais, Anne-Cécile; Alpi, Arno; Lilley, David M J; Ahmed, Shawn; Gartner, Anton

    2010-07-15

    DNA double-strand breaks (DSBs) can be repaired by homologous recombination (HR), which can involve Holliday junction (HJ) intermediates that are ultimately resolved by nucleolytic enzymes. An N-terminal fragment of human GEN1 has recently been shown to act as a Holliday junction resolvase, but little is known about the role of GEN-1 in vivo. Holliday junction resolution signifies the completion of DNA repair, a step that may be coupled to signaling proteins that regulate cell cycle progression in response to DNA damage. Using forward genetic approaches, we identified a Caenorhabditis elegans dual function DNA double-strand break repair and DNA damage signaling protein orthologous to the human GEN1 Holliday junction resolving enzyme. GEN-1 has biochemical activities related to the human enzyme and facilitates repair of DNA double-strand breaks, but is not essential for DNA double-strand break repair during meiotic recombination. Mutational analysis reveals that the DNA damage-signaling function of GEN-1 is separable from its role in DNA repair. GEN-1 promotes germ cell cycle arrest and apoptosis via a pathway that acts in parallel to the canonical DNA damage response pathway mediated by RPA loading, CHK1 activation, and CEP-1/p53-mediated apoptosis induction. Furthermore, GEN-1 acts redundantly with the 9-1-1 complex to ensure genome stability. Our study suggests that GEN-1 might act as a dual function Holliday junction resolvase that may coordinate DNA damage signaling with a late step in DNA double-strand break repair.

  5. The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Aymeric P Bailly

    2010-07-01

    Full Text Available DNA double-strand breaks (DSBs can be repaired by homologous recombination (HR, which can involve Holliday junction (HJ intermediates that are ultimately resolved by nucleolytic enzymes. An N-terminal fragment of human GEN1 has recently been shown to act as a Holliday junction resolvase, but little is known about the role of GEN-1 in vivo. Holliday junction resolution signifies the completion of DNA repair, a step that may be coupled to signaling proteins that regulate cell cycle progression in response to DNA damage. Using forward genetic approaches, we identified a Caenorhabditis elegans dual function DNA double-strand break repair and DNA damage signaling protein orthologous to the human GEN1 Holliday junction resolving enzyme. GEN-1 has biochemical activities related to the human enzyme and facilitates repair of DNA double-strand breaks, but is not essential for DNA double-strand break repair during meiotic recombination. Mutational analysis reveals that the DNA damage-signaling function of GEN-1 is separable from its role in DNA repair. GEN-1 promotes germ cell cycle arrest and apoptosis via a pathway that acts in parallel to the canonical DNA damage response pathway mediated by RPA loading, CHK1 activation, and CEP-1/p53-mediated apoptosis induction. Furthermore, GEN-1 acts redundantly with the 9-1-1 complex to ensure genome stability. Our study suggests that GEN-1 might act as a dual function Holliday junction resolvase that may coordinate DNA damage signaling with a late step in DNA double-strand break repair.

  6. TALEN-Induced Double-Strand Break Repair of CTG Trinucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Valentine Mosbach

    2018-02-01

    Full Text Available Trinucleotide repeat expansions involving CTG/CAG triplets are responsible for several neurodegenerative disorders, including myotonic dystrophy and Huntington’s disease. Because expansions trigger the disease, contracting repeat length could be a possible approach to gene therapy for these disorders. Here, we show that a TALEN-induced double-strand break was very efficient at contracting expanded CTG repeats in yeast. We show that RAD51, POL32, and DNL4 are dispensable for double-strand break repair within CTG repeats, the only required genes being RAD50, SAE2, and RAD52. Resection was totally abolished in the absence of RAD50 on both sides of the break, whereas it was reduced in a sae2Δ mutant on the side of the break containing the longest repeat tract, suggesting that secondary structures at double-strand break ends must be removed by the Mre11-Rad50 complex and Sae2. Following the TALEN double-strand break, single-strand annealing occurred between both sides of the repeat tract, leading to repeat contraction.

  7. The Role of Long Non Coding RNAs in the Repair of DNA Double Strand Breaks.

    Science.gov (United States)

    Dianatpour, Ali; Ghafouri-Fard, Soudeh

    2017-01-01

    DNA double strand breaks (DSBs) are abrasions caused in both strands of the DNA duplex following exposure to both exogenous and endogenous conditions. Such abrasions have deleterious effect in cells leading to genome rearrangements and cell death. A number of repair systems including homologous recombination (HR) and non-homologous end-joining (NHEJ) have been evolved to minimize the fatal effects of these lesions in cell. The role of protein coding genes in regulation of these pathways has been assessed previously. However, a number of recent studies have focused on evaluation of non-coding RNAs participation in DNA repair. We performed a computerized search of the Medline/ Pubmed databases with key words: DNA repair, homologous recombination, non-homologues end joining and long non-coding RNA (LncRNA). The existing data highlight the role of long non-coding RNAs in DSB repair as well as dysregulation in their expression which would lead to pathological conditions such as cancer. The specific mechanism of their contribution in DNA repair pathways has been elucidated for a few of them. LncRNAs participate in several steps of DNA repair pathways and regulate the expression of key components of these pathways including p53 tumor suppressor gene.

  8. RNF4 is required for DNA double-strand break repair in vivo

    DEFF Research Database (Denmark)

    Vyas, R; Kumar, R; Clermont, F

    2013-01-01

    , and that Rnf4-deficient cells and mice exhibit increased sensitivity to genotoxic stress. Mechanistically, we show that Rnf4 targets SUMOylated MDC1 and SUMOylated BRCA1, and is required for the loading of Rad51, an enzyme required for HR repair, onto sites of DNA damage. Similarly to inactivating mutations......Unrepaired DNA double-strand breaks (DSBs) cause genetic instability that leads to malignant transformation or cell death. Cells respond to DSBs with the ordered recruitment of signaling and repair proteins to the sites of DNA lesions. Coordinated protein SUMOylation and ubiquitylation have crucial...... for both homologous recombination (HR) and non-homologous end joining repair. To establish a link between Rnf4 and the DNA damage response (DDR) in vivo, we generated an Rnf4 allelic series in mice. We show that Rnf4-deficiency causes persistent ionizing radiation-induced DNA damage and signaling...

  9. The processing of double-stranded DNA breaks for recombinational repair by helicase-nuclease complexes.

    Science.gov (United States)

    Yeeles, Joseph T P; Dillingham, Mark S

    2010-03-02

    Double-stranded DNA breaks are prepared for recombinational repair by nucleolytic digestion to form single-stranded DNA overhangs that are substrates for RecA/Rad51-mediated strand exchange. This processing can be achieved through the activities of multiple helicases and nucleases. In bacteria, the function is mainly provided by a stable multi-protein complex of which there are two structural classes; AddAB- and RecBCD-type enzymes. These helicase-nucleases are of special interest with respect to DNA helicase mechanism because they are exceptionally powerful DNA translocation motors, and because they serve as model systems for both single molecule studies and for understanding how DNA helicases can be coupled to other protein machinery. This review discusses recent developments in our understanding of the AddAB and RecBCD complexes, focussing on their distinctive strategies for processing DNA ends. We also discuss the extent to which bacterial DNA end resection mechanisms may parallel those used in eukaryotic cells. (c) 2010 Elsevier B.V. All rights reserved.

  10. SIRT6 stabilizes DNA-dependent protein kinase at chromatin for DNA double-strand break repair

    DEFF Research Database (Denmark)

    McCord, Ronald A; Michishita, Eriko; Hong, Tao

    2009-01-01

    The Sir2 chromatin regulatory factor links maintenance of genomic stability to life span extension in yeast. The mammalian Sir2 family member SIRT6 has been proposed to have analogous functions, because SIRT6-deficiency leads to shortened life span and an aging-like degenerative phenotype in mice......, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA......-PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor...

  11. Improving long term driving comfort by taking breaks - How break activity affects effectiveness.

    Science.gov (United States)

    Sammonds, George M; Mansfield, Neil J; Fray, Mike

    2017-11-01

    During long duration journeys, drivers are encouraged to take regular breaks. The benefits of breaks have been documented for safety; breaks may also be beneficial for comfort. The activity undertaken during a break may influence its effectiveness. Volunteers completed 3 journeys on a driving simulator. Each 130 min journey included a 10 min break after the first hour. During the break volunteers either stayed seated, left the simulator and sat in an adjacent room, or took a walk on a treadmill. The results show a reduction in driver discomfort during the break for all 3 conditions, but the effectiveness of the break was dependent on activity undertaken. Remaining seated in the vehicle provided some improvement in comfort, but more was experienced after leaving the simulator and sitting in an adjacent room. The most effective break occurred when the driver walked for 10 min on a treadmill. The benefits from taking a break continued until the end of the study (after a further hour of driving), such that comfort remained the best after taking a walk and worst for those who remained seated. It is concluded that taking a break and taking a walk is an effective method for relieving driving discomfort. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. MOF phosphorylation by ATM regulates 53BP1-mediated double-strand break repair pathway choice.

    Science.gov (United States)

    Gupta, Arun; Hunt, Clayton R; Hegde, Muralidhar L; Chakraborty, Sharmistha; Chakraborty, Sharmistha; Udayakumar, Durga; Horikoshi, Nobuo; Singh, Mayank; Ramnarain, Deepti B; Hittelman, Walter N; Namjoshi, Sarita; Asaithamby, Aroumougame; Hazra, Tapas K; Ludwig, Thomas; Pandita, Raj K; Tyler, Jessica K; Pandita, Tej K

    2014-07-10

    Cell-cycle phase is a critical determinant of the choice between DNA damage repair by nonhomologous end-joining (NHEJ) or homologous recombination (HR). Here, we report that double-strand breaks (DSBs) induce ATM-dependent MOF (a histone H4 acetyl-transferase) phosphorylation (p-T392-MOF) and that phosphorylated MOF colocalizes with γ-H2AX, ATM, and 53BP1 foci. Mutation of the phosphorylation site (MOF-T392A) impedes DNA repair in S and G2 phase but not G1 phase cells. Expression of MOF-T392A also blocks the reduction in DSB-associated 53BP1 seen in wild-type S/G2 phase cells, resulting in enhanced 53BP1 and reduced BRCA1 association. Decreased BRCA1 levels at DSB sites correlates with defective repairosome formation, reduced HR repair, and decreased cell survival following irradiation. These data support a model whereby ATM-mediated MOF-T392 phosphorylation modulates 53BP1 function to facilitate the subsequent recruitment of HR repair proteins, uncovering a regulatory role for MOF in DSB repair pathway choice during S/G2 phase. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  13. A robust network of double-strand break repair pathways governs genome integrity during C. elegans development.

    NARCIS (Netherlands)

    Pontier, D.B.; Tijsterman, M.

    2009-01-01

    To preserve genomic integrity, various mechanisms have evolved to repair DNA double-strand breaks (DSBs). Depending on cell type or cell cycle phase, DSBs can be repaired error-free, by homologous recombination, or with concomitant loss of sequence information, via nonhomologous end-joining (NHEJ)

  14. A robust network of double-strand break repair pathways governs genome integrity during C. elegans development.

    Science.gov (United States)

    Pontier, Daphne B; Tijsterman, Marcel

    2009-08-25

    To preserve genomic integrity, various mechanisms have evolved to repair DNA double-strand breaks (DSBs). Depending on cell type or cell cycle phase, DSBs can be repaired error-free, by homologous recombination, or with concomitant loss of sequence information, via nonhomologous end-joining (NHEJ) or single-strand annealing (SSA). Here, we created a transgenic reporter system in C. elegans to investigate the relative contribution of these pathways in somatic cells during animal development. Although all three canonical pathways contribute to repair in the soma, in their combined absence, animals develop without growth delay and chromosomal breaks are still efficiently repaired. This residual repair, which we call alternative end-joining, dominates DSB repair only in the absence of NHEJ and resembles SSA, but acts independent of the SSA nuclease XPF and repair proteins from other pathways. The dynamic interplay between repair pathways might be developmentally regulated, because it was lost from terminally differentiated cells in adult animals. Our results demonstrate profound versatility in DSB repair pathways for somatic cells of C. elegans, which are thus extremely fit to deal with chromosomal breaks.

  15. The involvement of human RECQL4 in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Singh, Dharmendra Kumar; Karmakar, Parimal; Aamann, Maria Diget

    2010-01-01

    Rothmund-Thomson syndrome (RTS) is an autosomal recessive hereditary disorder associated with mutation in RECQL4 gene, a member of the human RecQ helicases. The disease is characterized by genomic instability, skeletal abnormalities and predisposition to malignant tumors, especially osteosarcomas....... The precise role of RECQL4 in cellular pathways is largely unknown; however, recent evidence suggests its involvement in multiple DNA metabolic pathways. This study investigates the roles of RECQL4 in DNA double-strand break (DSB) repair. The results show that RECQL4-deficient fibroblasts are moderately......-induced DSBs and remains for a shorter duration than WRN and BLM, indicating its distinct role in repair of DSBs. Endogenous RECQL4 also colocalizes with gammaH2AX at the site of DSBs. The RECQL4 domain responsible for its DNA damage localization has been mapped to the unique N-terminus domain between amino...

  16. Assembly and function of DNA double-strand break repair foci in mammalian cells

    DEFF Research Database (Denmark)

    Bekker-Jensen, Simon; Mailand, Niels

    2010-01-01

    DNA double-strand breaks (DSBs) are among the most cytotoxic types of DNA damage, which if left unrepaired can lead to mutations or gross chromosomal aberrations, and promote the onset of diseases associated with genomic instability such as cancer. One of the most discernible hallmarks...... of the cellular response to DSBs is the accumulation and local concentration of a plethora of DNA damage signaling and repair proteins in the vicinity of the lesion, initiated by ATM-mediated phosphorylation of H2AX (¿-H2AX) and culminating in the generation of distinct nuclear compartments, so-called Ionizing...... of such DNA repair foci still remains limited. In this review, we focus on recent discoveries on the mechanisms that govern the formation of IRIF, and discuss the implications of such findings in light of our understanding of the physiological importance of these structures....

  17. Visualization of DNA Double-Strand Break Repair at the Single-Molecule Level

    Energy Technology Data Exchange (ETDEWEB)

    Dynan, William S.; Li, Shuyi; Mernaugh, Raymond; Wragg, Stephanie; Takeda, Yoshihiko

    2003-03-27

    Exposure to low doses of ionizing radiation is universal. The signature injury from ionizing radiation exposure is induction of DNA double-strand breaks (DSBs). The first line of defense against DSBs is direct ligation of broken DNA ends via the nonhomologous end-joining pathway. Because even a relatively high environmental exposure induces only a few DSBs per cell, our current understanding of the response to this exposure is limited by the ability to measure DSB repair events reliably in situ at a single-molecule level. To address this need, we have taken advantage of biological amplification, measuring relocalization of proteins and detection of protein phosphorylation as a surrogate for detection of broken ends themselves. We describe the use of specific antibodies to investigate the kinetics and mechanism of repair of very small numbers of DSBs in human cells by the nonhomologous end-joining pathway.

  18. Epigenetic modifications in double-strand break DNA damage signaling and repair.

    Science.gov (United States)

    Rossetto, Dorine; Truman, Andrew W; Kron, Stephen J; Côté, Jacques

    2010-09-15

    Factors involved in the cellular response to double-strand break (DSB) DNA damage have been identified as potential therapeutic targets that would greatly sensitize cancer cells to radiotherapy and genotoxic chemotherapy. These targets could disable the repair machinery and/or reinstate normal cell-cycle checkpoint leading to growth arrest, senescence, and apoptosis. It is now clear that a major aspect of the DNA damage response occurs through specific interactions with chromatin structure and its modulation. It implicates highly dynamic posttranslational modifications of histones that are critical for DNA damage recognition and/or signaling, repair of the lesion, and release of cell-cycle arrest. Therefore, drugs that target the enzymes responsible for these modifications, or the protein modules reading them, have very high therapeutic potential. This review presents the current state of knowledge on the different chromatin modifications and their roles in each step of eukaryotic DSB DNA damage response. ©2010 AACR.

  19. SCAI promotes DNA double-strand break repair in distinct chromosomal contexts

    DEFF Research Database (Denmark)

    Hansen, Rebecca Kring; Mund, Andreas; Poulsen, Sara Lund

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions, whose accurate repair by non-homologous end-joining (NHEJ) or homologous recombination (HR) is crucial for genome integrity and is strongly influenced by the local chromatin environment. Here, we identify SCAI (suppressor of cancer...... in repressive chromatin environments. Moreover, we establish an important role of SCAI in meiotic recombination, as SCAI deficiency in mice leads to germ cell loss and subfertility associated with impaired retention of the DMC1 recombinase on meiotic chromosomes. Collectively, our findings uncover SCAI...

  20. Quantitation of intracellular NAD(P)H can monitor an imbalance of DNA single strand break repair in base excision repair deficient cells in real time

    Science.gov (United States)

    Nakamura, Jun; Asakura, Shoji; Hester, Susan D.; de Murcia, Gilbert; Caldecott, Keith W.; Swenberg, James A.

    2003-01-01

    DNA single strand breaks (SSBs) are one of the most frequent DNA lesions in genomic DNA generated either by oxidative stress or during the base excision repair pathways. Here we established a new real-time assay to assess an imbalance of DNA SSB repair by indirectly measuring PARP-1 activation through the depletion of intracellular NAD(P)H. A water-soluble tetrazolium salt is used to monitor the amount of NAD(P)H in living cells through its reduction to a yellow colored water-soluble formazan dye. While this assay is not a direct method, it does not require DNA extraction or alkaline treatment, both of which could potentially cause an artifactual induction of SSBs. In addition, it takes only 4 h and requires less than a half million cells to perform this measurement. Using this assay, we demonstrated that the dose- and time-dependent depletion of NAD(P)H in XRCC1-deficient CHO cells exposed to methyl methanesulfonate. This decrease was almost completely blocked by a PARP inhibitor. Furthermore, methyl methanesulfonate reduced NAD(P)H in PARP-1+/+cells, whereas PARP-1–/– cells were more resistant to the decrease in NAD(P)H. These results indicate that the analysis of intracellular NAD(P)H level using water-soluble tetrazolium salt can assess an imbalance of SSB repair in living cells in real time. PMID:12930978

  1. Transient RNA-DNA Hybrids Are Required for Efficient Double-Strand Break Repair.

    Science.gov (United States)

    Ohle, Corina; Tesorero, Rafael; Schermann, Géza; Dobrev, Nikolay; Sinning, Irmgard; Fischer, Tamás

    2016-11-03

    RNA-DNA hybrids are a major internal cause of DNA damage within cells, and their degradation by RNase H enzymes is important for maintaining genomic stability. Here, we identified an unexpected role for RNA-DNA hybrids and RNase H enzymes in DNA repair. Using a site-specific DNA double-strand break (DSB) system in Schizosaccharomyces pombe, we showed that RNA-DNA hybrids form as part of the homologous-recombination (HR)-mediated DSB repair process and that RNase H enzymes are essential for their degradation and efficient completion of DNA repair. Deleting RNase H stabilizes RNA-DNA hybrids around DSB sites and strongly impairs recruitment of the ssDNA-binding RPA complex. In contrast, overexpressing RNase H1 destabilizes these hybrids, leading to excessive strand resection and RPA recruitment and to severe loss of repeat regions around DSBs. Our study challenges the existing model of HR-mediated DSB repair and reveals a surprising role for RNA-DNA hybrids in maintaining genomic stability. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. SAW1 is required for SDSA double-strand break repair in S. cerevisiae.

    Science.gov (United States)

    Diamante, Graciel; Phan, Claire; Celis, Angie S; Krueger, Jonas; Kelson, Eric P; Fischhaber, Paula L

    2014-03-14

    SAW1, coding for Saw1, is required for single-strand annealing (SSA) DNA double-strand break (DSB) repair in Saccharomycescerevisiae. Saw1 physically associates with Rad1 and Rad52 and recruits the Rad1-Rad10 endonuclease. Herein we show by fluorescence microscopy that SAW1 is similarly required for recruitment of Rad10 to sites of Synthesis-Dependent Strand Annealing (SDSA) and associates with sites of SDSA repair in a manner temporally overlapped with Rad10. The magnitude of induction of colocalized Saw1-CFP/Rad10-YFP/DSB-RFP foci in SDSA is more dramatic in S and G2 phase cells than in M phase, consistent with the known mechanism of SDSA. We observed a substantial fraction of foci in which Rad10 was localized to the repair site without Saw1, but few DSB sites that contained Saw1 without Rad10. Together these data are consistent with a model in which Saw1 recruits Rad1-Rad10 to SDSA sites, possibly even binding as a protein-protein complex, but departs the repair site in advance of Rad1-Rad10. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Double-strand break repair mechanisms in Escherichia coli: recent insights

    Directory of Open Access Journals (Sweden)

    Đermić D

    2015-01-01

    Full Text Available Damir Ðermić Ruđer Bošković Institute, Division of Molecular Biology, Zagreb, Croatia Abstract: In order to survive, all organisms must repair the continuous appearance of double-strand breaks (DSBs in their DNA. Escherichia coli does this by RecA-dependent homologous recombination (HR, during which the RecA protein is assembled on a 3´-terminated overhang that is created by a process called DNA end resection. The RecA nucleoprotein filament searches for and invades an intact homologous DNA sequence, creating a central HR intermediate. This review describes recent insights into HR and DSB repair in E. coli, especially the processes that precede the formation of a RecA nucleoprotein filament, with an emphasis on the regulation of 3´-tail metabolism. Since HR is a highly conserved process, the parallels to DSB repair in eukaryotic systems are discussed, bearing in mind that the lessons learned from studies in simpler bacterial models may be useful for studying DSB repair and the maintenance of genome stability in eukaryotes. Keywords: RecA nucleoprotein filament, homologous recombination, exonucleases, genome stability, 3´-overhang metabolism

  4. Non Random Distribution of DMD Deletion Breakpoints and Implication of Double Strand Breaks Repair and Replication Error Repair Mechanisms.

    Science.gov (United States)

    Marey, Isabelle; Ben Yaou, Rabah; Deburgrave, Nathalie; Vasson, Aurélie; Nectoux, Juliette; Leturcq, France; Eymard, Bruno; Laforet, Pascal; Behin, Anthony; Stojkovic, Tanya; Mayer, Michèle; Tiffreau, Vincent; Desguerre, Isabelle; Boyer, François Constant; Nadaj-Pakleza, Aleksandra; Ferrer, Xavier; Wahbi, Karim; Becane, Henri-Marc; Claustres, Mireille; Chelly, Jamel; Cossee, Mireille

    2016-05-27

    Dystrophinopathies are mostly caused by copy number variations, especially deletions, in the dystrophin gene (DMD). Despite the large size of the gene, deletions do not occur randomly but mainly in two hot spots, the main one involving exons 45 to 55. The underlying mechanisms are complex and implicate two main mechanisms: Non-homologous end joining (NHEJ) and micro-homology mediated replication-dependent recombination (MMRDR). Our goals were to assess the distribution of intronic breakpoints (BPs) in the genomic sequence of the main hot spot of deletions within DMD gene and to search for specific sequences at or near to BPs that might promote BP occurrence or be associated with DNA break repair. Using comparative genomic hybridization microarray, 57 deletions within the intron 44 to 55 region were mapped. Moreover, 21 junction fragments were sequenced to search for specific sequences. Non-randomly distributed BPs were found in introns 44, 47, 48, 49 and 53 and 50% of BPs clustered within genomic regions of less than 700bp. Repeated elements (REs), known to promote gene rearrangement via several mechanisms, were present in the vicinity of 90% of clustered BPs and less frequently (72%) close to scattered BPs, illustrating the important role of such elements in the occurrence of DMD deletions. Palindromic and TTTAAA sequences, which also promote DNA instability, were identified at fragment junctions in 20% and 5% of cases, respectively. Micro-homologies (76%) and insertions or deletions of small sequences were frequently found at BP junctions. Our results illustrate, in a large series of patients, the important role of RE and other genomic features in DNA breaks, and the involvement of different mechanisms in DMD gene deletions: Mainly replication error repair mechanisms, but also NHEJ and potentially aberrant firing of replication origins. A combination of these mechanisms may also be possible.

  5. Structure of the Rad50 DNA double-strand break repair protein in complex with DNA.

    Science.gov (United States)

    Rojowska, Anna; Lammens, Katja; Seifert, Florian U; Direnberger, Carolin; Feldmann, Heidi; Hopfner, Karl-Peter

    2014-12-01

    The Mre11-Rad50 nuclease-ATPase is an evolutionarily conserved multifunctional DNA double-strand break (DSB) repair factor. Mre11-Rad50's mechanism in the processing, tethering, and signaling of DSBs is unclear, in part because we lack a structural framework for its interaction with DNA in different functional states. We determined the crystal structure of Thermotoga maritima Rad50(NBD) (nucleotide-binding domain) in complex with Mre11(HLH) (helix-loop-helix domain), AMPPNP, and double-stranded DNA. DNA binds between both coiled-coil domains of the Rad50 dimer with main interactions to a strand-loop-helix motif on the NBD. Our analysis suggests that this motif on Rad50 does not directly recognize DNA ends and binds internal sites on DNA. Functional studies reveal that DNA binding to Rad50 is not critical for DNA double-strand break repair but is important for telomere maintenance. In summary, we provide a structural framework for DNA binding to Rad50 in the ATP-bound state. © 2014 The Authors.

  6. TRF2 is required for repair of nontelomeric DNA double-strand breaks by homologous recombination.

    Science.gov (United States)

    Mao, Zhiyong; Seluanov, Andrei; Jiang, Ying; Gorbunova, Vera

    2007-08-07

    TRF2 (telomeric repeat binding factor 2) is an essential component of the telomeric cap, where it forms and stabilizes the T-loop junctions. TRF2 forms the T-loops by stimulating strand invasion of the 3' overhang into duplex DNA. TRF2 also has been shown to localize to nontelomeric DNA double-strand breaks, but its functional role in DNA repair has not been examined. Here, we present evidence that TRF2 is involved in homologous recombination (HR) repair of nontelomeric double-strand breaks. Depletion of TRF2 strongly inhibited HR and delayed the formation of Rad51 foci after gamma-irradiation, whereas overexpression of TRF2 stimulated HR. Depletion of TRF2 had no effect on nonhomologous end-joining, and overexpression of TRF2 inhibited nonhomologous end-joining. We propose, based on our results and on the ability of TRF2 to mediate strand invasion, that TRF2 plays an essential role in HR by facilitating the formation of early recombination intermediates.

  7. E4 ligase-specific ubiquitination hubs coordinate DNA double-strand-break repair and apoptosis.

    Science.gov (United States)

    Ackermann, Leena; Schell, Michael; Pokrzywa, Wojciech; Kevei, Éva; Gartner, Anton; Schumacher, Björn; Hoppe, Thorsten

    2016-11-01

    Multiple protein ubiquitination events at DNA double-strand breaks (DSBs) regulate damage recognition, signaling and repair. It has remained poorly understood how the repair process of DSBs is coordinated with the apoptotic response. Here, we identified the E4 ubiquitin ligase UFD-2 as a mediator of DNA-damage-induced apoptosis in a genetic screen in Caenorhabditis elegans. We found that, after initiation of homologous recombination by RAD-51, UFD-2 forms foci that contain substrate-processivity factors including the ubiquitin-selective segregase CDC-48 (p97), the deubiquitination enzyme ATX-3 (Ataxin-3) and the proteasome. In the absence of UFD-2, RAD-51 foci persist, and DNA damage-induced apoptosis is prevented. In contrast, UFD-2 foci are retained until recombination intermediates are removed by the Holliday-junction-processing enzymes GEN-1, MUS-81 or XPF-1. Formation of UFD-2 foci also requires proapoptotic CEP-1 (p53) signaling. Our findings establish a central role of UFD-2 in the coordination between the DNA-repair process and the apoptotic response.

  8. Repair of DNA strand breaks by the overlapping functions of lesion-specific and non-lesion-specific DNA 3' phosphatases.

    Science.gov (United States)

    Vance, J R; Wilson, T E

    2001-11-01

    In Saccharomyces cerevisiae, the apurinic/apyrimidinic (AP) endonucleases Apn1 and Apn2 act as alternative pathways for the removal of various 3'-terminal blocking lesions from DNA strand breaks and in the repair of abasic sites, which both result from oxidative DNA damage. Here we demonstrate that Tpp1, a homologue of the 3' phosphatase domain of polynucleotide kinase, is a third member of this group of redundant 3' processing enzymes. Unlike Apn1 and Apn2, Tpp1 is specific for the removal of 3' phosphates at strand breaks and does not possess more general 3' phosphodiesterase, exonuclease, or AP endonuclease activities. Deletion of TPP1 in an apn1 apn2 mutant background dramatically increased the sensitivity of the double mutant to DNA damage caused by H2O2 and bleomycin but not to damage caused by methyl methanesulfonate. The triple mutant was also deficient in the repair of 3' phosphate lesions left by Tdp1-mediated cleavage of camptothecin-stabilized Top1-DNA covalent complexes. Finally, the tpp1 apn1 apn2 triple mutation displayed synthetic lethality in combination with rad52, possibly implicating postreplication repair in the removal of unrepaired 3'-terminal lesions resulting from endogenous damage. Taken together, these results demonstrate a clear role for the lesion-specific enzyme, Tpp1, in the repair of a subset of DNA strand breaks.

  9. Repair of DNA Strand Breaks by the Overlapping Functions of Lesion-Specific and Non-Lesion-Specific DNA 3′ Phosphatases

    Science.gov (United States)

    Vance, John R.; Wilson, Thomas E.

    2001-01-01

    In Saccharomyces cerevisiae, the apurinic/apyrimidinic (AP) endonucleases Apn1 and Apn2 act as alternative pathways for the removal of various 3′-terminal blocking lesions from DNA strand breaks and in the repair of abasic sites, which both result from oxidative DNA damage. Here we demonstrate that Tpp1, a homologue of the 3′ phosphatase domain of polynucleotide kinase, is a third member of this group of redundant 3′ processing enzymes. Unlike Apn1 and Apn2, Tpp1 is specific for the removal of 3′ phosphates at strand breaks and does not possess more general 3′ phosphodiesterase, exonuclease, or AP endonuclease activities. Deletion of TPP1 in an apn1 apn2 mutant background dramatically increased the sensitivity of the double mutant to DNA damage caused by H2O2 and bleomycin but not to damage caused by methyl methanesulfonate. The triple mutant was also deficient in the repair of 3′ phosphate lesions left by Tdp1-mediated cleavage of camptothecin-stabilized Top1-DNA covalent complexes. Finally, the tpp1 apn1 apn2 triple mutation displayed synthetic lethality in combination with rad52, possibly implicating postreplication repair in the removal of unrepaired 3′-terminal lesions resulting from endogenous damage. Taken together, these results demonstrate a clear role for the lesion-specific enzyme, Tpp1, in the repair of a subset of DNA strand breaks. PMID:11585902

  10. RecA bundles mediate homology pairing between distant sisters during DNA break repair

    Science.gov (United States)

    Lesterlin, Christian; Ball, Graeme; Schermelleh, Lothar; Sherratt, David J.

    2014-02-01

    DNA double-strand break (DSB) repair by homologous recombination has evolved to maintain genetic integrity in all organisms. Although many reactions that occur during homologous recombination are known, it is unclear where, when and how they occur in cells. Here, by using conventional and super-resolution microscopy, we describe the progression of DSB repair in live Escherichia coli. Specifically, we investigate whether homologous recombination can occur efficiently between distant sister loci that have segregated to opposite halves of an E. coli cell. We show that a site-specific DSB in one sister can be repaired efficiently using distant sister homology. After RecBCD processing of the DSB, RecA is recruited to the cut locus, where it nucleates into a bundle that contains many more RecA molecules than can associate with the two single-stranded DNA regions that form at the DSB. Mature bundles extend along the long axis of the cell, in the space between the bulk nucleoid and the inner membrane. Bundle formation is followed by pairing, in which the two ends of the cut locus relocate at the periphery of the nucleoid and together move rapidly towards the homology of the uncut sister. After sister locus pairing, RecA bundles disassemble and proteins that act late in homologous recombination are recruited to give viable recombinants 1-2-generation-time equivalents after formation of the initial DSB. Mutated RecA proteins that do not form bundles are defective in sister pairing and in DSB-induced repair. This work reveals an unanticipated role of RecA bundles in channelling the movement of the DNA DSB ends, thereby facilitating the long-range homology search that occurs before the strand invasion and transfer reactions.

  11. End-joining repair of double-strand breaks in Drosophila melanogaster is largely DNA ligase IV independent.

    Science.gov (United States)

    McVey, Mitch; Radut, Dora; Sekelsky, Jeff J

    2004-12-01

    Repair of DNA double-strand breaks can occur by either nonhomologous end joining or homologous recombination. Most nonhomologous end joining requires a specialized ligase, DNA ligase IV (Lig4). In Drosophila melanogaster, double-strand breaks created by excision of a P element are usually repaired by a homologous recombination pathway called synthesis-dependent strand annealing (SDSA). SDSA requires strand invasion mediated by DmRad51, the product of the spn-A gene. In spn-A mutants, repair proceeds through a nonconservative pathway involving the annealing of microhomologies found within the 17-nt overhangs produced by P excision. We report here that end joining of P-element breaks in the absence of DmRad51 does not require Drosophila LIG4. In wild-type flies, SDSA is sometimes incomplete, and repair is finished by an end-joining pathway that also appears to be independent of LIG4. Loss of LIG4 does not increase sensitivity to ionizing radiation in late-stage larvae, but lig4 spn-A double mutants do show heightened sensitivity relative to spn-A single mutants. Together, our results suggest that a LIG4-independent end-joining pathway is responsible for the majority of double-strand break repair in the absence of homologous recombination in flies.

  12. Active and break spells of the Indian summer monsoon

    Indian Academy of Sciences (India)

    In this paper, we suggest criteria for the identification of active and break events of the Indian summer monsoon on the basis of recently derived high resolution daily gridded rainfall dataset over India (1951–2007). Active and break events are defined as periods during the peak monsoon months of July and August, in which ...

  13. Mammalian RAD52 Functions in Break-Induced Replication Repair of Collapsed DNA Replication Forks.

    Science.gov (United States)

    Sotiriou, Sotirios K; Kamileri, Irene; Lugli, Natalia; Evangelou, Konstantinos; Da-Ré, Caterina; Huber, Florian; Padayachy, Laura; Tardy, Sebastien; Nicati, Noemie L; Barriot, Samia; Ochs, Fena; Lukas, Claudia; Lukas, Jiri; Gorgoulis, Vassilis G; Scapozza, Leonardo; Halazonetis, Thanos D

    2016-12-15

    Human cancers are characterized by the presence of oncogene-induced DNA replication stress (DRS), making them dependent on repair pathways such as break-induced replication (BIR) for damaged DNA replication forks. To better understand BIR, we performed a targeted siRNA screen for genes whose depletion inhibited G1 to S phase progression when oncogenic cyclin E was overexpressed. RAD52, a gene dispensable for normal development in mice, was among the top hits. In cells in which fork collapse was induced by oncogenes or chemicals, the Rad52 protein localized to DRS foci. Depletion of Rad52 by siRNA or knockout of the gene by CRISPR/Cas9 compromised restart of collapsed forks and led to DNA damage in cells experiencing DRS. Furthermore, in cancer-prone, heterozygous APC mutant mice, homozygous deletion of the Rad52 gene suppressed tumor growth and prolonged lifespan. We therefore propose that mammalian RAD52 facilitates repair of collapsed DNA replication forks in cancer cells. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  14. DNA double-strand break repair is impaired in presenescent Syrian hamster fibroblasts.

    Science.gov (United States)

    Solovjeva, Ljudmila; Firsanov, Denis; Vasilishina, Anastasia; Chagin, Vadim; Pleskach, Nadezhda; Kropotov, Andrey; Svetlova, Maria

    2015-10-12

    Studies of DNA damage response are critical for the comprehensive understanding of age-related changes in cells, tissues and organisms. Syrian hamster cells halt proliferation and become presenescent after several passages in standard conditions of cultivation due to what is known as "culture stress". Using proliferating young and non-dividing presenescent cells in primary cultures of Syrian hamster fibroblasts, we defined their response to the action of radiomimetic drug bleomycin (BL) that induces DNA double-strand breaks (DSBs). The effect of the drug was estimated by immunoblotting and immunofluorescence microscopy using the antibody to phosphorylated histone H2AX (gH2AX), which is generally accepted as a DSB marker. At all stages of the cell cycle, both presenescent and young cells demonstrated variability of the number of gH2AX foci per nucleus. gH2AX focus induction was found to be independent from BL-hydrolase expression. Some differences in DSB repair process between BL-treated young and presenescent Syrian hamster cells were observed: (1) the kinetics of gH2AX focus loss in G0 fibroblasts of young culture was faster than in cells that prematurely stopped dividing; (2) presenescent cells were characterized by a slower recruitment of DSB repair proteins 53BP1, phospho-DNA-PK and phospho-ATM to gH2AX focal sites, while the rate of phosphorylated ATM/ATR substrate accumulation was the same as that in young cells. Our results demonstrate an impairment of DSB repair in prematurely aged Syrian hamster fibroblasts in comparison with young fibroblasts, suggesting age-related differences in response to BL therapy.

  15. Sequence conservation of the rad21 Schizosaccharomyces pombe DNA double-strand break repair gene in human and mouse.

    NARCIS (Netherlands)

    M.J. McKay (Michael); C. Troelstra (Christine); P.J. van der Spek (Peter); R. Kanaar (Roland); B. Smit (Bep); A. Hagemeijer (Anne); D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)

    1996-01-01

    textabstractThe rad21 gene of Schizosaccharomyces pombe is involved in the repair of ionizing radiation-induced DNA double-strand breaks. The isolation of mouse and human putative homologs of rad21 is reported here. Alignment of the predicted amino acid sequence of Rad21 with the mammalian proteins

  16. Tandem repeat modification during double-strand break repair induced by an engineered TAL effector nuclease in zebrafish genome.

    Directory of Open Access Journals (Sweden)

    Wanxu Huang

    Full Text Available Tandem repeats (TRs are abundant and widely distributed in eukaryotic genomes. TRs are thought to have various functions in gene transcription, DNA methylation, nucleosome position and chromatin organization. Variation of repeat units in the genome is observed in association with a number of diseases, such as Fragile X Syndrome, Huntington's disease and Friedreich's ataxia. However, the underlying mechanisms involved are poorly understood, largely owing to the technical limitations in modification of TRs at definite sites in the genome in vivo. Transcription activator-like effector nucleases (TALENs are widely used in recent years in gene targeting for their specific binding to target sequences when engineered in vitro. Here, we show that the repair of a double-strand break (DSB induced by TALENs adjacent to a TR can produce serial types of mutations in the TR region. Sequencing analysis revealed that there are three types of mutations induced by the DSB repair, including indels only within the TR region or within the flanking TALEN target region or simutaneously within both regions. Therefore, desired TR mutant types can be conveniently obtained by using engineered TALENs. These results demonstrate that TALENs can serve as a convenient tool for modifying TRs in the genome in studying the functions of TRs.

  17. DNA ligase 1 deficient plants display severe growth defects and delayed repair of both DNA single and double strand breaks

    Directory of Open Access Journals (Sweden)

    Bray Clifford M

    2009-06-01

    Full Text Available Abstract Background DNA ligase enzymes catalyse the joining of adjacent polynucleotides and as such play important roles in DNA replication and repair pathways. Eukaryotes possess multiple DNA ligases with distinct roles in DNA metabolism, with clear differences in the functions of DNA ligase orthologues between animals, yeast and plants. DNA ligase 1, present in all eukaryotes, plays critical roles in both DNA repair and replication and is indispensable for cell viability. Results Knockout mutants of atlig1 are lethal. Therefore, RNAi lines with reduced levels of AtLIG1 were generated to allow the roles and importance of Arabidopsis DNA ligase 1 in DNA metabolism to be elucidated. Viable plants were fertile but displayed a severely stunted and stressed growth phenotype. Cell size was reduced in the silenced lines, whilst flow cytometry analysis revealed an increase of cells in S-phase in atlig1-RNAi lines relative to wild type plants. Comet assay analysis of isolated nuclei showed atlig1-RNAi lines displayed slower repair of single strand breaks (SSBs and also double strand breaks (DSBs, implicating AtLIG1 in repair of both these lesions. Conclusion Reduced levels of Arabidopsis DNA ligase 1 in the silenced lines are sufficient to support plant development but result in retarded growth and reduced cell size, which may reflect roles for AtLIG1 in both replication and repair. The finding that DNA ligase 1 plays an important role in DSB repair in addition to its known function in SSB repair, demonstrates the existence of a previously uncharacterised novel pathway, independent of the conserved NHEJ. These results indicate that DNA ligase 1 functions in both DNA replication and in repair of both ss and dsDNA strand breaks in higher plants.

  18. AUNIP/C1orf135 directs DNA double-strand breaks towards the homologous recombination repair pathway.

    Science.gov (United States)

    Lou, Jiangman; Chen, Hongxia; Han, Jinhua; He, Hanqing; Huen, Michael S Y; Feng, Xin-Hua; Liu, Ting; Huang, Jun

    2017-10-17

    DNA double-strand breaks (DSBs) are mainly repaired by either homologous recombination (HR) or non-homologous end-joining (NHEJ). Here, we identify AUNIP/C1orf135, a largely uncharacterized protein, as a key determinant of DSB repair pathway choice. AUNIP physically interacts with CtIP and is required for efficient CtIP accumulation at DSBs. AUNIP possesses intrinsic DNA-binding ability with a strong preference for DNA substrates that mimic structures generated at stalled replication forks. This ability to bind DNA is necessary for the recruitment of AUNIP and its binding partner CtIP to DSBs, which in turn drives CtIP-dependent DNA-end resection and HR repair. Accordingly, loss of AUNIP or ablation of its ability to bind to DNA results in cell hypersensitivity toward a variety of DSB-inducing agents, particularly those that induce replication-associated DSBs. Our findings provide new insights into the molecular mechanism by which DSBs are recognized and channeled to the HR repair pathway.DNA double strand breaks can be repaired by homology-independent or homology-directed mechanisms. The choice between these pathways is a key event for genomic stability maintenance. Here the authors identify and characterize AUNIP, as a factor involved in tilting the balance towards homology repair.

  19. Annealing of Complementary DNA Sequences During Double-Strand Break Repair in Drosophila Is Mediated by the Ortholog of SMARCAL1.

    Science.gov (United States)

    Holsclaw, Julie Korda; Sekelsky, Jeff

    2017-05-01

    DNA double-strand breaks (DSBs) pose a serious threat to genomic integrity. If unrepaired, they can lead to chromosome fragmentation and cell death. If repaired incorrectly, they can cause mutations and chromosome rearrangements. DSBs are repaired using end-joining or homology-directed repair strategies, with the predominant form of homology-directed repair being synthesis-dependent strand annealing (SDSA). SDSA is the first defense against genomic rearrangements and information loss during DSB repair, making it a vital component of cell health and an attractive target for chemotherapeutic development. SDSA has also been proposed to be the primary mechanism for integration of large insertions during genome editing with CRISPR/Cas9. Despite the central role for SDSA in genome stability, little is known about the defining step: annealing. We hypothesized that annealing during SDSA is performed by the annealing helicase SMARCAL1, which can anneal RPA-coated single DNA strands during replication-associated DNA damage repair. We used unique genetic tools in Drosophila melanogaster to test whether the fly ortholog of SMARCAL1, Marcal1, mediates annealing during SDSA. Repair that requires annealing is significantly reduced in Marcal1 null mutants in both synthesis-dependent and synthesis-independent (single-strand annealing) assays. Elimination of the ATP-binding activity of Marcal1 also reduced annealing-dependent repair, suggesting that the annealing activity requires translocation along DNA. Unlike the null mutant, however, the ATP-binding defect mutant showed reduced end joining, shedding light on the interaction between SDSA and end-joining pathways. Copyright © 2017 by the Genetics Society of America.

  20. In vitro model for DNA double-strand break repair analysis in breast cancer reveals cell type-specific associations with age and prognosis.

    Science.gov (United States)

    Deniz, Miriam; Kaufmann, Julia; Stahl, Andreea; Gundelach, Theresa; Janni, Wolfgang; Hoffmann, Isabell; Keimling, Marlen; Hampp, Stephanie; Ihle, Michaela; Wiesmüller, Lisa

    2016-11-01

    Dysfunction of homologous recombination is a common denominator of changes associated with breast cancer-predisposing mutations. In our previous work, we identified a functional signature in peripheral blood lymphocytes from women who were predisposed that indicated a shift from homologous recombination to alternative, error-prone DNA double-strand break (DSB) repair pathways. To capture both hereditary and nonhereditary factors, we newly established a protocol for isolation and ex vivo analysis of epithelial cells, epithelial-mesenchymal transition cells (EMTs), and fibroblasts from breast cancer specimens (147 patients). By applying a fluorescence-based test system, we analyzed the error-prone DSB repair pathway microhomology-mediated end joining in these tumor-derived cell types and peripheral blood lymphocytes. In parallel, we investigated DNA lesion processing by quantitative immunofluorescence microscopy of histone H2AX phosphorylated on Ser139 focus after radiomimetic treatment. Our study reveals elevated histone H2AX phosphorylated on Ser139 damage removal in epithelial cells, not EMTs, and poly(ADP-ribose)polymerase inhibitor sensitivities, which suggested a DSB repair pathway shift with increasing patient age. Of interest, we found elevated microhomology-mediated end joining in EMTs, not epithelial cells, from patients who received a treatment recommendation of adjuvant chemotherapy, that is, those with high-risk tumors. Our discoveries of altered DSB repair activities in cells may serve as a method to further classify breast cancer to predict responsiveness to adjuvant chemotherapy and/or therapeutics that target DSB repair-dysfunctional tumors.-Deniz, M., Kaufmann, J., Stahl, A., Gundelach, T., Janni, W., Hoffmann, I., Keimling, M., Hampp, S., Ihle, M., Wiesmüller, L. In vitro model for DNA double-strand break repair analysis in breast cancer reveals cell type-specific associations with age and prognosis. © FASEB.

  1. IDN2 Interacts with RPA and Facilitates DNA Double-Strand Break Repair by Homologous Recombination in Arabidopsis.

    Science.gov (United States)

    Liu, Mingming; Ba, Zhaoqing; Costa-Nunes, Pedro; Wei, Wei; Li, Lanxia; Kong, Fansi; Li, Yan; Chai, Jijie; Pontes, Olga; Qi, Yijun

    2017-03-01

    Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genome integrity. We previously showed that DSB-induced small RNAs (diRNAs) facilitate homologous recombination-mediated DSB repair in Arabidopsis thaliana Here, we show that INVOLVED IN DE NOVO2 (IDN2), a double-stranded RNA binding protein involved in small RNA-directed DNA methylation, is required for DSB repair in Arabidopsis. We find that IDN2 interacts with the heterotrimeric replication protein A (RPA) complex. Depletion of IDN2 or the diRNA binding ARGONAUTE2 leads to increased accumulation of RPA at DSB sites and mislocalization of the recombination factor RAD51. These findings support a model in which IDN2 interacts with RPA and facilitates the release of RPA from single-stranded DNA tails and subsequent recruitment of RAD51 at DSB sites to promote DSB repair. © 2017 American Society of Plant Biologists. All rights reserved.

  2. Ras activation and symmetry breaking during Dictyostelium chemotaxis

    NARCIS (Netherlands)

    Kortholt, Arjan; Keizer-Gunnink, Ineke; Kataria, Rama; Van Haastert, Peter J. M.

    2013-01-01

    Central to chemotaxis is the molecular mechanism by which a shallow spatial gradient of chemoattractant induces symmetry breaking of activated signaling molecules. Previously, we have used Dictyostelium mutants to investigate the minimal requirements for chemotaxis, and identified a basal signaling

  3. ASPM influences DNA double-strand break repair and represents a potential target for radiotherapy.

    Science.gov (United States)

    Kato, Takamitsu A; Okayasu, Ryuichi; Jeggo, Penny A; Fujimori, Akira

    2011-12-01

    In a previous study using HiCEP (High coverage expression profiling), we demonstrated that ASPM (abnormal spindle-like microcephaly-associated) or the most common-type microcephaly (MCPH5) gene was selectively down-regulated by IR (ionizing radiation). The roles of ASPM on radiosensitivity, however, have never been studied. Using glioblastoma cell lines and normal human fibroblasts, we investigated how IR sensitivity (survived fraction, DNA repair and chromosome aberration) was affected by the reduction of ASPM by specific siRNA (small interfering RNA). Down-regulation of ASPM by siRNA enhanced radiosensitivity in three human cell lines examined. Constant-field gel electrophoreses and γ-H2AX (phosphorylated form of Histone H2A variant H2AX) foci analysis showed that ASPM-specific siRNA impaired DNA double-strand breaks (DSB) in irradiated cells. Elevated levels of abnormal chromosomes were also observed following ASPM siRNA. In addition IR-sensitization by ASPM knockdown was not enhanced in DNA-PK (DNA-dependent protein kinase) deficient glioblastoma cells suggesting that ASPM impacts upon a DNA-PK-dependent pathway. Our results show for the first time that ASPM is required for efficient non-homologous end-joining in mammalian cells. In clinical applications, ASPM could be a novel target for combination therapy with radiation as well as a useful biomarker for tumor prognosis as ever described.

  4. An alternative pathway for Alu retrotransposition suggests a role in DNA double-strand break repair.

    Science.gov (United States)

    Srikanta, Deepa; Sen, Shurjo K; Huang, Charles T; Conlin, Erin M; Rhodes, Ryan M; Batzer, Mark A

    2009-03-01

    The Alu family is a highly successful group of non-LTR retrotransposons ubiquitously found in primate genomes. Similar to the L1 retrotransposon family, Alu elements integrate primarily through an endonuclease-dependent mechanism termed target site-primed reverse transcription (TPRT). Recent studies have suggested that, in addition to TPRT, L1 elements occasionally utilize an alternative endonuclease-independent pathway for genomic integration. To determine whether an analogous mechanism exists for Alu elements, we have analyzed three publicly available primate genomes (human, chimpanzee and rhesus macaque) for endonuclease-independent recently integrated or lineage specific Alu insertions. We recovered twenty-three examples of such insertions and show that these insertions are recognizably different from classical TPRT-mediated Alu element integration. We suggest a role for this process in DNA double-strand break repair and present evidence to suggest its association with intra-chromosomal translocations, in-vitro RNA recombination (IVRR), and synthesis-dependent strand annealing (SDSA).

  5. DNA Double Strand Break Repair and its Association with Inherited Predispositions to Breast Cancer

    Directory of Open Access Journals (Sweden)

    Scott Rodney J

    2004-02-01

    Full Text Available Abstract Mutations in BRCA1 account for the majority of familial aggregations of early onset breast and ovarian cancer (~70% and about 1/5 of all early onset breast cancer families; in contrast, mutations in BRCA2 account for a smaller proportion of breast/ovarian cancer families and a similar proportion of early onset breast cancer families. BRCA2 has also been shown to be associated with a much more pleiotropic disease spectrum compared to BRCA1. Since the identification of both BRCA1 and BRCA2 investigations into the functions of these genes have revealed that both are associated with the maintenance of genomic integrity via their apparent roles in cellular response to DNA damage, especially their involvement in the process of double strand DNA break repair. This review will focus on the specific roles of both genes and how functional differences may account for the diverse clinical findings observed between families that harbour BRCA1 or BRCA2 mutations.

  6. OsRAD51C Is Essential for Double Strand Break Repair in Rice Meiosis

    Directory of Open Access Journals (Sweden)

    Ding eTang

    2014-05-01

    Full Text Available RAD51C is one of the RAD51 paralogs that plays an important role in DNA double-strand break repair by homologous recombination. Here, we identified and characterized OsRAD51C, the rice homolog of human RAD51C. The Osrad51c mutant plant is normal in vegetative growth but exhibits complete male and female sterility. Cytological investigation revealed that homologous pairing and synapsis were severely disrupted. Massive chromosome fragmentation occurred during metaphase I in Osrad51c meiocytes, and was fully suppressed by the CRC1 mutation. Immunofluorescence analysis showed that OsRAD51C localized onto the chromosomes from leptotene to early pachytene during prophase I, and that normal loading of OsRAD51C was dependent on OsREC8, PAIR2, and PAIR3. Additionally, ZEP1 did not localize properly in Osrad51c, indicating that OsRAD51C is required for synaptonemal complex assembly. Our study also provided evidence in support of a functional divergence in RAD51C among organisms.

  7. Crosstalk of DNA double-strand break repair pathways in PARP inhibitor treatment of BRCA1/2-mutated Cancer.

    Science.gov (United States)

    Sunada, Shigeaki; Nakanishi, Akira; Miki, Yoshio

    2018-02-10

    Germ-line mutations in breast cancer susceptibility gene 1 or 2 (BRCA1 or BRCA2) significantly increase cancer risk in hereditary breast and ovarian cancer syndrome (HBOC). Both genes function in the homologous recombination (HR) pathway of DNA double-strand break (DSB) repair process. Therefore, the DNA-repair defect characteristic in cancer cells brings therapeutic advantage for Poly(ADP-ribose) polymerase (PARP) inhibitor-induced synthetic lethality. The PARP inhibitor-based therapeutics initially causes cancer lethality but acquired resistance mechanisms have been found and need to be elucidated. In particular, it is essential to understand the mechanism of DNA damage and repair to PARP inhibitor treatment in detail. Further investigations have shown the roles of BRCA1/2 and its associations to other molecules in the DSB repair system. Notably, the repair pathway chosen in BRCA1-deficient cells could be entirely different from that in BRCA2-deficient cells after PARP inhibitor treatment. This review describes synthetic lethality and acquired resistance mechanisms to PARP inhibitor via the DSB repair pathway and subsequent repair process. In addition, recent knowledge of resistance mechanisms is discussed. Our model should contribute to the development of novel therapeutic strategies. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  8. Analysis of gene repair tracts from Cas9/gRNA double-stranded breaks in the human CFTR gene

    OpenAIRE

    Hollywood, Jennifer A.; Lee, Ciaran M.; Scallan, Martina F.; Harrison, Patrick T.

    2016-01-01

    To maximise the efficiency of template-dependent gene editing, most studies describe programmable and/or RNA-guided endonucleases that make a double-stranded break at, or close to, the target sequence to be modified. The rationale for this design strategy is that most gene repair tracts will be very short. Here, we describe a CRISPR Cas9/gRNA selection-free strategy which uses deep sequencing to characterise repair tracts from a donor plasmid containing seven nucleotide differences across a 2...

  9. Human Cell Assays for Synthesis-Dependent Strand Annealing and Crossing over During Double-Strand Break Repair

    OpenAIRE

    Grzegorz Zapotoczny; Jeff Sekelsky

    2017-01-01

    DNA double-strand breaks (DSBs) are one of the most deleterious types of lesions to the genome. Synthesis-dependent strand annealing (SDSA) is thought to be a major pathway of DSB repair, but direct tests of this model have only been conducted in budding yeast and Drosophila. To better understand this pathway, we developed an SDSA assay for use in human cells. Our results support the hypothesis that SDSA is an important DSB repair mechanism in human cells. We used siRNA knockdown to assess th...

  10. DNA repair activity in fish and interest in ecotoxicology: a review.

    Science.gov (United States)

    Kienzler, Aude; Bony, Sylvie; Devaux, Alain

    2013-06-15

    The knowledge of DNA repair in a target species is of first importance as it is the primary line of defense against genotoxicants, and a better knowledge of DNA repair capacity in fish could help to interpret genotoxicity data and/or assist in the choice of target species, developmental stage and tissues to focus on, both for environmental biomonitoring studies and DNA repair testing. This review focuses in a first part on what is presently known on a mechanistic basis, about the various DNA repair systems in fish, in vivo and in established cell lines. Data on base excision repair (BER), direct reversal with O⁶-alkylguanine transferase and double strand breaks repair, although rather scarce, are being reviewed, as well as nucleotide excision repair (NER) and photoreactivation repair (PER), which are by far the most studied repair mechanisms in fish. Most of these repair mechanisms seem to be strongly species and tissue dependent; they also depend on the developmental stage of the organisms. BER is efficient in vivo, although no data has been found on in vitro models. NER activity is quite low or even inexistent depending on the studies; however this lack is partly compensated by a strong PER activity, especially in early developmental stage. In a second part, a survey of the ecotoxicological studies integrating DNA repair as a parameter responding to single or mixture of contaminant is realized. Three main approaches are being used: the measurement of DNA repair gene expression after exposure, although it has not yet been clearly established whether gene expression is indicative of repair capacity; the monitoring of DNA damage removal by following DNA repair kinetics; and the modulation of DNA repair activity following exposure in situ, in order to assess the impact of exposure history on DNA repair capacity. Since all DNA repair processes are possible targets for environmental pollutants, we can also wonder at which extent such a modulation of repair capacities

  11. In Vitro Expansion of Bone Marrow Derived Mesenchymal Stem Cells Alters DNA Double Strand Break Repair of Etoposide Induced DNA Damage

    Directory of Open Access Journals (Sweden)

    Ian Hare

    2016-01-01

    Full Text Available Mesenchymal stem cells (MSCs are of interest for use in diverse cellular therapies. Ex vivo expansion of MSCs intended for transplantation must result in generation of cells that maintain fidelity of critical functions. Previous investigations have identified genetic and phenotypic alterations of MSCs with in vitro passage, but little is known regarding how culturing influences the ability of MSCs to repair double strand DNA breaks (DSBs, the most severe of DNA lesions. To investigate the response to DSB stress with passage in vitro, primary human MSCs were exposed to etoposide (VP16 at various passages with subsequent evaluation of cellular damage responses and DNA repair. Passage number did not affect susceptibility to VP16 or the incidence and repair kinetics of DSBs. Nonhomologous end joining (NHEJ transcripts showed little alteration with VP16 exposure or passage; however, homologous recombination (HR transcripts were reduced following VP16 exposure with this decrease amplified as MSCs were passaged in vitro. Functional evaluations of NHEJ and HR showed that MSCs were unable to activate NHEJ repair following VP16 stress in cells after successive passage. These results indicate that ex vivo expansion of MSCs alters their ability to perform DSB repair, a necessary function for cells intended for transplantation.

  12. Mitosis, double strand break repair, and telomeres: a view from the end: how telomeres and the DNA damage response cooperate during mitosis to maintain genome stability.

    Science.gov (United States)

    Cesare, Anthony J

    2014-11-01

    Double strand break (DSB) repair is suppressed during mitosis because RNF8 and downstream DNA damage response (DDR) factors, including 53BP1, do not localize to mitotic chromatin. Discovery of the mitotic kinase-dependent mechanism that inhibits DSB repair during cell division was recently reported. It was shown that restoring mitotic DSB repair was detrimental, resulting in repair dependent genome instability and covalent telomere fusions. The telomere DDR that occurs naturally during cellular aging and in cancer is known to be refractory to G2/M checkpoint activation. Such DDR-positive telomeres, and those that occur as part of the telomere-dependent prolonged mitotic arrest checkpoint, normally pass through mitosis without covalent ligation, but result in cell growth arrest in G1 phase. The discovery that suppressing DSB repair during mitosis may function primarily to protect DDR-positive telomeres from fusing during cell division reinforces the unique cooperation between telomeres and the DDR to mediate tumor suppression. © 2014 The Author. Bioessays published by WILEY Periodicals, Inc.

  13. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    Science.gov (United States)

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  14. Characterization of mammalian RAD51 double strand break repair using non-lethal dominant-negative forms

    OpenAIRE

    Lambert, Sarah; Lopez, Bernard S.

    2000-01-01

    In contrast to yeast RAD51, mammalian mRAD51 is an essential gene. Its role in double strand break (DSB) repair and its consequences on cell viability remain to be characterized precisely. Here, we used a hamster cell line carrying tandem repeat sequences with an I-SceI cleavage site. We characterized conservative recombination after I-SceI cleavage as gene conversion or intrachromatid crossing over associated with random reintegration of the excised reciprocal product. We identified two domi...

  15. Physical activity breaks and facilities in US secondary schools.

    Science.gov (United States)

    Hood, Nancy E; Colabianchi, Natalie; Terry-McElrath, Yvonne M; O'Malley, Patrick M; Johnston, Lloyd D

    2014-11-01

    Research on physical activity breaks and facilities (indoor and outdoor) in secondary schools is relatively limited. School administrators and students in nationally representative samples of 8th (middle school) and 10th/12th grade (high school) students were surveyed annually from 2008-2009 to 2011-2012. School administrators reported information about physical activity breaks and facilities. Students self-reported height, weight, and physical activity. The prevalence of physical activity breaks and indoor and outdoor facilities (dichotomized by median split) differed significantly by region of the country, school size, student race/ethnicity, and school socioeconomic status (SES). Breaks were associated with lower odds of overweight (adjusted odds ratio [AOR] = 0.91, 95% confidence interval [CI]: 0.83-1.00) and obesity (AOR = 0.86, 95% CI: 0.75-0.99) among middle school students. Among low-SES middle school students and schools, higher indoor facilities were associated with lower rates of overweight and obesity. Among high school students, higher indoor and outdoor facilities were associated with 19-42% higher odds of moderate-to-vigorous physical activity. Physical activity breaks and school facilities may help to address high rates of overweight/obesity and low physical activity levels among secondary students, especially lower-SES students. Students in all schools should have equal access to these resources. © 2014, American School Health Association.

  16. DNA double-strand break repair: a theoretical framework and its application.

    Science.gov (United States)

    Murray, Philip J; Cornelissen, Bart; Vallis, Katherine A; Chapman, S Jon

    2016-01-01

    DNA double-strand breaks (DSBs) are formed as a result of genotoxic insults, such as exogenous ionizing radiation, and are among the most serious types of DNA damage. One of the earliest molecular responses following DSB formation is the phosphorylation of the histone H2AX, giving rise to γH2AX. Many copies of γH2AX are generated at DSBs and can be detected in vitro as foci using well-established immuno-histochemical methods. It has previously been shown that anti-γH2AX antibodies, modified by the addition of the cell-penetrating peptide TAT and a fluorescent or radionuclide label, can be used to visualize and quantify DSBs in vivo. Moreover, when labelled with a high amount of the short-range, Auger electron-emitting radioisotope, (111)In, the amount of DNA damage within a cell can be increased, leading to cell death. In this report, we develop a mathematical model that describes how molecular processes at individual sites of DNA damage give rise to quantifiable foci. Equations that describe stochastic mean behaviours at individual DSB sites are derived and parametrized using population-scale, time-series measurements from two different cancer cell lines. The model is used to examine two case studies in which the introduction of an antibody (anti-γH2AX-TAT) that targets a key component in the DSB repair pathway influences system behaviour. We investigate: (i) how the interaction between anti-γH2AX-TAT and γH2AX effects the kinetics of H2AX phosphorylation and DSB repair and (ii) model behaviour when the anti-γH2AX antibody is labelled with Auger electron-emitting (111)In and can thus instigate additional DNA damage. This work supports the conclusion that DSB kinetics are largely unaffected by the introduction of the anti-γH2AX antibody, a result that has been validated experimentally, and hence the hypothesis that the use of anti-γH2AX antibody to quantify DSBs does not violate the image tracer principle. Moreover, it provides a novel model of DNA damage

  17. More efficient repair of DNA double-strand breaks in skeletal muscle stem cells compared to their committed progeny

    Directory of Open Access Journals (Sweden)

    Leyla Vahidi Ferdousi

    2014-11-01

    Full Text Available The loss of genome integrity in adult stem cells results in accelerated tissue aging and is possibly cancerogenic. Adult stem cells in different tissues appear to react robustly to DNA damage. We report that adult skeletal stem (satellite cells do not primarily respond to radiation-induced DNA double-strand breaks (DSBs via differentiation and exhibit less apoptosis compared to other myogenic cells. Satellite cells repair these DNA lesions more efficiently than their committed progeny. Importantly, non-proliferating satellite cells and post-mitotic nuclei in the fiber exhibit dramatically distinct repair efficiencies. Altogether, reduction of the repair capacity appears to be more a function of differentiation than of the proliferation status of the muscle cell. Notably, satellite cells retain a high efficiency of DSB repair also when isolated from the natural niche. Finally, we show that repair of DSB substrates is not only very efficient but, surprisingly, also very accurate in satellite cells and that accurate repair depends on the key non-homologous end-joining factor DNA-PKcs.

  18. Human Cell Assays for Synthesis-Dependent Strand Annealing and Crossing over During Double-Strand Break Repair.

    Science.gov (United States)

    Zapotoczny, Grzegorz; Sekelsky, Jeff

    2017-04-03

    DNA double-strand breaks (DSBs) are one of the most deleterious types of lesions to the genome. Synthesis-dependent strand annealing (SDSA) is thought to be a major pathway of DSB repair, but direct tests of this model have only been conducted in budding yeast and Drosophila To better understand this pathway, we developed an SDSA assay for use in human cells. Our results support the hypothesis that SDSA is an important DSB repair mechanism in human cells. We used siRNA knockdown to assess the roles of a number of helicases suggested to promote SDSA. None of the helicase knockdowns reduced SDSA, but knocking down BLM or RTEL1 increased SDSA. Molecular analysis of repair products suggests that these helicases may prevent long-tract repair synthesis. Since the major alternative to SDSA (repair involving a double-Holliday junction intermediate) can lead to crossovers, we also developed a fluorescent assay that detects crossovers generated during DSB repair. Together, these assays will be useful in investigating features and mechanisms of SDSA and crossover pathways in human cells. Copyright © 2017 Zapotoczny and Sekelsky.

  19. Human Cell Assays for Synthesis-Dependent Strand Annealing and Crossing over During Double-Strand Break Repair

    Directory of Open Access Journals (Sweden)

    Grzegorz Zapotoczny

    2017-04-01

    Full Text Available DNA double-strand breaks (DSBs are one of the most deleterious types of lesions to the genome. Synthesis-dependent strand annealing (SDSA is thought to be a major pathway of DSB repair, but direct tests of this model have only been conducted in budding yeast and Drosophila. To better understand this pathway, we developed an SDSA assay for use in human cells. Our results support the hypothesis that SDSA is an important DSB repair mechanism in human cells. We used siRNA knockdown to assess the roles of a number of helicases suggested to promote SDSA. None of the helicase knockdowns reduced SDSA, but knocking down BLM or RTEL1 increased SDSA. Molecular analysis of repair products suggests that these helicases may prevent long-tract repair synthesis. Since the major alternative to SDSA (repair involving a double-Holliday junction intermediate can lead to crossovers, we also developed a fluorescent assay that detects crossovers generated during DSB repair. Together, these assays will be useful in investigating features and mechanisms of SDSA and crossover pathways in human cells.

  20. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

    Science.gov (United States)

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

    2014-06-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by Mismatch and Double-strand Break Repair DNA substrates

    Science.gov (United States)

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M.; Bianco, Piero R.; Surtees, Jennifer A.

    2014-01-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3′ non-homologous tail removal (3′NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3′ NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3′ NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3′ NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. PMID:24746922

  2. Breaking supercontinents; no need to choose between passive or active

    Science.gov (United States)

    Wolstencroft, Martin; Davies, J. Huw

    2017-08-01

    Much debate has centred on whether continental break-up is predominantly caused by active upwelling in the mantle (e.g. plumes) or by long-range extensional stresses in the lithosphere. We propose the hypothesis that global supercontinent break-up events should always involve both. The fundamental principle involved is the conservation of mass within the spherical shell of the mantle, which requires a return flow for any major upwelling beneath a supercontinent. This shallow horizontal return flow away from the locus of upwelling produces extensional stress. We demonstrate this principle with numerical models, which simultaneously exhibit both upwellings and significant lateral flow in the upper mantle. For non-global break-up the impact of the finite geometry of the mantle will be less pronounced, weakening this process. This observation should motivate future studies of continental break-up to explicitly consider the global perspective, even when observations or models are of regional extent.

  3. Contribution of DNA double-strand break repair gene XRCC3 genotypes to oral cancer susceptibility in Taiwan.

    Science.gov (United States)

    Tsai, Chia-Wen; Chang, Wen-Shin; Liu, Juhn-Cherng; Tsai, Ming-Hsui; Lin, Cheng-Chieh; Bau, Da-Tian

    2014-06-01

    The DNA repair gene X-ray repair cross complementing protein 3 (XRCC3) is thought to play a major role in double-strand break repair and in maintaining genomic stability. Very possibly, defective double-strand break repair of cells can lead to carcinogenesis. Therefore, a case-control study was performed to reveal the contribution of XRCC3 genotypes to individual oral cancer susceptibility. In this hospital-based research, the association of XRCC3 rs1799794, rs45603942, rs861530, rs3212057, rs1799796, rs861539, rs28903081 genotypes with oral cancer risk in a Taiwanese population was investigated. In total, 788 patients with oral cancer and 956 age- and gender-matched healthy controls were genotyped. The results showed that there was significant differential distribution among oral cancer and controls in the genotypic (p=0.001428) and allelic (p=0.0013) frequencies of XRCC3 rs861539. As for the other polymorphisms, there was no difference between case and control groups. In gene-lifestyle interaction analysis, we have provided the first evidence showing that there is an obvious joint effect of XRCC3 rs861539 genotype with individual areca chewing habits on oral cancer risk. In conclusion, the T allele of XRCC3 rs861539, which has an interaction with areca chewing habit in oral carcinogenesis, may be an early marker for oral cancer in Taiwanese. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  4. Mechanism of elimination of phosphorylated histone H2AX from chromatin after repair of DNA double-strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Svetlova, M.P., E-mail: svetlma@mail.ru [Institute of Cytology, Russian Academy of Sciences, 4 Tikhoretsky ave., 194064 St. Petersburg (Russian Federation); Solovjeva, L.V.; Tomilin, N.V. [Institute of Cytology, Russian Academy of Sciences, 4 Tikhoretsky ave., 194064 St. Petersburg (Russian Federation)

    2010-03-01

    Covalent modifications of histones in chromatin play an important role in regulation of eukaryotic gene expression and DNA repair. Formation of double-strand breaks (DSBs) in DNA is followed by the rapid local phosphorylation of the C-terminal serine in the replacement histone H2AX in megabase chromatin domains around DSBs and formation of discrete nuclear foci called {gamma}H2AX foci. This epigenetic modification of chromatin represents the 'histone code' for DNA damage signaling and repair and has been extensively studied during last decade. It is known that after DSB rejoining {gamma}H2AX foci are eliminated from the nucleus, but molecular mechanism of this elimination remains to be established. However, {gamma}H2AX elimination can serve as a useful marker of DSB repair in normal cells and tissues. In this paper the available data on kinetics and possible mechanisms of {gamma}H2AX elimination are reviewed.

  5. Molecular Process Producing Oncogene Fusion in Lung Cancer Cells by Illegitimate Repair of DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Yoshitaka Seki

    2015-09-01

    Full Text Available Constitutive activation of oncogenes by fusion to partner genes, caused by chromosome translocation and inversion, is a critical genetic event driving lung carcinogenesis. Fusions of the tyrosine kinase genes ALK (anaplastic lymphoma kinase, ROS1 (c-ros oncogene 1, or RET (rearranged during transfection occur in 1%–5% of lung adenocarcinomas (LADCs and their products constitute therapeutic targets for kinase inhibitory drugs. Interestingly, ALK, RET, and ROS1 fusions occur preferentially in LADCs of never- and light-smokers, suggesting that the molecular mechanisms that cause these rearrangements are smoking-independent. In this study, using previously reported next generation LADC genome sequencing data of the breakpoint junction structures of chromosome rearrangements that cause oncogenic fusions in human cancer cells, we employed the structures of breakpoint junctions of ALK, RET, and ROS1 fusions in 41 LADC cases as “traces” to deduce the molecular processes of chromosome rearrangements caused by DNA double-strand breaks (DSBs and illegitimate joining. We found that gene fusion was produced by illegitimate repair of DSBs at unspecified sites in genomic regions of a few kb through DNA synthesis-dependent or -independent end-joining pathways, according to DSB type. This information will assist in the understanding of how oncogene fusions are generated and which etiological factors trigger them.

  6. Local Activity Principle:. the Cause of Complexity and Symmetry Breaking

    Science.gov (United States)

    Mainzer, Klaus

    2013-01-01

    The principle of local activity is precisely the missing concept to explain the emergence of complex patterns in a homogeneous medium. Leon O. Chua discovered and defined this principle in the theory of nonlinear electronic circuits in a mathematically rigorous way. The local principle can be generalized and proven at least for the class of nonlinear reaction-diffusion systems in physics, chemistry, biology and brain research. Recently, it was realized by memristors for nanoelectronic device applications in technical brains. In general, the emergence of complex patterns and structures is explained by symmetry breaking in homogeneous media. The principle of local activity is the cause of symmetry breaking in homogeneous media. We argue that the principle of local activity is really fundamental in science and can even be identified in quantum cosmology as symmetry breaking of local gauge symmetries generating the complexity of matter and forces in our universe. Finally, we consider applications in economic, financial, and social systems with the emergence of equilibrium states, symmetry breaking at critical points of phase transitions and risky acting at the edge of chaos. In any case, the driving causes of symmetry breaking and the emergence of complexity are locally active elements, cells, units, or agents.

  7. Impact of charged particle exposure on homologous DNA double-strand break repair in human blood-derived cells

    Directory of Open Access Journals (Sweden)

    Melanie eRall

    2015-11-01

    Full Text Available Ionizing radiation generates DNA double-strand breaks (DSB which, unless faithfully repaired, can generate chromosomal rearrangements in hematopoietic stem and/or progenitor cells (HSPC, potentially priming the cells towards a leukemic phenotype. Using an enhanced green fluorescent protein (EGFP-based reporter system, we recently identified differences in the removal of enzyme-mediated DSB in human HSPC versus mature peripheral blood lymphocytes (PBL, particularly regarding homologous DSB repair (HR. Assessment of chromosomal breaks via premature chromosome condensation or γH2AX foci indicated similar efficiency and kinetics of radiation-induced DSB formation and rejoining in PBL and HSPC. Prolonged persistence of chromosomal breaks was observed for higher LET charged particles which are known to induce more complex DNA damage compared to X rays. Consistent with HR deficiency in HSPC observed in our previous study, we noticed here pronounced focal accumulation of 53BP1 after X-ray and carbon ion exposure (intermediate LET in HSPC versus PBL. For higher LET, 53BP1 foci kinetics were similarly delayed in PBL and HSPC suggesting similar failure to repair complex DNA damage. Data obtained with plasmid reporter systems revealed a dose- and LET-dependent HR increase after X-ray, carbon ion and higher LET exposure, particularly in HR-proficient immortalized and primary lymphocytes, confirming preferential use of conservative HR in PBL for intermediate LET damage repair. HR measured adjacent to the leukemia-associated MLL breakpoint cluster sequence in reporter lines revealed dose-dependency of potentially leukemogenic rearrangements underscoring the risk of leukemia-induction by radiation treatment.

  8. Apn1 and Apn2 endonucleases prevent accumulation of repair-associated DNA breaks in budding yeast as revealed by direct chromosomal analysis.

    Science.gov (United States)

    Ma, Wenjian; Resnick, Michael A; Gordenin, Dmitry A

    2008-04-01

    Base excision repair (BER) provides relief from many DNA lesions. While BER enzymes have been characterized biochemically, BER functions within cells are much less understood, in part because replication bypass and double-strand break (DSB) repair can also impact resistance to base damage. To investigate BER in vivo, we examined the repair of methyl methanesulfonate (MMS) induced DNA damage in haploid G1 yeast cells, so that replication bypass and recombinational DSB repair cannot occur. Based on the heat-lability of MMS-induced base damage, an assay was developed that monitors secondary breaks in full-length yeast chromosomes where closely spaced breaks yield DSBs that are observed by pulsed-field gel electrophoresis. The assay detects damaged bases and abasic (AP) sites as heat-dependent breaks as well as intermediate heat-independent breaks that arise during BER. Using a circular chromosome, lesion frequency and repair kinetics could be easily determined. Monitoring BER in single and multiple glycosylase and AP-endonuclease mutants confirmed that Mag1 is the major enzyme that removes MMS-damaged bases. This approach provided direct physical evidence that Apn1 and Apn2 not only repair cellular base damage but also prevent break accumulation that can result from AP sites being channeled into other BER pathway(s).

  9. Ubiquitin-specific protease 5 is required for the efficient repair of DNA double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Satoshi Nakajima

    Full Text Available During the DNA damage response (DDR, ubiquitination plays an important role in the recruitment and regulation of repair proteins. However, little is known about elimination of the ubiquitination signal after repair is completed. Here we show that the ubiquitin-specific protease 5 (USP5, a deubiquitinating enzyme, is involved in the elimination of the ubiquitin signal from damaged sites and is required for efficient DNA double-strand break (DSB repair. Depletion of USP5 sensitizes cells to DNA damaging agents, produces DSBs, causes delayed disappearance of γH2AX foci after Bleocin treatment, and influences DSB repair efficiency in the homologous recombination pathway but not in the non-homologous end joining pathway. USP5 co-localizes to DSBs induced by laser micro-irradiation in a RAD18-dependent manner. Importantly, polyubiquitin chains at sites of DNA damage remained for longer periods in USP5-depleted cells. Our results show that disassembly of polyubiquitin chains by USP5 at sites of damage is important for efficient DSB repair.

  10. The democratization of gene editing: Insights from site-specific cleavage and double-strand break repair.

    Science.gov (United States)

    Jasin, Maria; Haber, James E

    2016-08-01

    DNA double-strand breaks (DSBs) are dangerous lesions that if not properly repaired can lead to genomic change or cell death. Organisms have developed several pathways and have many factors devoted to repairing DSBs, which broadly occurs by homologous recombination, which relies on an identical or homologous sequence to template repair, or nonhomologous end-joining. Much of our understanding of these repair mechanisms has come from the study of induced DNA cleavage by site-specific endonucleases. In addition to their biological role, these cellular pathways can be co-opted for gene editing to study gene function or for gene therapy or other applications. While the first gene editing experiments were done more than 20 years ago, the recent discovery of RNA-guided endonucleases has simplified approaches developed over the years to make gene editing an approach that is available to the entire biomedical research community. Here, we review DSB repair mechanisms and site-specific cleavage systems that have provided insight into these mechanisms and led to the current gene editing revolution. Copyright © 2016. Published by Elsevier B.V.

  11. The Democratization of Gene Editing: Insights from site-specific cleavage and double-strand break repair

    Science.gov (United States)

    Jasin, Maria; Haber, James E.

    2017-01-01

    DNA double-strand breaks (DSBs) are dangerous lesions that if not properly repaired can lead to genomic change or cell death. Organisms have developed several pathways and have many factors devoted to repairing DSBs, which broadly occur by homologous recombination that relies on an identical or homologous sequence to template repair, or nonhomologous end-joining. Much of our understanding of these repair mechanisms has come from the study of induced DNA cleavage by site-specific endonucleases. In addition to their biological role, these cellular pathways can be co-opted for gene editing to study gene function or for gene therapy or other applications. While the first gene editing experiments were done more than 20 years ago, the recent discovery of RNA-guided endonucleases has simplified approaches developed over the years to make gene editing an approach that is available to the entire biomedical research community. Here, we review DSB repair mechanisms and site-specific cleavage systems that have provided insight into these mechanisms and led to the current gene editing revolution. PMID:27261202

  12. Hsp90α regulates ATM and NBN functions in sensing and repair of DNA double-strand breaks.

    Science.gov (United States)

    Pennisi, Rosa; Antoccia, Antonio; Leone, Stefano; Ascenzi, Paolo; di Masi, Alessandra

    2017-08-01

    The molecular chaperone heat shock protein 90 (Hsp90α) regulates cell proteostasis and mitigates the harmful effects of endogenous and exogenous stressors on the proteome. Indeed, the inhibition of Hsp90α ATPase activity affects the cellular response to ionizing radiation (IR). Although the interplay between Hsp90α and several DNA damage response (DDR) proteins has been reported, its role in the DDR is still unclear. Here, we show that ataxia-telangiectasia-mutated kinase (ATM) and nibrin (NBN), but not 53BP1, RAD50, and MRE11, are Hsp90α clients as the Hsp90α inhibitor 17-(allylamino)-17-demethoxygeldanamycin (17-AAG) induces ATM and NBN polyubiquitination and proteosomal degradation in normal fibroblasts and lymphoblastoid cell lines. Hsp90α-ATM and Hsp90α-NBN complexes are present in unstressed and irradiated cells, allowing the maintenance of ATM and NBN stability that is required for the MRE11/RAD50/NBN complex-dependent ATM activation and the ATM-dependent phosphorylation of both NBN and Hsp90α in response to IR-induced DNA double-strand breaks (DSBs). Hsp90α forms a complex also with ph-Ser1981-ATM following IR. Upon phosphorylation, NBN dissociates from Hsp90α and translocates at the DSBs, while phThr5/7-Hsp90α is not recruited at the damaged sites. The inhibition of Hsp90α affects nuclear localization of MRE11 and RAD50, impairs DDR signaling (e.g., BRCA1 and CHK2 phosphorylation), and slows down DSBs repair. Hsp90α inhibition does not affect DNA-dependent protein kinase (DNA-PK) activity, which possibly phosphorylates Hsp90α and H2AX after IR. Notably, Hsp90α inhibition causes H2AX phosphorylation in proliferating cells, this possibly indicating replication stress events. Overall, present data shed light on the regulatory role of Hsp90α on the DDR, controlling ATM and NBN stability and influencing the DSBs signaling and repair. © 2017 Federation of European Biochemical Societies.

  13. Approach to the classical radiation biology. Ionizing radiation effects and repair mechanism of DNA double strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Utsumi, Hiroshi [Kyoto Univ., Kumatori, Osaka (Japan). Research Reactor Inst

    2000-09-01

    Split-dose recovery has been observed under a variety of experimental conditions in many cell systems and believed to be the recovery of sublethal damage (SLD). It is considered to be one of the most widespread and important cellular responses in clinical radiotherapy. To study the molecular mechanism of this recovery, we analyzed the knockout mutants KU70{sup -/-}, RAD54{sup -/-}, and KU70{sup -/-}/ RAD54{sup -/-} of the chicken B-cell line, DT40. Rad54 participates in the homologous recombinational (HR) repair of DNA double-strand breaks (DSB), while Ku proteins are involved in non-homologous end-joining (NHEJ). Split-dose recovery was observed in the parent DT40 and KU70{sup -/-} cells. Moreover the split-dose survival enhancement had all of the characteristics of SLD recovery that had been demonstrated earlier: e.g., the reappearance of the shoulder of the survival curve with dose fractionation; repair at 25degC; and inhibition by the antibiotic actinomycin D. These results strongly suggest that SLD recovery is due to DSB repair via or mediated by HR, and that these breaks constitute SLD. The tonicity-sensitive potentially lethal damage (PLD) recovery was also found only in DT40 and KU70 {sup -/-} cells. Delayed-plating PLD recovery may be controlled by NHEJ repair that works through the cell cycle. These results lead to the conclusion that the repair of DSBs could explain the classical operational recovery phenomena. We have also investigated RBE/LET using those mutants. (author)

  14. Chlamydomonas chloroplasts can use short dispersed repeats and multiple pathways to repair a double-strand break in the genome.

    Science.gov (United States)

    Odom, Obed W; Baek, Kwang-Hyun; Dani, Radhika N; Herrin, David L

    2008-03-01

    Certain group I introns insert into intronless DNA via an endonuclease that creates a double-strand break (DSB). There are two models for intron homing in phage: synthesis-dependent strand annealing (SDSA) and double-strand break repair (DSBR). The Cr.psbA4 intron homes efficiently from a plasmid into the chloroplast psbA gene in Chlamydomonas, but little is known about the mechanism. Analysis of co-transformants selected using a spectinomycin-resistant 16S gene (16S(spec)) provided evidence for both pathways. We also examined the consequences of the donor DNA having only one-sided or no homology with the psbA gene. When there was no homology with the donor DNA, deletions of up to 5 kb involving direct repeats that flank the psbA gene were obtained. Remarkably, repeats as short as 15 bp were used for this repair, which is consistent with the single-strand annealing (SSA) pathway. When the donor had one-sided homology, the DSB in most co-transformants was repaired using two DNAs, the donor and the 16S(spec) plasmid, which, coincidentally, contained a region that is repeated upstream of psbA. DSB repair using two separate DNAs provides further evidence for the SDSA pathway. These data show that the chloroplast can repair a DSB using short dispersed repeats located proximally, distally, or even on separate molecules relative to the DSB. They also provide a rationale for the extensive repertoire of repeated sequences in this genome.

  15. An inverse switch in DNA base excision and strand break repair contributes to melphalan resistance in multiple myeloma cells.

    Directory of Open Access Journals (Sweden)

    Mirta M L Sousa

    Full Text Available Alterations in checkpoint and DNA repair pathways may provide adaptive mechanisms contributing to acquired drug resistance. Here, we investigated the levels of proteins mediating DNA damage signaling and -repair in RPMI8226 multiple myeloma cells and its Melphalan-resistant derivative 8226-LR5. We observed markedly reduced steady-state levels of DNA glycosylases UNG2, NEIL1 and MPG in the resistant cells and cross-resistance to agents inducing their respective DNA base lesions. Conversely, repair of alkali-labile sites was apparently enhanced in the resistant cells, as substantiated by alkaline comet assay, autoribosylation of PARP-1, and increased sensitivity to PARP-1 inhibition by 4-AN or KU58684. Reduced base-excision and enhanced single-strand break repair would both contribute to the observed reduction in genomic alkali-labile sites, which could jeopardize productive processing of the more cytotoxic Melphalan-induced interstrand DNA crosslinks (ICLs. Furthermore, we found a marked upregulation of proteins in the non-homologous end-joining (NHEJ pathway of double-strand break (DSB repair, likely contributing to the observed increase in DSB repair kinetics in the resistant cells. Finally, we observed apparent upregulation of ATR-signaling and downregulation of ATM-signaling in the resistant cells. This was accompanied by markedly increased sensitivity towards Melphalan in the presence of ATR-, DNA-PK, or CHK1/2 inhibitors whereas no sensitizing effect was observed subsequent to ATM inhibition, suggesting that replication blocking lesions are primary triggers of the DNA damage response in the Melphalan resistant cells. In conclusion, Melphalan resistance is apparently contributed by modulation of the DNA damage response at multiple levels, including downregulation of specific repair pathways to avoid repair intermediates that could impair efficient processing of cytotoxic ICLs and ICL-induced DSBs. This study has revealed several novel

  16. ZTF-8 interacts with the 9-1-1 complex and is required for DNA damage response and double-strand break repair in the C. elegans germline.

    Directory of Open Access Journals (Sweden)

    Hyun-Min Kim

    2014-10-01

    Full Text Available Germline mutations in DNA repair genes are linked to tumor progression. Furthermore, failure in either activating a DNA damage checkpoint or repairing programmed meiotic double-strand breaks (DSBs can impair chromosome segregation. Therefore, understanding the molecular basis for DNA damage response (DDR and DSB repair (DSBR within the germline is highly important. Here we define ZTF-8, a previously uncharacterized protein conserved from worms to humans, as a novel factor involved in the repair of both mitotic and meiotic DSBs as well as in meiotic DNA damage checkpoint activation in the C. elegans germline. ztf-8 mutants exhibit specific sensitivity to γ-irradiation and hydroxyurea, mitotic nuclear arrest at S-phase accompanied by activation of the ATL-1 and CHK-1 DNA damage checkpoint kinases, as well as accumulation of both mitotic and meiotic recombination intermediates, indicating that ZTF-8 functions in DSBR. However, impaired meiotic DSBR progression partially fails to trigger the CEP-1/p53-dependent DNA damage checkpoint in late pachytene, also supporting a role for ZTF-8 in meiotic DDR. ZTF-8 partially co-localizes with the 9-1-1 DDR complex and interacts with MRT-2/Rad1, a component of this complex. The human RHINO protein rescues the phenotypes observed in ztf-8 mutants, suggesting functional conservation across species. We propose that ZTF-8 is involved in promoting repair at stalled replication forks and meiotic DSBs by transducing DNA damage checkpoint signaling via the 9-1-1 pathway. Our findings define a conserved function for ZTF-8/RHINO in promoting genomic stability in the germline.

  17. Ras activation and symmetry breaking during Dictyostelium chemotaxis.

    Science.gov (United States)

    Kortholt, Arjan; Keizer-Gunnink, Ineke; Kataria, Rama; Van Haastert, Peter J M

    2013-10-01

    Central to chemotaxis is the molecular mechanism by which a shallow spatial gradient of chemoattractant induces symmetry breaking of activated signaling molecules. Previously, we have used Dictyostelium mutants to investigate the minimal requirements for chemotaxis, and identified a basal signaling module providing activation of Ras and F-actin at the leading edge. Here, we show that Ras activation after application of a pipette releasing the chemoattractant cAMP has three phases, each depending on specific guanine-nucleotide-exchange factors (GEFs). Initially a transient activation of Ras occurs at the entire cell boundary, which is proportional to the local cAMP concentrations and therefore slightly stronger at the front than in the rear of the cell. This transient Ras activation is present in gα2 (gpbB)-null cells but not in gβ (gpbA)-null cells, suggesting that Gβγ mediates the initial activation of Ras. The second phase is symmetry breaking: Ras is activated only at the side of the cell closest to the pipette. Symmetry breaking absolutely requires Gα2 and Gβγ, but not the cytoskeleton or four cAMP-induced signaling pathways, those dependent on phosphatidylinositol (3,4,5)-triphosphate [PtdIns(3,4,5)P3], cGMP, TorC2 and PLA2. As cells move in the gradient, the crescent of activated Ras in the front half of the cell becomes confined to a small area at the utmost front of the cell. Confinement of Ras activation leads to cell polarization, and depends on cGMP formation, myosin and F-actin. The experiments show that activation, symmetry breaking and confinement of Ras during Dictyostelium chemotaxis uses different G-protein subunits and a multitude of Ras GEFs and GTPase-activating proteins (GAPs).

  18. Writers, Readers, and Erasers of Histone Ubiquitylation in DNA Double-Strand Break Repair

    DEFF Research Database (Denmark)

    Smeenk, Godelieve; Mailand, Niels

    2016-01-01

    for a range of genome caretaker proteins and their associated factors. These DNA damage-induced chromatin ubiquitylation marks provide an essential component of a histone code for DSB repair that is controlled by multifaceted regulatory circuits, underscoring its importance for genome stability maintenance...... accurate lesion repair and restoration of genome integrity. In vertebrate cells, ubiquitin-dependent modifications of histones adjacent to DSBs by RNF8, RNF168, and other ubiquitin ligases have a key role in promoting the assembly of repair protein complexes, serving as direct recruitment platforms....... In this review, we provide a comprehensive account of how DSB-induced histone ubiquitylation is sensed, decoded and modulated by an elaborate array of repair factors and regulators. We discuss how these mechanisms impact DSB repair pathway choice and functionality for optimal protection of genome integrity...

  19. Dynamics and Mechanism of Efficient DNA Repair Reviewed by Active-Site Mutants

    Science.gov (United States)

    Tan, Chuang; Liu, Zheyun; Li, Jiang; Guo, Xunmin; Wang, Lijuan; Zhong, Dongping

    2010-06-01

    Photolyases repair the UV-induced pyrimidine dimers in damage DNA via a photoreaction which includes a series of light-driven electron transfers between the two-electron-reduced flavin cofactor FADH^- and the dimer. We report here our systematic studies of the repair dynamics in E. coli photolyase with mutation of several active-site residues. With femtosecond resolution, we observed the significant change in the forward electron transfer from the excited FADH^- to the dimer and the back electron transfer from the repaired thymines by mutation of E274A, R226A, R342A, N378S and N378C. We also found that the mutation of E274A accelerates the bond-breaking of the thymine dimer. The dynamics changes are consistent with the quantum yield study of these mutants. These results suggest that the active-site residues play a significant role, structurally and chemically, in the DNA repair photocycle.

  20. BRCA2 and the DNA Double-Strand Break Repair Machinery

    National Research Council Canada - National Science Library

    Chen, Phang-Lang

    2000-01-01

    The overall goal of my grant proposal is to test the model, BRCA2 modulates the early steps of repair mediated by the Rad5O nuclease complex, and the later stages catalyzed by the Rad51 recombinase...

  1. Mouse BAZ1A (ACF1 is dispensable for double-strand break repair but is essential for averting improper gene expression during spermatogenesis.

    Directory of Open Access Journals (Sweden)

    James A Dowdle

    2013-11-01

    Full Text Available ATP-dependent chromatin remodelers control DNA access for transcription, recombination, and other processes. Acf1 (also known as BAZ1A in mammals is a defining subunit of the conserved ISWI-family chromatin remodelers ACF and CHRAC, first purified over 15 years ago from Drosophila melanogaster embryos. Much is known about biochemical properties of ACF and CHRAC, which move nucleosomes in vitro and in vivo to establish ordered chromatin arrays. Genetic studies in yeast, flies and cultured human cells clearly implicate these complexes in transcriptional repression via control of chromatin structures. RNAi experiments in transformed mammalian cells in culture also implicate ACF and CHRAC in DNA damage checkpoints and double-strand break repair. However, their essential in vivo roles in mammals are unknown. Here, we show that Baz1a-knockout mice are viable and able to repair developmentally programmed DNA double-strand breaks in the immune system and germ line, I-SceI endonuclease-induced breaks in primary fibroblasts via homologous recombination, and DNA damage from mitomycin C exposure in vivo. However, Baz1a deficiency causes male-specific sterility in accord with its high expression in male germ cells, where it displays dynamic, stage-specific patterns of chromosomal localization. Sterility is caused by pronounced defects in sperm development, most likely a consequence of massively perturbed gene expression in spermatocytes and round spermatids in the absence of BAZ1A: the normal spermiogenic transcription program is largely intact but more than 900 other genes are mis-regulated, primarily reflecting inappropriate up-regulation. We propose that large-scale changes in chromatin composition that occur during spermatogenesis create a window of vulnerability to promiscuous transcription changes, with an essential function of ACF and/or CHRAC chromatin remodeling activities being to safeguard against these alterations.

  2. Regulation of 53BP1 protein stability by RNF8 and RNF168 is important for efficient DNA double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Yiheng Hu

    Full Text Available 53BP1 regulates DNA double-strand break (DSB repair. In functional assays for specific DSB repair pathways, we found that 53BP1 was important in the conservative non-homologous end-joining (C-NHEJ pathway, and this activity was dependent upon RNF8 and RNF168. We observed that 53BP1 protein was diffusely abundant in nuclei, and upon ionizing radiation, 53BP1 was everywhere degraded except at DNA damage sites. Depletion of RNF8 or RNF168 blocked the degradation of the diffusely localized nuclear 53BP1, and ionizing radiation induced foci (IRIF did not form. Furthermore, when 53BP1 degradation was inhibited, a subset of 53BP1 was bound to DNA damage sites but bulk, unbound 53BP1 remained in the nucleoplasm, and localization of its downstream effector RIF1 at DSBs was abolished. Our data suggest a novel mechanism for responding to DSB that upon ionizing radiation, 53BP1 was divided into two populations, ensuring functional DSB repair: damage site-bound 53BP1 whose binding signal is known to be generated by RNF8 and RNF168; and unbound bulk 53BP1 whose ensuing degradation is regulated by RNF8 and RNF168.

  3. Meiotic versus mitotic recombination: two different routes for double-strand break repair: the different functions of meiotic versus mitotic DSB repair are reflected in different pathway usage and different outcomes.

    Science.gov (United States)

    Andersen, Sabrina L; Sekelsky, Jeff

    2010-12-01

    Studies in the yeast Saccharomyces cerevisiae have validated the major features of the double-strand break repair (DSBR) model as an accurate representation of the pathway through which meiotic crossovers (COs) are produced. This success has led to this model being invoked to explain double-strand break (DSB) repair in other contexts. However, most non-crossover (NCO) recombinants generated during S. cerevisiae meiosis do not arise via a DSBR pathway. Furthermore, it is becoming increasingly clear that DSBR is a minor pathway for recombinational repair of DSBs that occur in mitotically-proliferating cells and that the synthesis-dependent strand annealing (SDSA) model appears to describe mitotic DSB repair more accurately. Fundamental dissimilarities between meiotic and mitotic recombination are not unexpected, since meiotic recombination serves a very different purpose (accurate chromosome segregation, which requires COs) than mitotic recombination (repair of DNA damage, which typically generates NCOs). Copyright © 2010 WILEY Periodicals, Inc.

  4. Altered Hematopoiesis in Mice Lacking DNA Polymerase μ Is Due to Inefficient Double-Strand Break Repair

    Science.gov (United States)

    Lucas, Daniel; Escudero, Beatriz; Ligos, José Manuel; Segovia, Jose Carlos; Estrada, Juan Camilo; Terrados, Gloria; Blanco, Luis; Samper, Enrique; Bernad, Antonio

    2009-01-01

    Polymerase mu (Polμ) is an error-prone, DNA-directed DNA polymerase that participates in non-homologous end-joining (NHEJ) repair. In vivo, Polμ deficiency results in impaired Vκ-Jκ recombination and altered somatic hypermutation and centroblast development. In Polμ−/− mice, hematopoietic development was defective in several peripheral and bone marrow (BM) cell populations, with about a 40% decrease in BM cell number that affected several hematopoietic lineages. Hematopoietic progenitors were reduced both in number and in expansion potential. The observed phenotype correlates with a reduced efficiency in DNA double-strand break (DSB) repair in hematopoietic tissue. Whole-body γ-irradiation revealed that Polμ also plays a role in DSB repair in non-hematopoietic tissues. Our results show that Polμ function is required for physiological hematopoietic development with an important role in maintaining early progenitor cell homeostasis and genetic stability in hematopoietic and non-hematopoietic tissues. PMID:19229323

  5. A primary school active break programme (ACTI-BREAK): study protocol for a pilot cluster randomised controlled trial.

    Science.gov (United States)

    Watson, Amanda; Timperio, Anna; Brown, Helen; Hesketh, Kylie D

    2017-09-19

    Levels of overall physical activity have been shown to decline across childhood. Schools are considered ideal settings to promote physical activity as children spend a large amount of their waking hours at school. Time-efficient physical activity strategies that demonstrate a positive impact on academic-related outcomes are needed to enable physical activity to be prioritised in the school day. The ACTI-BREAK programme requires classroom teachers to integrate active breaks; 5-min bursts of moderate-intensity physical activity into their classroom routine. Active breaks have been shown to be effective in improving academic-related outcomes, a potentially appealing aspect for teachers and schools. The primary aim of this study is to assess the feasibility and potential efficacy of the ACTI-BREAK programme on children's academic achievement. Secondary aims are to explore the impact of ACTI-BREAK on children's on-task behaviour and objectively measured physical activity levels. ACTI-BREAK is a 6-week, classroom-based, physical activity intervention. This pilot trial of the programme will be evaluated using a cluster randomised controlled design. Government primary schools in metropolitan Melbourne, Australia will be invited to participate in the programme in 2017. Randomisation will occur at the school level, with the aim to recruit six schools (three intervention and three control). The ACTI-BREAK programme is theoretically grounded, and was developed with input and guidance from current primary school teachers. Teachers from the intervention schools will receive a 45-min training session and be asked to incorporate ACTI-BREAKS into their classroom routine three times per day for 6 weeks. Intervention support will be provided via assisted delivery. The primary outcomes will be children's academic achievement in mathematics and reading. Children's on-task behaviour and school-day physical activity will be assessed as secondary outcomes. Process evaluation will also be

  6. Activity Level and Function 2 Years After Anterior Talofibular Ligament Repair: A Comparison Between Arthroscopic Repair and Open Repair Procedures.

    Science.gov (United States)

    Li, Hong; Hua, Yinghui; Li, Hongyun; Ma, Kui; Li, Shengkun; Chen, Shiyi

    2017-07-01

    The open modified Broström anatomic repair technique is widely accepted as the reference standard for lateral ankle stabilization. Despite recent increases in publications regarding arthroscopic repair of the anterior talofibular ligament (ATFL) for treatment of chronic ankle instability, research is lacking that compares the functional outcomes between arthroscopic repair and open repair procedures for chronic ankle instability. To compare function and activity level after arthroscopic repair versus open repair of the ATFL in patients with lateral ankle instability. Cohort study; Level of evidence, 3. All patients who underwent arthroscopic or open surgical Broström repair of the ATFL between January 2012 and August 2014 were invited to participate in this study. All of the patients had consented for arthroscopic repair if feasible. In cases in which arthroscopic repair was impossible, the open modified Broström procedure was performed after arthroscopy. Patients accepted a systematic rehabilitation program postoperatively. American Orthopaedic Foot and Ankle Society (AOFAS) score, Karlsson Ankle Functional Score (KAFS), and Tegner activity score were used to evaluate ankle function preoperatively and at a minimum follow-up of 2 years. Magnetic resonance imaging (MRI) was performed to evaluate the signal to noise ratio (SNR) of the repaired ATFL. A total of 60 patients were included in this study. They were assigned to 1 of 2 groups according to their surgical procedure: 23 patients underwent arthroscopic repair (arthroscopic group) and 37 patients underwent open repair (open group). No patient in either group had ankle instability at follow-up postoperatively. After surgery, the AOFAS score ( P arthroscopic group and the open group, respectively. As well, no significant difference was found in the mean SNR value of ATFL between the arthroscopic group and the open group (9.1 ± 2.7 vs 8.8 ± 2.3; P = .39, respectively). When compared with open lateral ankle

  7. The Over-expression of the β2 Catalytic Subunit of the Proteasome Decreases Homologous Recombination and Impairs DNA Double-Strand Break Repair in Human Cells

    Directory of Open Access Journals (Sweden)

    Anita Collavoli

    2011-01-01

    Full Text Available By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB. This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p.

  8. Depletion of the bloom syndrome helicase stimulates homology-dependent repair at double-strand breaks in human chromosomes.

    Science.gov (United States)

    Wang, Yibin; Smith, Krissy; Waldman, Barbara Criscuolo; Waldman, Alan S

    2011-04-03

    Mutation of BLM helicase causes Blooms syndrome, a disorder associated with genome instability, high levels of sister chromatid exchanges, and cancer predisposition. To study the influence of BLM on double-strand break (DSB) repair in human chromosomes, we stably transfected a normal human cell line with a DNA substrate that contained a thymidine kinase (tk)-neo fusion gene disrupted by the recognition site for endonuclease I-SceI. The substrate also contained a closely linked functional tk gene to serve as a recombination partner for the tk-neo fusion gene. We derived two cell lines each containing a single integrated copy of the DNA substrate. In these cell lines, a DSB was introduced within the tk-neo fusion gene by expression of I-SceI. DSB repair events that occurred via homologous recombination (HR) or nonhomologous end-joining (NHEJ) were recovered by selection for G418-resistant clones. DSB repair was examined under conditions of either normal BLM expression or reduced BLM expression brought about by RNA interference. We report that BLM knockdown in both cell lines specifically increased the frequency of HR events that produced deletions by crossovers or single-strand annealing while leaving the frequency of gene conversions unchanged or reduced. We observed no change in the accuracy of individual HR events and no substantial alteration of the nature of individual NHEJ events when BLM expression was reduced. Our work provides the first direct evidence that BLM influences DSB repair pathway choice in human chromosomes and suggests that BLM deficiency can engender genomic instability by provoking an increased frequency of HR events of a potentially deleterious nature. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Microhomology-mediated end joining is the principal mediator of double-strand break repair during mitochondrial DNA lesions.

    Science.gov (United States)

    Tadi, Satish Kumar; Sebastian, Robin; Dahal, Sumedha; Babu, Ravi K; Choudhary, Bibha; Raghavan, Sathees C

    2016-01-15

    Mitochondrial DNA (mtDNA) deletions are associated with various mitochondrial disorders. The deletions identified in humans are flanked by short, directly repeated mitochondrial DNA sequences; however, the mechanism of such DNA rearrangements has yet to be elucidated. In contrast to nuclear DNA (nDNA), mtDNA is more exposed to oxidative damage, which may result in double-strand breaks (DSBs). Although DSB repair in nDNA is well studied, repair mechanisms in mitochondria are not characterized. In the present study, we investigate the mechanisms of DSB repair in mitochondria using in vitro and ex vivo assays. Whereas classical NHEJ (C-NHEJ) is undetectable, microhomology-mediated alternative NHEJ efficiently repairs DSBs in mitochondria. Of interest, robust microhomology-mediated end joining (MMEJ) was observed with DNA substrates bearing 5-, 8-, 10-, 13-, 16-, 19-, and 22-nt microhomology. Furthermore, MMEJ efficiency was enhanced with an increase in the length of homology. Western blotting, immunoprecipitation, and protein inhibition assays suggest the involvement of CtIP, FEN1, MRE11, and PARP1 in mitochondrial MMEJ. Knockdown studies, in conjunction with other experiments, demonstrated that DNA ligase III, but not ligase IV or ligase I, is primarily responsible for the final sealing of DSBs during mitochondrial MMEJ. These observations highlight the central role of MMEJ in maintenance of mammalian mitochondrial genome integrity and is likely relevant for deletions observed in many human mitochondrial disorders. © 2016 Tadi et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  10. Break for Physical Activity: Incorporating Classroom-Based Physical Activity Breaks into Preschools

    Science.gov (United States)

    Wadsworth, Danielle D.; Robinson, Leah E.; Beckham, Karen; Webster, Kip

    2012-01-01

    Engaging in moderate-to-vigorous physical activity is essential to lifelong health and wellness. Physical activity behaviors established in early childhood relate to physical activity behaviors in later years. However, research has shown that children are adopting more sedentary behaviors. Incorporating structured and planned physical activity…

  11. The extreme radiosensitivity of the squamous cell carcinoma SKX is due to a defect in double-strand break repair.

    Science.gov (United States)

    Kasten-Pisula, Ulla; Menegakis, Apostolos; Brammer, Ingo; Borgmann, Kerstin; Mansour, Wael Y; Degenhardt, Sarah; Krause, Mechthild; Schreiber, Andreas; Dahm-Daphi, Jochen; Petersen, Cordula; Dikomey, Ekkehard; Baumann, Michael

    2009-02-01

    Squamous cell carcinomas (SCCs) are characterized by moderate radiosensitivity. We have established the human head & neck SCC cell line SKX, which shows an exceptionally high radiosensitivity. It was the aim of this study to understand the underlying mechanisms. Experiments were performed with SKX and FaDu, the latter taken as a control of moderate radiosensitivity. Cell lines were grown as xenografts as well as cell cultures. For xenografts, radiosensitivity was determined via local tumour control assay, and for cell cultures using colony assay. For cell cultures, apoptosis was determined by Annexin V staining and G1-arrest by BrdU labelling. Double-strand breaks (DSBs) were detected by both constant-field gel electrophoresis (CFGE) and gammaH2AX-foci technique; DSB rejoining was also assessed by in vitro rejoining assay; chromosomal damage was determined by G01-assay. Compared to FaDu, SKX cells are extremely radiosensitive as found for both xenografts (TCD(50) for 10 fractions 46.0Gy [95% C.I.: 39; 54 Gy] vs. 18.9 Gy [95% C.I.: 13; 25Gy]) and cell cultures (D(0.01); 7.1 vs. 3.5Gy). Both cell lines showed neither radiation-induced apoptosis nor radiation-induced permanent G1-arrest. For DSBs, there was no difference in the induction but for repair with SKX cells showing a higher level of both, slowly repaired DSBs and residual DSBs. The in vitro DSB repair assay revealed that SKX cells are defective in nonhomologous endjoining (NHEJ), and that more than 40% of DSBs are rejoined by single-strand annealing (SSA). SKX cells also depicted a two-fold higher number of lethal chromosomal aberrations when compared to FaDu cells. The extreme radiosensitivity of the SCC SKX seen both in vivo and in vitro can be ascribed to a reduced DNA double-strand break repair, resulting from a defect in NHEJ. This defect might be due to preferred usage of other pathways, such as SSA, which prevents efficient endjoining.

  12. Double-strand break repair: are Rad51/RecA--DNA joints barriers to DNA replication?

    Science.gov (United States)

    Aguilera, A

    2001-06-01

    The central step of homologous recombination is the DNA strand exchange reaction catalyzed by bacterial RecA or eukaryotic Rad51. Besides Rad51-mediated synthesis-dependent strand annealing (SDSA), DNA ends can promote replication in Escherichia coli (recombination-dependent replication, RDR) and yeast (break-induced replication, BIR). However, what causes a DNA end to be repaired via SDSA or via BIR/RDR? I propose that Rad51/RecA--DNA plectonemic joints act as barriers to DNA replication and that BIR/RDR is only possible when the DNA polymerase that synthesizes DNA from the invading 3' end does not encounter RecA/Rad51--DNA joints in its path.

  13. Role for the mammalian Swi5-Sfr1 complex in DNA strand break repair through homologous recombination.

    Directory of Open Access Journals (Sweden)

    Yufuko Akamatsu

    2010-10-01

    Full Text Available In fission yeast, the Swi5-Sfr1 complex plays an important role in homologous recombination (HR, a pathway crucial for the maintenance of genomic integrity. Here we identify and characterize mammalian Swi5 and Sfr1 homologues. Mouse Swi5 and Sfr1 are nuclear proteins that form a complex in vivo and in vitro. Swi5 interacts in vitro with Rad51, the DNA strand-exchange protein which functions during HR. By generating Swi5(-/- and Sfr1(-/- embryonic stem cell lines, we found that both proteins are mutually interdependent for their stability. Importantly, the Swi5-Sfr1 complex plays a role in HR when Rad51 function is perturbed in vivo by expression of a BRC peptide from BRCA2. Swi5(-/- and Sfr1(-/- cells are selectively sensitive to agents that cause DNA strand breaks, in particular ionizing radiation, camptothecin, and the Parp inhibitor olaparib. Consistent with a role in HR, sister chromatid exchange induced by Parp inhibition is attenuated in Swi5(-/- and Sfr1(-/- cells, and chromosome aberrations are increased. Thus, Swi5-Sfr1 is a newly identified complex required for genomic integrity in mammalian cells with a specific role in the repair of DNA strand breaks.

  14. A Role for BLM in Double-Strand Break Repair Pathway Choice: Prevention of CtIP/Mre11-Mediated Alternative Nonhomologous End-Joining

    DEFF Research Database (Denmark)

    Grabarz, Anastazja; Guirouilh-Barbat, Josée; Barascu, Aurelia

    2013-01-01

    The choice of the appropriate double-strand break (DSB) repair pathway is essential for the maintenance of genomic stability. Here, we show that the Bloom syndrome gene product, BLM, counteracts CtIP/MRE11-dependent long-range deletions (>200 bp) generated by alternative end-joining (A-EJ). BLM...

  15. Feasibility of measuring radiation-induced DNA double strand breaks and their repair by pulsed field gel electrophoresis in freshly isolated cells from the mouse RIF-1 tumor

    NARCIS (Netherlands)

    vanWaarde, MAWH; vanAssen, AJ; Konings, AWT; Kampinga, HH

    1996-01-01

    Purpose: To examine the technical feasibility of pulsed field gel electrophoresis (PFGE) as a predictive assay for the radioresponsiveness of tumors. Induction and repair of DNA double strand breaks (DSBs) in a freshly prepared cell suspension from a RIF-1 tumor (irradiated ex vivo) was compared

  16. DNA damage and repair activity after broccoli intake in young healthy smokers

    DEFF Research Database (Denmark)

    Riso, Patrizia; Martini, Daniela; Møller, Peter

    2010-01-01

    compounds, including smokers. The aim of the study was to evaluate the effect of broccoli intake on biomarkers of DNA damage and repair. Twenty-seven young healthy smokers consumed a portion of steamed broccoli (250 g/day) or a control diet for 10 days each within a crossover design with a washout period...... mRNA expression levels of repair and defence enzymes: 8-oxoguanine DNA glycosylase (OGG1), nucleoside diphosphate linked moiety X-type motif 1 (NUDT1) and heme oxygenase 1 (HO-1). After broccoli consumption, the level of oxidised DNA lesions decreased by 41% (95% confidence interval: 10%, 72......%) and the resistance to H(2)O(2)-induced DNA strand breaks increased by 23% (95% CI: 13%, 34%). Following broccoli intake, a higher protection was observed in subjects with glutathione S-transferase (GST) M1-null genotype. The expression level and activity of repair enzymes was unaltered. In conclusion, broccoli...

  17. [Defect of preferential repair of gamma-ray-induced single-strand breaks in transcribed and non-transcribed DNA in Cockayne syndrome cells].

    Science.gov (United States)

    Igusheva, O A; Mikhel'son, V M; Pleskach, N M; Bil'din, V N; Zhestianikov, V D

    1998-01-01

    The repair of gamma-ray-induced DNA single-strand breaks in transcribed (protooncogene c-myc) and non-transcribed (human satellite III) DNA of normal human fibroblasts and fibroblasts obtained from a patient with Cockayne's syndrome (CS) has been investigated. A method of alkaline sucrose sedimentation was applied besides the Southern hybridization of 32P-DNA, containing sequences analysed with total 3H-DNA distributed through sucrose gradient fractions. No increase in the induction of DNA single-strand breaks was found in gamma-irradiated CS fibroblasts, compared to normal human fibroblasts. At the same time, an evident defect in the preferential repair of single-strand breaks in c-myc gene was observed.

  18. Non-homologous end joining is the responsible pathway for the repair of fludarabine-induced DNA double strand breaks in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Campos-Nebel, Marcelo de [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)], E-mail: mnebel@hematologia.anm.edu.ar; Larripa, Irene; Gonzalez-Cid, Marcela [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)

    2008-11-10

    Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by {gamma}H2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU

  19. Frequent and efficient use of the sister chromatid for DNA double-strand break repair during budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Tamara Goldfarb

    2010-10-01

    Full Text Available Recombination between homologous chromosomes of different parental origin (homologs is necessary for their accurate segregation during meiosis. It has been suggested that meiotic inter-homolog recombination is promoted by a barrier to inter-sister-chromatid recombination, imposed by meiosis-specific components of the chromosome axis. Consistent with this, measures of Holliday junction-containing recombination intermediates (joint molecules [JMs] show a strong bias towards inter-homolog and against inter-sister JMs. However, recombination between sister chromatids also has an important role in meiosis. The genomes of diploid organisms in natural populations are highly polymorphic for insertions and deletions, and meiotic double-strand breaks (DSBs that form within such polymorphic regions must be repaired by inter-sister recombination. Efforts to study inter-sister recombination during meiosis, in particular to determine recombination frequencies and mechanisms, have been constrained by the inability to monitor the products of inter-sister recombination. We present here molecular-level studies of inter-sister recombination during budding yeast meiosis. We examined events initiated by DSBs in regions that lack corresponding sequences on the homolog, and show that these DSBs are efficiently repaired by inter-sister recombination. This occurs with the same timing as inter-homolog recombination, but with reduced (2- to 3-fold yields of JMs. Loss of the meiotic-chromosome-axis-associated kinase Mek1 accelerates inter-sister DSB repair and markedly increases inter-sister JM frequencies. Furthermore, inter-sister JMs formed in mek1Δ mutants are preferentially lost, while inter-homolog JMs are maintained. These findings indicate that inter-sister recombination occurs frequently during budding yeast meiosis, with the possibility that up to one-third of all recombination events occur between sister chromatids. We suggest that a Mek1-dependent reduction in

  20. Lingering single-strand breaks trigger Rad51-independent homology-directed repair of collapsed replication forks in the polynucleotide kinase/phosphatase mutant of fission yeast.

    Directory of Open Access Journals (Sweden)

    Arancha Sanchez

    2017-09-01

    Full Text Available The DNA repair enzyme polynucleotide kinase/phosphatase (PNKP protects genome integrity by restoring ligatable 5'-phosphate and 3'-hydroxyl termini at single-strand breaks (SSBs. In humans, PNKP mutations underlie the neurological disease known as MCSZ, but these individuals are not predisposed for cancer, implying effective alternative repair pathways in dividing cells. Homology-directed repair (HDR of collapsed replication forks was proposed to repair SSBs in PNKP-deficient cells, but the critical HDR protein Rad51 is not required in PNKP-null (pnk1Δ cells of Schizosaccharomyces pombe. Here, we report that pnk1Δ cells have enhanced requirements for Rad3 (ATR/Mec1 and Chk1 checkpoint kinases, and the multi-BRCT domain protein Brc1 that binds phospho-histone H2A (γH2A at damaged replication forks. The viability of pnk1Δ cells depends on Mre11 and Ctp1 (CtIP/Sae2 double-strand break (DSB resection proteins, Rad52 DNA strand annealing protein, Mus81-Eme1 Holliday junction resolvase, and Rqh1 (BLM/WRN/Sgs1 DNA helicase. Coupled with increased sister chromatid recombination and Rad52 repair foci in pnk1Δ cells, these findings indicate that lingering SSBs in pnk1Δ cells trigger Rad51-independent homology-directed repair of collapsed replication forks. From these data, we propose models for HDR-mediated tolerance of persistent SSBs with 3' phosphate in pnk1Δ cells.

  1. Reach and Implementation of Physical Activity Breaks and Active Lessons in Elementary School Classrooms

    Science.gov (United States)

    Turner, Lindsey; Chaloupka, Frank J.

    2017-01-01

    The integration of physical activity into elementary school classrooms, through brief activity breaks (ABs) and lessons that incorporate movement into instruction as active lessons (ALs), are key parts of school physical activity programming and can improve children's health and academic outcomes. With nationally representative survey data from…

  2. Optimizing Computation of Repairs from Active Integrity Constraints

    DEFF Research Database (Denmark)

    Cruz-Filipe, Luís

    2014-01-01

    Active integrity constraints (AICs) are a form of integrity constraints for databases that not only identify inconsistencies, but also suggest how these can be overcome. The semantics for AICs defines different types of repairs, but deciding whether an inconsistent database can be repaired...... and finding possible repairs is a NP- or Σ2p-complete problem, depending on the type of repairs one has in mind. In this paper, we introduce two different relations on AICs: an equivalence relation of independence, allowing the search to be parallelized among the equivalence classes, and a precedence relation...

  3. Inhibition of proteasomal degradation of rpn4 impairs nonhomologous end-joining repair of DNA double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Donghong Ju

    Full Text Available BACKGROUND: The proteasome homeostasis in Saccharomyces cerevisiae is regulated by a negative feedback circuit in which the transcription factor Rpn4 induces the proteasome genes and is rapidly degraded by the assembled proteasome. The integrity of the Rpn4-proteasome feedback loop is critical for cell viability under stressed conditions. We have demonstrated that inhibition of Rpn4 degradation sensitizes cells to DNA damage, particularly in response to high doses of DNA damaging agents. The underlying mechanism, however, remains unclear. METHODOLOGY/PRINCIPAL FINDINGS: Using yeast genetics and biochemical approach we show that inhibition of Rpn4 degradation displays a synthetic growth defect with deletion of the MEC1 checkpoint gene and sensitizes several checkpoint mutants to DNA damage. In addition, inhibition of Rpn4 degradation leads to a defect in repair of double-strand breaks (DSBs by nonhomologous end-joining (NHEJ. The expression levels of several key NHEJ genes are downregulated and the recruitment of Yku70 to a DSB is reduced by inhibition of Rpn4 degradation. We find that Rpn4 and the proteasome are recruited to a DSB, suggesting their direct participation in NHEJ. Inhibition of Rpn4 degradation may result in a concomitant delay of release of Rpn4 and the proteasome from a DSB. CONCLUSION/SIGNIFICANCE: This study provides the first evidence for the role of proteasomal degradation of Rpn4 in NHEJ.

  4. Bypass of a 5',8-cyclopurine-2'-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks.

    Science.gov (United States)

    Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan

    2015-09-01

    5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. The non-homologous end-joining (NHEJ) pathway for the repair of DNA double-strand breaks: I. A mathematical model.

    Science.gov (United States)

    Taleei, Reza; Nikjoo, Hooshang

    2013-05-01

    This article presents a biochemical kinetic model for the non-homologous end joining (NHEJ) of DNA double-strand break (DSB) repair pathway. The model is part of a theoretical framework to encompass all cellular DSB repair pathways. The NHEJ model was developed by taking into consideration the biological characteristics of the repair processes in the absence of homologous recombination (HR), the major alternative pathway for DSB repair. The model considers fast and slow components of the repair kinetics resulting in a set of differential equations that were solved numerically. In the absence of available published data for reaction rate constants for the repair proteins involved in NHEJ, we propose reaction rate constants for the solution of the equations. We assume as a first approximation that the reaction rate constants are applicable to mammalian cells under same conditions. The model was tested by comparing measured and simulated DSB repair kinetics obtained with HR-deficient cell lines irradiated by X rays in the dose range of 20-80 Gy. Measured data for initial protein recruitment to a DSB were used to independently estimate rate constants for Ku70/Ku80 and DNA-dependent protein kinase catalytic subunit (DNA-PKcs). We show here based on the model of DSB repair described in this article, application of the model in the accompanying article (Taleei et al., Radiat. Res. 179, 540-548, 2013) and by simulation of repair times for each individual DSB produced by individual tracks of electrons, that the complexity of damage may explain the slow kinetics of DNA DSB repair.

  6. Salidroside stimulates DNA repair enzyme Parp-1 activity in mouse HSC maintenance.

    Science.gov (United States)

    Li, Xue; Sipple, Jared; Pang, Qishen; Du, Wei

    2012-05-03

    Salidroside is a phenylpropanoid glycoside isolated from the medicinal plant Rhodiola rosea, which has potent antioxidant properties. Here we show that salidroside prevented the loss of hematopoietic stem cells (HSCs) in mice under oxidative stress. Quiescent HSCs were recruited into cell cycling on in vivo challenge with oxidative stress, which was blocked by salidroside. Surprisingly, salidroside does not prevent the production of reactive oxygen species but reduces hydrogen peroxide-induced DNA-strand breaks in bone marrow cells enriched for HSCs. We tested whether salidroside enhances oxidative DNA damage repair in mice deficient for 5 DNA repair pathways known to be involved in oxidative DNA damage repair; we found that salidroside activated poly(ADP-ribose)polymerase-1 (PARP-1), a component of the base excision repair pathway, in mouse bone marrow HSCs as well as primary fibroblasts and human lymphoblasts. PARP-1 activation by salidroside protects quiescent HSCs from oxidative stress-induced cycling in native animals and self-renewal defect in transplanted recipients, which was abrogated by genetic ablation or pharmacologic inhibition of PARP-1. Together, these findings suggest that activation of PARP-1 by salidroside could affect the homeostasis and function of HSCs and contribute to the antioxidant effects of salidroside.

  7. Alkylation base damage is converted into repairable double-strand breaks and complex intermediates in G2 cells lacking AP endonuclease.

    Directory of Open Access Journals (Sweden)

    Wenjian Ma

    2011-04-01

    Full Text Available DNA double-strand breaks (DSBs are potent sources of genome instability. While there is considerable genetic and molecular information about the disposition of direct DSBs and breaks that arise during replication, relatively little is known about DSBs derived during processing of single-strand lesions, especially for the case of single-strand breaks (SSBs with 3'-blocked termini generated in vivo. Using our recently developed assay for detecting end-processing at random DSBs in budding yeast, we show that single-strand lesions produced by the alkylating agent methyl methanesulfonate (MMS can generate DSBs in G2-arrested cells, i.e., S-phase independent. These derived DSBs were observed in apn1/2 endonuclease mutants and resulted from aborted base excision repair leading to 3' blocked single-strand breaks following the creation of abasic (AP sites. DSB formation was reduced by additional mutations that affect processing of AP sites including ntg1, ntg2, and, unexpectedly, ogg1, or by a lack of AP sites due to deletion of the MAG1 glycosylase gene. Similar to direct DSBs, the derived DSBs were subject to MRX (Mre11, Rad50, Xrs2-determined resection and relied upon the recombinational repair genes RAD51, RAD52, as well as on the MCD1 cohesin gene, for repair. In addition, we identified a novel DNA intermediate, detected as slow-moving chromosomal DNA (SMD in pulsed field electrophoresis gels shortly after MMS exposure in apn1/2 cells. The SMD requires nicked AP sites, but is independent of resection/recombination processes, suggesting that it is a novel structure generated during processing of 3'-blocked SSBs. Collectively, this study provides new insights into the potential consequences of alkylation base damage in vivo, including creation of novel structures as well as generation and repair of DSBs in nonreplicating cells.

  8. Identification of Ku70 and Ku80 homologues in Arabidopsis thaliana: evidence for a role in the repair of DNA double-strand breaks.

    Science.gov (United States)

    Tamura, Katsunori; Adachi, Yugo; Chiba, Keiko; Oguchi, Keiko; Takahashi, Hideo

    2002-03-01

    In higher organisms such as mammals and plants, DNA double-strand breaks (DSBs) are repaired preferentially by non-homologous end joining (NHEJ) rather than by homologous recombination. The NHEJ pathway is mediated by Ku, a heterodimer of approximately 70 and 80 kDa subunits, which contributes to various aspects of the metabolism of DNA ends in eukaryotic cells. On the basis of their predicted sequence similarity to human Ku70 and Ku80, cDNAs encoding the first plant homologues of these proteins (AtKu70 and AtKu80, respectively) have now been isolated from Arabidopsis thaliana. AtKu70 and AtKu80 share 28.6 and 22.5% amino acid sequence identity with human Ku70 and Ku80, respectively. Yeast two-hybrid analysis demonstrated that AtKu70 and AtKu80 form a heterodimer, and electrophoretic mobility-shift assays revealed that this heterodimer binds to double-stranded telomeric and non-telomeric DNA sequences, but not to single-stranded DNA. The AtKu heterodimer also possesses single-stranded DNA-dependent ATPase and ATP-dependent DNA helicase activities. Reverse transcription and the polymerase chain reaction revealed that AtKu70 and AtKu80 genes are expressed widely but at low levels in plant tissues. The expression of these two genes in cultured cells was markedly increased in response to the generation of DSBs by bleomycin or methylmethane sulfonate. These results suggest that the evolutionarily conserved Ku70-Ku80 heterodimer functions in DSB repair by the NHEJ pathway in A. thaliana.

  9. Non-homologous end-joining protein expression screen from radiosensitive cancer patients yields a novel DNA double strand break repair phenotype.

    Science.gov (United States)

    McKay, Michael J; Goh, Su Kak; McKay, Jeremy N; Chao, Michael; McKay, Timothy M

    2017-03-01

    Clinical radiosensitivity is a significant impediment to tumour control and cure, in that it restricts the total doses which can safely be delivered to the whole radiotherapy population, within the tissue tolerance of potentially radiosensitive (RS) individuals. Understanding its causes could lead to personalization of radiotherapy. We screened tissues from a unique bank of RS cancer patients for expression defects in major DNA double-strand break repair proteins, using Western blot analysis and subsequently reverse-transcriptase polymerase chain reaction and pulsed-field gel electrophoresis. We hypothesized that abnormalities in expression of these proteins may explain the radiosensitivity of some of our cancer patients. The cells from one patient showed a reproducibly consistent expression reduction in two complex-forming DNA double-strand break repair protein components (DNA Ligase IV and XRCC4). We also showed a corresponding reduction in both gene products at the mRNA level. Additionally, the mRNA inducibility by ionizing radiation was increased for one of the proteins in the patient's cells. We confirmed the likely functional significance of the non-homologous end-joining (NHEJ) expression abnormalities with a DNA double strand break (DNA DSB) repair assay. We have identified a novel biological phenotype linked to clinical radiosensitivity. This is important in that very few molecular defects are known in human radiotherapy subjects. Such knowledge may contribute to the understanding of radiation response mechanisms in cancer patients and to personalization of radiotherapy.

  10. Analysis of Repair Mechanisms following an Induced Double-Strand Break Uncovers Recessive Deleterious Alleles in the Candida albicans Diploid Genome.

    Science.gov (United States)

    Feri, Adeline; Loll-Krippleber, Raphaël; Commere, Pierre-Henri; Maufrais, Corinne; Sertour, Natacha; Schwartz, Katja; Sherlock, Gavin; Bougnoux, Marie-Elisabeth; d'Enfert, Christophe; Legrand, Mélanie

    2016-10-11

    The diploid genome of the yeast Candida albicans is highly plastic, exhibiting frequent loss-of-heterozygosity (LOH) events. To provide a deeper understanding of the mechanisms leading to LOH, we investigated the repair of a unique DNA double-strand break (DSB) in the laboratory C. albicans SC5314 strain using the I-SceI meganuclease. Upon I-SceI induction, we detected a strong increase in the frequency of LOH events at an I-SceI target locus positioned on chromosome 4 (Chr4), including events spreading from this locus to the proximal telomere. Characterization of the repair events by single nucleotide polymorphism (SNP) typing and whole-genome sequencing revealed a predominance of gene conversions, but we also observed mitotic crossover or break-induced replication events, as well as combinations of independent events. Importantly, progeny that had undergone homozygosis of part or all of Chr4 haplotype B (Chr4B) were inviable. Mining of genome sequencing data for 155 C. albicans isolates allowed the identification of a recessive lethal allele in the GPI16 gene on Chr4B unique to C. albicans strain SC5314 which is responsible for this inviability. Additional recessive lethal or deleterious alleles were identified in the genomes of strain SC5314 and two clinical isolates. Our results demonstrate that recessive lethal alleles in the genomes of C. albicans isolates prevent the occurrence of specific extended LOH events. While these and other recessive lethal and deleterious alleles are likely to accumulate in C. albicans due to clonal reproduction, their occurrence may in turn promote the maintenance of corresponding nondeleterious alleles and, consequently, heterozygosity in the C. albicans species. Recessive lethal alleles impose significant constraints on the biology of diploid organisms. Using a combination of an I-SceI meganuclease-mediated DNA DSB, a fluorescence-activated cell sorter (FACS)-optimized reporter of LOH, and a compendium of 155 genome

  11. A novel protein, Rsf1/Pxd1, is critical for the single-strand annealing pathway of double-strand break repair in Schizosaccharomyces pombe.

    Science.gov (United States)

    Wang, Hanqian; Zhang, Zhanlu; Zhang, Lan; Zhang, Qiuxue; Zhang, Liang; Zhao, Yangmin; Wang, Weibu; Fan, Yunliu; Wang, Lei

    2015-06-01

    The process of single-strand annealing (SSA) repairs DNA double-strand breaks that are flanked by direct repeat sequences through the coordinated actions of a series of proteins implicated in recombination, mismatch repair and nucleotide excision repair (NER). Many of the molecular and mechanistic insights gained in SSA repair have principally come from studies in the budding yeast Saccharomyces cerevisiae. However, there is little molecular understanding of the SSA pathway in the fission yeast Schizosaccharomyces pombe. To further our understanding of this important process, we established a new chromosome-based SSA assay in fission yeast. Our genetic analyses showed that, although many homologous components participate in SSA repair in these species indicating that some evolutionary conservation, Saw1 and Slx4 are not principal agents in the SSA repair pathway in fission yeast. This is in marked contrast to the function of Saw1 and Slx4 in budding yeast. Additionally, a novel genus-specific protein, Rsf1/Pxd1, physically interacts with Rad16, Swi10 and Saw1 in vitro and in vivo. We find that Rsf1/Pxd1 is not required for NER and demonstrate that, in fission yeast, Rsf1/Pxd1, but not Saw1, plays a critical role in SSA recombination. © 2015 John Wiley & Sons Ltd.

  12. In what extent classic radiation biology can be understand at the molecular level? Biological effects of ionizing radiation and repair mechanism of double strand breaks of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Utsumi, Hiroshi [Kyoto Univ., Kumatori, Osaka (Japan). Research Reactor Inst.

    2000-09-01

    This review revealed that classic radiation biology phenomena not based on substantial concept, such as lethal damage, sublethal damage, potentially lethal damage, recoveries from them, variation of radiation sensitivity due to cell cycle, RBE/LET relationships and mathematical expression of survival curve, can be described only at the levels of DNA double strand breaks (DSB) and its repair mechanism. Authors investigated chicken cells with DSB repair-defect, analyzed the molecular mechanisms of 'Elkind recovery' where cell survival rates are higher after fractionated irradiation than after single irradiation at a fixed dose, and showed that the phenomenon was derived from the cell revival resulting from homologous recombination repair of DSB yielded on homologous chromosome DNA. Investigations using HIMAC also revealed the molecular mechanisms of RBE/LET in those cells. Findings indicate that biological effects of ionizing radiation can be described at the molecular level.(K.H.)

  13. Influence of Double-Strand Break Repair on Radiation Therapy-Induced Acute Skin Reactions in Breast Cancer Patients

    Energy Technology Data Exchange (ETDEWEB)

    Mumbrekar, Kamalesh Dattaram [Division of Radiobiology and Toxicology, School of Life Sciences, Manipal University, Manipal, Karnataka (India); Fernandes, Donald Jerard [Department of Radiotherapy and Oncology, Shirdi Sai Baba Cancer Hospital and Research Centre, Kasturba Hospital, Manipal, Karnataka (India); Goutham, Hassan Venkatesh [Division of Radiobiology and Toxicology, School of Life Sciences, Manipal University, Manipal, Karnataka (India); Sharan, Krishna [Department of Radiotherapy and Oncology, Shirdi Sai Baba Cancer Hospital and Research Centre, Kasturba Hospital, Manipal, Karnataka (India); Vadhiraja, Bejadi Manjunath [Manipal Hospital, Bangalore, Karnataka (India); Satyamoorthy, Kapaettu [Division of Biotechnology, School of Life Sciences, Manipal University, Manipal, Karnataka (India); Bola Sadashiva, Satish Rao, E-mail: satishraomlsc@gmail.com [Division of Radiobiology and Toxicology, School of Life Sciences, Manipal University, Manipal, Karnataka (India)

    2014-03-01

    Purpose: Curative radiation therapy (RT)-induced toxicity poses strong limitations for efficient RT and worsens the quality of life. The parameter that explains when and to what extent normal tissue toxicity in RT evolves would be of clinical relevance because of its predictive value and may provide an opportunity for personalized treatment approach. Methods and Materials: DNA double-strand breaks and repair were analyzed by microscopic γ-H2AX foci analysis in peripheral lymphocytes from 38 healthy donors and 80 breast cancer patients before RT, a 2 Gy challenge dose of x-ray exposed in vitro. Results: The actual damage (AD) at 0.25, 3, and 6 hours and percentage residual damage (PRD) at 3 and 6 hours were used as parameters to measure cellular radiosensitivity and correlated with RT-induced acute skin reactions in patients stratified as non-overresponders (NOR) (Radiation Therapy Oncology Group [RTOG] grade <2) and overresponders (OR) (RTOG grade ≥2). The results indicated that the basal and induced (at 0.25 and 3 hours) γ-H2AX foci numbers were nonsignificant (P>.05) between healthy control donors and the NOR and OR groups, whereas it was significant between ORs and healthy donors at 6 hours (P<.001). There was a significantly higher PRD in OR versus NOR (P<.05), OR versus healthy donors (P<.001) and NOR versus healthy donors (P<.01), supported further by the trend analysis (r=.2392; P=.0326 at 6 hours). Conclusions: Our findings strongly suggest that the measurement of PRD by performing γ-H2AX foci analysis has the potential to be developed into a clinically useful predictive assay.

  14. MRE11–RAD50–NBS1 is a critical regulator of FANCD2 stability and function during DNA double-strand break repair

    Science.gov (United States)

    Roques, Céline; Coulombe, Yan; Delannoy, Mathieu; Vignard, Julien; Grossi, Simona; Brodeur, Isabelle; Rodrigue, Amélie; Gautier, Jean; Stasiak, Alicja Z; Stasiak, Andrzej; Constantinou, Angelos; Masson, Jean-Yves

    2009-01-01

    Monoubiquitination of the Fanconi anaemia protein FANCD2 is a key event leading to repair of interstrand cross-links. It was reported earlier that FANCD2 co-localizes with NBS1. However, the functional connection between FANCD2 and MRE11 is poorly understood. In this study, we show that inhibition of MRE11, NBS1 or RAD50 leads to a destabilization of FANCD2. FANCD2 accumulated from mid-S to G2 phase within sites containing single-stranded DNA (ssDNA) intermediates, or at sites of DNA damage, such as those created by restriction endonucleases and laser irradiation. Purified FANCD2, a ring-like particle by electron microscopy, preferentially bound ssDNA over various DNA substrates. Inhibition of MRE11 nuclease activity by Mirin decreased the number of FANCD2 foci formed in vivo. We propose that FANCD2 binds to ssDNA arising from MRE11-processed DNA double-strand breaks. Our data establish MRN as a crucial regulator of FANCD2 stability and function in the DNA damage response. PMID:19609304

  15. Examining the Knowledge and Capacity of Elementary Teachers to Implement Classroom Physical Activity Breaks

    Science.gov (United States)

    Dinkel, Danae M.; Lee, Jung-Min; Schaffer, Connie

    2016-01-01

    This study examined teachers' zone of proximal development for classroom physical activity breaks by assessing teachers' knowledge and capacity for implementing classroom physical activity breaks. Five school districts of various sizes (n = 346 teachers) took part in a short online survey. Descriptive statistics were calculated and chi-square…

  16. Leisure Activities during School Break among Children with Learning Disabilities: Preference vs. Performance

    Science.gov (United States)

    Yalon-Chamovitz, Shira; Mano, Tali; Jarus, Tal; Weinblatt, Nurit

    2006-01-01

    Participation in leisure activities may contribute to the development of social, motor, and language skills, and is therefore especially important for children with learning disabilities. Leisure activities of students in educational settings are performed mostly during breaks. While there have been some studies of the effect of breaks on…

  17. Multispectral imaging flow cytometry reveals distinct frequencies of γ-H2AX foci induction in DNA double strand break repair defective human cell lines.

    Science.gov (United States)

    Bourton, Emma C; Plowman, Piers N; Zahir, Sheba Adam; Senguloglu, Gonul Ulus; Serrai, Hiba; Bottley, Graham; Parris, Christopher N

    2012-02-01

    The measurement of γ-H2AX foci induction in cells provides a sensitive and reliable method for the quantitation of DNA damage responses in a variety of cell types. Accurate and rapid methods to conduct such observations are desirable. In this study, we have employed the novel technique of multispectral imaging flow cytometry to compare the induction and repair of γ-H2AX foci in three human cell types with different capacities for the repair of DNA double strand breaks (DSB). A repair normal fibroblast cell line MRC5-SV1, a DSB repair defective ataxia telangiectasia (AT5BIVA) cell line, and a DNA-PKcs deficient cell line XP14BRneo17 were exposed to 2 Gy gamma radiation from a (60)Cobalt source. Thirty minutes following exposure, we observed a dramatic induction of foci in the nuclei of these cells. After 24 hrs, there was a predictable reduction on the number of foci in the MRC5-SV1 cells, consistent with the repair of DNA DSB. In the AT5BIVA cells, persistence of the foci over a 24-hr period was due to the failure in the repair of DNA DSB. However, in the DNA-PKcs defective cells (XP14BRneo17), we observed an intermediate retention of foci in the nuclei indicative of partial repair of DNA DSB. In summary, the application of imaging flow cytometry has permitted an evaluation of foci in a large number of cells (20,000) for each cell line at each time point. This provides a novel method to determine differences in repair kinetics between different cell types. We propose that imaging flow cytometry provides an alternative platform for accurate automated high through-put analysis of foci induction in a variety of cell types. Copyright © 2011 International Society for Advancement of Cytometry.

  18. [Clinical research on repairing alveolar cleft with osteoinduction active material].

    Science.gov (United States)

    She, Xiao-ming; Zhang, Qian; Tian, Kun; Yang, Li; Xiong, Gui-fa

    2010-08-01

    To study the feasibility and authenticity of repairing alveolar defects in alveolar cleft patients with osteoinduction active material (OAM) in clinic. Twenty-seven cases of alveolar defect chosen from clinic were divided into two groups (test group and control group). For test group (12 cases), OAM was transplanted to repair the alveolar cleft. For control group (15 cases), autogenous ilium cancellous bone were transplanted into the defect region to repair alveolar cleft. At 6 months after operation, CT and three-dimensional reconstruction were used to observe alveolar appearance, and the effect and clinical success rate of recover alveolar cleft by using different repair material were compared. In the 27 cases, all the maxillary continuity was restored except two of test group and two of control group. There was no significant difference between test group and control group regarding the clinical success rate of the alveolar cleft repair (P = 1.000). OAM was used to repair the alveolar cleft that can result in new bone formations and the burgeon of canines from the bone grafted areas. There is no significant difference between OAM and autogenous ilium cancellous bone regarding the effect of the alveolar cleft repair.

  19. Inhibition of APOBEC3G activity impedes double-stranded DNA repair.

    Science.gov (United States)

    Prabhu, Ponnandy; Shandilya, Shivender M D; Britan-Rosich, Elena; Nagler, Adi; Schiffer, Celia A; Kotler, Moshe

    2016-01-01

    The cellular cytidine deaminase APOBEC3G (A3G) was first described as an anti-HIV-1 restriction factor, acting by directly deaminating reverse transcripts of the viral genome. HIV-1 Vif neutralizes the activity of A3G, primarily by mediating degradation of A3G to establish effective infection in host target cells. Lymphoma cells, which express high amounts of A3G, can restrict Vif-deficient HIV-1. Interestingly, these cells are more stable in the face of treatments that result in double-stranded DNA damage, such as ionizing radiation and chemotherapies. Previously, we showed that the Vif-derived peptide (Vif25-39) efficiently inhibits A3G deamination, and increases the sensitivity of lymphoma cells to ionizing radiation. In the current study, we show that additional peptides derived from Vif, A3G, and APOBEC3F, which contain the LYYF motif, inhibit deamination activity. Each residue in the Vif25-39 sequence moderately contributes to the inhibitory effect, whereas replacing a single residue in the LYYF motif completely abrogates inhibition of deamination. Treatment of A3G-expressing lymphoma cells exposed to ionizing radiation with the new inhibitory peptides reduces double-strand break repair after irradiation. Incubation of cultured irradiated lymphoma cells with peptides that inhibit double-strand break repair halts their propagation. These results suggest that A3G may be a potential therapeutic target that is amenable to peptide and peptidomimetic inhibition. © 2015 FEBS.

  20. Kinetic analysis of Yersinia pestis DNA adenine methyltransferase activity using a hemimethylated molecular break light oligonucleotide.

    Directory of Open Access Journals (Sweden)

    Robert J Wood

    Full Text Available BACKGROUND: DNA adenine methylation plays an important role in several critical bacterial processes including mismatch repair, the timing of DNA replication and the transcriptional control of gene expression. The dependence of bacterial virulence on DNA adenine methyltransferase (Dam has led to the proposal that selective Dam inhibitors might function as broad spectrum antibiotics. METHODOLOGY/PRINCIPAL FINDINGS: Herein we report the expression and purification of Yersinia pestis Dam and the development of a continuous fluorescence based assay for DNA adenine methyltransferase activity that is suitable for determining the kinetic parameters of the enzyme and for high throughput screening against potential Dam inhibitors. The assay utilised a hemimethylated break light oligonucleotide substrate containing a GATC methylation site. When this substrate was fully methylated by Dam, it became a substrate for the restriction enzyme DpnI, resulting in separation of fluorophore (fluorescein and quencher (dabcyl and therefore an increase in fluorescence. The assays were monitored in real time using a fluorescence microplate reader in 96 well format and were used for the kinetic characterisation of Yersinia pestis Dam, its substrates and the known Dam inhibitor, S-adenosylhomocysteine. The assay has been validated for high throughput screening, giving a Z-factor of 0.71+/-0.07 indicating that it is a sensitive assay for the identification of inhibitors. CONCLUSIONS/SIGNIFICANCE: The assay is therefore suitable for high throughput screening for inhibitors of DNA adenine methyltransferases and the kinetic characterisation of the inhibition.

  1. mus309 mutation, defective in DNA double-strand break repair, affects intergenic but not intragenic meiotic recombination in Drosophila melanogaster.

    Science.gov (United States)

    Portin, Petter

    2005-12-01

    The effect was investigated of the hypomorphic DNA double-strand break repair, notably synthesis-dependent strand annealing, deficient mutation mus309 on the third chromosome of Drosophila melanogaster on intergenic and intragenic meiotic recombination in the X chromosome. The results showed that the mutation significantly increases the frequency of intergenic crossing over in two of three gene intervals of the X chromosome studied. Interestingly the increase was most prevalent in the tip of the X chromosome where crossovers normally are least frequent per physical map unit length. In particular crossing over interference was also affected, indicating that the effect of the mus309 mutation involves preconditions of crossing over but not the event of crossing over itself. On the other hand, the results also show that most probably the mutation does not have any effect on intragenic recombination, i.e. gene conversion. These results are fully consistent with the present molecular models of meiotic crossing over initiated by double-strand breaks of DNA followed by formation of a single-end-invasion intermediate, or D-loop, which is subsequently processed to generate either crossover or non-crossover products involving formation of a double Holliday junction. In particular the results suggest that the mus309 gene is involved in resolution of the D-loop, thereby affecting the choice between double-strand-break repair (DSBR) and synthesis-dependent strand annealing (SDSA) pathways of meiotic recombination.

  2. Arabidopsis DNA ligase IV is induced by gamma-irradiation and interacts with an Arabidopsis homologue of the double strand break repair protein XRCC4.

    Science.gov (United States)

    West, C E; Waterworth, W M; Jiang, Q; Bray, C M

    2000-10-01

    Rejoining of single- and double-strand breaks (DSBs) introduced in DNA during replication, recombination, and DNA damage is catalysed by DNA ligase enzymes. Eukaryotes possess multiple DNA ligase enzymes, each having distinct roles in cellular metabolism. Double-strand breaks in DNA, which can occur spontaneously in the cell or be induced experimentally by gamma-irradiation, represent one of the most serious threats to genomic integrity. Non-homologous end joining (NHEJ) rather than homologous recombination is the major pathway for repair of DSBs in organisms with complex genomes, including humans and plants. DNA ligase IV in Saccharomyces cerevisiae and humans catalyses the final step in the NHEJ pathway of DSB repair. In this study we identify an Arabidopsis thaliana homologue (AtLIG4) of human and S. cerevisiae DNA ligase IV which is shown to encode an ATP-dependent DNA ligase with a theoretical molecular mass of 138 kDa and 48% similarity in amino-acid sequence to the human DNA ligase IV. Yeast two-hybrid analysis demonstrated a strong interaction between A. thaliana DNA ligase IV and the A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. This interaction is shown to be mediated via the tandem BRCA C-terminal domains of A. thaliana DNA ligase IV protein. Expression of AtLIG4 is induced by gamma-irradiation but not by UVB irradiation, consistent with an in vivo role for the A. thaliana DNA ligase IV in DSB repair.

  3. Distinct genetic control of homologous recombination repair of Cas9-induced double-strand breaks, nicks and paired nicks

    NARCIS (Netherlands)

    Vriend, Lianne E. M.; Prakash, Rohit; Chen, Chun-Chin; Vanoli, Fabio; Cavallo, Francesca; Zhang, Yu; Jasin, Maria; Krawczyk, Przemek M.

    2016-01-01

    DNA double-strand breaks (DSBs) are known to be powerful inducers of homologous recombination (HR), but single-strand breaks (nicks) have also been shown to trigger HR. Both DSB- and nick-induced HR ((nick)HR) are exploited in advanced genome-engineering approaches based on the bacterial RNA-guided

  4. Bi-directional routing of DNA mismatch repair protein human exonuclease 1 to replication foci and DNA double strand breaks

    DEFF Research Database (Denmark)

    Liberti, Sascha E; Andersen, Sofie Dabros; Wang, Jing

    2011-01-01

    Human exonuclease 1 (hEXO1) is implicated in DNA metabolism, including replication, recombination and repair, substantiated by its interactions with PCNA, DNA helicases BLM and WRN, and several DNA mismatch repair (MMR) proteins. We investigated the sub-nuclear localization of hEXO1 during S-phas...

  5. Caffeine impairs resection during DNA break repair by reducing the levels of nucleases Sae2 and Dna2.

    Science.gov (United States)

    Tsabar, Michael; Eapen, Vinay V; Mason, Jennifer M; Memisoglu, Gonen; Waterman, David P; Long, Marcus J; Bishop, Douglas K; Haber, James E

    2015-08-18

    In response to chromosomal double-strand breaks (DSBs), eukaryotic cells activate the DNA damage checkpoint, which is orchestrated by the PI3 kinase-like protein kinases ATR and ATM (Mec1 and Tel1 in budding yeast). Following DSB formation, Mec1 and Tel1 phosphorylate histone H2A on serine 129 (known as γ-H2AX). We used caffeine to inhibit the checkpoint kinases after DSB induction. We show that prolonged phosphorylation of H2A-S129 does not require continuous Mec1 and Tel1 activity. Unexpectedly, caffeine treatment impaired homologous recombination by inhibiting 5' to 3' end resection, independent of Mec1 and Tel1 inhibition. Caffeine treatment led to the rapid loss, by proteasomal degradation, of both Sae2, a nuclease that plays a role in early steps of resection, and Dna2, a nuclease that facilitates one of two extensive resection pathways. Sae2's instability is evident in the absence of DNA damage. A similar loss is seen when protein synthesis is inhibited by cycloheximide. Caffeine treatment had similar effects on irradiated HeLa cells, blocking the formation of RPA and Rad51 foci that depend on 5' to 3' resection of broken chromosome ends. Our findings provide insight toward the use of caffeine as a DNA damage-sensitizing agent in cancer cells. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Caffeine impairs resection during DNA break repair by reducing the levels of nucleases Sae2 and Dna2

    Science.gov (United States)

    Tsabar, Michael; Eapen, Vinay V.; Mason, Jennifer M.; Memisoglu, Gonen; Waterman, David P.; Long, Marcus J.; Bishop, Douglas K.; Haber, James E.

    2015-01-01

    In response to chromosomal double-strand breaks (DSBs), eukaryotic cells activate the DNA damage checkpoint, which is orchestrated by the PI3 kinase-like protein kinases ATR and ATM (Mec1 and Tel1 in budding yeast). Following DSB formation, Mec1 and Tel1 phosphorylate histone H2A on serine 129 (known as γ-H2AX). We used caffeine to inhibit the checkpoint kinases after DSB induction. We show that prolonged phosphorylation of H2A-S129 does not require continuous Mec1 and Tel1 activity. Unexpectedly, caffeine treatment impaired homologous recombination by inhibiting 5′ to 3′ end resection, independent of Mec1 and Tel1 inhibition. Caffeine treatment led to the rapid loss, by proteasomal degradation, of both Sae2, a nuclease that plays a role in early steps of resection, and Dna2, a nuclease that facilitates one of two extensive resection pathways. Sae2's instability is evident in the absence of DNA damage. A similar loss is seen when protein synthesis is inhibited by cycloheximide. Caffeine treatment had similar effects on irradiated HeLa cells, blocking the formation of RPA and Rad51 foci that depend on 5′ to 3′ resection of broken chromosome ends. Our findings provide insight toward the use of caffeine as a DNA damage-sensitizing agent in cancer cells. PMID:26019182

  7. Repair of DNA Strand Breaks by the Overlapping Functions of Lesion-Specific and Non-Lesion-Specific DNA 3′ Phosphatases

    OpenAIRE

    Vance, John R.; Wilson, Thomas E.

    2001-01-01

    In Saccharomyces cerevisiae, the apurinic/apyrimidinic (AP) endonucleases Apn1 and Apn2 act as alternative pathways for the removal of various 3′-terminal blocking lesions from DNA strand breaks and in the repair of abasic sites, which both result from oxidative DNA damage. Here we demonstrate that Tpp1, a homologue of the 3′ phosphatase domain of polynucleotide kinase, is a third member of this group of redundant 3′ processing enzymes. Unlike Apn1 and Apn2, Tpp1 is specific for the removal o...

  8. Inter-individual variation in DNA double-strand break repair in human fibroblasts before and after exposure to low doses of ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Paul F.; Nham, Peter B.; Urbin, Salustra S.; Hinz, John M.; Jones, Irene M. [Biosciences and Biotechnology Division, PO Box 808, L-452, Lawrence Livermore National Laboratory, Livermore, CA, 94551-0808 (United States); Thompson, Larry H., E-mail: thompson14@llnl.gov [Biosciences and Biotechnology Division, PO Box 808, L-452, Lawrence Livermore National Laboratory, Livermore, CA, 94551-0808 (United States)

    2010-01-05

    DNA double-strand breaks (DSB) are generally considered the most critical lesion induced by ionizing radiation (IR) and may initiate carcinogenesis and other disease. Using an immunofluorescence assay to simultaneously detect nuclear foci of the phosphorylated forms of histone H2AX and ATM kinase at sites of DSBs, we examined the response of 25 apparently normal and 10 DNA repair-deficient (ATM, ATR, NBN, LIG1, LIG4, and FANCG) primary fibroblast strains irradiated with low doses of {sup 137}Cs {gamma}-rays. Quiescent G{sub 0}/G{sub 1}-phase cultures were exposed to 5, 10, and 25 cGy and allowed to repair for 24 h. The maximum level of IR-induced foci (0.15 foci per cGy, at 10 or 30 min) in the normal strains showed much less inter-individual variation (CV {approx} 0.2) than the level of spontaneous foci, which ranged from 0.2-2.6 foci/cell (CV {approx} 0.6; mean {+-} SD of 1.00 {+-} 0.57). Significantly slower focus formation post-irradiation was observed in seven normal strains, similar to most mutant strains examined. There was variation in repair efficiency measured by the fraction of IR-induced foci remaining 24 h post-irradiation, curiously with the strains having slower focus formation showing more efficient repair after 25 cGy. Interestingly, the ranges of spontaneous and residual induced foci levels at 24 h in the normal strains were as least as large as those observed for the repair-defective mutant strains. The inter-individual variation in DSB foci parameters observed in cells exposed to low doses of ionizing radiation in this small survey of apparently normal people suggests that hypomorphic genetic variants in genomic maintenance and/or DNA damage signaling and repair genes may contribute to differential susceptibility to cancer induced by environmental mutagens.

  9. Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Khong Bee, E-mail: dmskkb@nccs.com.sg [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore); Zhu Congju; Wong Yinling; Gao Qiuhan; Ty, Albert; Wong, Meng Cheong [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore)

    2012-05-01

    Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)-Akt-DNA-dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, {gamma}-H{sub 2}AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, {gamma}-H{sub 2}AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G{sub 2}/M arrest and increased {gamma}-H{sub 2}AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased {gamma}-H{sub 2}AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are

  10. Active and break events of Indian summer monsoon during 1901-2014

    Digital Repository Service at National Institute of Oceanography (India)

    Pai; Sridhar, L.; RameshKumar, M.R.

    . Dyn., vol.46(11); 2016; 3921-3939 Active and Break Events of Indian Summer Monsoon during 1901-2014 D.S. Pai*, Latha Sridhar* and M. R. Ramesh Kumar** *India Meteorological Department, Pune **National Institute of Oceanography, Goa Contact e... & Slingo 2001, Gadgil & Joseph 2003, Ramesh Kumar and Desai 2004, Mandke et al. 2007, Krishnamurthy and Shukla 2000, 2007 & 2008, Rajeevan et al. 2010, Pai et al. 2011). Rajeevan et al. (2010) suggested criteria for identification of active and break...

  11. Functional Analysis of BARD1 Missense Variants in Homology-Directed Repair of DNA Double Strand Breaks.

    Science.gov (United States)

    Lee, Cindy; Banerjee, Tapahsama; Gillespie, Jessica; Ceravolo, Amanda; Parvinsmith, Matthew R; Starita, Lea M; Fields, Stanley; Toland, Amanda E; Parvin, Jeffrey D

    2015-12-01

    Genes associated with hereditary breast and ovarian cancer (HBOC) are often sequenced in search of mutations that are predictive of susceptibility to these cancer types, but the sequence results are frequently ambiguous because of the detection of missense substitutions for which the clinical impact is unknown. The BARD1 protein is the heterodimeric partner of BRCA1 and is included on clinical gene panels for testing for susceptibility to HBOC. Like BRCA1, it is required for homology-directed DNA repair (HDR). We measured the HDR function of 29 BARD1 missense variants, 27 culled from clinical test results and two synthetic variants. Twenty-three of the assayed variants were functional for HDR; of these, four are known neutral variants. Three variants showed intermediate function, and three others were defective in HDR. When mapped to BARD1 domains, residues crucial for HDR were located in the N- and C- termini of BARD1. In the BARD1 RING domain, critical residues mapped to the zinc-coordinating amino acids and to the BRCA1-BARD1 binding interface, highlighting the importance of interaction between BRCA1 and BARD1 for HDR activity. Based on these results, we propose that the HDR assay is a useful complement to genetic analyses to classify BARD1 variants of unknown clinical significance. © 2015 WILEY PERIODICALS, INC.

  12. Identification of Proteins Required for Repair of Double-Strand Chromosome Breaks, a Predisposing Factor in Breast Cancer

    National Research Council Canada - National Science Library

    Marshall-Batty, Kimberly

    2001-01-01

    ... when replication forks become arrested. This project bas focused on developing a bacterial model for DSB repair by characterizing the enzymatic apparatus needed to initiate DNA replication on recombination intermediates...

  13. Identification of Proteins Required for Repair of Double-Strand Chromosome Breaks, a Predisposing Factor in Breast Cancer

    National Research Council Canada - National Science Library

    Jones, Jessica

    2000-01-01

    ... when replication forks become arrested. This project has focused on developing a bacterial model for DSB repair by characterizing the enzymatic apparatus needed to initiate DNA replication on recombination intermediates...

  14. Either non-homologous ends joining or homologous recombination is required to repair double-strand breaks in the genome of macrophage-internalized Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Anna Brzostek

    Full Text Available The intracellular pathogen Mycobacterium tuberculosis (Mtb is constantly exposed to a multitude of hostile conditions and is confronted by a variety of potentially DNA-damaging assaults in vivo, primarily from host-generated antimicrobial toxic radicals. Exposure to reactive nitrogen species and/or reactive oxygen species causes different types of DNA damage, including oxidation, depurination, methylation and deamination, that can result in single- or double-strand breaks (DSBs. These breaks affect the integrity of the whole genome and, when left unrepaired, can lead to cell death. Here, we investigated the role of the DSB repair pathways, homologous recombination (HR and non-homologous ends joining (NHEJ, in the survival of Mtb inside macrophages. To this end, we constructed Mtb strains defective for HR (ΔrecA, NHEJ [Δ(ku,ligD], or both DSB repair systems [Δ(ku,ligD,recA]. Experiments using these strains revealed that either HR or NHEJ is sufficient for the survival and propagation of tubercle bacilli inside macrophages. Inhibition of nitric oxide or superoxide anion production with L-NIL or apocynin, respectively, enabled the Δ(ku,ligD,recA mutant strain lacking both systems to survive intracellularly. Complementation of the Δ(ku,ligD,recA mutant with an intact recA or ku-ligD rescued the ability of Mtb to propagate inside macrophages.

  15. MCM8 is required for a pathway of meiotic double-strand break repair independent of DMC1 in Arabidopsis thaliana.

    Science.gov (United States)

    Crismani, Wayne; Portemer, Virginie; Froger, Nicole; Chelysheva, Liudmila; Horlow, Christine; Vrielynck, Nathalie; Mercier, Raphaël

    2013-01-01

    Mini-chromosome maintenance (MCM) 2-9 proteins are related helicases. The first six, MCM2-7, are essential for DNA replication in all eukaryotes. In contrast, MCM8 is not always conserved in eukaryotes but is present in Arabidopsis thaliana. MCM8 is required for 95% of meiotic crossovers (COs) in Drosophila and is essential for meiosis completion in mouse, prompting us to study this gene in Arabidopsis meiosis. Three allelic Atmcm8 mutants showed a limited level of chromosome fragmentation at meiosis. This defect was dependent on programmed meiotic double-strand break (DSB) formation, revealing a role for AtMCM8 in meiotic DSB repair. In contrast, CO formation was not affected, as shown both genetically and cytologically. The Atmcm8 DSB repair defect was greatly amplified in the absence of the DMC1 recombinase or in mutants affected in DMC1 dynamics (sds, asy1). The Atmcm8 fragmentation defect was also amplified in plants heterozygous for a mutation in either recombinase, DMC1 or RAD51. Finally, in the context of absence of homologous chromosomes (i.e. haploid), mutation of AtMCM8 also provoked a low level of chromosome fragmentation. This fragmentation was amplified by the absence of DMC1 showing that both MCM8 and DMC1 can promote repair on the sister chromatid in Arabidopsis haploids. Altogether, this establishes a role for AtMCM8 in meiotic DSB repair, in parallel to DMC1. We propose that MCM8 is involved with RAD51 in a backup pathway that repairs meiotic DSB without giving CO when the major pathway, which relies on DMC1, fails.

  16. MCM8 is required for a pathway of meiotic double-strand break repair independent of DMC1 in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Wayne Crismani

    Full Text Available Mini-chromosome maintenance (MCM 2-9 proteins are related helicases. The first six, MCM2-7, are essential for DNA replication in all eukaryotes. In contrast, MCM8 is not always conserved in eukaryotes but is present in Arabidopsis thaliana. MCM8 is required for 95% of meiotic crossovers (COs in Drosophila and is essential for meiosis completion in mouse, prompting us to study this gene in Arabidopsis meiosis. Three allelic Atmcm8 mutants showed a limited level of chromosome fragmentation at meiosis. This defect was dependent on programmed meiotic double-strand break (DSB formation, revealing a role for AtMCM8 in meiotic DSB repair. In contrast, CO formation was not affected, as shown both genetically and cytologically. The Atmcm8 DSB repair defect was greatly amplified in the absence of the DMC1 recombinase or in mutants affected in DMC1 dynamics (sds, asy1. The Atmcm8 fragmentation defect was also amplified in plants heterozygous for a mutation in either recombinase, DMC1 or RAD51. Finally, in the context of absence of homologous chromosomes (i.e. haploid, mutation of AtMCM8 also provoked a low level of chromosome fragmentation. This fragmentation was amplified by the absence of DMC1 showing that both MCM8 and DMC1 can promote repair on the sister chromatid in Arabidopsis haploids. Altogether, this establishes a role for AtMCM8 in meiotic DSB repair, in parallel to DMC1. We propose that MCM8 is involved with RAD51 in a backup pathway that repairs meiotic DSB without giving CO when the major pathway, which relies on DMC1, fails.

  17. LncRNA lnc-RI regulates homologous recombination repair of DNA double-strand breaks by stabilizing RAD51 mRNA as a competitive endogenous RNA.

    Science.gov (United States)

    Shen, Liping; Wang, Qi; Liu, Ruixue; Chen, Zhongmin; Zhang, Xueqing; Zhou, Pingkun; Wang, Zhidong

    2017-12-04

    DNA double-strand break (DSB) repair is critical for the maintenance of genome stability. The current models of the mechanism of DSB repair are based on studies of DNA repair proteins. Long non-coding RNAs (lncRNAs) have recently emerged as new regulatory molecules, with diverse functions in biological processes. In the present study, we found that expression of the ionizing radiation-inducible lncRNA, lnc-RI, was correlate negatively with micronucleus frequencies in human peripheral blood lymphocytes. Knockdown of lnc-RI significantly increased spontaneous DSBs levels, which was confirmed to be associated with the decreased efficiency of homologous recombination (HR) repair of DSBs. The expression of RAD51, a key recombinase in the HR pathway, decreased sharply in lnc-RI-depressed cells. In a further investigation, we demonstrated that miR-193a-3p could bind with both lnc-RI and RAD51 mRNA and depressed the expression of lnc-RI and RAD51 mRNA. Lnc-RI acted as a competitive endogenous RNA (ceRNA) to stabilize RAD51 mRNA via competitive binding with miR-193a-3p and release of its inhibition of RAD51 expression. To our knowledge, this is the first study to demonstrate the role of lnc-RI in regulating HR repair of DSBs. The feedback loop established in the current study suggests that lnc-RI is critical for the maintenance of genomic stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Genetic variants in DNA double-strand break repair genes and risk of salivary gland carcinoma: a case-control study.

    Directory of Open Access Journals (Sweden)

    Li Xu

    Full Text Available DNA double strand break (DSB repair is the primary defense mechanism against ionizing radiation-induced DNA damage. Ionizing radiation is the only established risk factor for salivary gland carcinoma (SGC. We hypothesized that genetic variants in DSB repair genes contribute to individual variation in susceptibility to SGC. To test this hypothesis, we conducted a case-control study in which we analyzed 415 single nucleotide polymorphisms (SNPs in 45 DSB repair genes in 352 SGC cases and 598 controls. Multivariate logistic regression analysis was performed to calculate odds ratios (ORs and 95% confidence intervals (CIs. Rs3748522 in RAD52 and rs13180356 in XRCC4 were significantly associated with SGC after Bonferroni adjustment; ORs (95% CIs for the variant alleles of these SNPs were 1.71 (1.40-2.09, P = 1.70 × 10(-7 and 0.58 (0.45-0.74, P = 2.00 × 10(-5 respectively. The genetic effects were modulated by histological subtype. The association of RAD52-rs3748522 with SGC was strongest for mucoepidermoid carcinoma (OR = 2.21, 95% CI: 1.55-3.15, P = 1.25 × 10(-5, n = 74, and the association of XRCC4-rs13180356 with SGC was strongest for adenoid cystic carcinoma (OR = 0.60, 95% CI: 0.42-0.87, P = 6.91 × 10(-3, n = 123. Gene-level association analysis revealed one gene, PRKDC, with a marginally significant association with SGC risk in non-Hispanic whites. To our knowledge, this study is the first to comprehensively evaluate the genetic effect of DSB repair genes on SGC risk. Our results indicate that genetic variants in the DSB repair pathways contribute to inter-individual differences in susceptibility to SGC and show that the impact of genetic variants differs by histological subtype. Independent studies are warranted to confirm these findings.

  19. Cascade of chromosomal rearrangements caused by a heterogeneous T-DNA integration supports the double-stranded break repair model for T-DNA integration.

    Science.gov (United States)

    Hu, Yufei; Chen, Zhiyu; Zhuang, Chuxiong; Huang, Jilei

    2017-06-01

    Transferred DNA (T-DNA) from Agrobacterium tumefaciens can be integrated into the plant genome. The double-stranded break repair (DSBR) pathway is a major model for T-DNA integration. From this model, we expect that two ends of a T-DNA molecule would invade into a single DNA double-stranded break (DSB) or independent DSBs in the plant genome. We call the later phenomenon a heterogeneous T-DNA integration, which has never been observed. In this work, we demonstrated it in an Arabidopsis T-DNA insertion mutant seb19. To resolve the chromosomal structural changes caused by T-DNA integration at both the nucleotide and chromosome levels, we performed inverse PCR, genome resequencing, fluorescence in situ hybridization and linkage analysis. We found, in seb19, a single T-DNA connected two different chromosomal loci and caused complex chromosomal rearrangements. The specific break-junction pattern in seb19 is consistent with the result of heterogeneous T-DNA integration but not of recombination between two T-DNA insertions. We demonstrated that, in seb19, heterogeneous T-DNA integration evoked a cascade of incorrect repair of seven DSBs on chromosomes 4 and 5, and then produced translocation, inversion, duplication and deletion. Heterogeneous T-DNA integration supports the DSBR model and suggests that two ends of a T-DNA molecule could be integrated into the plant genome independently. Our results also show a new origin of chromosomal abnormalities. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  20. Endogenous sequence patterns predispose the repair modes of CRISPR/Cas9-induced DNA double-stranded breaks in Arabidopsis thaliana.

    Science.gov (United States)

    Vu, Giang T H; Cao, Hieu X; Fauser, Friedrich; Reiss, Bernd; Puchta, Holger; Schubert, Ingo

    2017-10-01

    The possibility to predict the outcome of targeted DNA double-stranded break (DSB) repair would be desirable for genome editing. Furthermore the consequences of mis-repair of potentially cell-lethal DSBs and the underlying pathways are not yet fully understood. Here we study the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-induced mutation spectra at three selected endogenous loci in Arabidopsis thaliana by deep sequencing of long amplicon libraries. Notably, we found sequence-dependent genomic features that affected the DNA repair outcome. Deletions of 1-bp to 1 kbp (all due to NHEJ) and deletions combined with insertions between 5-bp to >100 bp [caused by a synthesis-dependent strand annealing (SDSA)-like mechanism] occurred most frequently at all three loci. The appearance of single-stranded annealing events depends on the presence and distance between repeats flanking the DSB. The frequency and size of insertions is increased if a sequence with high similarity to the target site was available in cis. Most deletions were linked to pre-existing microhomology. Deletion and/or insertion mutations were blunt-end ligated or via de novo generated microhomology. While most mutation types and, to some degree, their predictability are comparable with animal systems, the broad range of deletion mutations seems to be a peculiar feature of the plant A. thaliana. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  1. DNA repair pathways involved in repair of lesions induced by 5-fluorouracil and its active metabolite FdUMP.

    Science.gov (United States)

    Matuo, Renata; Sousa, Fabrício Garmus; Escargueil, Alexandre E; Soares, Daniele G; Grivicich, Ivana; Saffi, Jenifer; Larsen, Annette K; Henriques, João Antonio Pêgas

    2010-01-15

    5-Fluorouracil (5-FU) is an antitumor antimetabolite that can be converted into fluoronucleotides and FdUMP. Fluoronucleotides are incorporated into DNA and RNA, while FdUMP results in nucleotide pool imbalance. Saccharomyces cerevisiae is unable to convert 5-FU into FdUMP, making yeast a unique model system to study the cellular effects of 5-FU and FdUMP independently. A panel of repair-deficient yeast strains was used to identify the DNA repair pathways needed for repair of lesions generated by 5-FU or FdUMP. This included yeast deficient in base excision repair (BER), nucleotide excision repair (NER), translesion synthesis (TLS), mismatch repair (MMR), post-replication repair (PRR), homologous recombination (HR) and non-homologous end-joining (NHEJ). The results revealed an important role of BER, since BER-mutants (ntg1, ntg2, apn1, apn2) showed pronounced sensitivity to both 5-FU and FdUMP. MMR mutants also showed high sensitivity to both compounds. In contrast, deficiencies in NER, NHEJ and TLS repair had only minor influence on the sensitivity to FU and FdUMP. Interestingly, deficiencies in HR (rad52) and PPR (rad6, rad18) were associated with increased sensitivity to 5-FU, but not to FdUMP. Taken together, our study reveals an important contribution of DNA repair pathways on the sensitivity to 5-FU and its active metabolite FdUMP. Importantly, the repair mechanisms differed for the 2 antimetabolites since lesions induced by 5-FU were repaired by BER, MMR, HR and PRR, while only BER and MMR were required for repair of FdUMP-induced lesions.

  2. Survey of Active Structural Control and Repair Using Piezoelectric Patches

    Directory of Open Access Journals (Sweden)

    Ahmed Abuzaid

    2015-05-01

    Full Text Available The piezoelectric actuator has gained popularity over the last few years. Attention has been directed towards the study of their electromechanical response in active repair and the control of damaged structures. This has been made possible through the development of various numerical and analytical techniques for such studies. The shift of focus towards the piezoelectric based approaches has been due to their advantages, which include strategic cost benefits in maintenance, as well as an increase in the life cycle of the repaired structures. Furthermore, adhesively bonded joints are widely used in the manufacturing and repairing of structures in many industries, especially automotive and aerospace engineering. This is due to the requirement for lightweight materials as well as the potential adhesive used to join materials with different characteristics. The piezoelectric actuator has also shown the capacity in controlling and lowering the shear stress concentration and joint edge peel in adhesively bonded joint systems. The structure’s control of stress and repair can generally be viewed as a reinforcement that influences the structure’s damage tolerance. Therefore, the interest of this review is on the applications of the piezoelectric actuators in both structural damage and the bonded adhesive joint system. The specific goal is to recognize the contemporary scientific challenges, including future opportunities.

  3. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    Energy Technology Data Exchange (ETDEWEB)

    Zafar, Faria; Seidler, Sara B.; Kronenberg, Amy; Schild, David; Wiese, Claudia

    2010-06-29

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  4. Autologous hematopoietic stem cell transplantation in lymphoma patients is associated with a decrease in the double strand break repair capacity of peripheral blood lymphocytes.

    Directory of Open Access Journals (Sweden)

    Sandrine Lacoste

    Full Text Available Patients who undergo autologous hematopoietic stem cell transplantation (aHCT for treatment of a relapsed or refractory lymphoma are at risk of developing therapy related- myelodysplasia/acute myeloid leukemia (t-MDS/AML. Part of the risk likely resides in inherent interindividual differences in their DNA repair capacity (DRC, which is thought to influence the effect chemotherapeutic treatments have on the patient's stem cells prior to aHCT. Measuring DRC involves identifying small differences in repair proficiency among individuals. Initially, we investigated the cell model in healthy individuals (primary lymphocytes and/or lymphoblastoid cell lines that would be appropriate to measure genetically determined DRC using host-cell reactivation assays. We present evidence that interindividual differences in DRC double-strand break repair (by non-homologous end-joining [NHEJ] or single-strand annealing [SSA] are better preserved in non-induced primary lymphocytes. In contrast, lymphocytes induced to proliferate are required to assay base excision (BER or nucleotide excision repair (NER. We established that both NHEJ and SSA DRCs in lymphocytes of healthy individuals were inversely correlated with the age of the donor, indicating that DSB repair in lymphocytes is likely not a constant feature but rather something that decreases with age (~0.37% NHEJ DRC/year. To investigate the predictive value of pre-aHCT DRC on outcome in patients, we then applied the optimized assays to the analysis of primary lymphocytes from lymphoma patients and found that individuals who later developed t-MDS/AML (cases were indistinguishable in their DRC from controls who never developed t-MDS/AML. However, when DRC was investigated shortly after aHCT in the same individuals (21.6 months later on average, aHCT patients (both cases and controls showed a significant decrease in DSB repair measurements. The average decrease of 6.9% in NHEJ DRC observed among aHCT patients was

  5. Examining the knowledge and capacity of elementary teachers to implement classroom physical activity breaks

    Directory of Open Access Journals (Sweden)

    Danae M. Dinkel

    2016-09-01

    Full Text Available This study examined teachers’ zone of proximal development for classroom physical activity breaks by assessing teachers’ knowledge and capacity for implementing classroom physical activity breaks. Five school districts of various sizes (n=346 teachers took part in a short online survey. Descriptive statistics were calculated and chi-square analyses were used to identify differences between districts. Almost all teachers utilized classroom physical activity to some extent. A third of teachers who stated they implemented classroom physical activity, experienced barriers to implementation. A majority of teachers were interested in learning more about classroom physical activity. There were significant differences between districts on the number of days per week classroom physical activity was integrated, the frequency of collaboration that occurred between teachers, the percentage of teachers who experienced barriers, and preferred delivery method of professional development. These findings support the importance of identifying teachers’ zone of proximal development to increase the use of classroom physical activity breaks. Understanding teachers’ knowledge and capacity for implementing classroom physical activity breaks can allow educational professionals to shift the implementation of classroom physical activity beyond sporadic use by isolated teachers and schools to a more systematic and consistent delivery across classrooms and throughout districts.

  6. Examining the Knowledge and Capacity of Elementary Teachers to Implement Classroom Physical Activity Breaks

    Directory of Open Access Journals (Sweden)

    Danae M. DINKEL

    2016-09-01

    Full Text Available This study examined teachers’ zone of proximal development for classroom physical activity breaks by assessing teachers’ knowledge and capacity for implementing classroom physical activity breaks. Five school districts of various sizes (n=346 teachers took part in a short online survey. Descriptive statistics were calculated and chi-square analyses were used to identify differences between districts. Almost all teachers utilized classroom physical activity to some extent. A third of teachers who stated they implemented classroom physical activity, experienced barriers to implementation. A majority of teachers were interested in learning more about classroom physical activity. There were significant differences between districts on the number of days per week classroom physical activity was integrated, the frequency of collaboration that occurred between teachers, the percentage of teachers who experienced barriers, and preferred delivery method of professional development. These findings support the importance of identifying teachers’ zone of proximal development to increase the use of classroom physical activity breaks. Understanding teachers’ knowledge and capacity for implementing classroom physical activity breaks can allow educational professionals to shift the implementation of classroom physical activity beyond sporadic use by isolated teachers and schools to a more systematic and consistent delivery across classrooms and throughout districts.

  7. A major role of the RecFOR pathway in DNA double-strand-break repair through ESDSA in Deinococcus radiodurans.

    Directory of Open Access Journals (Sweden)

    Esma Bentchikou

    2010-01-01

    Full Text Available In Deinococcus radiodurans, the extreme resistance to DNA-shattering treatments such as ionizing radiation or desiccation is correlated with its ability to reconstruct a functional genome from hundreds of chromosomal fragments. The rapid reconstitution of an intact genome is thought to occur through an extended synthesis-dependent strand annealing process (ESDSA followed by DNA recombination. Here, we investigated the role of key components of the RecF pathway in ESDSA in this organism naturally devoid of RecB and RecC proteins. We demonstrate that inactivation of RecJ exonuclease results in cell lethality, indicating that this protein plays a key role in genome maintenance. Cells devoid of RecF, RecO, or RecR proteins also display greatly impaired growth and an important lethal sectoring as bacteria devoid of RecA protein. Other aspects of the phenotype of recFOR knock-out mutants paralleled that of a DeltarecA mutant: DeltarecFOR mutants are extremely radiosensitive and show a slow assembly of radiation-induced chromosomal fragments, not accompanied by DNA synthesis, and reduced DNA degradation. Cells devoid of RecQ, the major helicase implicated in repair through the RecF pathway in E. coli, are resistant to gamma-irradiation and have a wild-type DNA repair capacity as also shown for cells devoid of the RecD helicase; in contrast, DeltauvrD mutants show a markedly decreased radioresistance, an increased latent period in the kinetics of DNA double-strand-break repair, and a slow rate of fragment assembly correlated with a slow rate of DNA synthesis. Combining RecQ or RecD deficiency with UvrD deficiency did not significantly accentuate the phenotype of DeltauvrD mutants. In conclusion, RecFOR proteins are essential for DNA double-strand-break repair through ESDSA whereas RecJ protein is essential for cell viability and UvrD helicase might be involved in the processing of double stranded DNA ends and/or in the DNA synthesis step of ESDSA.

  8. A Major Role of the RecFOR Pathway in DNA Double-Strand-Break Repair through ESDSA in Deinococcus radiodurans

    Science.gov (United States)

    Bentchikou, Esma; Servant, Pascale; Coste, Geneviève; Sommer, Suzanne

    2010-01-01

    In Deinococcus radiodurans, the extreme resistance to DNA–shattering treatments such as ionizing radiation or desiccation is correlated with its ability to reconstruct a functional genome from hundreds of chromosomal fragments. The rapid reconstitution of an intact genome is thought to occur through an extended synthesis-dependent strand annealing process (ESDSA) followed by DNA recombination. Here, we investigated the role of key components of the RecF pathway in ESDSA in this organism naturally devoid of RecB and RecC proteins. We demonstrate that inactivation of RecJ exonuclease results in cell lethality, indicating that this protein plays a key role in genome maintenance. Cells devoid of RecF, RecO, or RecR proteins also display greatly impaired growth and an important lethal sectoring as bacteria devoid of RecA protein. Other aspects of the phenotype of recFOR knock-out mutants paralleled that of a ΔrecA mutant: ΔrecFOR mutants are extremely radiosensitive and show a slow assembly of radiation-induced chromosomal fragments, not accompanied by DNA synthesis, and reduced DNA degradation. Cells devoid of RecQ, the major helicase implicated in repair through the RecF pathway in E. coli, are resistant to γ-irradiation and have a wild-type DNA repair capacity as also shown for cells devoid of the RecD helicase; in contrast, ΔuvrD mutants show a markedly decreased radioresistance, an increased latent period in the kinetics of DNA double-strand-break repair, and a slow rate of fragment assembly correlated with a slow rate of DNA synthesis. Combining RecQ or RecD deficiency with UvrD deficiency did not significantly accentuate the phenotype of ΔuvrD mutants. In conclusion, RecFOR proteins are essential for DNA double-strand-break repair through ESDSA whereas RecJ protein is essential for cell viability and UvrD helicase might be involved in the processing of double stranded DNA ends and/or in the DNA synthesis step of ESDSA. PMID:20090937

  9. Sexual activity among Nigerian women following successful obstetric fistula repair.

    Science.gov (United States)

    Anzaku, Stephen A; Lengmang, Sunday J; Mikah, Samaila; Shephard, Steven N; Edem, Bassey E

    2017-04-01

    To evaluate post-operative sexual activity among women who have undergone obstetric fistula repair. The present descriptive cross-sectional study recruited married women who had undergone successful obstetric fistula repair who were attending reunion activities at Bingham University Teaching Hospital, Jos, Nigeria, between March 13 and March 15, 2014. Participants were interviewed regarding penetrative vaginal intercourse after surgery, and any changes in sexual desire, arousal, orgasm, sexual satisfaction, and the presence of coital pain compared with before they experienced obstetric fistula. There were 102 patients who participated in interviews; 23 (22.5%) reported not being able to engage in penetrative vaginal intercourse and 12 (52%) of these patients ascribed this to a "tight" or "narrow" vagina. Compared with the pre-fistula period, 63 (61.7%) patients reported reduced sexual desire, 57 (55.9%) reported lack of or inadequate lubrication during intercourse, 12 (11.8%) reported anorgasmia, and 60 (58.8%) reported reduced attainment of orgasm. Dyspareunia was reported by 48 (47.1%) patients; 43 (90%) experienced superficial or deep dyspareunia, and 5 (10%) experienced both. A lack of and lower sexual satisfaction were reported by 20 (19.6%) and 40 (39.2%) patients, respectively. Following obstetric fistula repair, many women experienced difficulty engaging in penetrative vaginal intercourse and reported sexual dysfunction. Management of sexual dysfunction should be part of fistula rehabilitation programs. © 2016 International Federation of Gynecology and Obstetrics.

  10. DNA excision repair and double-strand break repair gene polymorphisms and the level of chromosome aberration in children with long-term exposure to radon.

    Science.gov (United States)

    Larionov, Aleksey V; Sinitsky, Maxim Y; Druzhinin, Vladimir G; Volobaev, Valentin P; Minina, Varvara I; Asanov, Maxim A; Meyer, Alina V; Tolochko, Tatiana A; Kalyuzhnaya, Ekaterina E

    2016-08-01

    To study polymorphic variants of repair genes in people affected by long-term exposure to radon. The chromosome aberration frequency in peripheral blood lymphocytes was used as the biological marker of genotoxicity. Genotyping of 12 single nucleotide polymorphisms in DNA repair genes (APE, XRCC1, OGG1, ADPRT, XpC, XpD, XpG, Lig4 and NBS1) was performed in children with long-term resident exposure to radon. Quantification of the aberrations was performed using light microscopy. The total frequency of aberrations was increased in carriers of the G/G genotype for the XpD gene (rs13181) polymorphism in recessive model confirmed by the results of ROC-analysis ('satisfactory predictor', AUC = 0.609). Single chromosome fragments frequency was increased in carriers of the G/G genotype in comparison with the T/T genotype. In respect to the total frequency of aberrations, the G/G genotype for the XpG gene (rs17655) polymorphism was also identified as a 'satisfactory predictor' (AUC = 0.605). Carriers of the T/C genotype for the ADPRT gene (rs1136410) polymorphism were characterized by an increased level of single fragments relative to the T/T genotype. The relationships with several types of cytogenetic damage suggest these three SNP (rs13181, rs17655 and rs1136410) may be considered radiosensitivity markers.

  11. Breaking BAD: A Data Serving Vision for Big Active Data.

    Science.gov (United States)

    Carey, Michael J; Jacobs, Steven; Tsotras, Vassilis J

    2016-06-01

    Virtually all of today's Big Data systems are passive in nature. Here we describe a project to shift Big Data platforms from passive to active. We detail a vision for a scalable system that can continuously and reliably capture Big Data to enable timely and automatic delivery of new information to a large pool of interested users as well as supporting analyses of historical information. We are currently building a Big Active Data (BAD) system by extending an existing scalable open-source BDMS (AsterixDB) in this active direction. This first paper zooms in on the Data Serving piece of the BAD puzzle, including its key concepts and user model.

  12. Vaginal pressure during daily activities before and after vaginal repair

    DEFF Research Database (Denmark)

    Mouritsen, L; Hulbaek, M; Brostrøm, S

    2007-01-01

    , pelvic floor contraction (PFC), coughing, Valsalva, rising from sitting to standing and lifting 2 and 5 kg with four different lifting techniques. VP was measured before, 1-5 days and 4-6 weeks after vaginal repair. Mean VP was four to five times higher during coughing and Valsalva compared to PFC...... and lifting 2 and 5 kg. Lifting in the walking position created a slightly higher VP compared to other lifting techniques, which did not differ. The VP did not increase when lifting 5 kg compared to 2 kg. Mean VP during coughing and Valsalva were significantly lower 1-5 days after the operation. VP...... was not related to the type of vaginal repair. The results imply that post-operative counselling should concentrate more on treating chronic cough and constipation than restrictions of moderate physical activities....

  13. Extraction of Active Enzymes from "Hard-to-Break-Cells"

    DEFF Research Database (Denmark)

    Ottaviani, Alessio; Tesauro, Cinzia; Fjelstrup, S

    We present the utilization of a rolling circle amplification (RCA) based assay to investigate the extraction efficiency of active enzymes from a class of “hard-to-break” cells, yeast Saccaramyces cerevisiae. Current analyses of microorganisms, such as pathogenic bacteria, parasites or particular...... life stages of microorganisms (e.g. spores from bacteria or fungi) is hampered by the lack of efficient lysis protocols that preserve the activity and integrity of the cellular content. Presented herein is a flexible scheme to screen lysis protocols for active enzyme extraction. We also report a gentle...... yet effective approach for extraction of active enzymes by entrapping cells in microdroplets. Combined effort of optimized extraction protocols and effective analytical approaches is expected to generate impact in future disease diagnosis and environmental safety....

  14. Future projections of active-break spells of Indian summer monsoon in a climate change perspective

    Science.gov (United States)

    Sudeepkumar, B. L.; Babu, C. A.; Varikoden, Hamza

    2018-02-01

    The effect of global climate change on Indian summer monsoon has been analysed with special emphasis on active-break cycle. The changes in intensity and duration of active and break monsoon conditions towards the end of the century are studied by using 850 hPa zonal circulations. The analysis is carried out using twenty year climatology of historical period (1986-2005) and future projections (2080-2099) simulated as part of Coupled Model Intercomparison Project phase 5 (CMIP5). Models are compared with NCEP/NCAR reanalysis data. The models that effectively capture the circulation pattern of monsoon (JJAS) are considered for assessing the future climate in RCP 4.5 scenario. They are CanESM2, CNRM-CM5, GFDL-ESM2M, MIROC5 and MPI-ESM-LR. During the southwest monsoon period, the ensemble mean of models projects a strengthening of the wind speed towards north (north of 15°N) and weakening to the southern region (especially south of 12°N) which facilitates wetting of northern Indian regions and drying of southern peninsular regions. In the case of active-break conditions, the active spells are found to be strengthening over northern India and weakening over the peninsular India, the break spells intensify over southern tip of peninsular India indicating intense breaks. Increased propensity of short intense active days and decreased propensity of long active days are also projected by the models. The number of break spells does not show any significant changes.

  15. Improving Cardiometabolic Health with Diet, Physical Activity, and Breaking Up Sitting: What about Sleep?

    Directory of Open Access Journals (Sweden)

    Grace E. Vincent

    2017-11-01

    Full Text Available Cardiometabolic disease poses a serious health and economic burden worldwide and its prevalence is predicted to increase. Prolonged sitting, lack of physical activity, poor diet, and short sleep duration are ubiquitous behaviors in modern society, and all are independent risk factors in the development of cardiometabolic disease. Existing evidence demonstrates that breaking up prolonged periods of sitting is beneficial for cardiometabolic health, however, studies have not controlled for prior sleep duration. This article examines how prolonged sitting and short sleep duration independently contribute to cardiometabolic risk, and how breaking up sitting and obtaining adequate sleep may reduce this risk. We suggest that as prolonged sitting and short sleep duration influence the same cardiometabolic parameters, there is potential for short sleep to attenuate the positive impact of breaking up prolonged sitting with physical activity. Likewise, breaking up prolonged sitting and obtaining adequate sleep together could improve predictors of cardiometabolic disease, i.e., the combined effect may be stronger than either alone. To explore these perspectives, we propose a research agenda to investigate the relationship between breaking up prolonged sitting with physical activity and short sleep duration. This will provide an evidence-base for informing the design of interventions to reduce the burden of cardiometabolic disease on communities worldwide.

  16. Elevated presence of retrotransposons at sites of DNA double strand break repair in mouse models of metabolic oxidative stress and MYC-induced lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Rockwood, Lynne D.; Felix, Klaus; Janz, Siegfried

    2004-04-14

    The chromosomally integrated shuttle vector pUR288 contains a lacZ reporter gene to study mutagenesis in vivo. We used pUR288 to compare patterns of genomic instability in two mouse models, lymphoma resulting from deregulated c-MYC expression ({lambda}-MYC), and endogenous oxidative stress caused by partial glucose 6-phosphate dehydrogenase (G6PD) deficiency. We found previously that spontaneous mutations in both models were predominantly genomic rearrangements of lacZ with mouse sequences, while most mutations in controls were point mutations. Here, we characterized the fine structure of 68 lacZ/mouse rearrangements from {lambda}-MYC lymphomas and G6PD deficient mice by sequencing breakpoint junctions and determining the origin of recombining mouse sequences. Fifty-eight of 68 (85%) recombination partners were identified. The structure of rearrangements from both {lambda}-MYC and G6PD deficient mice were remarkably alike. Intra-chromosomal deletions and inversions were common, occurring in 41% (24/58) of rearrangements, while 59% (34/58) were random translocations between lacZ and other chromosomes. Signatures of double strand break repair by nonhomologous end joining were observed at breakpoint junctions; 37% (25/68) contained 1-4 bp microhomologies, while the remaining breakpoints had no sequence homology. Long interspersed nuclear element-1 (LINE-1 or L1) retrotransposons, which constitute {approx}10% of the mouse genome, were present at 25% (17/68) of breakpoints, suggesting their participation in rearrangements. The similarity in the structure of rearrangements is consistent with the hypothesis that genetic rearrangements in {lambda}-MYC lymphomas and G6PD deficient mice result from the same mechanism, mutagenic repair of DNA double strand breaks arising from oxidative damage.

  17. BLM–DNA2–RPA–MRN and EXO1–BLM–RPA–MRN constitute two DNA end resection machineries for human DNA break repair

    Science.gov (United States)

    Nimonkar, Amitabh V.; Genschel, Jochen; Kinoshita, Eri; Polaczek, Piotr; Campbell, Judith L.; Wyman, Claire; Modrich, Paul; Kowalczykowski, Stephen C.

    2011-01-01

    Repair of dsDNA breaks requires processing to produce 3′-terminated ssDNA. We biochemically reconstituted DNA end resection using purified human proteins: Bloom helicase (BLM); DNA2 helicase/nuclease; Exonuclease 1 (EXO1); the complex comprising MRE11, RAD50, and NBS1 (MRN); and Replication protein A (RPA). Resection occurs via two routes. In one, BLM and DNA2 physically and specifically interact to resect DNA in a process that is ATP-dependent and requires BLM helicase and DNA2 nuclease functions. RPA is essential for both DNA unwinding by BLM and enforcing 5′ → 3′ resection polarity by DNA2. MRN accelerates processing by recruiting BLM to the end. In the other, EXO1 resects the DNA and is stimulated by BLM, MRN, and RPA. BLM increases the affinity of EXO1 for ends, and MRN recruits and enhances the processivity of EXO1. Our results establish two of the core machineries that initiate recombinational DNA repair in human cells. PMID:21325134

  18. Role of aerosols in modulating cloud properties during active-break cycle of Indian summer monsoon

    Science.gov (United States)

    Bhattacharya, A.; Chakraborty, A.; Venugopal, V.

    2017-09-01

    In this study, the weather research and forecast model coupled with chemistry (WRF-Chem), is used to understand the impact of aerosol-cloud interaction during the active-break cycles of the Indian summer monsoon. Two sets of simulations are performed, one with a fixed aerosol concentration ( ConstantAero) and the other with an observation-based prescription of the rate of change of aerosol concentration as a function of precipitation ( VaryingAero). This prescription is derived based on satellite-retrieved daily rainrate and concurrent observations of aerosol optical depth from aerosol robotic network. The proposed modification is necessitated by the lack of realistic emission estimates over the Indian region as well as the presence of inherent biases in monsoon simulation in WRF-Chem. In the VaryingAero simulation, unlike in the ConstantAero run, we find that the break-to-active monsoon phase has more cloud liquid water (CLW) and less rain efficiency than in the active-to-break phase. This is primarily due to the indirect effect of increased aerosol loading in the break phase. This result is in accordance with the observed behaviour of CLW estimtes from microwave imager (TRMM 2A12) and radar reflectivity (TRMM precipitation radar). We also find that the proposed interactive aerosol loading results in higher spatial variability in CLW and enhances the likelihood of increased cloud cover via formation of larger clouds. The modification also alters the diurnal cycle of clouds in break and break-to-active phases as compared to other phases due to aerosol loading, with a stronger diurnal cycle of upper level clouds in these phases in the VaryingAero model as compared to ConstantAero model.

  19. Nbs1 ChIP-Seq Identifies Off-Target DNA Double-Strand Breaks Induced by AID in Activated Splenic B Cells.

    Directory of Open Access Journals (Sweden)

    Lyne Khair

    2015-08-01

    Full Text Available Activation-induced cytidine deaminase (AID is required for initiation of Ig class switch recombination (CSR and somatic hypermutation (SHM of antibody genes during immune responses. AID has also been shown to induce chromosomal translocations, mutations, and DNA double-strand breaks (DSBs involving non-Ig genes in activated B cells. To determine what makes a DNA site a target for AID-induced DSBs, we identify off-target DSBs induced by AID by performing chromatin immunoprecipitation (ChIP for Nbs1, a protein that binds DSBs, followed by deep sequencing (ChIP-Seq. We detect and characterize hundreds of off-target AID-dependent DSBs. Two types of tandem repeats are highly enriched within the Nbs1-binding sites: long CA repeats, which can form Z-DNA, and tandem pentamers containing the AID target hotspot WGCW. These tandem repeats are not nearly as enriched at AID-independent DSBs, which we also identified. Msh2, a component of the mismatch repair pathway and important for genome stability, increases off-target DSBs, similar to its effect on Ig switch region DSBs, which are required intermediates during CSR. Most of the off-target DSBs are two-ended, consistent with generation during G1 phase, similar to DSBs in Ig switch regions. However, a minority are one-ended, presumably due to conversion of single-strand breaks to DSBs during replication. One-ended DSBs are repaired by processes involving homologous recombination, including break-induced replication repair, which can lead to genome instability. Off-target DSBs, especially those present during S phase, can lead to chromosomal translocations, deletions and gene amplifications, resulting in the high frequency of B cell lymphomas derived from cells that express or have expressed AID.

  20. Onset, active and break periods of the Australian monsoon

    Energy Technology Data Exchange (ETDEWEB)

    Shaik, Hakeem A [Northern Territory Regional Office, Australian Bureau of Meteorology, PO Box 40050, NT Regional Office, Bureau of Meteorology, Casuarina NT 0811, Darwin (Australia); Cleland, Samuel J, E-mail: h.shaik@bom.gov.a [Bureau of Meteorology, Cape Grim BAPS, Smithton Tasmania TAS 7300 (Australia)

    2010-08-15

    Four operational techniques of monsoon monitoring the Australian monsoon at Darwin have been developed in the Darwin Regional Specialised Meteorological Centre. Two techniques used the rainfall only criteria and look into the onset of wet season rainfall/monsoon rainfall. The other two techniques are based purely on Darwin wind data. The data used for the study ranges from 14 to 21 years. The main purpose of the study is to develop near-real time monitoring tools for the Australian monsoon at Darwin. The average date of onset of the monsoon ranges from 19 December to 30 December. The average date of monsoon onset is 28 December. In eleven out of twenty-one years the onset date remained within three days range between the two rainfall techniques, whereas it is eleven out of fourteen years between the wind techniques. The median number of active monsoon spells in a wet season is 3 for the rainfall techniques and 6 for the wind techniques. The average length of each active monsoon spell is around 4 days for all of the techniques. The date of onset of the monsoon has shown negative correlation with the Southern Oscillation Index (SOI) that is late onset is found to occur in El Nino years while early onset is more likely in La Nina years.

  1. Srs2 and Sgs1-Top3 suppress crossovers during double-strand break repair in yeast.

    Science.gov (United States)

    Ira, Grzegorz; Malkova, Anna; Liberi, Giordano; Foiani, Marco; Haber, James E

    2003-11-14

    Very few gene conversions in mitotic cells are associated with crossovers, suggesting that these events are regulated. This may be important for the maintenance of genetic stability. We have analyzed the relationship between homologous recombination and crossing-over in haploid budding yeast and identified factors involved in the regulation of crossover outcomes. Gene conversions unaccompanied by a crossover appear 30 min before conversions accompanied by exchange, indicating that there are two different repair mechanisms in mitotic cells. Crossovers are rare (5%), but deleting the BLM/WRN homolog, SGS1, or the SRS2 helicase increases crossovers 2- to 3-fold. Overexpressing SRS2 nearly eliminates crossovers, whereas overexpression of RAD51 in srs2Delta cells almost completely eliminates the noncrossover recombination pathway. We suggest Sgs1 and its associated topoisomerase Top3 remove double Holliday junction intermediates from a crossover-producing repair pathway, thereby reducing crossovers. Srs2 promotes the noncrossover synthesis-dependent strand-annealing (SDSA) pathway, apparently by regulating Rad51 binding during strand exchange.

  2. Srs2 and Sgs1–Top3 Suppress Crossovers during Double-Strand Break Repair in Yeast

    Science.gov (United States)

    Ira, Grzegorz; Malkova, Anna; Liberi, Giordano; Foiani, Marco; Haber, James E.

    2015-01-01

    Summary Very few gene conversions in mitotic cells are associated with crossovers, suggesting that these events are regulated. This may be important for the maintenance of genetic stability. We have analyzed the relationship between homologous recombination and crossing-over in haploid budding yeast and identified factors involved in the regulation of crossover outcomes. Gene conversions unaccompanied by a crossover appear 30 min before conversions accompanied by exchange, indicating that there are two different repair mechanisms in mitotic cells. Crossovers are rare (5%), but deleting the BLM/WRN homolog, SGS1, or the SRS2 helicase increases crossovers 2- to 3-fold. Overexpressing SRS2 nearly eliminates crossovers, whereas overexpression of RAD51 in srs2Δ cells almost completely eliminates the noncrossover recombination pathway. We suggest Sgs1 and its associated topoisomerase Top3 remove double Holliday junction intermediates from a crossover-producing repair pathway, thereby reducing crossovers. Srs2 promotes the noncrossover synthesis-dependent strand-annealing (SDSA) pathway, apparently by regulating Rad51 binding during strand exchange. PMID:14622595

  3. PCNA function in the activation and strand direction of MutLα endonuclease in mismatch repair

    Science.gov (United States)

    Pluciennik, Anna; Dzantiev, Leonid; Iyer, Ravi R.; Constantin, Nicoleta; Kadyrov, Farid A.; Modrich, Paul

    2010-01-01

    MutLα (MLH1–PMS2) is a latent endonuclease that is activated in a mismatch-, MutSα-, proliferating cell nuclear antigen (PCNA)-, replication factor C (RFC)-, and ATP-dependent manner, with nuclease action directed to the heteroduplex strand that contains a preexisting break. RFC depletion experiments and use of linear DNAs indicate that RFC function in endonuclease activation is limited to PCNA loading. Whereas nicked circular heteroduplex DNA is a good substrate for PCNA loading and for endonuclease activation on the incised strand, covalently closed, relaxed circular DNA is a poor substrate for both reactions. However, covalently closed supercoiled or bubble-containing relaxed heteroduplexes, which do support PCNA loading, also support MutLα activation, but in this case cleavage strand bias is largely abolished. Based on these findings we suggest that PCNA has two roles in MutLα function: The clamp is required for endonuclease activation, an effect that apparently involves interaction of the two proteins, and by virtue of its loading orientation, PCNA determines the strand direction of MutLα incision. These results also provide a potential mechanism for activation of mismatch repair on nonreplicating DNA, an effect that may have implications for the somatic phase of triplet repeat expansion. PMID:20713735

  4. Breaking Up Sitting with Light-Intensity Physical Activity: Implications for Shift-Workers

    Science.gov (United States)

    Jay, Sarah M.; Vandelanotte, Corneel; Ferguson, Sally A.

    2017-01-01

    Prolonged sitting, restricted sleep, and circadian disruption are all independent risk factors for non-communicable diseases. Previous research has demonstrated that breaking up sitting with light-intensity physical activity has clear benefits for the health of day workers, but these findings may not apply in the presence of sleep restriction and/or circadian disruption—both of which are commonly experienced by shift-workers. Specifically, sleep restriction, and circadian disruption result in acute physiological changes that may offset the benefits of breaking up sitting. This commentary will explore the potential benefits of breaking up sitting for health, work performance, and subsequent sleep in shift-workers. Future areas of research designed to understand the mechanisms by which prolonged sitting and shift work impact worker health and safety and to support the design of effective occupational health and safety interventions are proposed. PMID:29035315

  5. Breaking Up Sitting with Light-Intensity Physical Activity: Implications for Shift-Workers

    Directory of Open Access Journals (Sweden)

    Grace E. Vincent

    2017-10-01

    Full Text Available Prolonged sitting, restricted sleep, and circadian disruption are all independent risk factors for non-communicable diseases. Previous research has demonstrated that breaking up sitting with light-intensity physical activity has clear benefits for the health of day workers, but these findings may not apply in the presence of sleep restriction and/or circadian disruption—both of which are commonly experienced by shift-workers. Specifically, sleep restriction, and circadian disruption result in acute physiological changes that may offset the benefits of breaking up sitting. This commentary will explore the potential benefits of breaking up sitting for health, work performance, and subsequent sleep in shift-workers. Future areas of research designed to understand the mechanisms by which prolonged sitting and shift work impact worker health and safety and to support the design of effective occupational health and safety interventions are proposed.

  6. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

    Energy Technology Data Exchange (ETDEWEB)

    Revaud, D.

    2009-06-15

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  7. RAD50 is required for efficient initiation of resection and recombinational repair at random, gamma-induced double-strand break ends.

    Directory of Open Access Journals (Sweden)

    Jim Westmoreland

    2009-09-01

    Full Text Available Resection of DNA double-strand break (DSB ends is generally considered a critical determinant in pathways of DSB repair and genome stability. Unlike for enzymatically induced site-specific DSBs, little is known about processing of random "dirty-ended" DSBs created by DNA damaging agents such as ionizing radiation. Here we present a novel system for monitoring early events in the repair of random DSBs, based on our finding that single-strand tails generated by resection at the ends of large molecules in budding yeast decreases mobility during pulsed field gel electrophoresis (PFGE. We utilized this "PFGE-shift" to follow the fate of both ends of linear molecules generated by a single random DSB in circular chromosomes. Within 10 min after gamma-irradiation of G2/M arrested WT cells, there is a near-synchronous PFGE-shift of the linearized circular molecules, corresponding to resection of a few hundred bases. Resection at the radiation-induced DSBs continues so that by the time of significant repair of DSBs at 1 hr there is about 1-2 kb resection per DSB end. The PFGE-shift is comparable in WT and recombination-defective rad52 and rad51 strains but somewhat delayed in exo1 mutants. However, in rad50 and mre11 null mutants the initiation and generation of resected ends at radiation-induced DSB ends is greatly reduced in G2/M. Thus, the Rad50/Mre11/Xrs2 complex is responsible for rapid processing of most damaged ends into substrates that subsequently undergo recombinational repair. A similar requirement was found for RAD50 in asynchronously growing cells. Among the few molecules exhibiting shift in the rad50 mutant, the residual resection is consistent with resection at only one of the DSB ends. Surprisingly, within 1 hr after irradiation, double-length linear molecules are detected in the WT and rad50, but not in rad52, strains that are likely due to crossovers that are largely resection- and RAD50-independent.

  8. Vaginal pressure during daily activities before and after vaginal repair

    DEFF Research Database (Denmark)

    Mouritsen, L; Hulbaek, M; Brostrøm, S

    2007-01-01

    The objective of the study was to measure vaginal pressure during various daily activities in patients before and after vaginal surgery for pelvic organ prolapse, searching data for evidence-based activity guidelines. Vaginal pressure (VP) was studied in 23 patients during activities such as rest...... was not related to the type of vaginal repair. The results imply that post-operative counselling should concentrate more on treating chronic cough and constipation than restrictions of moderate physical activities.......The objective of the study was to measure vaginal pressure during various daily activities in patients before and after vaginal surgery for pelvic organ prolapse, searching data for evidence-based activity guidelines. Vaginal pressure (VP) was studied in 23 patients during activities such as rest...... and lifting 2 and 5 kg. Lifting in the walking position created a slightly higher VP compared to other lifting techniques, which did not differ. The VP did not increase when lifting 5 kg compared to 2 kg. Mean VP during coughing and Valsalva were significantly lower 1-5 days after the operation. VP...

  9. The requirement for recombination factors differs considerably between different pathways of homologous double-strand break repair in somatic plant cells.

    Science.gov (United States)

    Roth, Nadine; Klimesch, Jacqueline; Dukowic-Schulze, Stefanie; Pacher, Michael; Mannuss, Anja; Puchta, Holger

    2012-12-01

    In recent years, multiple factors involved in DNA double-strand break (DSB) repair have been characterised in Arabidopsis thaliana. Using homologous sequences in somatic cells, DSBs are mainly repaired by two different pathways: synthesis-dependent strand annealing (SDSA) and single-strand annealing (SSA). By applying recombination substrates in which recombination is initiated by the induction of a site-specific DSB by the homing endonuclease I-SceI, we were able to characterise the involvement of different factors in both pathways. The nucleases MRE11 and COM1, both involved in DSB end processing, were not required for either SDSA or SSA in our assay system. Both SDSA and SSA were even more efficient without MRE11, in accordance with the fact that a loss of MRE11 might negatively affect the efficiency of non-homologous end joining. Loss of the classical recombinase RAD51 or its two paralogues RAD51C and XRCC3, as well as the SWI2/SNF2 remodelling factor RAD54, resulted in a drastic deficiency in SDSA but had hardly any influence on SSA, confirming that a strand exchange reaction is only required for SDSA. The helicase FANCM, which is postulated to be involved in the stabilisation of recombination intermediates, is surprisingly not only needed for SDSA but to a lesser extent also for SSA. Both SSA and SDSA were affected only weakly when the SMC6B protein, implicated in sister chromatid recombination, was absent, indicating that SSA and SDSA are in most cases intrachromatid recombination reactions. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  10. U. V. induces long-lived DNA breaks in Cockayne's syndrome and cells from an immunodeficient individual (46BR): defects and disturbance in post incision steps of excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Squires, S.; Johnson, R.T.

    1983-01-01

    In normal cells exposed to low U.V. doses the several enzymic steps of the excision repair process are closely coupled with the result that DNA gaps are transient and present at such low frequency that it is very difficult to detect them. Cells from a U.V.-sensitive human genetic disorder, Cockayne's Syndrome (CS) and from an immunodeficient individual 46BR, have been examined with respect to their incision capacity after U.V. in the presence and absence of inhibitors of DNA synthesis. We have measured the initial rates of DNA break accumulation in the presence of hydroxyurea and 1-beta-D arabinofuranosylcytosine and find that in both these groups the rate is only slightly lower than in normal cells. However, there is a marked difference between U.V. sensitive cells and normal in the accumulation of long-lived DNA breaks in the absence of inhibitors. While in normal cells practically no breaks could be detected, the U.V. sensitive cells accumulated significant numbers of DNA breaks within 15 min of incubation; 46BR cells showed almost the same level of DNA breaks without the inhibitors as with them. In CS break accumulation can be detected in the absence of inhibitors for only a short time after irradiation (approximately 30 min), but less so when deoxyribonucleosides are provided. The spontaneous break accumulation is related to the time elapsed since proteolytic detachment of the cells from monolayer; 24 h after replating CS breaks no longer accumulate in response to U.V. 46BR cells, on the other hand, accumulate breaks even 1 day after replating and express unligated gaps 2 h after irradiation with a relatively low U.V. dose such as 4 Jm-2. Provision of DNA precursors does not greatly reduce break accumulation. The extremely slow rate of gap sealing in 46BR cells is consistent with the hypothesis that a ligase defect is expressed in these cells.

  11. Effects of physical activity and breaks on mathematics engagement in adolescents.

    Science.gov (United States)

    Owen, Katherine B; Parker, Philip D; Astell-Burt, Thomas; Lonsdale, Chris

    2018-01-01

    The purpose of this study was to determine whether physical activity has a positive relationship with school engagement regardless of the presence or absence of a recess or lunch break before the classroom lesson. Data were collected over three ten-week periods: January-April 2014 (Time 1), October-December 2014 (Time 2), and April-June 2015 (Time 3). A cohort of 2194 adolescents (mean age=13.40years, SD=.73) wore an accelerometer during the hour before a mathematics lesson and completed a questionnaire following the mathematics lesson to assess school engagement in that lesson. Linear mixed models indicated that moderate-intensity activity before a mathematics lesson had a positive linear relationship with cognitive engagement (β=.40, pengagement (β=-.18, pengagement. Educators should be aware that students tend to demonstrate the lowest levels of school engagement after recess breaks. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  12. In vitro Antiglycation and Cross-Link Breaking Activities of Sri ...

    African Journals Online (AJOL)

    Purpose: To investigate the antiglycation and cross-link breaking activities of Sri Lankan low-grown orthodox Orange Pekoe grade black tea (Camellia sinensis L) Methods: Five concentrations (6.25, 12.5, 25.0, 50.0 or 100.0 ìg/ml) of Black tea brew (BTB) were made using Sri Lankan low-grown Orange Pekoe (O.P.) grade ...

  13. Bypass of a 5′,8-cyclopurine-2′-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks

    Science.gov (United States)

    Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E.; Terzidis, Michael A.; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan

    2015-01-01

    5′,8-cyclopurine-2′-deoxynucleosides including 5′,8-cyclo-dA (cdA) and 5′,8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5′,8-cyclopurine-2′-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5′R-cdA, but inefficiently bypassed a 5′S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5′,8-cyclopurine-2′-deoxynucleoside. Moreover, we found that bypass of a 5′S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5′,8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. PMID:26123757

  14. The MRT-1 nuclease is required for DNA crosslink repair and telomerase activity in vivo in Caenorhabditis elegans.

    Science.gov (United States)

    Meier, Bettina; Barber, Louise J; Liu, Yan; Shtessel, Ludmila; Boulton, Simon J; Gartner, Anton; Ahmed, Shawn

    2009-11-18

    The telomerase reverse transcriptase adds de novo DNA repeats to chromosome termini. Here we define Caenorhabditis elegans MRT-1 as a novel factor required for telomerase-mediated telomere replication and the DNA-damage response. MRT-1 is composed of an N-terminal domain homologous to the second OB-fold of POT1 telomere-binding proteins and a C-terminal SNM1 family nuclease domain, which confer single-strand DNA-binding and processive 3'-to-5' exonuclease activity, respectively. Furthermore, telomerase activity in vivo depends on a functional MRT-1 OB-fold. We show that MRT-1 acts in the same telomere replication pathway as telomerase and the 9-1-1 DNA-damage response complex. MRT-1 is dispensable for DNA double-strand break repair, but functions with the 9-1-1 complex to promote DNA interstrand cross-link (ICL) repair. Our data reveal MRT-1 as a dual-domain protein required for telomerase function and ICL repair, which raises the possibility that telomeres and ICL lesions may share a common feature that plays a critical role in de novo telomere repeat addition.

  15. 3'-phosphodiesterase and 3'-->5' exonuclease activities of yeast Apn2 protein and requirement of these activities for repair of oxidative DNA damage.

    Science.gov (United States)

    Unk, I; Haracska, L; Prakash, S; Prakash, L

    2001-03-01

    In Saccharomyces cerevisiae, the AP endonucleases encoded by the APN1 and APN2 genes provide alternate pathways for the removal of abasic sites. Oxidative DNA-damaging agents, such as H(2)O(2), produce DNA strand breaks which contain 3'-phosphate or 3'-phosphoglycolate termini. Such 3' termini are inhibitory to synthesis by DNA polymerases. Here, we show that purified yeast Apn2 protein contains 3'-phosphodiesterase and 3'-->5' exonuclease activities, and mutation of the active-site residue Glu59 to Ala in Apn2 inactivates both these activities. Consistent with these biochemical observations, genetic studies indicate the involvement of APN2 in the repair of H(2)O(2)-induced DNA damage in a pathway alternate to APN1, and the Ala59 mutation inactivates this function of Apn2. From these results, we conclude that the ability of Apn2 to remove 3'-end groups from DNA is paramount for the repair of strand breaks arising from the reaction of DNA with reactive oxygen species.

  16. Repair of some active genes in Cockayne syndrome cells is at the genome overall rate.

    Science.gov (United States)

    Kantor, G J; Bastin, S A

    1995-05-01

    Repair of UV (254 nm)-induced DNA damage in cells from patients with the genetic disease Cockayne syndrome (CS; CS3BE, CS2BE) has been examined in several different genomic regions. These regions include those that contain the actively transcribed beta-actin and adenosine deaminase (ADA) genes and the inactive insulin and 754 loci. The beta-actin, ADA and insulin regions are repaired at about the same rate, one which is equal to the genome overall repair rate. The 754 locus is repaired considerably more slowly. The insulin region is repaired at the same rate in both CS and normal cells as is the 754 locus. The only difference from normal is that the active genes, while repaired well, are not preferentially repaired relative to the genome overall. Our results are consistent with the hypothesis that the repair defect in CS is due to an inactive transcription-repair coupling factor (TRCF). However, the results also indicate that factors other than TRCF and active transcription must also promote repair of some regions relative to others in both normal and CS cells.

  17. Spontaneous mirror-symmetry breaking induces inverse energy cascade in 3D active fluids

    CERN Document Server

    Słomka, Jonasz

    2016-01-01

    Classical turbulence theory assumes that energy transport in a 3D turbulent flow proceeds through a Richardson cascade whereby larger vortices successively decay into smaller ones. By contrast, an additional inverse cascade characterized by vortex-mergers exists in 2D fluids and gases, with profound implications for meteorological flows and fluid mixing. The possibility of a helicity-driven inverse cascade in 3D fluids had been rejected in the 1970s based on equilibrium-thermodynamic arguments. Recently, however, it was proposed that certain symmetry breaking processes could potentially trigger a 3D inverse cascade, but no physical system exhibiting this phenomenon has been identified to date. Here, we present direct analytical and numerical evidence for the existence of a robust inverse energy cascade in an experimentally validated 3D active fluid model, describing microbial suspension flows that spontaneously break mirror-symmetry. We show analytically that self-organized scale selection, a generic feature ...

  18. Mutagenicity of 2-amino-3-methylimidazo[4,5-f]quinoline in colon and liver of Big Blue rats: role of DNA adducts, strand breaks, DNA repair and oxidative stress

    DEFF Research Database (Denmark)

    Moller, P.; Wallin, H.; Vogel, U.

    2002-01-01

    weeks. There were dose-response relationships of DNA adducts (P-32-postlabeling) and DNA strand breaks (comet assay) in colon and liver tissues, with the highest levels of DNA adducts and strand breaks in the colon. There was dose-dependent induction of mutations in both the colon and the liver...... and colon. A lower frequency of mutations in the colon than in the liver could be related to higher expression of DNA repair enzymes in the former.......The contribution of oxidative stress, different types of DNA damage and expression of DNA repair enzymes in colon and liver mutagenesis induced by 2-amino-3-methylimidazo [4,5-f]quinoline (IQ) was investigated in four groups of six Big Blue rats fed diets with 0, 20, 70, and 200 mg IQ/kg for 3...

  19. Developing model-making and model-breaking skills using direct measurement video-based activities

    Science.gov (United States)

    Vonk, Matthew; Bohacek, Peter; Militello, Cheryl; Iverson, Ellen

    2017-12-01

    This study focuses on student development of two important laboratory skills in the context of introductory college-level physics. The first skill, which we call model making, is the ability to analyze a phenomenon in a way that produces a quantitative multimodal model. The second skill, which we call model breaking, is the ability to critically evaluate if the behavior of a system is consistent with a given model. This study involved 116 introductory physics students in four different sections, each taught by a different instructor. All of the students within a given class section participated in the same instruction (including labs) with the exception of five activities performed throughout the semester. For those five activities, each class section was split into two groups; one group was scaffolded to focus on model-making skills and the other was scaffolded to focus on model-breaking skills. Both conditions involved direct measurement videos. In some cases, students could vary important experimental parameters within the video like mass, frequency, and tension. Data collected at the end of the semester indicate that students in the model-making treatment group significantly outperformed the other group on the model-making skill despite the fact that both groups shared a common physical lab experience. Likewise, the model-breaking treatment group significantly outperformed the other group on the model-breaking skill. This is important because it shows that direct measurement video-based instruction can help students acquire science-process skills, which are critical for scientists, and which are a key part of current science education approaches such as the Next Generation Science Standards and the Advanced Placement Physics 1 course.

  20. Nuclear translocation contributes to regulation of DNA excision repair activities

    DEFF Research Database (Denmark)

    Knudsen, Nina Østergaard; Andersen, Sofie Dabros; Lützen, Anne

    2009-01-01

    .T. Tomicic, W.P. Roos, B. Kaina, Mechanisms of human DNA repair: an update, Toxicology 193 (2003) 3-34; N.B. Larsen, M. Rasmussen, L.J. Rasmussen, Nuclear and mitochondrial DNA repair: similar pathways? Mitochondrion 5 (2005) 89-108]. Protein interactions are not only important for function, but also...

  1. Classroom-Based Physical Activity Breaks and Children's Attention: Cognitive Engagement Works!

    Science.gov (United States)

    Schmidt, Mirko; Benzing, Valentin; Kamer, Mario

    2016-01-01

    Classroom-based physical activity breaks are postulated to positively impact children's attention during their school day. However, empirical evidence for this claim is scarce and the role of cognitive engagement in enhancing children's attentional performance is unexplored in studies on physical activity breaks. The aim of the present study was therefore to disentangle the separate and/or combined effects of physical exertion and cognitive engagement induced by physical activity breaks on primary school children's attention. In addition, the role of children's affective reactions to acute interventions at school was investigated. Using a 2 × 2 between-subjects experimental design, 92 children between the ages of 11 and 12 years (M = 11.77, SD = 0.41) were randomly assigned to one of four experimental conditions: (1) combo group (physical activity with high cognitive demands), (2) cognition group (sedentary with high cognitive demands), (3) physical group (physical activity with low cognitive demands), and (4) control group (sedentary with low cognitive demands). Attention and affect were measured before and immediately after a 10-min intervention. ANCOVAs revealed that whereas physical exertion had no effect on any measure of children's attentional performance, cognitive engagement was the crucial factor leading to increased focused attention and enhanced processing speed. Mediational analyses showed that changes in positive affect during the interventions mediated the effect between cognitive engagement and focused attention as well as between cognitive engagement and processing speed. These surprising results are discussed in the light of theories predicting both facilitating and deteriorative effects of positive affect on attention.

  2. In normal human fibroblasts variation in DSB repair capacity cannot be ascribed to radiation-induced changes in the localisation, expression or activity of major NHEJ proteins

    DEFF Research Database (Denmark)

    Kasten-Pisula, Ulla; Vronskaja, Svetlana; Overgaard, Jens

    2008-01-01

    BACKGROUND AND PURPOSE: The aim of the present study was to test whether for normal human fibroblasts the variation in double-strand break (DSB) repair capacity results from radiation-induced differences in localisation, expression or activity of major non-homologous end-joining (NHEJ) proteins....... MATERIALS AND METHODS: Experiments were performed with 11 normal human fibroblast strains AF01-11. NHEJ proteins were determined by Western blot and DNA-PK activity by pulldown-assay. RESULTS: The four NHEJ proteins tested (Ku70, Ku80, XRCC4 and DNA-PKcs) were found to be localised almost exclusively......) did not alter the expression of these proteins and there was also no change in the DNA-PK activity. These results indicate that the variation in DSB repair capacity determined for these fibroblasts can be ascribed to differences neither in the localisation or expression of Ku70, Ku80 and XRCC4 nor...

  3. SELECTIVE-INHIBITION OF REPAIR OF ACTIVE GENES BY HYPERTHERMIA IS DUE TO INHIBITION OF GLOBAL AND TRANSCRIPTION COUPLED REPAIR PATHWAYS

    NARCIS (Netherlands)

    SAKKERS, RJ; FILON, AR; BRUNSTING, JF; KAMPINGA, HH; KONINGS, AWT; MULLENDERS, LHF

    Hyperthermia specifically inhibits the repair of UV-induced DNA photolesions in transcriptionally active genes, To define more precisely which mechanisms underlie the heat-induced inhibition of repair of active genes, removal of cyclobutane pyrimidine dimers (CPDs) was studied in human fibroblasts

  4. Regional Heat Sources and the Active and Break Phases of Boreal Summer Intraseasonal Variability

    Energy Technology Data Exchange (ETDEWEB)

    Annamalai, H; Sperber, K R

    2003-12-15

    The boreal summer intraseasonal variability (BSISV) associated with the 30-50 day mode is represented by the co-existence of three components, poleward propagation of convection over the Indian and tropical west Pacific longitudes and eastward propagation along the equator. The hypothesis that the three components influence each other has been investigated using observed OLR, NCEP-NCAR reanalysis, and solutions from an idealized linear model. The null hypothesis is that the three components are mutually independent. Cyclostationary EOF (CsEOF) analysis is applied on filtered OLR to extract the life-cycle of the BSISV. The dominant mode of CsEOF is significantly tied to observed rainfall over the Indian subcontinent. The components of the heating patterns from CsEOF analysis serve as prescribed forcings for the linear model. This allows us to ascertain which heat sources and sinks are instrumental in driving the large-scale monsoon circulation during the BSISV life-cycle. We identify three new findings: (1) the circulation anomalies that develop as a Rossby wave response to suppressed convection over the equatorial Indian Ocean associated with the previous break phase of the BSISV precondition the ocean-atmosphere system in the western Indian Ocean and trigger the next active phase of the BSISV, (2) the development of convection over the tropical west Pacific forces descent anomalies to the west. This, in conjunction with the weakened cross-equatorial flow due to suppressed convective anomalies over the equatorial Indian Ocean reduce the tropospheric moisture over the Arabian Sea, and promote westerly wind anomalies that do not recurve over India. As a result the low-level cyclonic vorticity shifts from India to southeast Asia and break conditions are initiated over India, and (3) the circulation anomalies forced by equatorial Indian Ocean convective anomalies significantly influence the active/break phases over the tropical west Pacific. Our model solutions support

  5. Pain during sexual activity before and after laparoscopic inguinal hernia repair

    DEFF Research Database (Denmark)

    Tolver, Mette A; Rosenberg, Jacob

    2015-01-01

    BACKGROUND: Sexual life may be impaired by pain during sexual activity in patients with inguinal hernia. On the other hand, inguinal hernia repair has also been reported to cause sexual dysfunction in terms of pain during sexual activity and ejaculation. The primary aim of this study...... was to estimate the prevalence of pain during sexual activity before and after laparoscopic inguinal hernia repair, and the secondary, to describe pain location, frequency of pain during sexual activity, and to which degree sexual life was affected by the pain. Furthermore, to examine whether preoperative pain...... during sexual activity was a risk factor for postoperative pain during sexual activity. METHODS: A prospective questionnaire study before and 6 months after hernia repair was conducted. Men (age 18-85 years) undergoing laparoscopic inguinal hernia repair were included. RESULTS: In total, 160 men were...

  6. Merlin controls the repair capacity of Schwann cells after injury by regulating Hippo/YAP activity.

    Science.gov (United States)

    Mindos, Thomas; Dun, Xin-Peng; North, Katherine; Doddrell, Robin D S; Schulz, Alexander; Edwards, Philip; Russell, James; Gray, Bethany; Roberts, Sheridan L; Shivane, Aditya; Mortimer, Georgina; Pirie, Melissa; Zhang, Nailing; Pan, Duojia; Morrison, Helen; Parkinson, David B

    2017-02-01

    Loss of the Merlin tumor suppressor and activation of the Hippo signaling pathway play major roles in the control of cell proliferation and tumorigenesis. We have identified completely novel roles for Merlin and the Hippo pathway effector Yes-associated protein (YAP) in the control of Schwann cell (SC) plasticity and peripheral nerve repair after injury. Injury to the peripheral nervous system (PNS) causes a dramatic shift in SC molecular phenotype and the generation of repair-competent SCs, which direct functional repair. We find that loss of Merlin in these cells causes a catastrophic failure of axonal regeneration and remyelination in the PNS. This effect is mediated by activation of YAP expression in Merlin-null SCs, and loss of YAP restores axonal regrowth and functional repair. This work identifies new mechanisms that control the regenerative potential of SCs and gives new insight into understanding the correct control of functional nerve repair in the PNS. © 2017 Mindos et al.

  7. Monitoring regulation of DNA repair activities of cultured cells in-gel using the comet assay.

    Science.gov (United States)

    Nickson, Catherine M; Parsons, Jason L

    2014-01-01

    Base excision repair (BER) is the predominant cellular mechanism by which human cells repair DNA base damage, sites of base loss, and DNA single strand breaks of various complexity, that are generated in their thousands in every human cell per day as a consequence of cellular metabolism and exogenous agents, including ionizing radiation. Over the last three decades the comet assay has been employed in scientific research to examine the cellular response to these types of DNA damage in cultured cells, therefore revealing the efficiency and capacity of BER. We have recently pioneered new research demonstrating an important role for post-translational modifications (particularly ubiquitylation) in the regulation of cellular levels of BER proteins, and that subtle changes (∼20-50%) in protein levels following siRNA knockdown of E3 ubiquitin ligases or deubiquitylation enzymes can manifest in significant changes in DNA repair capacity monitored using the comet assay. For example, we have shown that the E3 ubiquitin ligase Mule, the tumor suppressor protein ARF, and the deubiquitylation enzyme USP47 modulate DNA repair by controlling cellular levels of DNA polymerase β, and also that polynucleotide kinase phosphatase levels are controlled by ATM-dependant phosphorylation and Cul4A-DDB1-STRAP-dependent ubiquitylation. In these studies we employed a modification of the comet assay whereby cultured cells, following DNA damage treatment, are embedded in agarose and allowed to repair in-gel prior to lysis and electrophoresis. Whilst this method does have its limitations, it avoids the extensive cell culture-based processing associated with the traditional approach using attached cells and also allows for the examination of much more precise DNA repair kinetics. In this review we will describe, using this modified comet assay, our accumulating evidence that ubiquitylation-dependant regulation of BER proteins has important consequences for overall cellular DNA repair

  8. Monitoring regulation of DNA repair activities of cultured cells in-gel using the comet assay

    Directory of Open Access Journals (Sweden)

    Jason Luke Parsons

    2014-07-01

    Full Text Available Base excision repair (BER is the predominant cellular mechanism by which human cells repair DNA base damage, sites of base loss and DNA single strand breaks of various complexity, that are generated in their thousands in every human cell per day as a consequence of cellular metabolism and exogenous agents, including ionising radiation. Over the last three decades the comet assay has been employed in scientific research to examine the cellular response to these types of DNA damage in cultured cells, therefore revealing the efficiency and capacity of BER. We have recently pioneered new research demonstrating an important role for post-translational modifications (particularly ubiquitylation in the regulation of cellular levels of BER proteins, and that subtle changes (~20-50 % in protein levels following siRNA knockdown of E3 ubiquitin ligases or deubiquitylation enzymes can manifest in significant changes in DNA repair capacity monitored using the comet assay. For example, we have shown that the E3 ubiquitin ligase Mule, the tumour suppressor protein ARF and the deubiquitylation enzyme USP47 modulate DNA repair by controlling cellular levels of DNA polymerase β, and also that polynucleotide kinase phosphatase levels are controlled by ATM-dependant phosphorylation and Cul4A-DDB1-STRAP-dependent ubiquitylation. In these studies we employed a modification of the comet assay whereby cultured cells, following DNA damage treatment, are embedded in agarose and allowed to repair in-gel prior to lysis and electrophoresis. Whilst this method does have its limitations, it avoids the extensive cell culture-based processing associated with the traditional approach using attached cells and also allows for the examination of much more precise DNA repair kinetics. In this review we will describe, using this modified comet assay, our accumulating evidence that ubiquitylation-dependant regulation of BER proteins has important consequences for overall cellular DNA

  9. P-glycoprotein attenuates DNA repair activity in multidrug-resistant cells by acting through the Cbp-Csk-Src cascade.

    Science.gov (United States)

    Lin, Li-Fang; Wu, Ming-Hsi; Pidugu, Vijaya Kumar; Ho, I-Ching; Su, Tsann-Long; Lee, Te-Chang

    2017-07-11

    Recent studies have demonstrated that P-glycoprotein (P-gp) expression impairs DNA interstrand cross-linking agent-induced DNA repair efficiency in multidrug-resistant (MDR) cells. To date, the detailed molecular mechanisms underlying how P-gp interferes with Src activation and subsequent DNA repair activity remain unclear. In this study, we determined that the C-terminal Src kinase-binding protein (Cbp) signaling pathway involved in the negative control of Src activation is enhanced in MDR cells. We also demonstrated that cells that ectopically express P-gp exhibit reduced activation of DNA damage response regulators, such as ATM, Chk2, Braca1 and Nbs1 and hence attenuated DNA double-strand break repair capacity and become more susceptible than vector control cells to DNA interstrand cross-linking (ICL) agents. Moreover, we demonstrated that P-gp can not only interact with Cbp and Src but also enhance the formation of inhibitory C-terminal Src kinase (Csk)-Cbp complexes that reduce phosphorylation of the Src activation residue Y416 and increase phosphorylation of the Src negative regulatory residue Y527. Notably, suppression of Cbp expression in MDR cells restores cisplatin-induced Src activation, improves DNA repair capacity, and increases resistance to ICL agents. Ectopic expression of Cbp attenuates cisplatin-induced Src activation and increases the susceptibility of cells to ICL agents. Together, the current results indicate that P-gp inhibits DNA repair activity by modulating Src activation via Cbp-Csk-Src cascade. These results suggest that DNA ICL agents are likely to have therapeutic potential against MDR cells with P-gp-overexpression.

  10. Poly(ADP-ribose) polymerase 1 regulates activity of DNA polymerase {beta} in long patch base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Sukhanova, Maria; Khodyreva, Svetlana [Institute of Chemical Biology and Fundamental Medicine SB RAS, Novosibirsk (Russian Federation); Lavrik, Olga, E-mail: lavrik@niboch.nsc.ru [Institute of Chemical Biology and Fundamental Medicine SB RAS, Novosibirsk (Russian Federation)

    2010-03-01

    Poly(ADP-ribose)polymerase 1 (PARP1), functioning as DNA nick-sensor, interacts with base excision repair (BER) DNA intermediates containing single-strand breaks. When bound to DNA breaks, PARP1 catalyzes synthesis of poly(ADP-ribose) covalently attached to itself and some nuclear proteins. Autopoly(ADP-ribosyl)ation of PARP1 facilitates its dissociation from DNA breaks and is considered as a factor regulating DNA repair. In the study, using system reconstituted from purified BER proteins, bovine testis nuclear extract and model BER DNA intermediates, we examined the influence of PARP1 and its autopoly(ADP-ribosyl)ation on DNA polymerase {beta} (Pol {beta})-mediated long patch (LP) BER DNA synthesis that is accomplished through a cooperation between Pol {beta} and apurinic/apyrimidinic endonuclease1 (APE1) or flap endonuclease 1 (FEN1) and gap-filling activity of Pol {beta}. PARP1 upon interaction with nicked LP BER DNA intermediated, formed after gap-filling, was shown to suppress the subsequent steps in LP pathway. PARP1 interferes with APE1-dependent stimulation of DNA synthesis by Pol {beta} via strand-displacement mechanism. PARP1 also represses Pol {beta}/FEN1-mediated LP BER DNA synthesis via a 'gap translation' mechanism inhibiting FEN1 activity on the nicked DNA intermediate. Poly(ADP-ribosyl)ation of PARP1 abolishes its inhibitory influence on LP BER DNA synthesis catalyzed by Pol {beta} both via APE1-mediated strand-displacement and FEN1-mediated 'gap translation' mechanism. Thus PARP1 may act as a negative regulator of Pol {beta} activity in LP BER pathway and poly(ADP-ribosyl)ation of PARP1 seems to play a critical role in enablement of Pol {beta}-mediated DNA synthesis in this process. In contrast, interaction of PARP1 with one nucleotide gapped DNA mimicking the intermediate of short patch (SP) BER slightly inhibits the gap-filling activity of Pol {beta} and the overall efficiency of SP BER is practically unaffected by PARP1. Thus

  11. UV exposed electronically activated damage and photoreactivation repair

    Science.gov (United States)

    Bohr, Henrik; Malik, Bary

    2007-03-01

    An investigation of the possible physics underlying the damage caused to DNA by UV radiation and its subsequent repair via a photoreactivation mechanism is presented in this study. An electronic pathway starting from the initial damage to the final repair process is proposed. UV radiation is absorbed to create a hole-excited thymine or other pyrimidine that subsequently is responsible for the formation of the thymine dimer. The negative-ion of the cofactor riboflavin, FADH-, formed by the exposure of the photolyase protein to visible light interacts with the hole-excited electronic orbital of the thymine dimer inducing a photon-less Auger transition, which restores the two thymines to the ground state, thereby detaching the lesion and repairing the DNA. Due to energy balance, the process has to involve an electronic excited state (s). The mechanism involves the least amount of energy dissipation and is charge neutral. It also avoids radiation damage in the repair process, that is, is a radiationless process.

  12. Can cognitive activities during breaks in repetitive manual work accelerate recovery from fatigue? A controlled experiment.

    Directory of Open Access Journals (Sweden)

    Svend Erik Mathiassen

    Full Text Available Neurophysiologic theory and some empirical evidence suggest that fatigue caused by physical work may be more effectively recovered during "diverting" periods of cognitive activity than during passive rest; a phenomenon of great interest in working life. We investigated the extent to which development and recovery of fatigue during repeated bouts of an occupationally relevant reaching task was influenced by the difficulty of a cognitive activity between these bouts. Eighteen male volunteers performed three experimental sessions, consisting of six 7-min bouts of reaching alternating with 3 minutes of a memory test differing in difficulty between sessions. Throughout each session, recordings were made of upper trapezius muscle activity using electromyography (EMG, heart rate and heart rate variability (HRV using electrocardiography, arterial blood pressure, and perceived fatigue (Borg CR10 scale and SOFI. A test battery before, immediately after and 1 hour after the work period included measurements of maximal shoulder elevation strength (MVC, pressure pain threshold (PPT over the trapezius muscles, and a submaximal isometric contraction. As expected, perceived fatigue and EMG amplitude increased during the physical work bouts. Recovery did occur between the bouts, but fatigue accumulated throughout the work period. Neither EMG changes nor recovery of perceived fatigue during breaks were influenced by cognitive task difficulty, while heart rate and HRV recovered the most during breaks with the most difficult task. Recovery of perceived fatigue after the 1 hour work period was also most pronounced for the most difficult cognitive condition, while MVC and PPT showed ambiguous patterns, and EMG recovered similarly after all three cognitive protocols. Thus, we could confirm that cognitive tasks between bouts of fatiguing physical work can, indeed, accelerate recovery of some factors associated with fatigue, even if benefits may be moderate and some

  13. Break-induced ATR and Ddb1-Cul4(Cdt)² ubiquitin ligase-dependent nucleotide synthesis promotes homologous recombination repair in fission yeast

    DEFF Research Database (Denmark)

    Moss, Jennifer; Tinline-Purvis, Helen; Walker, Carol A

    2010-01-01

    Nucleotide synthesis is a universal response to DNA damage, but how this response facilitates DNA repair and cell survival is unclear. Here we establish a role for DNA damage-induced nucleotide synthesis in homologous recombination (HR) repair in fission yeast. Using a genetic screen, we found...

  14. De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks

    KAUST Repository

    Mahfouz, Magdy M.

    2011-01-24

    Site-specific and rare cutting nucleases are valuable tools for genome engineering. The generation of double-strand DNA breaks (DSBs) promotes homologous recombination in eukaryotes and can facilitate gene targeting, additions, deletions, and inactivation. Zinc finger nucleases have been used to generate DSBs and subsequently, for genome editing but with low efficiency and reproducibility. The transcription activator-like family of type III effectors (TALEs) contains a central domain of tandem repeats that could be engineered to bind specific DNA targets. Here, we report the generation of a Hax3-based hybrid TALE nuclease with a user-selected DNA binding specificity. We show that the engineered TALE nuclease can bind to its target sequence in vitro and that the homodimeric TALE nuclease can cleave double-stranded DNA in vitro if the DNA binding sites have the proper spacing and orientation. Transient expression assays in tobacco leaves suggest that the hybrid nuclease creates DSB in its target sequence, which is subsequently repaired by nonhomologous end-joining repair. Taken together, our data show the feasibility of engineering TALE-based hybrid nucleases capable of generating site-specific DSBs and the great potential for site-specific genome modification in plants and eukaryotes in general.

  15. Evidence based on studies of the mus309 mutant, deficient in DNA double-strand break repair, that meiotic crossing over in Drosophila melanogaster is a two-phase process.

    Science.gov (United States)

    Portin, Petter

    2010-10-01

    The mus309 gene in Drosophila melanogaster encodes a RecQ helicase which is involved in DNA double-strand break (DSB) repair and specifically in the choice between the different pathways of the repair. In a brood pattern analysis of mus309 and wild type females which either had or had not experienced a temperature shock, different parameters of meiotic crossing over including map distances and crossover interference in the X chromosome were measured. The results suggest that, like in other eukaryotes studied, the control of meiotic crossover formation also in D. melanogaster is a two-phase process. The first phase seems to be temperature shock sensitive, independent of the mus309 gene and coincidental with the premeiotic DNA synthesis, thus most likely representing the formation of DSBs. The second phase seems to be temperature shock tolerant, dependent on the mus309 gene, occurring during the meiotic prophase and most likely representing the choice made by the oocyte between the different pathways of the DSB repair. A hypothesis of the localization of chiasmata is also presented, combining the mechanisms of interference and the so-called centromere effect, and based on the balance between the SDSA and DSBR pathways of DSB repair.

  16. The Break

    DEFF Research Database (Denmark)

    Strand, Anete Mikkala Camille; Larsen, Jens

    2015-01-01

    that language and the social has been granted too much power on the dispense of the bodily, physical and biological – or in short, in dispense of the material. The break To be or not to be poses the theoretical notion of dis-/continuity (Barad, 2007, 2010) from the quantum approach to storytelling (Strand 2012...... and euro each year. The paper tries to explore new ways to deal with these challenges through a quantum approach to storytelling where the enactment of core values, bodies, spaces and artifacts positions managers and CEO’s from major Scandinavian organizations in sites where they can re-evaluate their life...... stones on a table in an office of a municipality in Denmark. Silence….. Rebuilding rooms for taking breaks with the inclusion of different activities such as a game of soccer or a hike seems to provide the tools to rework these imbalances or enslaving patterns. Break……. The attempt at meeting...

  17. Coordinated sensing and active repair for self-healing

    Science.gov (United States)

    Hurley, D. A.; Huston, D. R.

    2011-02-01

    Self-repairing structural systems have the potential for improved performance ranges and lifetimes over conventional systems. Self-healing materials are not a new phenomenon and have been used in automotive and aeronautical applications for over a century. The bulk of these systems operate by using damage to directly initiate a repair response without any supervisory coordination. Integrating sensing and supervisory control technologies with self-healing may improve the safety and reliability of critical components and structures. This project illustrates the benefit of an integrated sensing, control, and self-healing system using laboratory scale test beds. A thermoplastic polymer embedded with resistive heating wires acts as the self-healing material. Damage is detected using an electro-optical sensing scheme based on photoresistors and a PC handling control duties. As damage occurs it is detected, located, and characterized. The key to this project is the integration of sensor feedback to control healing so that repairs are executed, monitored, and completed on the basis of continuous sensor data. This proof-of-concept prototype can likely be expanded and improved with alternative sensor options, self-healing materials, and system architecture.

  18. Does a Higher Incidence of Break Times in Primary Schools Result in Children Being More Physically Active?

    Science.gov (United States)

    Kobel, Susanne; Kettner, Sarah; Erkelenz, Nanette; Kesztyüs, Dorothea; Steinacker, Jürgen M.

    2015-01-01

    Background: Regular physical activity (PA) has multiple benefits to health; however, the majority of schoolchildren do not reach PA guidelines of 60 minutes of moderate to vigorous PA (MVPA) daily. During the school day, break times are often the only opportunity for children to be physically active. This study investigated PA levels during school…

  19. Numerical analysis of piezoelectric active repair in the presence of frictional contact conditions.

    Science.gov (United States)

    Alaimo, Andrea; Milazzo, Alberto; Orlando, Calogero; Messineo, Antonio

    2013-04-02

    The increasing development of smart materials, such as piezoelectric and shape memory alloys, has opened new opportunities for improving repair techniques. Particularly, active repairs, based on the converse piezoelectric effect, can increase the life of a structure by reducing the crack opening. A deep characterization of the electromechanical behavior of delaminated composite structures, actively repaired by piezoelectric patches, can be achieved by considering the adhesive layer between the host structure and the repair and by taking into account the frictional contact between the crack surfaces. In this paper, Boundary Element (BE) analyses performed on delaminated composite structures repaired by active piezoelectric patches are presented. A two-dimensional boundary integral formulation for piezoelectric solids based on the multi-domain technique to model the composite host damaged structures and the bonded piezoelectric patches is employed. An interface spring model is also implemented to take into account the finite stiffness of the bonding layers and to model the frictional contact between the delamination surfaces, by means of an iterative procedure. The effect of the adhesive between the plies of piezoelectric bimorph devices on the electromechanical response is first pointed out for both sensing and actuating behavior. Then, the effect of the frictional contact condition on the fracture mechanics behavior of actively repaired delaminated composite structures is investigated.

  20. Associations between social ecological factors and self-reported short physical activity breaks during work hours among desk-based employees.

    Science.gov (United States)

    Bennie, Jason A; Timperio, Anna F; Crawford, David A; Dunstan, David W; Salmon, Jo L

    2011-01-01

    To examine the associations between potential social ecological correlates and self-reported short physical activity breaks during work hours (defined as any interruption in sitting time during a typical work hour) among a sample of employees who commonly sit for working tasks. 801 employed adults aged 18-70 years from metropolitan Melbourne, Australia were surveyed in 2009 about their short physical activity breaks from sitting during work hours and potential social ecological correlates of this behaviour. Men reported significantly more short physical activity breaks per work hour than did women (2.5 vs. 2.3 breaks/h, p=0.02). A multivariable linear regression analysis adjusting for clustering and meeting the public health physical activity recommendations showed that the factors associated with frequency of short physical activity breaks per work hour were perceptions of lack of time for short physical activity breaks for men (-0.31 breaks/h, 95% confidence intervals [CI] -0.52, -0.09) and lack of information about taking short physical activity breaks for women (-0.20 breaks/h, CI -0.47, -0.05). These findings suggest that providing male employees with support for short physical activity breaks during work hours, and female employees with information on benefits of this behaviour may be useful for reducing workplace sedentary time. Crown Copyright © 2011. Published by Elsevier Inc. All rights reserved.

  1. 75 FR 51808 - Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied...

    Science.gov (United States)

    2010-08-23

    ...-9] Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied... for renovation, repair and painting programs in accordance with section 402(c)(3) of TSCA, 15 U.S.C... CFR 745.324(d)(2), to administer and enforce requirements for a renovation, repair and painting...

  2. 75 FR 13127 - Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied...

    Science.gov (United States)

    2010-03-18

    ... AGENCY Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied... for a renovation, repair and painting program in accordance with section 402(c)(3) of TSCA, 15 U.S.C... administer and enforce requirements for a renovation, repair and painting program in accordance with section...

  3. 76 FR 12106 - Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied...

    Science.gov (United States)

    2011-03-04

    ... AGENCY Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied..., repair and painting program in accordance with section 402(c)(3) of TSCA. This notice also announces that... a renovation, repair and painting program in accordance with section 402(c)(3) of TSCA. This notice...

  4. Breaking the resistance of Escherichia coli: Antimicrobial activity of Berberis lycium Royle.

    Science.gov (United States)

    Malik, Tauseef Ahmad; Kamili, Azra N; Chishti, M Z; Ahad, Shazia; Tantry, Mudasir A; Hussain, P R; Johri, R K

    2017-01-01

    The antimicrobial activity of root bark of Berberis lycium and its principal component berberine was tested against a panel of microbial strains using agar well diffusion test and further analyzed using micro-broth dilution method. Preliminary analysis, on the basis of zone of Inhibition (ZOI) showed that the methanolic extract of B. lycium was highly effective against Escherichia coli (ZOI 41 ± 1 mm). Among the bacterial strains E. coli was found to be most susceptible and among fungi Candida albicans was the most susceptible for berberine as well as the crude methanolic extract of the plant. Methanolic extract of the plant was more effective for E. coli (MIC 1.7 ± 1.18; MBC 2.4 ± 1.18) than berberine (MIC 3.5 ± 0.57) (p E. coli showed the development of resistant colonies after 72 h when tested with berberine but the development of such colonies was not observed with the methanolic extract of the plant. This could be due to the presence of resistance breaking molecules in the crude methanolic extract of B. lycium. Also the MIC index of crude methanolic extract was 1.39 for E. coli, which showed the mode of action to be bactericidal. HPLC analysis revealed the presence of berberine at highest concentration in methanolic extract of the plant, followed by aqueous extract. Potentiation of this berberine by resistance breaking molecules in the crude extract could be a possible explanation for its strong effectiveness. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Laser-activated solder weld repair of the inferior alveolar nerve in rats

    Science.gov (United States)

    Curtis, Nigel J.; Lauto, Antonio; Trickett, Rodney I.; Owen, Earl R.; Walker, D. M.

    1997-05-01

    A new laser activated solder weld technique is described for the microsurgical repair of the inferior alveolar nerve in rats. The laser weld technique used an albumin based solder, containing indocyanine cardiogreen, plus an infrared diode laser. Seven animals had inferior alveolar nerve repairs performed using the laser weld technique and these were compared against corresponding unoperated controls plus three cases of nerve section without repair. Histochemical analysis was performed utilizing neuron counts and horseradish peroxidase tracer (HRP) uptake in the trigeminal ganglion following sacrifice and staining of frozen sections with cresyl violet and diaminobenzidene. The results of this analysis showed comparable mean neuron counts and mean HRP uptake by neurons for the unoperated control and laser weld groups with considerable reduction of mean values in cases of nerve section with no repair. Sections of the repaired inferior alveolar nerves, stained with Masson's trichrome, showed no adverse reactions by axons or epineurium to the coagulative repair with the solder and demonstrated regeneration of myelinated axons at the time of sacrifice. In summary a new technique of laser weld repair of the inferior alveolar nerve is described which, on initial analysis, appears to be a reliable alternative to traditional techniques.

  6. DNA double-strand breaks activate ATM independent of mitochondrial dysfunction in A549 cells.

    Science.gov (United States)

    Kalifa, Lidza; Gewandter, Jennifer S; Staversky, Rhonda J; Sia, Elaine A; Brookes, Paul S; O'Reilly, Michael A

    2014-10-01

    Excessive nuclear or mitochondrial DNA damage can lead to mitochondrial dysfunction, decreased energy production, and increased generation of reactive oxygen species (ROS). Although numerous cell signaling pathways are activated when cells are injured, the ataxia telangiectasia mutant (ATM) protein has emerged as a major regulator of the response to both mitochondrial dysfunction and nuclear DNA double-strand breaks (DSBs). Because mitochondrial dysfunction is often a response to excessive DNA damage, it has been difficult to determine whether nuclear and/or mitochondrial DNA DSBs activate ATM independent of mitochondrial dysfunction. In this study, mitochondrial and nuclear DNA DSBs were generated in the A549 human lung adenocarcinoma cell line by infecting with retroviruses expressing the restriction endonuclease PstI fused to a mitochondrial targeting sequence (MTS) or nuclear localization sequence (NLS) and a hemagglutinin antigen epitope tag (HA). Expression of MTS-PstI-HA or NLS-PstI-HA activated the DNA damage response defined by phosphorylation of ATM, the tumor suppressor protein p53 (TP53), KRAB-associated protein (KAP)-1, and structural maintenance of chromosomes (SMC)-1. Phosphorylated ATM and SMC1 were detected in nuclear fractions, whereas phosphorylated TP53 and KAP1 were detected in both mitochondrial and nuclear fractions. PstI also enhanced expression of the cyclin-dependent kinase inhibitor p21 and inhibited cell growth. This response to DNA damage occurred in the absence of detectable mitochondrial dysfunction and excess production of ROS. These findings reveal that DNA DSBs are sufficient to activate ATM independent of mitochondrial dysfunction and suggest that the activated form of ATM and some of its substrates are restricted to the nuclear compartment, regardless of the site of DNA damage. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Genomic approaches to DNA repair and mutagenesis.

    Science.gov (United States)

    Wyrick, John J; Roberts, Steven A

    2015-12-01

    DNA damage is a constant threat to cells, causing cytotoxicity as well as inducing genetic alterations. The steady-state abundance of DNA lesions in a cell is minimized by a variety of DNA repair mechanisms, including DNA strand break repair, mismatch repair, nucleotide excision repair, base excision repair, and ribonucleotide excision repair. The efficiencies and mechanisms by which these pathways remove damage from chromosomes have been primarily characterized by investigating the processing of lesions at defined genomic loci, among bulk genomic DNA, on episomal DNA constructs, or using in vitro substrates. However, the structure of a chromosome is heterogeneous, consisting of heavily protein-bound heterochromatic regions, open regulatory regions, actively transcribed genes, and even areas of transient single stranded DNA. Consequently, DNA repair pathways function in a much more diverse set of chromosomal contexts than can be readily assessed using previous methods. Recent efforts to develop whole genome maps of DNA damage, repair processes, and even mutations promise to greatly expand our understanding of DNA repair and mutagenesis. Here we review the current efforts to utilize whole genome maps of DNA damage and mutation to understand how different chromosomal contexts affect DNA excision repair pathways. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Macrophage activation and its role in repair and pathology after spinal cord injury.

    Science.gov (United States)

    Gensel, John C; Zhang, Bei

    2015-09-04

    The injured spinal cord does not heal properly. In contrast, tissue repair and functional recovery occur after skin or muscle injuries. The reason for this dichotomy in wound repair is unclear but inflammation, and specifically macrophage activation, likely plays a key role. Macrophages have the ability to promote the repair of injured tissue by regulating transitions through different phase of the healing response. In the current review we compare and contrast the healing and inflammatory responses between spinal cord injuries and tissues that undergo complete wound resolution. Through this comparison, we identify key macrophage phenotypes that are inaptly triggered or absent after spinal cord injury and discuss spinal cord stimuli that contribute to this maladaptive response. Sequential activation of classic, pro-inflammatory, M1 macrophages and alternatively activated, M2a, M2b, and M2c macrophages occurs during normal healing and facilitates transitions through the inflammatory, proliferative, and remodeling phases of repair. In contrast, in the injured spinal cord, pro-inflammatory macrophages potentiate a prolonged inflammatory phase and remodeling is not properly initiated. The desynchronized macrophage activation after spinal cord injury is reminiscent of the inflammation present in chronic, non-healing wounds. By refining the role macrophages play in spinal cord injury repair we bring to light important areas for future neuroinflammation and neurotrauma research. This article is part of a Special Issue entitled SI: Spinal cord injury. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  9. Impairment of sexual activity before and after endoscopic totally extraperitoneal (TEP) hernia repair.

    Science.gov (United States)

    Schouten, N; van Dalen, T; Smakman, N; Clevers, G J; Davids, P H P; Verleisdonk, E J M M; Tekatli, H; Burgmans, J P J

    2012-01-01

    In patients with inguinal hernias, sexual activity may be impaired due to hernia-related pain. Surgical repair may improve these complaints but can also lead to similar symptoms as a long-term complication of the operation. Endoscopic hernia repair is associated with less postoperative pain and earlier return to normal activities, but its effect on pain-related sexual function is unknown. In this study, the incidence and effect of pain related to sexual activity are evaluated before and after endoscopic totally extraperitoneal (TEP) hernia repair. A hospital-based questionnaire study of pain-related sexual dysfunction was conducted in November 2009 in 500 male patients ≥18 years, who underwent TEP repair of a primary hernia between March 2006 and December 2008. The response rate was 77.2%. Pain of any severity during sexual activity was reported by 124 patients (32.1%) preoperatively and 35 patients (9.1%) postoperatively. Only 2.3% of the 262 patients with no history of preoperative pain experienced moderate to severe (VAS 4-10) pain postoperatively. Pain impaired sexual function in 63 patients (16.3%) preoperatively and in 18 patients (4.7%) postoperatively. The majority of patients who reported pain during sexual activity preoperatively (n = 102, 82.3%) had no pain postoperatively. The frequency of moderate to severe painful sexual activity decreased from 21.2% (preoperatively) to 3.4% after TEP repair (P TEP hernia repair. Postoperatively, moderate to severe painful sexual activity occurred in 2.3% of the patients with no history of preoperative complaints.

  10. [Mitral valve repair in the course of active infectious endocarditis. Study of four patients].

    Science.gov (United States)

    García-Alonso, Carlos J; Ferrer, Elena; Vallejo, Nuria; Delgado, Luis; Pedro-Botet, María Luisa; Ruyra, Xavier; Bayés-Genis, Antoni

    2013-06-04

    Mitral valve (MV) repair is the preferred surgical treatment for degenerative mitral regurgitation (MR). However, questions remain about the efficacy of MV repair when performed for MR caused by infective endocarditis (IE), particularly during its active phase. Although several observational studies have suggested the superiority of MV repair over replacement in patients undergoing surgery for IE, many centres are still opting for valve replacement because of its technical feasibility and reproducibility. In the following document we expose the experience of our hospital. We present a series of 4 patients who recently underwent surgery for IE during its active phase. Epidemiological and clinical characteristics are discussed. All patients underwent different MV repair techniques. No relapse or reinfection has been reported. All patients present MR grades 0 or iI/ivIV at follow up. Even during the active phase of IE, MV repair is a feasible technique with good postoperatory results. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  11. Femur fracture repair - discharge

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/patientinstructions/000166.htm Femur fracture repair - discharge To use the sharing features on this page, please enable JavaScript. You had a fracture (break) in the femur in your leg. It ...

  12. Breaking Bat

    Science.gov (United States)

    Aguilar, Isaac-Cesar; Kagan, David

    2013-01-01

    The sight of a broken bat in Major League Baseball can produce anything from a humorous dribbler in the infield to a frightening pointed projectile headed for the stands. Bats usually break at the weakest point, typically in the handle. Breaking happens because the wood gets bent beyond the breaking point due to the wave sent down the bat created…

  13. Comparison of repair of DNA double-strand breaks in identical sequences in primary human fibroblast and immortal hamster-human hybrid cells harboring a single copy of human chromosome 11

    Science.gov (United States)

    Fouladi, B.; Waldren, C. A.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    2000-01-01

    We have optimized a pulsed-field gel electrophoresis assay that measures induction and repair of double-strand breaks (DSBs) in specific regions of the genome (Lobrich et al., Proc. Natl. Acad. Sci. USA 92, 12050-12054, 1995). The increased sensitivity resulting from these improvements makes it possible to analyze the size distribution of broken DNA molecules immediately after the introduction of DSBs and after repair incubation. This analysis shows that the distribution of broken DNA pieces after exposure to sparsely ionizing radiation is consistent with the distribution expected from randomly induced DSBs. It is apparent from the distribution of rejoined DNA pieces after repair incubation that DNA ends continue to rejoin between 3 and 24 h postirradiation and that some of these rejoining events are in fact misrejoining events, since novel restriction fragments both larger and smaller than the original fragment are generated after repair. This improved assay was also used to study the kinetics of DSB rejoining and the extent of misrejoining in identical DNA sequences in human GM38 cells and human-hamster hybrid A(L) cells containing a single human chromosome 11. Despite the numerous differences between these cells, which include species and tissue of origin, levels of TP53, expression of telomerase, and the presence or absence of a homologous chromosome for the restriction fragments examined, the kinetics of rejoining of radiation-induced DSBs and the extent of misrejoining were similar in the two cell lines when studied in the G(1) phase of the cell cycle. Furthermore, DSBs were removed from the single-copy human chromosome in the hamster A(L) cells with similar kinetics and misrejoining frequency as at a locus on this hybrid's CHO chromosomes.

  14. Efficacy of DNA double-strand breaks repair in breast cancer is decreased in carriers of the variant allele of the UBC9 gene c.73G>A polymorphism.

    Science.gov (United States)

    Synowiec, Ewelina; Krupa, Renata; Morawiec, Zbigniew; Wasylecka, Maja; Dziki, Lukasz; Morawiec, Jan; Blasiak, Janusz; Wozniak, Katarzyna

    2010-12-10

    UBC9 (E2) SUMO conjugating enzyme plays an important role in the maintenance of genome stability and integrity. In the present work we examined the association between the c.73G>A (Val25Met) polymorphism of the UBC9 gene (rs11553473) and efficacy of DNA double-strand breaks (DSBs) repair (DRE) in breast cancer patients. We determined the level of endogenous (basal) and exogenous (induced by γ-irradiation) DSBs and efficacy of their repair in peripheral blood lymphocytes of 57 breast cancer patients and 70 healthy individuals. DNA damage and repair were studied by neutral comet assay. Genotypes were determined in DNA from peripheral blood lymphocytes by allele-specific PCR (ASO-PCR). We also correlated genotypes with the clinical characteristics of breast cancer patients. We observed a strong association between breast cancer occurrence and the variant allele carried genotypes in patients with elevated level of basal as well as induced DNA damage (OR 6.74, 95% CI 2.27-20.0 and OR 5.33, 95% CI 1.81-15.7, respectively). We also found statistically significant (pA polymorphism of the UBC9 gene in breast cancer patients. Carriers of variant allele have decreased DNA DRE as compared to wild type genotype carriers. We did not find any association with the UBC9 gene polymorphism and estrogen and progesterone receptor status. The variant allele of the UBC9 gene polymorphism was strongly inversely related to HER negative breast cancer patients (OR 0.03, 95% CI 0.00-0.23). Our results suggest that the c.73G>A polymorphism of the UBC9 gene may affect DNA DSBs repair efficacy in breast cancer patients. Copyright © 2010 Elsevier B.V. All rights reserved.

  15. Efficacy of DNA double-strand breaks repair in breast cancer is decreased in carriers of the variant allele of the UBC9 gene c.73G>A polymorphism

    Energy Technology Data Exchange (ETDEWEB)

    Synowiec, Ewelina [Department of Molecular Genetics, University of Lodz, Lodz (Poland); Krupa, Renata [Laboratory of DNA Repair, Department of Molecular Genetics, University of Lodz, Banacha 12/16, Lodz (Poland); Morawiec, Zbigniew; Wasylecka, Maja [Department of Surgical Oncology, N. Copernicus Hospital, Lodz (Poland); Dziki, Lukasz; Morawiec, Jan [Department of General and Colorectal Surgery, Medical University of Lodz, Lodz (Poland); Blasiak, Janusz [Department of Molecular Genetics, University of Lodz, Lodz (Poland); Wozniak, Katarzyna, E-mail: wozniak@biol.uni.lodz.pl [Laboratory of DNA Repair, Department of Molecular Genetics, University of Lodz, Banacha 12/16, Lodz (Poland)

    2010-12-10

    UBC9 (E2) SUMO conjugating enzyme plays an important role in the maintenance of genome stability and integrity. In the present work we examined the association between the c.73G>A (Val25Met) polymorphism of the UBC9 gene (rs11553473) and efficacy of DNA double-strand breaks (DSBs) repair (DRE) in breast cancer patients. We determined the level of endogenous (basal) and exogenous (induced by {gamma}-irradiation) DSBs and efficacy of their repair in peripheral blood lymphocytes of 57 breast cancer patients and 70 healthy individuals. DNA damage and repair were studied by neutral comet assay. Genotypes were determined in DNA from peripheral blood lymphocytes by allele-specific PCR (ASO-PCR). We also correlated genotypes with the clinical characteristics of breast cancer patients. We observed a strong association between breast cancer occurrence and the variant allele carried genotypes in patients with elevated level of basal as well as induced DNA damage (OR 6.74, 95% CI 2.27-20.0 and OR 5.33, 95% CI 1.81-15.7, respectively). We also found statistically significant (p < 0.05) difference in DRE related to the c.73G>A polymorphism of the UBC9 gene in breast cancer patients. Carriers of variant allele have decreased DNA DRE as compared to wild type genotype carriers. We did not find any association with the UBC9 gene polymorphism and estrogen and progesterone receptor status. The variant allele of the UBC9 gene polymorphism was strongly inversely related to HER negative breast cancer patients (OR 0.03, 95% CI 0.00-0.23). Our results suggest that the c.73G>A polymorphism of the UBC9 gene may affect DNA DSBs repair efficacy in breast cancer patients.

  16. The DNA translocase RAD5A acts independently of the other main DNA repair pathways, and requires both its ATPase and RING domain for activity in Arabidopsis thaliana.

    Science.gov (United States)

    Klemm, Tobias; Mannuß, Anja; Kobbe, Daniela; Knoll, Alexander; Trapp, Oliver; Dorn, Annika; Puchta, Holger

    2017-08-01

    Multiple pathways exist to repair DNA damage induced by methylating and crosslinking agents in Arabidopsis thaliana. The SWI2/SNF2 translocase RAD5A, the functional homolog of budding yeast Rad5 that is required for the error-free branch of post-replicative repair, plays a surprisingly prominent role in the repair of both kinds of lesions in Arabidopsis. Here we show that both the ATPase domain and the ubiquitination function of the RING domain of the Arabidopsis protein are essential for the cellular response to different forms of DNA damage. To define the exact role of RAD5A within the complex network of DNA repair pathways, we crossed the rad5a mutant line with mutants of different known repair factors of Arabidopsis. We had previously shown that RAD5A acts independently of two main pathways of replication-associated DNA repair defined by the helicase RECQ4A and the endonuclease MUS81. The enhanced sensitivity of all double mutants tested in this study indicates that the repair of damaged DNA by RAD5A also occurs independently of nucleotide excision repair (AtRAD1), single-strand break repair (AtPARP1), as well as microhomology-mediated double-strand break repair (AtTEB). Moreover, RAD5A can partially complement for a deficient AtATM-mediated DNA damage response in plants, as the double mutant shows phenotypic growth defects. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  17. Energy expenditure and heart rate response to breaking up sedentary time with three different physical activity interventions.

    Science.gov (United States)

    Carter, S E; Jones, M; Gladwell, V F

    2015-05-01

    Prolonged sedentary behaviour is associated with increased cardiovascular disease risk and decreased energy expenditure (EE). Workplace interventions breaking up sedentary time have increased EE but the cardiovascular responses are unknown. The practicalities of these interventions, such as required costs and workplace adaptations, are questioned. Calisthenics exercises overcome such limitations, but have not been assessed. The aim of this study was to assess the EE and heart rate (HR) response when breaking up sedentary time with a short bout of standing, walking or calisthenics. Twenty healthy participants (15 male) completed four 30 min conditions: a) 30 min sitting, or breaking up this period with two minutes of b) standing, c) treadmill walking (4 km·h(-1)) or d) a set of calisthenics exercises (including squats and lunges). HR and EE (indirect calorimetry) were assessed throughout. During the activity break, calisthenics caused the highest HR (90 ± 12 bpm) compared to all other conditions (Sit: 70 ± 12 bpm; Stand:72 ± 13 bpm; Walk:84 ± 10 bpm; p cardiovascular health and assist in weight management. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Base excision repair activities differ in human lung cancer cells and corresponding normal controls

    DEFF Research Database (Denmark)

    Karahalil, Bensu; Bohr, Vilhelm A; De Souza-Pinto, Nadja C

    2010-01-01

    for the repair of oxidized modifications both in nuclear and mitochondrial DNA. In order to ascertain whether diminished BER capacity might account for increased levels of oxidative DNA damage in cancer cells, the activities of BER enzymes in three different lung cancer cell lines and their non......-cancerous counterparts were measured using oligonucleotide substrates with single DNA lesions to assess specific BER enzymes. The activities of four BER enzymes, OGG1, NTH1, UDG and APE1, were compared in mitochondrial and nuclear extracts. For each specific lesion, the repair activities were similar among the three...... cell lines used. However, the specific activities and cancer versus control comparison differed significantly between the nuclear and mitochondrial compartments. OGG1 activity, as measured by 8-oxodA incision, was up-regulated in cancer cell mitochondria but down-regulated in the nucleus when compared...

  19. Active School Lesson Breaks Increase Daily Vigorous Physical Activity, but Not Daily Moderate to Vigorous Physical Activity in Elementary School Boys.

    Science.gov (United States)

    Wilson, Andrew N; Olds, Timothy; Lushington, Kurt; Parvazian, Somayeh; Dollman, James

    2017-02-01

    Brief classroom-based episodes of physical activity (active lesson breaks, ALBs) have improved schoolchildren's classroom behaviors in some studies, and may also increase the likelihood of children meeting the recommended daily minutes of moderate to vigorous physical activity (MVPA). However, there is emerging evidence that increases in physical activity at particular times of the day may lead to compensatory declines at other times. This study explored evidence for compensatory declines in response to a 10 min ALB during the school day. Thirty-eight 12-year-old boys from a single elementary school completed intervention and control conditions in a cross-over design, with each phase lasting one week. The intervention consisted of a single 10-min active lesson break delivered on each of three days in the intervention week. Twenty-four hour accelerometry was used to quantify moderate and vigorous physical activity. ALBs increased in-school MVPA by 5.8 min (p .05), However, vigorous physical activity increased significantly over the whole day (11.2 vs 8.9 min, p = .0006). A brief episode of classroom-based play led to a modest increase in vigorous physical activity in elementary school students, but did not increase MVPA across the day.

  20. Flexible rectangular wave-breaking-free pulse generation in actively mode-locked ytterbium-doped fiber laser.

    Science.gov (United States)

    Chen, He; Chen, Sheng-Ping; Jiang, Zong-Fu; Hou, Jing

    2014-11-03

    We demonstrate nanosecond scale rectangular wave-breaking-free pulse generation in an actively mode locked Yb-doped fiber laser based on a combined action of active periodic cavity loss modulation and nonlinear polarization rotation effect. The pulse width of the laser can be controlled in the range of 890 ps to above 124 ns instantaneously by adjusting the electrical signal applied on the modulator. As high as 19.8 nJ wave-breaking-free pulse is achieved with maximum available pump power. The output pulse temporal dynamics exhibit various distinct characteristics under different modulation and polarization control. The laser presents unusually flexible tunabilities in pulse width, pulse energy and pulse shape.

  1. Outcome of early active mobilization after flexor tendons repair in zones II-V in hand

    Directory of Open Access Journals (Sweden)

    Saini Narender

    2010-01-01

    Full Text Available Background: The functional outcome of a flexor tendon injury after repair depends on multiple factors. The postoperative management of tendon injuries has paved a sea through many mobilization protocols. The improved understanding of splinting techniques has promoted the understanding and implication of these mobilization protocols. We conducted a study to observe and record the results of early active mobilization of repaired flexor tendons in zones II-V. Materials and Methods: 25 cases with 75 digits involving 129 flexor tendons including 8 flexor pollicis longus (FPL tendons in zones II-V of thumb were subjected to the early active mobilization protocol. Eighteen (72% patients were below 30 years of age. Twenty-four cases (96% sustained injury by sharp instrument either accidentally or by assault. Ring and little finger were involved in 50% instances. In all digits, either a primary repair (n=26 or a delayed primary repair (n=49 was done. The repair was done with the modified Kessler core suture technique with locking epitendinous sutures with a knot inside the repair site, using polypropylene 3-0/4-0 sutures. An end-to-end repair of the cut nerves was done under loupe magnification using a 6-0/8-0 polyamide suture. The rehabilitation program adopted was a modification of Kleinert′s regimen, and Silfverskiold regimen. The final assessment was done at 14 weeks post repair using the Louisville system of Lister et al. Results: Eighteen of excellent results were attributed to ring and little fingers where there was a flexion lag of < 1 cm and an extension lag of < 15o. FPL showed 75% (n=6 excellent flexion. 63% (n=47 digits showed excellent results whereas good results were seen in 19% (n=14 digits. Nine percent (n=7 digits showed fair and the same number showed poor results. The cases where the median (n=4 or ulnar nerve (n=6 or both (n=3 were involved led to some deformity (clawing/ape thumb at 6 months postoperatively. The cases with digital

  2. 3′-Phosphodiesterase and 3′→5′ Exonuclease Activities of Yeast Apn2 Protein and Requirement of These Activities for Repair of Oxidative DNA Damage

    Science.gov (United States)

    Unk, Ildiko; Haracska, Lajos; Prakash, Satya; Prakash, Louise

    2001-01-01

    In Saccharomyces cerevisiae, the AP endonucleases encoded by the APN1 and APN2 genes provide alternate pathways for the removal of abasic sites. Oxidative DNA-damaging agents, such as H2O2, produce DNA strand breaks which contain 3′-phosphate or 3′-phosphoglycolate termini. Such 3′ termini are inhibitory to synthesis by DNA polymerases. Here, we show that purified yeast Apn2 protein contains 3′-phosphodiesterase and 3′→5′ exonuclease activities, and mutation of the active-site residue Glu59 to Ala in Apn2 inactivates both these activities. Consistent with these biochemical observations, genetic studies indicate the involvement of APN2 in the repair of H2O2-induced DNA damage in a pathway alternate to APN1, and the Ala59 mutation inactivates this function of Apn2. From these results, we conclude that the ability of Apn2 to remove 3′-end groups from DNA is paramount for the repair of strand breaks arising from the reaction of DNA with reactive oxygen species. PMID:11238902

  3. When Teams Break Down: A Study of the Active Army/National Guard Feud of 1997

    National Research Council Canada - National Science Library

    Collins, Ruth

    1998-01-01

    Teamwork is at the heart of all that is good and successful about the U.S. Army. Because it is so critical to warfighting and to all other missions, peacetime and wartime, we are taught not to expect anything good when teams break down...

  4. Developing Model-Making and Model-Breaking Skills Using Direct Measurement Video-Based Activities

    Science.gov (United States)

    Vonk, Matthew; Bohacek, Peter; Militello, Cheryl; Iverson, Ellen

    2017-01-01

    This study focuses on student development of two important laboratory skills in the context of introductory college-level physics. The first skill, which we call model making, is the ability to analyze a phenomenon in a way that produces a quantitative multimodal model. The second skill, which we call model breaking, is the ability to critically…

  5. Effect of Amalaki rasayana on DNA damage and repair in randomized aged human individuals.

    Science.gov (United States)

    Vishwanatha, Udupi; Guruprasad, Kanive P; Gopinath, Puthiya M; Acharya, Raviraj V; Prasanna, Bokkasa V; Nayak, Jayakrishna; Ganesh, Rajeshwari; Rao, Jayalaxmi; Shree, Rashmi; Anchan, Suchitra; Raghu, Kothanahalli S; Joshi, Manjunath B; Paladhi, Puspendu; Varier, Panniampilly M; Muraleedharan, Kollath; Muraleedharan, Thrikovil S; Satyamoorthy, Kapaettu

    2016-09-15

    Preparations from Phyllanthus emblica called Amalaki rasayana is used in the Indian traditional medicinal system of Ayurveda for healthy living in elderly. The biological effects and its mechanisms are not fully understood. Since the diminishing DNA repair is the hallmark of ageing, we tested the influence of Amalaki rasayana on recognized DNA repair activities in healthy aged individuals. Amalaki rasayana was prepared fresh and healthy aged randomized human volunteers were administrated with either rasayana or placebo for 45 days strictly as per the traditional text. The DNA repair was analyzed in peripheral blood mononuclear cells before and after rasayana administration and after 45 days post-rasayana treatment regimen. UVC-induced DNA strand break repair (DSBR) based on extent of DNA unwinding by fluorometric analysis, nucleotide excision repair (NER) by flow cytometry and constitutive base excision repair (BER) by gap filling method were analyzed. Amalaki rasayana administration stably maintained/enhanced the DSBR in aged individuals. There were no adverse side effects. Further, subjects with different body mass index showed differential DNA strand break repair capacity. No change in unscheduled DNA synthesis during NER and BER was observed between the groups. Intake of Amalaki rasayana by aged individuals showed stable maintenance of DNA strand break repair without toxic effects. However, there was no change in nucleotide and base excision repair activities. Results warrant further studies on the effects of Amalaki rasayana on DSBR activities. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  6. Characterization of 26 deletion CNVs reveals the frequent occurrence of micro-mutations within the breakpoint-flanking regions and frequent repair of double-strand breaks by templated insertions derived from remote genomic regions.

    Science.gov (United States)

    Wang, Ye; Su, Peiqiang; Hu, Bin; Zhu, Wenjuan; Li, Qibin; Yuan, Ping; Li, Jiangchao; Guan, Xinyuan; Li, Fucheng; Jing, Xiangyi; Li, Ru; Zhang, Yongling; Férec, Claude; Cooper, David N; Wang, Jun; Huang, Dongsheng; Chen, Jian-Min; Wang, Yiming

    2015-06-01

    Copy number variations (CNVs) have increasingly been reported to cause, or predispose to, human disease. However, a large fraction of these CNVs have not been accurately characterized at the single-base-pair level, thereby hampering a better understanding of the mutational mechanisms underlying CNV formation. Here, employing a composite pipeline method derived from various inference-based programs, we have characterized 26 deletion CNVs [including three novel pathogenic CNVs involving an autosomal gene (EXT2) causing hereditary osteochondromas and an X-linked gene (CLCN5) causing Dent disease, as well as 23 CNVs previously identified by inference from a cohort of Canadian autism spectrum disorder families] to the single-base-pair level of accuracy from whole-genome sequencing data. We found that breakpoint-flanking micro-mutations (within 22 bp of the breakpoint) are present in a significant fraction (5/26; 19%) of the deletion CNVs. This analysis also provided evidence that a recently described error-prone form of DNA repair (i.e., repair of DNA double-strand breaks by templated nucleotide sequence insertions derived from distant regions of the genome) not only causes human genetic disease but also impacts on human genome evolution. Our findings illustrate the importance of precise CNV breakpoint delineation for understanding the underlying mutational mechanisms and have implications for primer design in relation to the detection of deletion CNVs in clinical diagnosis.

  7. Fuzzy Activity Based Life Cycle Costing For Repairable Equipment

    Directory of Open Access Journals (Sweden)

    Mulubrhan Freselam

    2016-01-01

    Full Text Available Life-cycle cost (LCC is the much known method used for decision making that considers all costs in the life of a system or equipment. Predicting LCCs is fraught with potential errors, owing to the uncertainty in future events, future costs, interest rates, and even hidden costs. These uncertainties have a direct impact on the decision making. Activity based LCC is used to identify the activities and cost drivers in acquisition, operation and maintenance phase. This activity based LCC is integrated with fuzzy set theory and interval mathematics to model these uncertainties. Day–Stout–Warren (DSW algorithm and the vertex method are then used to evaluate competing alternatives. A case of two pumps (Pump A and Pump B are taken and their LCC is analysed using the developed model. The equivalent annual cost of Pump B is greater than Pump A, which leads the decision maker to choose Pump A over Pump B.

  8. Patient-Reported Outcomes and Return to Activity After Peroneus Brevis Repair.

    Science.gov (United States)

    Steginsky, Brian; Riley, Aimee; Lucas, Douglas E; Philbin, Terrence M; Berlet, Gregory C

    2016-02-01

    There is limited data on functional outcomes after primary repair of partial peroneal tendon tears. Previous reports have been limited by small cohorts, duration of follow-up, and often included both tenodesis and primary repair. The purpose of this study was to report the functional outcomes and return to activity in the largest cohort to date with partial peroneal tendon tears treated with primary repair. A chart review identified all patients who underwent primary repair of the peroneus brevis tendon from 2008 to 2012. Demographic data, magnetic resonance imaging findings, and postoperative complications were reviewed. Patients were asked to complete a follow-up questionnaire, Foot and Ankle Ability Measure (FAAM), and Foot Function Index (FFI). There were 201 patients who underwent primary repair of the peroneus brevis tendon. The average age at time of operation was 44.3 years. Seventy-one patients returned the follow-up questionnaires with an average follow-up of 4.6 years. Fifty-two patients completed the FFI questionnaire preoperatively and postoperatively. Fifty-nine patients (83.1%) reported a return to regular exercise and sports at final follow-up. At 1 year postoperatively, 76.5% of patients returned to the same preinjury activities, and 62.3% returned to the same level of preinjury activity. Furthermore, 85.9% of patients were satisfied with their outcome, and 91.4% of patients reported they would choose to undergo the same procedure again. The mean FAAM score was 85.2 at follow-up. The mean preoperative and postoperative FFI score was 41.1 and 12.2, respectively. There was a significant improvement in the FFI score of 28.9 after primary peroneus brevis tendon repair (P < .001). Primary repair of peroneus brevis tendon provided consistent improvement in functional outcomes in the majority of patients, as measured by a validated scoring system, the FFI. FAAM scores demonstrated good function compared to historical controls. The majority of patients

  9. The Diverse AAA+ Machines that Repair Inhibited Rubisco Active Sites

    Directory of Open Access Journals (Sweden)

    Oliver Mueller-Cajar

    2017-05-01

    Full Text Available Gaseous carbon dioxide enters the biosphere almost exclusively via the active site of the enzyme ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco. This highly conserved catalyst has an almost universal propensity to non-productively interact with its substrate ribulose 1,5-bisphosphate, leading to the formation of dead-end inhibited complexes. In diverse autotrophic organisms this tendency has been counteracted by the recruitment of dedicated AAA+ (ATPases associated with various cellular activities proteins that all use the energy of ATP hydrolysis to remodel inhibited Rubisco active sites leading to release of the inhibitor. Three evolutionarily distinct classes of these Rubisco activases (Rcas have been discovered so far. Green and red-type Rca are mostly found in photosynthetic eukaryotes of the green and red plastid lineage respectively, whereas CbbQO is associated with chemoautotrophic bacteria. Ongoing mechanistic studies are elucidating how the various motors are utilizing both similar and contrasting strategies to ultimately perform their common function of cracking the inhibited Rubisco active site. The best studied mechanism utilized by red-type Rca appears to involve transient threading of the Rubisco large subunit C-terminal peptide, reminiscent of the action performed by Clp proteases. As well as providing a fascinating example of convergent molecular evolution, Rca proteins can be considered promising crop-improvement targets. Approaches aiming to replace Rubisco in plants with improved enzymes will need to ensure the presence of a compatible Rca protein. The thermolability of the Rca protein found in crop plants provides an opportunity to fortify photosynthesis against high temperature stress. Photosynthesis also appears to be limited by Rca when light conditions are fluctuating. Synthetic biology strategies aiming to enhance the autotrophic CO2 fixation machinery will need to take into consideration the requirement for

  10. Break-induced replication is highly inaccurate.

    Directory of Open Access Journals (Sweden)

    Angela Deem

    2011-02-01

    Full Text Available DNA must be synthesized for purposes of genome duplication and DNA repair. While the former is a highly accurate process, short-patch synthesis associated with repair of DNA damage is often error-prone. Break-induced replication (BIR is a unique cellular process that mimics normal DNA replication in its processivity, rate, and capacity to duplicate hundreds of kilobases, but is initiated at double-strand breaks (DSBs rather than at replication origins. Here we employed a series of frameshift reporters to measure mutagenesis associated with BIR in Saccharomyces cerevisiae. We demonstrate that BIR DNA synthesis is intrinsically inaccurate over the entire path of the replication fork, as the rate of frameshift mutagenesis during BIR is up to 2,800-fold higher than during normal replication. Importantly, this high rate of mutagenesis was observed not only close to the DSB where BIR is less stable, but also far from the DSB where the BIR replication fork is fast and stabilized. We established that polymerase proofreading and mismatch repair correct BIR errors. Also, dNTP levels were elevated during BIR, and this contributed to BIR-related mutagenesis. We propose that a high level of DNA polymerase errors that is not fully compensated by error-correction mechanisms is largely responsible for mutagenesis during BIR, with Pol δ generating many of the mutagenic errors. We further postulate that activation of BIR in eukaryotic cells may significantly contribute to accumulation of mutations that fuel cancer and evolution.

  11. Comparison of slow and accelerated rehabilitation protocol after arthroscopic rotator cuff repair: pain and functional activity.

    Science.gov (United States)

    Düzgün, Irem; Baltacı, Gül; Atay, O Ahmet

    2011-01-01

    In this study, we sought to compare the effects of the slow and accelerated protocols on pain and functional activity level after arthroscopic rotator cuff repair. The study included 29 patients (3 men, 26 women) who underwent arthroscopic repair of stage 2 and 3 rotator cuff tears. Patients were randomized in two groups: the accelerated protocol group (n=13) and slow protocol group (n=16). Patients in the accelerated protocol group participated in a preoperative rehabilitation program for 4-6 weeks. Patients were evaluated preoperatively and for 24 weeks postoperatively. Pain was assessed by visual analog scale, and functional activity level was assessed by The Disabilities of The Arm Shoulder and Hand (DASH) questionnaire. The active range of motion was initiated at week 3 after surgery for the accelerated rehabilitation protocol and at week 6 for the slow protocol. The rehabilitation program was completed by the 8th week with the accelerated protocol and by the 22nd week with the slow protocol. There was no significant difference between the slow and accelerated protocols with regard to pain at rest (p>0.05). However, the accelerated protocol was associated with less pain during activity at weeks 5 and 16, and with less pain at night during week 5 (prehabilitation after arthroscopic rotator cuff repair to prevent the negative effects of immobilization and to support rapid reintegration to daily living activities.

  12. D-ribose inhibits DNA repair synthesis in human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zunica, G.; Marini, M.; Brunelli, M.A.; Chiricolo, M.; Franceschi, C.

    1986-07-31

    D-ribose is cytotoxic for quiescent human lymphocytes and severely inhibits their PHA-induced proliferation at concentrations (25-50 mM) at which other simple sugars are ineffective. In order to explain these effects, DNA repair synthesis was evaluated in PHA-stimulated human lymphocytes treated with hydroxyurea and irradiated. D-ribose, in contrast to other reducing sugars, did not induce repair synthesis and therefore did not apparently damage DNA in a direct way, although it markedly inhibited gamma ray-induced repair. Taking into account that lymphocytes must rejoin physiologically-formed DNA strand breaks in order to enter the cell cycle, we suggest that D-ribose exerts its cytotoxic activity by interfering with metabolic pathways critical for the repair of DNA breaks.

  13. The complexity of DNA double strand break is a crucial factor for activating ATR signaling pathway for G2/M checkpoint regulation regardless of ATM function.

    Science.gov (United States)

    Xue, Lian; Furusawa, Yoshiya; Okayasu, Ryuichi; Miura, Masahiko; Cui, Xing; Liu, Cuihua; Hirayama, Ryoichi; Matsumoto, Yoshitaka; Yajima, Hirohiko; Yu, Dong

    2015-01-01

    DNA double strand break (DSB) repair pathway choice following ionizing radiation (IR) is currently an appealing research topic, which is still largely unclear. Our recent paper indicated that the complexity of DSBs is a critical factor that enhances DNA end resection. It has been well accepted that the RPA-coated single strand DNA produced by resection is a signaling structure for ATR activation. Therefore, taking advantage of high linear energy transfer (LET) radiation to effectively produce complex DSBs, we investigated how the complexity of DSB influences the function of ATR pathway on the G2/M checkpoint regulation. Human skin fibroblast cells with or without ATM were irradiated with X rays or heavy ion particles, and dual-parameter flow cytometry was used to quantitatively assess the mitotic entry at early period post radiation by detecting the cells positive for phosphor histone H3. In ATM-deficient cells, ATR pathway played a pivotal role and functioned in a dose- and LET-dependent way to regulate the early G2/M arrest even as low as 0.2Gy for heavy ion radiation, which indicated that ATR pathway could be rapidly activated and functioned in an ATM-independent, but DSB complexity-dependent manner following exposure to IR. Furthermore, ATR pathway also functioned more efficiently in ATM-proficient cells to block G2 to M transition at early period of particle radiation exposure. Accordingly, in contrast to ATM inhibitor, ATR inhibitor had a more effective radiosensitizing effect on survival fraction following heavy ion beams as compared with X ray radiation. Taken together, our results reveal that the complexity of DSBs is a crucial factor for the activation of ATR pathway for G2/M checkpoint regulation, and ATM-dependent end resection is not essential for the activation. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. 75 FR 6383 - Lead-Based Paint Renovation, Repair and Painting, and Pre-Renovation Education Activities in...

    Science.gov (United States)

    2010-02-09

    ... AGENCY Lead-Based Paint Renovation, Repair and Painting, and Pre- Renovation Education Activities in....324(d)(2), to administer and enforce requirements for a renovation, repair and painting program in accordance with section 402(c)(3) of TSCA, 15 U.S.C. 2682(c)(3), and a lead-based paint pre-renovation...

  15. FAN1 Activity on Asymmetric Repair Intermediates Is Mediated by an Atypical Monomeric Virus-type Replication-Repair Nuclease Domain

    Directory of Open Access Journals (Sweden)

    Simon Pennell

    2014-07-01

    Full Text Available FAN1 is a structure-selective DNA repair nuclease with 5′ flap endonuclease activity, involved in the repair of interstrand DNA crosslinks. It is the only eukaryotic protein with a virus-type replication-repair nuclease (“VRR-Nuc” “module” that commonly occurs as a standalone domain in many bacteria and viruses. Crystal structures of three representatives show that they structurally resemble Holliday junction resolvases (HJRs, are dimeric in solution, and are able to cleave symmetric four-way junctions. In contrast, FAN1 orthologs are monomeric and cleave 5′ flap structures in vitro, but not Holliday junctions. Modeling of the VRR-Nuc domain of FAN1 reveals that it has an insertion, which packs against the dimerization interface observed in the structures of the viral/bacterial VRR-Nuc proteins. We propose that these additional structural elements in FAN1 prevent dimerization and bias specificity toward flap structures.

  16. Laser-activated nano-biomaterials for tissue repair and controlled drug release

    Energy Technology Data Exchange (ETDEWEB)

    Matteini, P; Ratto, F; Rossi, F; Pini, R [Institute of Applied Physics ' Nello Carrara' , National Research Council, via Madonna del Piano 10 50019 Sesto Fiorentino (Italy)

    2014-07-31

    We present recent achievements of minimally invasive welding of biological tissue and controlled drug release based on laser-activated nano-biomaterials. In particular, we consider new advancements in the biomedical application of near-IR absorbing gold nano-chromophores as an original solution for the photothermal repair of surgical incisions and as nanotriggers of controlled drug release from hybrid biopolymer scaffolds. (laser biophotonics)

  17. Genomic Approaches to DNA repair and Mutagenesis

    OpenAIRE

    Wyrick, John J.; Roberts, Steven A.

    2015-01-01

    DNA damage is a constant threat to cells, causing cytotoxicity as well as inducing genetic alterations. The steady-state abundance of DNA lesions in a cell is minimized by a variety of DNA repair mechanisms, including DNA strand break repair, mismatch repair, nucleotide excision repair, base excision repair, and ribonucleotide excision repair. The efficiencies and mechanisms by which these pathways remove damage from chromosomes have been primarily characterized by investigating the processin...

  18. Pangea break-up: from passive to active margin in the Colombian Caribbean Realm

    Science.gov (United States)

    Gómez, Cristhian; Kammer, Andreas

    2017-04-01

    The break-up of Western Pangea has lead to a back-arc type tectonic setting along the periphery of Gondwana, with the generation of syn-rift basins filled with sedimentary and volcanic sequences during the Middle to Late Triassic. The Indios and Corual formations in the Santa Marta massif of Northern Andes were deposited in this setting. In this contribution we elaborate a stratigraphic model for both the Indios and Corual formations, based on the description and classification of sedimentary facies and their architecture and a provenance analysis. Furthermore, geotectonic environments for volcanic and volcanoclastic rock of both units are postulated. The Indios Formation is a shallow-marine syn-rift basin fill and contains gravity flows deposits. This unit is divided into three segments; the lower and upper segments are related to fan-deltas, while the middle segment is associated to offshore deposits with lobe incursions of submarine fans. Volcanoclastic and volcanic rocks of the Indios and Corual formations are bimodal in composition and are associated to alkaline basalts. Volcanogenic deposits comprise debris, pyroclastic and lava flows of both effusive and explosive eruptions. These units record multiple phases of rifting and reveal together a first stage in the break-up of Pangea during Middle and Late Triassic in North Colombia.

  19. Enhanced repair effect of toll-like receptor 4 activation on neurotmesis: assessment using MR neurography.

    Science.gov (United States)

    Li, H J; Zhang, X; Zhang, F; Wen, X H; Lu, L J; Shen, J

    2014-08-01

    Alternative use of molecular approaches is promising for improving nerve regeneration in surgical repair of neurotmesis. The purpose of this study was to determine the role of MR imaging in assessment of the enhanced nerve regeneration with toll-like receptor 4 signaling activation in surgical repair of neurotmesis. Forty-eight healthy rats in which the sciatic nerve was surgically transected followed by immediate surgical coaptation received intraperitoneal injection of toll-like receptor 4 agonist lipopolysaccharide (n = 24, study group) or phosphate buffered saline (n = 24, control group) until postoperative day 7. Sequential T2 measurements and gadofluorine M-enhanced MR imaging and sciatic functional index were obtained over an 8-week follow-up period, with histologic assessments performed at regular intervals. T2 relaxation times and gadofluorine enhancement of the distal nerve stumps were measured and compared between nerves treated with lipopolysaccharide and those treated with phosphate buffered saline. Nerves treated with lipopolysaccharide injection achieved better functional recovery and showed more prominent gadofluorine enhancement and prolonged T2 values during the degenerative phase compared with nerves treated with phosphate buffered saline. T2 values in nerves treated with lipopolysaccharide showed a more rapid return to baseline level than did gadofluorine enhancement. Histology exhibited more macrophage recruitment, faster myelin debris clearance, and more pronounced nerve regeneration in nerves treated with toll-like receptor 4 activation. The enhanced nerve repair with toll-like receptor 4 activation in surgical repair of neurotmesis can be monitored by using gadofluorine M-enhanced MR imaging and T2 relaxation time measurements. T2 relaxation time seems more sensitive than gadofluorine M-enhanced MR imaging for detecting such improved nerve regeneration. © 2014 by American Journal of Neuroradiology.

  20. Individual repair of radiation-induced DNA double-strand breaks in lymphocytes. Implications for radiation-induced dermatitis in breast cancer; Die individuelle Reparatur von strahleninduzierten DNA-Doppelstrangbruechen in Lymphozyten. Implikationen fuer die radiogene Dermatitis beim Mammakarzinom

    Energy Technology Data Exchange (ETDEWEB)

    Melchior, Patrick Wilhelm

    2011-07-01

    Purpose: Adjuvant 'whole breast radiotherapy' (WBRT) is the standard of care after breast conserving surgery in women with breast cancer. Throughout different cancer stages the addition of WBRT leads to significantly improved rates of freedom from local failure and overall survival. WBRT is generally well tolerated. A 5-10%-rate of severe acute or long-term side effects is commonly observed. For both radiation-mediated tumor-cell-elimination and induction of side effects, DNA-double-strand-breaks (DSB) presumably play the decisive role. The intensity of normal tissue reactions in radiotherapy can, in part, be attributed to the intrinsic DSB repair-capacity. In this study in vivo and in vitro experiments are carried through in order to assess DSB repair-kinetics in blood lymphocytes of women with breast cancer. These findings are to be correlated with the degree of radiation-induced normal tissue toxicity. Patients and Methods: Eighteen patients with breast cancer, in whom WBRT was indicated, were examined. A total WBRT dose of 50 Gy (single dose 2 Gy) with an additional boost-radiotherapy to the initial tumor-region to a total dose of 60-66 Gy was administered. DSB repair was determined by means of counting γ-H2AX foci in blood lymphocytes at predefined points in time, i.e. before and 0.5 h; 2.5 h; 5 h and 24 h after in vivo irradiation (1st fraction of WBRT) and before and 0.5 h; 2.5 h and 5 h after in vitro irradiation with increasing radiation doses in the range of 10 - 500 mGy. Acute normal tissue toxicity was scored on the basis of a modified RTOG-classification (main aspects were erythema and dry or moist skin desquamation). Results: DSB repair-halflife-times did not differ between patients with a higher or lower than average incidence of acute side effects. In patients with 'above average' side effects larger irradiation volumes were treated (volume surrounded by the 50%-isodose). Adjusted for these, no single patients showed elevated

  1. The Impact of Brain Breaks Classroom-Based Physical Activities on Attitudes toward Physical Activity in Polish School Children in Third to Fifth Grade

    Directory of Open Access Journals (Sweden)

    Agata Glapa

    2018-02-01

    Full Text Available The purpose of this study was to examine the effectiveness of the Brain Breaks® Physical Activity Solutions in changing attitudes toward physical activity of school children in a community in Poland. In 2015, a sample of 326 pupils aged 9–11 years old from 19 classes at three selected primary schools were randomly assigned to control and experimental groups within the study. During the classes, children in the experimental group performed physical activities two times per day in three to five minutes using Brain Breaks® videos for four months, while the control group did not use the videos during the test period. Students’ attitudes toward physical activities were assessed before and after the intervention using the “Attitudes toward Physical Activity Scale”. Repeated measures of ANOVA were used to examine the change from pre- to post-intervention. Overall, a repeated measures ANOVA indicated time-by-group interaction effects in ‘Self-efficacy on learning with video exercises’, F(1.32 = 75.28, p = 0.00, η2 = 0.19. Although the changes are minor, there were benefits of the intervention. It may be concluded that HOPSports Brain Breaks® Physical Activity Program contributes to better self-efficacy on learning while using video exercise of primary school children.

  2. The Impact of Brain Breaks Classroom-Based Physical Activities on Attitudes toward Physical Activity in Polish School Children in Third to Fifth Grade.

    Science.gov (United States)

    Glapa, Agata; Grzesiak, Joanna; Laudanska-Krzeminska, Ida; Chin, Ming-Kai; Edginton, Christopher R; Mok, Magdalena Mo Ching; Bronikowski, Michal

    2018-02-21

    The purpose of this study was to examine the effectiveness of the Brain Breaks® Physical Activity Solutions in changing attitudes toward physical activity of school children in a community in Poland. In 2015, a sample of 326 pupils aged 9-11 years old from 19 classes at three selected primary schools were randomly assigned to control and experimental groups within the study. During the classes, children in the experimental group performed physical activities two times per day in three to five minutes using Brain Breaks® videos for four months, while the control group did not use the videos during the test period. Students' attitudes toward physical activities were assessed before and after the intervention using the "Attitudes toward Physical Activity Scale". Repeated measures of ANOVA were used to examine the change from pre- to post-intervention. Overall, a repeated measures ANOVA indicated time-by-group interaction effects in 'Self-efficacy on learning with video exercises', F(1.32) = 75.28, p = 0.00, η2 = 0.19. Although the changes are minor, there were benefits of the intervention. It may be concluded that HOPSports Brain Breaks® Physical Activity Program contributes to better self-efficacy on learning while using video exercise of primary school children.

  3. A study on the characteristics of temperature inversions in active and break phases of Indian summer monsoon

    Digital Repository Service at National Institute of Oceanography (India)

    Muraleedharan, P.M.; Mohankumar, K.; Sivakumar, K.U.

    stream_size 36355 stream_content_type text/plain stream_name J_Atmos_Solar-Terr_Phys_93_11a.pdf.txt stream_source_info J_Atmos_Solar-Terr_Phys_93_11a.pdf.txt Content-Encoding UTF-8 Content-Type text/plain; charset=UTF-8... 1        Author version: J. Atmos. Solar-Terr. Phys., vol.93; 2013; 11-20 A study on the characteristics of temperature inversions in active and break phases of Indian summer monsoon P. M. MURALEEDHARAN†, K. MOHANKUMAR**, K. U. SIVAKUMAR...

  4. Pitx2 promotes heart repair by activating the antioxidant response after cardiac injury.

    Science.gov (United States)

    Tao, Ge; Kahr, Peter C; Morikawa, Yuka; Zhang, Min; Rahmani, Mahdis; Heallen, Todd R; Li, Lele; Sun, Zhao; Olson, Eric N; Amendt, Brad A; Martin, James F

    2016-06-02

    Myocardial infarction results in compromised myocardial function and heart failure owing to insufficient cardiomyocyte self-renewal. Unlike many vertebrates, mammalian hearts have only a transient neonatal renewal capacity. Reactivating primitive reparative ability in the mature mammalian heart requires knowledge of the mechanisms that promote early heart repair. By testing an established Hippo-deficient heart regeneration mouse model for factors that promote renewal, here we show that the expression of Pitx2 is induced in injured, Hippo-deficient ventricles. Pitx2-deficient neonatal mouse hearts failed to repair after apex resection, whereas adult mouse cardiomyocytes with Pitx2 gain-of-function efficiently regenerated after myocardial infarction. Genomic analyses indicated that Pitx2 activated genes encoding electron transport chain components and reactive oxygen species scavengers. A subset of Pitx2 target genes was cooperatively regulated with the Hippo pathway effector Yap. Furthermore, Nrf2, a regulator of the antioxidant response, directly regulated the expression and subcellular localization of Pitx2. Pitx2 mutant myocardium had increased levels of reactive oxygen species, while antioxidant supplementation suppressed the Pitx2 loss-of-function phenotype. These findings reveal a genetic pathway activated by tissue damage that is essential for cardiac repair.

  5. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Crosbie, Philip A.J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Watson, Amanda J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Agius, Raymond [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Barber, Philip V. [North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Margison, Geoffrey P. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Povey, Andrew C., E-mail: apovey@manchester.ac.uk [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom)

    2012-04-01

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [{sup 32}P]-based oligonucleotide cleavage assay (MPG substrate 5 Prime -CCGCT{epsilon}AGCGGGTACCGAGCTCGAAT; {epsilon}A = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 {+-} 1.67 fmol/{mu}g DNA/h vs 3.47 {+-} 1.35 fmol/{mu}g DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  6. Beta-carotene suppression of benzophenone-sensitized lipid peroxidation in hexane through additional chain-breaking activities

    Energy Technology Data Exchange (ETDEWEB)

    Cvetkovic, Dragan [Faculty of Technology, 16000 Leskovac (Serbia); Markovic, Dejan, E-mail: dejan_markovic57@yahoo.co [Faculty of Technology, 16000 Leskovac (Serbia)

    2011-01-15

    The aim of this work is to estimate the antioxidant activity of {beta}-carotene in the presence of two different mixtures of phospholipids in hexane solution, under continuous UV-irradiation from three different ranges (UV-A, UV-B, and UV-C). {beta}-Carotene is employed to control lipid peroxidation process generated by UV-irradiation, in the presence and in the absence of selected photosensitizer, benzophenone, by scavenging the involved, created free radicals. The results show that {beta}-carotene undergoes to a substantial, probably structural dependent destruction (bleaching), highly dependent on UV-photons energy input, more expressed in the presence than in the absence of benzophenone. The additional bleaching is synchronized with the further increase in {beta}-carotene antioxidant activity in the presence of benzophenone, implying the same cause: increase in (phospholipids peroxidation) chain-breaking activities.

  7. On breaks of the Indian monsoon

    Indian Academy of Sciences (India)

    Further, there are three or four active-break cycles in a season according to Webster et al (1998) which implies a time scale of about 40 days for which Goswami and Mohan (2000), and Annamalai and Slingo (2001) have studied breaks and active minus break fluctuations. On the other hand, neither the traditional breaks ...

  8. Effects of post mortem interval and gender in DNA base excision repair activities in rat brains

    Energy Technology Data Exchange (ETDEWEB)

    Soltys, Daniela Tathiana; Pereira, Carolina Parga Martins; Ishibe, Gabriela Naomi; Souza-Pinto, Nadja Cristhina de, E-mail: nadja@iq.usp.br

    2015-06-15

    Most human tissues used in research are of post mortem origin. This is the case for all brain samples, and due to the difficulty in obtaining a good number of samples, especially in the case of neurodegenerative diseases, male and female samples are often included in the same experimental group. However, the effects of post mortem interval (PMI) and gender differences in the endpoints being analyzed are not always fully understood, as is the case for DNA repair activities. To investigate these effects, in a controlled genetic background, base excision repair (BER) activities were measured in protein extracts obtained from Wistar rat brains from different genders and defined PMI up to 24 hours, using a novel fluorescent-based in vitro incision assay. Uracil and AP-site incision activity in nuclear and mitochondrial extracts were similar in all groups included in this study. Our results show that gender and PMI up to 24 hours have no influence in the activities of the BER proteins UDG and APE1 in rat brains. These findings demonstrate that these variables do not interfere on the BER activities included in these study, and provide a security window to work with UDG and APE1 proteins in samples of post mortem origin.

  9. Effect of different types of rest-break interventions on neck and shoulder muscle activity, perceived discomfort and productivity in symptomatic VDU operators: a randomized controlled trial.

    Science.gov (United States)

    Nakphet, Nuttika; Chaikumarn, Montakarn; Janwantanakul, Prawit

    2014-01-01

    This study evaluated the effect of different types of activities during rest-break interventions on neck and shoulder muscle activity, muscle discomfort and productivity among symptomatic video display unit (VDU) operators performing prolonged computer terminal work. Randomized controlled trial was used. Thirty symptomatic VDU operators were randomly assigned to 2 active break groups (stretching and dynamic movement) and a reference group. The subjects performed the same typing task for 60 min and received 3-min breaks after each 20 min of work. Root mean square and median frequency were calculated for neck and shoulder muscle activity. Muscle discomfort was measured with Borg's CR-10 scale. Productivity was measured by counting words. There were no significant differences between the types of activities during breaks on neck and shoulder muscle activity, muscle discomfort or productivity. However, there was a significant difference in the level of muscle discomfort over time. Three types of activity during breaks showed a favourable effect on neck and shoulder muscle activity and productivity, and a positive effect on muscle discomfort in symptomatic VDU operators.

  10. The Break

    DEFF Research Database (Denmark)

    Strand, Anete Mikkala Camille

    2018-01-01

    The chapter elaborates on how to deal with one of the major challenges facing organizations worldwide; Stress. The Break enacts a quantum approach to meet the challenges by proposing a combination of three different quantum storytelling technologies; protreptic mentoring, walking and material...... storytelling to enact fruitful breakings of patterns unbecoming. The claim being, that the hamster wheel of Work-life anno 2016 needs reconfiguration and the simple yet fruitful manner by which this is done is through acknowledging the benefits of bodies, spaces and artifacts – and the benefits of actually...... taking a break, discontinuing for a moment in order to continue better, wiser and more at ease. Both within and as part of the daily routines, and – now and then – outside these routines in the majesty of nature with time to explore and redirect the course of life in companionships with fellow man...

  11. The impact of 10-minute activity breaks outside the classroom on male students' on-task behaviour and sustained attention: a randomised crossover design.

    Science.gov (United States)

    Wilson, Andrew N; Olds, Timothy; Lushington, Kurt; Petkov, John; Dollman, James

    2016-04-01

    The aim was to evaluate the impact of a brief activity bout outside the classroom on boys' attention and on-task behaviour in the classroom setting. Fifty-eight boys (mean age 11.2 ± 0.6 years) were recruited from a boys' elementary school in Adelaide, South Australia. Two year 5 and, similarly, two year 6 classes were assigned using a crossover design to either four weeks of a 10 minute Active Lesson Break followed by four weeks of a 10 minute Passive Lesson Break (reading) or visa versa. Attention was quantified using a computerised psychomotor vigilance task, and on-task behaviour by direct observation. Neither the Active Lesson nor the Passive Lesson condition significantly affected sustained attention or on-task behaviour, and there were no significant differences between conditions. There was no impact on participants' sustained attention or on-task behaviour after a short activity break between lessons. Brief activity breaks outside the classroom do not compromise participants' on-task behaviour or attention levels upon returning to the classroom, although improvement in these variables is not seen either. However, the results suggest that active breaks are effective for accruing moderate-to-vigorous physical activity without compromising classroom behaviours. ©2015 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  12. Dual Nuclease and Helicase Activities of Helicobacter pylori AddAB Are Required for DNA Repair, Recombination, and Mouse Infectivity*

    OpenAIRE

    Amundsen, Susan K.; Fero, Jutta; Nina R Salama; Smith, Gerald R

    2009-01-01

    Helicobacter pylori infection of the human stomach is associated with disease-causing inflammation that elicits DNA damage in both bacterial and host cells. Bacteria must repair their DNA to persist. The H. pylori AddAB helicase-exonuclease is required for DNA repair and efficient stomach colonization. To dissect the role of each activity in DNA repair and infectivity, we altered the AddA and AddB nuclease (NUC) domains and the AddA helicase (HEL) domain by site-directed mutagenesis. Extracts...

  13. Ruptured human Achilles tendon has elevated metabolic activity up to 1 year after repair.

    Science.gov (United States)

    Eliasson, Pernilla; Couppé, Christian; Lonsdale, Markus; Svensson, René B; Neergaard, Christian; Kjær, Michael; Friberg, Lars; Magnusson, S Peter

    2016-09-01

    Following Achilles tendon rupture, running is often allowed after 6 months. However, tendon healing is slow and the metabolic status of the tendon at this point is unknown. The purpose of this study was to investigate tendon metabolism (glucose uptake) and vascularization at 3, 6 and 12 months after Achilles tendon rupture as measured using PET and power Doppler ultrasonography (PDUS). The study group comprised 23 patients with surgically repaired Achilles tendon rupture who were investigated at 3 months (n = 7), 6 months (n = 7) and 12 months (n = 9) after surgery. The triceps surae complex was loaded over 20 min of slow treadmill walking while a radioactive tracer ((18)F-FDG) was administered prior to PET. Vascularization was measured in terms of PDUS flow activity, and patient-reported outcomes were scored using the Achilles tendon rupture score (ATRS) and sports assessment (VISA-A) questionnaire. Relative glucose uptake ((18)F-FDG) was higher in repaired tendons than in intact tendons at all time-points (6, 3 and 1.6 times higher at 3, 6 and 12 months, respectively; P ≤ 0.001), and was also higher in the tendon core than in the periphery at 3 and 6 months (P ≤ 0.02), but lower at 12 months (P = 0.06). Relative glucose uptake was negatively related to ATRS at 6 months after repair (r = -0.89, P ≤ 0.01). PDUS flow activity was higher in repaired tendons than in intact tendons at 3 and 6 months (P tendon. Indeed, metabolic activity remained elevated for more than 1 year after injury despite normalized vascularization. The robust negative correlation between tendon metabolism and patient-reported outcome suggests that a high metabolic activity 6 months after the injury may be related to a poor clinical healing outcome.

  14. Neutrophil activation during acetaminophen hepatotoxicity and repair in mice and humans

    Energy Technology Data Exchange (ETDEWEB)

    Williams, C. David; Bajt, Mary Lynn [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Sharpe, Matthew R. [Department of Internal Medicine, University of Kansas Hospital, Kansas City, KS (United States); McGill, Mitchell R. [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Farhood, Anwar [Department of Pathology, St. David' s North Austin Medical Center, Austin, TX 78756 (United States); Jaeschke, Hartmut, E-mail: hjaeschke@kumc.edu [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States)

    2014-03-01

    Following acetaminophen (APAP) overdose there is an inflammatory response triggered by the release of cellular contents from necrotic hepatocytes into the systemic circulation which initiates the recruitment of neutrophils into the liver. It has been demonstrated that neutrophils do not contribute to APAP-induced liver injury, but their role and the role of NADPH oxidase in injury resolution are controversial. C57BL/6 mice were subjected to APAP overdose and neutrophil activation status was determined during liver injury and liver regeneration. Additionally, human APAP overdose patients (ALT: > 800 U/L) had serial blood draws during the injury and recovery phases for the determination of neutrophil activation. Neutrophils in the peripheral blood of mice showed an increasing activation status (CD11b expression and ROS priming) during and after the peak of injury but returned to baseline levels prior to complete injury resolution. Hepatic sequestered neutrophils showed an increased and sustained CD11b expression, but no ROS priming was observed. Confirming that NADPH oxidase is not critical to injury resolution, gp91{sup phox}−/− mice following APAP overdose displayed no alteration in injury resolution. Peripheral blood from APAP overdose patients also showed increased neutrophil activation status after the peak of liver injury and remained elevated until discharge from the hospital. In mice and humans, markers of activation, like ROS priming, were increased and sustained well after active liver injury had subsided. The similar findings between surviving patients and mice indicate that neutrophil activation may be a critical event for host defense or injury resolution following APAP overdose, but not a contributing factor to APAP-induced injury. - Highlights: • Neutrophil (PMN) function increases during liver repair after acetaminophen overdose. • Liver repair after acetaminophen (APAP)-overdose is not dependent on NADPH oxidase. • Human PMNs do not appear

  15. Metal inhibition of human N-methylpurine-DNA glycosylase activity in base excision repair.

    Science.gov (United States)

    Wang, Ping; Guliaev, Anton B; Hang, Bo

    2006-10-25

    Cadmium (Cd2+), nickel (Ni2+) and cobalt (Co2+) are human and/or animal carcinogens. Zinc (Zn2+) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd2+, Ni2+, and Zn2+ can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (varepsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1,000 microM, both Cd2+ and Zn2+ showed metal-dependent inhibition of the MPG catalytic activity. Ni2+ also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co2+ and Mg2+ did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the varepsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd2+, Zn2+, and Ni2+ at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn2+ showed that the MPG active site has a potential binding site for Zn2+, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

  16. Sox9 activation is involved in tubule repair after unilateral partial nephrectomy.

    Science.gov (United States)

    Ma, Qiwang; Wang, Yujia; Zuo, Wei

    2017-11-30

    Tubule repair has been noticed after kidney tissue damage, however the cellular mechanism behind remains unclear. Here we successfully constructed a mouse unilateral partial nephrectomy model mimicking renal carcinoma surgery, and further investigated whether this procedure triggered regenerative action. We used the unilateral partial nephrectomy model to study kidney repair. Kidney function after nephrectomy was measured using creatinine and urea nitrogen assay kit. Wound healing was assessed by Masson Trichrome Staining. Tissue regeneration was tested by Sox9+ cells Immunofluorescence staining. The differentiation potential of Sox9+ cells were assessed by immunoanalysis with various tubular cell markers. Notch activation was determined by qPCR and western blotting. In this model, we found that massive Sox9+ cells emerged one day after the surgery and lasted for up to 20days. Then, we have demonstrated that Sox9+ cells had proliferative capacity and could regenerate epithelial cells in the proximal tubule, the loop of Henle, the distal tubule segment, the collecting duct, and the parietal layer cell, but not the podocyte. In the end, we revealed that the Sox9 activation was involved with Notch signaling pathway. The current study reveals that Sox9 activation can contribute to kidney tubule regeneration after unilateral partial nephrectomy in mice. Copyright © 2017. Published by Elsevier Inc.

  17. Flavonoid Compound Icariin Activates Hypoxia Inducible Factor-1α in Chondrocytes and Promotes Articular Cartilage Repair.

    Directory of Open Access Journals (Sweden)

    Pengzhen Wang

    Full Text Available Articular cartilage has poor capability for repair following trauma or degenerative pathology due to avascular property, low cell density and migratory ability. Discovery of novel therapeutic approaches for articular cartilage repair remains a significant clinical need. Hypoxia is a hallmark for cartilage development and pathology. Hypoxia inducible factor-1alpha (HIF-1α has been identified as a key mediator for chondrocytes to response to fluctuations of oxygen availability during cartilage development or repair. This suggests that HIF-1α may serve as a target for modulating chondrocyte functions. In this study, using phenotypic cellular screen assays, we identify that Icariin, an active flavonoid component from Herba Epimedii, activates HIF-1α expression in chondrocytes. We performed systemic in vitro and in vivo analysis to determine the roles of Icariin in regulation of chondrogenesis. Our results show that Icariin significantly increases hypoxia responsive element luciferase reporter activity, which is accompanied by increased accumulation and nuclear translocation of HIF-1α in murine chondrocytes. The phenotype is associated with inhibiting PHD activity through interaction between Icariin and iron ions. The upregulation of HIF-1α mRNA levels in chondrocytes persists during chondrogenic differentiation for 7 and 14 days. Icariin (10-6 M increases the proliferation of chondrocytes or chondroprogenitors examined by MTT, BrdU incorporation or colony formation assays. Icariin enhances chondrogenic marker expression in a micromass culture including Sox9, collagen type 2 (Col2α1 and aggrecan as determined by real-time PCR and promotes extracellular matrix (ECM synthesis indicated by Alcian blue staining. ELISA assays show dramatically increased production of aggrecan and hydroxyproline in Icariin-treated cultures at day 14 of chondrogenic differentiation as compared with the controls. Meanwhile, the expression of chondrocyte catabolic

  18. Harnessing neural activity to promote repair of the damaged corticospinal system after spinal cord injury

    Directory of Open Access Journals (Sweden)

    John H Martin

    2016-01-01

    Full Text Available As most spinal cord injuries (SCIs are incomplete, an important target for promoting neural repair and recovery of lost motor function is to promote the connections of spared descending spinal pathways with spinal motor circuits. Among the pathways, the corticospinal tract (CST is most associated with skilled voluntary functions in humans and many animals. CST loss, whether at its origin in the motor cortex or in the white matter tracts subcortically and in the spinal cord, leads to movement impairments and paralysis. To restore motor function after injury will require repair of the damaged CST. In this review, I discuss how knowledge of activity-dependent development of the CST-which establishes connectional specificity through axon pruning, axon outgrowth, and synaptic competition among CST terminals-informed a novel activity-based therapy for promoting sprouting of spared CST axons after injur in mature animals. This therapy, which comprises motor cortex electrical stimulation with and without concurrent trans-spinal direct current stimulation, leads to an increase in the gray matter axon length of spared CST axons in the rat spinal cord and, after a pyramidal tract lesion, restoration of skilled locomotor movements. I discuss how this approach is now being applied to a C 4 contusion rat model.

  19. Clustered Mutation Signatures Reveal that Error-Prone DNA Repair Targets Mutations to Active Genes.

    Science.gov (United States)

    Supek, Fran; Lehner, Ben

    2017-07-27

    Many processes can cause the same nucleotide change in a genome, making the identification of the mechanisms causing mutations a difficult challenge. Here, we show that clustered mutations provide a more precise fingerprint of mutagenic processes. Of nine clustered mutation signatures identified from >1,000 tumor genomes, three relate to variable APOBEC activity and three are associated with tobacco smoking. An additional signature matches the spectrum of translesion DNA polymerase eta (POLH). In lymphoid cells, these mutations target promoters, consistent with AID-initiated somatic hypermutation. In solid tumors, however, they are associated with UV exposure and alcohol consumption and target the H3K36me3 chromatin of active genes in a mismatch repair (MMR)-dependent manner. These regions normally have a low mutation rate because error-free MMR also targets H3K36me3 chromatin. Carcinogens and error-prone repair therefore redistribute mutations to the more important regions of the genome, contributing a substantial mutation load in many tumors, including driver mutations. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Electroweak breaking and supersymmetry breaking

    Indian Academy of Sciences (India)

    We discuss the clash between the absence of fine tuning in the Higgs potential and a sufficient suppression of flavour changing neutral current transitions in supersymmetric extensions of the standard model. It is pointed out that horizontal U ( 1 ) symmetry combined with the D -term supersymmetry breaking provides a ...

  1. Active Achilles tendon kinesitherapy accelerates Achilles tendon repair by promoting neurite regeneration☆

    Science.gov (United States)

    Jielile, Jiasharete; Aibai, Minawa; Sabirhazi, Gulnur; Shawutali, Nuerai; Tangkejie, Wulanbai; Badelhan, Aynaz; Nuerduola, Yeermike; Satewalede, Turde; Buranbai, Darehan; Hunapia, Beicen; Jialihasi, Ayidaer; Bai, Jingping; Kizaibek, Murat

    2012-01-01

    Active Achilles tendon kinesitherapy facilitates the functional recovery of a ruptured Achilles tendon. However, protein expression during the healing process remains a controversial issue. New Zealand rabbits, aged 14 weeks, underwent tenotomy followed immediately by Achilles tendon microsurgery to repair the Achilles tendon rupture. The tendon was then immobilized or subjected to postoperative early motion treatment (kinesitherapy). Mass spectrography results showed that after 14 days of motion treatment, 18 protein spots were differentially expressed, among which, 12 were up-regulated, consisting of gelsolin isoform b and neurite growth-related protein collapsing response mediator protein 2. Western blot analysis showed that gelsolin isoform b was up-regulated at days 7–21 of motion treatment. These findings suggest that active Achilles tendon kinesitherapy promotes the neurite regeneration of a ruptured Achilles tendon and gelsolin isoform b can be used as a biomarker for Achilles tendon healing after kinesitherapy. PMID:25317130

  2. High Throughput and Mechano-Active Platforms to Promote Cartilage Regeneration and Repair

    Science.gov (United States)

    Mohanraj, Bhavana

    Traumatic joint injuries initiate acute degenerative changes in articular cartilage that can lead to progressive loss of load-bearing function. As a result, patients often develop post-traumatic osteoarthritis (PTOA), a condition for which there currently exists no biologic interventions. To address this need, tissue engineering aims to mimic the structure and function of healthy, native counterparts. These constructs can be used to not only replace degenerated tissue, but also build in vitro, pre-clinical models of disease. Towards this latter goal, this thesis focuses on the design of a high throughput system to screen new therapeutics in a micro-engineered model of PTOA, and the development of a mechanically-responsive drug delivery system to augment tissue-engineered approaches for cartilage repair. High throughput screening is a powerful tool for drug discovery that can be adapted to include 3D tissue constructs. To facilitate this process for cartilage repair, we built a high throughput mechanical injury platform to create an engineered cartilage model of PTOA. Compressive injury of functionally mature constructs increased cell death and proteoglycan loss, two hallmarks of injury observed in vivo. Comparison of this response to that of native cartilage explants, and evaluation of putative therapeutics, validated this model for subsequent use in small molecule screens. A primary screen of 118 compounds identified a number of 'hits' and relevant pathways that may modulate pathologic signaling post-injury. To complement this process of therapeutic discovery, a stimuli-responsive delivery system was designed that used mechanical inputs as the 'trigger' mechanism for controlled release. The failure thresholds of these mechanically-activated microcapsules (MAMCs) were influenced by physical properties and composition, as well as matrix mechanical properties in 3D environments. TGF-beta released from the system upon mechano-activation stimulated stem cell

  3. A prospective randomized controlled trial of controlled passive mobilization vs. place and active hold exercises after zone 2 flexor tendon repair.

    Science.gov (United States)

    Farzad, Maryam; Layeghi, Fereydoun; Asgari, Ali; Ring, David C; Karimlou, Masoud; Hosseini, S Ali

    2014-01-01

    The rehabilitation program after flexor tendon repair of zone II laceration varies. We designed a Prospective Randomized Controlled Trial of controlled passive mobilization (modified Kleinert) vs. Place and active hold exercises after zone 2-flexor tendon repair by two-strand suture (Modified kessler). Sixty-four fingers in 54 patients with zone 2 flexor tendon modified Kessler repairs were enrolled in a prospective randomized controlled trial comparing place and active hold exercises to controlled passive mobilization (modified Kleinert). The primary outcome measure was total active motion eight weeks after repair as measured by an independent and blinded therapist. Patients treated with place and active hold exercises had significantly greater total active motion (146) eight weeks after surgery than patients treated with controlled passive mobilization (114) (modified Klinert). There were no ruptures in either group. Place and hold achieves greater motion than controlled passive mobilization after a two-strand repair for zone 2 flexor tendon repairs.

  4. Structure-function relationships governing activity and stability of a DNA alkylation damage repair thermostable protein.

    Science.gov (United States)

    Perugino, Giuseppe; Miggiano, Riccardo; Serpe, Mario; Vettone, Antonella; Valenti, Anna; Lahiri, Samarpita; Rossi, Franca; Rossi, Mosè; Rizzi, Menico; Ciaramella, Maria

    2015-10-15

    Alkylated DNA-protein alkyltransferases repair alkylated DNA bases, which are among the most common DNA lesions, and are evolutionary conserved, from prokaryotes to higher eukaryotes. The human ortholog, hAGT, is involved in resistance to alkylating chemotherapy drugs. We report here on the alkylated DNA-protein alkyltransferase, SsOGT, from an archaeal species living at high temperature, a condition that enhances the harmful effect of DNA alkylation. The exceptionally high stability of SsOGT gave us the unique opportunity to perform structural and biochemical analysis of a protein of this class in its post-reaction form. This analysis, along with those performed on SsOGT in its ligand-free and DNA-bound forms, provides insights in the structure-function relationships of the protein before, during and after DNA repair, suggesting a molecular basis for DNA recognition, catalytic activity and protein post-reaction fate, and giving hints on the mechanism of alkylation-induced inactivation of this class of proteins. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Bonding, Bridging, and Boundary Breaking: The Civic Lessons of High School Student Activities

    Science.gov (United States)

    Shelly, Bryan

    2011-01-01

    This article presents evidence designed to expand scholarly knowledge of how high school co-curricular activities generate the positive effects previous scholarship has found. Studies of empowerment across various fields identify a sense of autonomy, self-belief, self-expression, the ability to work together with diverse others, and a critical…

  6. Inguinal hernia repair with Parietex ProGrip mesh causes minimal discomfort and allows early return to normal activities.

    Science.gov (United States)

    Batabyal, Pikli; Haddad, Richard L; Samra, Jaswinder S; Wickins, Simon; Sweeney, Edmund; Hugh, Thomas J

    2016-01-01

    The type of inguinal hernia repair used depends on many factors but predominantly the surgeon's training, interpretation of the literature, and personal preference. This prospective cohort study describes a consecutive series of open mesh inguinal hernia repairs (modified Lichtenstein technique) performed as an outpatient procedure using 2 different mesh types. Analysis was undertaken on 540 consecutive patients who underwent inguinal hernia repair between January 2007 and December 2012. Short-term outcomes were compared between those repaired with conventional polypropylene mesh and those with Parietex ProGrip mesh. Most patients were male (89%) and the mean age was 63 years. The median operative time was 50 minutes for unilateral hernias and 90 minutes for bilateral hernias. The use of Parietex ProGrip mesh reduced the operative time to 40 minutes for unilateral hernias (P hernias (P hernia repair, 88% of the patients were discharged home within 4 hours of operation. There was no mortality and the overall complication rate was 7.4%. One patient developed a pulmonary embolus but the remainder of the complications were minor. Twenty-four hours postoperatively, 74% of the patients were either totally pain free or had minimal discomfort. At 4 weeks, 97% of the patients were either pain free or had minimal discomfort. Patients who underwent unilateral inguinal hernia repair with Parietex ProGrip mesh had the most rapid return to normal activities (10 vs 14 days, P < .04). Open anterior inlay mesh repair is safe and results in minimal postoperative pain and early return to normal activities. ProGrip mesh resulted in a shorter operative time and more rapid return to normal activities compared with polypropylene mesh (10 vs 14 days). Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Laboratory Activity to Promote Student Understanding of UV Mutagenesis and DNA Repair

    Directory of Open Access Journals (Sweden)

    Joshua Ernest Kouassi

    2017-05-01

    Full Text Available Changes in DNA molecules are common, due to the effects of UV light and other external and internal mutagens. Cells have a variety of repair mechanisms which serve to maintain the accuracy of the genetic code. This activity includes a low-cost, safe and technically feasible experiment, which allows students to observe the effects of UV mutagenesis and DNA photorepair in the halophilc archaeon, Haloferax volcanii. An optional extension links this activity to topics of immediate concern to students – how exposure to UVC light contributes to skin cancer risk and the protective effects of sunscreen. Students design and carry out an experiment to test whether SPF 15 sunscreen increases the lethal exposure time for H. volcanii by a factor of 15. Throughout the activity, discussion questions engage students in actively thinking about the biological phenomena and experimental procedures and analysis. This activity is designed for students in college or university genetics, microbiology, or introductory biology courses as well as in high school honors biology courses. Teachers report that this activity was valuable in helping students understand mutagenesis and photorepair and in developing student skills in designing and analyzing experiments.

  8. DNA Strand Breaks in Mitotic Germ Cells of Caenorhabditis elegans Evaluated by Comet Assay

    Science.gov (United States)

    Park, Sojin; Choi, Seoyun; Ahn, Byungchan

    2016-01-01

    DNA damage responses are important for the maintenance of genome stability and the survival of organisms. Such responses are activated in the presence of DNA damage and lead to cell cycle arrest, apoptosis, and DNA repair. In Caenorhabditis elegans, double-strand breaks induced by DNA damaging agents have been detected indirectly by antibodies against DSB recognizing proteins. In this study we used a comet assay to detect DNA strand breaks and to measure the elimination of DNA strand breaks in mitotic germline nuclei of C. elegans. We found that C. elegans brc-1 mutants were more sensitive to ionizing radiation and camptothecin than the N2 wild-type strain and repaired DNA strand breaks less efficiently than N2. This study is the first demonstration of direct measurement of DNA strand breaks in mitotic germline nuclei of C. elegans. This newly developed assay can be applied to detect DNA strand breaks in different C. elegans mutants that are sensitive to DNA damaging agents. PMID:26903030

  9. DNA Strand Breaks in Mitotic Germ Cells of Caenorhabditis elegans Evaluated by Comet Assay.

    Science.gov (United States)

    Park, Sojin; Choi, Seoyun; Ahn, Byungchan

    2016-03-01

    DNA damage responses are important for the maintenance of genome stability and the survival of organisms. Such responses are activated in the presence of DNA damage and lead to cell cycle arrest, apoptosis, and DNA repair. In Caenorhabditis elegans, double-strand breaks induced by DNA damaging agents have been detected indirectly by antibodies against DSB recognizing proteins. In this study we used a comet assay to detect DNA strand breaks and to measure the elimination of DNA strand breaks in mitotic germline nuclei of C. elegans. We found that C. elegans brc-1 mutants were more sensitive to ionizing radiation and camptothecin than the N2 wild-type strain and repaired DNA strand breaks less efficiently than N2. This study is the first demonstration of direct measurement of DNA strand breaks in mitotic germline nuclei of C. elegans. This newly developed assay can be applied to detect DNA strand breaks in different C. elegans mutants that are sensitive to DNA damaging agents.

  10. Ruptured human Achilles tendon has elevated metabolic activity up to 1 year after repair

    DEFF Research Database (Denmark)

    Eliasson, Pernilla; Couppé, Christian; Lonsdale, Markus

    2016-01-01

    surae complex was loaded over 20 min of slow treadmill walking while a radioactive tracer ((18)F-FDG) was administered prior to PET. Vascularization was measured in terms of PDUS flow activity, and patient-reported outcomes were scored using the Achilles tendon rupture score (ATRS) and sports assessment...... (VISA-A) questionnaire. RESULTS: Relative glucose uptake ((18)F-FDG) was higher in repaired tendons than in intact tendons at all time-points (6, 3 and 1.6 times higher at 3, 6 and 12 months, respectively; P ≤ 0.001), and was also higher in the tendon core than in the periphery at 3 and 6 months (P ≤ 0...

  11. Peroxiredoxin 6 phospholipid hydroperoxidase activity in the repair of peroxidized cell membranes

    Directory of Open Access Journals (Sweden)

    Aron B. Fisher

    2018-04-01

    Full Text Available Although lipid peroxidation associated with oxidative stress can result in cellular death, sub-lethal lipid peroxidation can gradually resolve with return to the pre-exposure state. We have shown that resolution of lipid peroxidation is greatly delayed in lungs or cells that are null for peroxiredoxin 6 (Prdx6 and that both the phospholipase A2 and the GSH peroxidase activities of Prdx6 are required for a maximal rate of recovery. Like other peroxiredoxins, Prdx6 can reduce H2O2 and short chain hydroperoxides, but in addition can directly reduce phospholipid hydroperoxides. This study evaluated the relative role of these two different peroxidase activities of Prdx6 in the repair of peroxidized cell membranes. The His26 residue in Prdx6 is an important component of the binding site for phospholipids. Thus, we evaluated the lungs from H26A-Prdx6 expressing mice and generated H26A-Prdx6 expressing pulmonary microvascular endothelial cells (PMVEC by lentiviral infection of Prdx6 null cells to compare with wild type in the repair of lipid peroxidation. Isolated lungs and PMVEC were exposed to tert-butyl hydroperoxide and mice were exposed to hyperoxia (> 95% O2. Assays for lipid peroxidation in wild type control and mutant lungs and cells showed ~4-fold increase at end-exposure. Control lungs and cells showed gradual resolution during a post-exposure recovery period. However, there was no recovery from lipid peroxidation by H26A-Prdx6 lungs or PMVEC. These studies confirm an important role for Prdx6 in recovery from membrane lipid peroxidation and indicate that reduction of H2O2 or short chain hydroperoxides does not play a role in the recovery process. Keywords: Lipid peroxidation, Oxidant stress, Hyperoxia, Endothelial cells, Perfused lung, Histidine mutation

  12. Early rehabilitation affects functional outcomes and activities of daily living after arthroscopic rotator cuff repair: a case report.

    Science.gov (United States)

    Shimo, Satoshi; Sakamoto, Yuta; Tokiyoshi, Akinari; Yamamoto, Yasuhiro

    2016-01-01

    [Purpose] The effect of early rehabilitation protocols after arthroscopic rotator cuff repair is currently unknown. We examined short-term effects of early rehabilitation on functional outcomes and activities of daily living after arthroscopic rotator cuff repair. [Subject and Methods] An 82-year-old male fell during a walk, resulting in a supraspinatus tear. Arthroscopic rotator cuff repair was performed using a single-row technique. He wore an abduction brace for 6 weeks after surgery. [Results] From day 1 after surgery, passive range of motion exercises, including forward flexion and internal and external rotation were performed twice per day. Starting at 6 weeks after surgery, active range of motion exercises and muscle strengthening exercises were introduced gradually. At 6 weeks after surgery, his active forward flexion was 150°, UCLA shoulder rating scale score was 34 points, and Quick Disabilities of the Arm, Shoulder, and Hand questionnaire disability/symptom score was 36 points. At 20 weeks after surgery, his active forward flexion was 120°, UCLA shoulder rating scale score was 34 points, and Quick Disabilities of the Arm, Shoulder, and Hand questionnaire disability/symptom score was 0 points. [Conclusion] These protocols are recommended to physical therapists during rehabilitation for arthroscopic rotator cuff repair to support rapid reintegration into activities of daily living.

  13. Dual inhibition of ATR and ATM potentiates the activity of trabectedin and lurbinectedin by perturbing the DNA damage response and homologous recombination repair.

    Science.gov (United States)

    Lima, Michelle; Bouzid, Hana; Soares, Daniele G; Selle, Frédéric; Morel, Claire; Galmarini, Carlos M; Henriques, João A P; Larsen, Annette K; Escargueil, Alexandre E

    2016-05-03

    Trabectedin (Yondelis®, ecteinascidin-743, ET-743) is a marine-derived natural product approved for treatment of advanced soft tissue sarcoma and relapsed platinum-sensitive ovarian cancer. Lurbinectedin is a novel anticancer agent structurally related to trabectedin. Both ecteinascidins generate DNA double-strand breaks that are processed through homologous recombination repair (HRR), thereby rendering HRR-deficient cells particularly sensitive. We here characterize the DNA damage response (DDR) to trabectedin and lurbinectedin in HeLa cells. Our results show that both compounds activate the ATM/Chk2 (ataxia-telangiectasia mutated/checkpoint kinase 2) and ATR/Chk1 (ATM and RAD3-related/checkpoint kinase 1) pathways. Interestingly, pharmacological inhibition of Chk1/2, ATR or ATM is not accompanied by any significant improvement of the cytotoxic activity of the ecteinascidins while dual inhibition of ATM and ATR strongly potentiates it. Accordingly, concomitant inhibition of both ATR and ATM is an absolute requirement to efficiently block the formation of γ-H2AX, MDC1, BRCA1 and Rad51 foci following exposure to the ecteinascidins. These results are not restricted to HeLa cells, but are shared by cisplatin-sensitive and -resistant ovarian carcinoma cells. Together, our data identify ATR and ATM as central coordinators of the DDR to ecteinascidins and provide a mechanistic rationale for combining these compounds with ATR and ATM inhibitors.

  14. Impact of active and break wind spells on the demand-supply balance in wind energy in India

    Science.gov (United States)

    Kulkarni, Sumeet; Deo, M. C.; Ghosh, Subimal

    2018-02-01

    With an installed capacity of over 19,000 MW, the wind power currently accounts for almost 70% of the total installed capacity among the renewable energy sector in India. The extraction of wind power mainly depends on prevailing meteorology which is strongly influenced by monsoon variability. The monsoon season is characterized by significant fluctuations in between periods of wet and dry spells. During the dry spells, the demand for power from agriculture and cooling equipment increases, whereas during the wet periods, such demand reduces, although, at the same time, the power supply increases because of strong westerly winds contributing to an enhanced production of wind energy. At this backdrop, we aim to assess the impact of intra-seasonal wind variability on the balance of energy supply and demand during monsoon seasons in India. Further, we explore the probable cause of wind variability by relating it to El Nino events. It is observed that the active and break phases in wind significantly impact the overall wind potential output. Although the dry spells are generally found to reduce the overall wind potential, their impact on the potential seems to have declined after the year 2000. The impact of meteorological changes on variations in wind power studied in this work should find applications typically in taking investment decisions on conventional generation facilities, like thermal, which are currently used to maintain the balance of power supply and demand.

  15. Impact of active and break wind spells on the demand-supply balance in wind energy in India

    Science.gov (United States)

    Kulkarni, Sumeet; Deo, M. C.; Ghosh, Subimal

    2017-01-01

    With an installed capacity of over 19,000 MW, the wind power currently accounts for almost 70% of the total installed capacity among the renewable energy sector in India. The extraction of wind power mainly depends on prevailing meteorology which is strongly influenced by monsoon variability. The monsoon season is characterized by significant fluctuations in between periods of wet and dry spells. During the dry spells, the demand for power from agriculture and cooling equipment increases, whereas during the wet periods, such demand reduces, although, at the same time, the power supply increases because of strong westerly winds contributing to an enhanced production of wind energy. At this backdrop, we aim to assess the impact of intra-seasonal wind variability on the balance of energy supply and demand during monsoon seasons in India. Further, we explore the probable cause of wind variability by relating it to El Nino events. It is observed that the active and break phases in wind significantly impact the overall wind potential output. Although the dry spells are generally found to reduce the overall wind potential, their impact on the potential seems to have declined after the year 2000. The impact of meteorological changes on variations in wind power studied in this work should find applications typically in taking investment decisions on conventional generation facilities, like thermal, which are currently used to maintain the balance of power supply and demand.

  16. Two human homologs of Rad23 are functionally interchangeable in complex formation and stimulation of XPC repair activity.

    NARCIS (Netherlands)

    K. Sugasawa (Kaoru); J.M.Y. Ng (Jessica); C. Masutani (Chikahide); T. Maekawa; A. Uchida; P.J. van der Spek (Peter); A.P.M. Eker (André); S. Rademakers (Suzanne); C.E. Visser (Cécile); A. Aboussekhra; R.D. Wood (Richard); F. Hanaoka (Fumio); D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)

    1997-01-01

    textabstractXPC-hHR23B protein complex is specifically involved in nucleotide excision repair (NER) of DNA lesions on transcriptionally inactive sequences as well as the nontranscribed strand of active genes. Here we demonstrate that not only highly purified recombinant hHR23B (rhHR23B) but also a

  17. Pregabalin enhances myelin repair and attenuates glial activation in lysolecithin-induced demyelination model of rat optic chiasm.

    Science.gov (United States)

    Daneshdoust, Danyal; Khalili-Fomeshi, Mohsen; Ghasemi-Kasman, Maryam; Ghorbanian, Davoud; Hashemian, Mona; Gholami, Mohammad; Moghadamnia, Aliakbar; Shojaei, Amir

    2017-03-06

    Multiple sclerosis (MS) is an autoimmune disease in which more than 70% of patients experience visual disturbance as the earliest symptoms. Lysolecithin (LPC)-induced focal demyelination model has been developed to evaluate the effects of different therapies on myelin repair improvement. In this study, the effects of pregabalin administration on myelin repair and glial activation were investigated. Local demyelination was induced by administration of LPC (1%, 2μL) into the rat optic chiasm. Rats underwent daily injection of pregabalin (30mg/kg, i.p) or vehicle. Visual-evoked potentials (VEPs) recordings were performed for evaluating the function of optic pathway on days 3, 7, 14 and 28 post lesions. Myelin specific staining and immunostaining against GFAP and Iba1 were also carried out for assessment of myelination and glial activation respectively. Electrophysiological data indicated that pregabalin administration could significantly reduce the P1-N1 latency and increase the amplitude of VEPs waves compared to saline group. Luxol fast blue staining and immunostaining against PLP, as mature myelin marker, showed that myelin repair was improved in animals received pregabalin treatment. In addition, pregabalin effectively reduced the expression of GFAP and Iba1 as activated glial markers in optic chiasm. The present study indicates that pregabalin administration enhances myelin repair and ameliorates glial activation of optic chiasm following local injection of LPC. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

  18. MR imaging and T2 measurements in peripheral nerve repair with activation of Toll-like receptor 4 of neurotmesis.

    Science.gov (United States)

    Zhang, Xiang; Zhang, Fang; Lu, Liejing; Li, Haojiang; Wen, Xuehua; Shen, Jun

    2014-05-01

    To investigate the role of MR imaging in neurotmesis combined with surgical repair and Toll-like receptor 4 (TLR4) activation. Forty-eight rats received subepineurial microinjection of the TLR4 agonist lipopolysaccharide (LPS, n = 24) or phosphate buffered saline (PBS, n = 24) immediately after surgical repair of the transected sciatic nerve. Sequential fat-suppressed T2-weighted imaging and quantitative T2 measurements were obtained at 3, 7, 14 and 21 days after surgery, with histologic assessments performed at regular intervals. T2 relaxation times and histological quantification of the distal stumps were measured and compared. The distal stumps of transected nerves treated with LPS or PBS both showed persistent enlargement and hyperintense signal. T2 values of the distal stumps showed a rapid rise to peak level followed by a rapid decline pattern in nerves treated with LPS, while exhibiting a slow rise to peak value followed by a slow decline in nerves treated with PBS. Nerves treated with LPS exhibited more prominent macrophage recruitment, faster myelin debris clearance and more pronounced nerve regeneration. Nerves treated with TLR4 activation had a characteristic pattern of T2 value change over time. Longitudinal T2 measurements can be used to detect the enhanced repair effect associated with TLR4 activation in the surgical repair of neurotmesis. • TLR4 activation had additional beneficial effects on neurotmesis beyond surgical repair. • TLR4 activation had a characteristic time course of T2 values. • T2 measurements can help detect beneficial effects with TLR4 activation.

  19. Lamin A Is an Endogenous SIRT6 Activator and Promotes SIRT6-Mediated DNA Repair

    Directory of Open Access Journals (Sweden)

    Shrestha Ghosh

    2015-11-01

    Full Text Available The nuclear lamins are essential for various molecular events in the nucleus, such as chromatin organization, DNA replication, and provision of mechanical support. A specific point mutation in the LMNA gene creates a truncated prelamin A termed progerin, causing Hutchinson-Gilford progeria syndrome (HGPS. SIRT6 deficiency leads to defective genomic maintenance and accelerated aging similar to HGPS, suggesting a potential link between lamin A and SIRT6. Here, we report that lamin A is an endogenous activator of SIRT6 and facilitates chromatin localization of SIRT6 upon DNA damage. Lamin A promotes SIRT6-dependent DNA-PKcs (DNA-PK catalytic subunit recruitment to chromatin, CtIP deacetylation, and PARP1 mono-ADP ribosylation in response to DNA damage. The presence of progerin jeopardizes SIRT6 activation and compromises SIRT6-mediated molecular events in response to DNA damage. These data reveal a critical role for lamin A in regulating SIRT6 activities, suggesting that defects in SIRT6 functions contribute to impaired DNA repair and accelerated aging in HGPS.

  20. Signalization and repair of the DNA double-strand breaks of in the cerebral tumors: modulation of the radiation response with the chemotherapy treatments; Signalization et reparation des cassures double-brin de l'ADN dans les gliomes: modulation de la reponse aux traitements chimio-radiotherapeutiques

    Energy Technology Data Exchange (ETDEWEB)

    Marcinkova-Bencokova, Z

    2007-07-15

    There are about 6000 new cases of nervous system tumours each year in France. However, the current radio chemotherapeutic approaches against brain tumours remain still insufficient to produce a satisfactory therapeutic index. In parallel, the knowledge of the early radiobiological events has considerably progressed in the last few years. This thesis aims to provide new insights in the molecular and cellular response of brain tumours to radio chemotherapy. This thesis was divided into four stages. Stage 1: a novel DNA double-strand breaks repair pathway depending on the MRE11 protein but independent of the phosphorylation of H2AX emerged from the study of artefacts of the immunofluorescence technique and a systematic analysis of the radiosensitivity of human cells. Stage 2: the radiobiological features of 3 rodent models of glioma among the most used in preclinical trials and of 7 human glioma cell lines were investigated. Functional impairments of the BRCA1 protein in response to radiation and/or cisplatin were observed in the majority of the models tested, raising the question of the role of this protein in the anti-glioma treatments and in glioma genesis. Stage 3: in order to extend our approach to genetic syndromes associated with cerebral tumours predisposition, the radiobiological characteristics of the fibroblasts resulting from patients suffering from neurofibromatosis type 1 (NF1), a pathology associated with a strong incidence of peripheral nervous system tumours, were investigated. NF1 appeared to be a syndrome with moderated radiosensitivity, associated with a weak deficiency of DNA end-joining repair but with a strong activity of MRE11. These results enabled us to propose a preliminary model involving both proteins BRCA1 and NF1. Stage 4: considering the role of BRCA1 in the inhibition of some tyrosine kinase activity and in the response to cisplatin, we tested the radiobiological effects of treatments combining radiation, cisplatin and tyrosine kinase

  1. Cost -Benefit Analysis of a Single-Unit System with Preventive Maintenance and Weibull Distribution for Failure and Repair Activities

    Directory of Open Access Journals (Sweden)

    Kumar Ashish

    2014-12-01

    Full Text Available This paper deals with a reliability model developed for a single-unit system which goes for preventive maintenance after a pre-specific time ‘t’ up to which no failure occurs. There is a single server who takes some time to arrive at the system for doing repair activities. The unit does not work as new after repair at complete failure and so called the degraded unit. The degraded unit is replaced by new one after its failure with some replacement time. The failure time, preventive maintenance time, replacement time and repair time of the unit are taken as Weibull distributed with common shape parameter and different scale parameters. The switching devices are perfect. The system is observed at suitable regenerative epochs to obtain various measures of system effectiveness of interest to system designers and operation managers.

  2. Robust thumb flexor tendon repairs with a six-strand M-Tang method, pulley venting, and early active motion.

    Science.gov (United States)

    Pan, Z J; Qin, J; Zhou, X; Chen, J

    2017-11-01

    We present the outcomes of flexor pollicis longus tendon repairs in 34 thumbs using a six-strand M-Tang repair with venting of one or two pulleys according to site of tendon laceration. The A2 pulley was vented in all three thumbs with zone 1 injury. In 31 thumbs with zone 2 injuries, the oblique pulley was vented partially or entirely. Twenty-two thumbs had both the A1 and oblique pulleys vented. Six to 46 months post-surgery, 14 thumbs with zone 2 injuries were rated excellent, 13 good, three fair and one failure according to Tang criteria. No tendon ruptures or bowstringing occurred. Fourteen of 34 thumbs had deficits in interphalangeal joint extension averaging 13°. We conclude that venting of one or two pulleys may ensure recovery of thumb function without risking tendon bowstringing and that early active thumb motion is safe with a robust tendon repair. IV.

  3. The genetic defect in Cockayne syndrome is associated with a defect in repair of UV-induced DNA damage in transcriptionally active DNA

    Energy Technology Data Exchange (ETDEWEB)

    Venema, J.; Mullenders, L.H.; Natarajan, A.T.; van Zeeland, A.A.; Mayne, L.V. (State Univ. of Leiden (Netherlands))

    1990-06-01

    Cells from patients with Cockayne syndrome (CS) are hypersensitive to UV-irradiation but have an apparently normal ability to remove pyrimidine dimers from the genome overall. We have measured the repair of pyrimidine dimers in defined DNA sequences in three normal and two CS cell strains. When compared to a nontranscribed locus, transcriptionally active genes were preferentially repaired in all three normal cell strains. There was no significant variation in levels of repair between various normal individuals or between two constitutively expressed genes, indicating that preferential repair may be a consistent feature of constitutively expressed genes in human cells. Neither CS strain, from independent complementation groups, was able to repair transcriptionally active DNA with a similar rate and to the same extent as normal cells, indicating that the genetic defect in CS lies in the pathway for repair of transcriptionally active DNA. These results have implications for understanding the pleiotropic clinical effects associated with disorders having defects in the repair of DNA damage. In particular, neurodegeneration appears to be associated with the loss of preferential repair of active genes and is not simply correlated with reduced levels of overall repair.

  4. Structure and Stability of ERCC1-XPF DNA Repair Complexes

    NARCIS (Netherlands)

    Faridounnia, M.

    2015-01-01

    Understanding DNA repair pathways such as Nucleotide Excision Repair, Double Strand Break repair and Interstrand Cross-Link repair is of basic interest for understanding fundamental cellular processes. It also forms the basis for understanding molecular details of diseases when defects occur in

  5. Dynamics and mechanisms of DNA repair by photolyase

    Science.gov (United States)

    Liu, Zheyun; Wang, Lijuan; Zhong, Dongping

    2015-01-01

    Photolyase, a class of flavoproteins, uses blue light to repair two types of ultraviolet-induced DNA damage, cyclobutane pyrimidine dimer (CPD) and pyrimidine-pyrimidone (6–4) photoproduct (6–4PP). In this perspective, we review the recent progress on the repair dynamics and mechanisms of both types of DNA restoration by photolyases. We first report the spectroscopic characterization of flavin in various redox states and the active-site solvation dynamics in photolyases. We then systematically summarize the detailed repair dynamics of damaged DNA by photolyases and a biomimetic system through resolving all elementary steps on the ultrafast timescales, including multiple intermolecular electron- and proton-transfer reactions and bond-breaking and -making processes. We determined the unique electron tunneling pathways, identified the key functional residues and revealed the molecular origin of high repair efficiency, and thus elucidate the molecular mechanisms and repair photocycles at the most fundamental level. We finally conclude that the active sites of photolyases, unlike aqueous solution for the biomimetic system, provide a unique electrostatic environment and local flexibility and thus a dedicated synergy for all elementary dynamics to maximize the repair efficiency. This repair photomachine is the first enzyme that the entire functional evolution is completely mapped out in real time. PMID:25870862

  6. MR imaging and T2 measurements in peripheral nerve repair with activation of Toll-like receptor 4 of neurotmesis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiang; Zhang, Fang; Lu, Liejing; Li, Haojiang; Wen, Xuehua; Shen, Jun [Sun Yat-Sen University, Department of Radiology, Sun Yat-Sen Memorial Hospital, Guangzhou, Guangdong (China)

    2014-05-15

    To investigate the role of MR imaging in neurotmesis combined with surgical repair and Toll-like receptor 4 (TLR4) activation. Forty-eight rats received subepineurial microinjection of the TLR4 agonist lipopolysaccharide (LPS, n = 24) or phosphate buffered saline (PBS, n = 24) immediately after surgical repair of the transected sciatic nerve. Sequential fat-suppressed T2-weighted imaging and quantitative T2 measurements were obtained at 3, 7, 14 and 21 days after surgery, with histologic assessments performed at regular intervals. T2 relaxation times and histological quantification of the distal stumps were measured and compared. The distal stumps of transected nerves treated with LPS or PBS both showed persistent enlargement and hyperintense signal. T2 values of the distal stumps showed a rapid rise to peak level followed by a rapid decline pattern in nerves treated with LPS, while exhibiting a slow rise to peak value followed by a slow decline in nerves treated with PBS. Nerves treated with LPS exhibited more prominent macrophage recruitment, faster myelin debris clearance and more pronounced nerve regeneration. Nerves treated with TLR4 activation had a characteristic pattern of T2 value change over time. Longitudinal T2 measurements can be used to detect the enhanced repair effect associated with TLR4 activation in the surgical repair of neurotmesis. (orig.)

  7. DNA repair: Dynamic defenders against cancer and aging

    Energy Technology Data Exchange (ETDEWEB)

    Fuss, Jill O.; Cooper, Priscilla K.

    2006-04-01

    (UV) component of sunlight. NER can be divided into two classes based on where the repair occurs. NER occurring in DNA that is not undergoing transcription (i.e., most of the genome) is called global genome repair (GGR or GGNER), while NER taking place in the transcribed strand of active genes is called transcription-coupled repair (TCR or TC-NER). We will explore NER in more detail below. Mismatch repair (MMR) is another type of excision repair that specifically removes mispaired bases resulting from replication errors. DNA damage can also result in breaks in the DNA backbone, in one or both strands. Single-strand breaks (SSBs) are efficiently repaired by a mechanism that shares common features with the later steps in BER. Double-strand breaks (DSBs) are especially devastating since by definition there is no intact complementary strand to serve as a template for repair, and even one unrepaired DSB can be lethal [3]. In cells that have replicated their DNA prior to cell division, the missing information can be supplied by the duplicate copy, or sister chromatid, and DSBs in these cells are faithfully repaired by homologous recombination involving the exchange of strands of DNA between the two copies. However, most cells in the body are non-dividing, and in these cells the major mechanism for repairing DSBs is by non-homologous end joining (NHEJ), which as the name implies involves joining two broken DNA ends together without a requirement for homologous sequence and which therefore has a high potential for loss of genetic information.

  8. Preferential repair of ionizing radiation-induced damage in the transcribed strand of an active human gene is defective in Cockayne syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Leadon, S.A. (Univ. of North Carolina, Chapel Hill, NC (United States)); Copper, P.K. (Lawrence Berkeley Lab., CA (United States))

    1993-11-15

    Cells from patients with Cockayne syndrome (CS), which are sensitive to killing by UV although overall damage removal appears normal, are specifically defective in repair of UV damage in actively transcribe genes. Because several CS strains display cross-sensitivity to killing by ionizing radiation, the authors examined whether ionizing radiation-induced damage in active genes is preferentially repaired by normal cells and whether the radiosensitivity of CS cells can be explained by a defect in this process. They found that ionizing radiation-induced damage was repaired more rapidly in the transcriptionally active metallothionein IIA (MTIIA) gene than in the inactive MTIIB gene or in the genome overall in normal cells as a result of faster repair on the transcribed strand of MTIIA. Cells of the radiosensitive CS strain CS1AN are completely defective in this strand-selective repair of ionizing radiation-induced damage, although their overall repair rate appears normal. CS3BE cells, which are intermediate in radiosensitivity, do exhibit more rapid repair of the transcribed strand but at a reduced rate compared to normal cells. Xeroderma pigmentosum complementation group A cells, which are hypersensitive to UV light because of a defect in the nucleotide excision repair pathway but do not show increased sensitivity to ionizing radiation, preferentially repair ionizing radiation-induced damage on the transcribed strand of MTIIA. Thus, the ability to rapidly repair ionizing radiation-induced damage in actively transcribing genes correlates with cell survival. The results extend the generality of preferential repair in active genes to include damage other than bulky lesions.

  9. Preferential repair of ionizing radiation-induced damage in the transcribed strand of an active human gene is defective in Cockayne syndrome.

    Science.gov (United States)

    Leadon, S A; Cooper, P K

    1993-11-15

    Cells from patients with Cockayne syndrome (CS), which are sensitive to killing by UV although overall damage removal appears normal, are specifically defective in repair of UV damage in actively transcribed genes. Because several CS strains display cross-sensitivity to killing by ionizing radiation, we examined whether ionizing radiation-induced damage in active genes is preferentially repaired by normal cells and whether the radiosensitivity of CS cells can be explained by a defect in this process. We found that ionizing radiation-induced damage was repaired more rapidly in the transcriptionally active metallothionein IIA (MTIIA) gene than in the inactive MTIIB gene or in the genome overall in normal cells as a result of faster repair on the transcribed strand of MTIIA. Cells of the radiosensitive CS strain CS1AN are completely defective in this strand-selective repair of ionizing radiation-induced damage, although their overall repair rate appears normal. CS3BE cells, which are intermediate in radiosensitivity, do exhibit more rapid repair of the transcribed strand but at a reduced rate compared to normal cells. Xeroderma pigmentosum complementation group A cells, which are hypersensitive to UV light because of a defect in the nucleotide excision repair pathway but do not show increased sensitivity to ionizing radiation, preferentially repair ionizing radiation-induced damage on the transcribed strand of MTIIA. Thus, the ability to rapidly repair ionizing radiation-induced damage in actively transcribing genes correlates with cell survival. Our results extend the generality of preferential repair in active genes to include damage other than bulky lesions.

  10. The repair of melphalan-induced DNA adducts in the transcribed strand of active genes is subject to a strong polarity effect.

    OpenAIRE

    Episkopou, Hara; Kyrtopoulos, Soterios A.; Sfikakis, Petros P.; Meletios A Dimopoulos; Souliotis, Vassilis L

    2011-01-01

    To investigate the mechanisms of the therapeutic action and drug resistance to the nitrogen mustard melphalan, melphalan-induced DNA damage repair and chromatin structure were examined along the p53, N-ras and d-globin gene loci in cells carrying different repair activities. In nucleotide excision repair-deficient XP-A cells, similar levels of adducts were found in all fragments examined, indicating uniform distribution of DNA damage. In both, repair-proficient CS-B and XP-C cells, faster rep...

  11. MOTOR SKILLS AND NUTRITIONAL STATUS OUTCOMES FROM A PHYSICAL ACTIVITY INTERVENTION IN SHORT BREAKS ON PRESCHOOL CHILDREN CONDUCTED BY THEIR EDUCATORS: A PILOT STUDY.

    Science.gov (United States)

    Monsalves-Alvarez, Matias; Castro-Sepulveda, Mauricio; Zapata-Lamana, Rafael; Rosales-Soto, Giovanni; Salazar, Gabriela

    2015-10-01

    childhood obesity is a worldwide health concern. For this issue different intervention have being planned to increase physical activity patterns and reduce the excess of weight in children with limited or no success. the aim of this study is to evaluate the results of a pilot intervention consisting in three 15-minute breaks conducted by educators and supervised by physical education teachers on motor skills and nutritional status in preschool children. sample was 70 preschool children (32 boys and 38 girls), age 4 ± 0,6 years. The physical activity classes were performed three times a week, 45 minutes daily, distributed in three 15 minutes breaks. The circuits were planned to have; jumps, sprints, carrying medicinal balls, gallops and crawling. Motor skill tests that were performed Standing long jump (SLJ) and Twelve meter run. with the intervention no significant differences in nutritional status where found on mean Z score (boys p = 0.49, girls p = 0.77). An increment on weight and height was fount after the intervention (p intervention when we normalize by weight in boys (p = 0.002) and girls (p intervention (p intervention with more intense activities in small breaks (15 minutes), and guided by the educators could improve essential motor skills (running and jumping) in preschool children of a semi-rural sector independent of nutritional status. This gaining in motor skills is the first step to increase physical activity levels in preschool children. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  12. DNA repair enzyme APE1 from evolutionarily ancient Hydra reveals redox activity exclusively found in mammalian APE1.

    Science.gov (United States)

    Pekhale, Komal; Haval, Gauri; Perween, Nusrat; Antoniali, Giulia; Tell, Gianluca; Ghaskadbi, Surendra; Ghaskadbi, Saroj

    2017-11-01

    Only mammalian apurinic/apyrimidinic endonuclease1 (APE1) has been reported to possess both DNA repair and redox activities. C terminal of the protein is required for base excision repair, while the redox activity resides in the N terminal due to cysteine residues at specific positions. APE1s from other organisms studied so far lack the redox activity in spite of having the N terminal domain. We find that APE1 from the Cnidarian Hydra exhibits both endonuclease and redox activities similar to mammalian APE1. We further show the presence of the three indispensable cysteines in Hydra APE1 for redox activity by site directed mutagenesis. Importance of redox domain but not the repair domain of APE1 in regeneration has been demonstrated by using domain-specific inhibitors. Our findings clearly demonstrate that the redox function of APE1 evolved very early in metazoan evolution and is not a recent acquisition in mammalian APE1 as believed so far. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Roscovitine modulates DNA repair and senescence: implications for combination chemotherapy.

    Science.gov (United States)

    Crescenzi, Elvira; Palumbo, Giuseppe; Brady, Hugh J M

    2005-11-15

    Treatment of tumor cells by chemotherapy activates a series of responses ranging from apoptosis to premature senescence and repair. Survival responses are characterized by inhibition of cyclin-dependent kinases. Because inhibition of cyclin-dependent kinases represents a distinctive feature of DNA damage-induced prosurvival responses, we investigated the possibility that the cyclin-dependent kinase inhibitor roscovitine modulates drug-induced responses in human adenocarcinoma cells, favoring cell survival. Sublethal concentrations of doxorubicin were used to induce premature senescence in human adenocarcinoma cells. The effect of the cyclin-dependent kinase inhibitor roscovitine on the doxorubicin-dependent cell cycle checkpoint activation and DNA repair pathways was evaluated. Roscovitine reinforces doxorubicin-dependent G(1) checkpoint in A549 and HEC1B cells leading to decreased frequency of double-strand breaks and to the preferential induction of senescence and enhanced clonogenic survival. However, in other tumor cell lines, such as HCT116 and H1299, combined treatment with doxorubicin and roscovitine increases the frequency of double-strand breaks and dramatically sensitizes to doxorubicin. This unexpected effect of roscovitine depends on a novel ability to inhibit DNA double-strand break repair processes and requires inactivation of the pRb pathway. Roscovitine, by hindering DNA repair processes, has the potential to inhibit recovery of mildly damaged tumor cells after doxorubicin treatment and to increase the susceptibility of tumor cells to chemotherapy. However, in some tumor cells, the cell cycle inhibitory function of roscovitine prevails over the DNA repair inhibitory activity, favoring premature senescence and clonogenic growth. These data indicate a novel mechanism underlying combined chemotherapy, which may have wide application in treatment of carcinomas.

  14. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions

    DEFF Research Database (Denmark)

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela

    2016-01-01

    During class switch recombination (CSR), antigen-stimulated B-cells rearrange their immunoglobulin constant heavy chain (CH) loci to generate antibodies with different effector functions. CSR is initiated by activation-induced deaminase (AID), which converts cytosines in switch (S) regions......, repetitive sequences flanking the CHloci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks...... (DSBs), which trigger CSR. Surprisingly, genetic experiments revealed that CSR is dependent not only on AID and UNG, but also on mismatch repair (MMR). To elucidate the role of MMR in CSR, we studied the processing of uracil-containing DNA substrates in extracts of MMR-proficient and -deficient human...

  15. The exonuclease activity of hPMC2 is required for transcriptional regulation of the QR gene and repair of estrogen-induced abasic sites.

    Science.gov (United States)

    Krishnamurthy, N; Ngam, C R; Berdis, A J; Montano, M M

    2011-11-24

    We have previously reported that the expression of antioxidative stress enzymes is upregulated by trans-hydroxytamoxifen (TOT) in breast epithelial cell lines providing protection against estrogen-induced DNA damage. This regulation involves Estrogen Receptor β (ERβ) recruitment to the Electrophile Response Element (EpRE) and a novel protein, human homolog of Xenopus gene which Prevents Mitotic Catastrophe (hPMC2). We have also demonstrated that ERβ and hPMC2 are required for TOT-dependent recruitment of poly (ADP-ribose) polymerase 1 (PARP-1) and Topoisomerase IIβ (Topo IIβ) to the EpRE. Sequence analysis reveals that the C-terminus of hPMC2 encodes a putative exonuclease domain. Using in vitro kinetic assays, we found that hPMC2 is a 3'-5' non-processive exonuclease that degrades both single-stranded and double-stranded substrates. Mutation of two conserved carboxylate residues drastically reduced the exonuclease activity of hPMC2, indicating the relative importance of the catalytic residues. Western blot analysis of breast cancer cell lines for Quinone Reductase (QR) levels revealed that the intrinsic exonuclease activity of hPMC2 was required for TOT-induced QR upregulation. Chromatin immunoprecipitation (ChIP) assays also indicated that hPMC2 was involved in the formation of strand breaks observed with TOT treatment and is specific for the EpRE-containing region of the QR gene. We also determined that the transcription factor NF-E2-related factor-2 (Nrf2) is involved in the specificity of hPMC2 for the EpRE. In addition, we determined that the catalytic activity of hPMC2 is required for repair of abasic sites that result from estrogen-induced DNA damage. Thus, our study provides a mechanistic basis for transcriptional regulation by hPMC2 and provides novel insights into its role in cancer prevention.

  16. Revised Interim Final Consolidated Enforcement Response and Penalty Policy for the Pre-Renovation Education Rule; Renovation, Repair and Painting Rule; and Lead-Based Paint Activities Rule

    Science.gov (United States)

    This is the revised version of the Interim Final Consolidated Enforcement Response and Penalty Policy for the Pre-Renovation Education Rule; Renovation, Repair and Painting Rule; and Lead-Based Paint Activities Rule.

  17. Approach for Estimating Exposures and Incremental Health Effects from Lead Due to Renovation Repair and Painting Activities in Public and Commercial Buildings

    Science.gov (United States)

    Approach for Estimating Exposures and Incremental Health Effects from Lead Due to Renovation Repair and Painting Activities in Public and Commercial Buildings: links to documents at www.regulations.gov, links to PDFs related to Approach document

  18. Approach for Estimating Exposures and Incremental Health Effects from Lead During Renovation, Repair, and Painting Activities in Public and Commercial Buildings

    Science.gov (United States)

    Approach for Estimating Exposures and Incremental Health Effects from Lead During Renovation, Repair, and Painting Activities in Public and Commercial Buildings” (Technical Approach Document). Also available for public review and comment are two supplementary documents: the detai...

  19. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  20. 75 FR 11121 - Incidental Takes of Marine Mammals During Specified Activities; Replacement and Repair of Fur...

    Science.gov (United States)

    2010-03-10

    ..., age class, and sex, whenever possible, that is sighted in the vicinity of the proposed project area... the replacement and repair of the observation towers and walkways during a single winter and spring... by breeding females, who within a few days give birth and begin nursing their single pup. Lactating...

  1. Antimutagenic activity of casein against MNNG in the E. coli DNA repair host-mediated assay.

    NARCIS (Netherlands)

    Boekel, van M.A.J.S.; Goeptar, A.R.; Alink, G.M.

    1997-01-01

    The effect of caseinate and soy protein in the diet on the mutagenicity induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was assessed in-vivo and ex-vivo in the DNA-repair host-mediated assay and liquid suspension assay, respectively. Of the two proteins only casein showed a strong

  2. Acetylation regulates WRN catalytic activities and affects base excision DNA repair

    DEFF Research Database (Denmark)

    Muftuoglu, Meltem; Kusumoto, Rika; Speina, Elzbieta

    2008-01-01

    The Werner protein (WRN), defective in the premature aging disorder Werner syndrome, participates in a number of DNA metabolic processes, and we have been interested in the possible regulation of its function in DNA repair by post-translational modifications. Acetylation mediated by histone...

  3. Breaking Bad

    DEFF Research Database (Denmark)

    Harlev, Mikkel Alexander; Sun Yin, Haohua; Langenheldt, Klaus Christian

    2018-01-01

    Bitcoin is a cryptocurrency whose transactions are recorded on a distributed, openly accessible ledger. On the Bitcoin Blockchain, an entity’s real-world identity is hidden behind a pseudonym, a so-called address. Therefore, Bitcoin is widely assumed to provide a high degree of anonymity, which...... is a driver for its frequent use for illicit activities. This paper presents a novel approach for reducing the anonymity of the Bitcoin Blockchain by using Supervised Machine Learning to predict the type of yet-unidentified entities. We utilised a sample of 434 entities with ≈ 200 million transactions...... discuss our novel approach of Supervised Machine Learning for uncovering Blockchain anonymity and its potential applications to forensics and financial compliance and its societal implications, outline study limitations and propose future research directions....

  4. Effect of a 12-Week Summer Break on School Day Physical Activity and Health-Related Fitness in Low-Income Children from CSPAP Schools.

    Science.gov (United States)

    Fu, You; Brusseau, Timothy A; Hannon, James C; Burns, Ryan D

    2017-01-01

    Background . The purpose of this study was to examine the effect of a 12-week summer break on school day physical activity and health-related fitness (HRF) in children from schools receiving a Comprehensive School Physical Activity Program (CSPAP). Methods . Participants were school-aged children ( N = 1,232; 624 girls and 608 boys; mean age = 9.5 ± 1.8 years) recruited from three low-income schools receiving a CSPAP. Physical activity and HRF levels were collected during the end of spring semester 2015 and again during the beginning of fall semester 2015. Physical activity was assessed using the Yamax DigiWalker CW600 pedometer. HRF measures consisted of body mass index (BMI) and the Progressive Aerobic Cardiovascular Endurance Run (PACER). Results . Results from a doubly MANCOVA analysis indicated that pedometer step counts decreased from 4,929 steps in the spring to 4,445 steps in the fall (mean difference = 484 steps; P schools receiving a CSPAP intervention had lower levels of school day physical activity and cardiorespiratory endurance following a 12-week summer break.

  5. Taking breaks from work: an exploratory inquiry.

    Science.gov (United States)

    Strongman, K T; Burt, C D

    2000-05-01

    Two studies concerned with taking breaks from either mental or physical work are presented. In the first study, a questionnaire was given to 101 students in which they answered questions about their own break taking and that of others. They also completed a time management questionnaire and scales about procrastination, self-esteem, and work overload. In the second study, 17 students kept detailed diaries of their daily break-taking behavior over a 6-week period. Results are discussed in terms of the types of reasons given for taking breaks and the possible discrepancies between such reasons and the actual activities engaged in during breaks.

  6. Stripped-down DNA repair in a highly reduced parasite

    Directory of Open Access Journals (Sweden)

    Fast Naomi M

    2007-03-01

    Full Text Available Abstract Background Encephalitozoon cuniculi is a member of a distinctive group of single-celled parasitic eukaryotes called microsporidia, which are closely related to fungi. Some of these organisms, including E. cuniculi, also have uniquely small genomes that are within the prokaryotic range. Thus, E. cuniculi has undergone a massive genome reduction which has resulted in a loss of genes from diverse biological pathways, including those that act in DNA repair. DNA repair is essential to any living cell. A loss of these mechanisms invariably results in accumulation of mutations and/or cell death. Six major pathways of DNA repair in eukaryotes include: non-homologous end joining (NHEJ, homologous recombination repair (HRR, mismatch repair (MMR, nucleotide excision repair (NER, base excision repair (BER and methyltransferase repair. DNA polymerases are also critical players in DNA repair processes. Given the close relationship between microsporidia and fungi, the repair mechanisms present in E. cuniculi were compared to those of the yeast Saccharomyces cerevisiae to ascertain how the process of genome reduction has affected the DNA repair pathways. Results E. cuniculi lacks 16 (plus another 6 potential absences of the 56 DNA repair genes sought via BLASTP and PSI-BLAST searches. Six of 14 DNA polymerases or polymerase subunits are also absent in E. cuniculi. All of these genes are relatively well conserved within eukaryotes. The absence of genes is not distributed equally among the different repair pathways; some pathways lack only one protein, while there is a striking absence of many proteins that are components of both double strand break repair pathways. All specialized repair polymerases are also absent. Conclusion Given the large number of DNA repair genes that are absent from the double strand break repair pathways, E. cuniculi is a prime candidate for the study of double strand break repair with minimal machinery. Strikingly, all of the

  7. Chromosome End Repair and Genome Stability in Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    Susannah F. Calhoun

    2017-08-01

    Full Text Available The human malaria parasite Plasmodium falciparum replicates within circulating red blood cells, where it is subjected to conditions that frequently cause DNA damage. The repair of DNA double-stranded breaks (DSBs is thought to rely almost exclusively on homologous recombination (HR, due to a lack of efficient nonhomologous end joining. However, given that the parasite is haploid during this stage of its life cycle, the mechanisms involved in maintaining genome stability are poorly understood. Of particular interest are the subtelomeric regions of the chromosomes, which contain the majority of the multicopy variant antigen-encoding genes responsible for virulence and disease severity. Here, we show that parasites utilize a competitive balance between de novo telomere addition, also called “telomere healing,” and HR to stabilize chromosome ends. Products of both repair pathways were observed in response to DSBs that occurred spontaneously during routine in vitro culture or resulted from experimentally induced DSBs, demonstrating that both pathways are active in repairing DSBs within subtelomeric regions and that the pathway utilized was determined by the DNA sequences immediately surrounding the break. In combination, these two repair pathways enable parasites to efficiently maintain chromosome stability while also contributing to the generation of genetic diversity.

  8. Flexor tendon physiology: tendon nutrition and cellular activity in injury and repair.

    Science.gov (United States)

    Gelberman, R H

    1985-01-01

    Scientific studies of the past 20 years have done much to redefine the mechanisms by which flexor tendons heal. Several points have become increasingly clear: Flexor tendons are nourished to a greater extent by synovial fluid diffusion than vascular perfusion. Tendon cells are capable of proliferating, producing collagen, and reconstructing their own gliding surface in the absence of adhesion ingrowth. The key to a successful outcome after flexor tendon repair appears to be an early restoration of tendon continuity, reconstruction of the sheath, if possible, and early passive mobilization. This complex stimulates the tendon's intrinsic repair potential, which is contained within the cells of the tendon itself but appears to be expressed only under ideal experimental and clinical situations.

  9. Supplementary motor area and primary auditory cortex activation in an expert break-dancer during the kinesthetic motor imagery of dance to music.

    Science.gov (United States)

    Olshansky, Michael P; Bar, Rachel J; Fogarty, Mary; DeSouza, Joseph F X

    2015-01-01

    The current study used functional magnetic resonance imaging to examine the neural activity of an expert dancer with 35 years of break-dancing experience during the kinesthetic motor imagery (KMI) of dance accompanied by highly familiar and unfamiliar music. The goal of this study was to examine the effect of musical familiarity on neural activity underlying KMI within a highly experienced dancer. In order to investigate this in both primary sensory and motor planning cortical areas, we examined the effects of music familiarity on the primary auditory cortex [Heschl's gyrus (HG)] and the supplementary motor area (SMA). Our findings reveal reduced HG activity and greater SMA activity during imagined dance to familiar music compared to unfamiliar music. We propose that one's internal representations of dance moves are influenced by auditory stimuli and may be specific to a dance style and the music accompanying it.

  10. Activation of Type II Cells into Regenerative Stem Cell Antigen-1+ Cells during Alveolar Repair

    Science.gov (United States)

    Kumar, Varsha Suresh; Zhang, Wei; Rehman, Jalees; Malik, Asrar B.

    2015-01-01

    The alveolar epithelium is composed of two cell types: type I cells comprise 95% of the gas exchange surface area, whereas type II cells secrete surfactant, while retaining the ability to convert into type I cells to induce alveolar repair. Using lineage-tracing analyses in the mouse model of Pseudomonas aeruginosa–induced lung injury, we identified a population of stem cell antigen (Sca)-1–expressing type II cells with progenitor cell properties that mediate alveolar repair. These cells were shown to be distinct from previously reported Sca-1–expressing bronchioalveolar stem cells. Microarray and Wnt reporter studies showed that surfactant protein (Sp)-C+Sca-1+ cells expressed Wnt signaling pathway genes, and inhibiting Wnt/β-catenin signaling prevented the regenerative function of Sp-C+Sca-1+ cells in vitro. Thus, P. aeruginosa–mediated lung injury induces the generation of a Sca-1+ subset of type II cells. The progenitor phenotype of the Sp-C+Sca-1+ cells that mediates alveolar epithelial repair might involve Wnt signaling. PMID:25474582

  11. 46 CFR 196.30-20 - Breaking of safety valve seal.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Breaking of safety valve seal. 196.30-20 Section 196.30... OPERATIONS Reports of Accidents, Repairs, and Unsafe Equipment § 196.30-20 Breaking of safety valve seal. (a) If at any time it is necessary to break the seal on a safety valve for any purpose, the Chief...

  12. DNA repair and radiation sensitivity in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, D.J.C.; Stackhouse, M. [Los Alamos National Lab., NM (United States); Chen, D.S. [Rochester Univ., NY (United States). Dept. of Radiation Oncology

    1993-02-01

    Ionizing radiation induces various types of damage in mammalian cells including DNA single-strand breaks, DNA double-strand breaks (DSB), DNA-protein cross links, and altered DNA bases. Although human cells can repair many of these lesions there is little detailed knowledge of the nature of the genes and the encoded enzymes that control these repair processes. We report here on the cellular and genetic analyses of DNA double-strand break repair deficient mammalian cells. It has been well established that the DNA double-strand break is one of the major lesions induced by ionizing radiation. Utilizing rodent repair-deficient mutant, we have shown that the genes responsible for DNA double-strand break repair are also responsible for the cellular expression of radiation sensitivity. The molecular genetic analysis of DSB repair in rodent/human hybrid cells indicate that at least 6 different genes in mammalian cells are responsible for the repair of radiation-induced DNA double-strand breaks. Mapping and the prospect of cloning of human radiation repair genes are reviewed. Understanding the molecular and genetic basis of radiation sensitivity and DNA repair in man will provide a rational foundation to predict the individual risk associated with radiation exposure and to prevent radiation-induced genetic damage in the human population.

  13. DNA repair and radiation sensitivity in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, D.J.C.; Stackhouse, M. (Los Alamos National Lab., NM (United States)); Chen, D.S. (Rochester Univ., NY (United States). Dept. of Radiation Oncology)

    1993-01-01

    Ionizing radiation induces various types of damage in mammalian cells including DNA single-strand breaks, DNA double-strand breaks (DSB), DNA-protein cross links, and altered DNA bases. Although human cells can repair many of these lesions there is little detailed knowledge of the nature of the genes and the encoded enzymes that control these repair processes. We report here on the cellular and genetic analyses of DNA double-strand break repair deficient mammalian cells. It has been well established that the DNA double-strand break is one of the major lesions induced by ionizing radiation. Utilizing rodent repair-deficient mutant, we have shown that the genes responsible for DNA double-strand break repair are also responsible for the cellular expression of radiation sensitivity. The molecular genetic analysis of DSB repair in rodent/human hybrid cells indicate that at least 6 different genes in mammalian cells are responsible for the repair of radiation-induced DNA double-strand breaks. Mapping and the prospect of cloning of human radiation repair genes are reviewed. Understanding the molecular and genetic basis of radiation sensitivity and DNA repair in man will provide a rational foundation to predict the individual risk associated with radiation exposure and to prevent radiation-induced genetic damage in the human population.

  14. Human Cardiac-Derived Stem/Progenitor Cells Fine-Tune Monocyte-Derived Descendants Activities toward Cardiac Repair

    Directory of Open Access Journals (Sweden)

    Noémie Dam

    2017-10-01

    Full Text Available Cardiac repair following MI relies on a finely regulated immune response involving sequential recruitment of monocytes to the injured tissue. Monocyte-derived cells are also critical for tissue homeostasis and healing process. Our previous findings demonstrated the interaction of T and natural killer cells with allogeneic human cardiac-derived stem/progenitor cells (hCPC and suggested their beneficial effect in the context of cardiac repair. Therefore, we investigated here whether monocytes and their descendants could be also modulated by allogeneic hCPC toward a repair/anti-inflammatory phenotype. Through experimental in vitro assays, we assessed the impact of allogeneic hCPC on the recruitment, functions and differentiation of monocytes. We found that allogeneic hCPC at steady state or under inflammatory conditions can incite CCL-2/CCR2-dependent recruitment of circulating CD14+CD16− monocytes and fine-tune their activation toward an anti-inflammatory profile. Allogeneic hCPC also promoted CD14+CD16− monocyte polarization into anti-inflammatory/immune-regulatory macrophages with high phagocytic capacity and IL10 secretion. Moreover, hCPC bended the differentiation of CD14+CD16− monocytes to dendritic cells (DCs toward anti-inflammatory macrophage-like features and impaired their antigen-presenting function in favor of immune-modulation. Collectively, our results demonstrate that allogeneic hCPC could reshape monocytes, macrophages as well as DCs responses by favoring their anti-inflammatory/tolerogenic activation/polarization. Thereby, therapeutic allogeneic hCPC might also contribute to post-infarct myocardial healing by modeling the activities of monocytes and their derived descendants.

  15. Hypospadias repair

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003000.htm Hypospadias repair To use the sharing features on this page, please enable JavaScript. Hypospadias repair is surgery to correct a defect in ...

  16. DNA damage response and repair data with pharmacological modulators of Tousled

    Directory of Open Access Journals (Sweden)

    Prakash Srinivasan Timiri Shanmugam

    2016-06-01

    Full Text Available Human Tousled kinase 1 (TLK1 plays an important role in chromatin remodeling, replication, and DNA damage response and repair. TLK1 activity is immediately, but transiently, downregulated after genotoxic insult, and its recovery is important for exit from checkpoint arrest and cell survival after radiation. The data in this article compliments research presented in the paper titled, “Tousled kinase activator, gallic acid, promotes DNA repair and suppresses radiation cytotoxicity in salivary gland cells” [1]. The identification of small molecule activators and inhibitors of TLK1 provided an opportunity to pharmacologically alter the protein׳s activity to elucidate its role in DNA damage response pathways. TLK1 effectors, gallic acid (GA and thioridazine (THD activate and inhibit the kinase, respectively, and the data report on the impact of these compounds and the significance of TLK1 to DNA break repair and the survival of human salivary acinar cells.

  17. Differential blockade to assess surgical repair by intraoperative active mobilization in knee injuries-Beyond labour analgesia

    Directory of Open Access Journals (Sweden)

    G Vijay Anand

    2011-01-01

    Full Text Available Motor-sparing selective epidural analgesia has long been practised in the field of labour analgesia. However, the utility of such techniques in other fields remain limited. We present the successful use of a similar technique of differential blockade in a case of quadriceps plasty with realignment of patella for recurrent dislocation of patella. A very low concentration of bupivacaine and fentanyl was used through continous epidural. The adequacy of repair was assessed intraoperatively by active movement of operated limb by patient himself.

  18. Chain-breaking antioxidant activity of natural polyphenols as determined during the chain oxidation of methyl linoleate in Triton X-100 micelles.

    Science.gov (United States)

    Roginsky, Vitaly

    2003-06-15

    Natural polyphenols (PP) are known as potent antioxidants, which are believed to prevent many degenerative diseases, including cancer and atherosclerosis. Much attention in the literature has been given to the antioxidant activity of PP-containing products; however, information on the antioxidative properties of individual PP is rather poor and controversial. In this work, the chain-breaking antioxidant activities of several natural PP and their synthetic analogs were determined during the chain oxidation of methyl linoleate in an aqueous buffered, pH 7.40, micellar solution of Triton X-100, induced by 2,2'-azobis(2-amidinopropan) dihydrochloride at 37 degrees C. Use of the mode of the controlled chain reaction allowed separate determination of the rate constant for the reaction of PP with the lipid peroxy radical and the stoichiometric factor of inhibition (f), which shows how many kinetic chains can be terminated by one molecule of PP. All the PP studied display a pronounced antioxidant activity. A significant difference in f value between catechol derivatives and pyrogallol derivatives was found. While with pyrogallol derivatives (gallic acid, epigallocatechin, propyl gallate, myricetin), f was found to be around 2, the theoretically expected value, f, for catechol derivatives (catechol, catechin, epicatechin, quercetin, rutin, caffeic acid) was found to be within the range 3.6-6.3. The elevated antioxidant capacity of catechol derivatives may be explained by the contribution of products of PP oxidative transformation, most likely by dimers, to inhibition. With catechin, epicatechin, and quercetin, the reactivity of products exceeds that of original PP. A real chain-breaking antioxidant activity of PP is likely determined not so much by the reactivity of the original PP as by the probability of the formation of active products and their antioxidant activities. The above findings were applied to explain some features of the antioxidant activity of teas and red

  19. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  20. Double strand breaks can initiate gene silencing and SIRT1-dependent onset of DNA methylation in an exogenous promoter CpG island.

    Directory of Open Access Journals (Sweden)

    Heather M O'Hagan

    2008-08-01

    Full Text Available Chronic exposure to inducers of DNA base oxidation and single and double strand breaks contribute to tumorigenesis. In addition to the genetic changes caused by this DNA damage, such tumors often contain epigenetically silenced genes with aberrant promoter region CpG island DNA hypermethylation. We herein explore the relationships between such DNA damage and epigenetic gene silencing using an experimental model in which we induce a defined double strand break in an exogenous promoter construct of the E-cadherin CpG island, which is frequently aberrantly DNA hypermethylated in epithelial cancers. Following the onset of repair of the break, we observe recruitment to the site of damage of key proteins involved in establishing and maintaining transcriptional repression, namely SIRT1, EZH2, DNMT1, and DNMT3B, and the appearance of the silencing histone modifications, hypoacetyl H4K16, H3K9me2 and me3, and H3K27me3. Although in most cells selected after the break, DNA repair occurs faithfully with preservation of activity of the promoter, a small percentage of the plated cells demonstrate induction of heritable silencing. The chromatin around the break site in such a silent clone is enriched for most of the above silent chromatin proteins and histone marks, and the region harbors the appearance of increasing DNA methylation in the CpG island of the promoter. During the acute break, SIRT1 appears to be required for the transient recruitment of DNMT3B and subsequent methylation of the promoter in the silent clones. Taken together, our data suggest that normal repair of a DNA break can occasionally cause heritable silencing of a CpG island-containing promoter by recruitment of proteins involved in silencing. Furthermore, with contribution of the stress-related protein SIRT1, the break can lead to the onset of aberrant CpG island DNA methylation, which is frequently associated with tight gene silencing in cancer.

  1. Homologous-pairing activity of the human DNA-repair proteins Xrcc3⋅Rad51C

    Science.gov (United States)

    Kurumizaka, Hitoshi; Ikawa, Shukuko; Nakada, Maki; Eda, Keiko; Kagawa, Wataru; Takata, Minoru; Takeda, Shunichi; Yokoyama, Shigeyuki; Shibata, Takehiko

    2001-01-01

    The human Xrcc3 protein is involved in the repair of damaged DNA through homologous recombination, in which homologous pairing is a key step. The Rad51 protein is believed to be the only protein factor that promotes homologous pairing in recombinational DNA repair in mitotic cells. In the brain, however, Rad51 expression is extremely low, whereas XRCC3, a human homologue of Saccharomyces cerevisiae RAD57 that activates the Rad51-dependent homologous pairing with the yeast Rad55 protein, is expressed. In this study, a two-hybrid analysis conducted with the use of a human brain cDNA library revealed that the major Xrcc3-interacting protein is a Rad51 paralog, Rad51C/Rad51L2. The purified Xrcc3⋅Rad51C complex, which shows apparent 1:1 stoichiometry, was found to catalyze the homologous pairing. Although the activity is reduced, the Rad51C protein alone also catalyzed homologous pairing, suggesting that Rad51C is a catalytic subunit for homologous pairing. The DNA-binding activity of Xrcc3⋅Rad51C was drastically decreased in the absence of Xrcc3, indicating that Xrcc3 is important for the DNA binding of Xrcc3⋅Rad51C. Electron microscopic observations revealed that Xrcc3⋅Rad51C and Rad51C formed similar filamentous structures with circular single-stranded DNA. PMID:11331762

  2. Preclinical anti-myeloma activity of EDO-S101, a new bendamustine-derived molecule with added HDACi activity, through potent DNA damage induction and impairment of DNA repair.

    Science.gov (United States)

    López-Iglesias, Ana-Alicia; Herrero, Ana B; Chesi, Marta; San-Segundo, Laura; González-Méndez, Lorena; Hernández-García, Susana; Misiewicz-Krzeminska, Irena; Quwaider, Dalia; Martín-Sánchez, Montserrat; Primo, Daniel; Paíno, Teresa; Bergsagel, P Leif; Mehrling, Thomas; González-Díaz, Marcos; San-Miguel, Jesús F; Mateos, María-Victoria; Gutiérrez, Norma C; Garayoa, Mercedes; Ocio, Enrique M

    2017-06-20

    Despite recent advances in the treatment of multiple myeloma (MM), the prognosis of most patients remains poor, and resistance to traditional and new drugs frequently occurs. EDO-S101 is a novel therapeutic agent conceived as the fusion of a histone deacetylase inhibitor radical to bendamustine, with the aim of potentiating its alkylating activity. The efficacy of EDO-S101 was evaluated in vitro, ex vivo and in vivo, alone, and in combination with standard anti-myeloma agents. The underlying mechanisms of action were also evaluated on MM cell lines, patient samples, and different murine models. EDO-S101 displayed potent activity in vitro in MM cell lines (IC 50 1.6-4.8 μM) and ex vivo in cells isolated from MM patients, which was higher than that of bendamustine and independent of the p53 status and previous melphalan resistance. This activity was confirmed in vivo, in a CB17-SCID murine plasmacytoma model and in de novo Vk*MYC mice, leading to a significant survival improvement in both models. In addition, EDO-S101 was the only drug with single-agent activity in the multidrug resistant Vk12653 murine model. Attending to its mechanism of action, the molecule showed both, a HDACi effect (demonstrated by α-tubulin and histone hyperacetylation) and a DNA-damaging effect (shown by an increase in γH2AX); the latter being again clearly more potent than that of bendamustine. Using a reporter plasmid integrated into the genome of some MM cell lines, we demonstrate that, apart from inducing a potent DNA damage, EDO-S101 specifically inhibited the double strand break repair by the homologous recombination pathway. Moreover, EDO-S101 treatment reduced the recruitment of repair proteins such as RAD51 to DNA-damage sites identified as γH2AX foci. Finally, EDO-S101 preclinically synergized with bortezomib, both in vitro and in vivo. These findings provide rationale for the clinical investigation of EDO-S101 in MM, either as a single agent or in combination with other anti

  3. Feasibility of externally activated self-repairing concrete with epoxy injection network and Cu-Al-Mn superelastic alloy reinforcing bars

    Science.gov (United States)

    Pareek, Sanjay; Shrestha, Kshitij C.; Suzuki, Yusuke; Omori, Toshihiro; Kainuma, Ryosuke; Araki, Yoshikazu

    2014-10-01

    This paper studies the effectiveness of an externally activated self-repairing technique for concrete members with epoxy injection network and Cu-Al-Mn superelastic alloy (SEA) reinforcing bars (rebars). Compared to existing crack self-repairing and self-healing techniques, the epoxy injection network has the following strengths: (1) Different from the self-repairing methods using brittle containers or tubes for adhesives, the proposed self-repair process can be performed repeatedly and is feasible for onsite concrete casting. (2) Different from the autogenic self-healing techniques, full strength recovery can be achieved in a shorter time period without the necessity of water. This paper attempts to enhance the self-repairing capability of the epoxy injection network by reducing residual cracks by using cost-effective Cu-based SEA bars. The effectiveness of the present technique is examined using concrete beam specimens reinforced by 3 types of bars. The first specimen is reinforced by steel deformed bars, the second by steel threaded bars, and finally by SEA threaded rebars. The tests were performed with a 3 point cyclic loading with increasing amplitude. From the test results, effective self-repairing was confirmed for small deformation levels irrespective of the reinforcement types. Effective self-repairing was observed in the SEA reinforced specimen even under much larger deformations. Nonlinear finite element analysis was performed to confirm the experimental findings.

  4. DNA Repair Deficiency in Neurodegeneration

    Science.gov (United States)

    Jeppesen, Dennis Kjølhede; Bohr, Vilhelm A.; Stevnsner, Tinna

    2011-01-01

    Deficiency in repair of nuclear and mitochondrial DNA damage has been linked to several neurodegenerative disorders. Many recent experimental results indicate that the post-mitotic neurons are particularly prone to accumulation of unrepaired DNA lesions potentially leading to progressive neurodegeneration. Nucleotide excision repair is the cellular pathway responsible for removing helix-distorting DNA damage and deficiency in such repair is found in a number of diseases with neurodegenerative phenotypes, including Xeroderma Pigmentosum and Cockayne syndrome. The main pathway for repairing oxidative base lesions is base excision repair, and such repair is crucial for neurons given their high rates of oxygen metabolism. Mismatch repair corrects base mispairs generated during replication and evidence indicates that oxidative DNA damage can cause this pathway to expand trinucleotide repeats, thereby causing Huntington’s disease. Single-strand breaks are common DNA lesions and are associated with the neurodegenerative diseases, ataxia-oculomotor apraxia-1 and spinocerebellar ataxia with axonal neuropathy-1. DNA double-strand breaks are toxic lesions and two main pathways exist for their repair: homologous recombination and non-homologous end-joining. Ataxia telangiectasia and related disorders with defects in these pathways illustrate that such defects can lead to early childhood neurodegeneration. Aging is a risk factor for neurodegeneration and accumulation of oxidative mitochondrial DNA damage may be linked with the age-associated neurodegenerative disorders Alzheimer’s disease, Parkinson’s disease and amyotrophic lateral sclerosis. Mutation in the WRN protein leads to the premature aging disease Werner syndrome, a disorder that features neurodegeneration. In this article we review the evidence linking deficiencies in the DNA repair pathways with neurodegeneration. PMID:21550379

  5. Activation of the Hh pathway in periosteum-derived mesenchymal stem cells induces bone formation in vivo: implication for postnatal bone repair.

    Science.gov (United States)

    Wang, Qun; Huang, Chunlan; Zeng, Fanjie; Xue, Ming; Zhang, Xinping

    2010-12-01

    While the essential role of periosteum in cortical bone repair and regeneration is well established, the molecular pathways that control the early osteogenic and chondrogenic differentiation of periosteal stem/progenitor cells during repair processes are unclear. Using a murine segmental bone graft transplantation model, we isolated a population of early periosteum-callus-derived mesenchymal stem cells (PCDSCs) from the healing autograft periosteum. These cells express typical mesenchymal stem cell markers and are capable of differentiating into osteoblasts, adipocytes, and chondrocytes. Characterization of these cells demonstrated that activation of the hedgehog (Hh) pathway effectively promoted osteogenic and chondrogenic differentiation of PCDSCs in vitro and induced bone formation in vivo. To determine the role of the Hh pathway in adult bone repair, we deleted Smoothened (Smo), the receptor that transduces all Hh signals at the onset of bone autograft repair via a tamoxifen-inducible RosaCreER mouse model. We found that deletion of Smo markedly reduced osteogenic differentiation of isolated PCDSCs and further resulted in a near 50% reduction in periosteal bone callus formation at the cortical bone junction as determined by MicroCT and histomorphometric analyses. These data strongly suggest that the Hh pathway plays an important role in adult bone repair via enhancing differentiation of periosteal progenitors and that activation of the Hh pathway at the onset of healing could be beneficial for repair and regeneration.

  6. Polychlorinated biphenyl quinone induces oxidative DNA damage and repair responses: The activations of NHEJ, BER and NER via ATM-p53 signaling axis.

    Science.gov (United States)

    Dong, Hui; Shi, Qiong; Song, Xiufang; Fu, Juanli; Hu, Lihua; Xu, Demei; Su, Chuanyang; Xia, Xiaomin; Song, Erqun; Song, Yang

    2015-07-01

    Our previous studies demonstrated that polychlorinated biphenyl (PCB) quinone induced oxidative DNA damage in HepG2 cells. To promote genomic integrity, DNA damage response (DDR) coordinates cell-cycle transitions, DNA repair and apoptosis. PCB quinone-induced cell cycle arrest and apoptosis have been documented, however, whether PCB quinone insult induce DNA repair signaling is still unknown. In this study, we identified the activation of DDR and corresponding signaling events in HepG2 cells upon the exposure to a synthetic PCB quinone, PCB29-pQ. Our data illustrated that PCB29-pQ induces the phosphorylation of p53, which was mediated by ataxia telangiectasia mutated (ATM) protein kinase. The observed phosphorylated histone H2AX (γ-H2AX) foci and the elevation of 8-hydroxy-2'-deoxyguanosine (8-OHdG) indicated that DDR was stimulated by PCB29-pQ treatment. Additionally, we found PCB29-pQ activates non-homologous end joining (NHEJ), base excision repair (BER) and nucleotide excision repair (NER) signalings. However, these repair pathways are not error-free processes and aberrant repair of DNA damage may cause the potential risk of carcinogenesis and mutagenesis. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Tribute to dr louis keith: twin and physician extraordinaire/twin research reports: influences on asthma severity; chimerism revisited; DNA strand break repair/media reports: twins born apart; elevated twin frequencies; celebrity father of twins; conjoined twinning.

    Science.gov (United States)

    Segal, Nancy L

    2014-10-01

    The International Society for Twin Studies has lost a valued friend and colleague. Dr Louis Keith, Emeritus Professor of Obstetrics and Gynecology at Northwestern University, in Chicago, passed away on Sunday, July 6, 2014. His life and work with twins will be acknowledged at the November 2014 International Twin Congress in Budapest, Hungary. Next, twin research reports on the severity of asthma symptoms, a case of chimerism, and factors affecting DNA breakage and repair mechanisms are reviewed. Media reports cover twins born apart, elevated twin frequencies, a celebrity father of twins, and a family's decision to keep conjoined twins together.

  8. Enzymes repair radiation injury. What they can do with the fundamental cellular components - experiments with biologically active DNA

    Energy Technology Data Exchange (ETDEWEB)

    Meermann, H.

    1986-01-01

    A cell is able to repair radiation injury all by itself. It houses a variety of very efficient experts for this task, namely repair enzymes, which indeed can repair injuries of the fundamental cellular components, as e.g. the bases of the DNA, and even severe injuries induced by high-energy radiation, as for example X radiation, electrons, neutron, and ion beams.

  9. BRD4 Promotes DNA Repair and Mediates the Formation of TMPRSS2-ERG Gene Rearrangements in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Xiangyi Li

    2018-01-01

    Full Text Available BRD4 belongs to the bromodomain and extraterminal (BET family of chromatin reader proteins that bind acetylated histones and regulate gene expression. Pharmacological inhibition of BRD4 by BET inhibitors (BETi has indicated antitumor activity against multiple cancer types. We show that BRD4 is essential for the repair of DNA double-strand breaks (DSBs and mediates the formation of oncogenic gene rearrangements by engaging the non-homologous end joining (NHEJ pathway. Mechanistically, genome-wide DNA breaks are associated with enhanced acetylation of histone H4, leading to BRD4 recruitment, and stable establishment of the DNA repair complex. In support of this, we also show that, in clinical tumor samples, BRD4 protein levels are negatively associated with outcome after prostate cancer (PCa radiation therapy. Thus, in addition to regulating gene expression, BRD4 is also a central player in the repair of DNA DSBs, with significant implications for cancer therapy.

  10. DNA Repair Defects and Chromosomal Aberrations

    Science.gov (United States)

    Hada, Megumi; George, K. A.; Huff, J. L.; Pluth, J. M.; Cucinotta, F. A.

    2009-01-01

    Yields of chromosome aberrations were assessed in cells deficient in DNA doublestrand break (DSB) repair, after exposure to acute or to low-dose-rate (0.018 Gy/hr) gamma rays or acute high LET iron nuclei. We studied several cell lines including fibroblasts deficient in ATM (ataxia telangiectasia mutated; product of the gene that is mutated in ataxia telangiectasia patients) or NBS (nibrin; product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase (DNA-PK) activity. Chromosomes were analyzed using the fluorescence in situ hybridization (FISH) chromosome painting method in cells at the first division post irradiation, and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma irradiation induced greater yields of both simple and complex exchanges in the DSB repair-defective cells than in the normal cells. The quadratic dose-response terms for both simple and complex chromosome exchanges were significantly higher for the ATM- and NBS-deficient lines than for normal fibroblasts. However, in the NBS cells the linear dose-response term was significantly higher only for simple exchanges. The large increases in the quadratic dose-response terms in these repair-defective cell lines points the importance of the functions of ATM and NBS in chromatin modifications to facilitate correct DSB repair and minimize the formation of aberrations. The differences found between ATM- and NBS-deficient cells at low doses suggest that important questions should with regard to applying observations of radiation sensitivity at high dose to low-dose exposures. For aberrations induced by iron nuclei, regression models preferred purely linear dose responses for simple exchanges and quadratic dose responses for complex exchanges. Relative biological effectiveness (RBE) factors of all of

  11. Bladder exstrophy repair

    Science.gov (United States)

    Bladder birth defect repair; Everted bladder repair; Exposed bladder repair; Repair of bladder exstrophy ... Bladder exstrophy repair involves two surgeries. The first surgery is to repair the bladder. The second one ...

  12. Code breaking in the pacific

    CERN Document Server

    Donovan, Peter

    2014-01-01

    Covers the historical context and the evolution of the technically complex Allied Signals Intelligence (Sigint) activity against Japan from 1920 to 1945 Describes, explains and analyzes the code breaking techniques developed during the war in the Pacific Exposes the blunders (in code construction and use) made by the Japanese Navy that led to significant US Naval victories

  13. Synthesis and quantitative structure-activity relationship of imidazotetrazine prodrugs with activity independent of O6-methylguanine-DNA-methyltransferase, DNA mismatch repair, and p53.

    Science.gov (United States)

    Pletsas, Dimitrios; Garelnabi, Elrashied A E; Li, Li; Phillips, Roger M; Wheelhouse, Richard T

    2013-09-12

    The antitumor prodrug temozolomide is compromised by its dependence for activity on DNA mismatch repair (MMR) and the repair of the chemosensitive DNA lesion, O6-methylguanine (O6-MeG), by O6-methylguanine-DNA-methyltransferase (E.C. 2.1.1.63, MGMT). Tumor response is also dependent on wild-type p53. Novel 3-(2-anilinoethyl)-substituted imidazotetrazines are reported that have activity independent of MGMT, MMR, and p53. This is achieved through a switch of mechanism so that bioactivity derives from imidazotetrazine-generated arylaziridinium ions that principally modify guanine-N7 sites on DNA. Mono- and bifunctional analogues are reported, and a quantitative structure-activity relationship (QSAR) study identified the p-tolyl-substituted bifunctional congener as optimized for potency, MGMT-independence, and MMR-independence. NCI60 data show the tumor cell response is distinct from other imidazotetrazines and DNA-guanine-N7 active agents such as nitrogen mustards and cisplatin. The new imidazotetrazine compounds are promising agents for further development, and their improved in vitro activity validates the principles on which they were designed.

  14. Anti-Inflammatory, Immunomodulatory, and Tissue Repair Activity on Human Keratinocytes by Green Innovative Nanocomposites.

    Science.gov (United States)

    Morganti, Pierfrancesco; Fusco, Alessandra; Paoletti, Iole; Perfetto, Brunella; Del Ciotto, Paola; Palombo, Marco; Chianese, Angelo; Baroni, Adone; Donnarumma, Giovanna

    2017-07-22

    The use of raw materials obtained by waste and processed through innovative industrial methodologies has generated an industry of about a trillion dollars in a short time, and in the near future will provide resources and services for the conservation and sustainable use of natural resources in order to ensure a better and fairer welfare for the human race. The production of nano-fiber chitin non-woven tissue is in accordance with the Organization for Economic Co-operation and Development (OECD) and European Union (EU) bio-economic programs: 100% biodegradable, ecological, and therefore useful in decreasing dependence on fossil fuel resources. The aim of our study is the evaluation of different formulations of a non-woven tissue obtained from electrospinning of a mixture of nanochitin fibrils, lignin, and poly (ethylene) oxide (PEO) on the restoration of damaged tissues. Wound repair is a complex process that involves epithelial and immune cells and includes the induction of metalloproteinases, inflammatory mediators, and angiogenic factors. Our in vitro results have shown that all of the realized chitin nanofibrils-bio-lignin non-woven tissues tested as nontoxic for human keratinocytes (HaCat) cells. Furthermore, the bio-composites that included bio-lignin at 0.1% have been able to modulate the expression of pro-inflammatory cytokines (Tumor Necrosis Factor-α, IL-1α, and IL8), lipopolysaccharide (LPS)-induced, and matrix metalloproteinases (MMPs) and human beta-defensin 2 (HBD-2) expression in HaCat cells, suggesting an anti-inflammatory and immunomodulatory role. Taken together, our results suggest that our chitin nanofibrils-bio-lignin non-woven tissue represents a skin-friendly tool that is able to favor a correct and fast wound repair.

  15. Growth Factor-Reinforced ECM Fabricated from Chemically Hypoxic MSC Sheet with Improved In Vivo Wound Repair Activity.

    Science.gov (United States)

    Du, Hui-Cong; Jiang, Lin; Geng, Wen-Xin; Li, Jing; Zhang, Rui; Dang, Jin-Ge; Shu, Mao-Guo; Li, Li-Wen

    2017-01-01

    MSC treatment can promote cutaneous wound repair through multiple mechanisms, and paracrine mediators secreted by MSC are responsible for most of its therapeutic benefits. Recently, MSC sheet composed of live MSCs and their secreted ECMs was reported to promote wound healing; however, whether its ECM alone could accelerate wound closure remained unknown. In this study, Nc-ECM and Cc-ECM were prepared from nonconditioned and CoCl2-conditioned MSC sheets, respectively, and their wound healing properties were evaluated in a mouse model of full-thickness skin defect. Our results showed that Nc-ECM can significantly promote wound repair through early adipocyte recruitment, rapid reepithelialization, enhanced granulation tissue growth, and augmented angiogenesis. Moreover, conditioning of MSC sheet with CoCl2 dramatically enriched its ECM with collagen I, collagen III, TGF-β1, VEGF, and bFGF via activation of HIF-1α and hence remarkably improved its ECM's in vivo wound healing potency. All the Cc-ECM-treated wounds completely healed on day 7, while Nc-ECM-treated wounds healed about 85.0% ± 8.6%, and no-treatment wounds only healed 69.8% ± 9.6% (p MSC sheet has the potential for clinical translation and will lead to a MSC-derived, cost-effective, bankable biomaterial for wound management.

  16. Repair activity of oxidatively damaged DNA and telomere length in human lung epithelial cells after exposure to multi-walled carbon nanotubes

    DEFF Research Database (Denmark)

    Borghini, Andrea; Roursgaard, Martin; Andreassi, Maria Grazia

    2017-01-01

    the cells toward replicative senescence, assessed by attrition of telomeres. To investigate this, H2O2 and KBrO3 were used to induce DNA damage in the cells and the effect of pre-exposure to MWCNT tested for a change in repair activity inside the cells or in the extract of treated cells. The effect of MWCNT...... at times longer than 24h, but this decrease was not concentration dependent. The results suggest that the seemingly low mutagenicity of CNTs in cultured cells may be associated with an increased DNA repair activity and a replicative senescence, which may counteract the manifestation of DNA lesions...... in cultured cells, whereas these materials appear to induce low or no mutagenicity. Therefore, the present study aimed to investigate whether in vitro exposure of cultured airway epithelial cells (A549) to multi-walled CNTs (MWCNTs) could increase the DNA repair activity of oxidatively damaged DNA and drive...

  17. Metabolism, Genomics, and DNA Repair in the Mouse Aging Liver

    Directory of Open Access Journals (Sweden)

    Michel Lebel

    2011-01-01

    Full Text Available The liver plays a pivotal role in the metabolism of nutrients, drugs, hormones, and metabolic waste products, thereby maintaining body homeostasis. The liver undergoes substantial changes in structure and function within old age. Such changes are associated with significant impairment of many hepatic metabolic and detoxification activities, with implications for systemic aging and age-related disease. It has become clear, using rodent models as biological tools, that genetic instability in the form of gross DNA rearrangements or point mutations accumulate in the liver with age. DNA lesions, such as oxidized bases or persistent breaks, increase with age and correlate well with the presence of senescent hepatocytes. The level of DNA damage and/or mutation can be affected by changes in carcinogen activation, decreased ability to repair DNA, or a combination of these factors. This paper covers some of the DNA repair pathways affecting liver homeostasis with age using rodents as model systems.

  18. [Ocular manifestations in a patient with Cockayne syndrome and simultaneous reduced DNA repair].

    Science.gov (United States)

    Lang, G E; Gebhart, E; Lang, C; Naumann, G O

    1991-06-01

    A 14 year old white boy presented with the typical clinical findings of Cockayne syndrome. Photodermatosis was known since the third week of life. He had disproportionate short stature with a short trunk, long limbs and flexion contractures of the large joints. He also was cachectic and prematurely aged. He had a typical facies. The hearing was slightly impaired. The prominent ocular findings were corneal opacifications, salt and pepper like retinal pigment epithelial changes and optic atrophy. On fibroblast culture the DNA repair activity is usually normal in patients with Cockayne syndrome. The DNA repair activity in our patient however was markedly reduced to 25% of normal. On lymphocyte culture a significantly increased 4-nitroquinoline-1-oxide sensitivity (cytotoxicity and increased break-rate) was found. These findings indicate that the boy has a specific variant of Cockayne syndrome with simultaneously reduced DNA-repair activity.

  19. Clubfoot repair

    Science.gov (United States)

    ... Clubfoot release; Talipes equinovarus - repair; Tibialis anterior tendon transfer Patient ... of the foot. In: Herring JA, ed. Tachdjian's Pediatric Orthopaedics . 5th ed. Philadelphia, PA: Elsevier Saunders; 2014: ...

  20. Sublethal gamma irradiation affects reproductive impairment and elevates antioxidant enzyme and DNA repair activities in the monogonont rotifer Brachionus koreanus

    Energy Technology Data Exchange (ETDEWEB)

    Han, Jeonghoon; Won, Eun-Ji [Department of Biological Sciences, College of Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Kim, Il-Chan; Yim, Joung Han [Division of Life Sciences, Korea Polar Research Institute, Incheon 406-840 (Korea, Republic of); Lee, Su-Jae [Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Sciences, College of Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of)

    2014-10-15

    Highlights: • No mortality within 96 h even at a high intensity (1200 Gy). • A reduced fecundity of Brachionus koreanus at over 150 Gy with a decrease in lifespan. • Dose-dependent ROS increase with GST enzyme activity at sub-lethal doses. • Significant impact on life table parameters, particularly fecundity. • Significant up-regulation of DNA repair-associated genes at sublethal doses. - Abstract: To examine the effects of gamma radiation on marine organisms, we irradiated several doses of gamma ray to the microzooplankton Brachionus koreanus, and measured in vivo and in vitro endpoints including the survival rate, lifespan, fecundity, population growth, gamma ray-induced oxidative stress, and modulated patterns of enzyme activities and gene expressions after DNA damage. After gamma radiation, no individuals showed any mortality within 96 h even at a high intensity (1200 Gy). However, a reduced fecundity (e.g. cumulated number of offspring) of B. koreanus at over 150 Gy was observed along with a slight decrease in lifespan. At 150 Gy and 200 Gy, the reduced fecundity of the rotifers led to a significant decrease in population growth, although in the second generation the population growth pattern was not affected even at 200 Gy when compared to the control group. At sub-lethal doses, reactive oxygen species (ROS) levels dose-dependently increased with GST enzyme activity. In addition, up-regulations of the antioxidant and chaperoning genes in response to gamma radiation were able to recover cellular damages, and life table parameters were significantly influenced, particularly with regard to fecundity. DNA repair-associated genes showed significantly up-regulated expression patterns in response to sublethal doses (150 and 200 Gy), as shown in the expression of the gamma-irradiated B. koreanus p53 gene, suggesting that these sublethal doses were not significantly fatal to B. koreanus but induced DNA damages leading to a decrease of the population size.

  1. Magnetic structure and ferroelectric activity in orthorhombic YMnO3: Relative roles of magnetic symmetry breaking and atomic displacements

    Science.gov (United States)

    Solovyev, I. V.; Valentyuk, M. V.; Mazurenko, V. V.

    2012-10-01

    We discuss the relative roles played by the magnetic inversion symmetry breaking and the ferroelectric (FE) atomic displacements in the multiferroic state of YMnO3. For these purposes we derive a realistic low-energy model, using results of first-principles electronic structure calculations and experimental parameters of the crystal structure below and above the FE transition. Then, we solve this model in the mean-field Hartree-Fock approximation. We argue that the multiferroic state in YMnO3 has a magnetic origin, and the centrosymmetric Pbnm structure is formally sufficient for explaining the main details of the noncentrosymmetric magnetic ground state. The relativistic spin-orbit interaction lifts the degeneracy, caused by the frustration of isotropic exchange interactions in the ab plane, and stabilizes a twofold periodic noncollinear magnetic state, which is similar to the E state apart from the spin canting. The noncentrosymmetric atomic displacements in the P21nm phase reduce the spin canting, but do not change the symmetry of the magnetic state. The effect of the P21nm distortion on the FE polarization ΔPa, parallel to the orthorhombic a axis, is twofold: (i) It gives rise to ionic contributions, associated with the oxygen and yttrium sites; (ii) it affects the electronic polarization, mainly through the change of the spin canting. The relatively small value of ΔPa, observed in the experiment, is caused by a partial cancellation of the electronic and ionic contributions, as well as different contributions in the ionic part, which takes place for the experimental P21nm structure. The twofold periodic magnetic state competes with the fourfold periodic one and, even in the displaced P21nm phase, these two states continue to coexist in a narrow energy range. Finally, we theoretically optimize the crystal structure. For these purposes we employ the LSDA+U approach and assume the collinear E-type antiferromagnetic alignment. Then, we use the obtained structural

  2. Oxidative Genome Damage and Its Repair in Neurodegenerative Diseases: Function of Transition Metals as a Double-Edged Sword

    Science.gov (United States)

    Hegde, Muralidhar L.; Hegde, Pavana M.; Rao, K.S.J.; Mitra, Sankar

    2013-01-01

    The neurons in the central nervous system (CNS) with high O2 consumption and prolonged life span are chronically exposed to high levels of reactive oxygen species (ROS). Accumulation of ROS-induced genome damage in the form of oxidized bases and single-strand breaks (SSBs) as well as their defective or reduced repair in the brain has been implicated in the etiology of various neurological disorders including Alzheimer’s/Parkinson’s diseases (AD/PD). Although inactivating mutations in some DNA repair genes have been linked to hereditary neurodegenerative diseases, the underlying mechanisms of repair deficiencies for the sporadic diseases is not understood. The ROS-induced DNA damages are predominantly repaired via highly conserved and regulated base excision/SSB repair (BER/SSBR) pathway. We recently made an interesting discovery that transition metals iron (Fe) and copper (Cu) which accumulate excessively in the brains of AD, PD and other neurodegenerative diseases, act as a ‘double-edged sword’ by inducing genotoxic ROS and inhibiting DNA damage repair at the same time. These metals inhibit the base excision activity of NEIL family DNA glycosylases by oxidizing them, changing their structure, and inhibiting their binding to downstream repair proteins. Metal chelators and reducing agents partially reverse the inhibition, while curcumin with both chelating and reducing activities reverses the inhibition nearly completely. In this review, we have discussed the possible etiological linkage of BER/SSBR defects to neurodegenerative diseases and therapeutic potential of metal chelators in restoring DNA repair capacity. PMID:21441656

  3. A short physical activity break from cognitive tasks increases selective attention in primary school children aged 10-11

    NARCIS (Netherlands)

    Janssen, M.; Chin A Paw, M.J.M.; Rauh, S.P.; Toussaint, H.M.; van Mechelen, W.; Verhagen, E.A.L.M.

    2014-01-01

    Importance Evidence for an acute effect of physical activity on cognitive performance within the school setting is limited. The purpose of this study was to gain insight into acute effects of a short physical activity bout on selective attention in primary school children, specifically in the school

  4. INTERNAL REPAIR OF PIPELINES

    Energy Technology Data Exchange (ETDEWEB)

    Bill Bruce; Nancy Porter; George Ritter; Matt Boring; Mark Lozev; Ian Harris; Bill Mohr; Dennis Harwig; Robin Gordon; Chris Neary; Mike Sullivan

    2005-07-20

    liners, indicating that this type of liner is only marginally effective at restoring the pressure containing capabilities of pipelines. Failure pressures for larger diameter pipe repaired with a semi-circular patch of carbon fiber-reinforced composite lines were also marginally greater than that of a pipe section with un-repaired simulated damage without a liner. These results indicate that fiber reinforced composite liners have the potential to increase the burst pressure of pipe sections with external damage Carbon fiber based liners are viewed as more promising than glass fiber based liners because of the potential for more closely matching the mechanical properties of steel. Pipe repaired with weld deposition failed at pressures lower than that of un-repaired pipe in both the virgin and damaged conditions, indicating that this repair technology is less effective at restoring the pressure containing capability of pipe than a carbon fiber-reinforced liner repair. Physical testing indicates that carbon fiber-reinforced liner repair is the most promising technology evaluated to-date. In lieu of a field installation on an abandoned pipeline, a preliminary nondestructive testing protocol is being developed to determine the success or failure of the fiber-reinforced liner pipeline repairs. Optimization and validation activities for carbon-fiber repair methods are ongoing.

  5. Parasympathetic nervous system activity predicts mood repair use and its effectiveness among adolescents with and without histories of major depression

    Science.gov (United States)

    Yaroslavsky, Ilya; Rottenberg, Jonathan; Bylsma, Lauren M.; Jennings, J. Richard; George, Charles; Baji, Ildikó; Benák, István; Dochnal, Roberta; Halas, Kitti; Kapornai, Krisztina; Kiss, Enikő; Makai, Attila; Varga, Hedvig; Vetró, Ágnes; Kovacs, Maria

    2016-01-01

    Depressive disorders that onset in the juvenile years have been linked to far reaching adverse consequences, making it imperative to elucidate key mechanisms and contributory factors. Excessive use of regulatory responses that exacerbate sadness (maladaptive mood repair) or insufficient use of regulatory responses that reduce it (adaptive mood repair) may reflect behavioral mechanisms of depression risk. Cardiac vagal control, indexed by patterns of respiratory sinus arrhythmia (RSA), has received attention as a putative physiological risk factor for depression. Although mood repair and RSA are related, the nature of this relationship is not well characterized in the context of depression risk. Therefore, we tested alternative models of the relationships between RSA patterns (at rest and in response to a sad film), trait mood repair, and the effectiveness of a mood repair response in the laboratory (state mood repair) among adolescents with depression histories (n=210) and emotionally healthy peers (n=161). In our data, a mediation model best explained the association between the key constructs: Adolescents with normative RSA patterns exhibited lower levels of depression and trait maladaptive mood repair, and benefited more from instructed (state) mood repair in the laboratory. By contrast, adolescents with atypical RSA patterns exhibited higher levels of depression and dispositional maladaptive mood repair, which, in turn, mediated the relations of RSA patterns and depression symptoms. Atypical RSA patterns also predicted reduced benefits from laboratory mood repair. PMID:26950752

  6. Protein roadblocks and helix discontinuities are barriers to the initiation of mismatch repair

    Science.gov (United States)

    Pluciennik, Anna; Modrich, Paul

    2007-01-01

    The hemimethylated d(GATC) sequence that directs Escherichia coli mismatch repair can reside on either side of a mismatch at a separation distance of 1,000 bp or more. Initiation of repair involves the mismatch-, MutS-, and MutL-dependent activation of MutH endonuclease, which incises the unmethylated strand at the d(GATC) sequence, with the ensuing strand break serving as the loading site for the appropriate 3′-to-5′ or 5′-to-3′ excision system. However, the mechanism responsible for the coordinated recognition of the mismatch and a hemimodified d(GATC) site is uncertain. We show that a protein roadblock (EcoRIE111Q, a hydrolytically defective form of EcoRI endonuclease) placed on the helix between the two DNA sites inhibits MutH activation by 70–80% and that events that escape inhibition are attributable, at least in part, to diffusion of EcoRIE111Q away from its recognition site. We also demonstrate that a double-strand break located within the shorter path linking the mismatch and a d(GATC) site in a circular heteroduplex abolishes MutH activation, whereas a double-strand break within the longer path is without effect. These findings support the idea that initiation of mismatch repair involves signaling along the helix contour. PMID:17620611

  7. DNA repair deficiency in neurodegeneration

    DEFF Research Database (Denmark)

    Jeppesen, Dennis Kjølhede; Bohr, Vilhelm A; Stevnsner, Tinna V.

    2011-01-01

    causing Huntington's disease. Single-strand breaks are common DNA lesions and are associated with the neurodegenerative diseases, ataxia-oculomotor apraxia-1 and spinocerebellar ataxia with axonal neuropathy-1. DNA double-strand breaks are toxic lesions and two main pathways exist for their repair......: homologous recombination and non-homologous end-joining. Ataxia telangiectasia and related disorders with defects in these pathways illustrate that such defects can lead to early childhood neurodegeneration. Aging is a risk factor for neurodegeneration and accumulation of oxidative mitochondrial DNA damage...

  8. Anti-tumour compounds illudin S and Irofulven induce DNA lesions ignored by global repair and exclusively processed by transcription- and replication-coupled repair pathways.

    Science.gov (United States)

    Jaspers, Nicolaas G J; Raams, Anja; Kelner, Michael J; Ng, Jessica M Y; Yamashita, Yukiko M; Takeda, Shiunichi; McMorris, Trevor C; Hoeijmakers, Jan H J

    2002-12-05

    Illudin S is a natural sesquiterpene drug with strong anti-tumour activity. Inside cells, unstable active metabolites of illudin cause the formation of as yet poorly characterised DNA lesions. In order to identify factors involved in their repair, we have performed a detailed genetic survey of repair-defective mutants for responses to the drug. We show that 90% of illudin's lethal effects in human fibroblasts can be prevented by an active nucleotide excision repair (NER) system. Core NER enzymes XPA, XPF, XPG, and TFIIH are essential for recovery. However, the presence of global NER initiators XPC, HR23A/HR23B and XPE is not required, whereas survival, repair and recovery from transcription inhibition critically depend on CSA, CSB and UVS, the factors specific for transcription-coupled NER. Base excision repair and non-homologous end-joining of DNA breaks do not play a major role in the processing of illudin lesions. However, active RAD18 is required for optimal cell survival, indicating that the lesions also block replication forks, eliciting post-replication-repair-like responses. However, the translesion-polymerase DNA pol eta is not involved. We conclude that illudin-induced lesions are exceptional in that they appear to be ignored by all of the known global repair systems, and can only be repaired when trapped in stalled replication or transcription complexes. We show that the semisynthetic illudin derivative hydroxymethylacylfulvene (HMAF, Irofulven), currently under clinical trial for anti-tumour therapy, acts via the same mechanism. Copyright 2002 Elsevier Science B.V.

  9. Mitochondrial base excision repair assays

    DEFF Research Database (Denmark)

    Maynard, Scott; de Souza-Pinto, Nadja C; Scheibye-Knudsen, Morten

    2010-01-01

    The main source of mitochondrial DNA (mtDNA) damage is reactive oxygen species (ROS) generated during normal cellular metabolism. The main mtDNA lesions generated by ROS are base modifications, such as the ubiquitous 8-oxoguanine (8-oxoG) lesion; however, base loss and strand breaks may also occur....... Many human diseases are associated with mtDNA mutations and thus maintaining mtDNA integrity is critical. All of these lesions are repaired primarily by the base excision repair (BER) pathway. It is now known that mammalian mitochondria have BER, which, similarly to nuclear BER, is catalyzed by DNA...

  10. Polychlorinated biphenyl quinone induces oxidative DNA damage and repair responses: The activations of NHEJ, BER and NER via ATM-p53 signaling axis

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Hui; Shi, Qiong; Song, Xiufang; Fu, Juanli; Hu, Lihua; Xu, Demei; Su, Chuanyang; Xia, Xiaomin; Song, Erqun; Song, Yang, E-mail: songyangwenrong@hotmail.com

    2015-07-01

    Our previous studies demonstrated that polychlorinated biphenyl (PCB) quinone induced oxidative DNA damage in HepG2 cells. To promote genomic integrity, DNA damage response (DDR) coordinates cell-cycle transitions, DNA repair and apoptosis. PCB quinone-induced cell cycle arrest and apoptosis have been documented, however, whether PCB quinone insult induce DNA repair signaling is still unknown. In this study, we identified the activation of DDR and corresponding signaling events in HepG2 cells upon the exposure to a synthetic PCB quinone, PCB29-pQ. Our data illustrated that PCB29-pQ induces the phosphorylation of p53, which was mediated by ataxia telangiectasia mutated (ATM) protein kinase. The observed phosphorylated histone H2AX (γ-H2AX) foci and the elevation of 8-hydroxy-2′-deoxyguanosine (8-OHdG) indicated that DDR was stimulated by PCB29-pQ treatment. Additionally, we found PCB29-pQ activates non-homologous end joining (NHEJ), base excision repair (BER) and nucleotide excision repair (NER) signalings. However, these repair pathways are not error-free processes and aberrant repair of DNA damage may cause the potential risk of carcinogenesis and mutagenesis. - Highlights: • Polychlorinated biphenyl quinone induces oxidative DNA damage in HepG2 cells. • The elevation of γ-H2AX and 8-OHdG indicates the activation of DNA damage response. • ATM-p53 signaling acts as the DNA damage sensor and effector. • Polychlorinated biphenyl quinone activates NHEJ, BER and NER signalings.

  11. Poly(ADP-ribose polymerase (PARP-1 is not involved in DNA double-strand break recovery

    Directory of Open Access Journals (Sweden)

    Fernet Marie

    2003-07-01

    Full Text Available Abstract Background The cytotoxicity and the rejoining of DNA double-strand breaks induced by γ-rays, H2O2 and neocarzinostatin, were investigated in normal and PARP-1 knockout mouse 3T3 fibroblasts to determine the role of poly(ADP-ribose polymerase (PARP-1 in DNA double-strand break repair. Results PARP-1-/- were considerably more sensitive than PARP-1+/+ 3T3s to induced cell kill by γ-rays and H2O2. However, the two cell lines did not show any significant difference in the susceptibility to neocarzinostatin below 1.5 nM drug. Restoration of PARP-1 expression in PARP-1-/- 3T3s by retroviral transfection of the full PARP-1 cDNA did not induce any change in neocarzinostatin response. Moreover the incidence and the rejoining kinetics of neocarzinostatin-induced DNA double-strand breaks were identical in PARP-1+/+ and PARP-1-/- 3T3s. Poly(ADP-ribose synthesis following γ-rays and H2O2 was observed in PARP-1-proficient cells only. In contrast neocarzinostatin, even at supra-lethal concentration, was unable to initiate PARP-1 activation yet it induced H2AX histone phosphorylation in both PARP1+/+ and PARP-1-/- 3T3s as efficiently as γ-rays and H2O2. Conclusions The results show that PARP-1 is not a major determinant of DNA double-strand break recovery with either strand break rejoining or cell survival as an endpoint. Even though both PARP-1 and ATM activation are major determinants of the cell response to γ-rays and H2O2, data suggest that PARP-1-dependent poly(ADP-ribose synthesis and ATM-dependent H2AX phosphorylation, are not inter-related in the repair pathway of neocarzinostatin-induced DNA double-strand breaks.

  12. Kinetic theory approach to modeling of cellular repair mechanisms under genome stress.

    Directory of Open Access Journals (Sweden)

    Jinpeng Qi

    Full Text Available Under acute perturbations from outer environment, a normal cell can trigger cellular self-defense mechanism in response to genome stress. To investigate the kinetics of cellular self-repair process at single cell level further, a model of DNA damage generating and repair is proposed under acute Ion Radiation (IR by using mathematical framework of kinetic theory of active particles (KTAP. Firstly, we focus on illustrating the profile of Cellular Repair System (CRS instituted by two sub-populations, each of which is made up of the active particles with different discrete states. Then, we implement the mathematical framework of cellular self-repair mechanism, and illustrate the dynamic processes of Double Strand Breaks (DSBs and Repair Protein (RP generating, DSB-protein complexes (DSBCs synthesizing, and toxins accumulating. Finally, we roughly analyze the capability of cellular self-repair mechanism, cellular activity of transferring DNA damage, and genome stability, especially the different fates of a certain cell before and after the time thresholds of IR perturbations that a cell can tolerate maximally under different IR perturbation circumstances.

  13. INTERNAL REPAIR OF PIPELINES

    Energy Technology Data Exchange (ETDEWEB)

    Robin Gordon; Bill Bruce; Ian Harris; Dennis Harwig; George Ritter; Bill Mohr; Matt Boring; Nancy Porter; Mike Sullivan; Chris Neary

    2004-12-31

    liners, indicating that this type of liner is only marginally effective at restoring the pressure containing capabilities of pipelines. Failure pressures for larger diameter pipe repaired with a semi-circular patch of carbon fiber-reinforced composite lines were also marginally greater than that of a pipe section with un-repaired simulated damage without a liner. These results indicate that fiber reinforced composite liners have the potential to increase the burst pressure of pipe sections with external damage Carbon fiber based liners are viewed as more promising than glass fiber based liners because of the potential for more closely matching the mechanical properties of steel. Pipe repaired with weld deposition failed at pressures lower than that of un-repaired pipe in both the virgin and damaged conditions, indicating that this repair technology is less effective at restoring the pressure containing capability of pipe than a carbon fiber-reinforced liner repair. Physical testing indicates that carbon fiber-reinforced liner repair is the most promising technology evaluated to-date. The first round of optimization and validation activities for carbon-fiber repairs are complete. Development of a comprehensive test plan for this process is recommended for use in the field trial portion of this program.

  14. Modulation Economic Mathematics for the Leveling of the Resources in the Repairs of the Sugar Industry

    Directory of Open Access Journals (Sweden)

    Yaritcet Jiménez–Argota

    2015-12-01

    Full Text Available The administration and control of the repairs in a sugar represent a decisive activity for the good development and later use of the installed industrial capacity, because in dependence this process is executed of how they could diminish the stops for accidental breaks. The objective of the investigation is to optimize the process of repairs to reduce the total costs of the industry, by means of the application of a model of lineal programming for the leveling of the resources: direct manpower and materials. The mathematical pattern proposed for the leveling of the resources according to the value of the total looseness supported in the calculation of the cost slope, they overcome from the planning, the real values of the evaluated period, in the stops for accidental breaks, the productions and the expenses in 27,5 %, 100,7% and 4 % respectively. 

  15. Splicing stimulates siRNA formation at Drosophila DNA double-strand breaks.

    Science.gov (United States)

    Merk, Karin; Breinig, Marco; Böttcher, Romy; Krebs, Stefan; Blum, Helmut; Boutros, Michael; Förstemann, Klaus

    2017-06-01

    DNA double-strand breaks trigger the production of locus-derived siRNAs in fruit flies, human cells and plants. At least in flies, their biogenesis depends on active transcription running towards the break. Since siRNAs derive from a double-stranded RNA precursor, a major question is how broken DNA ends can generate matching sense and antisense transcripts. We performed a genome-wide RNAi-screen in cultured Drosophila cells, which revealed that in addition to DNA repair factors, many spliceosome components are required for efficient siRNA generation. We validated this observation through site-specific DNA cleavage with CRISPR-cas9 followed by deep sequencing of small RNAs. DNA breaks in intron-less genes or upstream of a gene's first intron did not efficiently trigger siRNA production. When DNA double-strand breaks were induced downstream of an intron, however, this led to robust siRNA generation. Furthermore, a downstream break slowed down splicing of the upstream intron and a detailed analysis of siRNA coverage at the targeted locus revealed that unspliced pre-mRNA contributes the sense strand to the siRNA precursor. Since splicing factors are stimulating the response but unspliced transcripts are entering the siRNA biogenesis, the spliceosome is apparently stalled in a pre-catalytic state and serves as a signaling hub. We conclude that convergent transcription at DNA breaks is stimulated by a splicing dependent control process. The resulting double-stranded RNA is converted into siRNAs that instruct the degradation of cognate mRNAs. In addition to a potential role in DNA repair, the break-induced transcription may thus be a means to cull improper RNAs from the transcriptome of Drosophila melanogaster. Since the splicing factors identified in our screen also stimulated siRNA production from high copy transgenes, it is possible that this surveillance mechanism serves in genome defense beyond DNA double-strand breaks.

  16. Mechanism-Based Drug Combinations with the DNA Strand-Breaking Nucleoside Analog CNDAC.

    Science.gov (United States)

    Liu, Xiaojun; Jiang, Yingjun; Nowak, Billie; Hargis, Sarah; Plunkett, William

    2016-10-01

    CNDAC (2'-C-cyano-2'-deoxy-1-β-d-arabino-pentofuranosyl-cytosine, DFP10917) and its orally bioavailable prodrug, sapacitabine, are undergoing clinical trials for hematologic malignancies and solid tumors. The unique action mechanism of inducing DNA strand breaks distinguishes CNDAC from other deoxycytidine analogs. To optimize the clinical potentials of CNDAC, we explored multiple strategies combining CNDAC with chemotherapeutic agents targeting distinct DNA damage repair pathways that are currently in clinical use. The ability of each agent to decrease proliferative potential, determined by clonogenic assays, was determined in paired cell lines proficient and deficient in certain DNA repair proteins. Subsequently, each agent was used in combination with CNDAC at fixed concentration ratios. The clonogenicity was quantitated by median effect analysis, and a combination index was calculated. The c-Abl kinase inhibitor imatinib had synergy with CNDAC in HCT116 cells, regardless of p53 status. Inhibitors of PARP1 that interfere with homologous recombination (HR) repair or base excision repair (BER) and agents such as temozolomide that cause DNA damage repaired by the BER pathway were also synergistic with CNDAC. The toxicity of the nitrogen mustards bendamustine and cytoxan, or of platinum compounds, which generate DNA adducts repaired by nucleotide excision repair and HR, was additive with CNDAC. An additive cell killing was also achieved by the combination of CNDAC with taxane mitotic inhibitors (paclitaxel and docetaxel). At concentrations that allow survival of the majority of wild-type cells, the synergistic or additive combination effects were selective in HR-deficient cells. This study provides mechanistic rationales for combining CNDAC with other active drugs. Mol Cancer Ther; 15(10); 2302-13. ©2016 AACR. ©2016 American Association for Cancer Research.

  17. DNA-Protein Crosslink Proteolysis Repair.

    Science.gov (United States)

    Vaz, Bruno; Popovic, Marta; Ramadan, Kristijan

    2017-06-01

    Proteins that are covalently bound to DNA constitute a specific type of DNA lesion known as DNA-protein crosslinks (DPCs). DPCs represent physical obstacles to the progression of DNA replication. If not repaired, DPCs cause stalling of DNA replication forks that consequently leads to DNA double-strand breaks, the most cytotoxic DNA lesion. Although DPCs are common DNA lesions, the mechanism of DPC repair was unclear until now. Recent work unveiled that DPC repair is orchestrated by proteolysis performed by two distinct metalloproteases, SPARTAN in metazoans and Wss1 in yeast. This review summarizes recent discoveries on two proteases in DNA replication-coupled DPC repair and establishes DPC proteolysis repair as a separate DNA repair pathway for genome stability and protection from accelerated aging and cancer. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Web-Based Activity Breaks: Impacts on Energy Expenditure and Time in Off-Task Behavior in Elementary School Children

    Science.gov (United States)

    Huddleston, Holly Henry

    2017-01-01

    The purpose of study 1 was to characterize energy expenditure (EE) during academic subjects and activities during an elementary school day. Children in 2nd-4th grades (N = 33) wore the SenseWear Armband (SWA) for five school days to measure EE. Teachers' logs were compared to SWA data to extract information about EE throughout the day. Energy…

  19. Saccharomyces cerevisiae Mhr1 can bind Xho I-induced mitochondrial DNA double-strand breaks in vivo.

    Science.gov (United States)

    Prasai, Kanchanjunga; Robinson, Lucy C; Tatchell, Kelly; Harrison, Lynn

    2017-10-12

    Mitochondrial DNA (mtDNA) double-strand break (DSB) repair is essential for maintaining mtDNA integrity, but little is known about the proteins involved in mtDNA DSB repair. Here, we utilize Saccharomyces cerevisiae as a eukaryotic model to identify proteins involved in mtDNA DSB repair. We show that Mhr1, a protein known to possess homologous DNA pairing activity in vitro, binds to mtDNA DSBs in vivo, indicating its involvement in mtDNA DSB repair. Our data also indicate that Yku80, a protein previously implicated in mtDNA DSB repair, does not compete with Mhr1 for binding to mtDNA DSBs. In fact, C-terminally tagged Yku80 could not be detected in yeast mitochondrial extracts. Therefore, we conclude that Mhr1, but not Yku80, is a potential mtDNA DSB repair factor in yeast. Copyright © 2017 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  20. Proteomics-based network analysis characterizes biological processes and pathways activated by preconditioned mesenchymal stem cells in cardiac repair mechanisms.

    Science.gov (United States)

    Di Silvestre, Dario; Brambilla, Francesca; Scardoni, Giovanni; Brunetti, Pietro; Motta, Sara; Matteucci, Marco; Laudanna, Carlo; Recchia, Fabio A; Lionetti, Vincenzo; Mauri, Pierluigi

    2017-05-01

    We have demonstrated that intramyocardial delivery of human mesenchymal stem cells preconditioned with a hyaluronan mixed ester of butyric and retinoic acid (MSCp+) is more effective in preventing the decay of regional myocardial contractility in a swine model of myocardial infarction (MI). However, the understanding of the role of MSCp+ in proteomic remodeling of cardiac infarcted tissue is not complete. We therefore sought to perform a comprehensive analysis of the proteome of infarct remote (RZ) and border zone (BZ) of pigs treated with MSCp+ or unconditioned stem cells. Heart tissues were analyzed by MudPIT and differentially expressed proteins were selected by a label-free approach based on spectral counting. Protein profiles were evaluated by using PPI networks and their topological analysis. The proteomic remodeling was largely prevented in MSCp+ group. Extracellular proteins involved in fibrosis were down-regulated, while energetic pathways were globally up-regulated. Cardioprotectant pathways involved in the production of keto acid metabolites were also activated. Additionally, we found that new hub proteins support the cardioprotective phenotype characterizing the left ventricular BZ treated with MSCp+. In fact, the up-regulation of angiogenic proteins NCL and RAC1 can be explained by the increase of capillary density induced by MSCp+. Our results show that angiogenic pathways appear to be uniquely positioned to integrate signaling with energetic pathways involving cardiac repair. Our findings prompt the use of proteomics-based network analysis to optimize new approaches preventing the post-ischemic proteomic remodeling that may underlie the limited self-repair ability of adult heart. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Clinical Prediction Rule for Declines in Activities of Daily Living at 6 Months After Surgery for Hip Fracture Repair.

    Science.gov (United States)

    Tanaka, Ryo; Umehara, Takuya; Fujimura, Takafumi; Ozawa, Junya

    2016-12-01

    To develop and assess a clinical prediction rule (CPR) to predict declines in activities of daily living (ADL) at 6 months after surgery for hip fracture repair. Prospective, cohort study. From hospital to home. Patients (N=104) with hip fractures after surgery. Not applicable. ADL were assessed using the Barthel Index at 6 months after surgery. At 6 months after surgery, 86 patients (82.6%) were known to be alive, 1 patient (1.0%) had died, and 17 (16.3%) were lost to follow-up. Thirty-two patients (37.2%) did not recover their ADL at 6 months after surgery to levels before fracture. The classification and regression trees methodology was used to develop 2 models to predict a decline in ADL: (1) model 1 included age, type of fracture, and care level before fracture (sensitivity=75.0%, specificity=81.5%, positive predictive value=70.6%, positive likelihood ratio=4.050); and (2) model 2 included the degree of independence 2 weeks postsurgery for ADL chair transfer, ADL ambulation, and age (sensitivity=65.6%, specificity=87.0%, positive predictive value=75.0%, positive likelihood ratio=5.063). The areas under the receiver operating characteristic curves of both CPR models were .825 (95% confidential interval, .728-.923) and .790 (95% confidence interval, .683-.897), respectively. CPRs with moderate accuracy were developed to predict declines in ADL at 6 months after surgery for hip fracture repair. Copyright © 2016 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  2. Effects of combinatorial treatment with pituitary adenylate cyclase activating peptide and human mesenchymal stem cells on spinal cord tissue repair.

    Directory of Open Access Journals (Sweden)

    Kuan-Min Fang

    Full Text Available The aim of this study is to understand if human mesenchymal stem cells (hMSCs and neuropeptide pituitary adenylate cyclase-activating polypeptide (PACAP have synergistic protective effect that promotes functional recovery in rats with severe spinal cord injury (SCI. To evaluate the effect of delayed combinatorial therapy of PACAP and hMSCs on spinal cord tissue repair, we used the immortalized hMSCs that retain their potential of neuronal differentiation under the stimulation of neurogenic factors and possess the properties for the production of several growth factors beneficial for neural cell survival. The results indicated that delayed treatment with PACAP and hMSCs at day 7 post SCI increased the remaining neuronal fibers in the injured spinal cord, leading to better locomotor functional recovery in SCI rats when compared to treatment only with PACAP or hMSCs. Western blotting also showed that the levels of antioxidant enzymes, Mn-superoxide dismutase (MnSOD and peroxiredoxin-1/6 (Prx-1 and Prx-6, were increased at the lesion center 1 week after the delayed treatment with the combinatorial therapy when compared to that observed in the vehicle-treated control. Furthermore, in vitro studies showed that co-culture with hMSCs in the presence of PACAP not only increased a subpopulation of microglia expressing galectin-3, but also enhanced the ability of astrocytes to uptake extracellular glutamate. In summary, our in vivo and in vitro studies reveal that delayed transplantation of hMSCs combined with PACAP provides trophic molecules to promote neuronal cell survival, which also foster beneficial microenvironment for endogenous glia to increase their neuroprotective effect on the repair of injured spinal cord tissue.

  3. Direct Imaging by Cryo-TEM Shows Membrane Break-up by Phospholipase A2 Enzymatic Activity

    DEFF Research Database (Denmark)

    Callisen, Thomas Hønger; Talmon, Y.

    1998-01-01

    increase our insight into the function of PLA2 under physiological conditions as well as into general interfacial catalysis. In the present study we apply for the first time cryo-transmission electron microscopy (cryo-TEM) and high-performance liquid chromatography (HPLC) to characterize the PLA2...... hydrolysis of phospholipid vesicles with respect to changes in lipid composition and morphology. Our direct experimental results show that the initial reaction conditions are strongly perturbed during the course of hydrolysis, Most strikingly, cryo-TEM reveals that starting in the lag phase, vesicles become...... perforated and degrade into open vesicles, bilayer fragments, and micelles, This structural instability extends throughout the system in the activity burst regime. In agreement with earlier reported correlations between initial phospholipase activity and substrate morphology, our results suggest that the lag...

  4. Effect of Content of Sulfate Groups in Seaweed Polysaccharides on Antioxidant Activity and Repair Effect of Subcellular Organelles in Injured HK-2 Cells

    Directory of Open Access Journals (Sweden)

    Xiao-Tao Ma

    2017-01-01

    Full Text Available This study aims to investigate the repair effect of subcellular structure injuries of the HK-2 cells of four degraded seaweed polysaccharides (DSPs, namely, the degraded Porphyra yezoensis, Gracilaria lemaneiformis, Sargassum fusiform, and Undaria pinnatifida polysaccharides. The four DSPs have similar molecular weight, but with different content of sulfate groups (i.e., 17.9%, 13.3%, 8.2%, and 5.5%, resp.. The damaged model was established using 2.8 mmol/L oxalate to injure HK-2 cells, and 60 μg/mL of various DSPs was used to repair the damaged cells. With the increase of sulfate group content in DSPs, the scavenging activity of radicals and their reducing power were all improved. Four kinds of DSPs have repair effect on the subcellular organelles of damaged HK-2 cells. After being repaired by DSPs, the release amount of lactate dehydrogenase was decreased, the integrity of cell membrane and lysosome increased, the Δψm increased, the cell of G1 phase arrest was inhibited, the proportion of S phase increased, and cell apoptotic and necrosis rates were significantly reduced. The greater the content of sulfate group is, the stronger is the repair ability of the polysaccharide. These DSPs, particularly the polysaccharide with higher sulfate group content, may be a potential drug for the prevention and cure of kidney stones.

  5. Variation in Base Excision Repair Capacity

    OpenAIRE

    Wilson, David M.; Kim, Daemyung; Berquist, Brian R.; Sigurdson, Alice J.

    2010-01-01

    The major DNA repair pathway for coping with spontaneous forms of DNA damage, such as natural hydrolytic products or oxidative lesions, is base excision repair (BER). In particular, BER processes mutagenic and cytotoxic DNA lesions such as non-bulky base modifications, abasic sites, and a range of chemically distinct single-strand breaks. Defects in BER have been linked to cancer predisposition, neurodegenerative disorders, and immunodeficiency. Recent data indicate a large degree of sequence...

  6. Consistency of Trend Break Point Estimator with Underspecified Break Number

    Directory of Open Access Journals (Sweden)

    Jingjing Yang

    2017-01-01

    Full Text Available This paper discusses the consistency of trend break point estimators when the number of breaks is underspecified. The consistency of break point estimators in a simple location model with level shifts has been well documented by researchers under various settings, including extensions such as allowing a time trend in the model. Despite the consistency of break point estimators of level shifts, there are few papers on the consistency of trend shift break point estimators in the presence of an underspecified break number. The simulation study and asymptotic analysis in this paper show that the trend shift break point estimator does not converge to the true break points when the break number is underspecified. In the case of two trend shifts, the inconsistency problem worsens if the magnitudes of the breaks are similar and the breaks are either both positive or both negative. The limiting distribution for the trend break point estimator is developed and closely approximates the finite sample performance.

  7. 75 FR 21233 - Incidental Takes of Marine Mammals During Specified Activities; Replacement and Repair of Fur...

    Science.gov (United States)

    2010-04-23

    ... activity (other than commercial fishing) within a specified geographical region if certain findings are... death of any marine mammal occurs that may be a result of the construction activities, NMFS AKR will... that another injury or death does not occur and to ensure that the applicant remains in compliance with...

  8. Symmetry Breaking in Hofstadter's Butterfly in graphene

    Science.gov (United States)

    Forsythe, Carlos; Dean, Cory; Wang, Lei; Maher, Patrick; Ghahari, Fereshte; Moon, Pilkyung; Koshino, Mikito; Taniguchi, Takashi; Watanabe, Kenji; Shepard, Ken; Hone, Jim; Kim, Philip

    2013-03-01

    We will present magnetotransport measurements in hBN encapsulated bilayer graphene devices where one of hBN substrates provides a weak modulation of lattice potential. Under a strong magnetic field, interplay between periodic electric potential and quantizing magnetic field lead to a fractal energy spectrum known as Hofstadter's butterfly. In graphene, while spin and layer symmetry breakings are expected in dual gated devices under large magnetic fields, valley symmetry breaking in the Hofstadter regime is not so easily understood. We will present the observance of these measured gaps along with a discussion of symmetry breaking in our BLG-hBN devices. Further quantitative analysis of these breakings will be presented through the temperature dependence of quantized conductance at these gaps. Through careful modulation of temperature and electron density, we have extracted a range of activation energies associated with symmetry breakings. the speaker acknowledges support from the Columbia Optics and Quantum Electronics IGERT under NSF grant DGE-1069420

  9. Interaction of proliferating cell nuclear antigen with PMS2 is required for MutLα activation and function in mismatch repair

    Science.gov (United States)

    Genschel, Jochen; Kadyrova, Lyudmila Y.; Iyer, Ravi R.; Dahal, Basanta K.; Kadyrov, Farid A.; Modrich, Paul

    2017-01-01

    Eukaryotic MutLα (mammalian MLH1–PMS2 heterodimer; MLH1–PMS1 in yeast) functions in early steps of mismatch repair as a latent endonuclease that requires a mismatch, MutSα/β, and DNA-loaded proliferating cell nuclear antigen (PCNA) for activation. We show here that human PCNA and MutLα interact specifically but weakly in solution to form a complex of approximately 1:1 stoichiometry that depends on PCNA interaction with the C-terminal endonuclease domain of the MutLα PMS2 subunit. Amino acid substitution mutations within a PMS2 C-terminal 721QRLIAP motif attenuate or abolish human MutLα interaction with PCNA, as well as PCNA-dependent activation of MutLα endonuclease, PCNA- and DNA-dependent activation of MutLα ATPase, and MutLα function in in vitro mismatch repair. Amino acid substitution mutations within the corresponding yeast PMS1 motif (723QKLIIP) reduce or abolish mismatch repair in vivo. Coupling of a weak allele within this motif (723AKLIIP) with an exo1Δ null mutation, which individually confer only weak mutator phenotypes, inactivates mismatch repair in the yeast cell. PMID:28439008

  10. Toll pathway is required for wound-induced expression of barrier repair genes in the Drosophila epidermis

    Science.gov (United States)

    Capilla, Amalia; Karachentsev, Dmitry; Patterson, Rachel A.; Hermann, Anita; Juarez, Michelle T.; McGinnis, William

    2017-01-01

    The epidermis serves as a protective barrier in animals. After epidermal injury, barrier repair requires activation of many wound response genes in epidermal cells surrounding wound sites. Two such genes in Drosophila encode the enzymes dopa decarboxylase (Ddc) and tyrosine hydroxylase (ple). In this paper we explore the involvement of the Toll/NF-κB pathway in the localized activation of wound repair genes around epidermal breaks. Robust activation of wound-induced transcription from ple and Ddc requires Toll pathway components ranging from the extracellular ligand Spätzle to the Dif transcription factor. Epistasis experiments indicate a requirement for Spätzle ligand downstream of hydrogen peroxide and protease function, both of which are known activators of wound-induced transcription. The localized activation of Toll a few cell diameters from wound edges is reminiscent of local activation of Toll in early embryonic ventral hypoderm, consistent with the hypothesis that the dorsal–ventral patterning function of Toll arose from the evolutionary cooption of a morphogen-responsive function in wound repair. Furthermore, the combinatorial activity of Toll and other signaling pathways in activating epidermal barrier repair genes can help explain why developmental activation of the Toll, ERK, or JNK pathways alone fail to activate wound repair loci. PMID:28289197

  11. Transcriptomic analysis of tail regeneration in the lizard Anolis carolinensis reveals activation of conserved vertebrate developmental and repair mechanisms.

    Directory of Open Access Journals (Sweden)

    Elizabeth D Hutchins

    Full Text Available Lizards, which are amniote vertebrates like humans, are able to lose and regenerate a functional tail. Understanding the molecular basis of this process would advance regenerative approaches in amniotes, including humans. We have carried out the first transcriptomic analysis of tail regeneration in a lizard, the green anole Anolis carolinensis, which revealed 326 differentially expressed genes activating multiple developmental and repair mechanisms. Specifically, genes involved in wound response, hormonal regulation, musculoskeletal development, and the Wnt and MAPK/FGF pathways were differentially expressed along the regenerating tail axis. Furthermore, we identified 2 microRNA precursor families, 22 unclassified non-coding RNAs, and 3 novel protein-coding genes significantly enriched in the regenerating tail. However, high levels of progenitor/stem cell markers were not observed in any region of the regenerating tail. Furthermore, we observed multiple tissue-type specific clusters of proliferating cells along the regenerating tail, not localized to the tail tip. These findings predict a different mechanism of regeneration in the lizard than the blastema model described in the salamander and the zebrafish, which are anamniote vertebrates. Thus, lizard tail regrowth involves the activation of conserved developmental and wound response pathways, which are potential targets for regenerative medical therapies.

  12. Repair of diverse diabetic defects of β-cells in man and mouse by pharmacological glucokinase activation.

    Science.gov (United States)

    Doliba, Nicolai M; Fenner, Deborah; Zelent, Bogumil; Bass, Joseph; Sarabu, Ramakanth; Matschinsky, Franz M

    2012-10-01

    Glucokinase activators (GKAs) are being developed and clinically tested for potential antidiabetic therapy. The potential benefits and limitations of this approach continue to be intensively debated. To contribute to the understanding of experimental pharmacology and therapeutics of GKAs, we have tested the efficacy of one of these agents (Piragliatin) in isolated islets from humans with type 2 diabetes mellitus (T2DM), from mice with glucokinase (GK) mutations induced by ethyl-nitroso-urea (ENU) as models of Maturity Onset Diabetes of the Young linked to GK and Permanent Neonatal Diabetes Mellitus linked to GK (PNDM-GK) and finally of islets rendered glucose insensitive by treatment with the sulphonyl urea compound glyburide in organ culture. We found that the GKA repaired the defect in all three instances as manifest in increased glucose-induced insulin release and elevated intracellular calcium responses. The results show the remarkable fact that acute pharmacological activation of GK reverses secretion defects of β-cells caused by molecular mechanism that differ vastly in nature, including the little understood multifactorial lesion of β-cells in T2DM of man, the complex GK mutations in mice resembling GK disease and acute sulphonylurea failure of mouse β-cells in tissue culture. The implications of these results are to be discussed on the theoretical basis underpinning the strategy of developing these drugs and in light of recent results of clinical trials with GKAs that failed for little understood reasons. © 2012 Blackwell Publishing Ltd.

  13. The impact of rainfall and school break time policies on physical activity in 9-10 year old British children: a repeated measures study

    Directory of Open Access Journals (Sweden)

    Cassidy Aedín

    2011-05-01

    Full Text Available Abstract Background The weather may be a driver of seasonal patterns in children's physical activity (PA. A better understanding of the relationships between weather and PA may help increase children's PA. This study aims to examine the association between PA and rainfall in 9-10 year old children, and how it may be modified by school policies. Methods 1794 participants in the SPEEDY study in Norfolk, UK recorded PA using ActiGraph accelerometers over up to six days in the summer term of 2007. Multilevel regression models were used to determine the day-by-day association between rainfall and minutes spent sedentary, in moderate-to-vigorous PA (MVPA, and average counts per minute (cpm over the whole day (07:00-21:00 and the lunchtime period (12:00-14:00. School policies for break times in bad weather were fitted as interaction terms with rainfall. Results Relative to days with no rain, children spent 9.4 minutes (95%CI 7.0 to 11.9 fewer in MVPA, were sedentary for 13.6 minutes (8.8 to 18.4 more, and accumulated 85.9 cpm (66.2 to 105.5 fewer over the whole day on the wettest days. Children allowed to play outside in wet weather showed the lowest lunchtime PA levels on the wettest days, undertaking 9.8 minutes (6.2 to 13.5 fewer MVPA, 16.1 minutes (10.3 to 21.9 more sedentary, and accumulating 408.0 cpm (250.9 to 565.1 fewer than those allowed to be active indoors. Conclusions Rainfall is negatively associated with PA in primary school children, but providing indoor physical activities in wet weather may help children maintain physical activity levels irrespective of rainfall.

  14. The Association of Low-Penetrance Variants in DNA Repair Genes with Colorectal Cancer: A Systematic Review and Meta-Analysis

    OpenAIRE

    Aggarwal, Nikhil; Donald, Neil D; Malik, Salim; Selvendran, Subothini S; McPhail, Mark JW.; Monahan, Kevin J

    2017-01-01

    Objectives: Approximately 35% of colorectal cancer (CRC) risk is attributable to heritable factors known hereditary syndromes, accounting for 6%. The remainder may be due to lower penetrance polymorphisms particularly of DNA repair genes. DNA repair pathways, including base excision repair (BER), nucleotide excision repair (NER), mismatch repair (MMR), direct reversal repair (DRR), and double-strand break repair are complex, evolutionarily conserved, and critical in carcinogenesis. Germline m...

  15. Recurrent shoulder instability among athletes: changes in quality of life, sports activity, and muscle function following open repair.

    Science.gov (United States)

    Meller, Rupert; Krettek, Christian; Gösling, Thomas; Wähling, Knut; Jagodzinski, Michael; Zeichen, Johannes

    2007-03-01

    Recurrent anterior shoulder instability is a disabling condition in young athletes with possibly underestimated impact on quality of life and sports activity. Commonly used clinical scoring systems do not reflect the impairment of quality of life and sports activity. It was our aim to assess the return to preinjury levels of quality of life and sports activity as well as the changes in muscle function among competitive and recreational athletes. Patients suffering from post-traumatic recurrent shoulder instability have to adopt their participation in sports and therefore discover a reduction in quality of life. Open stabilization procedures are able to improve shoulder function and to reduce recurrence rates. However, return to preinjury shoulder function is not guaranteed. Retrospective longitudinal cohort study on 19 consecutive athletes with recurrent, post-traumatic shoulder instability. All patients were treated with an open, capsulo-labral repair. The minimum follow-up was 24 months. Life quality (SF12) and sports activity data (Athletic Shoulder Outcome Scoring System) were retrospectively collected for the time before injury (time 1) and for the time with recurrent instability (time 2). Two years after surgical stabilization (time 3), we followed our patients with different clinical outcome scores, rotator surface EMG measurement, isokinetic muscle strength testing, and a radiological evaluation. This design of a three-step follow-up allowed for calculating the impact on quality of life and sports activity following the injury. Two years after surgery, the clinical scoring systems revealed good-to-excellent results in all patients. Quality of life physical component summary remained diminished by 9.2% despite the surgical procedure and was therefore significantly lower as compared to preinjury levels (p Sports activity was also significantly lower at the time of follow-up (p life and sports activity 2 years after surgery. Muscle activity and muscle strength

  16. Mutagenicity of 2-amino-3-methylimidazo[4,5-f]quinoline in colon and liver of Big Blue Rats: role of DNA adducts, strand breaks, DNA repair and oxidative stress

    DEFF Research Database (Denmark)

    Møller, Peter; Wallin, Håkan; Vogel, Ulla

    2002-01-01

    , indicating a higher rate of protein oxidation in the liver following IQ administration. In plasma and erythrocytes there were unaltered levels of oxidized protein, malondialdehyde, and antioxidant enzyme activities (superoxide dismutase, glutathione peroxidase, catalase, glutathione reductase) indicating...

  17. Protozoan ALKBH8 Oxygenases Display both DNA Repair and tRNA Modification Activities

    DEFF Research Database (Denmark)

    Zdżalik, Daria; Vågbø, Cathrine B; Kirpekar, Finn

    2014-01-01

    , interestingly, two protozoan ALKBH8s also catalyzed wobble uridine modification of tRNA, thus displaying a dual in vitro activity. Also, we found the modification status of tRNAGly(UCC) to be unaltered in an ALKBH8 deficient mutant of Agrobacterium tumefaciens, indicating that bacterial ALKBH8s have a function...

  18. Of Heart & Kidneys: Hands-On Activities for Demonstrating Organ Function & Repair

    Science.gov (United States)

    Kao, Robert M.

    2014-01-01

    A major challenge in teaching organ development and disease is deconstructing a complex choreography of molecular and cellular changes over time into a linear stepwise process for students. As an entry toward learning developmental concepts, I propose two inexpensive hands-on activities to help facilitate learning of (1) how to identify defects in…

  19. β-Catenin Activation in Muscle Progenitor Cells Regulates Tissue Repair.

    Science.gov (United States)

    Rudolf, Anja; Schirwis, Elija; Giordani, Lorenzo; Parisi, Alice; Lepper, Christoph; Taketo, Makoto Mark; Le Grand, Fabien

    2016-05-10

    Skeletal muscle regeneration relies on a pool of resident muscle stem cells called satellite cells (MuSCs). Following injury-induced destruction of the myofibers, quiescent MuSCs are activated and generate transient amplifying progenitors (myoblasts) that will fuse to form new myofibers. Here, we focus on the canonical Wnt signaling pathway and find that either conditional β-catenin disruption or activation in adult MuSCs results in perturbation of muscle regeneration. Using both in vivo and in vitro approaches, we observed that myoblasts lacking β-catenin show delayed differentiation, whereas myoblasts with constitutively active β-catenin undergo precocious growth arrest and differentiation. Transcriptome analysis further demonstrated that Wnt/β-catenin signaling interacts with multiple pathways and, more specifically, TGF-β signaling. Indeed, exogenous TGF-β2 stimulation restores the regenerative potential of muscles with targeted β-catenin disruption in MuSCs. We conclude that a precise level of β-catenin activity is essential for regulating the amplification and differentiation of MuSC descendants during adult myogenesis. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  20. APOBEC3G enhances lymphoma cell radioresistance by promoting cytidine deaminase-dependent DNA repair.

    Science.gov (United States)

    Nowarski, Roni; Wilner, Ofer I; Cheshin, Ori; Shahar, Or D; Kenig, Edan; Baraz, Leah; Britan-Rosich, Elena; Nagler, Arnon; Harris, Reuben S; Goldberg, Michal; Willner, Itamar; Kotler, Moshe

    2012-07-12

    APOBEC3 proteins catalyze deamination of cytidines in single-stranded DNA (ssDNA), providing innate protection against retroviral replication by inducing deleterious dC > dU hypermutation of replication intermediates. APOBEC3G expression is induced in mitogen-activated lymphocytes; however, no physiologic role related to lymphoid cell proliferation has yet to be determined. Moreover, whether APOBEC3G cytidine deaminase activity transcends to processing cellular genomic DNA is unknown. Here we show that lymphoma cells expressing high APOBEC3G levels display efficient repair of genomic DNA double-strand breaks (DSBs) induced by ionizing radiation and enhanced survival of irradiated cells. APOBEC3G transiently accumulated in the nucleus in response to ionizing radiation and was recruited to DSB repair foci. Consistent with a direct role in DSB repair, inhibition of APOBEC3G expression or deaminase activity resulted in deficient DSB repair, whereas reconstitution of APOBEC3G expression in leukemia cells enhanced DSB repair. APOBEC3G activity involved processing of DNA flanking a DSB in an integrated reporter cassette. Atomic force microscopy indicated that APOBEC3G multimers associate with ssDNA termini, triggering multimer disassembly to multiple catalytic units. These results identify APOBEC3G as a prosurvival factor in lymphoma cells, marking APOBEC3G as a potential target for sensitizing lymphoma to radiation therapy.

  1. Exonuclease 1 and its versatile roles in DNA repair

    DEFF Research Database (Denmark)

    Keijzers, Guido; Liu, Dekang; Rasmussen, Lene Juel

    2016-01-01

    Exonuclease 1 (EXO1) is a multifunctional 5' → 3' exonuclease and a DNA structure-specific DNA endonuclease. EXO1 plays roles in DNA replication, DNA mismatch repair (MMR) and DNA double-stranded break repair (DSBR) in lower and higher eukaryotes and contributes to meiosis, immunoglobulin...

  2. Early active rehabilitation after arthroscopic rotator cuff repair: a prospective randomized pilot study.

    Science.gov (United States)

    Raschhofer, Rudolf; Poulios, Nikos; Schimetta, Wolfgang; Kisling, Rüdiger; Mittermaier, Christian

    2017-10-01

    To compare two different rehabilitation strategies, primary passive motion versus early isometric loading of the rotator cuff. Prospective randomized controlled observer-blinded pilot study. Institute of Physical Medicine and Rehabilitation. Thirty patients after rotator cuff surgery. All participants were randomly assigned to one of the two outpatient treatment groups: primary passive motion versus early isometric loading of the rotator cuff. Both groups were treated for 12 weeks and performed additionally a home exercise program. The primary outcome measure for functional assessment was the Constant Murley score. The secondary outcome measures were the Disabilities of the Arm, Shoulder and Hand score (DASH), active range of motion, pain level and strength. Patients were assessed before, 6, 12 and 24 weeks after surgery. Repeatedly measured metric variables were compared by the Quade rank analysis of covariance and revealed substantially better Constant Murley scores in the early activated group at all 3 assessments (6 weeks: 41 [31;45] versus 30 [23;37]; 12 weeks: 68 [56;77] versus 59 [53;62]; 24 weeks: 79 [76;81] versus 66 [62;74]; data as median [25%;75%]). Postoperative changes of Constant score were in favour of the active group with the biggest difference at week 12 (28 [38;12] versus 9 [27;-4]). Maximal pain levels showed clear more reduction 6 and 24 weeks after surgery in the early activated group. This pilot study with early isometric loading of the rotator cuff shows better function and less maximal pain. Further research is warranted to confirm our results.

  3. Evaluation of cytotoxicity and gelatinases activity in 3T3 fibroblast cell by root repair materials

    OpenAIRE

    Varol Basak; Tuna Elif Bahar; Karsli Emine; Kasimoglu Yelda; Koruyucu Mine; Seymen Figen; Nurten Rustem

    2016-01-01

    The aim of this study was to investigate the effects of calcium silicate-based products on cytotoxicity in the 3T3 fibroblast and gelatinolytic activity of matrix metalloproteinases (MMPs). 3T3 fibroblasts were incubated directly with Ortho Mineral trioxide aggregate (MTA), BioAggregate, Biodentine, MTA Plus, MTA Angelus and MTA Cerkamed for 24 hours and seven days. The cytotoxicity was determined using an MTT assay. Supernatants were collected to determine MMP-2 and MMP-9. Data were analysed...

  4. Shiga Toxin 1, as DNA Repair Inhibitor, Synergistically Potentiates the Activity of the Anticancer Drug, Mafosfamide, on Raji Cells

    Directory of Open Access Journals (Sweden)

    Piero Sestili

    2013-02-01

    Full Text Available Shiga toxin 1 (Stx1, produced by pathogenic Escherichia coli, targets a restricted subset of human cells, which possess the receptor globotriaosylceramide (Gb3Cer/CD77, causing hemolytic uremic syndrome. In spite of the high toxicity, Stx1 has been proposed in the treatment of Gb3Cer/CD77-expressing lymphoma. Here, we demonstrate in a Burkitt lymphoma cell model expressing this receptor, namely Raji cells, that Stx1, at quasi-non-toxic concentrations (0.05–0.1 pM, inhibits the repair of mafosfamide-induced DNA alkylating lesions, synergistically potentiating the cytotoxic activity of the anticancer drug. Conversely, human promyelocytic leukemia cells HL-60, which do not express Gb3Cer/CD77, were spared by the toxin as previously demonstrated for CD34+ human progenitor cells, and hence, in this cancer model, no additive nor synergistic effects were observed with the combined Stx1/mafosfamide treatment. Our findings suggest that Stx1 could be used to improve the mafosfamide-mediated purging of Gb3Cer/CD77+ tumor cells before autologous bone marrow transplantation.

  5. Homeostatic nuclear RAGE–ATM interaction is essential for efficient DNA repair

    Science.gov (United States)

    Kumar, Varun; Fleming, Thomas; Terjung, Stefan; Gorzelanny, Christian; Gebhardt, Christoffer; Agrawal, Raman; Mall, Marcus A.; Ranzinger, Julia; Zeier, Martin; Madhusudhan, Thati; Ranjan, Satish; Isermann, Berend; Liesz, Arthur; Deshpande, Divija; Häring, Hans-Ulrich; Biswas, Subrata K; Reynolds, Paul R.; Hammes, Hans-Peter; Peperkok, Rainer; Angel, Peter; Herzig, Stephan

    2017-01-01

    Abstract The integrity of genome is a prerequisite for healthy life. Indeed, defects in DNA repair have been associated with several human diseases, including tissue-fibrosis, neurodegeneration and cancer. Despite decades of extensive research, the spatio-mechanical processes of double-strand break (DSB)-repair, especially the auxiliary factor(s) that can stimulate accurate and timely repair, have remained elusive. Here, we report an ATM-kinase dependent, unforeseen function of the nuclear isoform of the Receptor for Advanced Glycation End-products (nRAGE) in DSB-repair. RAGE is phosphorylated at Serine376 and Serine389 by the ATM kinase and is recruited to the site of DNA-DSBs via an early DNA damage response. nRAGE preferentially co-localized with the MRE11 nuclease subunit of the MRN complex and orchestrates its nucleolytic activity to the ATR kinase signaling. This promotes efficient RPA2S4-S8 and CHK1S345 phosphorylation and thereby prevents cellular senescence, IPF and carcinoma formation. Accordingly, loss of RAGE causatively linked to perpetual DSBs signaling, cellular senescence and fibrosis. Importantly, in a mouse model of idiopathic pulmonary fibrosis (RAGE−/−), reconstitution of RAGE efficiently restored DSB-repair and reversed pathological anomalies. Collectively, this study identifies nRAGE as a master regulator of DSB-repair, the absence of which orchestrates persistent DSB signaling to senescence, tissue-fibrosis and oncogenesis. PMID:28977635

  6. Both genetic and dietary factors underlie individual differences in DNA damage levels and DNA repair capacity.

    Science.gov (United States)

    Slyskova, Jana; Lorenzo, Yolanda; Karlsen, Anette; Carlsen, Monica H; Novosadova, Vendula; Blomhoff, Rune; Vodicka, Pavel; Collins, Andrew R

    2014-04-01

    The interplay between dietary habits and individual genetic make-up is assumed to influence risk of cancer, via modulation of DNA integrity. Our aim was to characterize internal and external factors that underlie inter-individual variability in DNA damage and repair and to identify dietary habits beneficial for maintaining DNA integrity. Habitual diet was estimated in 340 healthy individuals using a food frequency questionnaire and biomarkers of antioxidant status were quantified in fasting blood samples. Markers of DNA integrity were represented by DNA strand breaks, oxidized purines, oxidized pyrimidines and a sum of all three as total DNA damage. DNA repair was characterized by genetic variants and functional activities of base and nucleotide excision repair pathways. Sex, fruit-based food consumption and XPG genotype were factors significantly associated with the level of DNA damage. DNA damage was higher in women (p=0.035). Fruit consumption was negatively associated with the number of all measured DNA lesions, and this effect was mediated mostly by β-cryptoxanthin and β-tocopherol (pindividual antioxidants were also associated with DNA repair capacity; both the base and nucleotide excision repairs were lower in women and the latter increased with higher plasma levels of ascorbic acid and α-carotene (pgenetic and dietary factors that modulate DNA integrity. We propose that the positive health effect of fruit intake is partially mediated via DNA damage suppression and a simultaneous increase in DNA repair capacity. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Operational maneuvers and pipelines activities repairs for the 32 inches scraper tool recovering

    Energy Technology Data Exchange (ETDEWEB)

    Valdivia, Jose; Salguero, Luis; Villanueva, Pedro [Compania Operadora del Gas Amazonas, Lima (Peru)

    2009-07-01

    Transportadora de Gas del Peru and the Compania Operadora de Gas del Amazonas, responsible companies of the transport, operation and maintenance of the pipelines who transport natural gas and natural gas liquids respectively of the Camisea Project - Peru, following the internal policies and the maintenance plan of the pipeline transportation system was planned the activities for the internal pipeline inspection of these activities for 729.3 Km of natural gas pipeline covering diameters of 32 inches, 24 inches and 18 inches. After the first run of the cleaning tool, was scheduled the launch of the dummy scraper (scraper tool) along to the first 210 Km of the 32 inches natural gas pipeline , given changes in elevation along the trace and the low flow of transport. This scraper tool could not reach the final destination. After many series operational maneuvers as venting, creation of differential pressure in valves, the scraper tool only reach the first 75 Km of the trace. After an exhaustive analysis of trending pressure variations, it was concluded that this scraper showed intermittent progress of short durations, concluding that this scraper had not reach the next check point. In this way was decided to conduct operational maneuvers in order to locate, relocated and retrieve the scrapper tool from de 32 inches natural gas pipeline. (author)

  8. Global analysis of double-strand break processing reveals in vivo properties of the helicase-nuclease complex AddAB.

    Science.gov (United States)

    Badrinarayanan, Anjana; Le, Tung B K; Spille, Jan-Hendrik; Cisse, Ibrahim I; Laub, Michael T

    2017-05-01

    In bacteria, double-strand break (DSB) repair via homologous recombination is thought to be initiated through the bi-directional degradation and resection of DNA ends by a helicase-nuclease complex such as AddAB. The activity of AddAB has been well-studied in vitro, with translocation speeds between 400-2000 bp/s on linear DNA suggesting that a large section of DNA around a break site is processed for repair. However, the translocation rate and activity of AddAB in vivo is not known, and how AddAB is regulated to prevent excessive DNA degradation around a break site is unclear. To examine the functions and mechanistic regulation of AddAB inside bacterial cells, we developed a next-generation sequencing-based approach to assay DNA processing after a site-specific DSB was introduced on the chromosome of Caulobacter crescentus. Using this assay we determined the in vivo rates of DSB processing by AddAB and found that putative chi sites attenuate processing in a RecA-dependent manner. This RecA-mediated regulation of AddAB prevents the excessive loss of DNA around a break site, limiting the effects of DSB processing on transcription. In sum, our results, taken together with prior studies, support a mechanism for regulating AddAB that couples two key events of DSB repair-the attenuation of DNA-end processing and the initiation of homology search by RecA-thereby helping to ensure that genomic integrity is maintained during DSB repair.

  9. Booster Breaks in the workplace: participants’ perspectives on health-promoting work breaks

    Science.gov (United States)

    Taylor, Wendell C.; King, Kathryn E.; Shegog, Ross; Paxton, Raheem J.; Evans-Hudnall, Gina L.; Rempel, David M.; Chen, Vincent; Yancey, Antronette K.

    2013-01-01

    Increasing sedentary work has been associated with greater cardiovascular and metabolic risk, as well as premature mortality. Interrupting the sedentary workday with health-promoting work breaks can counter these negative health effects. To examine the potential sustainability of work-break programs, we assessed the acceptance of these breaks among participants in a Booster Break program. We analyzed qualitative responses from 35 participants across five worksites where one 15-min physical activity break was taken each workday. Two worksites completed a 1-year intervention and three worksites completed a 6-month intervention. Responses to two open-ended questions about the acceptance and feasibility of Booster Breaks were obtained from a survey administered after the intervention. Three themes for benefits and two themes for barriers were identified. The benefit themes were (i) reduced stress and promoted enjoyment, (ii) increased health awareness and facilitated behavior change, and (iii) enhanced workplace social interaction. The barrier themes were the need for (iv) greater variety in Booster Break routines and (v) greater management support. This study provides empirical support for the acceptance and feasibility of Booster Breaks during the workday. Emphasizing the benefits and minimizing the barriers are strategies that can be used to implement Booster Breaks in other workplaces. PMID:23466367

  10. Histone Variant Regulates DNA Repair via Chromatin Condensation | Center for Cancer Research

    Science.gov (United States)

    Activating the appropriate DNA repair pathway is essential for maintaining the stability of the genome after a break in both strands of DNA. How a pathway is selected, however, is not well understood. Since these double strand breaks (DSBs) occur while DNA is packaged as chromatin, changes in its organization are necessary for repair to take place. Numerous alterations have been associated with DSBs, including modifications of histone tails and exchange of histone variants, some increasing chromatin accessibility, others reducing it. In fact, distinct domains flanking a single DSB have been observed that are bound by opposing repair pathway proteins 53BP1and BRCA1, which promote non-homologous end joining (NHEJ) and homologous recombination (HR), respectively. To investigate whether DSB-proximal chromatin reorganization affects repair pathway selection, Philipp Oberdoerffer, Ph.D., of CCR’s Laboratory of Receptor Biology and Gene Expression, and his colleagues performed a high-throughput RNA interference (RNAi) screen for chromatin-related genes that modulate HR.

  11. Reliability measures of a computer system with priority to PM over the H/W repair activities subject to MOT and MRT

    Directory of Open Access Journals (Sweden)

    Ashish Kumar

    2015-01-01

    Full Text Available This paper concentrates on the evaluation of reliability measures of a computer system of two-identical units having independent failure of h/w and s/w components. Initially one unit is operative and the other is kept as spare in cold standby. There is a single server visiting the system immediately whenever needed. The server conducts preventive maintenance of the unit after a maximum operation time. If server is unable to repair the h/w components in maximum repair time, then components in the unit are replaced immediately by new one. However, only replacement of the s/w components has been made at their failure. The priority is given to the preventive maintenance over repair activities of the h/w. The time to failure of the components follows negative exponential distribution whereas the distribution of preventive maintenance, repair and replacement time are taken as arbitrary. The expressions for some important reliability measures of system effectiveness have been derived using semi-Markov process and regenerative point technique. The graphical behavior of the results has also been shown for a particular case.

  12. A novel role of the Dna2 translocase function in DNA break resection.

    Science.gov (United States)

    Miller, Adam S; Daley, James M; Pham, Nhung Tuyet; Niu, Hengyao; Xue, Xiaoyu; Ira, Grzegorz; Sung, Patrick

    2017-03-01

    DNA double-strand break repair by homologous recombination entails nucleolytic resection of the 5' strand at break ends. Dna2, a flap endonuclease with 5'-3' helicase activity, is involved in the resection process. The Dna2 helicase activity has been implicated in Okazaki fragment processing during DNA replication but is thought to be dispensable for DNA end resection. Unexpectedly, we found a requirement for the helicase function of Dna2 in end resection in budding yeast cells lacking exonuclease 1. Biochemical analysis reveals that ATP hydrolysis-fueled translocation of Dna2 on ssDNA facilitates 5' flap cleavage near a single-strand-double strand junction while attenuating 3' flap incision. Accordingly, the ATP hydrolysis-defective dna2-K1080E mutant is less able to generate long products in a reconstituted resection system. Our study thus reveals a previously unrecognized role of the Dna2 translocase activity in DNA break end resection and in the imposition of the 5' strand specificity of end resection. © 2017 Miller et al.; Published by Cold Spring Harbor Laboratory Press.

  13. Evaluation of cytotoxicity and gelatinases activity in 3T3 fibroblast cell by root repair materials

    Directory of Open Access Journals (Sweden)

    Varol Basak

    2016-09-01

    Full Text Available The aim of this study was to investigate the effects of calcium silicate-based products on cytotoxicity in the 3T3 fibroblast and gelatinolytic activity of matrix metalloproteinases (MMPs. 3T3 fibroblasts were incubated directly with Ortho Mineral trioxide aggregate (MTA, BioAggregate, Biodentine, MTA Plus, MTA Angelus and MTA Cerkamed for 24 hours and seven days. The cytotoxicity was determined using an MTT assay. Supernatants were collected to determine MMP-2 and MMP-9. Data were analysed using IBM SPSS 22. Seventh day extracts of Ortho MTA and Biodentine showed reduced cell viability. Specific characterization of MMPs in cell culture demonstrated that MMP-2 (62 kPa in the cell culture supernatants by gelatin zymography showed induced expression in four out of seven groups by 3T3 cells. No MMP-9 expression was observed. The cytotoxicity of materials revealed a significant difference in cell viability between the groups on the first and seventh days. The results of this study revealed minor cytotoxic effects for Ortho MTA and Biodentine. This study suggests that endodontic sealers induced production of MMP-2. MMP-9 might be expressed in small amounts when compared with MMP-2.

  14. Polynucleotide kinase/phosphatase, Pnk1, is involved in base excision repair in Schizosaccharomyces pombe.

    Science.gov (United States)

    Kashkina, Ekaterina; Qi, Tao; Weinfeld, Michael; Young, Dallan

    2012-08-01

    We previously reported that Schizosaccharomyces pombe pnk1 cells are more sensitive than wild-type cells to γ-radiation and camptothecin, indicating that Pnk1 is required for DNA repair. Here, we report that pnk1pku70 and pnk1rhp51 double mutants are more sensitive to γ-radiation than single mutants, from which we infer that Pnk1's primary role is independent of either homologous recombination or non-homologous end joining mechanisms. We also report that pnk1 cells are more sensitive than wild-type cells to oxidizing and alkylating agents, suggesting that Pnk1 is involved in base excision repair. Mutational analysis of Pnk1 revealed that the DNA 3'-phosphatase activity is necessary for repair of DNA damage, whereas the 5'-kinase activity is dispensable. A role for Pnk1 in base excision repair is supported by genetic analyses which revealed that pnk1apn2 is synthetically lethal, suggesting that Pnk1 and Apn2 may function in parallel pathways essential for the repair of endogenous DNA damage. Furthermore, the nth1pnk1apn2 and tdp1pnk1apn2 triple mutants are viable, implying that single-strand breaks with 3'-blocked termini produced by Nth1 and Tdp1 contribute to synthetic lethality. We also examined the sensitivity to methyl methanesulfonate of all single and double mutant combinations of nth1, apn2, tdp1 and pnk1. Together, our results support a model where Tdp1 and Pnk1 act in concert in an Apn2-independent base excision repair pathway to repair 3'-blocked termini produced by Nth1; and they also provide evidence that Pnk1 has additional roles in base excision repair. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Repair process and a repaired component

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, III, Herbert Chidsey; Simpson, Stanley F.

    2018-02-20

    Matrix composite component repair processes are disclosed. The matrix composite repair process includes applying a repair material to a matrix composite component, securing the repair material to the matrix composite component with an external securing mechanism and curing the repair material to bond the repair material to the matrix composite component during the securing by the external securing mechanism. The matrix composite component is selected from the group consisting of a ceramic matrix composite, a polymer matrix composite, and a metal matrix composite. In another embodiment, the repair process includes applying a partially-cured repair material to a matrix composite component, and curing the repair material to bond the repair material to the matrix composite component, an external securing mechanism securing the repair material throughout a curing period, In another embodiment, the external securing mechanism is consumed or decomposed during the repair process.

  16. Breaking Therapeutic Inertia in Type 2 Diabetes: Active Detection of In-Patient Cases Allows Improvement of Metabolic Control at Midterm

    Directory of Open Access Journals (Sweden)

    Anna M. Lucas Martín

    2015-01-01

    Full Text Available Type 2 diabetes (T2D exists in 25–40% of hospitalized patients. Therapeutic inertia is the delay in the intensification of a treatment and it is frequent in T2D. The objectives of this study were to detect patients admitted to surgical wards with hyperglycaemia (HH; fasting glycaemia > 140 mg/dL as well as those with T2D and suboptimal chronic glycaemic control (SCGC and to assess the midterm impact of treatment modifications indicated at discharge. A total of 412 HH patients were detected in a period of 18 months; 86.6% (357 had a diagnosed T2D. Their preadmittance HbA1c was 7.7 ± 1.5%; 47% (189 had HbA1c ≥ 7.4% (SCGC and were moved to the upper step in the therapeutic algorithm at discharge. Another 15 subjects (3.6% of the cohort had T2D according to their current HbA1c. Ninety-four of the 189 SCGC patients were evaluated 3–6 months later. Their HbA1c before in-hospital-intervention was 8.6 ± 1.2% and 7.5 ± 1.2% at follow-up (P<0.004. Active detection of hyperglycaemia in patients admitted in conventional surgical beds permits the identification of T2D patients with SCGC as well as previously unknown cases. A shift to the upper step in the therapeutic algorithm at discharge improves this control. Hospitalization is an opportunity to break therapeutic inertia.

  17. Motorcycle Repair.

    Science.gov (United States)

    Hein, Jim; Bundy, Mike

    This motorcycle repair curriculum guide contains the following ten areas of study: brake systems, clutches, constant mesh transmissions, final drives, suspension, mechanical starting mechanisms, electrical systems, fuel systems, lubrication systems, and overhead camshafts. Each area consists of one or more units of instruction. Each instructional…

  18. Omphalocele repair

    Science.gov (United States)

    ... your child to visit a very ill sibling Surgical wound care - open Images Omphalocele repair - series References Chung DH. Pediatric surgery. In: Townsend CM Jr, Beauchamp RD, Evers BM, Mattox KL, ... Modern Surgical Practice . 20th ed. Philadelphia, PA: Elsevier; 2017:chap ...

  19. Turbine repair process, repaired coating, and repaired turbine component

    Science.gov (United States)

    Das, Rupak; Delvaux, John McConnell; Garcia-Crespo, Andres Jose

    2015-11-03

    A turbine repair process, a repaired coating, and a repaired turbine component are disclosed. The turbine repair process includes providing a turbine component having a higher-pressure region and a lower-pressure region, introducing particles into the higher-pressure region, and at least partially repairing an opening between the higher-pressure region and the lower-pressure region with at least one of the particles to form a repaired turbine component. The repaired coating includes a silicon material, a ceramic matrix composite material, and a repaired region having the silicon material deposited on and surrounded by the ceramic matrix composite material. The repaired turbine component a ceramic matrix composite layer and a repaired region having silicon material deposited on and surrounded by the ceramic matrix composite material.

  20. Recombinational DNA repair and human disease

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Larry H.; Schild, David

    2002-11-30

    We review the genes and proteins related to the homologous recombinational repair (HRR) pathway that are implicated in cancer through either genetic disorders that predispose to cancer through chromosome instability or the occurrence of somatic mutations that contribute to carcinogenesis. Ataxia telangiectasia (AT), Nijmegen breakage syndrome (NBS), and an ataxia-like disorder (ATLD), are chromosome instability disorders that are defective in the ataxia telangiectasia mutated (ATM), NBS, and Mre11 genes, respectively. These genes are critical in maintaining cellular resistance to ionizing radiation (IR), which kills largely by the production of double-strand breaks (DSBs). Bloom syndrome involves a defect in the BLM helicase, which seems to play a role in restarting DNA replication forks that are blocked at lesions, thereby promoting chromosome stability. The Werner syndrome gene (WRN) helicase, another member of the RecQ family like BLM, has very recently been found to help mediate homologous recombination. Fanconi anemia (FA) is a genetically complex chromosomal instability disorder involving seven or more genes, one of which is BRCA2. FA may be at least partially caused by the aberrant production of reactive oxidative species. The breast cancer-associated BRCA1 and BRCA2 proteins are strongly implicated in HRR; BRCA2 associates with Rad51 and appears to regulate its activity. We discuss in detail the phenotypes of the various mutant cell lines and the signaling pathways mediated by the ATM kinase. ATM's phosphorylation targets can be grouped into oxidative stress-mediated transcriptional changes, cell cycle checkpoints, and recombinational repair. We present the DNA damage response pathways by using the DSB as the prototype lesion, whose incorrect repair can initiate and augment karyotypic abnormalities.

  1. The recombination protein RAD52 cooperates with the excision repair protein OGG1 for the repair of oxidative lesions in mammalian cells

    DEFF Research Database (Denmark)

    de Souza-Pinto, Nadja C; Maynard, Scott; Hashiguchi, Kazunari

    2009-01-01

    Oxidized bases are common types of DNA modifications. Their accumulation in the genome is linked to aging and degenerative diseases. These modifications are commonly repaired by the base excision repair (BER) pathway. Oxoguanine DNA glycosylase (OGG1) initiates BER of oxidized purine bases. A small...... activities and RAD52 stimulates OGG1 incision activity, likely increasing its turnover rate. RAD52 colocalizes with OGG1 after oxidative stress to cultured cells, but not after the direct induction of double-strand breaks by ionizing radiation. Human cells depleted of RAD52 via small interfering RNA...... knockdown, and mouse cells lacking the protein via gene knockout showed increased sensitivity to oxidative stress. Moreover, cells depleted of RAD52 show higher accumulation of oxidized bases in their genome than cells with normal levels of RAD52. Our results indicate that RAD52 cooperates with OGG1...

  2. Model Breaking Points Conceptualized

    Science.gov (United States)

    Vig, Rozy; Murray, Eileen; Star, Jon R.

    2014-01-01

    Current curriculum initiatives (e.g., National Governors Association Center for Best Practices and Council of Chief State School Officers 2010) advocate that models be used in the mathematics classroom. However, despite their apparent promise, there comes a point when models break, a point in the mathematical problem space where the model cannot,…

  3. Quantifying DNA double-strand breaks induced by site-specific endonucleases in living cells by ligation-mediated purification.

    Science.gov (United States)

    Chailleux, Catherine; Aymard, François; Caron, Pierre; Daburon, Virginie; Courilleau, Céline; Canitrot, Yvan; Legube, Gaëlle; Trouche, Didier

    2014-03-01

    Recent advances in our understanding of the management and repair of DNA double-strand breaks (DSBs) rely on the study of targeted DSBs that have been induced in living cells by the controlled activity of site-specific endonucleases, usually recombinant restriction enzymes. Here we describe a protocol for quantifying these endonuclease-induced DSBs; this quantification is essential to an interpretation of how DSBs are managed and repaired. A biotinylated double-stranded oligonucleotide is ligated to enzyme-cleaved genomic DNA, allowing the purification of the cleaved DNA on streptavidin beads. The extent of cleavage is then quantified either by quantitative PCR (qPCR) at a given site or at multiple sites by genome-wide techniques (e.g., microarrays or high-throughput sequencing). This technique, named ligation-mediated purification, can be performed in 2 d. It is more accurate and sensitive than existing alternative methods, and it is compatible with genome-wide analysis. It allows the amount of endonuclease-mediated breaks to be precisely compared between two conditions or across the genome, thereby giving insight into the influence of a given factor or of various chromatin contexts on local repair parameters.

  4. Germline stem cell gene PIWIL2 mediates DNA repair through relaxation of chromatin.

    Directory of Open Access Journals (Sweden)

    De-Tao Yin

    Full Text Available DNA damage response (DDR is an intrinsic barrier of cell to tumorigenesis initiated by genotoxic agents. However, the mechanisms underlying the DDR are not completely understood despite of extensive investigation. Recently, we have reported that ectopic expression of germline stem cell gene PIWIL2 is associated with tumor stem cell development, although the underlying mechanisms are largely unknown. Here we show that PIWIL2 is required for the repair of DNA-damage induced by various types of genotoxic agents. Upon ultraviolet (UV irradiation, silenced PIWIL2 gene in normal human fibroblasts was transiently activated after treatment with UV light. This activation was associated with DNA repair, because Piwil2-deficienct mouse embryonic fibroblasts (mili(-/- MEFs were defective in cyclobutane pyrimidine dimers (CPD repair after UV treatment. As a result, the UV-treated mili(-/- MEFs were more susceptible to apoptosis, as characterized by increased levels of DNA damage-associated apoptotic proteins, such as active caspase-3, cleaved Poly (ADP-ribose polymerase (PARP and Bik. The impaired DNA repair in the mili(-/- MEFs was associated with the reductions of histone H3 acetylation and chromatin relaxation, although the DDR pathway downstream chromatin relaxation appeared not to be directly affected by Piwil2. Moreover, guanine-guanine (Pt-[GG] and double strand break (DSB repair were also defective in the mili(-/- MEFs treated by genotoxic chemicals Cisplatin and ionizing radiation (IR, respectively. The results indicate that Piwil2 can mediate DNA repair through an axis of Piwil2 → histone acetylation → chromatin relaxation upstream DDR pathways. The findings reveal a new role for Piwil2 in DNA repair and suggest that Piwil2 may act as a gatekeeper against DNA damage-mediated tumorigenesis.

  5. Influence of irofulven, a transcription-coupled repair-specific antitumor agent, on RNA polymerase activity, stability and dynamics in living mammalian cells.

    Science.gov (United States)

    Escargueil, Alexandre E; Poindessous, Virginie; Soares, Daniele Grazziotin; Sarasin, Alain; Cook, Peter R; Larsen, Annette K

    2008-04-15

    Transcription-coupled repair (TCR) plays a key role in the repair of DNA lesions induced by bulky adducts and is initiated when the elongating RNA polymerase II (Pol II) stalls at DNA lesions. This is accompanied by alterations in Pol II activity and stability. We have previously shown that the monofunctional adducts formed by irofulven (6-hydroxymethylacylfulvene) are exclusively recognized by TCR, without involvement of global genome repair (GGR), making irofulven a unique tool to characterize TCR-associated processes in vivo. Here, we characterize the influence of irofulven on Pol II activity, stability and mobility in living mammalian cells. Our results demonstrate that irofulven induces specific inhibition of nucleoplasmic RNA synthesis, an important decrease of Pol II mobility, coupled to the accumulation of initiating polymerase and a time-dependent loss of the engaged enzyme, associated with its polyubiquitylation. Both proteasome-mediated degradation of the stalled polymerase and new protein synthesis are necessary to allow Pol II recycling into preinitiating complexes. Together, our findings provide novel insights into the subsequent fate of the stalled RNA polymerase II and demonstrate the essential role of the recycling process for transcriptional reinitiation and viability of mammalian cells.

  6. Prolonged particulate chromate exposure does not inhibit homologous recombination repair in North Atlantic right whale (Eubalaena glacialis) lung cells.

    Science.gov (United States)

    Browning, Cynthia L; Wise, Catherine F; Wise, John Pierce

    2017-09-15

    Chromosome instability is a common feature of cancers that forms due to the misrepair of DNA double strand breaks. Homologous recombination (HR) repair is a high fidelity DNA repair pathway that utilizes a homologous DNA sequence to accurately repair such damage and protect the genome. Prolonged exposure (>72h) to the human lung carcinogen, particulate hexavalent chromium (Cr(VI)), inhibits HR repair, resulting in increased chromosome instability in human cells. Comparative studies have shown acute Cr(VI) exposure induces less chromosome damage in whale cells than human cells, suggesting investigating the effect of this carcinogen in other species may inform efforts to prevent Cr(VI)-induced chromosome instability. Thus, the goal of this study was to determine the effect of prolonged Cr(VI) exposure on HR repair and clastogenesis in North Atlantic right whale (Eubalaena glacialis) lung cells. We show particulate Cr(VI) induces HR repair activity after both acute (24h) and prolonged (120h) exposure in North Atlantic right whale cells. Although the RAD51 response was lower following prolonged Cr(VI) exposure compared to acute exposure, the response was sufficient for HR repair to occur. In accordance with active HR repair, no increase in Cr(VI)-induced clastogenesis was observed with increased exposure time. These results suggest prolonged Cr(VI) exposure affects HR repair and genomic stability differently in whale and human lung cells. Future investigation of the differences in how human and whale cells respond to chemical carcinogens may provide valuable insight into mechanisms of preventing chemical carcinogenesis. Copyright © 2017. Published by Elsevier Inc.

  7. Drosophila DNA polymerase theta utilizes both helicase-like and polymerase domains during microhomology-mediated end joining and interstrand crosslink repair.

    Directory of Open Access Journals (Sweden)

    Kelly Beagan

    2017-05-01

    Full Text Available Double strand breaks (DSBs and interstrand crosslinks (ICLs are toxic DNA lesions that can be repaired through multiple pathways, some of which involve shared proteins. One of these proteins, DNA Polymerase θ (Pol θ, coordinates a mutagenic DSB repair pathway named microhomology-mediated end joining (MMEJ and is also a critical component for bypass or repair of ICLs in several organisms. Pol θ contains both polymerase and helicase-like domains that are tethered by an unstructured central region. While the role of the polymerase domain in promoting MMEJ has been studied extensively both in vitro and in vivo, a function for the helicase-like domain, which possesses DNA-dependent ATPase activity, remains unclear. Here, we utilize genetic and biochemical analyses to examine the roles of the helicase-like and polymerase domains of Drosophila Pol θ. We demonstrate an absolute requirement for both polymerase and ATPase activities during ICL repair in vivo. However, similar to mammalian systems, polymerase activity, but not ATPase activity, is required for ionizing radiation-induced DSB repair. Using a site-specific break repair assay, we show that overall end-joining efficiency is not affected in ATPase-dead mutants, but there is a significant decrease in templated insertion events. In vitro, Pol θ can efficiently bypass a model unhooked nitrogen mustard crosslink and promote DNA synthesis following microhomology annealing, although ATPase activity is not required for these functions. Together, our data illustrate the functional importance of the helicase-like domain of Pol θ and suggest that its tethering to the polymerase domain is important for its multiple functions in DNA repair and damage tolerance.

  8. Conserved structural chemistry for incision activity in structurally non-homologous apurinic/apyrimidinic endonuclease APE1 and endonuclease IV DNA repair enzymes.

    Energy Technology Data Exchange (ETDEWEB)

    Tsutakawa, Susan E.; Shin, David S.; Mol, Clifford D.; Izum, Tadahide; Arvai, Andrew S.; Mantha, Anil K.; Szczesny, Bartosz; Ivanov, Ivaylo N.; Hosfield, David J.; Maiti, Buddhadev; Pique, Mike E.; Frankel, Kenneth A.; Hitomi, Kenichi; Cunningham, Richard P.; Mitra, Sankar; Tainer, John A.

    2013-03-22

    Non-coding apurinic/apyrimidinic (AP) sites in DNA form spontaneously and as DNA base excision repair intermediates are the most common toxic and mutagenic in vivo DNA lesion. For repair, AP sites must be processed by 5' AP endonucleases in initial stages of base repair. Human APE1 and bacterial Nfo represent the two conserved 5' AP endonuclease families in the biosphere; they both recognize AP sites and incise the phosphodiester backbone 5' to the lesion, yet they lack similar structures and metal ion requirements. Here, we determined and analyzed crystal structures of a 2.4 ? resolution APE1-DNA product complex with Mg(2+) and a 0.92 Nfo with three metal ions. Structural and biochemical comparisons of these two evolutionarily distinct enzymes characterize key APE1 catalytic residues that are potentially functionally similar to Nfo active site components, as further tested and supported by computational analyses. We observe a magnesium-water cluster in the APE1 active site, with only Glu-96 forming the direct protein coordination to the Mg(2+). Despite differences in structure and metal requirements of APE1 and Nfo, comparison of their active site structures surprisingly reveals strong geometric conservation of the catalytic reaction, with APE1 catalytic side chains positioned analogously to Nfo metal positions, suggesting surprising functional equivalence between Nfo metal ions and APE1 residues. The finding that APE1 residues are positioned to substitute for Nfo metal ions is supported by the impact of mutations on activity. Collectively, the results illuminate the activities of residues, metal ions, and active site features for abasic site endonucleases.

  9. [Neural repair].

    Science.gov (United States)

    Kitada, Masaaki; Dezawa, Mari

    2008-05-01

    Recent progress of stem cell biology gives us the hope for neural repair. We have established methods to specifically induce functional Schwann cells and neurons from bone marrow stromal cells (MSCs). The effectiveness of these induced cells was evaluated by grafting them either into peripheral nerve injury, spinal cord injury, or Parkinson' s disease animal models. MSCs-derived Schwann cells supported axonal regeneration and re-constructed myelin to facilitate the functional recovery in peripheral and spinal cord injury. MSCs-derived dopaminergic neurons integrated into host striatum and contributed to behavioral repair. In this review, we introduce the differentiation potential of MSCs and finally discuss about their benefits and drawbacks of these induction systems for cell-based therapy in neuro-traumatic and neuro-degenerative diseases.

  10. Balancing Pathways in DNA Double Strand Break Repair

    NARCIS (Netherlands)

    I. Brandsma (Inger)

    2016-01-01

    markdownabstractAll information a cell needs to live and survive is stored in the genomic DNA. Maintenance of an intact and uncompromised genome is of vital importance for cell survival. Damaged DNA can block transcription and replication, processes essential for cell viability. Persistent DNA

  11. Pseudomonas pyocyanin inhibits wound repair by inducing premature cellular senescence: role for p38 mitogen-activated protein kinase.

    Science.gov (United States)

    Muller, Michael; Li, Zhe; Maitz, Peter K M

    2009-06-01

    Pseudomonas aeruginosa is an important nosocomial pathogen of burn wounds. Pyocyanin, a virulence factor produced by the bacterium, induces persistent intracellular oxidative stress and premature senescence in mammalian cells. Our aims were to evaluate pyocyanin levels in infected wound dressings and the potential of the toxin to influence wound repair. Surgical dressings from infected burn patients were examined for pyocyanin and normal primary human diploid fibroblasts (HDFs) were treated with comparable concentrations and their replicative ability examined. Pyocyanin was detected in the exudate of infected wound dressings in amounts up to 5.3 microg/g (mean: 2.0+/-2.3 microg/g). HDFs exposed to pyocyanin (1-50 microM; 0.2-10.5 microg/ml) underwent growth arrest at all concentrations and developed morphological characteristics associated with cellular senescence, including expression of senescence-associated beta-galactosidase. Using an in vitro wound repair model, a single exposure to pyocyanin inhibited wound repair in a concentration-dependent manner. Prior treatment with a specific p38(MAPK) inhibitor allowed cells to maintain their replicative ability and pre-senescent morphology indicating pyocyanin operates through the Erk/p38(MAPK) senescence pathway. These data support the hypothesis that bacterial virulence factors capable of inducing persistent low-level oxidative stress play a pivotal role in modulating the tissue repair response to infection by inducing premature cellular senescence.

  12. Assaying Break and Nick-Induced Homologous Recombination in Mammalian Cells Using the DR-GFP Reporter and Cas9 Nucleases

    NARCIS (Netherlands)

    Vriend, Lianne E. M.; Jasin, Maria; Krawczyk, Przemek M.

    2014-01-01

    Thousands of DNA breaks occur daily in mammalian cells, including potentially tumorigenic double-strand breaks (DSBs) and less dangerous but vastly more abundant single-strand breaks (SSBs). The majority of SSBs are quickly repaired, but some can be converted to DSBs, posing a threat to the

  13. Interference in DNA replication can cause mitotic chromosomal breakage unassociated with double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Mari Fujita

    Full Text Available Morphological analysis of mitotic chromosomes is used to detect mutagenic chemical compounds and to estimate the dose of ionizing radiation to be administered. It has long been believed that chromosomal breaks are always associated with double-strand breaks (DSBs. We here provide compelling evidence against this canonical theory. We employed a genetic approach using two cell lines, chicken DT40 and human Nalm-6. We measured the number of chromosomal breaks induced by three replication-blocking agents (aphidicolin, 5-fluorouracil, and hydroxyurea in DSB-repair-proficient wild-type cells and cells deficient in both homologous recombination and nonhomologous end-joining (the two major DSB-repair pathways. Exposure of cells to the three replication-blocking agents for at least two cell cycles resulted in comparable numbers of chromosomal breaks for RAD54(-/-/KU70(-/- DT40 clones and wild-type cells. Likewise, the numbers of chromosomal breaks induced in RAD54(-/-/LIG4(-/- Nalm-6 clones and wild-type cells were also comparable. These data indicate that the replication-blocking agents can cause chromosomal breaks unassociated with DSBs. In contrast with DSB-repair-deficient cells, chicken DT40 cells deficient in PIF1 or ATRIP, which molecules contribute to the completion of DNA replication, displayed higher numbers of mitotic chromosomal breaks induced by aphidicolin than did wild-type cells, suggesting that single-strand gaps left unreplicated may result in mitotic chromosomal breaks.

  14. Break-induced telomere synthesis underlies alternative telomere maintenance.

    Science.gov (United States)

    Dilley, Robert L; Verma, Priyanka; Cho, Nam Woo; Winters, Harrison D; Wondisford, Anne R; Greenberg, Roger A

    2016-11-03

    Homology-directed DNA repair is essential for genome maintenance through templated DNA synthesis. Alternative lengthening of telomeres (ALT) necessitates homology-directed DNA repair to maintain telomeres in about 10-15% of human cancers. How DNA damage induces assembly and execution of a DNA replication complex (break-induced replisome) at telomeres or elsewhere in the mammalian genome is poorly understood. Here we define break-induced telomere synthesis and demonstrate that it utilizes a specialized replisome, which underlies ALT telomere maintenance. DNA double-strand breaks enact nascent telomere synthesis by long-tract unidirectional replication. Proliferating cell nuclear antigen (PCNA) loading by replication factor C (RFC) acts as the initial sensor of telomere damage to establish predominance of DNA polymerase δ (Pol δ) through its POLD3 subunit. Break-induced telomere synthesis requires the RFC-PCNA-Pol δ axis, but is independent of other canonical replisome components, ATM and ATR, or the homologous recombination protein Rad51. Thus, the inception of telomere damage recognition by the break-induced replisome orchestrates homology-directed telomere maintenance.

  15. Role of Double-Strand Break End-Tethering during Gene Conversion in Saccharomyces cerevisiae

    Science.gov (United States)

    Haber, James E.

    2016-01-01

    Correct repair of DNA double-strand breaks (DSBs) is critical for maintaining genome stability. Whereas gene conversion (GC)-mediated repair is mostly error-free, repair by break-induced replication (BIR) is associated with non-reciprocal translocations and loss of heterozygosity. We have previously shown that a Recombination Execution Checkpoint (REC) mediates this competition by preventing the BIR pathway from acting on DSBs that can be repaired by GC. Here, we asked if the REC can also determine whether the ends that are engaged in a GC-compatible configuration belong to the same break, since repair involving ends from different breaks will produce potentially deleterious translocations. We report that the kinetics of repair are markedly delayed when the two DSB ends that participate in GC belong to different DSBs (termed Trans) compared to the case when both DSB ends come from the same break (Cis). However, repair in Trans still occurs by GC rather than BIR, and the overall efficiency of repair is comparable. Hence, the REC is not sensitive to the “origin” of the DSB ends. When the homologous ends for GC are in Trans, the delay in repair appears to reflect their tethering to sequences on the other side of the DSB that themselves recombine with other genomic locations with which they share sequence homology. These data support previous observations that the two ends of a DSB are usually tethered to each other and that this tethering facilitates both ends encountering the same donor sequence. We also found that the presence of homeologous/repetitive sequences in the vicinity of a DSB can distract the DSB end from finding its bona fide homologous donor, and that inhibition of GC by such homeologous sequences is markedly increased upon deleting Sgs1 but not Msh6. PMID:27074148

  16. Role of Double-Strand Break End-Tethering during Gene Conversion in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Suvi Jain

    2016-04-01

    Full Text Available Correct repair of DNA double-strand breaks (DSBs is critical for maintaining genome stability. Whereas gene conversion (GC-mediated