WorldWideScience

Sample records for break repair activity

  1. Activation of repair and checkpoints by double-strand breaks of DNA. Activational cascade of protein phosphorylation

    International Nuclear Information System (INIS)

    Molecular mechanisms of double-strand breaks repair and checkpoints include phosphorylations of repair and checkpoint-proteins by protein kinases. Chemical modification of proteins has different consequences including activation, changing of affinity to proteins and localization

  2. The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells

    International Nuclear Information System (INIS)

    Highly hazardous DNA double-strand breaks can be induced in eukaryotic cells by a number of agents including pathogenic bacterial strains. We have investigated the genotoxic potential of Pseudomonas aeruginosa, an opportunistic pathogen causing devastating nosocomial infections in cystic fibrosis or immunocompromised patients. Our data revealed that infection of immune or epithelial cells by P. aeruginosa triggered DNA strand breaks and phosphorylation of histone H2AX (γH2AX), a marker of DNA double-strand breaks. Moreover, it induced formation of discrete nuclear repair foci similar to gamma-irradiation-induced foci, and containing γH2AX and 53BP1, an adaptor protein mediating the DNA-damage response pathway. Gene deletion, mutagenesis, and complementation in P. aeruginosa identified ExoS bacterial toxin as the major factor involved in γH2AX induction. Chemical inhibition of several kinases known to phosphorylate H2AX demonstrated that Ataxia Telangiectasia Mutated (ATM) was the principal kinase in P. aeruginosa-induced H2AX phosphorylation. Finally, infection led to ATM kinase activation by an auto-phosphorylation mechanism. Together, these data show for the first time that infection by P. aeruginosa activates the DNA double-strand break repair machinery of the host cells. This novel information sheds new light on the consequences of P. aeruginosa infection in mammalian cells. As pathogenic Escherichia coli or carcinogenic Helicobacter pylori can alter genome integrity through DNA double-strand breaks, leading to chromosomal instability and eventually cancer, our findings highlight possible new routes for further investigations of P. aeruginosa in cancer biology and they identify ATM as a potential target molecule for drug design. (authors)

  3. DNA double strand break repair pathway choice following ionizing radiation

    International Nuclear Information System (INIS)

    A DNA double strand break (DSB) is one of the critical DNA lesions leading to cell death if unrepaired. DSB is repaired by two distinct repair pathways, i.e. non-homologous end-joining (NHEJ) or homologous recombination (HR). NHEJ contributes to DSB repair throughout the cell cycle, while HR is active during S/G2 phase following DNA replication. We aim to elucidate the molecular mechanisms underlying DSB repair pathway choice at two ended DSBs in G2 phase following ionizing radiation (IR). Here, we discuss recent work that provides new insights into DSB repair pathways choice including our study. (author)

  4. Micronuclei, DNA single-strand breaks and DNA-repair activity in mice exposed to 1,3-butadiene by inhalation

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Šmerák, P.; Vodičková, Ludmila; Naccarati, Alessio; Bárta, I.; Hemminki, K.

    2006-01-01

    Roč. 608, - (2006), s. 49-57. ISSN 1383-5718 R&D Projects: GA ČR(CZ) GA310/01/0802 Institutional research plan: CEZ:AV0Z50390512 Keywords : Single-strand DNA breaks * Micronucleus formation * DNA-repair activity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  5. Important DNA repair proteins in DNA double-strand break repair pathways

    International Nuclear Information System (INIS)

    DNA double-strand break repair pathway is one of DNA damage repair pathways. DNA repair genes can repair DNA damage, maintain the integrity of the genetic information and inhibit the formation of tumors. There are two mechanisms-non-homologous end joining and homologous recombination to repair DNA double-strand break. In this review, an overview of important repair proteins of non--homologous end joining and homologous recombination pathways was introduced. (authors)

  6. Repair of double-strand breaks in Micrococcus radiodurans

    International Nuclear Information System (INIS)

    Micrococcus radiodurans has been shown to sustain double-strand breaks in its DNA after exposure to x-radiation. Following sublethal doses of x-rays (200 krad in oxygen or less), the cells were able to repair these breaks, and an intermediate fast-sedimenting DNA component seemed to be involved in the repair process

  7. RNA-directed repair of DNA double-strand breaks.

    Science.gov (United States)

    Yang, Yun-Gui; Qi, Yijun

    2015-08-01

    DNA double-strand breaks (DSBs) are among the most deleterious DNA lesions, which if unrepaired or repaired incorrectly can cause cell death or genome instability that may lead to cancer. To counteract these adverse consequences, eukaryotes have evolved a highly orchestrated mechanism to repair DSBs, namely DNA-damage-response (DDR). DDR, as defined specifically in relation to DSBs, consists of multi-layered regulatory modes including DNA damage sensors, transducers and effectors, through which DSBs are sensed and then repaired via DNAprotein interactions. Unexpectedly, recent studies have revealed a direct role of RNA in the repair of DSBs, including DSB-induced small RNA (diRNA)-directed and RNA-templated DNA repair. Here, we summarize the recent discoveries of RNA-mediated regulation of DSB repair and discuss the potential impact of these novel RNA components of the DSB repair pathway on genomic stability and plasticity. PMID:25960340

  8. Modulation of DNA double-strand break repair activity in cell-free extracts of gamma-irradiated mouse testicular cells

    International Nuclear Information System (INIS)

    DNA double-strand breaks (DSBs) are potentially mutagenic lesions demanding effective damage recognition and repair. Even a single DSB can be detrimental if left unrepaired or misrepaired, and if present in gamete, it can cause foetal wastage or malformations/congenital defects in the offspring. The threats posed by DSBs have triggered the evolution of two major pathways of DSB repair, homologous recombination-mediated repair (HRR) and non-homologous end-joining (NHEJ), conserved from bacteria to mammals. Though HRR is more predominant in bacteria and yeast, NHEJ is more efficient in mammalian somatic cells. Studies in our laboratory have shown that both the pathways are equally efficient in mammalian male germ cells

  9. Heavy Metal Exposure Influences Double Strand Break DNA Repair Outcomes

    Science.gov (United States)

    Morales, Maria E.; Derbes, Rebecca S.; Ade, Catherine M.; Ortego, Jonathan C.; Stark, Jeremy; Deininger, Prescott L.; Roy-Engel, Astrid M.

    2016-01-01

    Heavy metals such as cadmium, arsenic and nickel are classified as carcinogens. Although the precise mechanism of carcinogenesis is undefined, heavy metal exposure can contribute to genetic damage by inducing double strand breaks (DSBs) as well as inhibiting critical proteins from different DNA repair pathways. Here we take advantage of two previously published culture assay systems developed to address mechanistic aspects of DNA repair to evaluate the effects of heavy metal exposures on competing DNA repair outcomes. Our results demonstrate that exposure to heavy metals significantly alters how cells repair double strand breaks. The effects observed are both specific to the particular metal and dose dependent. Low doses of NiCl2 favored resolution of DSBs through homologous recombination (HR) and single strand annealing (SSA), which were inhibited by higher NiCl2 doses. In contrast, cells exposed to arsenic trioxide preferentially repaired using the “error prone” non-homologous end joining (alt-NHEJ) while inhibiting repair by HR. In addition, we determined that low doses of nickel and cadmium contributed to an increase in mutagenic recombination-mediated by Alu elements, the most numerous family of repetitive elements in humans. Sequence verification confirmed that the majority of the genetic deletions were the result of Alu-mediated non-allelic recombination events that predominantly arose from repair by SSA. All heavy metals showed a shift in the outcomes of alt-NHEJ repair with a significant increase of non-templated sequence insertions at the DSB repair site. Our data suggest that exposure to heavy metals will alter the choice of DNA repair pathway changing the genetic outcome of DSBs repair. PMID:26966913

  10. G9a inhibition potentiates the anti-tumour activity of DNA double-strand break inducing agents by impairing DNA repair independent of p53 status.

    Science.gov (United States)

    Agarwal, Pallavi; Jackson, Stephen P

    2016-10-01

    Cancer cells often exhibit altered epigenetic signatures that can misregulate genes involved in processes such as transcription, proliferation, apoptosis and DNA repair. As regulation of chromatin structure is crucial for DNA repair processes, and both DNA repair and epigenetic controls are deregulated in many cancers, we speculated that simultaneously targeting both might provide new opportunities for cancer therapy. Here, we describe a focused screen that profiled small-molecule inhibitors targeting epigenetic regulators in combination with DNA double-strand break (DSB) inducing agents. We identify UNC0638, a catalytic inhibitor of histone lysine N-methyl-transferase G9a, as hypersensitising tumour cells to low doses of DSB-inducing agents without affecting the growth of the non-tumorigenic cells tested. Similar effects are also observed with another, structurally distinct, G9a inhibitor A-366. We also show that small-molecule inhibition of G9a or siRNA-mediated G9a depletion induces tumour cell death under low DNA damage conditions by impairing DSB repair in a p53 independent manner. Furthermore, we establish that G9a promotes DNA non-homologous end-joining in response to DSB-inducing genotoxic stress. This study thus highlights the potential for using G9a inhibitors as anti-cancer therapeutic agents in combination with DSB-inducing chemotherapeutic drugs such as etoposide. PMID:27431310

  11. Ghrelin Prevents Cisplatin-Induced Testicular Damage by Facilitating Repair of DNA Double Strand Breaks Through Activation of p53 in Mice.

    Science.gov (United States)

    Garcia, Jose M; Chen, Ji-an; Guillory, Bobby; Donehower, Lawrence A; Smith, Roy G; Lamb, Dolores J

    2015-07-01

    Cisplatin administration induces DNA damage resulting in germ cell apoptosis and subsequent testicular atrophy. Although 50 percent of male cancer patients receiving cisplatin-based chemotherapy develop long-term secondary infertility, medical treatment to prevent spermatogenic failure after chemotherapy is not available. Under normal conditions, testicular p53 promotes cell cycle arrest, which allows time for DNA repair and reshuffling during meiosis. However, its role in the setting of cisplatin-induced infertility has not been studied. Ghrelin administration ameliorates the spermatogenic failure that follows cisplatin administration in mice, but the mechanisms mediating these effects have not been well established. The aim of the current study was to characterize the mechanisms of ghrelin and p53 action in the testis after cisplatin-induced testicular damage. Here we show that cisplatin induces germ cell damage through inhibition of p53-dependent DNA repair mechanisms involving gamma-H2AX and ataxia telangiectasia mutated protein kinase. As a result, testicular weight and sperm count and motility were decreased with an associated increase in sperm DNA damage. Ghrelin administration prevented these sequelae by restoring the normal expression of gamma-H2AX, ataxia telangiectasia mutated, and p53, which in turn allows repair of DNA double stranded breaks. In conclusion, these findings indicate that ghrelin has the potential to prevent or diminish infertility caused by cisplatin and other chemotherapeutic agents by restoring p53-dependent DNA repair mechanisms. PMID:26019260

  12. Double strand break repair: two mechanisms in competition but tightly linked to cell cycle

    International Nuclear Information System (INIS)

    DNA double strand breaks (DSB) are highly toxic damage although they can be induced to create genetic diversity. Two distinct pathways can repair DSB: Homologous Recombination (HR) and Non Homologous End Joining (NHEJ). If un- or mis-repaired, this damage can lead to cancer. Thus, it is essential to investigate how these two pathways are regulated for DSB repair. NHEJ inhibition leads to HR DSB repair stimulation. However, this channeling to HR is tightly linked to cell cycle since NHEJ and HR are active in G1/early S and late S/G2, respectively. Our results suggest that G1-unrepaired DSB go through S phase to be repaired by HR in G2. Those results allow a better understanding of DSB repair mechanisms regulation. (author)

  13. Repair of x-ray-induced deoxyribonucleic acid single-strand breaks in xth mutants of Escherichia coli.

    OpenAIRE

    Seeberg, E; Steinum, A L

    1980-01-01

    An exonuclease III-deficient strain of Escherichia coli K-12, BW2001 (xthA11), was unable to perform rapid repair of X-ray-induced deoxyribonucleic acid single-strand breaks and appeared to have a defect in the priming of the 3'-termini necessary for initiation of repair synthesis at the breaks. This defect cannot be explained solely by the lack of exonuclease III activity, because other xth mutants tested, including a deletion mutant, repaired radiation-induced strand breaks at close to the ...

  14. FEN1 participates in repair of the 5'-phosphotyrosyl terminus of DNA single-strand breaks.

    Science.gov (United States)

    Kametani, Yukiko; Takahata, Chiaki; Narita, Takashi; Tanaka, Kiyoji; Iwai, Shigenori; Kuraoka, Isao

    2016-01-01

    Etoposide is a widely used anticancer drug and a DNA topoisomerase II (Top2) inhibitor. Etoposide produces Top2-attached single-strand breaks (Top2-SSB complex) and double-strand breaks (Top2-DSB complex) that are thought to induce cell death in tumor cells. The Top2-SSB complex is more abundant than the Top2-DSB complex. Human tyrosyl-DNA phosphodiesterase 2 (TDP2) is required for efficient repair of Top2-DSB complexes. However, the identities of the proteins involved in the repair of Top2-SSB complexes are unknown, although yeast genetic data indicate that 5' to 3' structure-specific DNA endonuclease activity is required for alternative repair of Top2 DNA damage. In this study, we purified a flap endonuclease 1 (FEN1) and xeroderma pigmentosum group G protein (XPG) in the 5' to 3' structure-specific DNA endonuclease family and synthesized single-strand break DNA substrates containing a 5'-phoshotyrosyl bond, mimicking the Top2-SSB complex. We found that FEN1 and XPG did not remove the 5'-phoshotyrosyl bond-containing DSB substrates but removed the 5'-phoshotyrosyl bond-containing SSB substrates. Under DNA repair conditions, FEN1 efficiently repaired the 5'-phoshotyrosyl bond-containing SSB substrates in the presence of DNA ligase and DNA polymerase. Therefore, FEN1 may play an important role in the repair of Top2-SSB complexes in etoposide-treated cells. PMID:26581212

  15. Nampt is involved in DNA double-strand break repair

    Institute of Scientific and Technical Information of China (English)

    Bingtao Zhu; Xiaoli Deng; Yifan Sun; Lin Bai; Zhikai Xiahou; Yusheng Cong; Xingzhi Xu

    2012-01-01

    DNA double-strand break (DSB) is the most severe form of DNA damage,which is repaired mainly through high-fidelity homologous recombination (HR) or error-prone non-homologous end joining (NHEJ).Defects in the DNA damage response lead to genomic instability and ultimately predispose organs to cancer.Nicotinamide phosphoribosyltransferase (Nampt),which is involved in nicotinamide adenine dinucleotide metabolism,is overexpressed in a variety of tumors.In this report,we found that Nampt physically associated with CtlP and DNA-PKcs/Ku80,which are key factors in HR and NHEJ,respectively.Depletion of Nampt by small interfering RNA (siRNA) led to defective NHEJ-mediated DSB repair and enhanced HR-mediated repair.Furthermore,the inhibition of Nampt expression promoted proliferation of cancer cells and normal human fibroblasts and decreased β-galactosidase staining,indicating a delay in the onset of cellular senescence in normal human fibroblasts.Taken together,our results suggest that Nampt is a suppressor of HR-mediated DSB repair and an enhancer of NHEJ-mediated DSB repair,contributing to the acceleration of cellular senescence.

  16. Regulation of DNA double-strand break repair pathway choice

    Institute of Scientific and Technical Information of China (English)

    Meena Shrivastav; Leyma P De Haro; Jac A Nickoloff

    2008-01-01

    DNA double-strand breaks (DSBs) are critical lesions that can result in cell death or a wide variety of genetic alterations including large- or small-scale deletions, loss of heterozygosity, translocations, and chromosome loss. DSBs are repaired by non-homologous end-joining (NHEJ) and homologous recombination (HR), and defects in these pathways cause genome instability and promote tumorigenesis. DSBs arise from endogenous sources includ-ing reactive oxygen species generated during cellular metabolism, collapsed replication forks, and nucleases, and from exogenous sources including ionizing radiation and chemicals that directly or indirectly damage DNA and are commonly used in cancer therapy. The DSB repair pathways appear to compete for DSBs, but the balance between them differs widely among species, between different cell types of a single species, and during different cell cycle phases of a single cell type. Here we review the regulatory factors that regulate DSB repair by NHEJ and HR in yeast and higher eukaryotes. These factors include regulated expression and phosphorylation of repair proteins, chromatin modulation of repair factor accessibility, and the availability of homologous repair templates. While most DSB repair proteins appear to function exclusively in NHEJ or HR, a number of proteins influence both pathways, including the MRE11/RAD50/NBS1 (XRS2) complex, BRCA1, histone H2AX, PARP-1, RAD18, DNA-dependent protein kinase catalytic subunit (DNA-PKcs), and ATM. DNA-PKcs plays a role in mammalian NHEJ, but it also influences HR through a complex regulatory network that may involve crosstalk with ATM, and the regulation of at least 12 proteins involved in HR that are phosphorylated by DNA-PKcs and/or ATM.

  17. Analysis of DNA double-strand break repair pathways in mice

    International Nuclear Information System (INIS)

    During the last years significant new insights have been gained into the mechanism and biological relevance of DNA double-strand break (DSB) repair in relation to genome stability. DSBs are a highly toxic DNA lesion, because they can lead to chromosome fragmentation, loss and translocations, eventually resulting in cancer. DSBs can be induced by cellular processes such as V(D)J recombination or DNA replication. They can also be introduced by exogenous agents DNA damaging agents such as ionizing radiation or mitomycin C. During evolution several pathways have evolved for the repair of these DSBs. The most important DSB repair mechanisms in mammalian cells are nonhomologous end-joining and homologous recombination. By using an undamaged repair template, homologous recombination ensures accurate DSB repair, whereas the untemplated nonhomologous end-joining pathway does not. Although both pathways are active in mammals, the relative contribution of the two repair pathways to genome stability differs in the different cell types. Given the potential differences in repair fidelity, it is of interest to determine the relative contribution of homologous recombination and nonhomologous end-joining to DSB repair. In this review, we focus on the biological relevance of DSB repair in mammalian cells and the potential overlap between nonhomologous end-joining and homologous recombination in different tissues

  18. Mitochondrial DNA repairs double-strand breaks in yeast chromosomes.

    Science.gov (United States)

    Ricchetti, M; Fairhead, C; Dujon, B

    1999-11-01

    The endosymbiotic theory for the origin of eukaryotic cells proposes that genetic information can be transferred from mitochondria to the nucleus of a cell, and genes that are probably of mitochondrial origin have been found in nuclear chromosomes. Occasionally, short or rearranged sequences homologous to mitochondrial DNA are seen in the chromosomes of different organisms including yeast, plants and humans. Here we report a mechanism by which fragments of mitochondrial DNA, in single or tandem array, are transferred to yeast chromosomes under natural conditions during the repair of double-strand breaks in haploid mitotic cells. These repair insertions originate from noncontiguous regions of the mitochondrial genome. Our analysis of the Saccharomyces cerevisiae mitochondrial genome indicates that the yeast nuclear genome does indeed contain several short sequences of mitochondrial origin which are similar in size and composition to those that repair double-strand breaks. These sequences are located predominantly in non-coding regions of the chromosomes, frequently in the vicinity of retrotransposon long terminal repeats, and appear as recent integration events. Thus, colonization of the yeast genome by mitochondrial DNA is an ongoing process. PMID:10573425

  19. Distinct spatiotemporal patterns and PARP dependence of XRCC1 recruitment to single-strand break and base excision repair

    NARCIS (Netherlands)

    A. Campalans (Anna); R. Amouroux (Rachel); H. Menoni (Hervé); W. Vermeulen (Wim); J.P. Radicella (Pablo)

    2013-01-01

    textabstractSingle-strand break repair (SSBR) and base excision repair (BER) of modified bases and abasic sites share several players. Among them is XRCC1, an essential scaffold protein with no enzymatic activity, required for the coordination of both pathways. XRCC1 is recruited to SSBR by PARP-1,

  20. The Heterochromatic Barrier to DNA Double Strand Break Repair: How to Get the Entry Visa

    Directory of Open Access Journals (Sweden)

    Aaron A. Goodarzi

    2012-09-01

    Full Text Available Over recent decades, a deep understanding of pathways that repair DNA double strand breaks (DSB has been gained from biochemical, structural, biophysical and cellular studies. DNA non-homologous end-joining (NHEJ and homologous recombination (HR represent the two major DSB repair pathways, and both processes are now well understood. Recent work has demonstrated that the chromatin environment at a DSB significantly impacts upon DSB repair and that, moreover, dramatic modifications arise in the chromatin surrounding a DSB. Chromatin is broadly divided into open, transcriptionally active, euchromatin (EC and highly compacted, transcriptionally inert, heterochromatin (HC, although these represent extremes of a spectrum. The HC superstructure restricts both DSB repair and damage response signaling. Moreover, DSBs within HC (HC-DSBs are rapidly relocalized to the EC-HC interface. The damage response protein kinase, ataxia telangiectasia mutated (ATM, is required for HC-DSB repair but is dispensable for the relocalization of HC-DSBs. It has been proposed that ATM signaling enhances HC relaxation in the DSB vicinity and that this is a prerequisite for HC-DSB repair. Hence, ATM is essential for repair of HC-DSBs. Here, we discuss how HC impacts upon the response to DSBs and how ATM overcomes the barrier that HC poses to repair.

  1. Repair of single-strand breaks induced in the DNA of Proteus mirabilis by excision repair after UV-irradiation

    International Nuclear Information System (INIS)

    Single-strand breaks have been produced in the DNA of P. mirabilis after UV-irradiation in dependence on the incident UV-doses. It has been found that there exists a discrepancy between the single-strand breaks estimated from sedimentation in alkaline sucrose gradients and the expected single-strand breaks approximated from measurements of dimer excision. The low number in incision breaks observed by sedimentation experiments is an indication that the cells are able to repair the excision-induced breaks as fast as they are formed. Toluenized cells have been used for investigation of the incision step independently of subsequent repair processes. In presence of NMN the appearance of more single-strand breaks in the DNA has been observed. Furthermore, the number of incision breaks in toluenized cells increased in presence of exogenous ATP. The completion of the excision repair process has been investigated by observing the rejoining of incision breaks. After irradiation with UV-doses higher than approximately 240 erg/mm2 the number of single-strand breaks remaining unrepaired in the DNA increased. Studies of the influence of nutrition conditions on the repair process have shown approximately the same capacity for repair of single-strand breaks in growth medium as well as in buffer. Progress in the excision repair was also followed by investigation of the DNA synthesized at the template-DNA containing the pyrimidine dimers. In comparison with E. coli, P. mirabilis showed a somewhat lower efficiency for the repair of single-strand breaks during the excision repair. (author)

  2. Evaluation of DNA Double Strand Breaks Repair Efficiency in Head and Neck Cancer

    OpenAIRE

    Walczak, Anna; Rusin, Pawel; Dziki, Lukasz; Zielinska-Blizniewska, Hanna; Olszewski, Jurek; Majsterek, Ireneusz

    2012-01-01

    Head and neck cancers (head and neck squamous cell carcinomas [HNSCC]) are a heterogeneous group of neoplasms with varying presenting symptoms, treatment, and expected outcome. There is a need to find an effective way of its treatment at the molecular level. Thus, we should identify the mechanism of cancer cell response to damaging agents' activity, especially at DNA level. Our major goal was to evaluate the efficacy of DNA double strand breaks (DSBs) repair in HTB-43 and SCC-25 cancer cell l...

  3. Atypical Role for PhoU in Mutagenic Break Repair under Stress in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Janet L Gibson

    Full Text Available Mechanisms of mutagenesis activated by stress responses drive pathogen/host adaptation, antibiotic and anti-fungal-drug resistance, and perhaps much of evolution generally. In Escherichia coli, repair of double-strand breaks (DSBs by homologous recombination is high fidelity in unstressed cells, but switches to a mutagenic mode using error-prone DNA polymerases when the both the SOS and general (σS stress responses are activated. Additionally, the σE response promotes spontaneous DNA breakage that leads to mutagenic break repair (MBR. We identified the regulatory protein PhoU in a genetic screen for functions required for MBR. PhoU negatively regulates the phosphate-transport and utilization (Pho regulon when phosphate is in excess, including the PstB and PstC subunits of the phosphate-specific ABC transporter PstSCAB. Here, we characterize the PhoU mutation-promoting role. First, some mutations that affect phosphate transport and Pho transcriptional regulation decrease mutagenesis. Second, the mutagenesis and regulon-expression phenotypes do not correspond, revealing an apparent new function(s for PhoU. Third, the PhoU mutagenic role is not via activation of the σS, SOS or σE responses, because mutations (or DSBs that restore mutagenesis to cells defective in these stress responses do not restore mutagenesis to phoU cells. Fourth, the mutagenesis defect in phoU-mutant cells is partially restored by deletion of arcA, a gene normally repressed by PhoU, implying that a gene(s repressed by ArcA promotes mutagenic break repair. The data show a new role for PhoU in regulation, and a new regulatory branch of the stress-response signaling web that activates mutagenic break repair in E. coli.

  4. Parp1-XRCC1 and the repair of DNA double strand breaks in mouse round spermatids

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, Emad A. [Department of Endocrinology and Metabolism, Faculty of Science, Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Boer, Peter de [Department of Obstetrics and Gynaecology, Radboud University Nijmegen Medical Centre, 6500 HB Nijmegen (Netherlands); Philippens, Marielle E.P.; Kal, Henk B. [Department of Radiotherapy, University Medical Center Utrecht, Heidelberglaan 100, 3584 CX Utrecht (Netherlands); Rooij, Dirk G. de, E-mail: d.g.derooij@uu.nl [Department of Endocrinology and Metabolism, Faculty of Science, Utrecht University, Padualaan 8, 3584 CH Utrecht (Netherlands); Center for Reproductive Medicine, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam (Netherlands)

    2010-01-05

    The repair of DNA double strand breaks (DSBs) in male germ cells is slower and differently regulated compared to that in somatic cells. Round spermatids show DSB repair and are radioresistant to apoptosis induction. Mutation induction studies using ionizing irradiation, indicated a high frequency of chromosome aberrations (CA) in the next generation. Since they are in a G1 comparable stage of the cell cycle, haploid spermatids are expected to repair DSBs by the non-homologous end-joining pathway (NHEJ). However, immunohistochemical evidence indicates that not all components of the classical NHEJ pathway are available since the presence of DNA-PKcs cannot be shown. Here, we demonstrate that round spermatids, as well as most other types of male germ cells express both Parp1 and XRCC1. Therefore, we have determined whether the alternative Parp1/XRCC1 dependent NHEJ pathway is active in these nuclei and also have tested for classical NHEJ activity by a genetic method. To evaluate DSB repair in SCID mice, deficient for DNA-PKcs, and to study the involvement of the Parp1/XRCC1 dependent NHEJ pathway in round spermatids, the loss of {gamma}-H2AX foci after irradiation has been determined in nucleus spreads of round spermatids of SCID mice and in nucleus spreads and histological sections of Parp1-inhibited mice and their respective controls. Results show that around half of the breaks in randomly selected round spermatids are repaired between 1 and 8 h after irradiation. The repair of 16% of the induced DSBs requires DNA-PKcs and 21% Parp1. Foci numbers in the Parp1-inhibited testes tend to be higher in spermatids of all epithelial stages reaching significance in stages I-III which indicates an active Parp1/XRCC1 pathway in round spermatids and a decreased repair capacity in later round spermatid stages. In Parp1-inhibited SCID mice only 14.5% of the breaks were repaired 8 h after irradiation indicating additivity of the two NHEJ pathways in round spermatids.

  5. Parp1-XRCC1 and the repair of DNA double strand breaks in mouse round spermatids

    International Nuclear Information System (INIS)

    The repair of DNA double strand breaks (DSBs) in male germ cells is slower and differently regulated compared to that in somatic cells. Round spermatids show DSB repair and are radioresistant to apoptosis induction. Mutation induction studies using ionizing irradiation, indicated a high frequency of chromosome aberrations (CA) in the next generation. Since they are in a G1 comparable stage of the cell cycle, haploid spermatids are expected to repair DSBs by the non-homologous end-joining pathway (NHEJ). However, immunohistochemical evidence indicates that not all components of the classical NHEJ pathway are available since the presence of DNA-PKcs cannot be shown. Here, we demonstrate that round spermatids, as well as most other types of male germ cells express both Parp1 and XRCC1. Therefore, we have determined whether the alternative Parp1/XRCC1 dependent NHEJ pathway is active in these nuclei and also have tested for classical NHEJ activity by a genetic method. To evaluate DSB repair in SCID mice, deficient for DNA-PKcs, and to study the involvement of the Parp1/XRCC1 dependent NHEJ pathway in round spermatids, the loss of γ-H2AX foci after irradiation has been determined in nucleus spreads of round spermatids of SCID mice and in nucleus spreads and histological sections of Parp1-inhibited mice and their respective controls. Results show that around half of the breaks in randomly selected round spermatids are repaired between 1 and 8 h after irradiation. The repair of 16% of the induced DSBs requires DNA-PKcs and 21% Parp1. Foci numbers in the Parp1-inhibited testes tend to be higher in spermatids of all epithelial stages reaching significance in stages I-III which indicates an active Parp1/XRCC1 pathway in round spermatids and a decreased repair capacity in later round spermatid stages. In Parp1-inhibited SCID mice only 14.5% of the breaks were repaired 8 h after irradiation indicating additivity of the two NHEJ pathways in round spermatids.

  6. RNF20-SNF2H Pathway of Chromatin Relaxation in DNA Double-Strand Break Repair

    Directory of Open Access Journals (Sweden)

    Akihiro Kato

    2015-07-01

    Full Text Available Rapid progress in the study on the association of histone modifications with chromatin remodeling factors has broadened our understanding of chromatin dynamics in DNA transactions. In DNA double-strand break (DSB repair, the well-known mark of histones is the phosphorylation of the H2A variant, H2AX, which has been used as a surrogate marker of DSBs. The ubiquitylation of histone H2B by RNF20 E3 ligase was recently found to be a DNA damage-induced histone modification. This modification is required for DSB repair and regulated by a distinctive pathway from that of histone H2AX phosphorylation. Moreover, the connection between H2B ubiquitylation and the chromatin remodeling activity of SNF2H has been elucidated. In this review, we summarize the current knowledge of RNF20-mediated processes and the molecular link to H2AX-mediated processes during DSB repair.

  7. Formation and repair of γ-radiation induced DNA breaks in micrococcus radiodurans cells

    International Nuclear Information System (INIS)

    A study was made of the yield of single- and double-strand DNA breaks in γ-irradiated M. radiodurans cells. It was shown that the system of superfast and fast repair of single-strand breaks of the studied bacteria is more effective than that of E.coli. The two studied strains of M. radiodurans differing in radiosensitivity exhibited similar effectiveness of the superfast and fast repair of single-strand breaks but the radioresistant strain possessed a better capacity for postirradiation repair of doublestrand breaks than the radiosensitive strain

  8. Repair pathways for heavy ion-induced complex DNA double strand breaks

    International Nuclear Information System (INIS)

    DNA double strand break (DSB) induced by ionizing radiation (IR) is a deleterious damage leading to cell death and genome instability if not properly repaired. It is well known that DSB is repaired by two major pathways, non-homologous end-joining (NHEJ) and homologous recombination (HR). It is also known that NHEJ is dominant throughout the cell cycle after X- or gamma-ray irradiation in mammalian cells, Meanwhile, it is thought that heavy-ion radiation (e.g., carbon-ions, iron-ions) gives rise to clustered DNA damages consisting of not only strand breaks but also aberrant bases in the vicinity of DSBs (complex DSBs). Our previous work suggested that the efficiency of NHEJ is diminished for repair of complex DSBs induced by heavy-ion radiation. We thought that this difficulty in NHEJ process associated with heavy ion induced complex DNA damage might be extended to HR process in cells exposed to heavy ions. In order to find out if this notion is true or not, exposed human cells to X-rays and heavy-ions, and studied HR associated processes at the molecular level. Our result indicates that complex DSBs induced by heavy ions effectively evoke DNA end resection activity during the HR process. Together with our results, a relevant recent progress in the field of DNA DSB repair will be discussed. (author)

  9. Genetics of x-ray induced double strand break repair in saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    The possible fates of x-ray-induced double-strand breaks in Saccharomyces cerevisiae were examined. One possible pathway which breaks can follow, the repair pathway, was studied by assaying strains with mutations in the RAD51, RAD54, and RAD57 loci for double-strand break repair. In order of increasing radiation sensitivity one finds: rad57-1(230)> rad51-1(300)> rad54-3(360). At 360, rad54-3 cells cannot repair double-strand breaks, while 230, they can. Strains with the rad57-1 mutation can rejoin broken chromosomes at both temperatures. However, the low survival at 360 shows that the assay is not distinguishing large DNA fragments which allow cell survival from those which cause cell death. A rad51-1 strain could also rejoin broken chromosomes, and was thus capable of incomplete repair. The data can be explained with the hypothesis that rad54-3 cells are blocked in an early step of repair, while rad51-1 and rad57-1 strains are blocked in a later step of repair. The fate of double-strand breaks when they are left unrepaired was investigated with the rad54-3 mutation. If breaks are prevented from entering the RAD54 repair pathway they become uncommitted lesions. These lesions are repaired slower than the original breaks. One possible fate for an uncommitted lesion is conversion into a fixed lesion, which is likely to be an unrepairable or misrepaired double-strand break. The presence of protein synthesis after irradiation increases the probability that a break will enter the repair pathway. Evidence shows that increased probability of repair results from enhanced synthesis of repair proteins shortly after radiation

  10. Double-strand break repair and G4 DNA stability in Caenorhabditis elegans

    NARCIS (Netherlands)

    Pontier, D.B.

    2010-01-01

    DNA double-strand breaks (DSBs) can be repaired by three canonical repair pathways. Homologous recombination (HR) uses the sister chromatid or homologous chromosome as a template to repair the DSB in an error-free manner. In non-homologous end-joining (NHEJ), the broken ends are ligated with little

  11. Split-dose recovery is due to the repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    DNA double-strand breaks are the molecular lesions the repair of which leads to the reappearance of the shoulder observed in split-dose experiments. This conclusion is based on results obtained with the help of a diploid yeast mutant rad54-3 which is temperature-conditional for the repair of DNA double-strand breaks. Two repair steps must be met to yield the reappearance of the shoulder on a split-dose survival curve: the repair of double-strand breaks during the interval between two doses and on the nutrient agar plate after the second dose. In yeast lethality may be attributable to either an unrepaired double-strand break (i.e. a double-strand break is a potentially lethal lesion) or to the interaction of two double-strand breaks (misrepair of double-strand breaks). Evidence is presented that the two cellular phenomena of liquid holding recovery (repair of potentially lethal damage) and of split-dose recovery (repair of sublethal damage) are based on the repair of the same molecular lesion, the DNA double-strand break. (author)

  12. Feedback inhibition of L1 and alu retrotransposition through altered double strand break repair kinetics

    Directory of Open Access Journals (Sweden)

    Wallace Nicholas A

    2010-10-01

    Full Text Available Abstract Background Cells adapt to various chronic toxic exposures in a multitude of ways to minimize further damage and maximize their growth potential. Expression of L1 elements in the human genome can be greatly deleterious to cells, generating numerous double strand breaks (DSBs. Cells have been reported to respond to chronic DSBs by altering the repair of these breaks, including increasing the rate of homology independent DSB repair. Retrotransposition is strongly affected by proteins involved in DSB repair. Therefore, L1 expression has the potential to be a source of chronic DSBs and thus bring about the changes in cellular environment that could ultimately restrict its own retrotransposition. Results We demonstrate that constitutive L1 expression leads to quicker DSB repair and decreases in the retrotransposition potential of L1 and other retrotransposons dependent on L1 expression for their mobility. This cellular adaptation results in reduced sensitivity to L1 induced toxicity. These effects can be induced by constitutive expression of the functional L1 ORF2 alone, but not by the constitutive expression of an L1 open reading frame 2 with mutations to its endonuclease and reverse transcriptase domains. This adaptation correlates with the relative activity of the L1 introduced into the cells. Conclusions The increased number of DSBs resulting from constitutive expression of L1 results in a more rapid rate of repair. The cellular response to this L1 expression also results in attenuation of retrotransposition and reduced sensitivity of the cells to negative consequences of L1 ORF2 expression. The influence does not appear to be through RNA interference. We believe that the increased rate of DSB repair is the most likely cause of the attenuation of retrotransposition. These alterations act as a fail safe mechanism that allows cells to escape the toxicity associated with the unchecked L1 expression. This gives cells that overexpress L1, such

  13. DNA polymerase θ (POLQ), double-strand break repair, and cancer.

    Science.gov (United States)

    Wood, Richard D; Doublié, Sylvie

    2016-08-01

    DNA polymerase theta (pol θ) is encoded in the genomes of many eukaryotes, though not in fungi. Pol θ is encoded by the POLQ gene in mammalian cells. The C-terminal third of the protein is a family A DNA polymerase with additional insertion elements relative to prokaryotic homologs. The N-terminal third is a helicase-like domain with DNA-dependent ATPase activity. Pol θ is important in the repair of genomic double-strand breaks (DSBs) from many sources. These include breaks formed by ionizing radiation and topoisomerase inhibitors, breaks arising at stalled DNA replication forks, breaks introduced during diversification steps of the mammalian immune system, and DSB induced by CRISPR-Cas9. Pol θ participates in a route of DSB repair termed "alternative end-joining" (altEJ). AltEJ is independent of the DNA binding Ku protein complex and requires DNA end resection. Pol θ is able to mediate joining of two resected 3' ends harboring DNA sequence microhomology. "Signatures" of Pol θ action during altEJ are the frequent utilization of longer microhomologies, and the insertion of additional sequences at joining sites. The mechanism of end-joining employs the ability of Pol θ to tightly grasp a 3' terminus through unique contacts in the active site, allowing extension from minimally paired primers. Pol θ is involved in controlling the frequency of chromosome translocations and preserves genome integrity by limiting large deletions. It may also play a backup role in DNA base excision repair. POLQ is a member of a cluster of similarly upregulated genes that are strongly correlated with poor clinical outcome for breast cancer, ovarian cancer and other cancer types. Inhibition of pol θ is a compelling approach for combination therapy of radiosensitization. PMID:27264557

  14. Unsuitability of lymphoblastoid cell lines as surrogate of cryopreserved isolated lymphocytes for the analysis of DNA double-strand break repair activity

    International Nuclear Information System (INIS)

    As first task of a comprehensive investigation on DNA repair genotype-phenotype correlations, the suitability of Epstein-Barr virus (EBV)-transformed lymphoblastoid cell lines (LCLs) as surrogate of cryopreserved peripheral blood mononuclear cells (PBMCs) in DNA repair phenotypic assays was evaluated. To this aim the amount of DNA damage induced by γ-rays and DNA repair capacity were evaluated in unstimulated (G0) and mitogen-simulated (G2) PBMC from 20 healthy subjects and in EBV-transformed LCL obtained from the same individuals. Phosphorylation of histone H2AX, micronuclei and chromosomal aberrations were the end-points investigated. The results obtained show higher basal frequencies of binucleated cells bearing micronuclei and nucleoplasmic bridge (NPB) in LCL with respect to PBMC, suggesting that EBV transformation may be associated with chromosomal instability. After irradiation, higher levels of micronuclei were induced in G0-treated PBMC compared to cycling LCL; conversely, NPB were more frequent in LCL than in PBMC. Moreover, higher levels of chromosomal aberrations were observed in G2-treated PBMC compared to LCL. Concerning γ-H2AX measurements, phosphorylation levels 1 h after treatment and dephosphorylation kinetics were basically similar in LCL and in PBMC. However, while Spearman's test showed a strong correlation between the results obtained in replicated experiments with PBMC, high inter-experimental variability and poor reproducibility was observed in the experiments performed with LCL, possibly due to the intrinsic instability of LCL. In summary, both the analysis of γ-H2AX and the evaluation of chromosome damage highlighted a larger inter-experimental variability in the results obtained with LCL compared to PBMC. Noteworthy, the two set of results proved to lack any significant correlation at the individual level. These results indicate that LCL may be unsuitable for investigating genotype-phenotype correlations with phenotypic DNA repair

  15. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  16. Pathway choice in DNA double strand break repair: observations of a balancing act

    Directory of Open Access Journals (Sweden)

    Brandsma Inger

    2012-11-01

    Full Text Available Abstract Proper repair of DNA double strand breaks (DSBs is vital for the preservation of genomic integrity. There are two main pathways that repair DSBs, Homologous recombination (HR and Non-homologous end-joining (NHEJ. HR is restricted to the S and G2 phases of the cell cycle due to the requirement for the sister chromatid as a template, while NHEJ is active throughout the cell cycle and does not rely on a template. The balance between both pathways is essential for genome stability and numerous assays have been developed to measure the efficiency of the two pathways. Several proteins are known to affect the balance between HR and NHEJ and the complexity of the break also plays a role. In this review we describe several repair assays to determine the efficiencies of both pathways. We discuss how disturbance of the balance between HR and NHEJ can lead to disease, but also how it can be exploited for cancer treatment.

  17. RecBCD Enzyme and the Repair of Double-Stranded DNA Breaks

    OpenAIRE

    Dillingham, Mark S.; Kowalczykowski, Stephen C.

    2008-01-01

    Summary: The RecBCD enzyme of Escherichia coli is a helicase-nuclease that initiates the repair of double-stranded DNA breaks by homologous recombination. It also degrades linear double-stranded DNA, protecting the bacteria from phages and extraneous chromosomal DNA. The RecBCD enzyme is, however, regulated by a cis-acting DNA sequence known as Chi (crossover hotspot instigator) that activates its recombination-promoting functions. Interaction with Chi causes an attenuation of the RecBCD enzy...

  18. Induction and repair of DNA strand breaks in human tumor cells

    International Nuclear Information System (INIS)

    The presence of radioresistant or repair-proficient cells in a tumor is often associated with radiotherapy failure. The authors have begun to study the mechanisms of resistance in these tumor cells. Their initial studies focused on the induction and repair of DNA strand breaks as measured by DNA elution. Eight human tumor (5 squamous cell carcinomas, 2 melanomas, and 1 adenocarcinoma) and 2 nonmalignant cell lines have been examined. Their D/sub O/s range from 1.07 Gy to 2.81 Gy while their extrapolation numbers (n) range from 1.2 to 24.8. Three parameters are being investigated for X-ray-induced DNA single and double-strand breaks; 1) the initial number of breaks induced, 2) the residual DNA strand break frequency and 3) the time to repair 50% of the lesions. The kinetics of repair of DNA single-strand breaks were similar for all the lines studied. In 2 cases, radiosensitivity was associated with either a high residual DNA strand break frequency or a slower rate of repair. No single parameter or combination of parameters, however, consistently correlated with radiosensitivity or n. Thus, while differences in the induction and repair of DNA single-strand breaks might explain some of the observed differences in radiation responses, they are in general a poor predictor radiation sensitivity

  19. The role of homologous recombination in radiation-induced double-strand break repair

    International Nuclear Information System (INIS)

    DNA double-strand breaks (DSBs) represent the most biologically significant lesions induced by ionizing radiation (IR). HR is the predominant pathway for repairing one-ended DSBs arising in S-phase when the replication fork encounters single-stranded breaks or base damages. Here, we discuss recent findings that two-ended DSBs directly induced by X- or γ-rays in late S- or G2-phase are repaired predominantly by NHEJ, with HR only repairing a sub-fraction of such DSBs. This sub-fraction represents DSBs which localize to heterochromatic DNA regions and, which in control cells, are repaired with slow kinetics over many hours post irradiation. The observation that defined DSB populations are repaired by either NHEJ or HR suggests an assignment of specific tasks for each of the two processes. Furthermore, heavy ion induced complex DSBs, which are in general more slowly repaired than X- or γ-ray induced breaks, are nearly always repaired by HR independent of chromatin localization suggesting that the speed of repair is an important factor determining the DSB repair pathway usage. Finally, NHEJ and HR can, under certain conditions, also compensate for each other such that DSBs normally repaired by one pathway can undergo repair by the other if genetic failures necessitate the pathway switch.

  20. Induction and repair of single-strand DNA breaks after X-irradiation of human fibroblasts deficient in glutathione

    International Nuclear Information System (INIS)

    Using the unwinding technique in weak alkali, the induction and repair of DNA single-strand breaks was determined after aerobic and anaerobic X-irradiation of human fibroblasts, obtained from a patient suffering from 5-oxoprolinuria, and from a clinically healthy control. The metabolic disorder associated with 5-oxoprolinuria is a deficiency in glutathione synthetase activity resulting in a greatly reduced glutathione content in the cells. A small dose-modifying effect of oxygen (o.e.r.=1.1) was found for these cells in comparison to an o.e.r. of 2.5 for control cells with normal glutathione content. No significant difference was found between the repair capacity of cells with normal and deficient glutathione content, and repair was nearly completed within 60 min of anoxic irradiation in each case. In contrast, after aerobic irradiation the glutathione-deficient cells repaired less than 70 per cent of the breaks during the same period. When the glutathione-deficient cells were incubated with either dithiothreitol or mercaptopropionyl-glycine directly after aerobic irradiation, almost complete repair was obtained within 60 min. The data are interpreted as indicating that the repair mechanism for oxically and anoxically induced single-strand breaks is qualitatively different, and requires glutathione in the former case. (author)

  1. Tocopherol monoglucoside enhances repair of radiation-induced DNA strand breaks in vivo

    International Nuclear Information System (INIS)

    In the present study it is examined repair of DNA single strand breaks in peripheral blood leucocytes of mice exposed to 4 Gy whole body gamma radiation using alkaline single cell gel electrophoresis or comet assay

  2. Ultrafast chemical repair of DNA single and double strand break precursors in irradiated V79 cells

    International Nuclear Information System (INIS)

    The fast kinetics of reactions of free radical precursors of DNA single strand breaks (ssb) and double strand breaks (dsb) have been determined in Chinese hamster V79 cells by fast mixing and irradiation methods using the alkaline unwinding technique to assay breaks. Fast chemical repair of oxygen-dependent ssb and dsb precursors was observed and approached completion within 10 to 20 ms of irradiation. Treatment of cells with the glutathione synthesis blocking agent, buthionine sulphoximine, showed that approximately half of the chemical repair was attributable to intracellular non-protein thiols. The nature of the residual repair is obscure, but it is apparently not attributable to non-protein thiols. Similar repair rates and thiol dependences were also found for cell kill. With all three endpoints, oxygen competes with and blocks the chemical repair. 36 refs., 6 figs., 1 tab

  3. New tools to study DNA double-strand break repair pathway choice.

    Directory of Open Access Journals (Sweden)

    Daniel Gomez-Cabello

    Full Text Available A broken DNA molecule is difficult to repair, highly mutagenic, and extremely cytotoxic. Such breaks can be repaired by homology-independent or homology-directed mechanisms. Little is known about the network that controls the repair pathway choice except that a licensing step for homology-mediated repair exists, called DNA-end resection. The choice between these two repair pathways is a key event for genomic stability maintenance, and an imbalance of the ratio is directly linked with human diseases, including cancer. Here we present novel reporters to study the balance between both repair options in human cells. In these systems, a double-strand break can be alternatively repaired by homology-independent or -dependent mechanisms, leading to the accumulation of distinct fluorescent proteins. These reporters thus allow the balance between both repair pathways to be analyzed in different experimental setups. We validated the reporters by analyzing the effect of protein downregulation of the DNA end resection and non-homologous end-joining pathways. Finally, we analyzed the role of the DNA damage response on double-strand break (DSB repair mechanism selection. Our reporters could be used in the future to understand the roles of specific factors, whole pathways, or drugs in DSB repair pathway choice, or for genome-wide screening. Moreover, our findings can be applied to increase gene-targeting efficiency, making it a beneficial tool for a broad audience in the biological sciences.

  4. Pathway choice in DNA double strand break repair: Observations of a balancing act

    NARCIS (Netherlands)

    I. Brandsma (Inger); D.C. van Gent (Dik)

    2012-01-01

    textabstractProper repair of DNA double strand breaks (DSBs) is vital for the preservation of genomic integrity. There are two main pathways that repair DSBs, Homologous recombination (HR) and Non-homologous end-joining (NHEJ). HR is restricted to the S and G2 phases of the cell cycle due to the req

  5. Repair of near-UV (365nm or 313 nm) induced DNA strand breaks

    International Nuclear Information System (INIS)

    The action of near-UV (365 nm or 313 nm) radiation in cellular inactivaton (biological measurements) and induction and repair of breaks (physical measurements) is studied in repair proficient strain and in pol A, rec A and uvr A deficient strains of Escherichia coli K-12. (M.A.C.)

  6. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in...

  7. Polymorphisms in DNA Repair Genes, Recreational Physical Activity and Breast Cancer Risk

    OpenAIRE

    McCullough, Lauren E.; Santella, Regina M.; Cleveland, Rebecca J.; Millikan, Robert C.; Olshan, Andrew F.; North, Kari E; Bradshaw, Patrick T.; Eng, Sybil M.; Terry, Mary Beth; Shen, Jing; Crew, Katherine D.; Rossner, Pavel; Teitelbaum, Susan L.; Neugut, Alfred I.; Gammon, Marilie D.

    2013-01-01

    The mechanisms driving the inverse association between recreational physical activity (RPA) and breast cancer risk are complex. While exercise is associated with increased reactive oxygen species production it may also improve damage repair systems, particularly those that operate on single-strand breaks including base excision repair (BER), nucleotide excision repair (NER) and mismatch repair (MMR). Of these repair pathways, the role of MMR in breast carcinogenesis is least investigated. Pol...

  8. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways

    OpenAIRE

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, ...

  9. Normal repair of DNA single-strand breaks in patients with ataxia telangiectasia

    International Nuclear Information System (INIS)

    The repair of DNA single-strand breaks induced by X-rays or bleomycin was investigated in diploid fibroblasts isolated from normal individuals and from patients with ataxia telangiectasia by the technique of alkaline elution. No difference was observed between these cell strains in the rate of rejoining of DNA strand breaks induced by low or moderate doses of X-rays or by treatment with bleomycin. Owing to the sensitivity of the technique employed, the possibility that ataxia telangiectasia cells are deficient in DNA single-strand break repair appears unlikely. (Auth.)

  10. Repair and gamma radiation-induced single- and double-strand breaks in DNA of Escherichia coli

    International Nuclear Information System (INIS)

    Studies in the kinetics of repair of γ-radiation-induced single- and double-strand breaks in DNA of E. coli cells showed that double-strand DNA breaks are rejoined by the following two ways. The first way is conditioned by repair of single-strand breaks and represents the repair of ''oblique'' double-strand breaks in DNA, whereas the second way is conditioned by functioning of the recombination mechanisms and, to all appearance, represents the repair of ''direct'' double-strand breaks in DNA

  11. Alkaline gel electrophoresis assay to detect DNA strand breaks and repair mechanisms in Escherichia coli

    International Nuclear Information System (INIS)

    Reactive oxygen species (ROS) can induce lesions in different cellular targets, including DNA. Stannous chloride (SnCl2) is a ROS generator, leading to lethality in Escherichia coli (E. coli), with the base excision repair (BER) mechanism playing a role in this process. Many techniques have been developed to detect genotoxicity, as comet assay, in eukaryotic cells, and plasmid DNA agarose gel electrophoresis. In this study, an adaptation of the alkaline gel electrophoresis method was carried out to ascertain the induction of strand breaks by SnCl2 in bacterial DNA, from E. coli BER mutants, and its repair pathway. Results obtained show that SnCl2 was able to induce DNA strand breaks in all strains tested. Moreover, endonuclease IV and exonuclease III play a role in DNA repair. On the whole, data has shown that the alkaline gel electrophoresis assay could be used both for studying DNA strand breaks induction and for associated repair mechanisms. (author)

  12. Numt-mediated double-strand break repair mitigates deletions during primate genome evolution.

    Directory of Open Access Journals (Sweden)

    Einat Hazkani-Covo

    2008-10-01

    Full Text Available Non-homologous end joining (NHEJ is the major mechanism of double-strand break repair (DSBR in mammalian cells. NHEJ has traditionally been inferred from experimental systems involving induced double strand breaks (DSBs. Whether or not the spectrum of repair events observed in experimental NHEJ reflects the repair of natural breaks by NHEJ during chromosomal evolution is an unresolved issue. In primate phylogeny, nuclear DNA sequences of mitochondrial origin, numts, are inserted into naturally occurring chromosomal breaks via NHEJ. Thus, numt integration sites harbor evidence for the mechanisms that act on the genome over evolutionary timescales. We have identified 35 and 55 lineage-specific numts in the human and chimpanzee genomes, respectively, using the rhesus monkey genome as an outgroup. One hundred and fifty two numt-chromosome fusion points were classified based on their repair patterns. Repair involving microhomology and repair leading to nucleotide additions were detected. These repair patterns are within the experimentally determined spectrum of classical NHEJ, suggesting that information from experimental systems is representative of broader genetic loci and end configurations. However, in incompatible DSBR events, small deletions always occur, whereas in 54% of numt integration events examined, no deletions were detected. Numts show a statistically significant reduction in deletion frequency, even in comparison to DSBR involving filler DNA. Therefore, numts show a unique mechanism of integration via NHEJ. Since the deletion frequency during numt insertion is low, native overhangs of chromosome breaks are preserved, allowing us to determine that 24% of the analyzed breaks are cohesive with overhangs of up to 11 bases. These data represent, to the best of our knowledge, the most comprehensive description of the structure of naturally occurring DSBs. We suggest a model in which the sealing of DSBs by numts, and probably by other filler

  13. JNK Phosphorylates SIRT6 to Stimulate DNA Double-Strand Break Repair in Response to Oxidative Stress by Recruiting PARP1 to DNA Breaks.

    Science.gov (United States)

    Van Meter, Michael; Simon, Matthew; Tombline, Gregory; May, Alfred; Morello, Timothy D; Hubbard, Basil P; Bredbenner, Katie; Park, Rosa; Sinclair, David A; Bohr, Vilhelm A; Gorbunova, Vera; Seluanov, Andrei

    2016-09-01

    The accumulation of damage caused by oxidative stress has been linked to aging and to the etiology of numerous age-related diseases. The longevity gene, sirtuin 6 (SIRT6), promotes genome stability by facilitating DNA repair, especially under oxidative stress conditions. Here we uncover the mechanism by which SIRT6 is activated by oxidative stress to promote DNA double-strand break (DSB) repair. We show that the stress-activated protein kinase, c-Jun N-terminal kinase (JNK), phosphorylates SIRT6 on serine 10 in response to oxidative stress. This post-translational modification facilitates the mobilization of SIRT6 to DNA damage sites and is required for efficient recruitment of poly (ADP-ribose) polymerase 1 (PARP1) to DNA break sites and for efficient repair of DSBs. Our results demonstrate a post-translational mechanism regulating SIRT6, and they provide the link between oxidative stress signaling and DNA repair pathways that may be critical for hormetic response and longevity assurance. PMID:27568560

  14. Writers, Readers, and Erasers of Histone Ubiquitylation in DNA Double-Strand Break Repair

    DEFF Research Database (Denmark)

    Smeenk, Godelieve; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions, whose faulty repair may alter the content and organization of cellular genomes. To counteract this threat, numerous signaling and repair proteins are recruited hierarchically to the chromatin areas surrounding DSBs to facilitate...... accurate lesion repair and restoration of genome integrity. In vertebrate cells, ubiquitin-dependent modifications of histones adjacent to DSBs by RNF8, RNF168, and other ubiquitin ligases have a key role in promoting the assembly of repair protein complexes, serving as direct recruitment platforms for a...... integrity, as well as cell and organismal fitness....

  15. Ago2 facilitates Rad51 recruitment and DNA double-strand break repair by homologous recombination

    OpenAIRE

    Gao, Min; Wei, Wei; Li, Ming-ming; Wu, Yong-Sheng; Ba, Zhaoqing; Jin, Kang-Xuan; Li, Miao-Miao; Liao, You-Qi; Adhikari, Samir; Chong, Zechen; Zhang, Ting; Guo, Cai-Xia; Tang, Tie-Shan; Zhu, Bing-Tao; Xu, Xing-Zhi

    2014-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic lesions and pose a major threat to genome stability if not properly repaired. We and others have previously shown that a class of DSB-induced small RNAs (diRNAs) is produced from sequences around DSB sites. DiRNAs are associated with Argonaute (Ago) proteins and play an important role in DSB repair, though the mechanism through which they act remains unclear. Here, we report that the role of diRNAs in DSB repair is restricted to repair by h...

  16. A role for small RNAs in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Wei, W.; Ba, Z.; Wu, Y.;

    2012-01-01

    Eukaryotes have evolved complex mechanisms to repair DNA double-strand breaks (DSBs) through coordinated actions of protein sensors, transducers, and effectors. Here we show that ∼21-nucleotide small RNAs are produced from the sequences in the vicinity of DSB sites in Arabidopsis and in human cells......RNAs are recruited by Argonaute 2 (AGO2) to mediate DSB repair. Knock down of Dicer or Ago2 in human cells reduces DSB repair. Our findings reveal a conserved function for small RNAs in the DSB repair pathway. We propose that diRNAs may function as guide molecules directing chromatin modifications or the...

  17. Differential requirement for SUB1 in chromosomal and plasmid double-strand DNA break repair.

    Directory of Open Access Journals (Sweden)

    Lijian Yu

    Full Text Available Non homologous end joining (NHEJ is an important process that repairs double strand DNA breaks (DSBs in eukaryotic cells. Cells defective in NHEJ are unable to join chromosomal breaks. Two different NHEJ assays are typically used to determine the efficiency of NHEJ. One requires NHEJ of linearized plasmid DNA transformed into the test organism; the other requires NHEJ of a single chromosomal break induced either by HO endonuclease or the I-SceI restriction enzyme. These two assays are generally considered equivalent and rely on the same set of NHEJ genes. PC4 is an abundant DNA binding protein that has been suggested to stimulate NHEJ. Here we tested the role of PC4's yeast homolog SUB1 in repair of DNA double strand breaks using different assays. We found SUB1 is required for NHEJ repair of DSBs in plasmid DNA, but not in chromosomal DNA. Our results suggest that these two assays, while similar are not equivalent and that repair of plasmid DNA requires additional factor(s that are not required for NHEJ repair of chromosomal double-strand DNA breaks. Possible roles for Sub1 proteins in NHEJ of plasmid DNA are discussed.

  18. Repair of X-ray-induced single-strand breaks by a cell-free system

    International Nuclear Information System (INIS)

    Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)

  19. Repair of single-strand breaks in normal and trisomic lymphocytes

    International Nuclear Information System (INIS)

    Recently, Athanasiou and colleagues (1981) reported a deficiency in the capacity of lymphocytes from persons with Down's syndrome to repair single-strand DNA breaks. They found that 1 h after exposure to 160 Gray, repair processes had restored the sedimentation profile of DNA from normal lymphocytes to control values, whereas the relative average molecular weight of DNA from irradiated lymphocytes from persons with Down's syndrome showed no increase during the repair interval. They have suggested that their data, in conjunction with the earlier data concerning the frequencies of induced chromosomal aberrations in lymphocytes from persons with Down's syndrome, reflect a decreased efficiency in some aspect of DNA repair in trisomic cells. However, for further studies of this hypothesis, it is more appropriate to study the rejoining of DNA single-strand breaks after doses comparable to those used in tests for chromosomal aberrations. (orig.)

  20. Involvement of a periplasmic protein kinase in DNA strand break repair and homologous recombination in Escherichia coli.

    Science.gov (United States)

    Khairnar, Nivedita P; Kamble, Vidya A; Mangoli, Suhas H; Apte, Shree K; Misra, Hari S

    2007-07-01

    The involvement of signal transduction in the repair of radiation-induced damage to DNA has been known in eukaryotes but remains understudied in bacteria. This article for the first time demonstrates a role for the periplasmic lipoprotein (YfgL) with protein kinase activity transducing a signal for DNA strand break repair in Escherichia coli. Purified YfgL protein showed physical as well as functional interaction with pyrroloquinoline-quinone in solution and the protein kinase activity of YfgL was strongly stimulated in the presence of pyrroloquinoline-quinone. Transgenic E. coli cells producing Deinococcus radiodurans pyrroloquinoline-quinone synthase showed nearly four log cycle improvement in UVC dark survival and 10-fold increases in gamma radiation resistance as compared with untransformed cells. Pyrroloquinoline-quinone enhanced the UV resistance of E. coli through the YfgL protein and required the active recombination repair proteins. The yfgL mutant showed higher sensitivity to UVC, mitomycin C and gamma radiation as compared with wild-type cells and showed a strong impairment in homologous DNA recombination. The mutant expressing an active YfgL in trans recovered the lost phenotypes to nearly wild-type levels. The results strongly suggest that the periplasmic phosphoquinolipoprotein kinase YfgL plays an important role in radiation-induced DNA strand break repair and homologous recombination in E. coli. PMID:17630970

  1. The role of homologous recombination in mitotic and meiotic double-strand break repair

    OpenAIRE

    Vries, Femke Adriana Theodora de

    2007-01-01

    All organisms are composed of cells and the cell’s nucleus contains DNA. The induction of DNA damage is a threat to organisms. Signalling of DNA damage and subsequent repair is of substantial importance. Double-strand breaks (DSBs) in DNA can be induced by ionising radiation and DNA damaging agents but also arise as intermediates in several cellular processes (e.g. meiosis). DSBs are among the most genotoxic DNA lesions and their accurate repair is crucial. Genetic instability resulting from ...

  2. RecA bundles mediate homology pairing between distant sisters during DNA break repair

    OpenAIRE

    Lesterlin, Christian; Ball, Graeme; Schermelleh, Lothar; Sherratt, David J.

    2013-01-01

    DNA double-strand break (DSB) repair by homologous recombination (HR) has evolved to maintain genetic integrity in all organisms 1 . Although many reactions that occur during HR are known 1-3 , it is unclear where, when and how they occur in cells is lacking. Here, by using conventional and super-resolution microscopy we describe the progression of DSB repair in live Escherichia coli. Specifically, we investigate whether HR can occur efficiently between distant sister loci that have segregate...

  3. DNA double-strand break repair proteins are required to cap the ends of mammalian chromosomes

    OpenAIRE

    Bailey, Susan M.; Meyne, Julianne; Chen, David J.; Kurimasa, Akihiro; Li, Gloria C.; Lehnert, Bruce E.; Goodwin, Edwin H.

    1999-01-01

    Recent findings intriguingly place DNA double-strand break repair proteins at chromosome ends in yeast, where they help maintain normal telomere length and structure. In the present study, an essential telomere function, the ability to cap and thereby protect chromosomes from end-to-end fusions, was assessed in repair-deficient mouse cell lines. By using fluorescence in situ hybridization with a probe to telomeric DNA, spontaneously occurring chromosome aberrations were examined for telomere ...

  4. Age and gender effects on DNA strand break repair in peripheral blood mononuclear cells

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander; Petersen, Inge; Bohr, Vilhelm A.; Christensen, Kaare; Stevnsner, Tinna V.

    2013-01-01

    single-strand breaks (SSBs) and double-strand breaks (DSBs) in human peripheral blood mononuclear cells (PBMCs). Of these lesions, DSBs are the least frequent but the most dangerous for cells. We have measured the level of endogenous SSBs, SSB repair capacity, γ-H2AX response, and DSB repair capacity in......Exogenous and endogenous damage to DNA is constantly challenging the stability of our genome. This DNA damage increase the frequency of errors in DNA replication, thus causing point mutations or chromosomal rearrangements and has been implicated in aging, cancer, and neurodegenerative diseases...

  5. Modeling the repair of DNA strand breaks caused by γ-radiation in a minichromosome

    International Nuclear Information System (INIS)

    The objective of the studies described here was the development of a mathematical model which would fit experimental data for the repair of single and double strand breaks induced in DNA in living cells by exposure to ionizing radiation, and which would allow to better understand the processes of DNA repair. DNA breaks are believed to play the major role in radiation-induced lethality and formation of chromosome deletions, and are therefore crucial to the response of cells to radiotherapy. In an initial model which we reported on the basis of data for the repair of Epstein–Barr minichromosomes in irradiated Raji cells, we assumed that DNA breaks are induced only at the moment of irradiation and are later removed by repair systems. This work gives a development of that mathematical model which fits the experimental results more precisely and suggests strongly that DNA breaks are generated not only by direct irradiation but also later, probably by systems engaged in repair of oxidative damage. (paper)

  6. APOBEC3 cytidine deaminases in double-strand DNA break repair and cancer promotion.

    Science.gov (United States)

    Nowarski, Roni; Kotler, Moshe

    2013-06-15

    High frequency of cytidine to thymidine conversions was identified in the genome of several types of cancer cells. In breast cancer cells, these mutations are clustered in long DNA regions associated with single-strand DNA (ssDNA), double-strand DNA breaks (DSB), and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs, and clustered mutations. Cancer Res; 73(12); 3494-8. ©2013 AACR. PMID:23598277

  7. Behaviour of UV-sensitive mutants of Proteus mirabilis to repair incision breaks

    International Nuclear Information System (INIS)

    In U.V.-sensitive mutants of P. mirabilis with the phenotype HCR, REC and EXR single-strand breaks appeared immediately after UV-irradiation. The behaviour of REC- and EXR-mutants was similar to the wildtype. The number of incision breaks observed by sedimentation analysis in these strains was very low. They could be joined during the excision repair process. From the ability of REC- and EXR-strains to rejoin most of the induced single-strand breaks it can be concluded that these strains have approximately the same capacity for excision repair as the wildtype. HCR-mutants of P. mirabilis produced single-strand breaks after UV-irradiation in contrast to HCR-mutants of E. coli. Therefore we suggest that HCR-mutants of P. mirabilis are not completely inhibited in the incision step. The single-strand breaks introduced in the DNA at the beginning of the repair process were not rejoined during further incubation. Experiments with toluenized cells led to the same results. The newly synthesized daughter DNA-strands of UV-irradiated HCR-mutants were of low molecular weight in comparison with those from unirradiated control cells during the repair period. This result is in agreement with the incapability of HCR-mutants to remove the pyrimidine dimers from the parental template strand. (author)

  8. Break-induced replication repair of damaged forks induces genomic duplications in human cells

    OpenAIRE

    Costantino, L.; Sotiriou, S. K.; Rantala, J. K.; Magin, S.; Mladenov, E.; Helleday, T.; Haber, J E; Iliakis, G.; Kallioniemi, O P; Halazonetis, T D

    2013-01-01

    In budding yeast, one-ended DNA double-strand breaks (DSBs) and damaged replication forks are repaired by break-induced replication (BIR), a homologous recombination pathway that requires the Pol32 subunit of DNA polymerase delta. DNA replication stress is prevalent in cancer, but BIR has not been characterized in mammals. In a cyclin E overexpression model of DNA replication stress, POLD3, the human ortholog of POL32, was required for cell cycle progression and processive DNA synthesis. Segm...

  9. DNA double-strand break repair: a relentless hunt uncovers new prey.

    Science.gov (United States)

    Sekiguchi, JoAnn M; Ferguson, David O

    2006-01-27

    A major pathway for repair of DNA double-strand breaks is nonhomologous end-joining (NHEJ). In this issue of Cell, and report the discovery of a new NHEJ factor called Cernunnos-XLF. Both groups report that this protein is mutated in a rare inherited human syndrome characterized by severe immunodeficiency, developmental delay, and hypersensitivity to agents that cause DNA double-strand breaks. PMID:16439201

  10. Give me a better break: Choosing workday break activities to maximize resource recovery.

    Science.gov (United States)

    Hunter, Emily M; Wu, Cindy

    2016-02-01

    Surprisingly little research investigates employee breaks at work, and even less research provides prescriptive suggestions for better workday breaks in terms of when, where, and how break activities are most beneficial. Based on the effort-recovery model and using experience sampling methodology, we examined the characteristics of employee workday breaks with 95 employees across 5 workdays. In addition, we examined resources as a mediator between break characteristics and well-being. Multilevel analysis results indicated that activities that were preferred and earlier in the work shift related to more resource recovery following the break. We also found that resources mediated the influence of preferred break activities and time of break on health symptoms and that resource recovery benefited person-level outcomes of emotional exhaustion, job satisfaction, and organizational citizenship behavior. Finally, break length interacted with the number of breaks per day such that longer breaks and frequent short breaks were associated with more resources than infrequent short breaks. PMID:26375961

  11. Genetic and environmental influence on DNA strand break repair: a twin study

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander;

    2013-01-01

    Accumulation of DNA damage deriving from exogenous and endogenous sources has significant consequences for cellular survival, and is implicated in aging, cancer, and neurological diseases. Different DNA repair pathways have evolved in order to maintain genomic stability. Genetic and environmental...... factors are likely to influence DNA repair capacity. In order to gain more insight into the genetic and environmental contribution to the molecular basis of DNA repair, we have performed a human twin study, where we focused on the consequences of some of the most abundant types of DNA damage (single...... dizygotic). We did not detect genetic effects on the DNA-strand break variables in our study....

  12. Tying the loose ends together in DNA double strand break repair with 53BP1

    Directory of Open Access Journals (Sweden)

    Carpenter Phillip B

    2006-08-01

    Full Text Available Abstract To maintain genomic stability and ensure the fidelity of chromosomal transmission, cells respond to various forms of genotoxic stress, including DNA double-stranded breaks (DSBs, through the activation of DNA damage response signaling networks. In response to DSBs as induced by ionizing radiation (IR, during DNA replication, or through immunoglobulin heavy chain (IgH rearrangements in B cells of lymphoid origin, the phosphatidyl inositol-like kinase (PIK kinases ATM (mutated in ataxia telangiectasia, ATR (ATM and Rad3-related kinase, and the DNA-dependent protein kinase (DNA-PK activate signaling pathways that lead to DSB repair. DSBs are repaired by either of two major, non-mutually exclusive pathways: homologous recombination (HR that utilizes an undamaged sister chromatid template (or homologous chromosome and non- homologous end joining (NHEJ, an error prone mechanism that processes and joins broken DNA ends through the coordinated effort of a small set of ubiquitous factors (DNA-PKcs, Ku70, Ku80, artemis, Xrcc4/DNA lig IV, and XLF/Cernunnos. The PIK kinases phosphorylate a variety of effector substrates that propagate the DNA damage signal, ultimately resulting in various biological outputs that influence cell cycle arrest, transcription, DNA repair, and apoptosis. A variety of data has revealed a critical role for p53-binding protein 1 (53BP1 in the cellular response to DSBs including various aspects of p53 function. Importantly, 53BP1 plays a major role in suppressing translocations, particularly in B and T cells. This report will review past experiments and current knowledge regarding the role of 53BP1 in the DNA damage response.

  13. Tying the loose ends together in DNA double strand break repair with 53BP1.

    Science.gov (United States)

    Adams, Melissa M; Carpenter, Phillip B

    2006-01-01

    To maintain genomic stability and ensure the fidelity of chromosomal transmission, cells respond to various forms of genotoxic stress, including DNA double-stranded breaks (DSBs), through the activation of DNA damage response signaling networks. In response to DSBs as induced by ionizing radiation (IR), during DNA replication, or through immunoglobulin heavy chain (IgH) rearrangements in B cells of lymphoid origin, the phosphatidyl inositol-like kinase (PIK) kinases ATM (mutated in ataxia telangiectasia), ATR (ATM and Rad3-related kinase), and the DNA-dependent protein kinase (DNA-PK) activate signaling pathways that lead to DSB repair. DSBs are repaired by either of two major, non-mutually exclusive pathways: homologous recombination (HR) that utilizes an undamaged sister chromatid template (or homologous chromosome) and non- homologous end joining (NHEJ), an error prone mechanism that processes and joins broken DNA ends through the coordinated effort of a small set of ubiquitous factors (DNA-PKcs, Ku70, Ku80, artemis, Xrcc4/DNA lig IV, and XLF/Cernunnos). The PIK kinases phosphorylate a variety of effector substrates that propagate the DNA damage signal, ultimately resulting in various biological outputs that influence cell cycle arrest, transcription, DNA repair, and apoptosis. A variety of data has revealed a critical role for p53-binding protein 1 (53BP1) in the cellular response to DSBs including various aspects of p53 function. Importantly, 53BP1 plays a major role in suppressing translocations, particularly in B and T cells. This report will review past experiments and current knowledge regarding the role of 53BP1 in the DNA damage response. PMID:16945145

  14. Essential Roles for Polymerase θ-Mediated End Joining in the Repair of Chromosome Breaks.

    Science.gov (United States)

    Wyatt, David W; Feng, Wanjuan; Conlin, Michael P; Yousefzadeh, Matthew J; Roberts, Steven A; Mieczkowski, Piotr; Wood, Richard D; Gupta, Gaorav P; Ramsden, Dale A

    2016-08-18

    DNA polymerase theta (Pol θ)-mediated end joining (TMEJ) has been implicated in the repair of chromosome breaks, but its cellular mechanism and role relative to canonical repair pathways are poorly understood. We show that it accounts for most repairs associated with microhomologies and is made efficient by coupling a microhomology search to removal of non-homologous tails and microhomology-primed synthesis across broken ends. In contrast to non-homologous end joining (NHEJ), TMEJ efficiently repairs end structures expected after aborted homology-directed repair (5' to 3' resected ends) or replication fork collapse. It typically does not compete with canonical repair pathways but, in NHEJ-deficient cells, is engaged more frequently and protects against translocation. Cell viability is also severely impaired upon combined deficiency in Pol θ and a factor that antagonizes end resection (Ku or 53BP1). TMEJ thus helps to sustain cell viability and genome stability by rescuing chromosome break repair when resection is misregulated or NHEJ is compromised. PMID:27453047

  15. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways

    Science.gov (United States)

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, we show that PARP-1, probably together with DNA ligase III, operates in an alternative pathway of non-homologous end joining (NHEJ) that functions as backup to the classical pathway of NHEJ that utilizes DNA-PKcs, Ku, DNA ligase IV, XRCC4, XLF/Cernunnos and Artemis. PARP-1 binds to DNA ends in direct competition with Ku. However, in irradiated cells the higher affinity of Ku for DSBs and an excessive number of other forms of competing DNA lesions limit its contribution to DSB repair. When essential components of the classical pathway of NHEJ are absent, PARP-1 is recruited for DSB repair, particularly in the absence of Ku and non-DSB lesions. This form of DSB repair is sensitive to PARP-1 inhibitors. The results define the function of PARP-1 in DSB repair and characterize a candidate pathway responsible for joining errors causing genomic instability and cancer. PMID:17088286

  16. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways.

    Science.gov (United States)

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, we show that PARP-1, probably together with DNA ligase III, operates in an alternative pathway of non-homologous end joining (NHEJ) that functions as backup to the classical pathway of NHEJ that utilizes DNA-PKcs, Ku, DNA ligase IV, XRCC4, XLF/Cernunnos and Artemis. PARP-1 binds to DNA ends in direct competition with Ku. However, in irradiated cells the higher affinity of Ku for DSBs and an excessive number of other forms of competing DNA lesions limit its contribution to DSB repair. When essential components of the classical pathway of NHEJ are absent, PARP-1 is recruited for DSB repair, particularly in the absence of Ku and non-DSB lesions. This form of DSB repair is sensitive to PARP-1 inhibitors. The results define the function of PARP-1 in DSB repair and characterize a candidate pathway responsible for joining errors causing genomic instability and cancer. PMID:17088286

  17. DNA strand breaks induced by 125I in cultured human kidney cells and their repair

    International Nuclear Information System (INIS)

    125I was incorporated into the DNA of cultured human kidney cells. In intact cells, 4 single-strand breaks per decay were measured. Two SSBs per decay were found in isolated DNA. The numbers of double-strand breaks per decay in two experiments ranged from 1.4 to 2.7 depending on two different constants used in the calculations. A detailed microdosimetric analysis will be necessary to establish relationships between eV absorbed in DNA after 125I-decay and numbers of induced strand breaks. By incubation of the cells after exposure repair of SSBs could be demonstrated. This was not the case for DSBs

  18. Measurement of DNA strand break repair and survival rate after X-irradiation of synchronized CHO cells

    International Nuclear Information System (INIS)

    The author investigated the induction and repair of DNA strand breaks and the survival rate of CHO cells after X-radiation at different stages of the cell cycle. His particular concern was the interdependence between cell inactivation and double strand break repair. (orig./AJ)

  19. The role of homologous recombination in mitotic and meiotic double-strand break repair

    NARCIS (Netherlands)

    Vries, Femke Adriana Theodora de

    2007-01-01

    All organisms are composed of cells and the cell’s nucleus contains DNA. The induction of DNA damage is a threat to organisms. Signalling of DNA damage and subsequent repair is of substantial importance. Double-strand breaks (DSBs) in DNA can be induced by ionising radiation and DNA damaging agents

  20. Regulation of DNA double-strand break repair by ubiquitin and ubiquitin-like modifiers

    DEFF Research Database (Denmark)

    Schwertman, Petra; Bekker-Jensen, Simon; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions. The swift recognition and faithful repair of such damage is crucial for the maintenance of genomic stability, as well as for cell and organismal fitness. Signalling by ubiquitin, SUMO and other ubiquitin-like modifiers (UBLs...

  1. Ago2 facilitates Rad51 recruitment and DNA double-strand break repair by homologous recombination

    DEFF Research Database (Denmark)

    Gao, Min; Wei, Wei; Li, Ming Hua;

    2014-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic lesions and pose a major threat to genome stability if not properly repaired. We and others have previously shown that a class of DSB-induced small RNAs (diRNAs) is produced from sequences around DSB sites. DiRNAs are associated with Argonaute ...

  2. Deficiency of DNA double-strand break repair and enhanced radiosensitivity in Tip60 silenced cells

    International Nuclear Information System (INIS)

    Objective: To investigate the effect of Tip60 on the cellular radiosensitivity,and to explore the related mechanism. Methods: siRNA and anacardic acid (AA, an inhibitor of Tip60 acetyltransferase) were used to inhibit Tip60 expression and its acetyltransferase activity, respectively. Radiosensitivity was analyzed by colony-forming ability assay. γ-H2AX foci were detected to analyze the DNA double-strand break (DSB). Immunoprecipitation was used to determine the interaction of proteins. Results: siRNA-mediated silencing of Tip60 led to enhanced sensitivity of U2OS cells at 1, 2 Gy after γ-ray irradiation, but had no significant effect at 4 Gy post-irradiation (t=3.364, 3.979, P<0.05).γ-H2AX foci detection indicated that Tip60 silencing resulted in a decreased capability of DNA double-strand break repair at 1, 4 and 8 h after irradiation (t=3.875, 3.183 and 3.175, respectively, P<0.05). The interaction of Tip60 and DNA-PKcs was prompted by ionizing radiation. Anacardic acid largely abrogated the phosphorylation of DNA-PKcs at T2609 site induced by irradiation. Conclusions: Tip60 plays a role in the cellular response to ionizing radiation-induced DNA damage through, at least in part, interacting with DNA-PKcs and regulating its phosphorylation. (authors)

  3. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure

    International Nuclear Information System (INIS)

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  4. Postreplication repair in ultraviolet-irradiated human fibroblasts: formation and repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    A neutral filter elution assay was used to determine if the post-replicational formation and repair of DNA double-strand breaks (DSB) occurs in u.v.-irradiated human cells. Excision-deficient XP12 cells were pulse-labeled with [3H]thymidine after u.v. irradiation (1.5-3J/m2), and the nascent DNA was followed during repair incubation. With increasing u.v. radiation fluences, an increasing fraction of DNA was eluted at a fast rate, indicating that DSB were produced. The maximum yield DSB was observed after about 24 h of post-irradiation incubation at 370C. Similar results were also obtained with repair-proficient VA13 cells when irradiated at much higher fluences (7.5-15J/m2). It is concluded that, at the u.v. radiation fluences used, the DSB produced in u.v.-irradiated human cells are the result of post-replication repair events, and at incubation times >24 h some of these DSB are repaired. (author)

  5. Induction and repair of DNA strand breaks in bovine lens epithelial cells after high LET irradiation

    Science.gov (United States)

    Baumstark-Khan, C.; Heilmann, J.; Rink, H.

    The lens epithelium is the initiation site for the development of radiation induced cataracts. Radiation in the cortex and nucleus interacts with proteins, while in the epithelium, experimental results reveal mutagenic and cytotoxic effects. It is suggested that incorrectly repaired DNA damage may be lethal in terms of cellular reproduction and also may initiate the development of mutations or transformations in surviving cells. The occurrence of such genetically modified cells may lead to lens opacification. For a quantitative risk estimation for astronauts and space travelers it is necessary to know the relative biological effectiveness (RBE), because the spacial and temporal distribution of initial physical damage induced by cosmic radiation differ significantly from that of X-rays. RBEs for the induction of DNA strand breaks and the efficiency of repair of these breaks were measured in cultured diploid bovine lens epithelial cells exposed to different LET irradiation to either 300 kV X-rays or to heavy ions at the UNILAC accelerator at GSI. Accelerated ions from Z=8 (O) to Z=92 (U) were used. Strand breaks were measured by hydroxyapatite chromatography of alkaline unwound DNA (overall strand breaks). Results showed that DNA damage occurs as a function of dose, of kinetic energy and of LET. For particles having the same LET the severity of the DNA damage increases with dose. For a given particle dose, as the LET rises, the numbers of DNA strand breaks increase to a maximum and then reach a plateau or decrease. Repair kinetics depend on the fluence (irradiation dose). At any LET value, repair is much slower after heavy ion exposure than after X-irradiation. For ions with an LET of less than 10,000 keV μ -1 more than 90 percent of the strand breaks induced are repaired within 24 hours. At higher particle fluences, especially for low energetic particles with a very high local density of energy deposition within the particle track, a higher proportion of non

  6. Double-strand break repair by interchromosomal recombination: an in vivo repair mechanism utilized by multiple somatic tissues in mammals.

    Directory of Open Access Journals (Sweden)

    Ryan R White

    Full Text Available Homologous recombination (HR is essential for accurate genome duplication and maintenance of genome stability. In eukaryotes, chromosomal double strand breaks (DSBs are central to HR during specialized developmental programs of meiosis and antigen receptor gene rearrangements, and form at unusual DNA structures and stalled replication forks. DSBs also result from exposure to ionizing radiation, reactive oxygen species, some anti-cancer agents, or inhibitors of topoisomerase II. Literature predicts that repair of such breaks normally will occur by non-homologous end-joining (in G1, intrachromosomal HR (all phases, or sister chromatid HR (in S/G(2. However, no in vivo model is in place to directly determine the potential for DSB repair in somatic cells of mammals to occur by HR between repeated sequences on heterologs (i.e., interchromosomal HR. To test this, we developed a mouse model with three transgenes-two nonfunctional green fluorescent protein (GFP transgenes each containing a recognition site for the I-SceI endonuclease, and a tetracycline-inducible I-SceI endonuclease transgene. If interchromosomal HR can be utilized for DSB repair in somatic cells, then I-SceI expression and induction of DSBs within the GFP reporters may result in a functional GFP+ gene. Strikingly, GFP+ recombinant cells were observed in multiple organs with highest numbers in thymus, kidney, and lung. Additionally, bone marrow cultures demonstrated interchromosomal HR within multiple hematopoietic subpopulations including multi-lineage colony forming unit-granulocyte-erythrocyte-monocyte-megakaryocte (CFU-GEMM colonies. This is a direct demonstration that somatic cells in vivo search genome-wide for homologous sequences suitable for DSB repair, and this type of repair can occur within early developmental populations capable of multi-lineage differentiation.

  7. Repair of DNA strand breaks in progeric fibroblasts and aging human diploid cells

    International Nuclear Information System (INIS)

    The rate of rejoining of DNA strand breaks induced by 10 krad of γ-irradiation has been studied in normal human diploid skin fibroblasts and skin fibroblasts from six patients with symptoms of progeria. Although slightly more rapid in very early passage, the repair rate in normal cells was similar throughout most of their life span in vitro. The appearance of cells with reduced repair capacity was evident as the cultures became senescent. The progeric fibroblasts varied greatly in their response to irradiation. The rate of repair was greatly reduced in two strains, whereas in two others extensive DNA degradation was consistently observed in unirradiated cells. Degradation was apparently related to the radiation received from the incorporated radiolabel. Normal repair was seen in progeric fibroblasts transformed by SV40 virus

  8. Multiple-pathway analysis of double-strand break repair mutations in Drosophila.

    Directory of Open Access Journals (Sweden)

    Dena M Johnson-Schlitz

    2007-04-01

    Full Text Available The analysis of double-strand break (DSB repair is complicated by the existence of several pathways utilizing a large number of genes. Moreover, many of these genes have been shown to have multiple roles in DSB repair. To address this complexity we used a repair reporter construct designed to measure multiple repair outcomes simultaneously. This approach provides estimates of the relative usage of several DSB repair pathways in the premeiotic male germline of Drosophila. We applied this system to mutations at each of 11 repair loci plus various double mutants and altered dosage genotypes. Most of the mutants were found to suppress one of the pathways with a compensating increase in one or more of the others. Perhaps surprisingly, none of the single mutants suppressed more than one pathway, but they varied widely in how the suppression was compensated. We found several cases in which two or more loci were similar in which pathway was suppressed while differing in how this suppression was compensated. Taken as a whole, the data suggest that the choice of which repair pathway is used for a given DSB occurs by a two-stage "decision circuit" in which the DSB is first placed into one of two pools from which a specific pathway is then selected.

  9. Primary immunodeficiency syndromes associated with defective DNA double-strand break repair.

    Science.gov (United States)

    Gennery, A R

    2006-01-01

    Damaging DNA double-strand breaks (DNA-DSBs) following ionizing radiation (IR) exposure, potentially lead to cell death or carcinogenesis. Non-homologous end-joining (NHEJ) is the main repair pathway employed by vertebrate cells to repair such damage. Many repair pathway proteins have been identified. The creation of many diverse lymphocyte receptors to identify potential pathogens has evolved by breaking and randomly re-sorting the gene segments coding for antigen receptors. Subsequent DNA-DSB repair utilizes the NHEJ proteins. Individuals with defective repair pathways are increasingly recognized with radiosensitivity and immunodeficiency. Patients with defects in ataxia-telangiectasia mutated, nibrin, MRE11, Rad50, Artemis, DNA ligase IV and Cernunnos-XRCC4-like factor have been identified. Most exhibit immunodeficiency, with a spectrum of presentation and overlap between conditions. Conventional treatment with immunoglobulin replacement or haematopoietic stem cell transplantation (HSCT) can be effective. A greater understanding of the molecular defect will enable better, tailored therapies to improve survival. PMID:16971555

  10. Single-cell microarray enables high-throughput evaluation of DNA double-strand breaks and DNA repair inhibitors.

    Science.gov (United States)

    Weingeist, David M; Ge, Jing; Wood, David K; Mutamba, James T; Huang, Qiuying; Rowland, Elizabeth A; Yaffe, Michael B; Floyd, Scott; Engelward, Bevin P

    2013-03-15

    A key modality of non-surgical cancer management is DNA damaging therapy that causes DNA double-strand breaks that are preferentially toxic to rapidly dividing cancer cells. Double-strand break repair capacity is recognized as an important mechanism in drug resistance and is therefore a potential target for adjuvant chemotherapy. Additionally, spontaneous and environmentally induced DSBs are known to promote cancer, making DSB evaluation important as a tool in epidemiology, clinical evaluation and in the development of novel pharmaceuticals. Currently available assays to detect double-strand breaks are limited in throughput and specificity and offer minimal information concerning the kinetics of repair. Here, we present the CometChip, a 96-well platform that enables assessment of double-strand break levels and repair capacity of multiple cell types and conditions in parallel and integrates with standard high-throughput screening and analysis technologies. We demonstrate the ability to detect multiple genetic deficiencies in double-strand break repair and evaluate a set of clinically relevant chemical inhibitors of one of the major double-strand break repair pathways, non-homologous end-joining. While other high-throughput repair assays measure residual damage or indirect markers of damage, the CometChip detects physical double-strand breaks, providing direct measurement of damage induction and repair capacity, which may be useful in developing and implementing treatment strategies with reduced side effects. PMID:23422001

  11. Homologous recombination repairs secondary replication induced DNA double-strand breaks after ionizing radiation

    OpenAIRE

    Groth, Petra; Orta, Manuel Luís; Elvers, Ingegerd; Majumder, Muntasir Mamun; Lagerqvist, Anne; Helleday, Thomas

    2012-01-01

    Ionizing radiation (IR) produces direct two-ended DNA double-strand breaks (DSBs) primarily repaired by non-homologous end joining (NHEJ). It is, however, well established that homologous recombination (HR) is induced and required for repair of a subset of DSBs formed following IR. Here, we find that HR induced by IR is drastically reduced when post-DNA damage replication is inhibited in mammalian cells. Both IR-induced RAD51 foci and HR events in the hprt gene are reduced in the presence of ...

  12. The Caenorhabditis elegans homolog of Gen1/Yen1 resolvases links DNA damage signaling to DNA double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Aymeric P Bailly

    2010-07-01

    Full Text Available DNA double-strand breaks (DSBs can be repaired by homologous recombination (HR, which can involve Holliday junction (HJ intermediates that are ultimately resolved by nucleolytic enzymes. An N-terminal fragment of human GEN1 has recently been shown to act as a Holliday junction resolvase, but little is known about the role of GEN-1 in vivo. Holliday junction resolution signifies the completion of DNA repair, a step that may be coupled to signaling proteins that regulate cell cycle progression in response to DNA damage. Using forward genetic approaches, we identified a Caenorhabditis elegans dual function DNA double-strand break repair and DNA damage signaling protein orthologous to the human GEN1 Holliday junction resolving enzyme. GEN-1 has biochemical activities related to the human enzyme and facilitates repair of DNA double-strand breaks, but is not essential for DNA double-strand break repair during meiotic recombination. Mutational analysis reveals that the DNA damage-signaling function of GEN-1 is separable from its role in DNA repair. GEN-1 promotes germ cell cycle arrest and apoptosis via a pathway that acts in parallel to the canonical DNA damage response pathway mediated by RPA loading, CHK1 activation, and CEP-1/p53-mediated apoptosis induction. Furthermore, GEN-1 acts redundantly with the 9-1-1 complex to ensure genome stability. Our study suggests that GEN-1 might act as a dual function Holliday junction resolvase that may coordinate DNA damage signaling with a late step in DNA double-strand break repair.

  13. Life forms employ different repair strategies of repair single- and double strand DNA breaks caused by different qualities of radiation: criticality of RecA mediated repair system

    International Nuclear Information System (INIS)

    Different qualities of radiation, either through direct or indirect pathway, induce qualitative different spectrum of damages in DNA, which are also different in in vitro and in vivo systems. The single- and double strand breaks of DNA are of special interest as they lead to serious biological consequences. The implications of such damage to DNA and their processing by various inherent repair pathways together decide the fate of the living form

  14. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125I and 3H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-(125I)iodo-2'-deoxyuridine or with (methyl-3H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10-14 (double-strand breaks) and 2.82 x 10-12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  15. Identification of Saccharomyces cerevisiae DNA ligase IV: involvement in DNA double-strand break repair.

    OpenAIRE

    Teo, S H; Jackson, S P

    1997-01-01

    DNA ligases catalyse the joining of single and double-strand DNA breaks, which is an essential final step in DNA replication, recombination and repair. Mammalian cells have four DNA ligases, termed ligases I-IV. In contrast, other than a DNA ligase I homologue (encoded by CDC9), no other DNA ligases have hitherto been identified in Saccharomyces cerevisiae. Here, we report the identification and characterization of a novel gene, LIG4, which encodes a protein with strong homology to mammalian ...

  16. Two pathways of DNA double-strand break repair in G1 cells of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    The G1 cells of the diploid yeast Saccharomyces cerevislae are known to be capable of a slow repair of DNA double-strand breaks (DSB) during holding the cells in a non-nutrient medium. In the present paper, it has been shown that S. cerevislae cells γ-irradiated in the G1 phase of cell cycle are capable of fast repair of DNA DSB; this process is completed within 30-40 min of holding the cells in water at 28 deg C. For this reason, the kinetics of DNA DSB repair during holding the cells in a non-nutrient medium are biphasic, i.e., the first, ''fast'' phase is completed within 30-40 min; wheras the second, ''slow'' one, within 48 h. Mutations rad51, rad52, rad54 and rad55 inhibit the fast repair of DNA DSB, whereas mutations rad50, rad53 and rad57 do not practically influence this process. It has been shown that the observed fast and slow repair of DNA DSB in the G1 diploid cells of S, cerevislae are separate pathways of DNA DSB repair in yeast

  17. Distinct spatio temporal patterns and PARP dependence of XRCC1 recruitment to single-strand break and base excision repair

    International Nuclear Information System (INIS)

    Single-strand break repair (SSBR) and base excision repair (BER) of modified bases and abasic sites share several players. Among them is XRCC1, an essential scaffold protein with no enzymatic activity, required for the coordination of both pathways. XRCC1 is recruited to SSBR by PARP-1, responsible for the initial recognition of the break. The recruitment of XRCC1 to BER is still poorly understood. Here we show by using both local and global induction of oxidative DNA base damage that XRCC1 participation in BER complexes can be distinguished from that in SSBR by several criteria. We show first that XRCC1 recruitment to BER is independent of PARP. Second, unlike SSBR complexes that are assembled within minutes after global damage induction, XRCC1 is detected later in BER patches, with kinetics consistent with the repair of oxidized bases. Third, while XRCC1-containing foci associated with SSBR are formed both in eu- and heterochromatin domains, BER complexes are assembled in patches that are essentially excluded from heterochromatin and where the oxidized bases are detected. (authors)

  18. Radiobiological study on DNA strand breaks and repair using single cell gel electrophoresis

    International Nuclear Information System (INIS)

    Single cell gel electrophoresis (SCGE) provides a novel method to measure DNA damage in individual cells and more importantly, to assess heterogeneity in response within a mixed population of cells. Cells embedded in agarose are lysed, subjected to electrophoresis, stained with a fluorescent DNA-specific dye, and viewed under a fluorescence microscope. Damaged cells display 'comets', broken DNA migrating farther to the anode in the electric field. We have previously used this technique to quantify DNA damage induced by moderate doses of low and high LET radiations in cultured Chinese hamster cells. The assay has been optimized in terms of lysing and electrophoresis conditions, and applied to analyse the DNA strand breaks, their repair kinetics and heterogeneity in response in individual Chinese hamster cells exposed to gamma-rays, and to KUR thermal neutrons with and without 10B or to KEK PF monochromatic soft X-rays as well as to a radio-mimetic agent, neocarzinostatin. The DNA double-strand breaks induced by boron-neutron captured reactions were repaired at a slower rate, but a heterogeneity in response might not contribute to the difference. The neocarzinostatin-induced DNA damage were efficiently repaired in a dose-dependent fashion. The initial amount of gamma-ray induced DNA double-strand breaks was not significantly altered in cells pre-exposed to very low adapting dose. (author)

  19. The mechanism of DNA double strand break repair induced by heavy ion radiation

    International Nuclear Information System (INIS)

    The combined effect of 17AAG (an Hsp90 inhibitor) and heavy ion irradiation was studied in vitro and in vivo. 17AAG was known to cause radio-sensitization in tumor cells irradiated with low linear energy transfer (LET) radiation by inhibiting DNA double strand break (DSB) repair. Our study shows the enhanced cell killing by the combination of 17AAG and carbon ion treatment, and this was also shown in in vivo mouse xenograft model. The cause of this may be S-phase related and involve non-DSB damage. The role played by DSB repair related critical proteins such as ATM, XLF and artemis was also investigated in cells exposed to heavy ions. Our study indicate that artemis plays a role in the slow component of DSB repair in cells with low LET, but this is not the case with high LET irradiation. (author)

  20. DNA double-strand break repair: a tale of pathway choices.

    Science.gov (United States)

    Li, Jing; Xu, Xingzhi

    2016-07-01

    Deoxyribonucleic acid double-strand breaks (DSBs) are cytotoxic lesions that must be repaired either through homologous recombination (HR) or non-homologous end-joining (NHEJ) pathways. DSB repair is critical for genome integrity, cellular homeostasis and also constitutes the biological foundation for radiotherapy and the majority of chemotherapy. The choice between HR and NHEJ is a complex yet not completely understood process that will entail more future efforts. Herein we review our current understandings about how the choice is made over an antagonizing balance between p53-binding protein 1 and breast cancer 1 in the context of cell cycle stages, downstream effects, and distinct chromosomal histone marks. These exciting areas of research will surely bring more mechanistic insights about DSB repair and be utilized in the clinical settings. PMID:27217474

  1. Distinct functions of BRCA1 and BRCA2 in double-strand break repair

    International Nuclear Information System (INIS)

    Individuals carrying BRCA mutations are predisposed to breast cancer. The BRCA1 and BRCA2 proteins are required for homologous recombination and DNA break repair, leading to the suggestion that they act in concert. However, direct evidence of a stable BRCA1/BRCA2 complex has not been demonstrated. Rather, the two proteins have been found as constituents of discrete, but perhaps nonexclusive complexes that are critical for repair. We discuss the interaction of BRCA1 with the BACH1 and BARD1 proteins, and suggest that the pleiotropic nature of mutations in BRCA1 may be associated with defects in protein–protein interactions. In contrast, the role of BRCA2 in DNA repair may be more defined by its direct interaction with the RAD51 recombinase

  2. Effects of camptothecin on double-strand break repair by non-homologous end-joining in DNA mismatch repair-deficient human colorectal cancer cell lines

    OpenAIRE

    Jacob, Sandrine; Miquel, Catherine; Sarasin, Alain; Praz, Françoise

    2005-01-01

    Loss of a functional mismatch repair (MMR) system in colorectal cancer (CRC) cells is associated with microsatellite instability and increased sensitivity to topoisomerase inhibitors. In this study, we have investigated whether a defect in double-strand break (DSB) repair by non-homologous end-joining (NHEJ) could explain why MMR-deficient CRC cells are hypersensitive to camptothecin (CPT), a topoisomerase I inhibitor. To evaluate the efficiency and the fidelity of DSB repair, we have transie...

  3. Effects of chemopreventive natural products on non-homologous end-joining DNA double-strand break repair.

    Science.gov (United States)

    Charles, Catherine; Nachtergael, Amandine; Ouedraogo, Moustapha; Belayew, Alexandra; Duez, Pierre

    2014-07-01

    Double-strand breaks (DSBs) may result from endogenous (e.g., reactive oxygen species, variable (diversity) joining, meiotic exchanges, collapsed replication forks, nucleases) or exogenous (e.g., ionizing radiation, chemotherapeutic agents, radiomimetic compounds) events. DSBs disrupt the integrity of DNA and failed or improper DSBs repair may lead to genomic instability and, eventually, mutations, cancer, or cell death. Non-homologous end-joining (NHEJ) is the major pathway used by higher eukaryotic cells to repair these lesions. Given the complexity of NHEJ and the number of proteins and cofactors involved, secondary metabolites from medicinal or food plants might interfere with the process, activating or inhibiting repair. Twelve natural products, arbutin, curcumin, indole-3-carbinol, and nine flavonoids (apigenin, baicalein, chalcone, epicatechin, genistein, myricetin, naringenin, quercetin, sakuranetin) were chosen for their postulated roles in cancer chemoprevention and/or treatment. The effects of these compounds on NHEJ were investigated with an in vitro protocol based on plasmid substrates. Plasmids were linearized by a restriction enzyme, generating cohesive ends, or by a combination of enzymes, generating incompatible ends; plasmids were then incubated with a nuclear extract prepared from normal human small-intestinal cells (FHS 74 Int), either treated with these natural products or untreated (controls). The NHEJ repair complex from nuclear extracts ligates linearized plasmids, resulting in plasmid oligomers that can be separated and quantified by on-chip microelectrophoresis. Some compounds (chalcone, epicatechin, myricetin, sakuranetin and arbutin) clearly activated NHEJ, whereas others (apigenin, baicalein and curcumin) significantly reduced the repair rate of both types of plasmid substrates. Although this in vitro protocol is only partly representative of the in vivo situation, the natural products appear to interfere with NHEJ repair and warrant

  4. The ultra-fast repair of single-strand breaks in DNA of γ-irradiated Chinese hamster cells

    International Nuclear Information System (INIS)

    Studies of the effect of thermal treatment of Chinese hamster cells on sedimentation of DNA in the alkaline sucrose gradient showed that heating the cells to 680C for 15 min caused the same degradation as γ-irradiation with 5 to 7 krad at 370C. The inhibition of cellular repair enzymes by heating was therefore unacceptable. The process of ultra-fast repair is essentially determined by the DNA-ligase reaction, which is activated in the presence of Mg ions, and inhibited in mammalian cells in the presence of EDTA and pyrophosphate. Sedimentation profiles were therefore measured for the DNA of Chinese hamster cells γ-irradiated (5 krad) at 00C or 220C in the presence of Mg++, or EDTA and pyrophosphate, and the results demonstrated ultra-fast repair only at 20 to 370C, in contrast to bacteria. A study was made of the temperature dependence of the activity of the DNA ligases isolated from E.coli and rabbit bone marrow. The NAD-dependent bacterial DNA ligase was active at temperatures from 0 to 400C, whereas ATP-dependent DNA ligase of mammals only showed activity in the range 15 to 400C. The differing temperature dependences of ultra-fast repair in bacterial and mammalian cells are in agreement with the temperature dependences of the activities of isolated enzymes, and the results suggest that the process of ultra-fast repair of single-strand breaks of DNA takes place in both bacterial and mammalian cells. (U.K.)

  5. PML nuclear body disruption impairs DNA double-strand break sensing and repair in APL

    Science.gov (United States)

    di Masi, A; Cilli, D; Berardinelli, F; Talarico, A; Pallavicini, I; Pennisi, R; Leone, S; Antoccia, A; Noguera, N I; Lo-Coco, F; Ascenzi, P; Minucci, S; Nervi, C

    2016-01-01

    Proteins involved in DNA double-strand break (DSB) repair localize within the promyelocytic leukemia nuclear bodies (PML-NBs), whose disruption is at the root of the acute promyelocytic leukemia (APL) pathogenesis. All-trans-retinoic acid (RA) treatment induces PML-RARα degradation, restores PML-NB functions, and causes terminal cell differentiation of APL blasts. However, the precise role of the APL-associated PML-RARα oncoprotein and PML-NB integrity in the DSB response in APL leukemogenesis and tumor suppression is still lacking. Primary leukemia blasts isolated from APL patients showed high phosphorylation levels of H2AX (γ-H2AX), an initial DSBs sensor. By addressing the consequences of ionizing radiation (IR)-induced DSB response in primary APL blasts and RA-responsive and -resistant myeloid cell lines carrying endogenous or ectopically expressed PML-RARα, before and after treatment with RA, we found that the disruption of PML-NBs is associated with delayed DSB response, as revealed by the impaired kinetic of disappearance of γ-H2AX and 53BP1 foci and activation of ATM and of its substrates H2AX, NBN, and CHK2. The disruption of PML-NB integrity by PML-RARα also affects the IR-induced DSB response in a preleukemic mouse model of APL in vivo. We propose the oncoprotein-dependent PML-NB disruption and DDR impairment as relevant early events in APL tumorigenesis. PMID:27468685

  6. Survivin inhibition and DNA double-strand break repair: A molecular mechanism to overcome radioresistance in glioblastoma

    International Nuclear Information System (INIS)

    Background and purpose: Gliomas display prime examples of ionizing radiation (IR) resistant tumors. The IAP Survivin is reported to be critically involved in radiation resistance by anti-apoptotic and by caspase-independent mechanisms. The present study aimed to elucidate an interrelationship between Survivin’s cellular localization and DNA damage repair in glioma cells. Material and methods: Cellular distribution and nuclear complex formation were assayed by immunoblotting, immunofluorescence staining and co-immunoprecipitation of Survivin bound proteins in LN229 glioblastoma cells. Apoptosis induction, survival and DNA repair following IR were assayed by means of caspase3/7 activity, clonogenic assay, γ-H2AX/53BP1 foci formation, single cell gel electrophoresis assay, and DNA-PKcs kinase assay in the presence of Survivin siRNA or over expression of Survivin-GFP. Results: Following irradiation, we observed a nuclear accumulation and a direct interrelationship between Survivin, MDC1, γ-H2AX, 53BP1 and DNA-PKcs, which was confirmed by immunofluorescence co-localization. Survivin downregulation by siRNA resulted in an increased apoptotic fraction, decreased clonogenic survival and increased DNA-damage, as demonstrated by higher amount of DNA breaks and an increased amount of γ-H2AX/53BP1 foci post irradiation. Furthermore, we detected in Survivin-depleted LN229 cells a hampered S2056 (auto)phosphorylation and a significantly decreased DNA-PKcs kinase activity. Conclusion: Nuclear accumulation of Survivin and interaction with components of the DNA-double-strand break (DSB) repair machinery indicates Survivin to regulate DSB damage repair that leads to a significant improvement of survival of LN229 glioblastoma cells.

  7. The production and repair of double strand breaks in cells from normal humans and patients with ataxia telangiectasia

    International Nuclear Information System (INIS)

    The production and repair of double strand breaks induced by γ-rays in the DNA of human fibroblasts have been measured by sedimentation in sucrose gradients under non-denaturing conditions. Unirradiated DNA formed a rapidly sedimenting gel. Low doses of radiation released freely sedimenting DNA molecules from this gel. Higher doses reduced the rate of sedimentation of the free DNA due to the introduction of double strand breaks. The breakage efficiency was 1 break/1.3x1010 daltons of DNA/krad. Postirradiation incubation after a high dose of radiation resulted in an increase in molecular weight of the free DNA molecules, and after a low dose the rapidly-sedimenting gel was reformed. These data suggest that double strand breaks are repaired in human fibroblasts. No significant differences were found between fibroblasts from two normal donors and four patients with the radiosensitive disorder, ataxia telangiectasia, in either the production or repair of double strand breaks

  8. Genetic polymorphisms of DNA double-strand break repair pathway genes and glioma susceptibility

    International Nuclear Information System (INIS)

    Genetic variations in DNA double-strand break repair genes can influence the ability of a cell to repair damaged DNA and alter an individual’s susceptibility to cancer. We studied whether polymorphisms in DNA double-strand break repair genes are associated with an increased risk of glioma development. We genotyped 10 potentially functional single nucleotide polymorphisms (SNPs) in 7 DNA double-strand break repair pathway genes (XRCC3, BRCA2, RAG1, XRCC5, LIG4, XRCC4 and ATM) in a case–control study including 384 glioma patients and 384 cancer-free controls in a Chinese Han population. Genotypes were determined using the OpenArray platform. In the single-locus analysis there was a significant association between gliomas and the LIG4 rs1805388 (Ex2 +54C>T, Thr9Ile) TT genotype (adjusted OR, 3.27; 95% CI, 1.87-5.71), as well as the TC genotype (adjusted OR, 1.62; 95% CI, 1.20-2.18). We also found that the homozygous variant genotype (GG) of XRCC4 rs1805377 (IVS7-1A>G, splice-site) was associated with a significantly increased risk of gliomas (OR, 1.77; 95% CI, 1.12-2.80). Interestingly, we detected a significant additive and multiplicative interaction effect between the LIG4 rs1805388 and XRCC4 rs1805377 polymorphisms with an increasing risk of gliomas. When we stratified our analysis by smoking status, LIG4 rs1805388 was associated with an increased glioma risk among smokers. These results indicate for the first time that LIG4 rs1805388 and XRCC4 rs1805377, alone or in combination, are associated with a risk of gliomas

  9. RNF4 is required for DNA double-strand break repair in vivo.

    Science.gov (United States)

    Vyas, R; Kumar, R; Clermont, F; Helfricht, A; Kalev, P; Sotiropoulou, P; Hendriks, I A; Radaelli, E; Hochepied, T; Blanpain, C; Sablina, A; van Attikum, H; Olsen, J V; Jochemsen, A G; Vertegaal, A C O; Marine, J-C

    2013-03-01

    Unrepaired DNA double-strand breaks (DSBs) cause genetic instability that leads to malignant transformation or cell death. Cells respond to DSBs with the ordered recruitment of signaling and repair proteins to the sites of DNA lesions. Coordinated protein SUMOylation and ubiquitylation have crucial roles in regulating the dynamic assembly of protein complexes at these sites. However, how SUMOylation influences protein ubiquitylation at DSBs is poorly understood. We show herein that Rnf4, an E3 ubiquitin ligase that targets SUMO-modified proteins, accumulates in DSB repair foci and is required for both homologous recombination (HR) and non-homologous end joining repair. To establish a link between Rnf4 and the DNA damage response (DDR) in vivo, we generated an Rnf4 allelic series in mice. We show that Rnf4-deficiency causes persistent ionizing radiation-induced DNA damage and signaling, and that Rnf4-deficient cells and mice exhibit increased sensitivity to genotoxic stress. Mechanistically, we show that Rnf4 targets SUMOylated MDC1 and SUMOylated BRCA1, and is required for the loading of Rad51, an enzyme required for HR repair, onto sites of DNA damage. Similarly to inactivating mutations in other key regulators of HR repair, Rnf4 deficiency leads to age-dependent impairment in spermatogenesis. These findings identify Rnf4 as a critical component of the DDR in vivo and support the possibility that Rnf4 controls protein localization at DNA damage sites by integrating SUMOylation and ubiquitylation events. PMID:23197296

  10. DNA Double Strand Break Response and Limited Repair Capacity in Mouse Elongated Spermatids

    Directory of Open Access Journals (Sweden)

    Emad A. Ahmed

    2015-12-01

    Full Text Available Spermatids are extremely sensitive to genotoxic exposures since during spermiogenesis only error-prone non homologous end joining (NHEJ repair pathways are available. Hence, genomic damage may accumulate in sperm and be transmitted to the zygote. Indirect, delayed DNA fragmentation and lesions associated with apoptotic-like processes have been observed during spermatid elongation, 27 days after irradiation. The proliferating spermatogonia and early meiotic prophase cells have been suggested to retain a memory of a radiation insult leading later to this delayed fragmentation. Here, we used meiotic spread preparations to localize phosphorylate histone H2 variant (γ-H2AX foci marking DNA double strand breaks (DSBs in elongated spermatids. This technique enabled us to determine the background level of DSB foci in elongated spermatids of RAD54/RAD54B double knockout (dko mice, severe combined immunodeficiency SCID mice, and poly adenosine diphosphate (ADP-ribose polymerase 1 (PARP1 inhibitor (DPQ-treated mice to compare them with the appropriate wild type controls. The repair kinetics data and the protein expression patterns observed indicate that the conventional NHEJ repair pathway is not available for elongated spermatids to repair the programmed and the IR-induced DSBs, reflecting the limited repair capacity of these cells. However, although elongated spermatids express the proteins of the alternative NHEJ, PARP1-inhibition had no effect on the repair kinetics after IR, suggesting that DNA damage may be passed onto sperm. Finally, our genetic mutant analysis suggests that an incomplete or defective meiotic recombinational repair of Spo11-induced DSBs may lead to a carry-over of the DSB damage or induce a delayed nuclear fragmentation during the sensitive programmed chromatin remodeling occurring in elongated spermatids.

  11. DNA polymerases δ and λ cooperate in repairing double-strand breaks by microhomology-mediated end-joining in Saccharomyces cerevisiae.

    Science.gov (United States)

    Meyer, Damon; Fu, Becky Xu Hua; Heyer, Wolf-Dietrich

    2015-12-15

    Maintenance of genome stability is carried out by a suite of DNA repair pathways that ensure the repair of damaged DNA and faithful replication of the genome. Of particular importance are the repair pathways, which respond to DNA double-strand breaks (DSBs), and how the efficiency of repair is influenced by sequence homology. In this study, we developed a genetic assay in diploid Saccharomyces cerevisiae cells to analyze DSBs requiring microhomologies for repair, known as microhomology-mediated end-joining (MMEJ). MMEJ repair efficiency increased concomitant with microhomology length and decreased upon introduction of mismatches. The central proteins in homologous recombination (HR), Rad52 and Rad51, suppressed MMEJ in this system, suggesting a competition between HR and MMEJ for the repair of a DSB. Importantly, we found that DNA polymerase delta (Pol δ) is critical for MMEJ, independent of microhomology length and base-pairing continuity. MMEJ recombinants showed evidence that Pol δ proofreading function is active during MMEJ-mediated DSB repair. Furthermore, mutations in Pol δ and DNA polymerase 4 (Pol λ), the DNA polymerase previously implicated in MMEJ, cause a synergistic decrease in MMEJ repair. Pol λ showed faster kinetics associating with MMEJ substrates following DSB induction than Pol δ. The association of Pol δ depended on RAD1, which encodes the flap endonuclease needed to cleave MMEJ intermediates before DNA synthesis. Moreover, Pol δ recruitment was diminished in cells lacking Pol λ. These data suggest cooperative involvement of both polymerases in MMEJ. PMID:26607450

  12. γ-ray dose rate effect in DNA double-strand break repair deficient murine cells

    International Nuclear Information System (INIS)

    Objective: To analyze the dose rate effect and potentially lethal damage repair in DNA double-strand break repair deficient murine cells (SCID) irradiated by γ-ray. Methods: The wild type (CB.17+/+) and SCID cells were exposed to γ-ray at high and low dose rates. The high dose rate exposure was fractionated into two equal doses at 24 h intervals. The survival rates of irradiated cells were calculated by clone-forming analysis. Results: When γ-ray was given to wild type (CB.17+/+) cells in two fractions at 24 h intervals, the survival rate was significantly higher than that when the same total dose was given singly. In contrast, there was no difference in the survival rates between the single and fractionated exposure in SCID cells. SCID cells were more sensitive than CB.17+/+ cells to both low and high dose rates γ-ray exposure for cell killing. The survival rate by low dose rate exposure was significantly higher than that by high dose rate exposure, not only in CB.17+/+ cells but also in SCID cells. Conclusions: SCID cells are deficient in repairing γ-ray induced double-strand breaks. There is dose rate effect in both SCID and CB.17+/+ cells

  13. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    Energy Technology Data Exchange (ETDEWEB)

    Hata, Kuniki [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Advanced Science Research Center, Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Urushibara, Ayumi; Yamashita, Shinichi; Shikazono, Naoya; Yokoya, Akinari [Advanced Science Research Center, Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Katsumura, Yosuke, E-mail: katsu@n.t.u-tokyo.ac.jp [Department of Nuclear Engineering and Management, School of Engineering, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Nuclear Professional School, School of Engineering, The University of Tokyo, 2-22 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1188 (Japan)

    2013-05-03

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield of DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems.

  14. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    International Nuclear Information System (INIS)

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield of DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems

  15. BMI1 is recruited to DNA breaks and contributes to DNA damage-induced H2A ubiquitination and repair.

    Science.gov (United States)

    Ginjala, Vasudeva; Nacerddine, Karim; Kulkarni, Atul; Oza, Jay; Hill, Sarah J; Yao, Ming; Citterio, Elisabetta; van Lohuizen, Maarten; Ganesan, Shridar

    2011-05-01

    DNA damage activates signaling pathways that lead to modification of local chromatin and recruitment of DNA repair proteins. Multiple DNA repair proteins having ubiquitin ligase activity are recruited to sites of DNA damage, where they ubiquitinate histones and other substrates. This DNA damage-induced histone ubiquitination is thought to play a critical role in mediating the DNA damage response. We now report that the polycomb protein BMI1 is rapidly recruited to sites of DNA damage, where it persists for more than 8 h. The sustained localization of BMI1 to damage sites is dependent on intact ATM and ATR and requires H2AX phosphorylation and recruitment of RNF8. BMI1 is required for DNA damage-induced ubiquitination of histone H2A at lysine 119. Loss of BMI1 leads to impaired repair of DNA double-strand breaks by homologous recombination and the accumulation of cells in G(2)/M. These data support a crucial role for BMI1 in the cellular response to DNA damage. PMID:21383063

  16. The structure of ends determines the pathway choice and Mre11 nuclease dependency of DNA double-strand break repair

    Science.gov (United States)

    Liao, Shuren; Tammaro, Margaret; Yan, Hong

    2016-01-01

    The key event in the choice of repair pathways for DNA double-strand breaks (DSBs) is the initial processing of ends. Non-homologous end joining (NHEJ) involves limited processing, but homology-dependent repair (HDR) requires extensive resection of the 5′ strand. How cells decide if an end is channeled to resection or NHEJ is not well understood. We hypothesize that the structure of ends is a major determinant and tested this hypothesis with model DNA substrates in Xenopus egg extracts. While ends with normal nucleotides are efficiently channeled to NHEJ, ends with damaged nucleotides or bulky adducts are channeled to resection. Resection is dependent on Mre11, but its nuclease activity is critical only for ends with 5′ bulky adducts. CtIP is absolutely required for activating the nuclease-dependent mechanism of Mre11 but not the nuclease-independent mechanism. Together, these findings suggest that the structure of ends is a major determinant for the pathway choice of DSB repair and the Mre11 nuclease dependency of resection. PMID:27084932

  17. Maintenance of genome stability in plants: repairing DNA double strand breaks and chromatin structure stability

    Directory of Open Access Journals (Sweden)

    Sujit eRoy

    2014-09-01

    Full Text Available Plant cells are subject to high levels of DNA damage resulting from plant’s obligatory dependence on sunlight and the associated exposure to environmental stresses like solar UV radiation, high soil salinity, drought, chilling injury and other air and soil pollutants including heavy metals and metabolic byproducts from endogenous processes. The irreversible DNA damages, generated by the environmental and genotoxic stresses affect plant growth and development, reproduction and crop productivity. Thus, for maintaining genome stability, plants have developed an extensive array of mechanisms for the detection and repair of DNA damages. This review will focus recent advances in our understanding of mechanisms regulating plant genome stability in the context of repairing of double stand breaks and chromatin structure maintenance.

  18. The involvement of human RECQL4 in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Singh, Dharmendra Kumar; Karmakar, Parimal; Aamann, Maria Diget; Schurman, Shepherd H; May, Alfred; Croteau, Deborah L; Burks, Lynnette; Plon, Sharon E; Bohr, Vilhelm A

    2010-01-01

    Rothmund-Thomson syndrome (RTS) is an autosomal recessive hereditary disorder associated with mutation in RECQL4 gene, a member of the human RecQ helicases. The disease is characterized by genomic instability, skeletal abnormalities and predisposition to malignant tumors, especially osteosarcomas....... The precise role of RECQL4 in cellular pathways is largely unknown; however, recent evidence suggests its involvement in multiple DNA metabolic pathways. This study investigates the roles of RECQL4 in DNA double-strand break (DSB) repair. The results show that RECQL4-deficient fibroblasts are...... moderately sensitive to gamma-irradiation and accumulate more gammaH2AX and 53BP1 foci than control fibroblasts. This is suggestive of defects in efficient repair of DSB's in the RECQL4-deficient fibroblasts. Real time imaging of live cells using laser confocal microscopy shows that RECQL4 is recruited early...

  19. Visualization of DNA Double-Strand Break Repair at the Single-Molecule Level

    Energy Technology Data Exchange (ETDEWEB)

    Dynan, William S.; Li, Shuyi; Mernaugh, Raymond; Wragg, Stephanie; Takeda, Yoshihiko

    2003-03-27

    Exposure to low doses of ionizing radiation is universal. The signature injury from ionizing radiation exposure is induction of DNA double-strand breaks (DSBs). The first line of defense against DSBs is direct ligation of broken DNA ends via the nonhomologous end-joining pathway. Because even a relatively high environmental exposure induces only a few DSBs per cell, our current understanding of the response to this exposure is limited by the ability to measure DSB repair events reliably in situ at a single-molecule level. To address this need, we have taken advantage of biological amplification, measuring relocalization of proteins and detection of protein phosphorylation as a surrogate for detection of broken ends themselves. We describe the use of specific antibodies to investigate the kinetics and mechanism of repair of very small numbers of DSBs in human cells by the nonhomologous end-joining pathway.

  20. The liver DNA breaks and repair of the fish (carassius auratus) induced by the sublethal metal mixture

    International Nuclear Information System (INIS)

    The breaks and repair of the carassius auratus's liver DNA induced by the metal mixture were studied by using the gel electrophoresis technique and 3H-TdR incorporation experiment. The results demonstrated that DNA breaks were detected after treated by zine, lead and metal mixture, and the RNSB order was the metal mixture >Pb>Zn. The DNA repair was found among the zinc treatment, cadmium treatment, lead treatment as well as metal mixture treatment, and the order of the repair ability was the metal mixture >Pb>Zn>Cd. The mixture of the metals increased the damage to the DNA. The results also showed that the result of the DNA breaks was not conformed completely to that of the DNA repair

  1. Rapid pairing and resegregation of distant homologous loci enables double-strand break repair in bacteria.

    Science.gov (United States)

    Badrinarayanan, Anjana; Le, Tung B K; Laub, Michael T

    2015-08-01

    Double-strand breaks (DSBs) can lead to the loss of genetic information and cell death. Although DSB repair via homologous recombination has been well characterized, the spatial organization of this process inside cells remains poorly understood, and the mechanisms used for chromosome resegregation after repair are unclear. In this paper, we introduced site-specific DSBs in Caulobacter crescentus and then used time-lapse microscopy to visualize the ensuing chromosome dynamics. Damaged loci rapidly mobilized after a DSB, pairing with their homologous partner to enable repair, before being resegregated to their original cellular locations, independent of DNA replication. Origin-proximal regions were resegregated by the ParABS system with the ParA structure needed for resegregation assembling dynamically in response to the DSB-induced movement of an origin-associated ParB away from one cell pole. Origin-distal regions were resegregated in a ParABS-independent manner and instead likely rely on a physical, spring-like force to segregate repaired loci. Collectively, our results provide a mechanistic basis for the resegregation of chromosomes after a DSB. PMID:26240183

  2. DNA double strand break damage by radiation and behavioral imaging of DNA repair enzymes

    International Nuclear Information System (INIS)

    The theme in the title is described mainly on authors' studies. Finding of a jellyfish GFP (green fluorescent protein) and its genomic recombination technique with a target protein have made it possible to investigate the behavior of the protein (the repair enzymes in this review) within a cell by fluorescent microscopy. Double strand breaks (DSBs), the most severe damage of DNA leading to cell death and carcinogenesis, are induced by irradiation of ionizing radiation and/or ultraviolet light, and repair mechanisms of non homologous end-joining and homologous recombinant repair are known major in mammalian cells and in lower eukaryotes, respectively. Authors used UVA for inducing DSBs under the presence of benzo[a]pyrene in mammalian cells like Chinese hamster ovary (CHO)-K1 and xrs-5, the behaviors of Ku70/80 repair molecules tagged by GFP were imaged by confocal laser microscopy, and one of findings was that Ku80 moved to the level most intensely irradiated. Fluorescent molecular imaging technique will be employed widely in clinical diagnosis and new drug development as well as in basic bioscience. (S.I.)

  3. Activation of Telomerase by Ionizing Radiation: Differential Response to the Inhibition of DNA Double-Strand Break Repair by Abrogation of Poly(ADP-ribosyl)ation, by LY294002, or by Wortmannin

    International Nuclear Information System (INIS)

    Purpose: Telomerase activity represents a radiation-inducible function, which may be targeted by a double-strand break (DSB)-activated signal transduction pathway. Therefore, the effects of DNA-PK inhibitors (Wortmannin and LY294002) on telomerase upregulation after irradiation were studied. In addition, the role of trans-dominant inhibition of poly(ADP-ribosyl)ation, which strongly reduces DSB rejoining, was assessed in comparison with 3-aminobenzamide. Methods and Materials: COM3 rodent cells carry a construct for the dexamethasone-inducible overexpression of the DNA-binding domain of PARP1 and exhibit greatly impaired DSB rejoining after irradiation. Telomerase activity was measured using polymerase chain reaction ELISA 1 h after irradiation with doses up to 10 Gy. Phosphorylation status of PKB/Akt and of PKCα/βII was assessed by western blotting. Results: No telomerase upregulation was detectable for irradiated cells with undisturbed DSB rejoining. In contrast, incubation with LY294002 or dexamethasone yielded pronounced radiation induction of telomerase activity that could be suppressed by Wortmannin. 3-Aminobenzamide not only was unable to induce telomerase activity but also suppressed telomerase upregulation upon incubation with LY294002 or dexamethasone. Phospho-PKB was detectable independent of irradiation or dexamethasone pretreatment, but was undetectable upon incubations with LY294002 or Wortmannin, whereas phospho-PKC rested detectable. Conclusions: Telomerase activation postirradiation was triggered by different treatments that interfere with DNA DSB processing. This telomerase upregulation, however, was not reflected by the phosporylation status of the putative mediators of TERT activation, PKB and PKC. Although an involvement of PKB in TERT activation is not supported by the present findings, a respective role of PKC isoforms other than α/βII cannot be ruled out

  4. Low concentration of arsenite exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity

    International Nuclear Information System (INIS)

    Epidemiological studies have associated arsenic exposure with many types of human cancers. Arsenic has also been shown to act as a co-carcinogen even at low concentrations. However, the precise mechanism of its co-carcinogenic action is unknown. Recent studies indicate that arsenic can interfere with DNA-repair processes. Poly(ADP-ribose) polymerase (PARP)-1 is a zinc-finger DNA-repair protein, which can promptly sense DNA strand breaks and initiate DNA-repair pathways. In the present study, we tested the hypothesis that low concentrations of arsenic could inhibit PAPR-1 activity and so exacerbate levels of ultraviolet radiation (UVR)-induced DNA strand breaks. HaCat cells were treated with arsenite and/or UVR, and then DNA strand breaks were assessed by comet assay. Low concentrations of arsenite (≤ 2 μM) alone did not induce significant DNA strand breaks, but greatly enhanced the DNA strand breaks induced by UVR. Further studies showed that 2 μM arsenite effectively inhibited PARP-1 activity. Zinc supplementation of arsenite-treated cells restored PARP-1 activity and significantly diminished the exacerbating effect of arsenite on UVR-induced DNA strand breaks. Importantly, neither arsenite treatment, nor zinc supplementation changed UVR-triggered reactive oxygen species (ROS) formation, suggesting that their effects upon UVR-induced DNA strand breaks are not through a direct free radical mechanism. Combination treatments of arsenite with PARP-1 inhibitor 3-aminobenzamide or PARP-1 siRNA demonstrate that PARP-1 is the target of arsenite. Together, these findings show that arsenite at low concentration exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity, which may represent an important mechanism underlying the co-carcinogenicity of arsenic

  5. Activation-induced cytidine deaminase acts on double-strand breaks in vitro.

    Science.gov (United States)

    Shen, Hong Ming

    2007-02-01

    Activation-induced cytidine deaminase (AID) is likely responsible for DNA cytidine deamination, although it may also act as an RNA deaminase. It functions on single-stranded DNA, the non-template strand in double-stranded DNA during transcription, or both strands in supercoiled DNA. To ask whether AID is able to deaminate cytidine at DNA breaks, plasmids, containing a SnaBI site (TAC downward arrowGTA) that forms blunt ends after digestion with SnaBI, were generated. If AID deaminates cytidine at the upstream blunt end, the ATG start codon in either of two drug resistance genes will be regenerated after ligation and replication in UDG-null E. coli cells. This study shows that AID targets cytidine at the break. The extent of deamination activity beyond the break is correlated with the base composition in the break region. If the break region is A, T-rich, C > T transitions are extensive. However, when the break region is not A, T-rich, mutations are mainly restricted to the break, similar to findings in vivo. The results indicate that AID has activity on double strand breaks (DSBs). Based on previous and current findings, a somatic hypermutation (SHM) model is proposed, in which collision between the transcription apparatus and the replication fork generates DSBs. After AID acts on break ends, the error-prone DNA repair machinery fixes and creates mutations. PMID:16697045

  6. Active sensing and repair composites

    OpenAIRE

    Kirkby, Eva

    2009-01-01

    This thesis describes the development of a smart carbon fibre polymer composite that is capable of sensing its own damage and self-healing. Structural composites are used in the aerospace and marine industries, for example. During their lifetime impact events are inevitable, which can result in extensive internal damage. Once damaged, the only options to date are manual repair or replacement. If self-sensing and self-healing properties could be imparted to the next generation of structural co...

  7. Mathematical modelling of the automated FADU assay for the quantification of DNA strand breaks and their repair in human peripheral mononuclear blood cells

    International Nuclear Information System (INIS)

    Cells continuously undergo DNA damage from exogenous agents like irradiation or genotoxic chemicals or from endogenous radicals produced by normal cellular metabolic activities. DNA strand breaks are one of the most common genotoxic lesions and they can also arise as intermediates of DNA repair activity. Unrepaired DNA damage can lead to genomic instability, which can massively compromise the health status of organisms. Therefore it is important to measure and quantify DNA damage and its repair. We have previously published an automated method for measuring DNA strand breaks based on fluorimetric detection of alkaline DNA unwinding [1], and here we present a mathematical model of the FADU assay, which enables to an analytic expression for the relation between measured fluorescence and the number of strand breaks. Assessment of the formation and also the repair of DNA strand breaks is a crucial functional parameter to investigate genotoxicity in living cells. A reliable and convenient method to quantify DNA strand breakage is therefore of significant importance for a wide variety of scientific fields, e.g. toxicology, pharmacology, epidemiology and medical sciences

  8. Alterations in the nuclear matrix protein mass correlate with heat-induced inhibition of DNA single-strand-break repair

    International Nuclear Information System (INIS)

    The total protein mass co-isolating with the nuclear matrix or nucleoid from Chinese hamster ovary (CHO) cells was observed to increase in heated cells as a function of increasing exposure temperature between 430C and 450C or of exposure time at any temperature. The sedimentation distance of the CHO cell nucleoid in sucrose gradients increased with increasing exposure time at 450C. Both these nuclear alterations correlated in a log-linear manner with heat-induced inhibition of DNA strand break repair. A two-fold threshold increase in nuclear matrix protein mass preceded any substantial inhibition of repair of DNA single-strand breaks. When preheated cells were incubated at 370C the nuclear matrix protein mass and nucleoid sedimentation recovered with a half-time of about 5 h, while DNA single-strand-break repair recovered with a half-time of about 2 h. When preheated cells were placed at 410C a further increase was observed in the nuclear matrix protein mass and the half-time of DNA strand break repair, while nucleoid sedimentation recovered toward control values. These results implicate alterations in the protein mass of the nuclear matrix in heat-induced inhibition of repair of DNA single-strand breaks. (author)

  9. Alkaline gel electrophoresis assay to detect DNA strand breaks and repair mechanisms in Escherichia coli

    Directory of Open Access Journals (Sweden)

    José Carlos Pelielo de Mattos

    2008-12-01

    Full Text Available Reactive oxygen species (ROS can induce lesions in different cellular targets, including DNA. Stannous chloride (SnCl2 is a ROS generator, leading to lethality in Escherichia coli (E. coli, with the base excision repair (BER mechanism playing a role in this process. Many techniques have been developed to detect genotoxicity, as comet assay, in eukaryotic cells, and plasmid DNA agarose gel electrophoresis. In this study, an adaptation of the alkaline gel electrophoresis method was carried out to ascertain the induction of strand breaks by SnCl2 in bacterial DNA, from E. coli BER mutants, and its repair pathway. Results obtained show that SnCl2 was able to induce DNA strand breaks in all strains tested. Moreover, endonuclease IV and exonuclease III play a role in DNA repair. On the whole, data has shown that the alkaline gel electrophoresis assay could be used both for studying DNA strand breaks induction and for associated repair mechanisms.Espécies reativas de oxigênio (ERO podem induzir lesões em diferentes alvos celulares, incluindo o DNA. O cloreto estanoso (SnCl2 é um gerador de ERO que induz letalidade em E. coli, sendo o reparo por excisão de bases (BER um mecanismo importante neste processo. Técnicas como o ensaio cometa (em eucariotos e a eletroforese de DNA plasmidial em gel de agarose têm sido utilizadas para detectar genotoxicidade. No presente estudo, uma adaptação do método de eletroforese em gel alcalino de agarose foi usada para verificar a indução de quebras, pelo SnCl2, no DNA de E. coli, bem como a participação de enzimas do BER na restauração das lesões. Os resultados mostraram que o SnCl2 induziu quebras no DNA de todas as cepas testadas. Além disso, endonuclease IV e exonuclease III estão envolvidas na reparação dos danos. Em resumo, os dados obtidos indicam que a metodologia de eletroforese em gel alcalino de agarose pode ser empregada tanto para o estudo de quebras no DNA, quanto para avaliação dos

  10. Determination of human DNA polymerase utilization for the repair of a model ionizing radiation-induced DNA strand break lesion in a defined vector substrate

    Science.gov (United States)

    Winters, T. A.; Russell, P. S.; Kohli, M.; Dar, M. E.; Neumann, R. D.; Jorgensen, T. J.

    1999-01-01

    Human DNA polymerase and DNA ligase utilization for the repair of a major class of ionizing radiation-induced DNA lesion [DNA single-strand breaks containing 3'-phosphoglycolate (3'-PG)] was examined using a novel, chemically defined vector substrate containing a single, site-specific 3'-PG single-strand break lesion. In addition, the major human AP endonuclease, HAP1 (also known as APE1, APEX, Ref-1), was tested to determine if it was involved in initiating repair of 3'-PG-containing single-strand break lesions. DNA polymerase beta was found to be the primary polymerase responsible for nucleotide incorporation at the lesion site following excision of the 3'-PG blocking group. However, DNA polymerase delta/straightepsilon was also capable of nucleotide incorporation at the lesion site following 3'-PG excision. In addition, repair reactions catalyzed by DNA polymerase beta were found to be most effective in the presence of DNA ligase III, while those catalyzed by DNA polymerase delta/straightepsilon appeared to be more effective in the presence of DNA ligase I. Also, it was demonstrated that the repair initiating 3'-PG excision reaction was not dependent upon HAP1 activity, as judged by inhibition of HAP1 with neutralizing HAP1-specific polyclonal antibody.

  11. Aberrant Double-Strand Break Repair Resulting in Half Crossovers in Mutants Defective for Rad51 or the DNA Polymerase δ Complex▿

    OpenAIRE

    Smith, Catherine E.; Lam, Alicia F.; Symington, Lorraine S

    2009-01-01

    Homologous recombination is an error-free mechanism for the repair of DNA double-strand breaks (DSBs). Most DSB repair events occur by gene conversion limiting loss of heterozygosity (LOH) for markers downstream of the site of repair and restricting deleterious chromosome rearrangements. DSBs with only one end available for repair undergo strand invasion into a homologous duplex DNA, followed by replication to the chromosome end (break-induced replication [BIR]), leading to LOH for all marker...

  12. Concerted control of DNA double strand break repair and cell cycle progression in X-irradiated mammalian cells

    International Nuclear Information System (INIS)

    Upon examination of cell cycle regulation in a damaged cell, relations were discovered of the cell cycle control mechanisms with a complicated web of signalling pathways, eventually called the genome surveillance system. After infliction of DNA double strand breaks (DSB), the signalling is initiated by sensor proteins and transducer protein kinase ATM. This kinase phosphorylates downstream effector proteins, such as checkpoint kinases CHK1 and CHK2, which initiate the pathways leading to cell cycle arrest. In contrast with the older model of linear transmission of signals in a certain sequence, it is now accepted that the damage signalling system is branched and contains feedback loops. DSB's presence is signalled by sensor proteins (MRE11-RAD50-nibrin complex, MRN) to ATM and the signal is amplified through adaptor proteins, MDC1/NFBD1 or 53BP1 (Tp53 binding protein). MRN contains a forkheadassociated (FHA) domain and BRCA1 carboxyl-terminal (BRCT) domain. The combination of the FHA/BRCT domains has a crucial role for the binding of nibrin to the H2AX histone, assembling the components of repair foci. These domains also are important for interaction of other proteins localised in the foci. For example, MDC1/NFBD1 contains a FHA domain and two BRCT domains which are involved in protein interactions. The signal generated at DSBs is amplified and transduced to recruit components of DNA repair systems. In a concerted way with the sequential recruitment of components of repair foci, activation of transcription of genes takes place, that is necessary for blocking progression through the cell cycle, for DNA repair or apoptosis. (author)

  13. Regulation of ATM in DNA double strand break repair accounts for the radiosensitivity in human cells exposed to high linear energy transfer ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Xue Lian, E-mail: xuelian@suda.edu.cn [School of Radiation Medicine and Public Health, Medical College of Soochow University, No. 199, Ren' ai Road, Suzhou 215123 (China); Yu Dong, E-mail: ydong@ncc.go.jp [Tumor Endocrinology Project, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Furusawa, Yoshiya; Okayasu, Ryuichi [Heavy-Ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba-shi 263-8555 (Japan); Tong Jian; Cao Jianping; Fan Saijun [School of Radiation Medicine and Public Health, Medical College of Soochow University, No. 199, Ren' ai Road, Suzhou 215123 (China)

    2009-11-02

    High linear energy transfer (LET) radiation shows different biological effects from low-LET radiation. The complex nature of high LET radiation-induced damage, especially the clustered DNA damage, brings about slow repair of DNA double strand breaks (DSBs), which finally lead to higher lethality and chromosome aberration. Ionizing radiation (IR) induced DNA DSBs are repaired by both non-homologous end-joining (NHEJ) and homologous recombination repair (HRR) pathways in mammalian cells. The novel function of ataxia telangiectasia-mutated (ATM) protein is its involvement in the DSB repair of slow kinetics for 'dirty' breaks rejoining by NHEJ, this suggests that ATM may play a more important role in high LET radiation-induced DNA damage. We show here that KU55933, an ATM inhibitor could distinctly lower the clonogenic survival in normal human skin fibroblast cells exposed to carbon ion radiation and dramatically impair the normal process for DSB repair. We also implicated the involvement of ATM in the two pathways of DNA DSB repair, with DNA-PKcs and Rad51 as the representative proteins. The phosphorylation of DNA-PKcs at Thr-2609 with both immunoblotting and immunofluorescent staining indicated an ATM-dependent change, while for Rad51, KU55933 pretreatment could postpone the formation of nuclear Rad51 foci. Interestingly, we also found that pretreatment with chloroquine, an ATM stimulator could protect cells from carbon ion radiation only at lower doses. For doses over 1 Gy, protection was no longer observed. There was a dose-dependent increase for ATM kinase activity, with saturation at about 1 Gy. Chloroquine pretreatment prior to 1 Gy of carbon ion radiation did not enhance the autophosphorylation of ATM at serine 1981. The function of ATM in G2/M checkpoint arrest facilitated DSB repair in high-LET irradiation. Our results provide a possible mechanism for the direct involvement of ATM in DSB repair by high-LET irradiation.

  14. Enhancing repair of radiation-induced strand breaks in cellular DNA as a radiotherapeutic potential

    International Nuclear Information System (INIS)

    Protection of mammalian organisms including man from deleterious effects of ionizing radiation is of paramount importance and development of effective approaches to combat radiation damages using non-toxic radioprotectors is of considerable interest for defence, nuclear industries, radiation accidents, space travels, etc., besides the protection of normal tissues during radiotherapy of tumours. Many synthetic as well as natural compounds have been investigated in the recent past for their efficacy to protect the biological systems from radiation induced damages. They include sulfhydryl compounds, antioxidants, plant extracts, immune-modulators, and other agents. However, the inherent toxicity of many of the synthetic agents at the effective radio-protective concentration warranted further search for safer and more effective radio-protectors. In this context, therapeutic radioprotectors which are effective on post irradiation administration are of special relevance. One of the property that can be applied while screening for such radiation protective therapeutics is their ability to enhance repair of radiation-induced lesions in cellular DNA in terms of cellular repair index based on the parameters of the DNA following comet assay. Post irradiation administration of some natural and synthetic agents have shown their potential to enhance repair of radiation-induced strand breaks in cellular DNA in mice. These include phytoceuticals such as gallic acid, sesamol etc., extracts of medicinal plants such as Andrographis panniculata, and a few synthetic compounds such as tocopherol-mono-glucoside. The talk will give an overview of the work on DNA repair enhancement by a few natural and synthetic agents. (author)

  15. RecA bundles mediate homology pairing between distant sisters during DNA break repair

    Science.gov (United States)

    Lesterlin, Christian; Ball, Graeme; Schermelleh, Lothar; Sherratt, David J.

    2014-02-01

    DNA double-strand break (DSB) repair by homologous recombination has evolved to maintain genetic integrity in all organisms. Although many reactions that occur during homologous recombination are known, it is unclear where, when and how they occur in cells. Here, by using conventional and super-resolution microscopy, we describe the progression of DSB repair in live Escherichia coli. Specifically, we investigate whether homologous recombination can occur efficiently between distant sister loci that have segregated to opposite halves of an E. coli cell. We show that a site-specific DSB in one sister can be repaired efficiently using distant sister homology. After RecBCD processing of the DSB, RecA is recruited to the cut locus, where it nucleates into a bundle that contains many more RecA molecules than can associate with the two single-stranded DNA regions that form at the DSB. Mature bundles extend along the long axis of the cell, in the space between the bulk nucleoid and the inner membrane. Bundle formation is followed by pairing, in which the two ends of the cut locus relocate at the periphery of the nucleoid and together move rapidly towards the homology of the uncut sister. After sister locus pairing, RecA bundles disassemble and proteins that act late in homologous recombination are recruited to give viable recombinants 1-2-generation-time equivalents after formation of the initial DSB. Mutated RecA proteins that do not form bundles are defective in sister pairing and in DSB-induced repair. This work reveals an unanticipated role of RecA bundles in channelling the movement of the DNA DSB ends, thereby facilitating the long-range homology search that occurs before the strand invasion and transfer reactions.

  16. Microhomology-mediated end joining is the principal mediator of double-strand break repair during mitochondrial DNA lesions

    OpenAIRE

    Tadi, Satish Kumar; Sebastian, Robin; Dahal, Sumedha; Babu, Ravi K.; Choudhary, Bibha; Raghavan, Sathees C.

    2016-01-01

    Mitochondrial DNA (mtDNA) deletions are associated with various mitochondrial disorders. The deletions identified in humans are flanked by short, directly repeated mitochondrial DNA sequences; however, the mechanism of such DNA rearrangements has yet to be elucidated. In contrast to nuclear DNA (nDNA), mtDNA is more exposed to oxidative damage, which may result in double-strand breaks (DSBs). Although DSB repair in nDNA is well studied, repair mechanisms in mitochondria are not characterized....

  17. Lack of dependence on p53 for DNA double strand break repair of episomal vectors in human lymphoblasts

    Science.gov (United States)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.

  18. Repair of DNA double-strand breaks in Escherichia coli cells requires synthesis of proteins that can be induced by UV light

    International Nuclear Information System (INIS)

    The repair of DNA double-strand breaks in Escherichia coli cells irradiated with γ rays occurs only after new proteins are synthesized in response to damage introduced in the genome DNA. One protein whose synthesis is thus induced is the recA protein, and previous work has shown that recA- cells do not repair double-strand breaks. However, inducing recA protein by treating cells with nalidixic acid does not induce repair of double-strand breaks, so this repair requires more than the presence of the recA protein. When repair of double-strand breaks is blocked, the genome DNA is degraded by an endonuclease-like action. Evidence is presented to show that the inducible inhibition of DNA degradation after x-irradiation [Pollard, E.C. and Randall, E.P. (1973) Radiat. Res. 55, 265] is probably caused by the inducible repair of DNA double-strand breaks

  19. Single-cell microarray enables high-throughput evaluation of DNA double-strand breaks and DNA repair inhibitors

    OpenAIRE

    Weingeist, David M.; Ge, Jing; Wood, David K.; Mutamba, James T; Huang, Qiuying; Rowland, Elizabeth A.; Yaffe, Michael B.; Floyd, Scott; Engelward, Bevin P.

    2013-01-01

    A key modality of non-surgical cancer management is DNA damaging therapy that causes DNA double-strand breaks that are preferentially toxic to rapidly dividing cancer cells. Double-strand break repair capacity is recognized as an important mechanism in drug resistance and is therefore a potential target for adjuvant chemotherapy. Additionally, spontaneous and environmentally induced DSBs are known to promote cancer, making DSB evaluation important as a tool in epidemiology, clinical evaluatio...

  20. Roles of Nucleoid-Associated Proteins in Stress-Induced Mutagenic Break Repair in Starving Escherichia coli.

    Science.gov (United States)

    Moore, Jessica M; Magnan, David; Mojica, Ana K; Núñez, María Angélica Bravo; Bates, David; Rosenberg, Susan M; Hastings, P J

    2015-12-01

    The mutagenicity of DNA double-strand break repair in Escherichia coli is controlled by DNA-damage (SOS) and general (RpoS) stress responses, which let error-prone DNA polymerases participate, potentially accelerating evolution during stress. Either base substitutions and indels or genome rearrangements result. Here we discovered that most small basic proteins that compact the genome, nucleoid-associated proteins (NAPs), promote or inhibit mutagenic break repair (MBR) via different routes. Of 15 NAPs, H-NS, Fis, CspE, and CbpA were required for MBR; Dps inhibited MBR; StpA and Hha did neither; and five others were characterized previously. Three essential genes were not tested. Using multiple tests, we found the following: First, Dps, which reduces reactive oxygen species (ROS), inhibited MBR, implicating ROS in MBR. Second, CbpA promoted F' plasmid maintenance, allowing MBR to be measured in an F'-based assay. Third, Fis was required for activation of the SOS DNA-damage response and could be substituted in MBR by SOS-induced levels of DinB error-prone DNA polymerase. Thus, Fis promoted MBR by allowing SOS activation. Fourth, H-NS represses ROS detoxifier sodB and was substituted in MBR by deletion of sodB, which was not otherwise mutagenic. We conclude that normal ROS levels promote MBR and that H-NS promotes MBR by maintaining ROS. CspE positively regulates RpoS, which is required for MBR. Four of five previously characterized NAPs promoted stress responses that enhance MBR. Hence, most NAPs affect MBR, the majority via regulatory functions. The data show that a total of six NAPs promote MBR by regulating stress responses, indicating the importance of nucleoid structure and function to the regulation of MBR and of coupling mutagenesis to stress, creating genetic diversity responsively. PMID:26500258

  1. Yield of radiation-induced DNA single-strand breaks in Escherichia coli and superinfecting phage lambda at different dose rates. Repair of strand breaks in different buffers

    International Nuclear Information System (INIS)

    Cells of E. coli K-12 strain AB 1886 were irradiated in oxygenated phosphate buffered saline at 20C with electrons from a 4-MeV linear accelerator. The yield of DNA single-strand breaks was determined as a function of the dose rate between 2.5 and 21,000 krad/min. For dose rates over 100 krad/min the yield was found to be constant. Below 10 krad/min the yield of breaks decreases drastically. This is explained by rejoining of breaks during irradiation. Twenty percent of the breaks induced by acute exposure are repaired within 3 min at 20C. Superinfecting phage lambda DNA is repaired at the same rate as chromosomal DNA. In contrast to the results obtained with phosphate-buffered saline, an increase in the number of breaks after irradiation is observed when the bacteria are suspended in tris buffer. It is suggested that buffers of low ionic strength facilitate the leakage through the membrane of a small-molecular-weight component(s) necessary for DNA strand rejoining

  2. The mechanism of DNA double strand break and its repair induced by heavy ion irradiation

    International Nuclear Information System (INIS)

    In order to understand the relationship between DNA double strand break (DSB) repair proteins and the regulation of centrosome amplifications in cells irradiated with heavy ions, the behavior of centrosome was monitored by an immuno-fluorescence technique using γ-tublin antibodies. In AT cells, the amplification of centrosome clearly increased with X-irradiation compared with normal cells. Inhibition of ATM, DNA-PK and PI3K also increased the amplification of centrosome with X-irradiation in normal cells. In contrast, with heavy ion radiation, the inhibition of DNA-PK did not affects the amplification of centrosome in normal cells. Our results suggest a difference in the mechanism of centrosome amplification after X-irradiation and high linear energy transfer (LET) heavy ion irradiation. (author)

  3. The mechanism of DNA double strand break repair induced by heavy ion radiation

    International Nuclear Information System (INIS)

    In order to understand the unique molecular characteristics associated with DNA double strand break (DSB) repair in cells irradiated with high linear energy transfer (LET) heavy ion radiation, we have studied phosphorylation status of DNA-PKcs at Thr 2609 in human cells with various ATM status. After high LET carbon ion irradiation, this threonine site was not well phosphorylated in cells with ATM inhibitor, while the phosphorylation was always observed in cells exposed to X-rays irrespective of ATM status; this was demonstrated both by immune-staining and Western blotting. Another important finding is that ATM seems to play a precious role in complex DNA damage such as one induced by high LET irradiation; this kind of ATM property has only been shown with low LET radiation. (author)

  4. Low concentration of arsenite exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity.

    Science.gov (United States)

    Qin, Xu-Jun; Hudson, Laurie G; Liu, Wenlan; Timmins, Graham S; Liu, Ke Jian

    2008-10-01

    Epidemiological studies have associated arsenic exposure with many types of human cancers. Arsenic has also been shown to act as a co-carcinogen even at low concentrations. However, the precise mechanism of its co-carcinogenic action is unknown. Recent studies indicate that arsenic can interfere with DNA-repair processes. Poly(ADP-ribose) polymerase (PARP)-1 is a zinc-finger DNA-repair protein, which can promptly sense DNA strand breaks and initiate DNA-repair pathways. In the present study, we tested the hypothesis that low concentrations of arsenic could inhibit PAPR-1 activity and so exacerbate levels of ultraviolet radiation (UVR)-induced DNA strand breaks. HaCat cells were treated with arsenite and/or UVR, and then DNA strand breaks were assessed by comet assay. Low concentrations of arsenite (mechanism. Combination treatments of arsenite with PARP-1 inhibitor 3-aminobenzamide or PARP-1 siRNA demonstrate that PARP-1 is the target of arsenite. Together, these findings show that arsenite at low concentration exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity, which may represent an important mechanism underlying the co-carcinogenicity of arsenic. PMID:18619636

  5. Analysis of gene repair tracts from Cas9/gRNA double-stranded breaks in the human CFTR gene.

    Science.gov (United States)

    Hollywood, Jennifer A; Lee, Ciaran M; Scallan, Martina F; Harrison, Patrick T

    2016-01-01

    To maximise the efficiency of template-dependent gene editing, most studies describe programmable and/or RNA-guided endonucleases that make a double-stranded break at, or close to, the target sequence to be modified. The rationale for this design strategy is that most gene repair tracts will be very short. Here, we describe a CRISPR Cas9/gRNA selection-free strategy which uses deep sequencing to characterise repair tracts from a donor plasmid containing seven nucleotide differences across a 216 bp target region in the human CFTR gene. We found that 90% of the template-dependent repair tracts were >100 bp in length with equal numbers of uni-directional and bi-directional repair tracts. The occurrence of long repair tracts suggests that a single gRNA could be used with variants of the same template to create or correct specific mutations within a 200 bp range, the size of ~80% of human exons. The selection-free strategy used here also allowed detection of non-homologous end joining events in many of the homology-directed repair tracts. This indicates a need to modify the donor, possibly by silent changes in the PAM sequence, to prevent creation of a second double-stranded break in an allele that has already been correctly edited by homology-directed repair. PMID:27557525

  6. RNF4 regulates DNA double-strand break repair in a cell cycle-dependent manner.

    Science.gov (United States)

    Kuo, Ching-Ying; Li, Xu; Stark, Jeremy M; Shih, Hsiu-Ming; Ann, David K

    2016-03-18

    Both RNF4 and KAP1 play critical roles in the response to DNA double-strand breaks (DSBs), but the functional interplay of RNF4 and KAP1 in regulating DNA damage response remains unclear. We have previously demonstrated the recruitment and degradation of KAP1 by RNF4 require the phosphorylation of Ser824 (pS824) and SUMOylation of KAP1. In this report, we show the retention of DSB-induced pS824-KAP1 foci and RNF4 abundance are inversely correlated as cell cycle progresses. Following irradiation, pS824-KAP1 foci predominantly appear in the cyclin A (-) cells, whereas RNF4 level is suppressed in the G0-/G1-phases and then accumulates during S-/G2-phases. Notably, 53BP1 foci, but not BRCA1 foci, co-exist with pS824-KAP1 foci. Depletion of KAP1 yields opposite effect on the dynamics of 53BP1 and BRCA1 loading, favoring homologous recombination repair. In addition, we identify p97 is present in the RNF4-KAP1 interacting complex and the inhibition of p97 renders MCF7 breast cancer cells relatively more sensitive to DNA damage. Collectively, these findings suggest that combined effect of dynamic recruitment of RNF4 to KAP1 regulates the relative occupancy of 53BP1 and BRCA1 at DSB sites to direct DSB repair in a cell cycle-dependent manner. PMID:26766492

  7. Repair of the double-strand breaks produced by 125I disintegrations in the DNA of micrococcus radiodurans

    International Nuclear Information System (INIS)

    Wild-type M. radiodurans and two radiosensitive mutants were used to study the lethal effects of 125I disintegrations in their DNA. The relative sensitivities of these three strains to inactivation by γ-radiation were reflected in their relative sensitivities to inactivation by 125I decay. The number of double-strand (ds) breaks in the DNA appeared to be similar at levels of γ-radiation and of 125I decay that reduced survival to 10%. All three strains of M. radiodurans rapidly repaired ds breaks produced in their DNA by either γ-radiation or 125I disintegrations. If one ds break per cell is a lethal event [Krisch. et al., 1975], cells of the three strains tested would die when they had left unrepaired one ds break out of an initial 45, 600 or 1800 ds breaks per single cell. (Auth.)

  8. Rtt107 phosphorylation promotes localisation to DNA double-stranded breaks (DSBs and recombinational repair between sister chromatids.

    Directory of Open Access Journals (Sweden)

    Pranav Ullal

    Full Text Available Efficient repair of DNA double-stranded breaks (DSB requires a coordinated response at the site of lesion. Nucleolytic resection commits repair towards homologous recombination, which preferentially occurs between sister chromatids. DSB resection promotes recruitment of the Mec1 checkpoint kinase to the break. Rtt107 is a target of Mec1 and serves as a scaffold during repair. Rtt107 plays an important role during rescue of damaged replication forks, however whether Rtt107 contributes to the repair of DSBs is unknown. Here we show that Rtt107 is recruited to DSBs induced by the HO endonuclease. Rtt107 phosphorylation by Mec1 and its interaction with the Smc5-Smc6 complex are both required for Rtt107 loading to breaks, while Rtt107 regulators Slx4 and Rtt101 are not. We demonstrate that Rtt107 has an effect on the efficiency of sister chromatid recombination (SCR and propose that its recruitment to DSBs, together with the Smc5-Smc6 complex is important for repair through the SCR pathway.

  9. Poly(ADP-Ribose) Polymerase-1 and DNA-Dependent Protein Kinase Have Equivalent Roles in Double Strand Break Repair Following Ionizing Radiation

    International Nuclear Information System (INIS)

    Purpose: Radiation-induced DNA double strand breaks (DSBs) are predominantly repaired by nonhomologous end joining (NHEJ), involving DNA-dependent protein kinase (DNA-PK). Poly(ADP-ribose) polymerase-1 (PARP-1), well characterized for its role in single strand break repair, may also facilitate DSB repair. We investigated the activation of these enzymes by differing DNA ends and their interaction in the cellular response to ionizing radiation (IR). Methods and Materials: The effect of PARP and DNA-PK inhibitors (KU-0058684 and NU7441) on repair of IR-induced DSBs was investigated in DNA-PK and PARP-1 proficient and deficient cells by measuring γH2AX foci and neutral comets. Complementary in vitro enzyme kinetics assays demonstrated the affinities of DNA-PK and PARP-1 for DSBs with varying DNA termini. Results: DNA-PK and PARP-1 both promoted the fast phase of resolution of IR-induced DSBs in cells. Inactivation of both enzymes was not additive, suggesting that PARP-1 and DNA-PK cooperate within the same pathway to promote DSB repair. The affinities of the two enzymes for oligonucleotides with blunt, 3' GGG or 5' GGG overhanging termini were similar and overlapping (Kdapp = 2.6-6.4nM for DNA-PK; 1.7-4.5nM for PARP-1). DNA-PK showed a slightly greater affinity for overhanging DNA and was significantly more efficient when activated by a 5' GGG overhang. PARP-1 had a preference for blunt-ended DNA and required a separate factor for efficient stimulation by a 5' GGG overhang. Conclusion: DNA-PK and PARP-1 are both required in a pathway facilitating the fast phase of DNA DSB repair.

  10. The effect of mitotic inhibitors on DNA strand size and radiation-associated break repair in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    The effect of mitotic inhibitors on formation and repair of DNA breaks was studied in cultured fibroblasts from patients with Down syndrome in order to investigate the hypothesis that the karyotyping procedure itself may play a role in the increased chromosome breakage seen in these cells after gamma radiation exposure. Using the nondenaturing elution and alkaline elution techniques to examine fibroblasts from Down syndrome patients and from controls, no specific abnormalities in Down syndrome cells could be detected after exposure to mitotic inhibitors, including rate and extent of elution of DNA from filters as well as repair of radiation-induced DNA breaks. In both normal and Down syndrome cell strains, however, exposure to mitotic inhibitors was associated with a decrease in cellular DNA strand size, suggesting the presence of drug-induced DNA strand breaks. The mechanism of increased chromosome sensitivity of Down syndrome cells to gamma radiation remains unknown. (orig.)

  11. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  12. "Old Dead Guys": Using Activity Breaks to Teach History

    Science.gov (United States)

    Holles, Joseph H.

    2009-01-01

    The people and history of chemical engineering surround us: Gibbs free energy, Arrhenius Equation, and Reynolds number. Since these seminal figures appear in almost every classroom lecture, they provide an opportunity for a historically focused activity break. Each activity break provides the students with an image of the historical figure along…

  13. Defective DNA double-strand break repair underlies enhanced tumorigenesis and chromosomal instability in p27 deficient mice with growth-factor induced oligodendrogliomas

    OpenAIRE

    See, Wendy L.; Miller, Jeffrey P.; Squatrito, Massimo; Holland, Eric; Resh, Marilyn D.; Koff, Andrew

    2010-01-01

    The tumor suppressive activities of the Kip-family of cdk inhibitors often go beyond their role in regulating the cell cycle. Here, we demonstrate that p27 enhances Rad51 accumulation during repair of double-strand DNA breaks. Progression of PDGF-induced oligodendrogliomas was accelerated in mice lacking the cyclin-cdk binding activities of p27kip1. Cell lines were developed from RCAS-PDGF infection of nestin-tv-a brain progenitor cells in culture. p27 deficiency did not affect cell prolifera...

  14. Approach to the classical radiation biology. Ionizing radiation effects and repair mechanism of DNA double strand breaks

    International Nuclear Information System (INIS)

    Split-dose recovery has been observed under a variety of experimental conditions in many cell systems and believed to be the recovery of sublethal damage (SLD). It is considered to be one of the most widespread and important cellular responses in clinical radiotherapy. To study the molecular mechanism of this recovery, we analyzed the knockout mutants KU70-/-, RAD54-/-, and KU70-/-/ RAD54-/- of the chicken B-cell line, DT40. Rad54 participates in the homologous recombinational (HR) repair of DNA double-strand breaks (DSB), while Ku proteins are involved in non-homologous end-joining (NHEJ). Split-dose recovery was observed in the parent DT40 and KU70-/- cells. Moreover the split-dose survival enhancement had all of the characteristics of SLD recovery that had been demonstrated earlier: e.g., the reappearance of the shoulder of the survival curve with dose fractionation; repair at 25degC; and inhibition by the antibiotic actinomycin D. These results strongly suggest that SLD recovery is due to DSB repair via or mediated by HR, and that these breaks constitute SLD. The tonicity-sensitive potentially lethal damage (PLD) recovery was also found only in DT40 and KU70 -/- cells. Delayed-plating PLD recovery may be controlled by NHEJ repair that works through the cell cycle. These results lead to the conclusion that the repair of DSBs could explain the classical operational recovery phenomena. We have also investigated RBE/LET using those mutants. (author)

  15. DNA single-strand breaks, double-strand breaks, and crosslinks in rat testicular germ cells: Measurements of their formation and repair by alkaline and neutral filter elution

    International Nuclear Information System (INIS)

    This work describes a neutral and alkaline elution method for measuring DNA single-strand breaks (SSBs), DNA double-strand breaks (DSBs), and DNA-DNA crosslinks in rat testicular germ cells after treatments in vivo or in vitro with both chemical mutagens and gamma-irradiation. The methods depend upon the isolation of testicular germ cells by collagenase and trypsin digestion, followed by filtration and centrifugation. 137Cs irradiation induced both DNA SSBs and DSBs in germ cells held on ice in vitro. Irradiation of the whole animal indicated that both types of DNA breaks are induced in vivo and can be repaired. A number of germ cell mutagens induced either DNA SSBs, DSBs, or cross-links after in vivo and in vitro dosing. These chemicals included methyl methanesulfonate, ethyl methanesulfonate, ethyl nitrosourea, dibromochlorpropane, ethylene dibromide, triethylene melamine, and mitomycin C. These results suggest that the blood-testes barrier is relatively ineffective for these mutagens, which may explain in part their in vivo mutagenic potency. This assay should be a useful screen for detecting chemical attack upon male germ-cell DNA and thus, it should help in the assessment of the mutagenic risk of chemicals. In addition, this approach can be used to study the processes of SSB, DSB, and crosslink repair in DNA of male germ cells, either from all stages or specific stages of development

  16. DNA Double Strand Break Repair and its Association with Inherited Predispositions to Breast Cancer

    Directory of Open Access Journals (Sweden)

    Scott Rodney J

    2004-02-01

    Full Text Available Abstract Mutations in BRCA1 account for the majority of familial aggregations of early onset breast and ovarian cancer (~70% and about 1/5 of all early onset breast cancer families; in contrast, mutations in BRCA2 account for a smaller proportion of breast/ovarian cancer families and a similar proportion of early onset breast cancer families. BRCA2 has also been shown to be associated with a much more pleiotropic disease spectrum compared to BRCA1. Since the identification of both BRCA1 and BRCA2 investigations into the functions of these genes have revealed that both are associated with the maintenance of genomic integrity via their apparent roles in cellular response to DNA damage, especially their involvement in the process of double strand DNA break repair. This review will focus on the specific roles of both genes and how functional differences may account for the diverse clinical findings observed between families that harbour BRCA1 or BRCA2 mutations.

  17. Cernunnos/XLF: a new player in DNA double-strand break repair.

    Science.gov (United States)

    Yano, Ken-ichi; Morotomi-Yano, Keiko; Akiyama, Hidenori

    2009-06-01

    Non-homologous end-joining (NHEJ) is the predominant repair pathway for DNA double-strand breaks (DSBs) in vertebrates and also plays a crucial role in V(D)J recombination of immunoglobulin genes. Cernunnos/XLF is a newly identified core factor for NHEJ, and its defect causes a genetic disease characterized by neural disorders, immunodeficiency and increased radiosensitivity. Cernunnos/XLF has at least two distinct functions in NHEJ. Cernunnos/XLF interacts with and stimulates the XRCC4/DNA ligase IV complex, which acts at the final ligation step in NHEJ. In living cells, Cernunnos/XLF quickly responds to DSB induction and accumulates at damaged sites in a Ku-dependent but XRCC4-independent manner. These observations indicate that Cernunnos/XLF plays a unique role in bridging damage sensing and DSB rejoining steps of NHEJ. Recent crystallographic analyses of the homodimeric Cernunnos/XLF protein provide structural insights into the Cernunnos/XLF functions. These studies offer important clues toward understanding the molecular mechanism for NHEJ-defective diseases. PMID:18992362

  18. DNA repair by thiols in air shows two radicals make a double-strand break

    International Nuclear Information System (INIS)

    Using agarose gel electrophoresis, we have measured the yields of DNA single- and double-strand breaks (SSBs and DSBs) for plasmid DNA γ-irradiated in aerobic aqueous solution. The presence during irradiation of either of the thiols cysteamine or N-(2-thioethyl)-1,3-diaminopropane (WR-1065) resulted in a concentration-dependent decrease in the yield of SSBs and a much greater decrease in the yield of DSBs. This large differential protective effect was not produced by thioethers or an alcohol of structural similarity to the two thiols, suggesting that repair of DSB radical precursors by thiols is more efficient than for SSB precursors. These observations suggest the existence of a diradical intermediate in the formation of DSBs. The results argue against a major contribution by a single radical mechanism involving interstrand radical transfer via hydrogen abstraction by a peroxyl intermediate, since the half-life of this radical transfer reaction appears to be significantly greater than the lifetime of the intermediate. 35 refs., 7 figs

  19. Detection and Repair of Ionizing Radiation-Induced DNA Double Strand Breaks: New Developments in Nonhomologous End Joining

    International Nuclear Information System (INIS)

    DNA damage can occur as a result of endogenous metabolic reactions and replication stress or from exogenous sources such as radiation therapy and chemotherapy. DNA double strand breaks are the most cytotoxic form of DNA damage, and defects in their repair can result in genome instability, a hallmark of cancer. The major pathway for the repair of ionizing radiation-induced DSBs in human cells is nonhomologous end joining. Here we review recent advances on the mechanism of nonhomologous end joining, as well as new findings on its component proteins and regulation

  20. Development of Novel Visual-Plus Quantitative Analysis Systems for Studying DNA Double-Strand Break Repairs in Zebrafish

    Institute of Scientific and Technical Information of China (English)

    Jingang Liu; Lu Gong; Changqing Chang; Cong Liu; Jinrong Peng; Jun Chen

    2012-01-01

    The use of reporter systems to analyze DNA double-strand break (DSB) repairs,based on the enhanced green fluorescent protein (EGFP) and meganuclease such as I-Sce Ⅰ,is usually carried out with cell lines.In this study,we developed three visual-plus quantitative assay systems for homologous recombination (HR),non-homologous end joining (NHEJ) and single-strand annealing (SSA) DSB repair pathways at the organismal level in zebrafish embryos.To initiate DNA DSB repair,we used two I-Sce Ⅰ recognition sites in opposite orientation rather than the usual single site.The NHEJ,HR and SSA repair pathways were separately triggered by the injection of three corresponding I-Sce I-cut constructions,and the repair of DNA lesion caused by I-Sce Ⅰ could be tracked by EGFP expression in the embryos.Apart from monitoring the intensity of green fluorescence,the repair frequencies could also be precisely measured by quantitative real-time polymerase chain reaction (qPCR).Analysis of DNA sequences at the DSB sites showed that NHEJ was predominant among these three repair pathways in zebrafish embryos.Furthermore,while HR and SSA reporter systems could be effectively decreased by the knockdown of rad51 and rad52,respectively,NHEJ could only be impaired by the knockdown of ligaseⅣ (lig4) when the NHEJ construct was cut by I-Sce Ⅰ in vivo.More interestingly,blocking NHEJ with lig4-MO increased the frequency of HR,but decreased the frequency of SSA.Our studies demonstrate that the major mechanisms used to repair DNA DSBs are conserved from zebrafish to mammal,and zebrafish provides an excellent model for studying and manipulating DNA DSB repair at the organismal level.

  1. Role of XRCC4 phosphorylation by DNA-PK in the regulation of NHEJ repair pathway of DNA double strand break

    International Nuclear Information System (INIS)

    Non-homologous end-joining (NHEJ) is the predominant pathway of DNA double strand breaks in higher eukaryotes and is active throughout the cell cycle. NHEJ repair includes many factors as Ku70/86, DNA-PKcs, XRCC4-Ligase IV complex and XLF (also known as Cernunnos). In these factors, DNA-PKcs acts as central regulator in NHEJ repair. It recruited at the DNA damages site after DNA damage and after association with Ku its kinase activity is activated. It phosphorylates many of important NHEJ proteins in vitro including XRCC4, Ku 70/86, Artemis, and even DNA-PKcs but till now, very less studies have been done to know the role and significance of phosphorylation in the NHEJ repair. Studies by other researchers identified various phosphorylation sites in XRCC4 by DNA-PK using mass spectrometry but these phosphorylation sites were shown to be dispensable for DSB repair. In the present investigation, we identified 3 serine and one new threonine phosphorylation sites in XRCC4 protein by DNA-PK. In vivo phosphorylation at these sites was verified by generating phosphorylation specific antibodies and the requirement for DNA-PK therein was verified by using DNA-PK inhibitor and DNA-PK proficient and deficient cell lines in response to radiation and zeocin treatment. We have also found that phosphorylation at these sites showed dose dependency in response to radiation treatment. The two serine and one threonine phosphorylation site is also biological important as their mutation into alanine significantly elevated radiosensitivity as measured by colony formation assay. Neutral comet assay showed delayed kinetics in DSB repair of these mutants. Furthermore, we have found a protein, with putative DSB repair function, which interacts with domain including the phosphorylation sites.These results indicate that these phosphorylation sites would mediate functional link between XRCC4 and DNA-PK. (author)

  2. scid mutation in mice confers hypersensitivity to ionizing radiation and a deficiency in DNA double-strand break repair

    International Nuclear Information System (INIS)

    C.B-17 severe combined immunodeficient (scid) mice carry the scid mutation and are severely deficient in both T cell- and B cell-mediated immunity, apparently as a result of defective V(D)J joining of the immunoglobulin and T-cell receptor gene elements. In the present studies, we have defined the tissue, cellular, and molecular basis of another characteristic of these mice: their hypersensitivity to ionizing radiation. Bone marrow stem cells, intestinal crypt cells, and epithelial skin cells from scid mice are 2- to 3-fold more sensitive when irradiated in situ than are congenic BALB/c or C.B-17 controls. Two independently isolated embryo fibroblastic scid mouse cell lines display similar hypersensitivities to gamma-rays. In addition, these cell lines are sensitive to cell killing by bleomycin, which also produces DNA strand breaks, but not by the DNA crosslinking agent mitomycin C or UV irradiation. Measurement of the rejoining of gamma-ray-induced DNA double-strand breaks by pulsed-field gel electrophoresis indicates that these animals are defective in this repair system. This suggests that the gamma-ray sensitivity of the scid mouse fibroblasts could be the result of reduced repair of DNA double-strand breaks. Therefore, a common factor may participate in both the repair of DNA double-strand breaks as well as V(D)J rejoining during lymphocyte development. This murine autosomal recessive mutation should prove extremely useful in fundamental studies of radiation-induced DNA damage and repair

  3. Nuclear organization and dynamics of the DSB-repair. Direct visualization of double strand breaks in functionally different chromatin domains

    Czech Academy of Sciences Publication Activity Database

    Falk, Martin; Lukášová, Emilie; Gabrielová, Barbora; Ondřej, Vladan; Kozubek, Stanislav; Kroupová, Iva

    La Jolla, 2007. s. 46-46. [Symposium on Biological Complexity: Diseases of Transcription. 11.01.2007-14.01.2007, La Jolla] R&D Projects: GA ČR(CZ) GP204/06/P349; GA MŠk(CZ) 1P05OC084 Institutional research plan: CEZ:AV0Z50040507 Keywords : double-strand breaks (DSB) * DSB-repair * higher-order chromatin structure Subject RIV: BO - Biophysics

  4. More efficient repair of DNA double-strand breaks in skeletal muscle stem cells compared to their committed progeny

    Directory of Open Access Journals (Sweden)

    Leyla Vahidi Ferdousi

    2014-11-01

    Full Text Available The loss of genome integrity in adult stem cells results in accelerated tissue aging and is possibly cancerogenic. Adult stem cells in different tissues appear to react robustly to DNA damage. We report that adult skeletal stem (satellite cells do not primarily respond to radiation-induced DNA double-strand breaks (DSBs via differentiation and exhibit less apoptosis compared to other myogenic cells. Satellite cells repair these DNA lesions more efficiently than their committed progeny. Importantly, non-proliferating satellite cells and post-mitotic nuclei in the fiber exhibit dramatically distinct repair efficiencies. Altogether, reduction of the repair capacity appears to be more a function of differentiation than of the proliferation status of the muscle cell. Notably, satellite cells retain a high efficiency of DSB repair also when isolated from the natural niche. Finally, we show that repair of DSB substrates is not only very efficient but, surprisingly, also very accurate in satellite cells and that accurate repair depends on the key non-homologous end-joining factor DNA-PKcs.

  5. Single-stranded DNA oligomers stimulate error-prone alternative repair of DNA double-strand breaks through hijacking Ku protein.

    Science.gov (United States)

    Yuan, Ying; Britton, Sébastien; Delteil, Christine; Coates, Julia; Jackson, Stephen P; Barboule, Nadia; Frit, Philippe; Calsou, Patrick

    2015-12-01

    In humans, DNA double-strand breaks (DSBs) are repaired by two mutually-exclusive mechanisms, homologous recombination or end-joining. Among end-joining mechanisms, the main process is classical non-homologous end-joining (C-NHEJ) which relies on Ku binding to DNA ends and DNA Ligase IV (Lig4)-mediated ligation. Mostly under Ku- or Lig4-defective conditions, an alternative end-joining process (A-EJ) can operate and exhibits a trend toward microhomology usage at the break junction. Homologous recombination relies on an initial MRN-dependent nucleolytic degradation of one strand at DNA ends. This process, named DNA resection generates 3' single-stranded tails necessary for homologous pairing with the sister chromatid. While it is believed from the current literature that the balance between joining and recombination processes at DSBs ends is mainly dependent on the initiation of resection, it has also been shown that MRN activity can generate short single-stranded DNA oligonucleotides (ssO) that may also be implicated in repair regulation. Here, we evaluate the effect of ssO on end-joining at DSB sites both in vitro and in cells. We report that under both conditions, ssO inhibit C-NHEJ through binding to Ku and favor repair by the Lig4-independent microhomology-mediated A-EJ process. PMID:26350212

  6. Active and break spells of the Indian summer monsoon

    Indian Academy of Sciences (India)

    M Rajeevan; Sulochana Gadgil; Jyoti Bhate

    2010-06-01

    In this paper, we suggest criteria for the identification of active and break events of the Indian summer monsoon on the basis of recently derived high resolution daily gridded rainfall dataset over India (1951–2007). Active and break events are defined as periods during the peak monsoon months of July and August, in which the normalized anomaly of the rainfall over a critical area, called the monsoon core zone exceeds 1 or is less than −1.0 respectively, provided the criterion is satisfied for at least three consecutive days. We elucidate the major features of these events. We consider very briefly the relationship of the intraseasonal fluctuations between these events and the interannual variation of the summer monsoon rainfall. We find that breaks tend to have a longer life-span than active spells. While, almost 80% of the active spells lasted 3–4 days, only 40% of the break spells were of such short duration. A small fraction (9%) of active spells and 32% of break spells lasted for a week or longer. While active events occurred almost every year, not a single break occurred in 26% of the years considered. On an average, there are 7 days of active and break events from July through August. There are no significant trends in either the days of active or break events. We have shown that there is a major difference between weak spells and long intense breaks. While weak spells are characterized by weak moist convective regimes, long intense break events have a heat trough type circulation which is similar to the circulation over the Indian subcontinent before the onset of the monsoon. The space-time evolution of the rainfall composite patterns suggests that the revival from breaks occurs primarily from northward propagations of the convective cloud zone. There are important differences between the spatial patterns of the active/break spells and those characteristic of interannual variation, particularly those associated with the link to ENSO. Hence, the

  7. Detection of DNA single-strand breaks during the repair of UV damage in xeroderma pigmentosum cells

    International Nuclear Information System (INIS)

    In this investigation, xeroderma pigmentosum (XP) fibroblasts, XP12BE, were uv-irradiated and then incubated with cytosine arabinoside and hydroxyurea for 4 hr to inhibit the polymerase step of DNA excision repair. By alkaline elution, DNA single-strand breaks (SSB) were detected in XP cells with this regimen with an efficiency of 0.1-0.2 SSB per 109 daltons of DNA per J m-2. There was an approximately linear relation between the SSB frequency and uv dose over a range of 0.2 to 25 J m-2. This effect was approximately two orders of magnitude greater in excision-proficient normal human fibroblasts than in XP cells. These results support the conclusion that a low residual level of DNA excision repair occurs in XP group A cells and that the SSB generated during this repair can be accumulated with this polymerase inhibitor

  8. The rate of repair of DNA breaks as function of dose and phase of the cycle in mammalian cells culture

    International Nuclear Information System (INIS)

    The rate of repair of DNA single-stranded breaks in Chinese hamster cells is shown to decrease shortly (approximately 5 min) after exposure to a dose of 20 krad. There was a approximately 10-fold decrease at the G1-phase as compared to a approximately 5-fold decrease in the asynchronous population. With 1.5 krad the rate of repair at the G1 phase is 1.5-time as low as that in the asynchronous culture containing 60% of cells at the S-phase, but it remains constant till the end of the process. Changes in the rate of repair at higher doses resulting in the interphase death of cells are explained by the development of radiation-induced unspecific reactions

  9. Sibling rivalry: competition between Pol X family members in V(D)J recombination and general double strand break repair.

    Science.gov (United States)

    Nick McElhinny, Stephanie A; Ramsden, Dale A

    2004-08-01

    The nonhomologous end-joining pathway is a major means for repairing double-strand breaks (DSBs) in all mitotic cell types. This repair pathway is also the only efficient means for resolving DSB intermediates in V(D)J recombination, a lymphocyte-specific genome rearrangement required for assembly of antigen receptors. A role for polymerases in end-joining has been well established. They are a major factor in determining the character of repair junctions but, in contrast to 'core' end-joining factors, typically appear to have a subtle impact on the efficiency of end-joining. Recent work implicates several members of the Pol X family in end-joining and suggests surprising complexity in the control of how these different polymerases are employed in this pathway. PMID:15242403

  10. Nonhomologous end joining of complex DNA double-strand breaks with proximal thymine glycol and interplay with base excision repair.

    Science.gov (United States)

    Almohaini, Mohammed; Chalasani, Sri Lakshmi; Bafail, Duaa; Akopiants, Konstantin; Zhou, Tong; Yannone, Steven M; Ramsden, Dale A; Hartman, Matthew C T; Povirk, Lawrence F

    2016-05-01

    DNA double-strand breaks induced by ionizing radiation are often accompanied by ancillary oxidative base damage that may prevent or delay their repair. In order to better define the features that make some DSBs repair-resistant, XLF-dependent nonhomologous end joining of blunt-ended DSB substrates having the oxidatively modified nonplanar base thymine glycol at the first (Tg1), second (Tg2), third (Tg3) or fifth (Tg5) positions from one 3' terminus, was examined in human whole-cell extracts. Tg at the third position had little effect on end-joining even when present on both ends of the break. However, Tg as the terminal or penultimate base was a major barrier to end joining (>10-fold reduction in ligated products) and an absolute barrier when present at both ends. Dideoxy trapping of base excision repair intermediates indicated that Tg was excised from Tg1, Tg2 and Tg3 largely if not exclusively after DSB ligation. However, Tg was rapidly excised from the Tg5 substrate, resulting in a reduced level of DSB ligation, as well as slow concomitant resection of the opposite strand. Ligase reactions containing only purified Ku, XRCC4, ligase IV and XLF showed that ligation of Tg3 and Tg5 was efficient and only partially XLF-dependent, whereas ligation of Tg1 and Tg2 was inefficient and only detectable in the presence of XLF. Overall, the results suggest that promoting ligation of DSBs with proximal base damage may be an important function of XLF, but that Tg can still be a major impediment to repair, being relatively resistant to both trimming and ligation. Moreover, it appears that base excision repair of Tg can sometimes interfere with repair of DSBs that would otherwise be readily rejoined. PMID:27049455

  11. An alternative mechanism for radioprotection by dimethyl sulfoxide. Possible facilitation of DNA double-strand break repair

    International Nuclear Information System (INIS)

    The radioprotective effects of dimethyl sulfoxide (DMSO) have been known for many years, and the suppression of hydroxyl (OH) radicals induced by ionizing radiation has been thought to be the main cause of this effect. However, the DMSO concentration used was very high, and might be toxic, in earlier studies. In the present study, we administered a lower, non-toxic concentration (0.5%, id est (i.e.), 64 mM) of DMSO before irradiation and examined its radioprotective effects. Colony formation assay and micronucleus assay showed significant radioprotective effects in Chinese hamster ovary (CHO), but not in xrs5, which is defective in the repair function of DNA double-strand breaks. The levels of phosphorylated H2AX and the formation of 53BP1 foci 15 minutes after irradiation, which might reflect initial DNA double-strand breaks, in DMSO-treated CHO cells were similar to those in non-treated cells, suggesting that the radioprotective effects were not attributable to the suppression of general indirect action in the lower concentration of DMSO. On the other hand, 2 hours after irradiation, the average number of 53BP1 foci, which might reflect residual DNA double-strand breaks, was significantly decreased in DMSO-treated CHO cells compared to non-treated cells. The results indicated that low concentration of DMSO exerts radioprotective effects through the facilitation of DNA double-strand break repair rather than through the suppression of indirect action. (author)

  12. A synopsis of experimental activities on small-break LOCA

    International Nuclear Information System (INIS)

    Through reactor safety studies like WASH 1400 or the ''Deutsche Risiko-Studie'' the attention has turned from large break loss of coolant accidents to small breaks because of the high contribution of this type of accidents to core meltdown. But only after the TMI-2 accident were also the main activities in the experimental fields shifted world-wide to the small break LOCAs. Since TMI numerous research programs have either been finished or are underway. This review paper presents: a classification of the various types of transients according to break size; a discussion of major physical phenomena associated with a small break LOCA, and a description of a few selected research programs and the most important results achieved. (author)

  13. MEIOTIC F-BOX Is Essential for Male Meiotic DNA Double-Strand Break Repair in Rice[OPEN

    Science.gov (United States)

    Wang, Chong; Yu, Junping; Zong, Jie; Lu, Pingli

    2016-01-01

    F-box proteins constitute a large superfamily in plants and play important roles in controlling many biological processes, but the roles of F-box proteins in male meiosis in plants remain unclear. Here, we identify the rice (Oryza sativa) F-box gene MEIOTIC F-BOX (MOF), which is essential for male meiotic progression. MOF belongs to the FBX subfamily and is predominantly active during leptotene to pachytene of prophase I. mof meiocytes display disrupted telomere bouquet formation, impaired pairing and synapsis of homologous chromosomes, and arrested meiocytes at late prophase I, followed by apoptosis. Although normal, programmed double-stranded DNA breaks (DSBs) form in mof mutants, foci of the phosphorylated histone variant γH2AX, a marker for DSBs, persist in the mutant, indicating that many of the DSBs remained unrepaired. The recruitment of Completion of meiosis I (COM1) and Radiation sensitive51C (RAD51C) to DSBs is severely compromised in mutant meiocytes, indicating that MOF is crucial for DSB end-processing and repair. Further analyses showed that MOF could physically interact with the rice SKP1-like Protein1 (OSK1), indicating that MOF functions as a component of the SCF E3 ligase to regulate meiotic progression in rice. Thus, this study reveals the essential role of an F-box protein in plant meiosis and provides helpful information for elucidating the roles of the ubiquitin proteasome system in plant meiotic progression. PMID:27436711

  14. Molecular Process Producing Oncogene Fusion in Lung Cancer Cells by Illegitimate Repair of DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Yoshitaka Seki

    2015-09-01

    Full Text Available Constitutive activation of oncogenes by fusion to partner genes, caused by chromosome translocation and inversion, is a critical genetic event driving lung carcinogenesis. Fusions of the tyrosine kinase genes ALK (anaplastic lymphoma kinase, ROS1 (c-ros oncogene 1, or RET (rearranged during transfection occur in 1%–5% of lung adenocarcinomas (LADCs and their products constitute therapeutic targets for kinase inhibitory drugs. Interestingly, ALK, RET, and ROS1 fusions occur preferentially in LADCs of never- and light-smokers, suggesting that the molecular mechanisms that cause these rearrangements are smoking-independent. In this study, using previously reported next generation LADC genome sequencing data of the breakpoint junction structures of chromosome rearrangements that cause oncogenic fusions in human cancer cells, we employed the structures of breakpoint junctions of ALK, RET, and ROS1 fusions in 41 LADC cases as “traces” to deduce the molecular processes of chromosome rearrangements caused by DNA double-strand breaks (DSBs and illegitimate joining. We found that gene fusion was produced by illegitimate repair of DSBs at unspecified sites in genomic regions of a few kb through DNA synthesis-dependent or -independent end-joining pathways, according to DSB type. This information will assist in the understanding of how oncogene fusions are generated and which etiological factors trigger them.

  15. Histone deacetylase inhibitors decrease NHEJ both by acetylation of repair factors and trapping of PARP1 at DNA double-strand breaks in chromatin

    Science.gov (United States)

    Robert, Carine; Nagaria, Pratik K.; Pawar, Nisha; Adewuyi, Adeoluwa; Gojo, Ivana; Meyers, David J.; Cole, Philip A.; Rassool, Feyruz V.

    2016-01-01

    Histone deacetylase inhibitors (HDACi) induce acetylation of histone and non-histone proteins, and modulate the acetylation of proteins involved in DNA double-strand break (DSB) repair. Non-homologous end-joining (NHEJ) is one of the main pathways for repairing DSBs. Decreased NHEJ activity has been reported with HDACi treatment. However, mechanisms through which these effects are regulated in the context of chromatin are unclear. We show that pan-HDACi, trichostatin A (TSA), causes differential acetylation of DNA repair factors Ku70/Ku80 and poly ADP-ribose polymerase-1 (PARP1), and impairs NHEJ. Repair effects are reversed by treatments with p300/CBP inhibitor C646, with significantly decreased acetylation of PARP1. In keeping with these findings, TSA treatment significantly increases PARP1 binding to DSBs in chromatin. Notably, AML patients treated with HDACi entinostat (MS275) in vivo also show increased formation of poly ADP-ribose (PAR) that co-localizes with DSBs. Further, we demonstrate that PARP1 bound to chromatin increases with duration of TSA exposure, resembling PARP “trapping”. Knockdown of PARP1 inhibits trapping and mitigates HDACi effects on NHEJ. Finally, combination of HDACi with potent PARP inhibitor talazoparib (BMN673) shows a dose-dependent increase in PARP “trapping”, which correlates with increased apoptosis. These results provide a mechanism through which HDACi inhibits deacetylation and increases binding of PARP1 to DSBs, leading to decreased NHEJ and cytotoxicity of leukemia cells. PMID:27064363

  16. Effect of 2-deoxy-D-glucose on DNA double strand break repair, cell survival and energy metabolism in euoxic Ehrlich ascites tumour cells

    International Nuclear Information System (INIS)

    Effects of 2-deoxy-D-glucose (2-DG) on DNA double strand break (dsb) repair, cell survival and on the energy metabolism were investigated in exponentially growing Ehrlich ascites tumour (EAT) cells. Cells in suspension were exposed to 40 Gy of X-rays and allowed to repair (up to 4h) with or without 2-DG at 37oC. DNA dsb rejoining was measured by means of clamped homogeneous electric field (CHEF), a pulsed field gel electrophoresis technique. The fraction of activity released (FAR) during electrophoresis (DNA associated 14C-thymidine) was used as a parameter to determine the number of dsb present in the DNA. Biphasic kinetics for dsb repair were observed. The presence of 2-DG significantly inhibited the slow component of dsb repair. The presence of 2-DG also enhanced radiation-induced cell killing. ATP content of cells was measured by a bioluminescence method. ATP content in exponentially growing cells was about 4 pg per cell. The level of ATP was reduced by 50% in presence of 2-DG (C2-DG/CG = 1.0). (author)

  17. Histone deacetylase inhibitors decrease NHEJ both by acetylation of repair factors and trapping of PARP1 at DNA double-strand breaks in chromatin.

    Science.gov (United States)

    Robert, Carine; Nagaria, Pratik K; Pawar, Nisha; Adewuyi, Adeoluwa; Gojo, Ivana; Meyers, David J; Cole, Philip A; Rassool, Feyruz V

    2016-06-01

    Histone deacetylase inhibitors (HDACi) induce acetylation of histone and non-histone proteins, and modulate the acetylation of proteins involved in DNA double-strand break (DSB) repair. Non-homologous end-joining (NHEJ) is one of the main pathways for repairing DSBs. Decreased NHEJ activity has been reported with HDACi treatment. However, mechanisms through which these effects are regulated in the context of chromatin are unclear. We show that pan-HDACi, trichostatin A (TSA), causes differential acetylation of DNA repair factors Ku70/Ku80 and poly ADP-ribose polymerase-1 (PARP1), and impairs NHEJ. Repair effects are reversed by treatments with p300/CBP inhibitor C646, with significantly decreased acetylation of PARP1. In keeping with these findings, TSA treatment significantly increases PARP1 binding to DSBs in chromatin. Notably, AML patients treated with HDACi entinostat (MS275) in vivo also show increased formation of poly ADP-ribose (PAR) that co-localizes with DSBs. Further, we demonstrate that PARP1 bound to chromatin increases with duration of TSA exposure, resembling PARP "trapping". Knockdown of PARP1 inhibits trapping and mitigates HDACi effects on NHEJ. Finally, combination of HDACi with potent PARP inhibitor talazoparib (BMN673) shows a dose-dependent increase in PARP "trapping", which correlates with increased apoptosis. These results provide a mechanism through which HDACi inhibits deacetylation and increases binding of PARP1 to DSBs, leading to decreased NHEJ and cytotoxicity of leukemia cells. PMID:27064363

  18. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL−1 and 50 μg mL−1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  19. Repair of adjacent single-strand breaks is often accompanied by the formation of tandem sequence duplications in plant genomes.

    Science.gov (United States)

    Schiml, Simon; Fauser, Friedrich; Puchta, Holger

    2016-06-28

    Duplication of existing sequences is a major mechanism of genome evolution. It has been previously shown that duplications can occur by replication slippage, unequal sister chromatid exchange, homologous recombination, and aberrant double-strand break-induced synthesis-dependent strand annealing reactions. In a recent study, the abundant presence of short direct repeats was documented by comparative bioinformatics analysis of different rice genomes, and the hypothesis was put forward that such duplications might arise due to the concerted repair of adjacent single-strand breaks (SSBs). Applying the CRISPR/Cas9 technology, we were able to test this hypothesis experimentally in the model plant Arabidopsis thaliana Using a Cas9 nickase to induce adjacent genomic SSBs in different regions of the genome (genic, intergenic, and heterochromatic) and at different distances (∼20, 50, and 100 bps), we analyzed the repair outcomes by deep sequencing. In addition to deletions, we regularly detected the formation of direct repeats close to the break sites, independent of the genomic context. The formation of these duplications as well as deletions may be associated with the presence of microhomologies. Most interestingly, we found that even the induction of two SSBs on the same DNA strand can cause genome alterations, albeit at a much lower level. Because such a scenario reflects a natural step during nucleotide excision repair, and given that the germline is set aside only late during development in plants, the repair of adjacent SSBs indeed seems to have an important influence on the shaping of plant genomes during evolution. PMID:27307441

  20. ZTF-8 interacts with the 9-1-1 complex and is required for DNA damage response and double-strand break repair in the C. elegans germline.

    Directory of Open Access Journals (Sweden)

    Hyun-Min Kim

    2014-10-01

    Full Text Available Germline mutations in DNA repair genes are linked to tumor progression. Furthermore, failure in either activating a DNA damage checkpoint or repairing programmed meiotic double-strand breaks (DSBs can impair chromosome segregation. Therefore, understanding the molecular basis for DNA damage response (DDR and DSB repair (DSBR within the germline is highly important. Here we define ZTF-8, a previously uncharacterized protein conserved from worms to humans, as a novel factor involved in the repair of both mitotic and meiotic DSBs as well as in meiotic DNA damage checkpoint activation in the C. elegans germline. ztf-8 mutants exhibit specific sensitivity to γ-irradiation and hydroxyurea, mitotic nuclear arrest at S-phase accompanied by activation of the ATL-1 and CHK-1 DNA damage checkpoint kinases, as well as accumulation of both mitotic and meiotic recombination intermediates, indicating that ZTF-8 functions in DSBR. However, impaired meiotic DSBR progression partially fails to trigger the CEP-1/p53-dependent DNA damage checkpoint in late pachytene, also supporting a role for ZTF-8 in meiotic DDR. ZTF-8 partially co-localizes with the 9-1-1 DDR complex and interacts with MRT-2/Rad1, a component of this complex. The human RHINO protein rescues the phenotypes observed in ztf-8 mutants, suggesting functional conservation across species. We propose that ZTF-8 is involved in promoting repair at stalled replication forks and meiotic DSBs by transducing DNA damage checkpoint signaling via the 9-1-1 pathway. Our findings define a conserved function for ZTF-8/RHINO in promoting genomic stability in the germline.

  1. Relative rates of repair of single-strand breaks and postirradiation DNA degradation in normal and induced cells of Escherichia coli

    International Nuclear Information System (INIS)

    Labeled DNA from irradiated Escherichia coli cells was studied on an alkaline sucrose gradient without acid precipitation of the DNA. This enabled the observation of both DNA repair and DNA degradation. The use of a predose of ultraviolet light (uv) caused induction of an inhibitor of postirradiation DNA degradation in le lambda+ strains. The effect of this induction on both the repair of single-strand breaks and DNA degradation was followed in strains WU3610 (uvr+) and WU3610-89 (uvr-). The repair process was more rapid than the degradation, and when degradation was inhibited more repair was apparent. Cells that were lex- (B/sub s-1/ and AB2474) could not be induced for inhibition of degradation. Nevertheless, by observation at short times repair could be seen clearly. This repaired DNA was degraded, suggesting that the signal for DNA degradation is not a single-strand break

  2. Approach to the classical radiation biology. Ionizing radiation effects and repair mechanism of DNA double strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Utsumi, Hiroshi [Kyoto Univ., Kumatori, Osaka (Japan). Research Reactor Inst

    2000-09-01

    Split-dose recovery has been observed under a variety of experimental conditions in many cell systems and believed to be the recovery of sublethal damage (SLD). It is considered to be one of the most widespread and important cellular responses in clinical radiotherapy. To study the molecular mechanism of this recovery, we analyzed the knockout mutants KU70{sup -/-}, RAD54{sup -/-}, and KU70{sup -/-}/ RAD54{sup -/-} of the chicken B-cell line, DT40. Rad54 participates in the homologous recombinational (HR) repair of DNA double-strand breaks (DSB), while Ku proteins are involved in non-homologous end-joining (NHEJ). Split-dose recovery was observed in the parent DT40 and KU70{sup -/-} cells. Moreover the split-dose survival enhancement had all of the characteristics of SLD recovery that had been demonstrated earlier: e.g., the reappearance of the shoulder of the survival curve with dose fractionation; repair at 25degC; and inhibition by the antibiotic actinomycin D. These results strongly suggest that SLD recovery is due to DSB repair via or mediated by HR, and that these breaks constitute SLD. The tonicity-sensitive potentially lethal damage (PLD) recovery was also found only in DT40 and KU70 {sup -/-} cells. Delayed-plating PLD recovery may be controlled by NHEJ repair that works through the cell cycle. These results lead to the conclusion that the repair of DSBs could explain the classical operational recovery phenomena. We have also investigated RBE/LET using those mutants. (author)

  3. An inverse switch in DNA base excision and strand break repair contributes to melphalan resistance in multiple myeloma cells.

    Directory of Open Access Journals (Sweden)

    Mirta M L Sousa

    Full Text Available Alterations in checkpoint and DNA repair pathways may provide adaptive mechanisms contributing to acquired drug resistance. Here, we investigated the levels of proteins mediating DNA damage signaling and -repair in RPMI8226 multiple myeloma cells and its Melphalan-resistant derivative 8226-LR5. We observed markedly reduced steady-state levels of DNA glycosylases UNG2, NEIL1 and MPG in the resistant cells and cross-resistance to agents inducing their respective DNA base lesions. Conversely, repair of alkali-labile sites was apparently enhanced in the resistant cells, as substantiated by alkaline comet assay, autoribosylation of PARP-1, and increased sensitivity to PARP-1 inhibition by 4-AN or KU58684. Reduced base-excision and enhanced single-strand break repair would both contribute to the observed reduction in genomic alkali-labile sites, which could jeopardize productive processing of the more cytotoxic Melphalan-induced interstrand DNA crosslinks (ICLs. Furthermore, we found a marked upregulation of proteins in the non-homologous end-joining (NHEJ pathway of double-strand break (DSB repair, likely contributing to the observed increase in DSB repair kinetics in the resistant cells. Finally, we observed apparent upregulation of ATR-signaling and downregulation of ATM-signaling in the resistant cells. This was accompanied by markedly increased sensitivity towards Melphalan in the presence of ATR-, DNA-PK, or CHK1/2 inhibitors whereas no sensitizing effect was observed subsequent to ATM inhibition, suggesting that replication blocking lesions are primary triggers of the DNA damage response in the Melphalan resistant cells. In conclusion, Melphalan resistance is apparently contributed by modulation of the DNA damage response at multiple levels, including downregulation of specific repair pathways to avoid repair intermediates that could impair efficient processing of cytotoxic ICLs and ICL-induced DSBs. This study has revealed several novel

  4. QUANTITATION OF INTRACELLULAR NAD(P)H IN LIVING CELLS CAN MONITOR AN IMBALANCE OF DNA SINGLE STRAND BREAK REPAIR IN REAL TIME

    Science.gov (United States)

    Quantitation of intracellular NAD(P)H in living cells can monitor an imbalance of DNA single strand break repair in real time.ABSTRACTDNA single strand breaks (SSBs) are one of the most frequent DNA lesions in genomic DNA generated either by oxidative stress or du...

  5. Conservation of the rad21 Schizosaccharomyces pombe DNA double-strand break repair gene in mammals

    International Nuclear Information System (INIS)

    Purpose/Objective: Genetic factors are likely to be major determinants of human cellular ionizing radiation sensitivity. DNA double strand breaks (dsbs) are significant ionizing radiation-induced lesions; cellular DNA dsb processing is also important in a number of other contexts. To further the understanding of DNA dsb processing in mammalian cells, we cloned and sequenced mammalian homologs of the rad21 Schizosaccharomyces pombe DNA dsb repair gene. Materials and Methods: The genes were cloned by evolutionary walking, exploiting sequence homology between the yeast and mammalian genes. Results: No major motifs indicative of a particular function were present in the predicted amino acid sequences of the mammalian genes. Alignment of the Rad21 amino acid sequence with its putative homologs showed that similarity was distributed across the length of the proteins, with more highly conserved regions at both termini. The mHR21sp (mouse homolog ofR ad21, S. pombe) and hHR21sp (humanh omolog of Rad21, S. pombe) predicted proteins were 96% identical, whereas the human and S. pombe proteins were 25% identical and 47% similar. RNA blot analysis showed that mHR21sp mRNA was abundant in all adult mouse tissues examined, with highest expression in testis and thymus. In addition to a 3.1kb mRNA transcript in all tissues, an additional 2.2kb transcript was present at a high level in post-meiotic spermatids, white expression of the 3.1kb mRNA in testis was confined to the meiotic compartment. hHR21sp mRNA was cell cycle regulated in human cells, increasing in late S phase to a peak in G2 phase. The level of hHR21sp transcripts was not altered by exposure of normal diploid fibroblasts to 10 Gy ionizing radiation. In situ hybridization showed mHR21sp resided on chromosome 15D3, whereashHR21sp localized to the syntenic 8q24 region. Conclusion: Cloning these novel mammalian genes and characterization of their protein products should contribute to the understanding of cellular DNA dsb

  6. Double-Strand Break Repair by Interchromosomal Recombination: An In Vivo Repair Mechanism Utilized by Multiple Somatic Tissues in Mammals

    OpenAIRE

    White, Ryan R; Sung, Patricia; Vestal, C. Greer; Benedetto, Gregory; Cornelio, Noelle; Richardson, Christine

    2013-01-01

    Homologous recombination (HR) is essential for accurate genome duplication and maintenance of genome stability. In eukaryotes, chromosomal double strand breaks (DSBs) are central to HR during specialized developmental programs of meiosis and antigen receptor gene rearrangements, and form at unusual DNA structures and stalled replication forks. DSBs also result from exposure to ionizing radiation, reactive oxygen species, some anti-cancer agents, or inhibitors of topoisomerase II. Literature p...

  7. Local Activity Principle:. the Cause of Complexity and Symmetry Breaking

    Science.gov (United States)

    Mainzer, Klaus

    2013-01-01

    The principle of local activity is precisely the missing concept to explain the emergence of complex patterns in a homogeneous medium. Leon O. Chua discovered and defined this principle in the theory of nonlinear electronic circuits in a mathematically rigorous way. The local principle can be generalized and proven at least for the class of nonlinear reaction-diffusion systems in physics, chemistry, biology and brain research. Recently, it was realized by memristors for nanoelectronic device applications in technical brains. In general, the emergence of complex patterns and structures is explained by symmetry breaking in homogeneous media. The principle of local activity is the cause of symmetry breaking in homogeneous media. We argue that the principle of local activity is really fundamental in science and can even be identified in quantum cosmology as symmetry breaking of local gauge symmetries generating the complexity of matter and forces in our universe. Finally, we consider applications in economic, financial, and social systems with the emergence of equilibrium states, symmetry breaking at critical points of phase transitions and risky acting at the edge of chaos. In any case, the driving causes of symmetry breaking and the emergence of complexity are locally active elements, cells, units, or agents.

  8. BMI1 Is Recruited to DNA Breaks and Contributes to DNA Damage-Induced H2A Ubiquitination and Repair ▿ †

    Science.gov (United States)

    Ginjala, Vasudeva; Nacerddine, Karim; Kulkarni, Atul; Oza, Jay; Hill, Sarah J.; Yao, Ming; Citterio, Elisabetta; van Lohuizen, Maarten; Ganesan, Shridar

    2011-01-01

    DNA damage activates signaling pathways that lead to modification of local chromatin and recruitment of DNA repair proteins. Multiple DNA repair proteins having ubiquitin ligase activity are recruited to sites of DNA damage, where they ubiquitinate histones and other substrates. This DNA damage-induced histone ubiquitination is thought to play a critical role in mediating the DNA damage response. We now report that the polycomb protein BMI1 is rapidly recruited to sites of DNA damage, where it persists for more than 8 h. The sustained localization of BMI1 to damage sites is dependent on intact ATM and ATR and requires H2AX phosphorylation and recruitment of RNF8. BMI1 is required for DNA damage-induced ubiquitination of histone H2A at lysine 119. Loss of BMI1 leads to impaired repair of DNA double-strand breaks by homologous recombination and the accumulation of cells in G2/M. These data support a crucial role for BMI1 in the cellular response to DNA damage. PMID:21383063

  9. Formation and repair of DNA double-strand breaks in superinfecting phage lambda after ionizing irradiation of Escherichia coli host cells

    International Nuclear Information System (INIS)

    Cells of Escherichia coli containing superinfecting phage lambda DNA molecules were irradiated with 4-MeV electrons and lysed at neutral pH; the lysates were sedimented in neutral sucrose gradients to separate lambda DNA molecules containing no strand breaks, one or more single-strand breaks, or a double-strand break. About 40 single-strand breaks were induced for every double-strand break in both the presence and absence of oxygen. The single-strand breaks were rapidly repaired after irradiation in nitrogen anoxia and subsequent incubation in aerobic growth medium, but no net reduction in the number of double-strand breaks was observed. This is similar to observations after oxic irradiation. No quadratic dose dependence of double-strand break induction was found up to 500 krad in oxygen and up to 1800 krad in nitrogen anoxia. Also, no difference in double-strand breakage was observed when equal doses in the range of 60 to 80 krad were delivered either (i) acutely, with 1 sec. or (ii) intermittently, with time to repair most single-strand breaks before onset of the next radiation pulse. It is concluded that the proposed mechanism whereby two independently induced single-strand breaks pair to form a double-strand break is not significant in the biological dose range

  10. The influence of bromodeoxyuridine on the induction and repair of DNA double-strand breaks in glioblastoma cells

    International Nuclear Information System (INIS)

    Aims: To examine the dose response of DNA damage and its modification by the radiosensitizer, 5-bromo-2'-deoxyuridine (BrdU). The sensitizing mechanism is analyzed with regard to its influence on the induction and repair of DNA double-strand breaks (DSBs). Material and Methods: Cells from three different human glioblastoma lines, A7, LH and U87MG, were X-irradiated with and without exposure to BrdU. DNA fragments were separated by field-inversion gel electrophoresis (FIGE) and quantified by fluorometry immediately and 24 h after irradiation. Results: In all cell lines, the dose response followed a linear-quadratic rather than a purely linear function. BrdU-treated cells exhibited a significantly higher amount of mobile DNA. In repair experiments with and without BrdU, the amount of mobile DNA fell close to control values within 24 h. Conclusions: The linear-quadratic model appropriately describes the X-ray induced fragmentation of DNA. BrdU sensitizing acts predominantly by increasing DNA fragility, and not by impairing damage repair. The amount of DSBs persistent after 24 h of repair is minimal, even after highly cytotoxic doses. However, it appears to depend on the extent of initial damage, causing sensitized cells to retain more DSBs than unsensitized cells. (orig.)

  11. PARP inhibition versus PARP-1 silencing: different outcomes in terms of single-strand break repair and radiation susceptibility

    OpenAIRE

    Godon, Camille; Cordelières, Fabrice P.; Biard, Denis; Giocanti, Nicole; Mégnin-Chanet, Frédérique; Hall, Janet; Favaudon, Vincent

    2008-01-01

    The consequences of PARP-1 disruption or inhibition on DNA single-strand break repair (SSBR) and radio-induced lethality were determined in synchronized, isogenic HeLa cells stably silenced or not for poly(ADP-ribose) polymerase-1 (PARP-1) (PARP-1KD) or XRCC1 (XRCC1KD). PARP-1 inhibition prevented XRCC1-YFP recruitment at sites of 405 nm laser micro irradiation, slowed SSBR 10-fold and triggered the accumulation of large persistent foci of GFP-PARP-1 and GFP-PCNA at photo damaged sites. These...

  12. XLS (c9orf142) is a new component of mammalian DNA double-stranded break repair

    OpenAIRE

    Craxton, A; J. Somers; Munnur, D; Jukes-Jones, R; Cain, K.; Malewicz, M

    2015-01-01

    Repair of double-stranded DNA breaks (DSBs) in mammalian cells primarily occurs by the non-homologous end-joining (NHEJ) pathway, which requires seven core proteins (Ku70/Ku86, DNA-PKcs (DNA-dependent protein kinase catalytic subunit), Artemis, XRCC4-like factor (XLF), XRCC4 and DNA ligase IV). Here we show using combined affinity purification and mass spectrometry that DNA-PKcs co-purifies with all known core NHEJ factors. Furthermore, we have identified a novel evolutionary conserved protei...

  13. The autophagy inhibitor chloroquine targets cancer stem cells in triple negative breast cancer by inducing mitochondrial damage and impairing DNA break repair.

    Science.gov (United States)

    Liang, Diana H; Choi, Dong Soon; Ensor, Joe E; Kaipparettu, Benny A; Bass, Barbara L; Chang, Jenny C

    2016-07-01

    Triple negative breast cancer (TNBC), characterized by an abundance of treatment-resistant breast cancer stem cells (CSCs), has a poorer prognosis than other types of breast cancers. Despite its aggressiveness, no effective targeted therapy exists for TNBC. Here, we demonstrate that CQ effectively targets CSCs via autophagy inhibition, mitochondrial structural damage, and impairment of double-stranded DNA break repair. Electron microscopy demonstrates CQ-induced mitochondrial cristae damage, which leads to mitochondrial membrane depolarization with a significant reduction in the activity of cytochrome c oxidase and accumulation of superoxide and double-stranded DNA breaks. CQ effectively diminishes the TNBC cells' ability to metastasize in vitro and in a TNBC xenograft model. When administered in combination with carboplatin, CQ effectively inhibits carboplatin-induced autophagy. This combination treatment significantly diminishes the expression of DNA repair proteins in CSC subpopulations, resulting in tumor growth reduction in carboplatin-resistant BRCA1 wild-type TNBC orthotopic xenografts. As TNBC's high treatment failure rate has been attributed to enrichment of CSCs, CQ, an autophagy inhibitor with anti-CSC effects, may be an effective adjunct to current TNBC chemotherapy regimens with carboplatin. PMID:27060208

  14. Common and unique genetic interactions of the poly(ADP-ribose) polymerases PARP1 and PARP2 with DNA double-strand break repair pathways.

    Science.gov (United States)

    Ghosh, Rajib; Roy, Sanchita; Kamyab, Johan; Dantzer, Francoise; Franco, Sonia

    2016-09-01

    In mammalian cells, chromatin poly(ADP-ribos)ylation (PARylation) at sites of DNA Double-Strand Breaks (DSBs) is mediated by two highly related enzymes, PARP1 and PARP2. However, enzyme-specific genetic interactions with other DSB repair factors remain largely undefined. In this context, it was previously shown that mice lacking PARP1 and H2AX, a histone variant that promotes DSB repair throughout the cell cycle, or the core nonhomologous end-joining (NHEJ) factor Ku80 are not viable, while mice lacking PARP1 and the noncore NHEJ factor DNA-PKcs are severely growth retarded and markedly lymphoma-prone. Here, we have examined the requirement for PARP2 in these backgrounds. We find that, like PARP1, PARP2 is essential for viability in mice lacking H2AX. Moreover, treatment of H2AX-deficient primary fibroblasts or B lymphocytes with PARP inhibitors leads to activation of the G2/M checkpoint and accumulation of chromatid-type breaks in a lineage- and gene-dose dependent manner. In marked contrast to PARP1, loss of PARP2 does not result in additional phenotypes in growth, development or tumorigenesis in mice lacking either Ku80 or DNA-PKcs. Altogether these findings highlight specific nonoverlapping functions of PARP1 and PARP2 at H2AX-deficient chromatin during replicative phases of the cell cycle and uncover a unique requirement for PARP1 in NHEJ-deficient cells. PMID:27373144

  15. H. pylori-Induced DNA Strand Breaks Are Introduced by Nucleotide Excision Repair Endonucleases and Promote NF-κB Target Gene Expression

    Directory of Open Access Journals (Sweden)

    Mara L. Hartung

    2015-10-01

    Full Text Available The human bacterial pathogen Helicobacter pylori exhibits genotoxic properties that promote gastric carcinogenesis. H. pylori introduces DNA double strand breaks (DSBs in epithelial cells that trigger host cell DNA repair efforts. Here, we show that H. pylori-induced DSBs are repaired via error-prone, potentially mutagenic non-homologous end-joining. A genome-wide screen for factors contributing to DSB induction revealed a critical role for the H. pylori type IV secretion system (T4SS. Inhibition of transcription, as well as NF-κB/RelA-specific RNAi, abrogates DSB formation. DSB induction further requires β1-integrin signaling. DSBs are introduced by the nucleotide excision repair endonucleases XPF and XPG, which, together with RelA, are recruited to chromatin in a highly coordinated, T4SS-dependent manner. Interestingly, XPF/XPG-mediated DNA DSBs promote NF-κB target gene transactivation and host cell survival. In summary, H. pylori induces XPF/XPG-mediated DNA damage through activation of the T4SS/β1-integrin signaling axis, which promotes NF-κB target gene expression and host cell survival.

  16. Physical Activity Breaks and Facilities in US Secondary Schools

    Science.gov (United States)

    Hood, Nancy E.; Colabianchi, Natalie; Terry-McElrath, Yvonne M.; O'Malley, Patrick M.; Johnston, Lloyd D.

    2014-01-01

    Background: Research on physical activity breaks and facilities (indoor and outdoor) in secondary schools is relatively limited. Methods: School administrators and students in nationally representative samples of 8th (middle school) and 10th/12th grade (high school) students were surveyed annually from 2008-2009 to 2011-2012. School administrators…

  17. Low concentration of arsenite exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity

    OpenAIRE

    Qin, Xu-Jun; Hudson, Laurie G.; Liu, Wenlan; Timmins, Graham S.; Liu, Ke Jian

    2008-01-01

    Epidemiological studies have associated arsenic exposure with many types of human cancers. Arsenic has also been shown to act as a co-carcinogen even at low concentrations. However, the precise mechanism of its co-carcinogenic action is unknown. Recent studies indicate that arsenic can interfere with DNA repair processes. Poly (ADP-ribose) polymerase (PARP)-1 is a zinc-finger DNA repair protein, which can promptly sense DNA strand breaks and initiate DNA repair pathways. In the present study,...

  18. DNA damage and repair activity after broccoli intake in young healthy smokers

    DEFF Research Database (Denmark)

    Riso, Patrizia; Martini, Daniela; Møller, Peter;

    2010-01-01

    compounds, including smokers. The aim of the study was to evaluate the effect of broccoli intake on biomarkers of DNA damage and repair. Twenty-seven young healthy smokers consumed a portion of steamed broccoli (250 g/day) or a control diet for 10 days each within a crossover design with a washout period...... mRNA expression levels of repair and defence enzymes: 8-oxoguanine DNA glycosylase (OGG1), nucleoside diphosphate linked moiety X-type motif 1 (NUDT1) and heme oxygenase 1 (HO-1). After broccoli consumption, the level of oxidised DNA lesions decreased by 41% (95% confidence interval: 10%, 72%) and...... the resistance to H(2)O(2)-induced DNA strand breaks increased by 23% (95% CI: 13%, 34%). Following broccoli intake, a higher protection was observed in subjects with glutathione S-transferase (GST) M1-null genotype. The expression level and activity of repair enzymes was unaltered. In conclusion...

  19. Xbp1-mediated histone H4 deacetylation contributes to DNA double-strand break repair in yeast

    Institute of Scientific and Technical Information of China (English)

    Ran Tao; Hua Chen; Chan Gao; Pcng Xue; Fuquan Yang; Jing-Dong J Han; Bing Zhou; Ye-Guang Chen

    2011-01-01

    Xbp1 has been shown to regulate the cell cycle as a transcriptional repressor in budding yeast Saccharomyces cerevisiae.In this study,we demonstrated that Xbp1 regulates DNA double-strand break (DSB) repair in S.cerevisiae.Xbp1 physically and genetically interacts with the histone deacetylase Rpd3 complex.Chromatin immunoprecipitation revealed that Xbp1 is required for efficient deacetylation of histone H4 flanking DSBs by the Rpd3 complex.Deletion of XBP1 leads to the delayed deacetylation of histone H4,which is coupled with increased nucleosome displacement,increased DNA end resection and decreased non-homologous end-joining (NHEJ).In response to DNA damage,Xbp1 is upregulated in a Mec1-Rad9-Rad53 checkpoint pathway-dependent manner and undergoes dephosphorylation.Cdk1,a central regulator of S.cerevisiae cell cycle,is responsible for Xbp1 phosphorylation at residues Ser146,Ser271 and Ser551.Substitution of these serine residues with alanine not only increases the association of Xbp1 with the Rpd3 complex and its recruitment to a DSB,but also promotes DSB repair.Together,our findings reveal a role for Xbp1 in DSB repair via NHEJ through regulation of histone H4 acetylation and nucleosome displacement in a positive feedback manner.

  20. A quantitative model of the major pathways for radiation-induced DNA double-strand break repair

    International Nuclear Information System (INIS)

    We have developed a model approach to simulate the major pathways of DNA double-strand break (DSB) repair in mammalian and human cells. The proposed model shows a possible mechanistic explanation of the basic regularities of DSB processing through the nonhomologous end-joining (NHEJ), homologous recombination (HR), and single-strand annealing (SSA). It reconstructs the time-courses of radiation-induced foci specific to particular repair processes including the major intermediate stages. The model is validated for ionizing radiations of a wide range of linear energy transfer (0.2-236 keV/μm) including a relatively broad spectrum of heavy ions. The appropriate set of reaction rate constants was suggested to satisfy the kinetics of DSB rejoining for the considered types of exposure. The simultaneous assessment of three repair pathways allows one to describe their possible biological relations in response to radiation. With the help of the proposed approach, we reproduce several experimental data sets on γ-H2AX foci remaining in different types of cells including those defective in NHEJ, HR, or SSA functions.

  1. Bi-directional routing of DNA mismatch repair protein human exonuclease 1 to replication foci and DNA double strand breaks

    DEFF Research Database (Denmark)

    Liberti, Sascha Emilie; Andersen, Sofie Dabros; Wang, Jing;

    2011-01-01

    Human exonuclease 1 (hEXO1) is implicated in DNA metabolism, including replication, recombination and repair, substantiated by its interactions with PCNA, DNA helicases BLM and WRN, and several DNA mismatch repair (MMR) proteins. We investigated the sub-nuclear localization of hEXO1 during S......-phase progression and in response to laser-induced DNA double strand breaks (DSBs). We show that hEXO1 and PCNA co-localize in replication foci. This apparent interaction is sustained throughout S-phase. We also demonstrate that hEXO1 is rapidly recruited to DNA DSBs. We have identified a PCNA interacting protein...... 390-490 and 787-846) are required to direct the protein to the DNA damage site. Our results reveal that protein domains in hEXO1 in conjunction with specific protein interactions control bi-directional routing of hEXO1 between on-going DNA replication and repair processes in living cells...

  2. Effects of daunomycin and radiation on cell-survival and repair of DNA single-strand breaks

    International Nuclear Information System (INIS)

    The combined action of Daunomycin and irradiation was investigated using mouse L-929 cells in culture. Survival of cells was measured with the colony assay. Sedimentation in alkaline sucrose gradients was used to study repair of DNA single-strand breaks (SSB) in the presence of various concentrations of Daunomycin. A small increase in radiosensitivity, as measured by decreasing D0, was obtained for doses of Daunomycin that are considerably toxic to the cells (0.1 μg/ml). However, the Dsub(q) values remained constant even at high concentrations indicating that Daunomycin does not interfere with recovery processes. The rate of rejoining of SSB remained constant up to 1.0 μg/ml, whereas concentrations of Daunomycin as high as 10 μg/ml reduced the velocity of repair by a factor of 13. The data show that concentrations of Daumomycin similar to those required for other DNA-binding drugs were required to inhibit SSB repair. For clinical purposes, no increase in tumour-killing efficiency may be expected from a combined treatment with Daumomycin and radiation. (author)

  3. XLS (c9orf142) is a new component of mammalian DNA double-stranded break repair.

    Science.gov (United States)

    Craxton, A; Somers, J; Munnur, D; Jukes-Jones, R; Cain, K; Malewicz, M

    2015-06-01

    Repair of double-stranded DNA breaks (DSBs) in mammalian cells primarily occurs by the non-homologous end-joining (NHEJ) pathway, which requires seven core proteins (Ku70/Ku86, DNA-PKcs (DNA-dependent protein kinase catalytic subunit), Artemis, XRCC4-like factor (XLF), XRCC4 and DNA ligase IV). Here we show using combined affinity purification and mass spectrometry that DNA-PKcs co-purifies with all known core NHEJ factors. Furthermore, we have identified a novel evolutionary conserved protein associated with DNA-PKcs-c9orf142. Computer-based modelling of c9orf142 predicted a structure very similar to XRCC4, hence we have named c9orf142-XLS (XRCC4-like small protein). Depletion of c9orf142/XLS in cells impaired DSB repair consistent with a defect in NHEJ. Furthermore, c9orf142/XLS interacted with other core NHEJ factors. These results demonstrate the existence of a new component of the NHEJ DNA repair pathway in mammalian cells. PMID:25941166

  4. Investigation of the repair of single-strand breaks in human DNA using alkaline gel electrophoresis

    International Nuclear Information System (INIS)

    Unstimulated lymphocytes from eight healthy persons were exposed to 10-, 30-, and 100-Gy doses of 60Co gamma radiation. The repair of damaged DNA was measured by (1) alkaline gel electrophoresis (extracted DNA loaded on 0.25% agarose gel, run at 1 V/cm for 39-44 h) at 0, 1, and 2 h after exposure and (2) incorporation of [3H]thymidine into unstimulated lymphocytes in the presence of 2 mM hydroxyurea 1 and 2 h after exposure. Both methods--alkaline gel electrophoresis and thymidine incorporation--showed that repair was completed within 2 h

  5. Double-strand breaks in DNA caused by repair of damage due to ultraviolet light

    International Nuclear Information System (INIS)

    DNA DSBs are formed in normal human IMR-90 cells during repair incubation after 100 and 300 J.m-2 of UVL. By contrast, no DSBs are formed after UVL in human XPA cells that are unable to excise pyrimidine dimers. The DSBs are not due to immediate cell death since all the cells excluded trypan blue at the time of assay and because XPA cells, which are much more UVL-sensitive than IMR-90, did not form DSBs after UVL. We suggest that these repair-induced DSBs should be potent lesions that might lead to cytotoxicity, chromosome aberrations, deletion mutations, and perhaps cellular transformation

  6. RNF4 is required for DNA double-strand break repair in vivo

    DEFF Research Database (Denmark)

    Vyas, R; Kumar, R; Clermont, F;

    2013-01-01

    Rnf4-deficient cells and mice exhibit increased sensitivity to genotoxic stress. Mechanistically, we show that Rnf4 targets SUMOylated MDC1 and SUMOylated BRCA1, and is required for the loading of Rad51, an enzyme required for HR repair, onto sites of DNA damage. Similarly to inactivating mutations in...... both homologous recombination (HR) and non-homologous end joining repair. To establish a link between Rnf4 and the DNA damage response (DDR) in vivo, we generated an Rnf4 allelic series in mice. We show that Rnf4-deficiency causes persistent ionizing radiation-induced DNA damage and signaling, and that...

  7. Optimizing Computation of Repairs from Active Integrity Constraints

    DEFF Research Database (Denmark)

    Cruz-Filipe, Luís

    2014-01-01

    Active integrity constraints (AICs) are a form of integrity constraints for databases that not only identify inconsistencies, but also suggest how these can be overcome. The semantics for AICs defines different types of repairs, but deciding whether an inconsistent database can be repaired and fi...

  8. A model treating the DNA double-strand break repair inhibition by damage clustering

    International Nuclear Information System (INIS)

    A microdosimetric model for the interpretation of radiation induced irreparable DNA double-strand breaks was applied to the biological endpoint of chromosomal aberrations. The model explains irreparable DNA double-strand breaks in terms of break clustering in DNA subunits. The model predicts quite good chromosomal aberrations in gamma- and X-ray irradiated V79 cells and human lymphocytes. In the case of α-particle irradiation the presumption had to be made, that only the cells with indirect events in the nucleus (due to delta-electrons) reach the metaphase and are analysed. With the help of this model we are able to explain the peculiar effectiveness of ultrasoft C-X-rays in human lymphocytes. In addition, an interpretation of experiments with accelerated and spatially correlated particles is given. (author)

  9. The Over-expression of the β2 Catalytic Subunit of the Proteasome Decreases Homologous Recombination and Impairs DNA Double-Strand Break Repair in Human Cells

    Directory of Open Access Journals (Sweden)

    Anita Collavoli

    2011-01-01

    Full Text Available By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB. This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p.

  10. CHO cell death, strand break damage, and repair due to combination radiation and hyperthermia

    International Nuclear Information System (INIS)

    Previous reports have suggested a relationship between the hyperthermia induced changes in nucleoprotein and the hyperthermic enhancement of radiation sensitivity. In this investigation, the level of initial strand break damage, DNA strand rejoining kinetics, DNA/protein ratios, and residual DNA damage were measured following combined hyperthermia and radiation treatments in an attempt to further understand these relationships

  11. DNA Ligase IV and Artemis Act Cooperatively to Suppress Homologous Recombination in Human Cells: Implications for DNA Double-Strand Break Repair

    OpenAIRE

    Aya Kurosawa; Shinta Saito; Sairei So; Mitsumasa Hashimoto; Kuniyoshi Iwabuchi; Haruka Watabe; Noritaka Adachi

    2013-01-01

    Nonhomologous end-joining (NHEJ) and homologous recombination (HR) are two major pathways for repairing DNA double-strand breaks (DSBs); however, their respective roles in human somatic cells remain to be elucidated. Here we show using a series of human gene-knockout cell lines that NHEJ repairs nearly all of the topoisomerase II- and low-dose radiation-induced DNA damage, while it negatively affects survival of cells harbouring replication-associated DSBs. Intriguingly, we find that loss of ...

  12. Heterozygous PALB2 c.1592delT mutation channels DNA double-strand break repair into error-prone pathways in breast cancer patients.

    Science.gov (United States)

    Obermeier, K; Sachsenweger, J; Friedl, T W P; Pospiech, H; Winqvist, R; Wiesmüller, L

    2016-07-21

    Hereditary heterozygous mutations in a variety of DNA double-strand break (DSB) repair genes have been associated with increased breast cancer risk. In the Finnish population, PALB2 (partner and localizer of BRCA2) represents a major susceptibility gene for female breast cancer, and so far, only one mutation has been described, c.1592delT, which leads to a sixfold increased disease risk. PALB2 is thought to participate in homologous recombination (HR). However, the effect of the Finnish founder mutation on DSB repair has not been investigated. In the current study, we used a panel of lymphoblastoid cell lines (LCLs) derived from seven heterozygous female PALB2 c.1592delT mutation carriers with variable health status and six wild-type matched controls. The results of our DSB repair analysis showed that the PALB2 mutation causes specific changes in pathway usage, namely increases in error-prone single-strand annealing (SSA) and microhomology-mediated end-joining (MMEJ) compared with wild-type LCLs. These data indicated haploinsufficiency regarding the suppression of error-prone DSB repair in PALB2 mutation carriers. To the contrary, neither reduced HR activities, nor impaired RAD51 filament assembly, nor sensitization to PARP inhibition were consistently observed. Expression of truncated mutant versus wild-type PALB2 verified a causal role of PALB2 c.1592delT in the shift to error-prone repair. Discrimination between healthy and malignancy-presenting PALB2 mutation carriers revealed a pathway shift particularly in the breast cancer patients, suggesting interaction of PALB2 c.1592delT with additional genomic lesions. Interestingly, the studied PALB2 mutation was associated with 53BP1 accumulation in the healthy mutation carriers but not the patients, and 53BP1 was limiting for error-prone MMEJ in patients but not in healthy carriers. Our study identified a rise in error-prone DSB repair as a potential threat to genomic integrity in heterozygous PALB2 mutation carriers

  13. Alkaline gel electrophoresis assay to detect DNA strand breaks and repair mechanisms in Escherichia coli

    OpenAIRE

    José Carlos Pelielo De Mattos; Ellen Serri da Motta; Márcia Betania Nunes de Oliveira; Flávio José da Silva Dantas; Adriano Caldeira de Araujo

    2008-01-01

    Reactive oxygen species (ROS) can induce lesions in different cellular targets, including DNA. Stannous chloride (SnCl2) is a ROS generator, leading to lethality in Escherichia coli (E. coli), with the base excision repair (BER) mechanism playing a role in this process. Many techniques have been developed to detect genotoxicity, as comet assay, in eukaryotic cells, and plasmid DNA agarose gel electrophoresis. In this study, an adaptation of the alkaline gel electrophoresis method was carried ...

  14. The repair fidelity of restriction enzyme-induced double strand breaks in plasmid DNA correlates with radioresistance in human tumor cell lines

    International Nuclear Information System (INIS)

    The accuracy of DNA repair may play a role in determining the cytotoxic effect of ionizing radiation. Repair, as measured by DNA strand breakage, often shows little difference between tumor cell lines of widely different radiosensitivity. The mechanism by which DNA fragments are rejoined is poorly understood. This study used plasmid transfection as a probe to assess the balance between correct repair and misrepair. A general trend for sensitive cells to show lower repair fidelity relative to resistant cells was observed. The type of double-strand cleavage of the plasmid (staggered or blunt) made little difference to the measured repair fidelity, in contrast to published studies in which restriction-enzyme breaks had been introduced into DNA within chromatin. Specific comparison of parent lines and their radiosensitive clones showed significant differences in repair fidelity for a relatively small change in radiation response, which was in line with the overall correlation. These same pairs have previously been shown to have no difference in the loss of DNA fragmentation with time after irradiation, and Southern analysis had confirmed the integrated plasmid copy number was similar in the cell lines compared. The number of intact copies of the damaged gene relative to the undamaged gene mirrored the observed repair fidelity. However, in one cell line out of the 10 studied, an exception to the observed trend was found. In comparison of two equally radioresistant bladder cancer cell lines, large differences in repair fidelity were observed. Again, no difference in the integrated copy number was found, and the damaged gene was highly rearranged or deleted in the cell line with low repair fidelity. It is suggested that repair fidelity can be, but is not invariably, a measure of correct repair relative to misrepair, resulting from the processing of double-strand breaks and, hence, the response to ionizing radiation. 24 refs., 2 figs., 2 tabs

  15. Repair of DNA double-strand breaks induced in Saccharomyces cerevisiae using different γ-ray dose rates: a pulsed-field gel electrophoresis analysis

    International Nuclear Information System (INIS)

    We investigated the effects of γ-ray exposures at high dose-rate (HDR, 23·2 Gy/min) and low dose-rate (LDR, 0·47 Gy/min) on survival and the induction of DNA double-strand breaks (dsb) in a diploid wild-type (D7) and the repair-deficient mutant strain rad52/rad52 of Saccharomyces cerevisiae. The relationship observed between γ-ray survival and dsb repair clearly indicates that increases in survival of wild-type cells, during LDR as compared with HDR exposures and after LHR, are strongly related to the repair of dsb. (author)

  16. DNA-PK and ATM phosphorylation sites in XLF/Cernunnos are not required for repair of DNA double strand breaks.

    Science.gov (United States)

    Yu, Yaping; Mahaney, Brandi L; Yano, Ken-Ichi; Ye, Ruiqiong; Fang, Shujuan; Douglas, Pauline; Chen, David J; Lees-Miller, Susan P

    2008-10-01

    Nonhomologous end joining (NHEJ) is the major pathway for the repair of DNA double strand breaks (DSBs) in human cells. NHEJ requires the catalytic subunit of the DNA-dependent protein kinase (DNA-PKcs), Ku70, Ku80, XRCC4, DNA ligase IV and Artemis, as well as DNA polymerases mu and lambda and polynucleotide kinase. Recent studies have identified an additional participant, XLF, for XRCC4-like factor (also called Cernunnos), which interacts with the XRCC4-DNA ligase IV complex and stimulates its activity in vitro, however, its precise role in the DNA damage response is not fully understood. Since the protein kinase activity of DNA-PKcs is required for NHEJ, we asked whether XLF might be a physiological target of DNA-PK. Here, we have identified two major in vitro DNA-PK phosphorylation sites in the C-terminal region of XLF, serines 245 and 251. We show that these represent the major phosphorylation sites in XLF in vivo and that serine 245 is phosphorylated in vivo by DNA-PK, while serine 251 is phosphorylated by Ataxia-Telangiectasia Mutated (ATM). However, phosphorylation of XLF did not have a significant effect on the ability of XLF to interact with DNA in vitro or its recruitment to laser-induced DSBs in vivo. Similarly, XLF in which the identified in vivo phosphorylation sites were mutated to alanine was able to complement the DSB repair defect as well as radiation sensitivity in XLF-deficient 2BN cells. We conclude that phosphorylation of XLF at these sites does not play a major role in the repair of IR-induced DSBs in vivo. PMID:18644470

  17. ATM protein is indispensable to repair complex-type DNA double strand breaks induced by high LET heavy ion irradiation.

    Science.gov (United States)

    Sekine, Emiko; Yu, Dong; Fujimori, Akira; Anzai, Kazunori; Okayasu, Ryuichi

    ATM (ataxia telangiectasia-mutated) protein responsible for a rare genetic disease with hyperradiosensitivity, is the one of the earliest repair proteins sensing DNA double-strand breaks (DSB). ATM is known to phosphorylate DNA repair proteins such as MRN complex (Mre11, Rad50 and NBS1), 53BP1, Artemis, Brca1, gamma-H2AX, and MDC. We studied the interactions between ATM and DNA-PKcs, a crucial NHEJ repair protein, after cells exposure to high and low LET irradiation. Normal human (HFL III, MRC5VA) and AT homozygote (AT2KY, AT5BIVA, AT3BIVA) cells were irradiated with X-rays and high LET radiation (carbon ions: 290MeV/n initial energy at 70 keV/um, and iron ions: 500MeV/n initial energy at 200KeV/um), and several critical end points were examined. AT cells with high LET irradiation showed a significantly higher radiosensitivity when compared with normal cells. The behavior of DNA DSB repair was monitored by immuno-fluorescence techniques using DNA-PKcs (pThr2609, pSer2056) and ATM (pSer1981) antibodies. In normal cells, the phosphorylation of DNA-PKcs was clearly detected after high LET irradiation, though the peak of phosphorylation was delayed when compared to X-irradiation. In contrast, almost no DNA-PKcs phosphorylation foci were detected in AT cells irradiated with high LET radiation. A similar result was also observed in normal cells treated with 10 uM ATM kinase specific inhibitor (KU55933) one hour before irradiation. These data suggest that the phosphorylation of DNA-PKcs with low LET X-rays is mostly ATM-independent, and the phosphorylation of DNA-PKcs with high LET radiation seems to require ATM probably due to its complex nature of DSB induced. Our study indicates that high LET heavy ion irradiation which we can observe in the space environment would provide a useful tool to study the fundamental mechanism associated with DNA DSB repair.

  18. Opposing roles of RNF8/RNF168 and deubiquitinating enzymes in ubiquitination-dependent DNA double-strand break response signaling and DNA-repair pathway choice

    Science.gov (United States)

    Nakada, Shinichiro

    2016-01-01

    The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway. PMID:26983989

  19. Role of deoxyribonucleic acid polymerase III in the repair of single-strand breaks produced in Escherichia coli deoxyribonucleic acid by gamma radiation

    International Nuclear Information System (INIS)

    Cell survival, deoxyribonucleic acid (DNA) degradation, and the repair of DNA single-strand breaks were measured for Escherichia coli K-12 pol+, polAl, polC1026(ts), and polAl polC1026(ts) cells after 137Cs γ irradiation. The results indicate that DNA polymerase III is required for growth medium-dependent (type III) repair in polA+ or polA cells and is necessary for growth medium-independent (type II) repair in polA cells. In pol+ or polC cells, DNA polymerase I performs type II repair efficiently. The relative deficiencies of each of these strains in DNA repair generally correlate with their relative sensitivities to cell killing and with the extent of DNA degradation observed

  20. Ionizing radiation damage to the folded chromosome of Escherichia coli K-12: repair of double-strand breaks in deoxyribonucleic acid

    International Nuclear Information System (INIS)

    The extremely gentle lysis and unfolding procedures that have been developed for the isolation of nucleoid deoxyribonucleic acid yield undamaged, replicating genomes, thus permitting direct measurement of the formation and repair of DNA double-strand breaks at biologically significant doses of ionizing radiation. Repair of ionizing radiation damage to folded chromosomes of Escherichia coli K-12 strain AB2497 was observed within 2 to 3 h of post-irradiation incubation in growth medium. Such behavior was not observed after post-irradiation incubation in growth medium of a recA13 strain (strain AB2487). A model based on recombinational repair is proposed to explain the formation of 2,200 to 2,300S material during early stages of incubation and to explain subsequent changes in the gradient profiles. Association of unrepaired DNA with the plasma membrane is proposed to explain the formation of a peak of rapidly sedimenting material (greater than 3,100S) during the later stage of repair. Direct evidence of repair of double-strand breaks during post-irradiation incubation in growth medium was obtained from gradient profiles of DNA from ribonuclease-digested chromosomes. The sedimentation coefficient of broken molecules was restored to the value of unirradiated DNA after 2 to 3 h of incubation, and the fraction of the DNA repaired in this fashion was equal to the fraction of cells that survived at the same dose. An average of 2.7 double-strand breaks per genome per lethal event was observed, suggesting that one to two double-strand breaks per genome are repairable in E. coli K-12 strain AB2497

  1. The repair of environmentally relevant DNA double strand breaks caused by high linear energy transfer irradiation--no simple task.

    Science.gov (United States)

    Moore, Shaun; Stanley, Fintan K T; Goodarzi, Aaron A

    2014-05-01

    High linear energy transfer (LET) ionising radiation (IR) such as radon-derived alpha particles and high mass, high energy (HZE) particles of cosmic radiation are the predominant forms of IR to which humanity is exposed throughout life. High-LET forms of IR are established carcinogens relevant to human cancer, and their potent mutagenicity is believed, in part, to be due to a greater incidence of clustered DNA double strand breaks (DSBs) and associated lesions, as ionization events occur within a more confined genomic space. The repair of such DNA damage is now well-documented to occur with slower kinetics relative to that induced by low-LET IR, and to be more reliant upon homology-directed repair pathways. Underlying these phenomena is the relative inability of non-homologous end-joining (NHEJ) to adequately resolve high-LET IR-induced DSBs. Current findings suggest that the functionality of the DNA-dependent protein kinase (DNA-PK), comprised of the Ku70-Ku80 heterodimer and the DNA-PK catalytic subunit (DNA-PKcs), is particularly perturbed by high-LET IR-induced clustered DSBs, rendering DNA-PK dependent NHEJ less relevant to resolving these lesions. By contrast, the NHEJ-associated DNA processing endonuclease Artemis shows a greater relevance to high-LET IR-induced DSB repair. Here, we will review the cellular response to high-LET irradiation, the implications of the chronic, low-dose modality of this exposure and molecular pathways that respond to high-LET irradiation induced DSBs, with particular emphasis on NHEJ factors. PMID:24565812

  2. DNA ligase IV and artemis act cooperatively to suppress homologous recombination in human cells: implications for DNA double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Aya Kurosawa

    Full Text Available Nonhomologous end-joining (NHEJ and homologous recombination (HR are two major pathways for repairing DNA double-strand breaks (DSBs; however, their respective roles in human somatic cells remain to be elucidated. Here we show using a series of human gene-knockout cell lines that NHEJ repairs nearly all of the topoisomerase II- and low-dose radiation-induced DNA damage, while it negatively affects survival of cells harbouring replication-associated DSBs. Intriguingly, we find that loss of DNA ligase IV, a critical NHEJ ligase, and Artemis, an NHEJ factor with endonuclease activity, independently contribute to increased resistance to replication-associated DSBs. We also show that loss of Artemis alleviates hypersensitivity of DNA ligase IV-null cells to low-dose radiation- and topoisomerase II-induced DSBs. Finally, we demonstrate that Artemis-null human cells display increased gene-targeting efficiencies, particularly in the absence of DNA ligase IV. Collectively, these data suggest that DNA ligase IV and Artemis act cooperatively to promote NHEJ, thereby suppressing HR. Our results point to the possibility that HR can only operate on accidental DSBs when NHEJ is missing or abortive, and Artemis may be involved in pathway switching from incomplete NHEJ to HR.

  3. Collision of Trapped Topoisomerase 2 with Transcription and Replication: Generation and Repair of DNA Double-Strand Breaks with 5′ Adducts

    Directory of Open Access Journals (Sweden)

    Hong Yan

    2016-07-01

    Full Text Available Topoisomerase 2 (Top2 is an essential enzyme responsible for manipulating DNA topology during replication, transcription, chromosome organization and chromosome segregation. It acts by nicking both strands of DNA and then passes another DNA molecule through the break. The 5′ end of each nick is covalently linked to the tyrosine in the active center of each of the two subunits of Top2 (Top2cc. In this configuration, the two sides of the nicked DNA are held together by the strong protein-protein interactions between the two subunits of Top2, allowing the nicks to be faithfully resealed in situ. Top2ccs are normally transient, but can be trapped by cancer drugs, such as etoposide, and subsequently processed into DSBs in cells. If not properly repaired, these DSBs would lead to genome instability and cell death. Here, I review the current understanding of the mechanisms by which DSBs are induced by etoposide, the unique features of such DSBs and how they are repaired. Implications for the improvement of cancer therapy will be discussed.

  4. Collision of Trapped Topoisomerase 2 with Transcription and Replication: Generation and Repair of DNA Double-Strand Breaks with 5' Adducts.

    Science.gov (United States)

    Yan, Hong; Tammaro, Margaret; Liao, Shuren

    2016-01-01

    Topoisomerase 2 (Top2) is an essential enzyme responsible for manipulating DNA topology during replication, transcription, chromosome organization and chromosome segregation. It acts by nicking both strands of DNA and then passes another DNA molecule through the break. The 5' end of each nick is covalently linked to the tyrosine in the active center of each of the two subunits of Top2 (Top2cc). In this configuration, the two sides of the nicked DNA are held together by the strong protein-protein interactions between the two subunits of Top2, allowing the nicks to be faithfully resealed in situ. Top2ccs are normally transient, but can be trapped by cancer drugs, such as etoposide, and subsequently processed into DSBs in cells. If not properly repaired, these DSBs would lead to genome instability and cell death. Here, I review the current understanding of the mechanisms by which DSBs are induced by etoposide, the unique features of such DSBs and how they are repaired. Implications for the improvement of cancer therapy will be discussed. PMID:27376333

  5. Ser1778 of 53BP1 Plays a Role in DNA Double-strand Break Repairs

    OpenAIRE

    Lee, Jung-Hee; Cheong, Hyang-Min; Kang, Mi-Young; Kim, Sang-Young; Kang, Yoonsung

    2009-01-01

    53BP1 is an important genome stability regulator, which protects cells against double-strand breaks. Following DNA damage, 53BP1 is rapidly recruited to sites of DNA breakage, along with other DNA damage response proteins, including γ-H2AX, MDC1, and BRCA1. The recruitment of 53BP1 requires a tandem Tudor fold which associates with methylated histones H3 and H4. It has already been determined that the majority of DNA damage response proteins are phosphorylated by ATM and/or ATR after DNA dama...

  6. Local activity principle the cause of complexity and symmetry breaking

    CERN Document Server

    Mainzer, Klaus

    2013-01-01

    The principle of local activity explains the emergence of complex patterns in a homogeneous medium. At first defined in the theory of nonlinear electronic circuits in a mathematically rigorous way, it can be generalized and proven at least for the class of nonlinear reaction-diffusion systems in physics, chemistry, biology, and brain research. Recently, it was realized by memristors for nanoelectronic device applications. In general, the emergence of complex patterns and structures is explained by symmetry breaking in homogeneous media, which is caused by local activity. This book argues that

  7. Break for Physical Activity: Incorporating Classroom-Based Physical Activity Breaks into Preschools

    Science.gov (United States)

    Wadsworth, Danielle D.; Robinson, Leah E.; Beckham, Karen; Webster, Kip

    2012-01-01

    Engaging in moderate-to-vigorous physical activity is essential to lifelong health and wellness. Physical activity behaviors established in early childhood relate to physical activity behaviors in later years. However, research has shown that children are adopting more sedentary behaviors. Incorporating structured and planned physical activity…

  8. Non-homologous end joining is the responsible pathway for the repair of fludarabine-induced DNA double strand breaks in mammalian cells

    International Nuclear Information System (INIS)

    Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by γH2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU-induced DSB

  9. Non-homologous end joining is the responsible pathway for the repair of fludarabine-induced DNA double strand breaks in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Campos-Nebel, Marcelo de [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)], E-mail: mnebel@hematologia.anm.edu.ar; Larripa, Irene; Gonzalez-Cid, Marcela [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)

    2008-11-10

    Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by {gamma}H2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU

  10. Comparison of transformation, DNA single strand breaks and its repair in human blood lymphocytes stimulated with PHA, ConA and PWM following exposure to γ-rays

    International Nuclear Information System (INIS)

    The transformation, DNA single strand breaks and its repair in human peripheral blood lymphocytes stimulated with PHA, ConA and PWM respectively following exposure to 60Co γ-rays were analyzed by 3H-thymidine incorporation and hydroxylapatite chromatography. The transformation of lymphocytes stimulated with PHA, ConA and PWM were suppressed by γ-rays and the dose-effect curves were biphasic within the range of 0-8 Gy. The lymphocytes stimulated with PWM were the most resistant to γ-rays. The extent of DNA single strand breaks in lymphocytes induced by γ-rays was linearly related to the dose within the range of 0-30 Gy and there was no marked difference in the three kinds of lymphocytes. After a period of post-irradiation (15 Gy) incubation at 37 deg C, the DNA single strand breaks could be rejoined but incompletely. The rejoined strands broke again if the cells were incubated longer. The repair ratio of single strand breaks in the lymphocytes stimulated with PWM was the highest among the cells with three mitogens. The results suggest that the difference of the radiation effect on transformation in different lytphocytes is probably related to the repair ability of DNA single strand breaks

  11. Stop and revive? The effectiveness of nap and active rest breaks for reducing driver sleepiness.

    Science.gov (United States)

    Watling, Christopher N; Smith, Simon S; Horswill, Mark S

    2014-11-01

    The purpose of this study was to compare the effects of two commonly utilized sleepiness countermeasures: a nap break and an active rest break. The effects of the countermeasures were evaluated by physiological (EEG), subjective, and driving performance measures. Participants completed 2 h of simulated driving, followed by a 15-min nap break or a 15-min active rest break, then completed the final hour of simulated driving. The nap break reduced EEG and subjective sleepiness. The active rest break did not reduce EEG sleepiness, with sleepiness levels eventually increasing, and resulted in an immediate reduction of subjective sleepiness. No difference was found between the two breaks for the driving performance measure. The immediate reduction of subjective sleepiness after the active rest break could leave drivers with erroneous perceptions of their sleepiness, particularly with increases of physiological sleepiness after the break. PMID:24961384

  12. Kinetics of DNA double-strand break repair throughout the cell cycle as assayed by pulsed field gel electrophoresis in CHO cells

    International Nuclear Information System (INIS)

    Repair of DNA double-strand breaks (dsb) was measured in exponentially growing, plateau-phase and synchronized G1, G1/S, early S, mid-S, late S, G2 + M amd mitotic CHO cells. Results suggest that the state of chromatin condensation has only a limited impact on the ability of the cells to rejoin dsb, and indicate that the cell cycle-dependent fluctuations in radiosensitivity cannot be explained by alterations in the rate of rejoining of dsb. Repair half-times of the slow component of dsb rejoining were similar to the half-times of rejoining of chromosome breaks as visualized by the technique of premature chromosome condensation, suggesting a cause-effect relationship between rejoining of this subject of dsb and rejoining of chromosome breaks. (author)

  13. Frequent and efficient use of the sister chromatid for DNA double-strand break repair during budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Tamara Goldfarb

    Full Text Available Recombination between homologous chromosomes of different parental origin (homologs is necessary for their accurate segregation during meiosis. It has been suggested that meiotic inter-homolog recombination is promoted by a barrier to inter-sister-chromatid recombination, imposed by meiosis-specific components of the chromosome axis. Consistent with this, measures of Holliday junction-containing recombination intermediates (joint molecules [JMs] show a strong bias towards inter-homolog and against inter-sister JMs. However, recombination between sister chromatids also has an important role in meiosis. The genomes of diploid organisms in natural populations are highly polymorphic for insertions and deletions, and meiotic double-strand breaks (DSBs that form within such polymorphic regions must be repaired by inter-sister recombination. Efforts to study inter-sister recombination during meiosis, in particular to determine recombination frequencies and mechanisms, have been constrained by the inability to monitor the products of inter-sister recombination. We present here molecular-level studies of inter-sister recombination during budding yeast meiosis. We examined events initiated by DSBs in regions that lack corresponding sequences on the homolog, and show that these DSBs are efficiently repaired by inter-sister recombination. This occurs with the same timing as inter-homolog recombination, but with reduced (2- to 3-fold yields of JMs. Loss of the meiotic-chromosome-axis-associated kinase Mek1 accelerates inter-sister DSB repair and markedly increases inter-sister JM frequencies. Furthermore, inter-sister JMs formed in mek1Δ mutants are preferentially lost, while inter-homolog JMs are maintained. These findings indicate that inter-sister recombination occurs frequently during budding yeast meiosis, with the possibility that up to one-third of all recombination events occur between sister chromatids. We suggest that a Mek1-dependent reduction in

  14. Effect of Wortmannin on the repair profiles of DNA double-strand breaks in the whole genome and in interstitial telomeric sequences of Chinese hamster cells

    International Nuclear Information System (INIS)

    The DNA breakage detection-fluorescence in situ hybridization (DBD-FISH) procedure was applied to analyze the effect of Wortmannin (WM) in the rejoining kinetics of ionizing radiation-induced DNA double-strand breaks (DSBs) in the whole genome and in the long interstitial telomeric repeat sequence (ITRS) blocks from Chinese hamster cell lines. The results indicate that the ITRS blocks from wild-type Chinese hamster cell lines, CHO9 and V79B, exhibit a slower initial rejoining rate of ionizing radiation-induced DSBs than the genome overall. Neither Rad51C nor the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) activities, involved in homologous recombination (HR) and in non-homologous end-joining (NHEJ) pathways of DSB repair respectively, influenced the rejoining kinetics within ITRS in contrast to DNA sequences in the whole genome. Nevertheless, DSB removal rate within ITRS was decreased in the absence of Ku86 activity, though at a lower affectation level than in the whole genome, thus homogenizing both rejoining kinetics rates. WM treatment slowed down the DSB rejoining kinetics rate in ITRS, this effect being more pronounced in the whole genome, resulting in a similar pattern to that of the Ku86 deficient cells. In fact, no WM effect was detected in the Ku86 deficient Chinese hamster cells, so probably WM does not add further impairment in DSB rejoining than that resulted as a consequence of absence of Ku activity. The same slowing effect was also observed after treatment of Rad51C and DNA-PKcs defective hamster cells by WM, suggesting that: (1) there is no potentiation of the HR when the NHEJ is impaired by WM, either in the whole genome or in the ITRS, and (2) that this impairment may probably involve more targets than DNA-PKcs. These results suggest that there is an intragenomic heterogeneity in DSB repair, as well as in the effect of WM on this process

  15. Some studies on the radiation-induced strand break of deoxyribonucleic acid (DNA) model systems. III. effect of repairing agents on polyribouridylic acid model systems

    International Nuclear Information System (INIS)

    The effect of repairing agents on polyuridylic acid model system has been investigated. Cysteamine and dithiothreitol (DTT) were used as radio-protectors. The effect of concentration, PH, ionic strength and counter ion on the G(ssb)-value in presence of cysteamine was studied. It was found 8% given off poly U strand break precursor radicals and the remainder 92% poly U strand break radicals were rationally repaired. A possible mechanism has been suggested. The least recorded G(ssb)-values were found at cysteamine concentration of 2 x 10-5 M in presence of 0.01 M and 0.1 M Na Cl O4. When DTT was used as a radio-protector, the rate constant K4 was half the value obtained when cystamine was used. 12% of broken strands were determined and 88% of poly U strand break radicals were repairable. When oxygen was present in the system, 42% broken poly U strands were found and only 58% of poly U strand radicals were repairable

  16. Comet assay to measure DNA repair: approach and applications

    OpenAIRE

    Azqueta, Amaya; SLYSKOVA, JANA; Langie, Sabine A. S.; O’Neill Gaivão, Isabel; Collins, Andrew

    2014-01-01

    Cellular repair enzymes remove virtually all DNA damage before it is fixed; repair therefore plays a crucial role in preventing cancer. Repair studied at the level of transcription correlates poorly with enzyme activity, and so assays of phenotype are needed. In a biochemical approach, substrate nucleoids containing specific DNA lesions are incubated with cell extract; repair enzymes in the extract induce breaks at damage sites; and the breaks are measured with the comet assay. The nature of ...

  17. Post-irradiation chemical processing of DNA damage generates double-strand breaks in cells already engaged in repair

    Science.gov (United States)

    Singh, Satyendra K.; Wang, Minli; Staudt, Christian; Iliakis, George

    2011-01-01

    In cells exposed to ionizing radiation (IR), double-strand breaks (DSBs) form within clustered-damage sites from lesions disrupting the DNA sugar–phosphate backbone. It is commonly assumed that these DSBs form promptly and are immediately detected and processed by the cellular DNA damage response (DDR) apparatus. This assumption is questioned by the observation that after irradiation of naked DNA, a fraction of DSBs forms minutes to hours after exposure as a result of temperature dependent, chemical processing of labile sugar lesions. Excess DSBs also form when IR-exposed cells are processed at 50°C, but have been hitherto considered method-related artifact. Thus, it remains unknown whether DSBs actually develop in cells after IR exposure from chemically labile damage. Here, we show that irradiation of ‘naked’ or chromatin-organized mammalian DNA produces lesions, which evolve to DSBs and add to those promptly induced, after 8–24 h in vitro incubation at 37°C or 50°C. The conversion is more efficient in chromatin-associated DNA, completed within 1 h in cells and delayed in a reducing environment. We conclude that IR generates sugar lesions within clustered-damage sites contributing to DSB formation only after chemical processing, which occurs efficiently at 37°C. This subset of delayed DSBs may challenge DDR, may affect the perceived repair kinetics and requires further characterization. PMID:21745815

  18. Repair of ionizing radiation-induced DNA double-strand breaks by non-homologous end-joining.

    Science.gov (United States)

    Mahaney, Brandi L; Meek, Katheryn; Lees-Miller, Susan P

    2009-02-01

    DNA DSBs (double-strand breaks) are considered the most cytotoxic type of DNA lesion. They can be introduced by external sources such as IR (ionizing radiation), by chemotherapeutic drugs such as topoisomerase poisons and by normal biological processes such as V(D)J recombination. If left unrepaired, DSBs can cause cell death. If misrepaired, DSBs may lead to chromosomal translocations and genomic instability. One of the major pathways for the repair of IR-induced DSBs in mammalian cells is NHEJ (non-homologous end-joining). The main proteins required for NHEJ in mammalian cells are the Ku heterodimer (Ku70/80 heterodimer), DNA-PKcs [the catalytic subunit of DNA-PK (DNA-dependent protein kinase)], Artemis, XRCC4 (X-ray-complementing Chinese hamster gene 4), DNA ligase IV and XLF (XRCC4-like factor; also called Cernunnos). Additional proteins, including DNA polymerases mu and lambda, PNK (polynucleotide kinase) and WRN (Werner's Syndrome helicase), may also play a role. In the present review, we will discuss our current understanding of the mechanism of NHEJ in mammalian cells and discuss the roles of DNA-PKcs and DNA-PK-mediated phosphorylation in NHEJ. PMID:19133841

  19. Correlativity study between expression of DNA double-strand break repair protein and radiosensitivity of tumor cells

    Institute of Scientific and Technical Information of China (English)

    Liang ZHUANG; Shiying YU; Xiaoyuan HUANG; Yang CAO; Huihua XIONG

    2009-01-01

    DNA double-strand break (DSB) is generally regarded as the most lethal of all DNA lesions after radiation. KuS0, DNA-PK catalytic subunit (DNA-PKcs) and ataxia telangiectasia mutated (ATM) proteins are major DSB repair proteins. In this study, survival fraction at 2Gy (SF2) values of eight human tumor cell lines (including four human cervical carcinoma cell lines HeLa, SiHa, C33A, Caski, three human breast carcinoma cell lines MCF-7, MDA-MB-231, MDA-MB-453, and one human lung carcinoma cell line A549) were acquired by clone formation assay, and western blot was applied to detect the expressions of Ku80, DNA-PKcs and ATM protein. The correlativity of protein expression with SF2 value was analyzed by Pearson linear correlation analysis. We found that the expression of the same protein in different cell lines and the expression of three proteins in the same cell line had a significant difference. The SF2 values were also different in eight tumor cell lines and there was a positive correlativity between the expression of DNA-PKcs and SF2 (r=0.723, P =0.043), but Ku80 and ATM expression had no correlation with SF2 (P>0.05). These findings suggest that the expression level of DNA-PKcs protein can be an indicator for predicting the radiosensitivity of tumor cells.

  20. DNA double strand break repair in mammalian cells: role of MRE11 and BLM proteins at the initiation of Non Homologous End Joining (NHEJ)

    International Nuclear Information System (INIS)

    DNA double strand breaks (DSBs) are highly cytotoxic lesions, which can lead to genetic rearrangements. Two pathways are responsible for repairing these lesions: homologous recombination (HR) and non homologous end joining (NHEJ). In our laboratory, an intrachromosomal substrate has been established in order to measure the efficiency and the fidelity of NHEJ in living cells (Guirouilh-Barbat 2004). This approach led us to identify a KU-independent alternative pathway, which uses micro homologies in the proximity of the junction to accomplish repair - the alternative NHEJ (Guirouilh-Barbat 2004, Guirouilh-Barbat et Rass 2007). The goal of my thesis consisted in identifying and characterising major actors of this pathway. In the absence of KU, alternative NHEJ would be initiated by ssDNA resection of damaged ends. We showed that the nuclease activity of MRE11 is necessary for this mechanism. MRE11 overexpression leads to a two fold stimulation of NHEJ efficiency, while the extinction of MRE11 by siRNA results in a two fold decrease. Our results demonstrate that the proteins RAD50 and CtIP act in the same pathway as MRE11. Moreover, in cells deficient for XRCC4, MIRIN - an inhibitor of the MRN complex - leads to a decrease in repair efficiency, implicating MRE11 in alternative NHEJ. We also showed that MRE11 can act in an ATM-dependent and independent manner (Rass et Grabarz Nat Struct Mol Biol 2009). The initiation of break resection needs to be pursued by a more extensive degradation of DNA, which is accomplished in yeast by the proteins Exo1 and Sgs1/Dna2. In human cells, in vitro studies have recently proposed a similar model of a two-step break resection. We chose to elucidate the role of one of the human homologs of Sgs1 - the RecQ helicase BLM - in the resection process. Our experiments show, that he absence of BLM decreases the efficiency of end joining by NHEJ, accompanied by an increase in error-prone events, especially long-range deletions (≥200 nt). This

  1. Inhibition of APOBEC3G activity impedes double-stranded DNA repair.

    Science.gov (United States)

    Prabhu, Ponnandy; Shandilya, Shivender M D; Britan-Rosich, Elena; Nagler, Adi; Schiffer, Celia A; Kotler, Moshe

    2016-01-01

    The cellular cytidine deaminase APOBEC3G (A3G) was first described as an anti-HIV-1 restriction factor, acting by directly deaminating reverse transcripts of the viral genome. HIV-1 Vif neutralizes the activity of A3G, primarily by mediating degradation of A3G to establish effective infection in host target cells. Lymphoma cells, which express high amounts of A3G, can restrict Vif-deficient HIV-1. Interestingly, these cells are more stable in the face of treatments that result in double-stranded DNA damage, such as ionizing radiation and chemotherapies. Previously, we showed that the Vif-derived peptide (Vif25-39) efficiently inhibits A3G deamination, and increases the sensitivity of lymphoma cells to ionizing radiation. In the current study, we show that additional peptides derived from Vif, A3G, and APOBEC3F, which contain the LYYF motif, inhibit deamination activity. Each residue in the Vif25-39 sequence moderately contributes to the inhibitory effect, whereas replacing a single residue in the LYYF motif completely abrogates inhibition of deamination. Treatment of A3G-expressing lymphoma cells exposed to ionizing radiation with the new inhibitory peptides reduces double-strand break repair after irradiation. Incubation of cultured irradiated lymphoma cells with peptides that inhibit double-strand break repair halts their propagation. These results suggest that A3G may be a potential therapeutic target that is amenable to peptide and peptidomimetic inhibition. PMID:26460502

  2. Spontaneous chiral symmetry breaking in collective active motion

    Science.gov (United States)

    Breier, Rebekka E.; Selinger, Robin L. B.; Ciccotti, Giovanni; Herminghaus, Stephan; Mazza, Marco G.

    2016-02-01

    Chiral symmetry breaking is ubiquitous in biological systems, from DNA to bacterial suspensions. A key unresolved problem is how chiral structures may spontaneously emerge from achiral interactions. We study a simple model of active swimmers in three dimensions that effectively incorporates hydrodynamic interactions. We perform large-scale molecular dynamics simulations (up to 106 particles) and find long-lived metastable collective states that exhibit chiral organization although the interactions are achiral. We elucidate under which conditions these chiral states will emerge and grow to large scales. To explore the complex phase space available to the system, we perform nonequilibrium quenches on a one-dimensional Lebwohl-Lasher model with periodic boundary conditions to study the likelihood of formation of chiral structures.

  3. Nuclear translocation contributes to regulation of DNA excision repair activities

    DEFF Research Database (Denmark)

    Knudsen, Nina Østergaard; Andersen, Sofie Dabros; Lützen, Anne; Nielsen, Finn Cilius; Rasmussen, Lene Juel

    2009-01-01

    DNA mutations are circumvented by dedicated specialized excision repair systems, such as the base excision repair (BER), nucleotide excision repair (NER), and mismatch repair (MMR) pathways. Although the individual repair pathways have distinct roles in suppressing changes in the nuclear DNA, it is...... co-import appears to be a mechanism employed by the composite repair systems NER and MMR to enhance and regulate nuclear accumulation of repair proteins thereby ensuring faithful DNA repair....

  4. Influence of Double-Strand Break Repair on Radiation Therapy-Induced Acute Skin Reactions in Breast Cancer Patients

    International Nuclear Information System (INIS)

    Purpose: Curative radiation therapy (RT)-induced toxicity poses strong limitations for efficient RT and worsens the quality of life. The parameter that explains when and to what extent normal tissue toxicity in RT evolves would be of clinical relevance because of its predictive value and may provide an opportunity for personalized treatment approach. Methods and Materials: DNA double-strand breaks and repair were analyzed by microscopic γ-H2AX foci analysis in peripheral lymphocytes from 38 healthy donors and 80 breast cancer patients before RT, a 2 Gy challenge dose of x-ray exposed in vitro. Results: The actual damage (AD) at 0.25, 3, and 6 hours and percentage residual damage (PRD) at 3 and 6 hours were used as parameters to measure cellular radiosensitivity and correlated with RT-induced acute skin reactions in patients stratified as non-overresponders (NOR) (Radiation Therapy Oncology Group [RTOG] grade <2) and overresponders (OR) (RTOG grade ≥2). The results indicated that the basal and induced (at 0.25 and 3 hours) γ-H2AX foci numbers were nonsignificant (P>.05) between healthy control donors and the NOR and OR groups, whereas it was significant between ORs and healthy donors at 6 hours (P<.001). There was a significantly higher PRD in OR versus NOR (P<.05), OR versus healthy donors (P<.001) and NOR versus healthy donors (P<.01), supported further by the trend analysis (r=.2392; P=.0326 at 6 hours). Conclusions: Our findings strongly suggest that the measurement of PRD by performing γ-H2AX foci analysis has the potential to be developed into a clinically useful predictive assay

  5. Identification of defective illegitimate recombinational repair of oxidatively-induced DNA double-strand breaks in ataxia-telangiectasia cells

    Science.gov (United States)

    Dar, M. E.; Winters, T. A.; Jorgensen, T. J.

    1997-01-01

    Ataxia-telangiectasia (A-T) is an autosomal-recessive lethal human disease. Homozygotes suffer from a number of neurological disorders, as well as very high cancer incidence. Heterozygotes may also have a higher than normal risk of cancer, particularly for the breast. The gene responsible for the disease (ATM) has been cloned, but its role in mechanisms of the disease remain unknown. Cellular A-T phenotypes, such as radiosensitivity and genomic instability, suggest that a deficiency in the repair of DNA double-strand breaks (DSBs) may be the primary defect; however, overall levels of DSB rejoining appear normal. We used the shuttle vector, pZ189, containing an oxidatively-induced DSB, to compare the integrity of DSB rejoining in one normal and two A-T fibroblast cells lines. Mutation frequencies were two-fold higher in A-T cells, and the mutational spectrum was different. The majority of the mutations found in all three cell lines were deletions (44-63%). The DNA sequence analysis indicated that 17 of the 17 plasmids with deletion mutations in normal cells occurred between short direct-repeat sequences (removing one of the repeats plus the intervening sequences), implicating illegitimate recombination in DSB rejoining. The combined data from both A-T cell lines showed that 21 of 24 deletions did not involve direct-repeats sequences, implicating a defect in the illegitimate recombination pathway. These findings suggest that the A-T gene product may either directly participate in illegitimate recombination or modulate the pathway. Regardless, this defect is likely to be important to a mechanistic understanding of this lethal disease.

  6. RNF4, a SUMO-targeted ubiquitin E3 ligase, promotes DNA double-strand break repair.

    Science.gov (United States)

    Galanty, Yaron; Belotserkovskaya, Rimma; Coates, Julia; Jackson, Stephen P

    2012-06-01

    Protein ubiquitylation and sumoylation play key roles in regulating cellular responses to DNA double-strand breaks (DSBs). Here, we show that human RNF4, a small ubiquitin-like modifier (SUMO)-targeted ubiquitin E3 ligase, is recruited to DSBs in a manner requiring its SUMO interaction motifs, the SUMO E3 ligases PIAS1 and PIAS4, and various DSB-responsive proteins. Furthermore, we reveal that RNF4 depletion impairs ubiquitin adduct formation at DSB sites and causes persistent histone H2AX phosphorylation (γH2AX) associated with defective DSB repair, hypersensitivity toward DSB-inducing agents, and delayed recovery from radiation-induced cell cycle arrest. We establish that RNF4 regulates turnover of the DSB-responsive factors MDC1 and replication protein A (RPA) at DNA damage sites and that RNF4-depleted cells fail to effectively replace RPA by the homologous recombination factors BRCA2 and RAD51 on resected DNA. Consistent with previous data showing that RNF4 targets proteins to the proteasome, we show that the proteasome component PSMD4 is recruited to DNA damage sites in a manner requiring its ubiquitin-interacting domains, RNF4 and RNF8. Finally, we establish that PSMD4 binds MDC1 and RPA1 in a DNA damage-induced, RNF4-dependent manner and that PSMD4 depletion cause MDC1 and γH2AX persistence in irradiated cells. RNF4 thus operates as a DSB response factor at the crossroads between the SUMO and ubiquitin systems. PMID:22661229

  7. Whence flavins? Redox-active ribonucleotides link metabolism and genome repair to the RNA world.

    Science.gov (United States)

    Nguyen, Khiem Van; Burrows, Cynthia J

    2012-12-18

    Present-day organisms are under constant environmental stress that damages bases in DNA, leading to mutations. Without DNA repair processes to correct these errors, such damage would be catastrophic. Organisms in all kingdoms have repair processes ranging from direct reversal to base excision and nucleotide excision repair, and the recently characterized giant viruses also include these mechanisms. At what point in the evolution of genomes did active repair mechanisms become critical? In particular, how did early RNA genomes protect themselves from UV photodamage that would have hampered nonenzymatic replication and led to a mutation rate too high to pass on accurate sequence information from one generation to the next? Photolyase is a widespread and phylogenetically ancient enzyme that utilizes longer wavelength light to cleave thymine dimers in DNA produced via photodamage. The protein serves as a binding scaffold but does not contribute to the catalytic chemistry; the action of the dinucleotide cofactor FADH(2) breaks the chemical bonds. This small bit of RNA, hailed as a "fossil of the RNA World," contains the flavin heterocycle, whose redox activity has been harnessed for myriad functions of life from metabolism to DNA repair. In present-day biochemistry, flavin biosynthesis begins with guanosine and proceeds through seven steps catalyzed by protein-based enzymes. This leads to the question of how flavins originally evolved. Did the RNA world include ancestral RNA bases with greater redox activity than G, A, C, and U that were capable of photorepair of uracil dimers? Could those ancestral bases have chemically evolved to the current flavin structure? Or did flavins already exist from prebiotic chemical synthesis? And were they then co-opted as catalysts for repair sometime after metabolism was established? In this Account, we analyze simple derivatives of guanosine and other bases that show two prerequisites for flavin-like photolyase activity: a significantly

  8. The proteomic investigation reveals interaction of mdig protein with the machinery of DNA double-strand break repair.

    Science.gov (United States)

    Wang, Wei; Lu, Yongju; Stemmer, Paul M; Zhang, Xiangmin; Bi, Yongyi; Yi, Zhengping; Chen, Fei

    2015-09-29

    To investigate how mineral dust-induced gene (mdig, also named as mina53, MINA, or NO52) promotes carcinogenesis through inducing active chromatin, we performed proteomics analyses for the interacting proteins that were co-immunoprecipitated by anti-mdig antibody from either the lung cancer cell line A549 cells or the human bronchial epithelial cell line BEAS-2B cells. On SDS-PAGE gels, three to five unique protein bands were consistently observed in the complexes pulled-down by mdig antibody, but not the control IgG. In addition to the mdig protein, several DNA repair or chromatin binding proteins, including XRCC5, XRCC6, RBBP4, CBX8, PRMT5, and TDRD, were identified in the complexes by the proteomics analyses using both Orbitrap Fusion and Orbitrap XL nanoESI-MS/MS in four independent experiments. The interaction of mdig with some of these proteins was further validated by co-immunoprecipitation using antibodies against mdig and its partner proteins, respectively. These data, thus, provide evidence suggesting that mdig accomplishes its functions on chromatin, DNA repair and cell growth through interacting with the partner proteins. PMID:26293673

  9. 1,4 Naphthoquinone protects radiation induced cell death and DNA damage in lymphocytes by activation Nrf2/are pathway and enhancing DNA repair

    International Nuclear Information System (INIS)

    1,4-Naphthoquinone (NQ) is the parent molecule of many clinically approved anticancer, anti-infective, and antiparasitic drugs such as anthracycline, mitomycin, daunorubicin, doxorubicin, diospyrin, and malarone. Presence of NQ during a-irradiation (4Gy) significantly reduced the death of irradiated murine splenic lymphocytes in a dose dependent manner (0.05-liM), with complete protection at liM as assessed by PI staining. Radioprotection by NQ was further confirmed by inhibition of caspase activation, decrease in cell size, DNA-fragmentation, nuclear-blebbing and clonogenic assay. All trans retinoic acid which is inhibitor of Nrf-2 pathway, completely abrogated the radioprotective effect of NQ, suggesting that radioprotective activity of NQ may be due to activation of Nrf-2 signaling pathways. Further, addition of NQ to lymphocytes activated Nrf-2 in time dependent manner as shown by confocal microscopy, electrophoretic mobility shift assay and quantitative real time PCR. It also increased the expression of Nrf-2 dependent cytoprotective genes like hemeoxygenase-1, MnSOD, catalse as demonstrated by real time PCR and flowcytometry. NQ protected lymphocytes significantly against radiation-induced cell death even when added after irradiation. Complete protection was observed by addition of NQ up to 2 h after irradiation. However, percentage protection decreased with increasing time interval. These results suggested that NQ may offer protection to lymphocytes activating repair pathways. Repair of radiation induced DNA strand breaks was studied by comet assay. Pretreatment of lymphocytes with NQ induced single strand breaks up to 6h but not double strand breaks in DNA. However, NQ mediated single strand breaks were repaired completely at longer time intervals. Addition of NQ to lymphocytes prior to 4 Gy a-radiation exposure showed decrease in the yield of DNA double strand breaks. The observed time-dependent decrease in the DNA strand breaks could be attributed to

  10. Survey of Active Structural Control and Repair Using Piezoelectric Patches

    Directory of Open Access Journals (Sweden)

    Ahmed Abuzaid

    2015-05-01

    Full Text Available The piezoelectric actuator has gained popularity over the last few years. Attention has been directed towards the study of their electromechanical response in active repair and the control of damaged structures. This has been made possible through the development of various numerical and analytical techniques for such studies. The shift of focus towards the piezoelectric based approaches has been due to their advantages, which include strategic cost benefits in maintenance, as well as an increase in the life cycle of the repaired structures. Furthermore, adhesively bonded joints are widely used in the manufacturing and repairing of structures in many industries, especially automotive and aerospace engineering. This is due to the requirement for lightweight materials as well as the potential adhesive used to join materials with different characteristics. The piezoelectric actuator has also shown the capacity in controlling and lowering the shear stress concentration and joint edge peel in adhesively bonded joint systems. The structure’s control of stress and repair can generally be viewed as a reinforcement that influences the structure’s damage tolerance. Therefore, the interest of this review is on the applications of the piezoelectric actuators in both structural damage and the bonded adhesive joint system. The specific goal is to recognize the contemporary scientific challenges, including future opportunities.

  11. The Impact of Individual In Vivo Repair of DNA Double-Strand Breaks on Oral Mucositis in Adjuvant Radiotherapy of Head-and-Neck Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Fleckenstein, Jochen, E-mail: rajfle@uks.eu [Department of Radiotherapy and Radiation Oncology, Saarland University Medical School, Homburg (Germany); Kuehne, Martin; Seegmueller, Katharina; Derschang, Sarah; Melchior, Patrick [Department of Radiotherapy and Radiation Oncology, Saarland University Medical School, Homburg (Germany); Graeber, Stefan [Institute for Medical Biometry, Epidemiology und Medical Informatics (IMBEI), Saarland University Medical School, Homburg (Germany); Fricke, Andreas; Ruebe, Claudia E.; Ruebe, Christian [Department of Radiotherapy and Radiation Oncology, Saarland University Medical School, Homburg (Germany)

    2011-12-01

    Purpose: To evaluate the impact of individual in vivo DNA double-strand break (DSB) repair capacity on the incidence of severe oral mucositis in patients with head-and-neck cancer undergoing adjuvant radiotherapy (RT) or radiochemotherapy (RCT). Patients and Methods: Thirty-one patients with resected head-and-neck cancer undergoing adjuvant RT or RCT were examined. Patients underwent RT of the primary tumor site and locoregional lymph nodes with a total dose of 60-66 Gy (single dose 2 Gy, five fractions per week). Chemotherapy consisted of two cycles of cisplatin and 5-fluorouracil. To assess DSB repair, {gamma}-H2AX foci in blood lymphocytes were quantified before and 0.5 h, 2.5 h, 5 h, and 24 h after in vivo radiation exposure (the first fraction of RT). World Health Organization scores for oral mucositis were documented weekly and correlated with DSB repair. Results: Sixteen patients received RT alone; 15 patients received RCT. In patients who developed Grade {>=} 3 mucositis (n = 18) the amount of unrepaired DSBs 24 h after radiation exposure and DSB repair half-times did not differ significantly from patients with Grade {<=}2 mucositis (n = 13). Patients with a proportion of unrepaired DSBs after 24 h higher than the mean value + one standard deviation had an increased incidence of severe oral mucositis. Conclusions: Evaluation of in vivo DSB repair by determination of {gamma}-H2AX foci loss is feasible in clinical practice and allows identification of patients with impaired DSB repair. The incidence of oral mucositis is not closely correlated with DSB repair under the evaluated conditions.

  12. The Impact of Individual In Vivo Repair of DNA Double-Strand Breaks on Oral Mucositis in Adjuvant Radiotherapy of Head-and-Neck Cancer

    International Nuclear Information System (INIS)

    Purpose: To evaluate the impact of individual in vivo DNA double-strand break (DSB) repair capacity on the incidence of severe oral mucositis in patients with head-and-neck cancer undergoing adjuvant radiotherapy (RT) or radiochemotherapy (RCT). Patients and Methods: Thirty-one patients with resected head-and-neck cancer undergoing adjuvant RT or RCT were examined. Patients underwent RT of the primary tumor site and locoregional lymph nodes with a total dose of 60–66 Gy (single dose 2 Gy, five fractions per week). Chemotherapy consisted of two cycles of cisplatin and 5-fluorouracil. To assess DSB repair, γ-H2AX foci in blood lymphocytes were quantified before and 0.5 h, 2.5 h, 5 h, and 24 h after in vivo radiation exposure (the first fraction of RT). World Health Organization scores for oral mucositis were documented weekly and correlated with DSB repair. Results: Sixteen patients received RT alone; 15 patients received RCT. In patients who developed Grade ≥ 3 mucositis (n = 18) the amount of unrepaired DSBs 24 h after radiation exposure and DSB repair half-times did not differ significantly from patients with Grade ≤2 mucositis (n = 13). Patients with a proportion of unrepaired DSBs after 24 h higher than the mean value + one standard deviation had an increased incidence of severe oral mucositis. Conclusions: Evaluation of in vivo DSB repair by determination of γ-H2AX foci loss is feasible in clinical practice and allows identification of patients with impaired DSB repair. The incidence of oral mucositis is not closely correlated with DSB repair under the evaluated conditions.

  13. Feasibility of measuring radiation-induced DNA double strand breaks and their repair by pulsed field gel electrophoresis in freshly isolated cells from the mouse RIF-1 tumor

    International Nuclear Information System (INIS)

    Purpose: To examine the technical feasibility of pulsed field gel electrophoresis (PFGE) as a predictive assay for the radio responsiveness of tumors. Induction and repair of DNA double strand breaks (DSBs) in a freshly prepared cell suspension from a RIF-1 tumor (irradiated ex vivo) was compared with DSB induction and repair in exponentially growing RIF-1 cells in culture (irradiated in vitro). Methods and Materials: A murine RIF-1 tumor grown in vivo was digested, and cells were exposed to x-rays (ex vivo) at doses of 1 to 75 Gy. DNA damage was measured using CHEF (clamped homogeneous electric fields) electrophoresis. Repair kinetics were studied at 37 deg. C for 4 h after irradiation. Radiosensitivity was determined by clonogenic assay, and cell cycle distributions by flow cytometry. For comparison, a trypsinized suspension of exponentially growing RIF-1 cells in vitro was run parallel with each ex vivo experiment. Results: Induction of DSBs, expressed as % DNA extracted from the plug, was similar in the in vitro and ex vivo irradiated cells. Compared to repair rates in in vitro cultured RIF-1 cells, repair kinetics in a freshly prepared cell suspension from the tumor were decreased, unrelated to differences in radiosensitivity. Differences in repair could not be explained by endogenous DNA degradation, nor by influences of enzymes used for digestion of the tumor. A lower plating efficiency and differences in ploidy (as revealed by flow cytometry) were the only reproducible differences between in vivo and in vitro grown cells that may explain the differences in repair kinetics. Conclusions: The current results do not support the idea that PFGE is a technique robust enough to be a predictive assay for the radiosensitivity of tumor cells

  14. Survey of Active Structural Control and Repair Using Piezoelectric Patches

    OpenAIRE

    Ahmed Abuzaid; Meftah Hrairi; M.S.I. Shaik Dawood

    2015-01-01

    The piezoelectric actuator has gained popularity over the last few years. Attention has been directed towards the study of their electromechanical response in active repair and the control of damaged structures. This has been made possible through the development of various numerical and analytical techniques for such studies. The shift of focus towards the piezoelectric based approaches has been due to their advantages, which include strategic cost benefits in maintenance, as well as an incr...

  15. BMI1 Is Recruited to DNA Breaks and Contributes to DNA Damage-Induced H2A Ubiquitination and Repair ▿ †

    OpenAIRE

    Ginjala, Vasudeva; Nacerddine, Karim; Kulkarni, Atul; Oza, Jay; Hill, Sarah J.; Yao, Ming; Citterio, Elisabetta; van Lohuizen, Maarten; Ganesan, Shridar

    2011-01-01

    DNA damage activates signaling pathways that lead to modification of local chromatin and recruitment of DNA repair proteins. Multiple DNA repair proteins having ubiquitin ligase activity are recruited to sites of DNA damage, where they ubiquitinate histones and other substrates. This DNA damage-induced histone ubiquitination is thought to play a critical role in mediating the DNA damage response. We now report that the polycomb protein BMI1 is rapidly recruited to sites of DNA damage, where i...

  16. Vaginal pressure during daily activities before and after vaginal repair

    DEFF Research Database (Denmark)

    Mouritsen, L; Hulbaek, M; Brostrøm, S;

    2007-01-01

    The objective of the study was to measure vaginal pressure during various daily activities in patients before and after vaginal surgery for pelvic organ prolapse, searching data for evidence-based activity guidelines. Vaginal pressure (VP) was studied in 23 patients during activities such as rest......, pelvic floor contraction (PFC), coughing, Valsalva, rising from sitting to standing and lifting 2 and 5 kg with four different lifting techniques. VP was measured before, 1-5 days and 4-6 weeks after vaginal repair. Mean VP was four to five times higher during coughing and Valsalva compared to PFC and...

  17. Radiation induced strand breaks and time scale for repair of broken strands in superinfecting phage lambda DNA in Escherichia coli lysogenic for lambda

    International Nuclear Information System (INIS)

    The production of the first radiation induced break in covalent lambda DNA molecules in pol+ and pol A 1 lysogenic host cells was measured after exposure to electrons from a linear accelerator and transfer to alkaline detergent within 100 ms from the onset of irradiation. The results revealed the presence of an oxygen effect in DNA strand breakage. In both pol+ and pol A 1 host cells the rate of production in nitrogen was 1.2x10-12 DNA single strand breaks per rad per dalton as compared to 5x10-12 in oxygen. The yields of strand breaks in lambda DNA in pol+ host cells under oxygenated or anoxic conditions are independent of whether the cells are irradiated in buffer at room temperature, in buffer at ice temperature, or in growth medium at 370C. These results indicate that enzymic repair of DNA strand breaks before analysis is insignificant in these experiments. The presence of an oxygen effect in DNA strand breakage under these conditions suggest that an actual difference exists between initial number of breaks produced in nitrogen and in oxygen. The kinetics of rejoining of broken molecules under optimal growth conditions was measured by incubating the irradiated host cells prior to lysis. In pol+ host cells 50% of the lambda DNA molecules broken in presence of oxygen are rejoined within 10 to 20 seconds of incubation. A significantly lower recovery is seen in pol+ host cells after irradiation in nitrogen. The rejoining of broken lambda DNA strands in pol A 1 host cells is impaired after irradiation in presence of oxygen as well as under anoxia. These results show that DNA polymerase I is needed for the rapid rejoining of radiation induced strand breaks in the DNA, and that oxygen promoted strand breaks are more easily rejoined than are those produced in nitrogen. (author)

  18. Signalization and repair of the DNA double-strand breaks of in the cerebral tumors: modulation of the radiation response with the chemotherapy treatments

    International Nuclear Information System (INIS)

    There are about 6000 new cases of nervous system tumours each year in France. However, the current radio chemotherapeutic approaches against brain tumours remain still insufficient to produce a satisfactory therapeutic index. In parallel, the knowledge of the early radiobiological events has considerably progressed in the last few years. This thesis aims to provide new insights in the molecular and cellular response of brain tumours to radio chemotherapy. This thesis was divided into four stages. Stage 1: a novel DNA double-strand breaks repair pathway depending on the MRE11 protein but independent of the phosphorylation of H2AX emerged from the study of artefacts of the immunofluorescence technique and a systematic analysis of the radiosensitivity of human cells. Stage 2: the radiobiological features of 3 rodent models of glioma among the most used in preclinical trials and of 7 human glioma cell lines were investigated. Functional impairments of the BRCA1 protein in response to radiation and/or cisplatin were observed in the majority of the models tested, raising the question of the role of this protein in the anti-glioma treatments and in glioma genesis. Stage 3: in order to extend our approach to genetic syndromes associated with cerebral tumours predisposition, the radiobiological characteristics of the fibroblasts resulting from patients suffering from neurofibromatosis type 1 (NF1), a pathology associated with a strong incidence of peripheral nervous system tumours, were investigated. NF1 appeared to be a syndrome with moderated radiosensitivity, associated with a weak deficiency of DNA end-joining repair but with a strong activity of MRE11. These results enabled us to propose a preliminary model involving both proteins BRCA1 and NF1. Stage 4: considering the role of BRCA1 in the inhibition of some tyrosine kinase activity and in the response to cisplatin, we tested the radiobiological effects of treatments combining radiation, cisplatin and tyrosine kinase

  19. Induction of double-strand breaks in DNA of prokaryotes and eukaryotes and their repair. 1. Application of elastoviscosimetry for studying double-strand breaks in DNA of Escherichia coli induced by γ-irradiation

    International Nuclear Information System (INIS)

    It is shown that the method of elastoviscosimetry gives a possibility to record the formation of DNA double-strand breaks in Escherichia coli cells induced by γ irradiation at doses close to D37. The dependence of changes of elastoviscosity parameter on the dose (tau0) passes through the maximum. It is shown that the ascending section of this curve (at minimum γ irradiation doses) characterizes the relaxation process of the superspiralised chromosome in nucleotide of the E. coli. This relaxation is observed due to γ induced damages which are not double-strand breaks. By the maximum position one can judge on a dose yield of the first DNA double-strand break, the descending part of the dose curve describes the kinetics of accumulation of breaks with the dose increase. The analysis of the data obtained gives the possibility to come to the conclusion that when applying a usual technique of irradiation and lysis of cells not providing for special measures on inhibition of endo-and exonuclease activity in γ irradiated cells, the dose yield of double-strand breaks noticeably increases (by 4.2 times). In the case of an essential, though incomplete, inhibition of nuclease activities in γ irradiated cells the dose yield of breaks approximately corresponds to the dose curve of inactivation of these cells (D3712.5+-3.0 krad, the first double-strand break -at 14.5+-2.4 krad)

  20. Comet assay analysis of repair of DNA strand breaks in normal and deficient human cells exposed to radiations and chemicals. Evidence for a repair pathway specificity of DNA ligation

    International Nuclear Information System (INIS)

    The induction and resealing of DNA strand breaks in a cell line with a proven defect in DNA ligase I, 46BR, and in two Bloom's syndrome cell lines. YBL6 and GM 1492, were compared to those observed in normal human 1BR/3 fibroblasts after treatment with a variety of genotoxic agents whose lesions are processed by different repair pathways. This analysis was performed using the single-cell gel electrophoresis assay. The three types of cells were found to have similar capabilities to recognize and incise ultraviolet photoproducts and also demonstrated similar amounts of DNA breaks immediately after γ irradiation. During post-treatment incubation, 46BR cells showed a marked DNA re-ligation defect after ultraviolet radiation damage, GM 1492 cells demonstrated a highly reduced DNA joining ability after relatively high doses of ultraviolet radiation, and YBL6 cells were particularly affected in DNA re-ligation after damage by 4-nitroquinoline-1-oxide. The two Bloom's syndrome cell lines and 46BR cells had a nearly normal ability to reseal breaks resulting from γ irradiation or treatment with xanthine plus xanthine oxidase. These findings suggest that different DNA ligases may be involved in different DNA repair pathways in human cells. 60 refs., 7 figs

  1. Vaginal pressure during daily activities before and after vaginal repair

    DEFF Research Database (Denmark)

    Mouritsen, L; Hulbaek, M; Brostrøm, S;

    2007-01-01

    , pelvic floor contraction (PFC), coughing, Valsalva, rising from sitting to standing and lifting 2 and 5 kg with four different lifting techniques. VP was measured before, 1-5 days and 4-6 weeks after vaginal repair. Mean VP was four to five times higher during coughing and Valsalva compared to PFC and...... lifting 2 and 5 kg. Lifting in the walking position created a slightly higher VP compared to other lifting techniques, which did not differ. The VP did not increase when lifting 5 kg compared to 2 kg. Mean VP during coughing and Valsalva were significantly lower 1-5 days after the operation. VP was not...... related to the type of vaginal repair. The results imply that post-operative counselling should concentrate more on treating chronic cough and constipation than restrictions of moderate physical activities....

  2. Reduced DNA double-strand break repair capacity and risk of squamous cell carcinoma of the head and neck-A case-control study.

    Science.gov (United States)

    Liu, Zhensheng; Liu, Hongliang; Gao, Fengqin; Dahlstrom, Kristina R; Sturgis, Erich M; Wei, Qingyi

    2016-04-01

    Tobacco smoke and alcohol use play important roles in the etiology of squamous cell carcinoma of the head and neck (SCCHN). Smoking causes DNA damage, including double-strand DNA breaks (DSBs), that leads to carcinogenesis. To test the hypothesis that suboptimal DSB repair capacity is associated with risk of SCCHN, we applied a flow cytometry-based method to detect the DSB repair phenotype first in four EBV-immortalized human lymphoblastoid cell lines and then in human peripheral blood T-lymphocytes (PBTLs). With this blood-based laboratory assay, we conducted a pilot case-control study of 100 patients with newly diagnosed, previously untreated SCCHN and 124 cancer-free controls of non-Hispanic whites. We found that the mean DSB repair capacity level was significantly lower in cases (42.1%) than that in controls (54.4%) (P<0.001). When we used the median DSB repair capacity level in the controls as the cutoff value for calculating the odds ratios (ORs) with adjustment for age, sex, smoking and drinking status, the cases were more likely than the controls to have a reduced DSB repair capacity (adjusted OR=1.93; 95% confidence interval, CI=1.04-3.56, P=0.037), especially for those subjects who were ever drinkers (adjusted OR=2.73; 95% CI=1.17-6.35, P=0.020) and had oropharyngeal tumors (adjusted OR=2.17; 95% CI=1.06-4.45, P=0.035). In conclusion, these findings suggest that individuals with a reduced DSB repair capacity may be at an increased risk of developing SCCHN. Larger studies are warranted to confirm these preliminary findings. PMID:26963119

  3. Studies on the repair of double strand break of DNA and cellular carcinogenesis, and consideration on the concept of extinction of nuclear power

    International Nuclear Information System (INIS)

    This paper describes the relationship between the repair of double strand break (DSB) of DNA and cellular carcinogenesis mainly on author's investigations, and his recent thought aiming at the extinction of nuclear power. The molecular repairing system is explained about DNA DSB induced by radiation and chemicals. When DSB occurs, nucleosome consisting from 4 core-histones participates to link the broken ends and then repair mechanisms of homologous recombination (HRR) and non-homologous end joining (NHEJ) begin to work. The latter is dominant in mammalians. Thus the genetic defect in these systems of DSB response and repair is a course of disorders such as ataxia telangiectasia (AT) (DSB sensor defect), genetic breast cancer (HRR defect), and radiosensitive-severe combined immunodeficiency (RS-SCID) (NHEJ defect), all of which result in cancer formation. NHEJ repair is known to be error-prone. Against multi-step carcinogenesis where accumulated gene mutations lead to the cancer formation, the author thinks chromosomal instability is one of important carcinogenic causes: the instability can be a trigger of producing cancer stem cells because the cells can be yielded from mouse embryonic stem cells where DSB is shown to participate in the process. Low dose radiation produces a small amount of DSB, to which the repair response is less sensitive at G2/M checkpoint, ultimately leading to genomic instability. Considering effects of the low dose radiation exposure above, and of the internal exposure to 3H-thymidine beta ray in cells, of indoor Rn participating 16% of lung cancer incidence (Canadian epidemiological data) and so on, together with moral and social responsibility of scientist and technologist, the author says to have attained to the concept of the ''Extinction of Nuclear Power''. (T.T)

  4. Inter-individual variation in DNA double-strand break repair in human fibroblasts before and after exposure to low doses of ionizing radiation

    International Nuclear Information System (INIS)

    DNA double-strand breaks (DSB) are generally considered the most critical lesion induced by ionizing radiation (IR) and may initiate carcinogenesis and other disease. Using an immunofluorescence assay to simultaneously detect nuclear foci of the phosphorylated forms of histone H2AX and ATM kinase at sites of DSBs, we examined the response of 25 apparently normal and 10 DNA repair-deficient (ATM, ATR, NBN, LIG1, LIG4, and FANCG) primary fibroblast strains irradiated with low doses of 137Cs γ-rays. Quiescent G0/G1-phase cultures were exposed to 5, 10, and 25 cGy and allowed to repair for 24 h. The maximum level of IR-induced foci (0.15 foci per cGy, at 10 or 30 min) in the normal strains showed much less inter-individual variation (CV ∼ 0.2) than the level of spontaneous foci, which ranged from 0.2-2.6 foci/cell (CV ∼ 0.6; mean ± SD of 1.00 ± 0.57). Significantly slower focus formation post-irradiation was observed in seven normal strains, similar to most mutant strains examined. There was variation in repair efficiency measured by the fraction of IR-induced foci remaining 24 h post-irradiation, curiously with the strains having slower focus formation showing more efficient repair after 25 cGy. Interestingly, the ranges of spontaneous and residual induced foci levels at 24 h in the normal strains were as least as large as those observed for the repair-defective mutant strains. The inter-individual variation in DSB foci parameters observed in cells exposed to low doses of ionizing radiation in this small survey of apparently normal people suggests that hypomorphic genetic variants in genomic maintenance and/or DNA damage signaling and repair genes may contribute to differential susceptibility to cancer induced by environmental mutagens.

  5. DNA breaks caused by monochromatic 365 nm ultraviolet-A radiation or hydrogen peroxide and their repair in human epithelioid and xeroderma pigmentosum cells

    International Nuclear Information System (INIS)

    The induction and repair of DNA single-strand breaks (SSB) assayed by alkaline filter elution was compared in human epithelioid P3 and xeroderma pigmentosum (XP) cells exposed to monochromatic 365-nm UV-A radiation and H2O2. Initial yields of SSB were measured with the cells held at 0.5oC during exposure. The yield from exposure to 365-nm radiation was slightly greater in XP than in P3 cells, whereas H2O2 produced more than three times as many SSB in P3 compared with XP cells. o-Phenanthroline (50 mM) markedly inhibited the yields of SSB induced in XP cells by H2O2, but had no effect on those produced by 365-nm UV-A. These results are consistent with the fact that P3 cells, unlike XP cells, have undetectable levels of catalase. The measured production of trace amounts of H2O2 by the actual 365-nm UV0A exposures was not sufficient to account for the numbers of breaks that were observed. Single-strand breaks produced by both agents were completely repaired after 50 min in P3 cells, as were H2O2-induced SSB in XP cells. However, 25% of the 365-nm UV-A-induced SSB in XP cells remained refractory to repair after 60 min. The results show that SSB produced by these two agents are different and that 365 nm radiation produces most SSB in cells by mechanisms other than by production of H2O2. (author)

  6. DNA double-strand break repair, DNA-PK, and DNA ligases in two human squamous carcinoma cell lines with different radiosensitivity

    International Nuclear Information System (INIS)

    Purpose: Variation in sensitivity to radiotherapy among tumors has been related to the capacity of cells to repair radiation-induced DNA double-strand breaks (DSBs). DNA-dependent protein kinase (DNA-PK) and DNA ligases may affect DNA dsb rejoining. This study was performed to compare rate of rejoining of radiation-induced DSBs, DNA-PK, and DNA ligase activities in two human squamous carcinoma cell lines with different sensitivity to ionizing radiation. Methods and Materials: Cell survival of two human squamous carcinoma cell lines, UM-SCC-1 and UM-SCC-14A, was determined by an in vitro clonogenic assay. DSB rejoining was studied using pulsed field gel electrophoresis (PFGE). DNA-PK activity was determined using BIOTRAK DNA-PK enzyme assay system (Amersham). DNA ligase activity in crude cell extracts was measured using [5'-33P] Poly (dA)·(oligo (dT) as a substrate. Proteolytic degradation of proteins was analyzed by means of Western blotting. Results: Applying the commonly used linear-quadratic equation to describe cell survival, S = e-αD-βD2, the two cell lines roughly have the same α value (∼0.40 Gy-1) whereas the β value was considerably higher in UM-SCC-14A (0.067 Gy-2 ± 0.007 Gy-2 [SEM]) as compared to UM-SCC-1 (0.013 Gy-2 ± 0.004 Gy-2 [SEM]). Furthermore, UM-SCC-1 was more proficient in rejoining of X-ray-induced DSBs as compared to UM-SCC-14A as quantified by PFGE. The constitutive level of DNA-PK activity was 1.6 times higher in UM-SCC-1 as compared to UM-SCC-14A (p < 0.05). The constitutive level of DNA ligase activity was similar in the two cell lines. Conclusions: The results suggest that the proficiency in rejoining of DSBs is associated with DNA-PK activity but not with total DNA ligase activity

  7. The Vitamin A Derivative All-Trans Retinoic Acid Repairs Amyloid-β-Induced Double-Strand Breaks in Neural Cells and in the Murine Neocortex

    Directory of Open Access Journals (Sweden)

    Emmanuelle Gruz-Gibelli

    2016-01-01

    Full Text Available The amyloid-β peptide or Aβ is the key player in the amyloid-cascade hypothesis of Alzheimer’s disease. Aβ appears to trigger cell death but also production of double-strand breaks (DSBs in aging and Alzheimer’s disease. All-trans retinoic acid (RA, a derivative of vitamin A, was already known for its neuroprotective effects against the amyloid cascade. It diminishes, for instance, the production of Aβ peptides and their oligomerisation. In the present work we investigated the possible implication of RA receptor (RAR in repair of Aβ-induced DSBs. We demonstrated that RA, as well as RAR agonist Am80, but not AGN 193109 antagonist, repair Aβ-induced DSBs in SH-SY5Y cells and an astrocytic cell line as well as in the murine cortical tissue of young and aged mice. The nonhomologous end joining pathway and the Ataxia Telangiectasia Mutated kinase were shown to be involved in RA-mediated DSBs repair in the SH-SY5Y cells. Our data suggest that RA, besides increasing cell viability in the cortex of young and even of aged mice, might also result in targeted DNA repair of genes important for cell or synaptic maintenance. This phenomenon would remain functional up to a point when Aβ increase and RA decrease probably lead to a pathological state.

  8. The role of the Mre11-Rad50-Nbs1 complex in double-strand break repair-facts and myths.

    Science.gov (United States)

    Takeda, Shunichi; Hoa, Nguyen Ngoc; Sasanuma, Hiroyuki

    2016-08-01

    Homologous recombination (HR) initiates double-strand break (DSB) repair by digesting 5'-termini at DSBs, the biochemical reaction called DSB resection, during which DSBs are processed by nucleases to generate 3' single-strand DNA. Rad51 recombinase polymerizes along resected DNA, and the resulting Rad51-DNA complex undergoes homology search. Although DSB resection by the Mre11 nuclease plays a critical role in HR in Saccharomyces cerevisiae, it remains elusive whether DSB resection by Mre11 significantly contributes to HR-dependent DSB repair in mammalian cells. Depletion of Mre11 decreases the efficiency of DSB resection only by 2- to 3-fold in mammalian cells. We show that although Mre11 is required for efficient HR-dependent repair of ionizing-radiation-induced DSBs, Mre11 is largely dispensable for DSB resection in both chicken DT40 and human TK6 B cell lines. Moreover, a 2- to 3-fold decrease in DSB resection has virtually no impact on the efficiency of HR. Thus, although a large number of researchers have reported the vital role of Mre11-mediated DSB resection in HR, the role may not explain the very severe defect in HR in Mre11-deficient cells, including their lethality. We here show experimental evidence for the additional roles of Mre11 in (i) elimination of chemical adducts from DSB ends for subsequent DSB repair, and (ii) maintaining HR intermediates for their proper resolution. PMID:27311583

  9. Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Khong Bee, E-mail: dmskkb@nccs.com.sg [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore); Zhu Congju; Wong Yinling; Gao Qiuhan; Ty, Albert; Wong, Meng Cheong [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore)

    2012-05-01

    Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)-Akt-DNA-dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, {gamma}-H{sub 2}AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, {gamma}-H{sub 2}AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G{sub 2}/M arrest and increased {gamma}-H{sub 2}AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased {gamma}-H{sub 2}AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are

  10. Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

    International Nuclear Information System (INIS)

    Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)–Akt-DNA–dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, γ-H2AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, γ-H2AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G2/M arrest and increased γ-H2AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased γ-H2AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are resistant to irradiation-induced cytotoxicity, G2/M

  11. Human chromosome 5 complements the DNA double-strand break-repair deficiency and gamma-ray sensitivity of the XR-1 hamster variant.

    OpenAIRE

    Giaccia, A. J.; Denko, N; MAcLAREN, R.; Mirman, D; Waldren, C; Hart, I; Stamato, T D

    1990-01-01

    XR-1 is a Chinese hamster ovary (CHO) cell mutant which is unusually sensitive to killing by gamma rays in the G1 portion of the cell cycle but has nearly normal resistance to gamma-ray damage in late S phase. The cell-cycle sensitivity correlates with the mutant's inability to repair DNA double-strand breaks (DSBs) produced by ionizing radiation and restriction enzymes. We have previously shown in somatic cell hybrids of XR-1 cells and human fibroblasts that the XR-1 mutation is a recessive ...

  12. Complex formation in yeast double-strand break repair: participation of Rad51, Rad52, Rad55, and Rad57 proteins.

    OpenAIRE

    Hays, S L; Firmenich, A A; Berg, P

    1995-01-01

    The repair of DNA double-strand breaks in Saccharomyces cerevisiae requires genes of the RAD52 epistasis group, of which RAD55 and RAD57 are members. Here, we show that the x-ray sensitivity of rad55 and rad57 mutant strains is suppressible by overexpression of RAD51 or RAD52. Virtually complete suppression is provided by the simultaneous overexpression of RAD51 and RAD52. This suppression occurs at 23 degrees C, where these mutants are more sensitive to x-rays, as well as at 30 degrees C and...

  13. Evaluation of a new range of light-activated surgical adhesives for tissue repair in a porcine model

    Science.gov (United States)

    Riley, Jill N.; Hodges, Diane E.; March, Keith L.; McNally-Heintzelman, Karen M.

    2001-05-01

    An in vitro study was conducted to determine the feasibility of using a new range of light-activated surgical adhesives for incision repair in a wide range of tissue types. Biodegradable polymer membranes of controlled porosity were fabricated with poly(L-lactic-co-glycolic acid) (PLGA) and salt particles using a solvent-casting and particulate- leaching technique. The porous membranes were doped with protein solder composed of 50%(w/v) bovine serum albumin solder and 0.5 mg/ml indocyanine green (ICG) dye mixed in deionized water. Tissue incisions were repaired using the surgical adhesive in conjunction with an 805-nm diode laser. Nine organs were tested ranging from skin to liver to the small intestine, as well as the coronary, pulmonary, carotid, femoral and splenetic arteries. Acute breaking strengths were measured and the data were analyzed by Student's T-test. Repairs formed on the small intestine were most successful followed by spleen, atrium, kidney, muscle and skin. The strongest vascular repairs were achieved in the carotid artery and femoral artery. The new surgical adhesive could possibly be used as a simple and effective method to stop bleeding and repair tissue quickly in an emergency situation, or as a substitute to mechanical staples or sutures in many clinical applications.

  14. Depletion of tyrosyl DNA phosphodiesterase 2 activity enhances etoposide-mediated double-strand break formation and cell killing.

    Science.gov (United States)

    Kont, Yasemin Saygideger; Dutta, Arijit; Mallisetty, Apurva; Mathew, Jeena; Minas, Tsion; Kraus, Christina; Dhopeshwarkar, Priyanka; Kallakury, Bhaskar; Mitra, Sankar; Üren, Aykut; Adhikari, Sanjay

    2016-07-01

    DNA topoisomerase 2 (Top2) poisons, including common anticancer drugs etoposide and doxorubicin kill cancer cells by stabilizing covalent Top2-tyrosyl-DNA 5'-phosphodiester adducts and DNA double-strand breaks (DSBs). Proteolytic degradation of the covalently attached Top2 leaves a 5'-tyrosylated blocked termini which is removed by tyrosyl DNA phosphodiesterase 2 (TDP2), prior to DSB repair through non-homologous end joining (NHEJ). Thus, TDP2 confers resistance of tumor cells to Top2-poisons by repairing such covalent DNA-protein adducts, and its pharmacological inhibition could enhance the efficacy of Top2-poisons. We discovered NSC111041, a selective inhibitor of TDP2, by optimizing a high throughput screening (HTS) assay for TDP2's 5'-tyrosyl phosphodiesterase activity and subsequent validation studies. We found that NSC111041 inhibits TDP2's binding to DNA without getting intercalated into DNA and enhanced etoposide's cytotoxicity synergistically in TDP2-expressing cells but not in TDP2 depleted cells. Furthermore, NSC111041 enhanced formation of etoposide-induced γ-H2AX foci presumably by affecting DSB repair. Immuno-histochemical analysis showed higher TDP2 expression in a sub-set of different type of tumor tissues. These findings underscore the feasibility of clinical use of suitable TDP2 inhibitors in adjuvant therapy with Top2-poisons for a sub-set of cancer patients with high TDP2 expression. PMID:27235629

  15. Genetic polymorphisms in DNA repair genes and possible links with DNA repair rates, chromosomal aberrations and single-strand breaks in DNA

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Kumar, R.; Štětina, R.; Sanyal, S.; Souček, P.; Haufroid, V.; Dušinská, M.; Kuricová, M.; Zámečníková, M.; Musak, L.; Buchancová, J.; Norppa, H.; Hirvonen, A.; Vodičková, L.; Naccarati, Alessio; Matoušů, Zora; Hemminki, K.

    2004-01-01

    Roč. 25, č. 5 (2004), s. 757-763. ISSN 0143-3334 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 5.375, year: 2004

  16. DNA Strand Breaks, Photoproducts, and Repair in Analog Space and Mars Environments: Implications for Microbial Interplanetary Transfer

    Science.gov (United States)

    Nicholson, W. L.; Möller, R.; Douki, T.; Robles, J.; Bruno, G.; Fajardo-Cavazos, P.; Schuerger, A. C.

    2008-03-01

    Bacterial spores are considered good candidates for interplanetary transport by natural impacts or human spaceflight. In this work we consider the mechanisms of DNA damage and repair in spores subjected to a hypothetical Earth-to-Mars transfer.

  17. The roles of APE1, APE2, DNA polymerase β and mismatch repair in creating S region DNA breaks during antibody class switch

    OpenAIRE

    Schrader, Carol E.; Guikema, Jeroen E.J.; Wu, Xiaoming; Stavnezer, Janet

    2008-01-01

    Immunoglobulin class switch recombination (CSR) occurs by an intrachromosomal deletion requiring generation of double-stranded DNA breaks (DSBs) in immunoglobulin switch region DNA. The initial steps of DSB formation have been elucidated: cytosine deamination by activation-induced cytidine deaminase (AID) and the generation of abasic sites by uracil-DNA glycosylase (UNG). We show that abasic sites are converted into single-strand breaks (SSBs) by apurinic/apyrimidinic endonucleases (APE1 and ...

  18. MCM8 is required for a pathway of meiotic double-strand break repair independent of DMC1 in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Wayne Crismani

    Full Text Available Mini-chromosome maintenance (MCM 2-9 proteins are related helicases. The first six, MCM2-7, are essential for DNA replication in all eukaryotes. In contrast, MCM8 is not always conserved in eukaryotes but is present in Arabidopsis thaliana. MCM8 is required for 95% of meiotic crossovers (COs in Drosophila and is essential for meiosis completion in mouse, prompting us to study this gene in Arabidopsis meiosis. Three allelic Atmcm8 mutants showed a limited level of chromosome fragmentation at meiosis. This defect was dependent on programmed meiotic double-strand break (DSB formation, revealing a role for AtMCM8 in meiotic DSB repair. In contrast, CO formation was not affected, as shown both genetically and cytologically. The Atmcm8 DSB repair defect was greatly amplified in the absence of the DMC1 recombinase or in mutants affected in DMC1 dynamics (sds, asy1. The Atmcm8 fragmentation defect was also amplified in plants heterozygous for a mutation in either recombinase, DMC1 or RAD51. Finally, in the context of absence of homologous chromosomes (i.e. haploid, mutation of AtMCM8 also provoked a low level of chromosome fragmentation. This fragmentation was amplified by the absence of DMC1 showing that both MCM8 and DMC1 can promote repair on the sister chromatid in Arabidopsis haploids. Altogether, this establishes a role for AtMCM8 in meiotic DSB repair, in parallel to DMC1. We propose that MCM8 is involved with RAD51 in a backup pathway that repairs meiotic DSB without giving CO when the major pathway, which relies on DMC1, fails.

  19. Genetic variants in DNA double-strand break repair genes and risk of salivary gland carcinoma: a case-control study.

    Directory of Open Access Journals (Sweden)

    Li Xu

    Full Text Available DNA double strand break (DSB repair is the primary defense mechanism against ionizing radiation-induced DNA damage. Ionizing radiation is the only established risk factor for salivary gland carcinoma (SGC. We hypothesized that genetic variants in DSB repair genes contribute to individual variation in susceptibility to SGC. To test this hypothesis, we conducted a case-control study in which we analyzed 415 single nucleotide polymorphisms (SNPs in 45 DSB repair genes in 352 SGC cases and 598 controls. Multivariate logistic regression analysis was performed to calculate odds ratios (ORs and 95% confidence intervals (CIs. Rs3748522 in RAD52 and rs13180356 in XRCC4 were significantly associated with SGC after Bonferroni adjustment; ORs (95% CIs for the variant alleles of these SNPs were 1.71 (1.40-2.09, P = 1.70 × 10(-7 and 0.58 (0.45-0.74, P = 2.00 × 10(-5 respectively. The genetic effects were modulated by histological subtype. The association of RAD52-rs3748522 with SGC was strongest for mucoepidermoid carcinoma (OR = 2.21, 95% CI: 1.55-3.15, P = 1.25 × 10(-5, n = 74, and the association of XRCC4-rs13180356 with SGC was strongest for adenoid cystic carcinoma (OR = 0.60, 95% CI: 0.42-0.87, P = 6.91 × 10(-3, n = 123. Gene-level association analysis revealed one gene, PRKDC, with a marginally significant association with SGC risk in non-Hispanic whites. To our knowledge, this study is the first to comprehensively evaluate the genetic effect of DSB repair genes on SGC risk. Our results indicate that genetic variants in the DSB repair pathways contribute to inter-individual differences in susceptibility to SGC and show that the impact of genetic variants differs by histological subtype. Independent studies are warranted to confirm these findings.

  20. Either non-homologous ends joining or homologous recombination is required to repair double-strand breaks in the genome of macrophage-internalized Mycobacterium tuberculosis.

    Directory of Open Access Journals (Sweden)

    Anna Brzostek

    Full Text Available The intracellular pathogen Mycobacterium tuberculosis (Mtb is constantly exposed to a multitude of hostile conditions and is confronted by a variety of potentially DNA-damaging assaults in vivo, primarily from host-generated antimicrobial toxic radicals. Exposure to reactive nitrogen species and/or reactive oxygen species causes different types of DNA damage, including oxidation, depurination, methylation and deamination, that can result in single- or double-strand breaks (DSBs. These breaks affect the integrity of the whole genome and, when left unrepaired, can lead to cell death. Here, we investigated the role of the DSB repair pathways, homologous recombination (HR and non-homologous ends joining (NHEJ, in the survival of Mtb inside macrophages. To this end, we constructed Mtb strains defective for HR (ΔrecA, NHEJ [Δ(ku,ligD], or both DSB repair systems [Δ(ku,ligD,recA]. Experiments using these strains revealed that either HR or NHEJ is sufficient for the survival and propagation of tubercle bacilli inside macrophages. Inhibition of nitric oxide or superoxide anion production with L-NIL or apocynin, respectively, enabled the Δ(ku,ligD,recA mutant strain lacking both systems to survive intracellularly. Complementation of the Δ(ku,ligD,recA mutant with an intact recA or ku-ligD rescued the ability of Mtb to propagate inside macrophages.

  1. DSB修复过程中的组蛋白修饰作用%Histone Modifications in DNA Double-Strand Breaks Damage Repair

    Institute of Scientific and Technical Information of China (English)

    贾兆君; 伍会健

    2013-01-01

    DNA doubled-strand breaks (DSBs) which is the most serious species in DNA damage can lead to the loss of genetic message or even cell death.To resist DSB damage,the organism has developed a DNA-damage response (DDR) mechanism for DNA damage repair to avoid the transfer of inaccurate genetic message.In this process,histone which is the main structural protein of chromatin is regulated by multi-modifications,such as phosphorylation,methylation,acetylation,ubiquitination and so on.These modifications of histones promote the recruitment of DDR-related protein to the site of DNA damage in the process of DNA damage repair,and change chromatin structure to facilitate repair progress in DDR.%DNA双键断裂(DNA doubled-strand breaks,DSBs)是目前已知DNA损伤中最为严重的一种,会造成遗传信息丢失,甚至细胞死亡.为了应对DSB损伤,生命体进化出DNA损伤应答(DNA-damage response,DDR)机制,进行损伤修复以防止错误遗传信息的传递.在这一过程中,作为染色质主要结构蛋白的组蛋白发生多种修饰,包括磷酸化、甲基化、乙酰化、泛素化等.这些组蛋白修饰促进DDR相关蛋白在DNA损伤处的招募,并改变染色质结构,以促进修复过程顺利进行.

  2. Role of 53BP1 in the regulation of DNA double-strand break repair pathway choice.

    Science.gov (United States)

    Gupta, Arun; Hunt, Clayton R; Chakraborty, Sharmistha; Pandita, Raj K; Yordy, John; Ramnarain, Deepti B; Horikoshi, Nobuo; Pandita, Tej K

    2014-01-01

    The p53-binding protein 1 (53BP1) is a well-known DNA damage response (DDR) factor, which is recruited to nuclear structures at the site of DNA damage and forms readily visualized ionizing radiation (IR) induced foci. Depletion of 53BP1 results in cell cycle arrest in G2/M phase as well as genomic instability in human as well as mouse cells. Within the DNA damage response mechanism, 53BP1 is classified as an adaptor/mediator, required for processing of the DNA damage response signal and as a platform for recruitment of other repair factors. More recently, specific 53BP1 contributions to DSB repair pathway choice have been recognized and are being characterized. In this review, we have summarized recent advances in understanding the role of 53BP1 in regulating DNA DSBs repair pathway choice, variable diversity joining [V(D)J] recombination and class-switch recombination (CSR). PMID:24320053

  3. DNA double strand break repair pathway plays a significant role in determining the radiotherapy induced normal tissue toxicity among head-and-neck and breast cancer

    International Nuclear Information System (INIS)

    The ability to predict individual risk of radiotherapy induced normal tissue complications prior to the therapy may give an opportunity to personalize the treatment aiming improved therapeutic effect and quality of life. Therefore, predicting the risk of developing acute reactions before the initiation of radiation therapy may serve as a potential biomarker. DNA double-strand break (DSB) induction and its repair kinetics in lymphocytes of Head-and-Neck (n = 183) and Breast cancer (n = 132) patients undergoing chemoradiation or radiation therapy alone were analyzed by performing γ-H2AX foci, neutral comet and a modified neutral filter elution assay. Candidate radioresponsive genes like DNA repair, antioxidant pathway, profibrotic cytokine genes were screened for the common variants for their association with normal tissue toxicity outcome. Patients were stratified as non-over responders (NOR) and over responders (OR) based on their Radiation Therapy Oncology Group grading for normal tissue adverse reactions. Our results suggest that DSB repair plays a major role in the development of normal tissue adverse reactions in H and N and Breast cancer patients. The cellular (γ-H2AX analysis) and SNP analysis may have the potential to be developed into a clinically useful predictive assay for identifying the normal tissue over reactors

  4. XRCC4 and XLF form long helical protein filaments suitable for DNA end protection and alignment to facilitate DNA double strand break repair.

    Science.gov (United States)

    Mahaney, Brandi L; Hammel, Michal; Meek, Katheryn; Tainer, John A; Lees-Miller, Susan P

    2013-02-01

    DNA double strand breaks (DSBs), induced by ionizing radiation (IR) and endogenous stress including replication failure, are the most cytotoxic form of DNA damage. In human cells, most IR-induced DSBs are repaired by the nonhomologous end joining (NHEJ) pathway. One of the most critical steps in NHEJ is ligation of DNA ends by DNA ligase IV (LIG4), which interacts with, and is stabilized by, the scaffolding protein X-ray cross-complementing gene 4 (XRCC4). XRCC4 also interacts with XRCC4-like factor (XLF, also called Cernunnos); yet, XLF has been one of the least mechanistically understood proteins and precisely how XLF functions in NHEJ has been enigmatic. Here, we examine current combined structural and mutational findings that uncover integrated functions of XRCC4 and XLF and reveal their interactions to form long, helical protein filaments suitable to protect and align DSB ends. XLF-XRCC4 provides a global structural scaffold for ligating DSBs without requiring long DNA ends, thus ensuring accurate and efficient ligation and repair. The assembly of these XRCC4-XLF filaments, providing both DNA end protection and alignment, may commit cells to NHEJ with general biological implications for NHEJ and DSB repair processes and their links to cancer predispositions and interventions. PMID:23442139

  5. Possible role(s) of nuclear matrix and DNA loop organization in fixation or repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    DNA double-strand breaks produced by ionizing radiation are considered to be a critical radiation-induced lesion responsible, in part, for cell killing. However, the manner in which structures within the nucleus involving DNA organization contribute to the balance between fixation or repair of these critical lesions remains largely obscure. The repair process requires both functional enzymes and substrate availability, i.e., access to and orientation of damage sites. Therefore, the ability to repair damaged DNA could be influenced not only by DNA integrity but also by the spatial organization of DNA. Therefore, the authors investigated the possibility that radiation-induced DNA damage differentially affects DNA supercoiling ability in cells of differing radiosensitivities using radioresistant and radiosensitive mutants of different origins. This study was also designed to determine if differences in the composition of the nuclear matrix exist between cell lines of each origin. Results from these studies indicate that differences in the composition of the nuclear matrix proteins and DNA stability might be related to intrinsic radiation resistance

  6. Differential repair of radiation-induced DNA damage in cells of human squamous cell carcinoma and the effect of caffeine and cysteamine on induction and repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    The goal of these experiments was to investigate further the relationship between DNA double-strand breaks and cell killing in human tumor cells, first by comparing different cell lines, and second by radiomodification studies. Field-inversion gel electrophoresis was used to quantify double-strand breaks. Two subclones of the radioresistant human squamous cell carcinoma line SQ20B (SQD9 and SQG6) were compared. These subclones differed in DNA index by a factor of 1.7 but showed the same resistance to radiation as cells of the parental cell line. It was found that, although induction of DSBs was not significantly different in the two cell lines, the t1/2 of the fast component of repair was significantly shorter for SQD9 cells, leading to greater overall repair which was not reflected in increased survival. Caffeine and cysteamine were tested as modifiers of radiosensitivity, using the radioresistant SQ20B line and the radiosensitive SCC61 cell line. No effect of caffeine was seen when the drug was present only during irradiation. Postirradiation incubations with caffeine, however, resulted in a dose reduction factor greater than 2.0 in cell survival for both cell lines. In contrast, induction of DSBs was reduced by caffeine, and no effect on DSB repair was observed. Cysteamine led to a dose protection factor greater than 1.8 in cell survival in both cell lines. A reduction in induced DSBs was found at high doses corresponding approximately with the increase in cell survival. Over the same (low) dose range, however, the correlation between DSB induction and cell killing was poor. These data indicate that DSB induction does not correlate well with cell killing either for different cell lines, for radiochemical modification (cysteamine) or for some other types of modification (caffeine). 31 refs., 8 figs

  7. Active and break events of Indian summer monsoon during 1901-2014

    Digital Repository Service at National Institute of Oceanography (India)

    Pai, D.S.; Sridhar, L.; RameshKumar, M.R.

    . Dyn., vol.46(11); 2016; 3921-3939 Active and Break Events of Indian Summer Monsoon during 1901-2014 D.S. Pai*, Latha Sridhar* and M. R. Ramesh Kumar** *India Meteorological Department, Pune **National Institute of Oceanography, Goa Contact e... words: Monsoon break and active spells, monsoon depression, gridded daily rainfall, decadal variation 2 1 Introduction Over India, the large scale rainfall during the SW monsoon season (June-September) is received in spells with intermediate dry...

  8. SIRT6 stabilizes DNA-dependent protein kinase at chromatin for DNA double-strand break repair

    DEFF Research Database (Denmark)

    McCord, Ronald A; Michishita, Eriko; Hong, Tao;

    2009-01-01

    -dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA-PKcs) to...

  9. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    International Nuclear Information System (INIS)

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  10. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    Energy Technology Data Exchange (ETDEWEB)

    Zafar, Faria; Seidler, Sara B.; Kronenberg, Amy; Schild, David; Wiese, Claudia

    2010-06-29

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  11. Active and break events of Indian summer monsoon during 1901-2014

    Science.gov (United States)

    Pai, D. S.; Sridhar, Latha; Ramesh Kumar, M. R.

    2016-06-01

    The study lists active and break monsoon events over India over a very long period (1901-2014) identified using criteria based on a rainfall index derived over a critical high rainfall region called core monsoon zone. The break and active spells identified in this study were mostly comparable with that identified in the earlier studies based on similar rainfall criteria during the common data period (1951-2007). However, some noticeable differences were observed in the rainfall anomaly pattern associated with the break monsoon spells identified in this study and that identified based on the synoptic criteria in the earlier studies. The stringent rainfall criteria used in this study seems to be better criteria for identifying the breaks. During the study period, both the active and break spells of short duration were more frequent than the long duration with about 63.4 % of the break spells and 94.3 % of the active spells falling in the range of 3-6 days. There were no active spells of duration ≥13 days. Whereas, about 8 % of the break spells were of duration ≥13 days. During both the halves of the data period (1901-1957 and 1958-2014), there was no change in the distribution of the break events. However, the number of active spells showed an increase of about 12 % in the in the second half, which was mainly in the short duration (3-6 days) spells. During the data period, decadal variations of break days showed an out phase of relationship with the number of days of monsoon depression (MD). Relatively stronger in phase relationship was observed between the decadal variation of MD days and that of the active days till around early 1980s which reversed later due to sudden decrease in the MD days. During the same period, both the active and break days were in the increasing phase. This was also coincided with the sudden and significant increase in the number of days of monsoon lows (LOW). The LOWs, which generally have short life helped in the occurrence of active

  12. A major role of the RecFOR pathway in DNA double-strand-break repair through ESDSA in Deinococcus radiodurans.

    Science.gov (United States)

    Bentchikou, Esma; Servant, Pascale; Coste, Geneviève; Sommer, Suzanne

    2010-01-01

    In Deinococcus radiodurans, the extreme resistance to DNA-shattering treatments such as ionizing radiation or desiccation is correlated with its ability to reconstruct a functional genome from hundreds of chromosomal fragments. The rapid reconstitution of an intact genome is thought to occur through an extended synthesis-dependent strand annealing process (ESDSA) followed by DNA recombination. Here, we investigated the role of key components of the RecF pathway in ESDSA in this organism naturally devoid of RecB and RecC proteins. We demonstrate that inactivation of RecJ exonuclease results in cell lethality, indicating that this protein plays a key role in genome maintenance. Cells devoid of RecF, RecO, or RecR proteins also display greatly impaired growth and an important lethal sectoring as bacteria devoid of RecA protein. Other aspects of the phenotype of recFOR knock-out mutants paralleled that of a DeltarecA mutant: DeltarecFOR mutants are extremely radiosensitive and show a slow assembly of radiation-induced chromosomal fragments, not accompanied by DNA synthesis, and reduced DNA degradation. Cells devoid of RecQ, the major helicase implicated in repair through the RecF pathway in E. coli, are resistant to gamma-irradiation and have a wild-type DNA repair capacity as also shown for cells devoid of the RecD helicase; in contrast, DeltauvrD mutants show a markedly decreased radioresistance, an increased latent period in the kinetics of DNA double-strand-break repair, and a slow rate of fragment assembly correlated with a slow rate of DNA synthesis. Combining RecQ or RecD deficiency with UvrD deficiency did not significantly accentuate the phenotype of DeltauvrD mutants. In conclusion, RecFOR proteins are essential for DNA double-strand-break repair through ESDSA whereas RecJ protein is essential for cell viability and UvrD helicase might be involved in the processing of double stranded DNA ends and/or in the DNA synthesis step of ESDSA. PMID:20090937

  13. A major role of the RecFOR pathway in DNA double-strand-break repair through ESDSA in Deinococcus radiodurans.

    Directory of Open Access Journals (Sweden)

    Esma Bentchikou

    2010-01-01

    Full Text Available In Deinococcus radiodurans, the extreme resistance to DNA-shattering treatments such as ionizing radiation or desiccation is correlated with its ability to reconstruct a functional genome from hundreds of chromosomal fragments. The rapid reconstitution of an intact genome is thought to occur through an extended synthesis-dependent strand annealing process (ESDSA followed by DNA recombination. Here, we investigated the role of key components of the RecF pathway in ESDSA in this organism naturally devoid of RecB and RecC proteins. We demonstrate that inactivation of RecJ exonuclease results in cell lethality, indicating that this protein plays a key role in genome maintenance. Cells devoid of RecF, RecO, or RecR proteins also display greatly impaired growth and an important lethal sectoring as bacteria devoid of RecA protein. Other aspects of the phenotype of recFOR knock-out mutants paralleled that of a DeltarecA mutant: DeltarecFOR mutants are extremely radiosensitive and show a slow assembly of radiation-induced chromosomal fragments, not accompanied by DNA synthesis, and reduced DNA degradation. Cells devoid of RecQ, the major helicase implicated in repair through the RecF pathway in E. coli, are resistant to gamma-irradiation and have a wild-type DNA repair capacity as also shown for cells devoid of the RecD helicase; in contrast, DeltauvrD mutants show a markedly decreased radioresistance, an increased latent period in the kinetics of DNA double-strand-break repair, and a slow rate of fragment assembly correlated with a slow rate of DNA synthesis. Combining RecQ or RecD deficiency with UvrD deficiency did not significantly accentuate the phenotype of DeltauvrD mutants. In conclusion, RecFOR proteins are essential for DNA double-strand-break repair through ESDSA whereas RecJ protein is essential for cell viability and UvrD helicase might be involved in the processing of double stranded DNA ends and/or in the DNA synthesis step of ESDSA.

  14. A model of oncogenic rearrangements: differences between chromosomal translocation mechanisms and simple double-strand break repair

    OpenAIRE

    Weinstock, David M.; Elliott, Beth; Jasin, Maria

    2006-01-01

    Recurrent reciprocal translocations are present in many hematologic and mesenchymal malignancies. Because significant sequence homology is absent from translocation breakpoint junctions, non-homologous end-joining (NHEJ) pathways of DNA repair are presumed to catalyze their formation. We developed translocation reporters for use in mammalian cells from which NHEJ events can be selected after precise chromosomal breakage. Translocations were efficiently recovered with these reporters using mou...

  15. Long-range heterochromatin association is mediated by silencing and double-strand DNA break repair proteins

    OpenAIRE

    Jacob G Kirkland; Kamakaka, Rohinton T.

    2013-01-01

    The eukaryotic genome is highly organized in the nucleus, and this organization affects various nuclear processes. However, the molecular details of higher-order organization of chromatin remain obscure. In the present study, we show that the Saccharomyces cerevisiae silenced loci HML and HMR cluster in three-dimensional space throughout the cell cycle and independently of the telomeres. Long-range HML–HMR interactions require the homologous recombination (HR) repair pathway and phosphorylate...

  16. Post-irradiation chemical processing of DNA damage generates double-strand breaks in cells already engaged in repair

    OpenAIRE

    Satyendra K Singh; Wang, Minli; Staudt, Christian; Iliakis, George

    2011-01-01

    In cells exposed to ionizing radiation (IR), double-strand breaks (DSBs) form within clustered-damage sites from lesions disrupting the DNA sugar–phosphate backbone. It is commonly assumed that these DSBs form promptly and are immediately detected and processed by the cellular DNA damage response (DDR) apparatus. This assumption is questioned by the observation that after irradiation of naked DNA, a fraction of DSBs forms minutes to hours after exposure as a result of temperature dependent, c...

  17. Heavy ion induced DNA strand breaks and their repair in diploid cells of the epithelium of the lens

    International Nuclear Information System (INIS)

    This diploma thesis investigates by means of alkaline unwinding and neutral elution the induction of DNA strand breaks and of rejoining processes as an effect of irradiation with very heavy, accelerated ions. It is found that: The effectiveness of very heavy ions (Z > 18) increases per particle with higher ordinal number, and with increasing velocities. The relative biological effectiveness increases with higher particle masses and lower velocities. The effects of very heavy ions are determined both by the LET and by the particle track extension (specific energy) of the various particles. Heavy ions are much more effective than X-rays with regard to inducing double strand breaks, as compared to DNA single strand breaks induced. Rejoining processes induced by heavy ions have been found to be delayed and incomplete, as compared to the X-ray effects. The number of rejoining processes decreases with rising ordinal number. The experiments indicate that the irradiation with lead or uranium ions most probably makes rejoining impossible. (orig./MG)

  18. Elevated presence of retrotransposons at sites of DNA double strand break repair in mouse models of metabolic oxidative stress and MYC-induced lymphoma

    International Nuclear Information System (INIS)

    The chromosomally integrated shuttle vector pUR288 contains a lacZ reporter gene to study mutagenesis in vivo. We used pUR288 to compare patterns of genomic instability in two mouse models, lymphoma resulting from deregulated c-MYC expression (λ-MYC), and endogenous oxidative stress caused by partial glucose 6-phosphate dehydrogenase (G6PD) deficiency. We found previously that spontaneous mutations in both models were predominantly genomic rearrangements of lacZ with mouse sequences, while most mutations in controls were point mutations. Here, we characterized the fine structure of 68 lacZ/mouse rearrangements from λ-MYC lymphomas and G6PD deficient mice by sequencing breakpoint junctions and determining the origin of recombining mouse sequences. Fifty-eight of 68 (85%) recombination partners were identified. The structure of rearrangements from both λ-MYC and G6PD deficient mice were remarkably alike. Intra-chromosomal deletions and inversions were common, occurring in 41% (24/58) of rearrangements, while 59% (34/58) were random translocations between lacZ and other chromosomes. Signatures of double strand break repair by nonhomologous end joining were observed at breakpoint junctions; 37% (25/68) contained 1-4 bp microhomologies, while the remaining breakpoints had no sequence homology. Long interspersed nuclear element-1 (LINE-1 or L1) retrotransposons, which constitute ∼10% of the mouse genome, were present at 25% (17/68) of breakpoints, suggesting their participation in rearrangements. The similarity in the structure of rearrangements is consistent with the hypothesis that genetic rearrangements in λ-MYC lymphomas and G6PD deficient mice result from the same mechanism, mutagenic repair of DNA double strand breaks arising from oxidative damage

  19. Elevated presence of retrotransposons at sites of DNA double strand break repair in mouse models of metabolic oxidative stress and MYC-induced lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Rockwood, Lynne D.; Felix, Klaus; Janz, Siegfried

    2004-04-14

    The chromosomally integrated shuttle vector pUR288 contains a lacZ reporter gene to study mutagenesis in vivo. We used pUR288 to compare patterns of genomic instability in two mouse models, lymphoma resulting from deregulated c-MYC expression ({lambda}-MYC), and endogenous oxidative stress caused by partial glucose 6-phosphate dehydrogenase (G6PD) deficiency. We found previously that spontaneous mutations in both models were predominantly genomic rearrangements of lacZ with mouse sequences, while most mutations in controls were point mutations. Here, we characterized the fine structure of 68 lacZ/mouse rearrangements from {lambda}-MYC lymphomas and G6PD deficient mice by sequencing breakpoint junctions and determining the origin of recombining mouse sequences. Fifty-eight of 68 (85%) recombination partners were identified. The structure of rearrangements from both {lambda}-MYC and G6PD deficient mice were remarkably alike. Intra-chromosomal deletions and inversions were common, occurring in 41% (24/58) of rearrangements, while 59% (34/58) were random translocations between lacZ and other chromosomes. Signatures of double strand break repair by nonhomologous end joining were observed at breakpoint junctions; 37% (25/68) contained 1-4 bp microhomologies, while the remaining breakpoints had no sequence homology. Long interspersed nuclear element-1 (LINE-1 or L1) retrotransposons, which constitute {approx}10% of the mouse genome, were present at 25% (17/68) of breakpoints, suggesting their participation in rearrangements. The similarity in the structure of rearrangements is consistent with the hypothesis that genetic rearrangements in {lambda}-MYC lymphomas and G6PD deficient mice result from the same mechanism, mutagenic repair of DNA double strand breaks arising from oxidative damage.

  20. Fast repair activities of quercetin and rutin toward dGMP hydroxyl radical adducts

    International Nuclear Information System (INIS)

    The repair activities and mechanisms of both quercetin and rutin towards the oxidizing deoxyguanosine monophosphate (d GMP) hydroxyl radical adduct were investigated with pulse radiolytic technique. On pulse irradiation of nitrous oxide saturated 2 mm d GMP aqueous solution containing 0.1 mm quercetin, the transient absorption spectrum of the d GMP hydroxyl radical adduct decays with the formation of phenoxyl radical of quercetin within tens of microseconds. It indicates that there is a repair reaction between d GMP hydroxyl radical adduct and quercetin. The repair activity of rutin towards hydroxyl radical adducts of d GMP was also observed. The rate constants of the repair reactions were calculated to be 3.05x108 and 1.31x108 M-1 s-1for quercetin and rutin, respectively. This result together with our previous studies demonstrated that non-enzymatic, fast repair is a universal repair mechanism of phenolic antioxidants.

  1. The DNA replication priming protein, PriA, is required for homologous recombination and double-strand break repair.

    OpenAIRE

    Kogoma, T; Cadwell, G W; Barnard, K G; Asai, T

    1996-01-01

    The PriA protein, a component of the phiX174-type primosome, was previously shown to be essential for damage-inducible DNA replication in Escherichia coli, termed inducible stable DNA replication. Here, we show that priA::kan null mutants are defective in transductional and conjugational homologous recombination and are hypersensitive to mitomycin C and gamma rays, which cause double-strand breaks. The introduction of a plasmid carrying the priA300 allele, which encodes a mutant PriA protein ...

  2. Double-Strand Break Repair in Bacteriophage T4: Recombination Effects of 3′–5′ Exonuclease Mutations

    OpenAIRE

    Shcherbakov, Victor P; Kudryashova, E. A.; Shcherbakova, T. S.; Sizova, S. T.; Plugina, L. A.

    2006-01-01

    The role of 3′–5′ exonucleases in double-strand break (DSB)-promoted recombination was studied in crosses of bacteriophage T4, in which DSBs were induced site specifically within the rIIB gene by SegC endonuclease in the DNA of only one of the parents. Frequency of rII+ recombinants was measured in two-factor crosses of the type i × ets1, where ets1 designates an insertion in the rIIB gene carrying the cleavage site for SegC and i's are rIIB or rIIA point mutations located at various distance...

  3. Human RECQ5 helicase promotes repair of DNA double-strand breaks by synthesis-dependent strand annealing

    Czech Academy of Sciences Publication Activity Database

    Paliwal, S.; Kanagaraj, R.; Sturzenegger, A.; Burdová, Kamila; Janščák, Pavel

    2014-01-01

    Roč. 42, č. 4 (2014), s. 2380-2390. ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565; GA ČR GAP305/10/0281 Grant ostatní: Swiss National Science Foundation(CH) 31003A-129747; Swiss National Science Foundation(CH) 31003A_146206 Institutional support: RVO:68378050 Keywords : Human RECQ5 helicase * DNA double-strand breaks * mitotic homologous recombination Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  4. Breaking the Ice: Career Development Activities for Accounting Students

    Science.gov (United States)

    Kilpatrick, Bob G.; Wilburn, Nancy L.

    2010-01-01

    This paper describes two co-curricular career development activities, mock interviews and speed networking that we provide for accounting majors at our university. The driving force behind both activities was to increase comfort levels for students when interacting with professionals and to enhance their job interview and networking skills.…

  5. The human apurinic/apyrimidinic endonuclease-1 suppresses activation of poly(adp-ribose) polymerase-1 induced by DNA single strand breaks

    International Nuclear Information System (INIS)

    DNA single-strand breaks (SSB) activate poly (ADP-ribose) polymerase 1 (PARP1), which then polymerizes ADP-ribosyl groups on various nuclear proteins, consuming cellular energy. Although PARP1 has a role in repairing SSB, activation of PARP1 also causes necrosis and inflammation due to depletion of cellular energy. Here we show that the major mammalian apurinic/apyrimidinic (AP) endonuclease-1 (APE1), an essential DNA repair protein, binds to SSB and suppresses the activation of PARP1. APE1's high affinity for SSB requires Arg177, which is unique in mammalian APEs. PARP1's binding to the cleaved DNA was inhibited, and PARP1 activation was suppressed by the wild-type APE1, but not by the R177A mutant APE1 protein. Cells transiently transfected with the wild-type APE1 decreased the PARP1 activation after H2O2 treatment, while such suppression did not occur with the expression of the R177A APE1 mutant. These results suggest that APE1 suppresses the activation of PARP1 during the repair process of the DNA damage generated by oxidative stress, which may have an important implication for cells to avoid necrosis due to energy depletion

  6. Extraction of Active Enzymes from "Hard-to-Break-Cells"

    DEFF Research Database (Denmark)

    Ottaviani, Alessio; Tesauro, Cinzia; Fjelstrup, S;

    We present the utilization of a rolling circle amplification (RCA) based assay to investigate the extraction efficiency of active enzymes from a class of “hard-to-break” cells, yeast Saccaramyces cerevisiae. Current analyses of microorganisms, such as pathogenic bacteria, parasites or particular...... life stages of microorganisms (e.g. spores from bacteria or fungi) is hampered by the lack of efficient lysis protocols that preserve the activity and integrity of the cellular content. Presented herein is a flexible scheme to screen lysis protocols for active enzyme extraction. We also report a gentle...

  7. Correlation between cell survival and DNA single-strand break repair proficiency in the Chinese hamster ovary cell lines AA8 and EM9 irradiated with 365-nm ultraviolet-A radiation

    International Nuclear Information System (INIS)

    Cell survival parameters and the induction and repair of DNA single-strand breaks were measured in two Chinese hamster ovary cell lines after irradiation with monochromatic UVA radiation of wavelength 365 nm. The radiosensitive mutant cell line EM9 is known to repair ionizing-radiation-induced single-strand breaks (SSB) more slowly than the parent line AA8. EM9 was determined to be 1.7-fold more sensitive to killing by 365-nm radiation than AA8 at the 10% survival level, and EM9 had a smaller shoulder region on the survival curve (α = 1.76) than AA8 (α = 0.62). No significant differences were found between the cell lines in the initial yields of SSB induced either by γ-radiation (as determined by alkaline sucrose gradient sedimentation) or by 365-nm UVA (as determined by alkaline elution). For measurement of initial SSB, cells were irradiated at 0.5oC to minimize DNA repair processes. Rejoining of 365-nm induced SSB was measured by irradiating cells at 0.5oC, allowing them to repair at 37oC in full culture medium, and then quantitating the remaining SSB by alkaline elution. The repair of these breaks followed biphasic kinetics in both cell lines. EM9 repaired the breaks more slowly (T1/2 values of 1.3 and 61.3 min) than did AA8 (T1/2 values of 0.9 and 53.3 min), and EM9 also left more breaks unrepaired 90 min after irradiation (24% vs 8% for AA8). Thus, the sensitivity of EM9 to 365-nm radiation correlated with its deficiency in repairing DNA lesions revealed as SSB in alkaline elution. These results suggest that DNA may be a critical target in 365-nm induced cellular lethality and that the ability of AA8 and EM9 cells to repair DNA strand breaks may be related to their ability to survive 365-nm radiation. (author)

  8. Inhibition of topoisomerase II activity in repair-proficient CHO K1 cells by 2-[(aminopropyl)amino]ethanethiol (WR-1065)

    International Nuclear Information System (INIS)

    The aminothiol 2-[(aminopropyl)amino]ethanethiol (WR-1065) is the active thiol of the clinically studied radioprotective agent S-2-(3-aminopropylamino) ethylphosphorothioic acid (WR-2721). WR-1065 is an effective radiation protector under in vitro conditions when it is administered 30 min prior to radiation exposure at a concentration of 4 mM to repair-proficient Chinese hamster ovary Kl cells (i.e., a dose modification factor of 1.4). In contrast, the DNA double-strand break, repair-deficient Chinese hamster ovary xrs-5 cell line is not protected under these conditions (i.e., a dose modification factor of 1.0). Topoisomerase (topo) I and II activities and protein contents were measured in both Kl and xrs-5 cell lines and were found to be similar in magnitude. Neither exposure to radiation, to WR-1065, or to both affected these variables in xrs-5 cells. WR 1065 was effective, however, in reducing topo 11 activity by a factor of 2 in the repair-proficient Kl cell line. Topo II protein content, however, was not affected by these exposure conditions. One of several mechanisms of radiation protection attributed to aminothiol compounds has been their ability to affect enzymatic reactions involved in DNA synthesis, repair, and cell cycle progression. These results demonstrate a modifying effect by 2-[(aminopropyl)amino]ethanethiol on a specific nuclear enzyme (i.e., type H topoisomerase), which is involved in DNA synthesis. These results also suggest that differences do exist between the topo 11 enzymes isolated from the parent repair-proficient Kl and the DNA double-strand break, repair-deficient xrs-5 mutant cell lines

  9. DNA breaks and repair in interstitial telomere sequences: Influence of chromatin structure; Etude des cassures de l'ADN et des mecanismes de reparation dans les sequences telomeriques interstitielles: Influence de la structure chromatinienne

    Energy Technology Data Exchange (ETDEWEB)

    Revaud, D.

    2009-06-15

    Interstitial Telomeric Sequences (ITS) are over-involved in spontaneous and radiationinduced chromosome aberrations in chinese hamster cells. We have performed a study to investigate the origin of their instability, spontaneously or after low doses irradiation. Our results demonstrate that ITS have a particular chromatin structure: short nucleotide repeat length, less compaction of the 30 nm chromatin fiber, presence of G-quadruplex structures. These features would modulate breaks production and would favour the recruitment of alternative DNA repair mechanisms, which are prone to produce chromosome aberrations. These pathways could be at the origin of chromosome aberrations in ITS whereas NHEJ and HR Double Strand Break repair pathways are rather required for a correct repair in these regions. (author)

  10. Nbs1 ChIP-Seq Identifies Off-Target DNA Double-Strand Breaks Induced by AID in Activated Splenic B Cells.

    Directory of Open Access Journals (Sweden)

    Lyne Khair

    2015-08-01

    Full Text Available Activation-induced cytidine deaminase (AID is required for initiation of Ig class switch recombination (CSR and somatic hypermutation (SHM of antibody genes during immune responses. AID has also been shown to induce chromosomal translocations, mutations, and DNA double-strand breaks (DSBs involving non-Ig genes in activated B cells. To determine what makes a DNA site a target for AID-induced DSBs, we identify off-target DSBs induced by AID by performing chromatin immunoprecipitation (ChIP for Nbs1, a protein that binds DSBs, followed by deep sequencing (ChIP-Seq. We detect and characterize hundreds of off-target AID-dependent DSBs. Two types of tandem repeats are highly enriched within the Nbs1-binding sites: long CA repeats, which can form Z-DNA, and tandem pentamers containing the AID target hotspot WGCW. These tandem repeats are not nearly as enriched at AID-independent DSBs, which we also identified. Msh2, a component of the mismatch repair pathway and important for genome stability, increases off-target DSBs, similar to its effect on Ig switch region DSBs, which are required intermediates during CSR. Most of the off-target DSBs are two-ended, consistent with generation during G1 phase, similar to DSBs in Ig switch regions. However, a minority are one-ended, presumably due to conversion of single-strand breaks to DSBs during replication. One-ended DSBs are repaired by processes involving homologous recombination, including break-induced replication repair, which can lead to genome instability. Off-target DSBs, especially those present during S phase, can lead to chromosomal translocations, deletions and gene amplifications, resulting in the high frequency of B cell lymphomas derived from cells that express or have expressed AID.

  11. Variability in AIRS CO2 during active and break phases of Indian summer monsoon.

    Science.gov (United States)

    Revadekar, J V; Ravi Kumar, K; Tiwari, Yogesh K; Valsala, Vinu

    2016-01-15

    Due to human activities, the atmospheric concentration of Carbon Dioxide (CO2) has been rising extensively since the Industrial Revolution. Indian summer monsoon (ISM) has a dominant westerly component from ocean to land with a strong tendency to ascend and hence may have role in CO2 distribution in lower and middle troposphere over Indian sub-continent. A substantial component of ISM variability arises from the fluctuations on the intra-seasonal scale between active and break phases which correspond to strong and weak monsoon circulation. In view of the above, an attempt is made in this study to examine the AIRS/AQUA satellite retrieved CO2 distribution in response to atmospheric circulation with focus on active and break phase. Correlation analysis indicates the increase in AIRS CO2 linked with strong monsoon circulation. Study also reveals that anomalous circulation pattern during active and break phase show resemblance with high and low values of AIRS CO2. Homogeneous monsoon regions of India show substantial increase in CO2 levels during active phase. Hilly regions of India show strong contrast in CO2 and vertical velocity during active and break phases. PMID:26476061

  12. Record-breaking Storm Activity on Uranus in 2014

    OpenAIRE

    De Pater, Imke; Sromovsky, L. A.; Fry, P. M.; Hammel, Heidi B.; Baranec, Christoph; Sayanagi, Kunio

    2015-01-01

    In spite of an expected decline in convective activity following the 2007 equinox of Uranus, eight sizable storms were detected on the planet with the near-infrared camera NIRC2, coupled to the adaptive optics system, on the 10-m W. M. Keck telescope on UT 5 and 6 August 2014. All storms were on Uranus's northern hemisphere, including the brightest storm ever seen in this planet at 2.2 $\\mu$m, reflecting 30% as much light as the rest of the planet at this wavelength. The storm was at a planet...

  13. Individual repair of radiation-induced DNA double-strand breaks in lymphocytes. Implications for radiation-induced dermatitis in breast cancer

    International Nuclear Information System (INIS)

    Purpose: Adjuvant 'whole breast radiotherapy' (WBRT) is the standard of care after breast conserving surgery in women with breast cancer. Throughout different cancer stages the addition of WBRT leads to significantly improved rates of freedom from local failure and overall survival. WBRT is generally well tolerated. A 5-10%-rate of severe acute or long-term side effects is commonly observed. For both radiation-mediated tumor-cell-elimination and induction of side effects, DNA-double-strand-breaks (DSB) presumably play the decisive role. The intensity of normal tissue reactions in radiotherapy can, in part, be attributed to the intrinsic DSB repair-capacity. In this study in vivo and in vitro experiments are carried through in order to assess DSB repair-kinetics in blood lymphocytes of women with breast cancer. These findings are to be correlated with the degree of radiation-induced normal tissue toxicity. Patients and Methods: Eighteen patients with breast cancer, in whom WBRT was indicated, were examined. A total WBRT dose of 50 Gy (single dose 2 Gy) with an additional boost-radiotherapy to the initial tumor-region to a total dose of 60-66 Gy was administered. DSB repair was determined by means of counting γ-H2AX foci in blood lymphocytes at predefined points in time, i.e. before and 0.5 h; 2.5 h; 5 h and 24 h after in vivo irradiation (1st fraction of WBRT) and before and 0.5 h; 2.5 h and 5 h after in vitro irradiation with increasing radiation doses in the range of 10 - 500 mGy. Acute normal tissue toxicity was scored on the basis of a modified RTOG-classification (main aspects were erythema and dry or moist skin desquamation). Results: DSB repair-halflife-times did not differ between patients with a higher or lower than average incidence of acute side effects. In patients with 'above average' side effects larger irradiation volumes were treated (volume surrounded by the 50%-isodose). Adjusted for these, no single patients showed elevated residual γ-H2AX foci

  14. RNA polymerase II transcription inhibits DNA repair by photolyase in the transcribed strand of active yeast genes.

    OpenAIRE

    Livingstone-Zatchej, M; Meier, A; Suter, B.; Thoma, F

    1997-01-01

    Yeast uses nucleotide excision repair (NER) and photolyase (photoreactivation) to repair cyclobutane pyrimidine dimers (CPDs) generated by ultraviolet light. In active genes, NER preferentially repairs the transcribed strand (TS). In contrast, we recently showed that photolyase preferentially repairs the non-transcribed strands (NTS) of the URA3 and HIS3 genes in minichromosomes. To test whether photoreactivation depends on transcription, repair of CPDs was investigated in the transcriptional...

  15. Observed changes in the characteristics of Active and Break Spells in the Indian Summer Monsoon

    Science.gov (United States)

    Singh, D.; Tsiang, M.; Rajaratnam, B.; Diffenbaugh, N. S.

    2013-12-01

    South Asia is home to about 24% of the world's population and is one of the world's most disaster prone regions. The majority of the people in this region depend on agriculture for their livelihood. Substantial variability in the South Asian Summer Monsoon occurs on an intraseasonal timescale (30-60 day) during which it fluctuates between spells of heavy (active spells) and low rainfall (breaks or weak spells). Considering the potentially severe implications of such rainfall variations, we quantify historical changes in the active and break spell characteristics in an effort to understand how these events are likely to respond to future anthropogenic forcings using the 1degx1deg gridded rainfall dataset. We find a decreasing trend in peak season rainfall since 1951 and a statistically significant shift in the rainfall distribution, suggesting greater extremes. Consequently, our results suggest an intensification of the active spells and more frequent occurrence of break spells at the 95% significance level. To understand the cause of these changes, we explore the environmental parameters in the North Indian Ocean and the Western Pacific that influence the occurrence of such events over the core monsoon region. We use the NCEP/NCAR Reanalysis 1 (1948-present) to do a composite analysis for two periods - 1951-1980 and 1981-2011. First, we examine the energetics of the baroclinic instabilities that initiate cyclonic depressions in the northern Bay of Bengal and the net moisture flux into the region. Further, sea surface temperatures are known to influence the characteristics of active and break spells. Therefore, next, we study sea surface temperature patterns in the Bay of Bengal and the equatorial western Pacific preceding breaks. We also examine the persistence of breaks through the diabatic heating anomalies over this region.

  16. In normal human fibroblasts variation in DSB repair capacity cannot be ascribed to radiation-induced changes in the localisation, expression or activity of major NHEJ proteins

    DEFF Research Database (Denmark)

    Kasten-Pisula, Ulla; Vronskaja, Svetlana; Overgaard, Jens; Dikomey, Ekkehard

    2008-01-01

    . MATERIALS AND METHODS: Experiments were performed with 11 normal human fibroblast strains AF01-11. NHEJ proteins were determined by Western blot and DNA-PK activity by pulldown-assay. RESULTS: The four NHEJ proteins tested (Ku70, Ku80, XRCC4 and DNA-PKcs) were found to be localised almost exclusively in the...... the activity of the DNA-PK complex induced upon irradiation. CONCLUSIONS: For normal human fibroblasts, the level or activity of NHEJ proteins measured prior to or after irradiation cannot be used to predict the DSB repair capacity or cellular radiosensitivity. Udgivelsesdato: 2008-Mar......BACKGROUND AND PURPOSE: The aim of the present study was to test whether for normal human fibroblasts the variation in double-strand break (DSB) repair capacity results from radiation-induced differences in localisation, expression or activity of major non-homologous end-joining (NHEJ) proteins...

  17. Record-breaking Storm Activity on Uranus in 2014

    CERN Document Server

    de Pater, Imke; Fry, P M; Hammel, Heidi B; Baranec, Christoph; Sayanagi, Kunio

    2015-01-01

    In spite of an expected decline in convective activity following the 2007 equinox of Uranus, eight sizable storms were detected on the planet with the near-infrared camera NIRC2, coupled to the adaptive optics system, on the 10-m W. M. Keck telescope on UT 5 and 6 August 2014. All storms were on Uranus's northern hemisphere, including the brightest storm ever seen in this planet at 2.2 $\\mu$m, reflecting 30% as much light as the rest of the planet at this wavelength. The storm was at a planetocentric latitude of $\\sim$15$^{\\circ}$N and reached altitudes of $\\sim$330 mbar, well above the regular uppermost cloud layer (methane-ice) in the atmosphere. A cloud feature at a latitude of 32$^{\\circ}$N, that was deeper in the atmosphere (near $\\sim$2 bar), was later seen by amateur astronomers. We also present images returned from our HST ToO program, that shows both of these cloud features. We further report the first detection of a long-awaited haze over the north polar region.

  18. Repair of x-ray-induced DNA double-strand breaks in specific Not I restriction fragments in human fibroblasts: joining of correct and incorrect ends

    Science.gov (United States)

    Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1995-01-01

    An assay that allows measurement of absolute induction frequencies for DNA double-strand breaks (dsbs) in defined regions of the genome and that quantitates rejoining of correct DNA ends has been used to study repair of dsbs in normal human fibroblasts after x-irradiation. The approach involves hybridization of single-copy DNA probes to Not I restriction fragments separated according to size by pulsed-field gel electrophoresis. Induction of dsbs is quantitated from the decrease in the intensity of the hybridizing restriction fragment and an accumulation of a smear below the band. Rejoining of dsbs results in reconstitution of the intact restriction fragment only if correct DNA ends are joined. By comparing results from this technique with results from a conventional electrophoresis assay that detects all rejoining events, it is possible to quantitate the misrejoining frequency. Three Not I fragments on the long arm of chromosome 21 were investigated with regard to dsb induction, yielding an identical induction rate of 5.8 X 10(-3) break per megabase pair per Gy. Correct dsb rejoining was measured for two of these Not I fragments after initial doses of 80 and 160 Gy. The misrejoining frequency was about 25% for both fragments and was independent of dose. This result appears to be representative for the whole genome as shown by analysis of the entire Not I fragment distribution. The correct rejoining events primarily occurred within the first 2 h, while the misrejoining kinetics included a much slower component, with about half of the events occurring between 2 and 24 h. These misrejoining kinetics are similar to those previously reported for production of exchange aberrations in interphase chromosomes.

  19. Children's Physical Activity Levels during Primary School Break Times: A Quantitative and Qualitative Research Design

    Science.gov (United States)

    Powell, Emma; Woodfield, Lorayne A.; Nevill, Alan A. M.

    2016-01-01

    The overall aim of this study was to assess the diversity of primary school children's physical activity (PA) during outdoor recess. The study was grounded in a mixed method approach, assisting in the identification of multifaceted predictors of children's PA, including insights to social behaviours during break time. Data were obtained from…

  20. DNA 双链断裂损伤修复的随机模型研究%A Stochastic Model on DNA Double Strand Breaks Repair

    Institute of Scientific and Technical Information of China (English)

    孙廷哲; 崔隽

    2015-01-01

    DNA double strand breaks (DSBs)pose serious threat to life.Efficient repair of DSBs is cru-cial for maintaining genomic integrity.Dynamic investigations of DSB repair have received intensive at-tention.However,previous models do not take into account the relation between extrinsic and intrinsic DNA damage.Therefore,a refined Monte Carlo model was constructed by considering spontaneous DNA damage and setting a threshold for cell cycle reentry.The refined model can better describe the dynamic DSB repair under stressed conditions.Extrinsic DSBs induced by irradiation were first fixed.When the level of damage falls below the threshold,intrinsic DNA damage will then emerge and both the extrinsic and intrinsic DSBs will possibly be simultaneously repaired during a specific period.The current model integrates both extrinsic and intrinsic DNA damage and sets a fertile ground for other models with DNA damage repair process.%DNA 双链断裂是一种非常严重的 DNA 损伤。对 DNA 双链断裂有效的修复对于维持基因组的稳定至关重要。对 DNA 双链断裂修复的动力学研究一直得到了广泛的关注。然而,以往的模型研究都没有充分考虑外源性和内源性 DNA 损伤修复之间的关联。因此,通过在细胞周期重启后引入自发生成的随机 DNA 双键断裂损伤,并设定触发细胞周期阻滞的阈值,一个精细化的 Monte Carlo 模型被构建并可以更好的模拟受迫状态下的损伤修复过程。细胞首先修复辐射刺激造成的 DNA 损伤,接着在总损伤水平低于特定阈值后产生内源性的 DNA 损伤并可能在某特定时间段内对两种来源损伤同时进行修复。本模型综合考虑了外源性和内源性 DNA 损伤修复的整合效应,为其它涵盖 DNA 损伤修复模块的模型研究提供了基础。

  1. A cell-cycle-stage-related chromosomal X-ray hypersensitivity in larval neuroblasts of Drosophila mei-9 and mei 41 mutants suggesting defective DNA double-strand break repair

    International Nuclear Information System (INIS)

    The authors have examined the chromosomal X-ray hypersensitivity in relation to the cell cycle in larval neuroblasts of the mutagen-sensitive and excision repair-defective mutant mei-9 and of the mutagen-sensitive and post-replication repair-defective mutant mei-41 of Drosophila melanogaster. When compared to wild-type cells, cells bearing the mei-9L1 allele produced unusually high levels in particular of chromatid deletions and to a lesser extent also of isochromatid deletions, but virtually no exchange aberrations. The chromosomal hypersensitivity is apparent at M1 when cells are irradiated in S or G2 but not when irradiated in G1. On the other hand, following irradiation cells bearing the mei-41D5 allele predominantly produce chromosome deletions. The phases of major sensitivity are the S and G1. Mei-9 and mei-41 mutants have been classified to date as proficient in DNA double-strand break repair. The data presented in this paper revealed an S-independent clastogenic hypersensitivity of mei-9 and mei-41 cells. They are interpreted as indicative evidence for the presence of impaired DNA double-strand break repair. The cell-cycle-related difference in the ratio of chromatid- versus chromosome-type deletions in both mutants suggests repair defects at partially different phases of the cell cycle in mei-9 and mei-41 mutant cells. (author). 47 refs.; 2 figs.; 5 tabs

  2. Aero Repair and Overhaul Services at Rolls Royce Group Plc: Application of Activity Based Costing

    OpenAIRE

    Vaithiyanathan, Shivany

    2005-01-01

    In this report an analysis has been carried out to study the application of Activity Based Costing (ABC) to the proposed repair and overhaul process at Rolls Royce Group Plc after the implementation of the aftermarket business policies.

  3. High Concentrations of Organic Contaminants in Air from Ship Breaking Activities in Chittagong, Bangladesh.

    Science.gov (United States)

    Nøst, Therese H; Halse, Anne K; Randall, Scott; Borgen, Anders R; Schlabach, Martin; Paul, Alak; Rahman, Atiqur; Breivik, Knut

    2015-10-01

    The beaches on the coast of Chittagong in Bangladesh are one of the most intense ship breaking areas in the world. The aim of the study was to measure the concentrations of organic contaminants in the air in the city of Chittagong, including the surrounding ship breaking areas using passive air samplers (N = 25). The compounds detected in the highest amounts were the polycyclic aromatic hydrocarbons (PAHs) and short-chain chlorinated paraffins (SCCPs), whereas dichlorodiphenyltrichloroethanes (DDTs), hexachlorobenzene (HCB), and polychlorinated biphenyls (PCBs) were several orders of magnitude lower in comparison. PCBs, PAHs, and HCB were highest at sites near the ship breaking activities, whereas DDTs and SCCPs were higher in the urban areas. Ship breaking activities likely act as atmospheric emission sources of PCBs, PAHs, and HCB, thus adding to the international emphasis on responsible recycling of ships. Concentrations of PAHs, PCBs, DDTs, HCB, and SCCPs in ambient air in Chittagong are high in comparison to those found in similar studies performed in other parts of Asia. Estimated toxic equivalent quotients indicate elevated human health risks caused by inhalation of PAHs at most sites. PMID:26351879

  4. An ocean-atmosphere interaction mechanism for the active break cycle of the Asian summer monsoon

    Energy Technology Data Exchange (ETDEWEB)

    Joseph, P.V.; Sabin, T.P. [Cochin University of Science and Technology, Department of Atmospheric Sciences, Cochin (India)

    2008-05-15

    A typical active-break cycle of the Asian summer monsoon is taken as beginning with maximum SST (pentad 0) over the north Bay of Bengal when the oceans to its west and east from longitude 40 -160 E, and between latitudes 10 and 25 N (area A) also has maximum SST. During this pentad the recently found 'Cold Pool' of the Bay of Bengal (between latitudes 3 N and 10 N) has its minimum SST. An area of convection takes genesis over the Bay of Bengal immediately after pentad 0 in the zone of large SST gradient north of the Cold Pool and it pulls the monsoon Low Level Jetstream (LLJ) through peninsular India. Convection and the LLJ westerlies then spread to the western Pacific Ocean during pentads 1-4 taken as the active phase of the monsoon during which convection and LLJ have grown in a positive feed back process. The cyclonic vorticity to the north of the LLJ axis is hypothesized to act as a flywheel maintaining the convection during the long active phase against the dissipating effect of atmospheric stabilization by each short spell of deep convection. By the end of pentad 4 the SST over area A has cooled and the convection weakens there, when the LLJ turns clockwise over the Arabian Sea and flows close to the equator in the Indian ocean. A band of convection develops at pentad 5 between the equator and latitude 10 S over the Indian ocean and it is nourished by the cyclonic vorticity of the LLJ now near the equator and the moisture supply through it. This is taken as the break monsoon phase lasting for about three to four pentads beginning from pentad 5 of a composite active-break cycle of 40 day duration. With reduced wind and convection over the area A during the break phase, solar radiation and light winds make the SST there warm rapidly and a new active-break cycle begins. SST, convection, LLJ and the net heat flux at the ocean surface have important roles in this new way of looking at the active-break cycle as a coupled ocean-atmosphere phenomenon. (orig.)

  5. Collision of Trapped Topoisomerase 2 with Transcription and Replication: Generation and Repair of DNA Double-Strand Breaks with 5′ Adducts

    OpenAIRE

    Hong Yan; Margaret Tammaro; Shuren Liao

    2016-01-01

    Topoisomerase 2 (Top2) is an essential enzyme responsible for manipulating DNA topology during replication, transcription, chromosome organization and chromosome segregation. It acts by nicking both strands of DNA and then passes another DNA molecule through the break. The 5′ end of each nick is covalently linked to the tyrosine in the active center of each of the two subunits of Top2 (Top2cc). In this configuration, the two sides of the nicked DNA are held together by the strong protein-prot...

  6. Coordinated sensing and active repair for self-healing

    International Nuclear Information System (INIS)

    Self-repairing structural systems have the potential for improved performance ranges and lifetimes over conventional systems. Self-healing materials are not a new phenomenon and have been used in automotive and aeronautical applications for over a century. The bulk of these systems operate by using damage to directly initiate a repair response without any supervisory coordination. Integrating sensing and supervisory control technologies with self-healing may improve the safety and reliability of critical components and structures. This project illustrates the benefit of an integrated sensing, control, and self-healing system using laboratory scale test beds. A thermoplastic polymer embedded with resistive heating wires acts as the self-healing material. Damage is detected using an electro-optical sensing scheme based on photoresistors and a PC handling control duties. As damage occurs it is detected, located, and characterized. The key to this project is the integration of sensor feedback to control healing so that repairs are executed, monitored, and completed on the basis of continuous sensor data. This proof-of-concept prototype can likely be expanded and improved with alternative sensor options, self-healing materials, and system architecture

  7. Laser-activated protein solder for peripheral nerve repair

    Science.gov (United States)

    Trickett, Rodney I.; Lauto, Antonio; Dawes, Judith M.; Owen, Earl R.

    1995-05-01

    A 100 micrometers core optical fiber-coupled 75 mW diode laser operating at a wavelength of 800 nm has been used in conjunction with a protein solder to stripe weld severed rat tibial nerves, reducing the long operating time required for microsurgical nerve repair. Welding is produced by selective laser denaturation of the albumin based solder which contains the dye indocyanine green. Operating time for laser soldering was 10 +/- 5 min. (n equals 20) compared to 23 +/- 9 min. (n equals 10) for microsuturing. The laser solder technique resulted in patent welds with a tensile strength of 15 +/- 5 g, while microsutured nerves had a tensile strength of 40 +/- 10 g. Histopathology of the laser soldered nerves, conducted immediately after surgery, displayed solder adhesion to the outer membrane with minimal damage to the inner axons of the nerves. An in vivo study is under way comparing laser solder repaired tibial nerves to conventional microsuture repair. At the time of submission 15 laser soldered nerves and 7 sutured nerves were characterized at 3 months and showed successful regeneration with compound muscle action potentials of 27 +/- 8 mV and 29 +/- 8 mW respectively. A faster, less damaging and long lasting laser based anastomotic technique is presented.

  8. Coordinated sensing and active repair for self-healing

    Science.gov (United States)

    Hurley, D. A.; Huston, D. R.

    2011-02-01

    Self-repairing structural systems have the potential for improved performance ranges and lifetimes over conventional systems. Self-healing materials are not a new phenomenon and have been used in automotive and aeronautical applications for over a century. The bulk of these systems operate by using damage to directly initiate a repair response without any supervisory coordination. Integrating sensing and supervisory control technologies with self-healing may improve the safety and reliability of critical components and structures. This project illustrates the benefit of an integrated sensing, control, and self-healing system using laboratory scale test beds. A thermoplastic polymer embedded with resistive heating wires acts as the self-healing material. Damage is detected using an electro-optical sensing scheme based on photoresistors and a PC handling control duties. As damage occurs it is detected, located, and characterized. The key to this project is the integration of sensor feedback to control healing so that repairs are executed, monitored, and completed on the basis of continuous sensor data. This proof-of-concept prototype can likely be expanded and improved with alternative sensor options, self-healing materials, and system architecture.

  9. Poly(ADP-ribose) polymerase 1 regulates activity of DNA polymerase {beta} in long patch base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Sukhanova, Maria; Khodyreva, Svetlana [Institute of Chemical Biology and Fundamental Medicine SB RAS, Novosibirsk (Russian Federation); Lavrik, Olga, E-mail: lavrik@niboch.nsc.ru [Institute of Chemical Biology and Fundamental Medicine SB RAS, Novosibirsk (Russian Federation)

    2010-03-01

    Poly(ADP-ribose)polymerase 1 (PARP1), functioning as DNA nick-sensor, interacts with base excision repair (BER) DNA intermediates containing single-strand breaks. When bound to DNA breaks, PARP1 catalyzes synthesis of poly(ADP-ribose) covalently attached to itself and some nuclear proteins. Autopoly(ADP-ribosyl)ation of PARP1 facilitates its dissociation from DNA breaks and is considered as a factor regulating DNA repair. In the study, using system reconstituted from purified BER proteins, bovine testis nuclear extract and model BER DNA intermediates, we examined the influence of PARP1 and its autopoly(ADP-ribosyl)ation on DNA polymerase {beta} (Pol {beta})-mediated long patch (LP) BER DNA synthesis that is accomplished through a cooperation between Pol {beta} and apurinic/apyrimidinic endonuclease1 (APE1) or flap endonuclease 1 (FEN1) and gap-filling activity of Pol {beta}. PARP1 upon interaction with nicked LP BER DNA intermediated, formed after gap-filling, was shown to suppress the subsequent steps in LP pathway. PARP1 interferes with APE1-dependent stimulation of DNA synthesis by Pol {beta} via strand-displacement mechanism. PARP1 also represses Pol {beta}/FEN1-mediated LP BER DNA synthesis via a 'gap translation' mechanism inhibiting FEN1 activity on the nicked DNA intermediate. Poly(ADP-ribosyl)ation of PARP1 abolishes its inhibitory influence on LP BER DNA synthesis catalyzed by Pol {beta} both via APE1-mediated strand-displacement and FEN1-mediated 'gap translation' mechanism. Thus PARP1 may act as a negative regulator of Pol {beta} activity in LP BER pathway and poly(ADP-ribosyl)ation of PARP1 seems to play a critical role in enablement of Pol {beta}-mediated DNA synthesis in this process. In contrast, interaction of PARP1 with one nucleotide gapped DNA mimicking the intermediate of short patch (SP) BER slightly inhibits the gap-filling activity of Pol {beta} and the overall efficiency of SP BER is practically unaffected by PARP1. Thus

  10. Poly(ADP-ribose) polymerase 1 regulates activity of DNA polymerase β in long patch base excision repair

    International Nuclear Information System (INIS)

    Poly(ADP-ribose)polymerase 1 (PARP1), functioning as DNA nick-sensor, interacts with base excision repair (BER) DNA intermediates containing single-strand breaks. When bound to DNA breaks, PARP1 catalyzes synthesis of poly(ADP-ribose) covalently attached to itself and some nuclear proteins. Autopoly(ADP-ribosyl)ation of PARP1 facilitates its dissociation from DNA breaks and is considered as a factor regulating DNA repair. In the study, using system reconstituted from purified BER proteins, bovine testis nuclear extract and model BER DNA intermediates, we examined the influence of PARP1 and its autopoly(ADP-ribosyl)ation on DNA polymerase β (Pol β)-mediated long patch (LP) BER DNA synthesis that is accomplished through a cooperation between Pol β and apurinic/apyrimidinic endonuclease1 (APE1) or flap endonuclease 1 (FEN1) and gap-filling activity of Pol β. PARP1 upon interaction with nicked LP BER DNA intermediated, formed after gap-filling, was shown to suppress the subsequent steps in LP pathway. PARP1 interferes with APE1-dependent stimulation of DNA synthesis by Pol β via strand-displacement mechanism. PARP1 also represses Pol β/FEN1-mediated LP BER DNA synthesis via a 'gap translation' mechanism inhibiting FEN1 activity on the nicked DNA intermediate. Poly(ADP-ribosyl)ation of PARP1 abolishes its inhibitory influence on LP BER DNA synthesis catalyzed by Pol β both via APE1-mediated strand-displacement and FEN1-mediated 'gap translation' mechanism. Thus PARP1 may act as a negative regulator of Pol β activity in LP BER pathway and poly(ADP-ribosyl)ation of PARP1 seems to play a critical role in enablement of Pol β-mediated DNA synthesis in this process. In contrast, interaction of PARP1 with one nucleotide gapped DNA mimicking the intermediate of short patch (SP) BER slightly inhibits the gap-filling activity of Pol β and the overall efficiency of SP BER is practically unaffected by PARP1. Thus, PARP1 differentially influences DNA synthesis in SP- and

  11. Outcome of early active mobilization after flexor tendons repair in zones II–V in hand

    OpenAIRE

    Saini Narender; Kundnani Vishal; Patni Purnima; Gupta S

    2010-01-01

    Background: The functional outcome of a flexor tendon injury after repair depends on multiple factors. The postoperative management of tendon injuries has paved a sea through many mobilization protocols. The improved understanding of splinting techniques has promoted the understanding and implication of these mobilization protocols. We conducted a study to observe and record the results of early active mobilization of repaired flexor tendons in zones II-V. Materials and Methods: 25 cases w...

  12. Extravehicular Activity Probabilistic Risk Assessment Overview for Thermal Protection System Repair on the Hubble Space Telescope Servicing Mission

    Science.gov (United States)

    Bigler, Mark; Canga, Michael A.; Duncan, Gary

    2010-01-01

    The Shuttle Program initiated an Extravehicular Activity (EVA) Probabilistic Risk Assessment (PRA) to assess the risks associated with performing a Shuttle Thermal Protection System (TPS) repair during the Space Transportation System (STS)-125 Hubble repair mission as part of risk trades between TPS repair and crew rescue.

  13. Suppression of Atlantic Tropical Cyclone Activity by Extratropical Rossby Wave Breaking

    Science.gov (United States)

    Zhang, G.; Wang, Z.

    2014-12-01

    With warm SST anomalies in the tropical Atlantic and cold SST anomalies in the East Pacific, the reduced Atlantic tropical cyclone activity from August to early September in 2013 was a surprise to the hurricane community. Our analyses suggest that the suppressed storm activity can be attributed to the frequent occurrence of dry air in the middle to upper troposphere along with strong vertical wind shear. Such unfavorable conditions are directly related to the equatorward propagation and breaking of midlatitude Rossby waves, which lead to the equatorward intrusions of cold and dry extratropical air. Further examination suggests the active anti-cyclonic Rossby wave breaking and frequent equatorward intrusions of extratropical air in August 2013 were associated with changes of the midlatitude jet stream (i.e., acceleration, eastward extension and greater strain rate). The EOF analysis of 200-hPa zonal wind identifies a recurrent mode of interannual variability over Atlantic, which is associated with the variations of the intensity and zonal extent of the mid-latitude jet. This mode is found significantly correlated to Atlantic hurricane frequency in August, with a coefficient higher than the Nino3.4 index and comparable to the (relative) SST of Major Development Region (MDR). Our analyses thus emphasize the extratropical impacts on Atlantic tropical cyclones via the Rossby wave breaking. This physical link is missing in most statistical and hybrid forecast schemes and may help explain the seasonal prediction bust in 2013.

  14. A uv-sensitive Chinese hamster lung fibroblast cell line (V79/UC) with a possible defect in DNA polymerase activity is deficient in DNA repair

    International Nuclear Information System (INIS)

    Studies of repair enzyme activities in a uv-sensitive cell line (V79/UC) derived from Chinese hamster V79 cells have revealed levels of total DNA polymerase that are about 50% of the levels in the parental cell line. There are a number of DNA polymerase inhibitors available which allow us to distinguish between the major forms of DNA polymerase (alpha, beta, gamma, and delta) identified in mammalian cells. Enzyme assays with these inhibitors indicate that the aphidicolin-sensitive DNA polymerase is defective in the V79/UC cell line. This could be either polymerase alpha or delta, or both. The V79/UC cells do not express resistance to aphidicolin in standard toxicity studies. However, when aphidicolin is added postirradiation in survival assays designed to measure the extent of inhibitable repair, V79/UC cells do not respond with the further decrease in survival seen in the parental line. Further evidence of a polymerase-dependent repair defect is evident from alkaline elution data. In this case the V79/UC cells show the appearance of single-strand breaks following uv irradiation in the absence of any added inhibitor. Cells of the V79/M12G parental line, on the other hand, show the appearance of single-strand breaks only when aphidicolin is present

  15. Laser-activated protein bands for peripheral nerve repair

    Science.gov (United States)

    Lauto, Antonio; Trickett, Rodney I.; Malik, Richard; Dawes, Judith M.; Owen, Earl R.

    1996-01-01

    A 100 micrometer core optical fiber-coupled 75 mW diode laser operating at a wavelength of 800 nm has been used in conjunction with a protein solder to stripe weld severed rat tibial nerves, reducing the long operating time required for microsurgical nerve repair. Welding is produced by selective laser denaturation of the protein based solder which contains the dye indocyanine green. Operating time for laser soldering was 10 plus or minus 5 min. (n equals 24) compared to 23 plus or minus 9 min (n equals 13) for microsuturing. The laser solder technique resulted in patent welds with a tensile strength of 15 plus or minus 5 g, while microsutured nerves had a tensile strength of 40 plus or minus 10 g. Histopathology of the laser soldered nerves, conducted immediately after surgery, displayed solder adhesion to the outer membrane with minimal damage to the inner axons of the nerves. An in vivo study, with a total of fifty-seven adult male wistar rats, compared laser solder repaired tibial nerves to conventional microsuture repair. Twenty-four laser soldered nerves and thirteen sutured nerves were characterized at three months and showed successful regeneration with average compound muscle action potentials (CMAP) of 2.4 plus or minus 0.7 mV and 2.7 plus or minus 0.8 mV respectively. Histopathology of the in vivo study, confirmed the comparable regeneration of axons in laser and suture operated nerves. A faster, less damaging and long lasting laser based anastomotic technique is presented.

  16. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions

    DEFF Research Database (Denmark)

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela;

    2016-01-01

    , repetitive sequences flanking the CHloci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks...

  17. Cloud properties during active and break spells of the West African summer monsoon from CloudSat-CALIPSO measurements

    Science.gov (United States)

    Efon, E.; Lenouo, A.; Monkam, D.; Manatsa, D.

    2016-07-01

    High resolution of daily rainfall dataset from the Tropical Rainfall Measuring Mission (TRMM) was used to identify active and break cloud formation periods. The clouds were characterized based on CloudSat-CALIPSO satellite images over West Africa during the summer monsoon during the period 2006-2010. The active and break periods are defined as the periods during the peak monsoon months of June to August when the normalized anomaly of rainfall over the monsoon core zone is greater than 0.9 or less than -0.9 respectively, provided the criteria is satisfied for at least three consecutive days. It is found that about 90% of the break period and 66.7% of the active spells lasted 3-4 days. Active spells lasting duration of about a week were observed while no break spell had such a long span. Cloud macrophysical (cloud base height (CBH), cloud top height (CTH) and cloud geometric depth (∆H), microphysical (cloud liquid water content, (LWC), liquid number concentration (LNC), liquid effective radius, ice water content (IWC), ice number concentration (INC) and ice effective radius) and radiative (heating rate properties) over South Central West Africa (5-15°N; 15°W-10°E) during the active and break spells were also analyzed. High-level clouds are more predominant during the break periods compared to the active periods. Active spells have lower INC compared to the break spells. Liquid water clouds are observed to have more radiative forcing during the active than break periods while ice phase clouds bring more cooling effect during the break spells compared to the active spells.

  18. Repair of γ-irradiation-induced DNA single-strand breaks in human bone marrow cells. Analysis of unfractionated and CD34+ cells using single-cell gel electrophoresis

    International Nuclear Information System (INIS)

    Human bone marrow mononuclear cells (BMMNCs) were separated by density gradient centrifugation, and a subpopulation of progenitor cells was further isolated using anti-CD34-coated magnetic beads. The cells were irradiated with γ-rays (0.93-5.43 Gy) from a 137Cs source. The extent of DNA damage, i.e., single-strand breaks (SSBs) and alkali-labile lesions of individual cells, was investigated using the alkaline single-cell gel electrophoresis technique. The irradiation resulted in a dose-dependent increase in DNA migration, reflecting the number of detectable DNA lesions. An approximately similar extent of SSB formation was observed in BMMNCs and CD34+ cells. Damage was repaired when the cells were incubated at 37C: a fast initial repair phase was followed by a slower rejoining of SSBs in both BMMNC and CD34+ cell populations. A significantly longer time was required to repair the lesions caused by 5.43 Gy than those caused by 0.93 Gy. In the present work we report, for the first time, the induction and repair of DNA SSBs at the level of single human bone marrow cells when exposed to ionizing radiation at clinically relevant doses. These data, together with our previous results with human blood granulocytes and lymphocytes, indicate an approximately similar extent of formation and repair of γ-irradiation-induced DNA SSBs in immature and mature human hematopoietic cells

  19. Silibinin enhances the repair of ultraviolet B-induced DNA damage by activating p53-dependent nucleotide excision repair mechanism in human dermal fibroblasts.

    Science.gov (United States)

    Guillermo-Lagae, Ruth; Deep, Gagan; Ting, Harold; Agarwal, Chapla; Agarwal, Rajesh

    2015-11-24

    Ultraviolet radiation B (UVB) is the main cause of DNA damage in epidermal cells; and if not repaired, this DNA damage leads to skin cancer. In earlier studies, we have reported that natural flavonolignan silibinin exerts strong chemopreventive efficacy against UVB-induced skin damage and carcinogenesis; however mechanistic studies are still being actively pursued. Here, we investigated the role of nucleotide excision repair (NER) pathway in silibinin's efficacy to repair UVB-induced DNA damage. Normal human dermal fibroblasts (NHDFs) were exposed to UVB (1 mJ/cm2) with pre- or post- silibinin (100 μM) treatment, and cyclobutane pyrimidine dimers (CPDs) formation/repair was measured. Results showed that post-UVB silibinin treatment accelerates DNA repair via activating the NER pathway including the expression of XPA (xeroderma pigmentosum complementation group A), XPB, XPC, and XPG. In UVB exposed fibroblasts, silibinin treatment also increased p53 and GADD45α expression; the key regulators of the NER pathway and DNA repair. Consistently, post-UVB silibinin treatment increased the mRNA transcripts of XPA and GADD45α. Importantly, silibinin showed no effect on UVB-induced DNA damage repair in XPA- and XPB-deficient human dermal fibroblasts suggesting their key role in silibinin-mediated DNA damage repair. Moreover, in the presence of pifithrin-α, an inhibitor of p53, the DNA repair efficacy of silibinin was compromised associated with a reduction in XPA and GADD45α transcripts. Together, these findings suggest that silibinin's efficacy against UVB-induced photodamage is primarily by inhibiting NER and p53; and these findings further support silibinin's usage as a potential inexpensive, effective, and non-toxic agent for skin cancer chemoprevention. PMID:26447614

  20. DNA apoptosis and stability in B-cell chronic lymphoid leukaemia: implication of the DNA double-strand breaks repair system by non homologous recombination

    International Nuclear Information System (INIS)

    After an introduction presenting the diagnosis and treatment of chronic lymphoid leukaemia, its molecular and genetic characteristics, and its cellular origin and clonal evolution, this research thesis describes the apoptosis (definition and characteristics, cancer and chemotherapy, apoptotic ways induced by gamma irradiation), the genotoxic stresses, the different repair mechanisms for different damages, and the DNA repair processes. It reports how human chronic lymphocytic leukaemia B cells can escape DNA damage-induced apoptosis through the non-homologous end-joining DNA repair pathway, and presents non-homologous end-joining DNA repair as a potent mutagenic process in human chronic lymphocytic leukaemia B cells

  1. Association of ATM activation and DNA repair with induced radioresistance after low-dose irradiation

    International Nuclear Information System (INIS)

    Mammalian cells often exhibit a hyper-radiosensitivity (HRS) to radiation doses <20 cGy, followed by increased radioresistance (IRR) at slightly higher doses (∼20-30 cGy). Here, the influence of DNA double-strand break repair (DSBR) on IRR was examined. The failure of Ataxia telangiectasia (AT) cells to undergo IRR reported by others was confirmed. Flow cytometric analysis indicated that normal cells fail to show a measurable increase in serine 1981 phosphorylated AT-mutated (ATM) protein after 10 cGy up to 4 h post irradiation, but a two- to fourfold increase after 25 cGy. Similarly, more proficient reduction of phosphorylated histone H2AX was observed 24 h after 25 cGy than after 10 cGy, suggesting that DSBR is more efficient during IRR than HRS. A direct examination of the consequences of inefficient DNA repair per se (as opposed to ATM-mediated signal transduction/cell cycle responses), by determining the clonogenic survival of cells lacking the DNA repair enzyme polynucleotide kinase/phosphatase, indicated that these cells have a response similar to AT cells, i.e. HRS but no IRR, strongly linking IRR to DSBR. (authors)

  2. A study on the characteristics of temperature inversions in active and break phases of Indian summer monsoon

    Science.gov (United States)

    Muraleedharan, P. M.; Mohankumar, K.; Sivakumar, K. U.

    2013-02-01

    The thermal inversion characteristics during active and break cycles of two consecutive and contrasting monsoon years were studied using GPS radiosonde profiles in Goa (15°46‧ N; 73°08‧ E), located on the west coast of India. The lower tropospheric inversions were associated with the active phase and it dissipated during the break phase due to weakening of the low level jet. A strong secondary inversion also appeared at 5-6 km in the break period. The genesis of both the inversions is linked with advection of warm and dry air from the Arabian and Persian high lands. During the active phase, convection overrides the stability shield provided by the advection induced low level inversion. Associated with the active phase, the temperature difference within the inversion invariably reaches above a threshold of 1 °C, whereas it is low in break conditions.

  3. Chemical repair activity of free radical scavenger edaravone. Reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA

    International Nuclear Information System (INIS)

    Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 108 dm3 mol-1 s-1 and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10–1000 μmol dm-3) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. (author)

  4. Break-induced ATR and Ddb1-Cul4(Cdt)² ubiquitin ligase-dependent nucleotide synthesis promotes homologous recombination repair in fission yeast

    DEFF Research Database (Denmark)

    Moss, Jennifer; Tinline-Purvis, Helen; Walker, Carol A;

    2010-01-01

    Nucleotide synthesis is a universal response to DNA damage, but how this response facilitates DNA repair and cell survival is unclear. Here we establish a role for DNA damage-induced nucleotide synthesis in homologous recombination (HR) repair in fission yeast. Using a genetic screen, we found th...

  5. Effects of extracellular and intracellular pH on repair of potentially lethal damage, chromosome aberrations and DNA double-strand breaks in irradiated plateau-phase A549 cells

    International Nuclear Information System (INIS)

    Plateau-phage A549 cells exhibit a high capacity for repair of potentially lethal radiation damage (PLD). Previously it was found that PLD repair could be partially inhibited by increasing the extracellular pH (pHe) of the spent medium from its normal value of 6.7-6.8 to 7.6 during postirradiation holding. This study shows that PLD repair is also inhibited by reducing the pHe of the spent medium to 6.0. The effects of altering pHe on rejoining of DNA double-strand breaks (DSBs) as measured by neutral filter elution and on mitotic delay and chromosome aberrations seen after releasing cells from the plateau phase were investigated. Neither increasing nor decreasing the pHe of the spent medium had an effect on radiation-induced mitotic delay. Rejoining of DSBs was significantly inhibited by holding at pHe 6.0 but not affected by holding at pHe 7.6. At 2 h after irradiation about 51% of unrejoined breaks remained at pHe 6.0, compared to about 15% at pHe 6.7 or 7.6. However, holding at pHe 7.6 appeared to cause a marginal change in the kinetics of rejoining of DSBs. Repair of lesions leading to dicentric and acentric chromosome aberrations did not occur when cells were held at pHe 6.0, since less than 10% of these aberrations disappeared from cells held for 24 h before subculture. In contrast, holding plateau-phase cells at pHe 7.6 vs 6.7 caused a small but significant reduction in the disappearance of dicentrics but had no effect on the rate or extent of the disappearance of acentrics. These data have led us to hypothesize that inhibition of PLD repair by holding at pHe 6.0 is related both to inhibition of pH-dependent DNA repair enzymes and to induction of changes in DNA which lead to misrepair when the cells are released from plateau phase. Inhibition of PLD repair by holding at pHe 7.6 is related primarily to changes in DNA structure which promote misrepair. 43 refs., 5 figs., 4 tabs

  6. Regional Heat Sources and the Active and Break Phases of Boreal Summer Intraseasonal Variability

    Energy Technology Data Exchange (ETDEWEB)

    Annamalai, H; Sperber, K R

    2003-12-15

    The boreal summer intraseasonal variability (BSISV) associated with the 30-50 day mode is represented by the co-existence of three components, poleward propagation of convection over the Indian and tropical west Pacific longitudes and eastward propagation along the equator. The hypothesis that the three components influence each other has been investigated using observed OLR, NCEP-NCAR reanalysis, and solutions from an idealized linear model. The null hypothesis is that the three components are mutually independent. Cyclostationary EOF (CsEOF) analysis is applied on filtered OLR to extract the life-cycle of the BSISV. The dominant mode of CsEOF is significantly tied to observed rainfall over the Indian subcontinent. The components of the heating patterns from CsEOF analysis serve as prescribed forcings for the linear model. This allows us to ascertain which heat sources and sinks are instrumental in driving the large-scale monsoon circulation during the BSISV life-cycle. We identify three new findings: (1) the circulation anomalies that develop as a Rossby wave response to suppressed convection over the equatorial Indian Ocean associated with the previous break phase of the BSISV precondition the ocean-atmosphere system in the western Indian Ocean and trigger the next active phase of the BSISV, (2) the development of convection over the tropical west Pacific forces descent anomalies to the west. This, in conjunction with the weakened cross-equatorial flow due to suppressed convective anomalies over the equatorial Indian Ocean reduce the tropospheric moisture over the Arabian Sea, and promote westerly wind anomalies that do not recurve over India. As a result the low-level cyclonic vorticity shifts from India to southeast Asia and break conditions are initiated over India, and (3) the circulation anomalies forced by equatorial Indian Ocean convective anomalies significantly influence the active/break phases over the tropical west Pacific. Our model solutions support

  7. Microdosimetrical calculations of the rate of repairable DNA - double strand breaks based on a model for the interpretation of experiments with different doses and radiation qualities

    International Nuclear Information System (INIS)

    When comparing various DNA injuries induced by radiation double breaks were shown to play peculiar role in subsequent cell changes such as inactivation, aberrations, mutations and transformations. However it was proved that significant part of radiation-induced double breaks could be repaied within cell. 3 refs

  8. Could a change in magnetic field geometry cause the break in the wind-activity relation?

    CERN Document Server

    Vidotto, A A; Jardine, M; See, V; Petit, P; Boisse, I; Saikia, S Boro; Hebrard, E; Jeffers, S V; Marsden, S C; Morin, J

    2015-01-01

    Wood et al suggested that mass-loss rate is a function of X-ray flux ($\\dot{M} \\propto F_x^{1.34}$) for dwarf stars with $F_x \\lesssim F_{x,6} \\equiv 10^6$ erg cm$^{-2}$ s$^{-1}$. However, more active stars do not obey this relation. These authors suggested that the break at $F_{x,6}$ could be caused by significant changes in magnetic field topology that would inhibit stellar wind generation. Here, we investigate this hypothesis by analysing the stars in Wood et al's sample that had their surface magnetic fields reconstructed through Zeeman-Doppler Imaging (ZDI). Although the solar-like outliers in the $\\dot{M}$ -- $F_x$ relation have higher fractional toroidal magnetic energy, we do not find evidence of a sharp transition in magnetic topology at $F_{x,6}$. To confirm this, further wind measurements and ZDI observations at both sides of the break are required. As active stars can jump between states with highly toroidal to highly poloidal fields, we expect significant scatter in magnetic field topology to exi...

  9. 77 FR 10762 - Agency Information Collection Activities: Declaration of Person Who Performed Repairs

    Science.gov (United States)

    2012-02-23

    ... SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: Declaration of Person... concerning the: Declaration of a Person Who Performed Repairs. This request for comment is being made pursuant to the Paperwork Reduction Act of 1995 (Pub. L. 104-13). DATES: Written comments should...

  10. Absorbing aerosols facilitate transition of Indian monsoon breaks to active spells

    Energy Technology Data Exchange (ETDEWEB)

    Manoj, M.G.; Devara, P.C.S.; Safai, P.D.; Goswami, B.N. [Indian Institute of Tropical Meteorology, Pashan, Pune (India)

    2011-12-15

    While some long breaks of monsoon intraseasonal oscillations (MISOs) are followed by active spells (BFA), some others are not (BNFA). The circulation during BFA (BNFA) cases helps (prevents) accumulation of absorbing aerosols over central India (CI) resulting in almost three times larger Aerosol Index (AI) over CI, during BFA cases compared to BNFA cases. A seminal role played by the absorbing aerosols in the transition from break to active spells is unraveled through modification of the north-south temperature gradient at lower levels. The meridional gradient of temperature at low level ({nabla}T) between aerosol-rich CI and pristine equatorial Indian Ocean is large (>6 C) and sustains for long time (>10 days) during BFA leading to significant moisture convergence to CI. The stability effect arising from surface cooling by the aerosols is overcome by the enhanced moisture convergence creating a moist static unstable atmosphere conducive for the large-scale organized convection over the CI region leading to the resurgence of active spells. The moisture convergence induced by {nabla}T was also able to overcome possible aerosol indirect effect (Twomey effect) and initiate deep convection and transition to active condition. During BNFA cases, however the maximum {nabla}T, which was weaker than the BFA cases by more than 1.5 C, could not sustain required moisture convergence and failed to lead to a sustained active spell. Using data from MODIS (MODerate resolution Imaging Spectroradiometer) onboard Terra and several other input parameters from various satellites for the period 2000-2009, the aerosol induced radiative forcing representative of two regions - the CI to the north and the pristine ocean to the south - were estimated and support the differences in observed {nabla}T during the two cases. Our results highlight the need for proper inclusion of absorbing aerosols in dynamical models for simulation of the observed variability of MISOs and their extended range

  11. [p53 activation by PI-3K family kinases after DNA double-strand breaks].

    Science.gov (United States)

    Pernin, D; Uhrhammer, N; Verrelle, P; Bignon, Y J; Bay, J O

    2000-09-01

    p53 plays a central role in the cellular response to DNA double-strand breaks (DSBs), and to DNA damage in general. The protein kinases ATM, ATR and DNA-PK detect DSBs and transmit this information to p53 by phosphorylation. This phosphorylation dissociates p53 from its negative regulator, mdm2. p53 then undergoes further modification and activates transcription of the genes responsible for cell cycle arrest. In certain circumstances, p53 also activates transcription of the genes responsible for apoptosis. The dysfunction of this cascade of events is oncogenic, with P53 itself being the most commonly mutated gene in malignant cells, although mutations in both the DNA damage sensors and cell cycle checkpoint and apoptosis effectors are frequent. A more complete understanding of p53 and the proteins it interacts with may allow the development of new cancer treatments. PMID:11038413

  12. Outcome of early active mobilization after flexor tendons repair in zones II-V in hand

    Directory of Open Access Journals (Sweden)

    Saini Narender

    2010-01-01

    Full Text Available Background: The functional outcome of a flexor tendon injury after repair depends on multiple factors. The postoperative management of tendon injuries has paved a sea through many mobilization protocols. The improved understanding of splinting techniques has promoted the understanding and implication of these mobilization protocols. We conducted a study to observe and record the results of early active mobilization of repaired flexor tendons in zones II-V. Materials and Methods: 25 cases with 75 digits involving 129 flexor tendons including 8 flexor pollicis longus (FPL tendons in zones II-V of thumb were subjected to the early active mobilization protocol. Eighteen (72% patients were below 30 years of age. Twenty-four cases (96% sustained injury by sharp instrument either accidentally or by assault. Ring and little finger were involved in 50% instances. In all digits, either a primary repair (n=26 or a delayed primary repair (n=49 was done. The repair was done with the modified Kessler core suture technique with locking epitendinous sutures with a knot inside the repair site, using polypropylene 3-0/4-0 sutures. An end-to-end repair of the cut nerves was done under loupe magnification using a 6-0/8-0 polyamide suture. The rehabilitation program adopted was a modification of Kleinert′s regimen, and Silfverskiold regimen. The final assessment was done at 14 weeks post repair using the Louisville system of Lister et al. Results: Eighteen of excellent results were attributed to ring and little fingers where there was a flexion lag of < 1 cm and an extension lag of < 15o. FPL showed 75% (n=6 excellent flexion. 63% (n=47 digits showed excellent results whereas good results were seen in 19% (n=14 digits. Nine percent (n=7 digits showed fair and the same number showed poor results. The cases where the median (n=4 or ulnar nerve (n=6 or both (n=3 were involved led to some deformity (clawing/ape thumb at 6 months postoperatively. The cases with digital

  13. Break-Induced Replication and Genome Stability

    Directory of Open Access Journals (Sweden)

    Anna Malkova

    2012-10-01

    Full Text Available Genetic instabilities, including mutations and chromosomal rearrangements, lead to cancer and other diseases in humans and play an important role in evolution. A frequent cause of genetic instabilities is double-strand DNA breaks (DSBs, which may arise from a wide range of exogeneous and endogeneous cellular factors. Although the repair of DSBs is required, some repair pathways are dangerous because they may destabilize the genome. One such pathway, break-induced replication (BIR, is the mechanism for repairing DSBs that possesses only one repairable end. This situation commonly arises as a result of eroded telomeres or collapsed replication forks. Although BIR plays a positive role in repairing DSBs, it can alternatively be a dangerous source of several types of genetic instabilities, including loss of heterozygosity, telomere maintenance in the absence of telomerase, and non-reciprocal translocations. Also, mutation rates in BIR are about 1000 times higher as compared to normal DNA replication. In addition, micro-homology-mediated BIR (MMBIR, which is a mechanism related to BIR, can generate copy-number variations (CNVs as well as various complex chromosomal rearrangements. Overall, activation of BIR may contribute to genomic destabilization resulting in substantial biological consequences including those affecting human health.

  14. De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks

    KAUST Repository

    Mahfouz, Magdy M.

    2011-01-24

    Site-specific and rare cutting nucleases are valuable tools for genome engineering. The generation of double-strand DNA breaks (DSBs) promotes homologous recombination in eukaryotes and can facilitate gene targeting, additions, deletions, and inactivation. Zinc finger nucleases have been used to generate DSBs and subsequently, for genome editing but with low efficiency and reproducibility. The transcription activator-like family of type III effectors (TALEs) contains a central domain of tandem repeats that could be engineered to bind specific DNA targets. Here, we report the generation of a Hax3-based hybrid TALE nuclease with a user-selected DNA binding specificity. We show that the engineered TALE nuclease can bind to its target sequence in vitro and that the homodimeric TALE nuclease can cleave double-stranded DNA in vitro if the DNA binding sites have the proper spacing and orientation. Transient expression assays in tobacco leaves suggest that the hybrid nuclease creates DSB in its target sequence, which is subsequently repaired by nonhomologous end-joining repair. Taken together, our data show the feasibility of engineering TALE-based hybrid nucleases capable of generating site-specific DSBs and the great potential for site-specific genome modification in plants and eukaryotes in general.

  15. Conjugated linoleic acid inhibiting DNA repair damaged by x-ray

    International Nuclear Information System (INIS)

    Non-homologous end-joining is the most effective repair of DNA double strand break. Epidermal growth factor receptor activates DSB repairs. Integration of EGFR inhibitors with radiation or chemotherapy were used in lung cancer treatment. Radiosensitivity effect of conjugated linoleic acid on tumor cells and reduced metastasis are reported

  16. Repair of DNA damage in mammalian cells after treatment with UV and dimethyl sulphate: discrimination between nucleotide and base excision repair by their temperature dependence.

    Science.gov (United States)

    Hjertvik, M; Erixon, K; Ahnström, G

    1998-03-01

    Alkylating agents have been reported to give rise to both short and long patches of repair. The reason for the different patch sizes is not known. One possibility is that alkylating agents can trigger both base and nucleotide excision repair. Another possibility is that base excision repair itself can result in different patch sizes. Recognition and incision at lesions is the rate limiting step in excision repair. In order to discriminate between base and nucleotide excision repair it would be desirable to be able to distinguish between different incision activities. In order to accurately measure incision rates, the rejoining of the strand-breaks formed must be inhibited. We have used two inhibitors, aphidicolin and 3-aminobenzamide. Aphidicolin, an inhibitor of DNA polymerases alpha/delta/epsilon. caused accumulation of single-strand breaks both after UV and dimethylsulphate. 3-Aminobenzamide, an inhibitor of poly(ADP-ribose)-polymerase caused accumulation of single-strand breaks only after alkylating agents and is thus specific for base excision repair. Enzymatic activities can be characterised by their activation energy. In order to discriminate between base and nucleotide excision repair the temperature dependence of incision activities was determined. When the temperature is decreased, the incision rate is reduced to a larger extent for UV than for DMS-induced repair. Incisions in UV-irradiated cells are practically cut off at temperatures of 15 degrees C and below, whereas DMS-exposed cells still are actively repairing at this temperature. In DMS treated cells the temperature dependence was the same whether aphidicolin or 3-aminobenzamide was used, speaking against an involvement of nucleotide excision repair. In addition, cell lines deficient in nucleotide excision repair responded in the same way to aphidicolin after DMS treatment as normal cells and were able to make incisions at 15 degrees C. This indicates that nucleotide excision repair is not to any

  17. Can cognitive activities during breaks in repetitive manual work accelerate recovery from fatigue? A controlled experiment.

    Directory of Open Access Journals (Sweden)

    Svend Erik Mathiassen

    Full Text Available Neurophysiologic theory and some empirical evidence suggest that fatigue caused by physical work may be more effectively recovered during "diverting" periods of cognitive activity than during passive rest; a phenomenon of great interest in working life. We investigated the extent to which development and recovery of fatigue during repeated bouts of an occupationally relevant reaching task was influenced by the difficulty of a cognitive activity between these bouts. Eighteen male volunteers performed three experimental sessions, consisting of six 7-min bouts of reaching alternating with 3 minutes of a memory test differing in difficulty between sessions. Throughout each session, recordings were made of upper trapezius muscle activity using electromyography (EMG, heart rate and heart rate variability (HRV using electrocardiography, arterial blood pressure, and perceived fatigue (Borg CR10 scale and SOFI. A test battery before, immediately after and 1 hour after the work period included measurements of maximal shoulder elevation strength (MVC, pressure pain threshold (PPT over the trapezius muscles, and a submaximal isometric contraction. As expected, perceived fatigue and EMG amplitude increased during the physical work bouts. Recovery did occur between the bouts, but fatigue accumulated throughout the work period. Neither EMG changes nor recovery of perceived fatigue during breaks were influenced by cognitive task difficulty, while heart rate and HRV recovered the most during breaks with the most difficult task. Recovery of perceived fatigue after the 1 hour work period was also most pronounced for the most difficult cognitive condition, while MVC and PPT showed ambiguous patterns, and EMG recovered similarly after all three cognitive protocols. Thus, we could confirm that cognitive tasks between bouts of fatiguing physical work can, indeed, accelerate recovery of some factors associated with fatigue, even if benefits may be moderate and some

  18. Review on Japanese activities in the field of maintenance and repair of LMFBR steam generators

    International Nuclear Information System (INIS)

    Summary of Japanese activities on maintenance and repair of LMFBR steam generators (SG) is described in this paper. The concept (adoption of helical coil tube etc.) of MONJU SG was established in conceptional design started from 1968, and research and development (R and D) program was prepared. Parallel with basic studies such as material, welding, sodium water reaction and etc., overall verification tests using mock up SGs were conducted. As the first step, 1 Mw SG with two active helical tubes (and eight dummy tubes) was fabricated and operated, and many maintenance and repair experiences were accumulated through two small water leak troubles. Two 50Mw SGs, 1/5 scale of MONJU SG, were constructed and operated for long time. Post test examinations were carried out for No.1 50 Mw SG and feasibility of this type of SG was confirmed. In regard to maintenance and repair techniques, explosive and welding method for tube plugging and UT and ECT techniques for inspection of tube integrity are under development. Overall verification test for on-site and in-factory maintenance and repair techniques was conducted using No.2 50Mw SG evaporator and applicability of those techniques to real plant was evaluated. Many experiences were accumulated for removal and cleaning of sodium water reaction products after sodium water reaction in the cooling system and pressure relief system, using the Large Sodium Water Reaction Test Facility (SWAT-1 and 3). (author)

  19. The evolution of activity breaks in the nest cycle of annual eusocial bees: a model of delayed exponential growth

    Directory of Open Access Journals (Sweden)

    Strohm Erhard

    2006-06-01

    Full Text Available Abstract Background Social insects show considerable variability not only in social organisation but also in the temporal pattern of nest cycles. In annual eusocial sweat bees, nest cycles typically consist of a sequence of distinct phases of activity (queen or workers collect food, construct, and provision brood cells and inactivity (nest is closed. Since the flight season is limited to the time of the year with sufficiently high temperatures and resource availability, every break reduces the potential for foraging and, thus, the productivity of a colony. This apparent waste of time has not gained much attention. Results We present a model that explains the evolution of activity breaks by assuming differential mortality during active and inactive phases and a limited rate of development of larvae, both reasonable assumptions. The model predicts a systematic temporal structure of breaks at certain times in the season which increase the fitness of a colony. The predicted pattern of these breaks is in excellent accordance with field data on the nest cycle of the halictid Lasioglossum malachurum. Conclusion Activity breaks are a counter-intuitive outcome of varying mortality rates that maximise the reproductive output of primitively eusocial nests.

  20. Defective DNA repair increases susceptibility to senescence through extension of Chk1-mediated G2 checkpoint activation.

    Science.gov (United States)

    Johmura, Yoshikazu; Yamashita, Emiri; Shimada, Midori; Nakanishi, Keiko; Nakanishi, Makoto

    2016-01-01

    Susceptibility to senescence caused by defective DNA repair is a major hallmark of progeroid syndrome patients, but molecular mechanisms of how defective DNA repair predisposes to senescence are largely unknown. We demonstrate here that suppression of DNA repair pathways extends the duration of Chk1-dependent G2 checkpoint activation and sensitizes cells to senescence through enhancement of mitosis skipping. Extension of G2 checkpoint activation by introduction of the TopBP1 activation domain and the nondegradable mutant of Claspin sensitizes cells to senescence. In contrast, a shortening of G2 checkpoint activation by expression of SIRT6 or depletion of OTUB2 reduces susceptibility to senescence. Fibroblasts from progeroid syndromes tested shows a correlation between an extension of G2 checkpoint activation and an increase in the susceptibility to senescence. These results suggest that extension of G2 checkpoint activation caused by defective DNA repair is critical for senescence predisposition in progeroid syndrome patients. PMID:27507734

  1. The risk of a new retinal break or detachment following cataract surgery in eyes that had undergone repair of phakic break or detachment: a hypothesis of a causal relationship to cataract surgery.

    OpenAIRE

    Grand, M. Gilbert

    2003-01-01

    PURPOSE: To determine the risk of new retinal tear or detachment following cataract surgery in eyes that had undergone successful repair of phakic retinal tear or detachment. METHODS: A computerized search of records of patients evaluated at the Barnes Retina Institute from 1990 to 2000 for a diagnosis of phakic retinal tear or detachment was accomplished. The records of successfully treated patients were analyzed by type of tear or detachment, method of treatment, and development of sequenti...

  2. Active Achilles tendon kinesitherapy accelerates Achilles tendon repair by promoting neurite regeneration☆

    OpenAIRE

    Jielile, Jiasharete; Aibai, Minawa; Sabirhazi, Gulnur; Shawutali, Nuerai; Tangkejie, Wulanbai; Badelhan, Aynaz; Nuerduola, Yeermike; Satewalede, Turde; Buranbai, Darehan; Hunapia, Beicen; Jialihasi, Ayidaer; Bai, Jingping; Kizaibek, Murat

    2012-01-01

    Active Achilles tendon kinesitherapy facilitates the functional recovery of a ruptured Achilles tendon. However, protein expression during the healing process remains a controversial issue. New Zealand rabbits, aged 14 weeks, underwent tenotomy followed immediately by Achilles tendon microsurgery to repair the Achilles tendon rupture. The tendon was then immobilized or subjected to postoperative early motion treatment (kinesitherapy). Mass spectrography results showed that after 14 days of mo...

  3. Laser-activated nano-biomaterials for tissue repair and controlled drug release

    Energy Technology Data Exchange (ETDEWEB)

    Matteini, P; Ratto, F; Rossi, F; Pini, R [Institute of Applied Physics ' Nello Carrara' , National Research Council, via Madonna del Piano 10 50019 Sesto Fiorentino (Italy)

    2014-07-31

    We present recent achievements of minimally invasive welding of biological tissue and controlled drug release based on laser-activated nano-biomaterials. In particular, we consider new advancements in the biomedical application of near-IR absorbing gold nano-chromophores as an original solution for the photothermal repair of surgical incisions and as nanotriggers of controlled drug release from hybrid biopolymer scaffolds. (laser biophotonics)

  4. Comparison of repair of DNA double-strand breaks in identical sequences in primary human fibroblast and immortal hamster-human hybrid cells harboring a single copy of human chromosome 11

    Science.gov (United States)

    Fouladi, B.; Waldren, C. A.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    2000-01-01

    We have optimized a pulsed-field gel electrophoresis assay that measures induction and repair of double-strand breaks (DSBs) in specific regions of the genome (Lobrich et al., Proc. Natl. Acad. Sci. USA 92, 12050-12054, 1995). The increased sensitivity resulting from these improvements makes it possible to analyze the size distribution of broken DNA molecules immediately after the introduction of DSBs and after repair incubation. This analysis shows that the distribution of broken DNA pieces after exposure to sparsely ionizing radiation is consistent with the distribution expected from randomly induced DSBs. It is apparent from the distribution of rejoined DNA pieces after repair incubation that DNA ends continue to rejoin between 3 and 24 h postirradiation and that some of these rejoining events are in fact misrejoining events, since novel restriction fragments both larger and smaller than the original fragment are generated after repair. This improved assay was also used to study the kinetics of DSB rejoining and the extent of misrejoining in identical DNA sequences in human GM38 cells and human-hamster hybrid A(L) cells containing a single human chromosome 11. Despite the numerous differences between these cells, which include species and tissue of origin, levels of TP53, expression of telomerase, and the presence or absence of a homologous chromosome for the restriction fragments examined, the kinetics of rejoining of radiation-induced DSBs and the extent of misrejoining were similar in the two cell lines when studied in the G(1) phase of the cell cycle. Furthermore, DSBs were removed from the single-copy human chromosome in the hamster A(L) cells with similar kinetics and misrejoining frequency as at a locus on this hybrid's CHO chromosomes.

  5. D-ribose inhibits DNA repair synthesis in human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zunica, G.; Marini, M.; Brunelli, M.A.; Chiricolo, M.; Franceschi, C.

    1986-07-31

    D-ribose is cytotoxic for quiescent human lymphocytes and severely inhibits their PHA-induced proliferation at concentrations (25-50 mM) at which other simple sugars are ineffective. In order to explain these effects, DNA repair synthesis was evaluated in PHA-stimulated human lymphocytes treated with hydroxyurea and irradiated. D-ribose, in contrast to other reducing sugars, did not induce repair synthesis and therefore did not apparently damage DNA in a direct way, although it markedly inhibited gamma ray-induced repair. Taking into account that lymphocytes must rejoin physiologically-formed DNA strand breaks in order to enter the cell cycle, we suggest that D-ribose exerts its cytotoxic activity by interfering with metabolic pathways critical for the repair of DNA breaks.

  6. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    International Nuclear Information System (INIS)

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTεAGCGGGTACCGAGCTCGAAT; εA = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 ± 1.67 fmol/μg DNA/h vs 3.47 ± 1.35 fmol/μg DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  7. Protozoan ALKBH8 Oxygenases Display both DNA Repair and tRNA Modification Activities

    DEFF Research Database (Denmark)

    Zdżalik, Daria; Vågbø, Cathrine B; Kirpekar, Finn;

    2014-01-01

    1-8 and FTO. Mammalian and plant ALKBH8 are tRNA hydroxylases targeting 5-methoxycarbonylmethyl-modified uridine (mcm5U) at the wobble position of tRNAGly(UCC). In contrast, the genomes of some bacteria encode a protein with strong sequence homology to ALKBH8, and robust DNA repair activity was......, interestingly, two protozoan ALKBH8s also catalyzed wobble uridine modification of tRNA, thus displaying a dual in vitro activity. Also, we found the modification status of tRNAGly(UCC) to be unaltered in an ALKBH8 deficient mutant of Agrobacterium tumefaciens, indicating that bacterial ALKBH8s have a function...

  8. The Vitamin A Derivative All-Trans Retinoic Acid Repairs Amyloid-β-Induced Double-Strand Breaks in Neural Cells and in the Murine Neocortex

    OpenAIRE

    Emmanuelle Gruz-Gibelli; Natacha Chessel; Clélia Allioux; Pascale Marin; Françoise Piotton; Geneviève Leuba; Herrmann, François R.; Armand Savioz

    2016-01-01

    The amyloid-β peptide or Aβ is the key player in the amyloid-cascade hypothesis of Alzheimer's disease. Aβ appears to trigger cell death but also production of double-strand breaks (DSBs) in aging and Alzheimer's disease. All-trans retinoic acid (RA), a derivative of vitamin A, was already known for its neuroprotective effects against the amyloid cascade. It diminishes, for instance, the production of Aβ peptides and their oligomerisation. In the present work we investigat...

  9. Repair processes in diverse systems: overview

    International Nuclear Information System (INIS)

    Studies on DNA repair in several bacterial systems as well as in eukaryotes are reviewed. Some topics discussed are: excision repair of uv damage in Mycoplasma; repair replication in uv-irradiated Tetrahymena; repair of double-strand breaks in DNA of Micrococcus radiodurans; DNA repair in Neurospora; lack of dimer excision in x-irradiated Vicia faba; and DNA repair in Nicotiana, Haplopappus, and Chlamydomonas

  10. Molecular studies on the nature of the repair defect in ataxia-telangiectasia and their implications for cellular radiobiology

    International Nuclear Information System (INIS)

    We have utilized DNA transfer and recombinant DNA techniques to probe DNA double-strand break repair in the human ionizing radiation-sensitive genetic syndrome ataxia-telangiectasis (A-T). Using restriction enzyme-generated double-strand breaks in the coding sequence of a selectable gene we have detected a significantly greater frequency of mis-repair of such breaks in a permanent A-T cell line compared with cell lines of normal radiosensitivity. This mis-repair in A-T can explain many of the clinical features of the disease but was insufficiently detailed to address the broad problem of DNA repair mechanisms relevant to ionizing radiation-induced damage. To extend these observations of DNA double-strand break mis-repair we have now applied this type of repair assay to novel, de novo induced mammalian X-ray-sensitive cell lines and to appropriate Escherichia coli mutants. In both cellular systems we have found some equivalence to the A-T repair defect. Studies on one E. coli mutant suggest an involvement of a topoisomerase activity in DNA double-strand break mis-repair, which may be relevant to the biochemical defect in A-T. (author)

  11. Early active mobilisation versus immobilisation after extrinsic extensor tendon repair: A prospective randomised trial

    Directory of Open Access Journals (Sweden)

    R K Patil

    2012-01-01

    Full Text Available Background: Whether to splint the extensor tendon repairs or to mobilise them early is debatable. Recently, mobilisation has shown favourable results in a few studies. This study was aimed to compare the two favoured protocols (immobilisation vs. early active motion in Indian population. Patients and Methods: Between June 2005 and June 2007, patients with extensor tendon injuries in zones V-VIII were randomly distributed in two groups: Group A, early active motion; and group B, immobilisation. Their results at 8 and 12 weeks and 6 months were compared. Results: Patients in early active motion group were found to have better total active motion and early return to work. This difference was statistically significant up to 12 weeks, but not at 6 months. Conclusion: Early active motion following extensor tendon repair hastens patients′ recovery and helps patients to gain complete range of motion at earlier postoperative period. With improved grip strength, the early return to work is facilitated, though these advantages are not sustained statistically significantly over long term.

  12. Effects of post mortem interval and gender in DNA base excision repair activities in rat brains

    International Nuclear Information System (INIS)

    Most human tissues used in research are of post mortem origin. This is the case for all brain samples, and due to the difficulty in obtaining a good number of samples, especially in the case of neurodegenerative diseases, male and female samples are often included in the same experimental group. However, the effects of post mortem interval (PMI) and gender differences in the endpoints being analyzed are not always fully understood, as is the case for DNA repair activities. To investigate these effects, in a controlled genetic background, base excision repair (BER) activities were measured in protein extracts obtained from Wistar rat brains from different genders and defined PMI up to 24 hours, using a novel fluorescent-based in vitro incision assay. Uracil and AP-site incision activity in nuclear and mitochondrial extracts were similar in all groups included in this study. Our results show that gender and PMI up to 24 hours have no influence in the activities of the BER proteins UDG and APE1 in rat brains. These findings demonstrate that these variables do not interfere on the BER activities included in these study, and provide a security window to work with UDG and APE1 proteins in samples of post mortem origin

  13. Effects of post mortem interval and gender in DNA base excision repair activities in rat brains

    Energy Technology Data Exchange (ETDEWEB)

    Soltys, Daniela Tathiana; Pereira, Carolina Parga Martins; Ishibe, Gabriela Naomi; Souza-Pinto, Nadja Cristhina de, E-mail: nadja@iq.usp.br

    2015-06-15

    Most human tissues used in research are of post mortem origin. This is the case for all brain samples, and due to the difficulty in obtaining a good number of samples, especially in the case of neurodegenerative diseases, male and female samples are often included in the same experimental group. However, the effects of post mortem interval (PMI) and gender differences in the endpoints being analyzed are not always fully understood, as is the case for DNA repair activities. To investigate these effects, in a controlled genetic background, base excision repair (BER) activities were measured in protein extracts obtained from Wistar rat brains from different genders and defined PMI up to 24 hours, using a novel fluorescent-based in vitro incision assay. Uracil and AP-site incision activity in nuclear and mitochondrial extracts were similar in all groups included in this study. Our results show that gender and PMI up to 24 hours have no influence in the activities of the BER proteins UDG and APE1 in rat brains. These findings demonstrate that these variables do not interfere on the BER activities included in these study, and provide a security window to work with UDG and APE1 proteins in samples of post mortem origin.

  14. Nuclear Countermeasure Activity of TP508 Linked to Restoration of Endothelial Function and Acceleration of DNA Repair

    Science.gov (United States)

    Olszewska-Pazdrak, Barbara; McVicar, Scott D.; Rayavara, Kempaiah; Moya, Stephanie M.; Kantara, Carla; Gammarano, Chris; Olszewska, Paulina; Fuller, Gerald M.; Sower, Laurie E.; Carney, Darrell H.

    2016-01-01

    There is increasing evidence that radiation-induced damage to endothelial cells and loss of endothelial function may contribute to both acute radiation syndromes and long-term effects of whole-body nuclear irradiation. Therefore, several drugs are being developed to mitigate the effects of nuclear radiation, most of these drugs will target and protect or regenerate leukocytes and platelets. Our laboratory has demonstrated that TP508, a 23-amino acid thrombin peptide, activates endothelial cells and stem cells to revascularize and regenerate tissues. We now show that TP508 can mitigate radiation-induced damage to endothelial cells in vitro and in vivo. Our in vitro results demonstrate that human endothelial cells irradiation attenuates nitric oxide (NO) signaling, disrupts tube formation and induces DNA double-strand breaks (DSB). TP508 treatment reverses radiation effects on NO signaling, restores tube formation and accelerates the repair of radiation-induced DSB. The radiation-mitigating effects of TP508 on endothelial cells were also seen in CD-1 mice where systemic injection of TP508 stimulated endothelial cell sprouting from aortic explants after 8 Gy irradiation. Systemic doses of TP508 that mitigated radiation-induced endothelial cell damage, also significantly increased survival of CD-1 mice when injected 24 h after 8.5 Gy exposure. These data suggest that increased survival observed with TP508 treatment may be due to its effects on vascular and microvascular endothelial cells. Our study supports the usage of a regenerative drug such as TP508 to activate endothelial cells as a countermeasure for mitigating the effects of nuclear radiation. PMID:27388041

  15. Radiation-induced DNA damage and DNA repair

    International Nuclear Information System (INIS)

    Although DNA undergoes various types of damage from radiation, active oxygen, and the like, a living body has a plurality of DNA repair mechanisms responding to the types of DNA damage. On the other hand, there are a system that results in cell death if the repair is impossible and a mechanism to lead to concretization if further repair is not accurately made. This paper explains the following items as the basic researches on these types of DNA damage and the repair mechanisms: (1) biological effects of DNA damage, (2) effect of DNA damage on DNA synthesis, and (3) effects of DNA damage on cells. It also explains the effects of radiation on cells with a focus on specific mechanism for (1) DNA damage caused by direct action due to radiation and by indirect action due mainly to active oxygen, and (2) DNA repair mechanism that works on DNA double-strand break (DSB). (A.O.)

  16. Pars plana vitrectomy for the repair of primary, inferior rhegmatogenous retinal detachment associated to inferior breaks. A comparison of a 25-gauge versus a 20-gauge system

    OpenAIRE

    dell’Omo, Roberto; Barca, Francesco; Tan, H. Stevie; Bijl, Heico M.; Oberstein, Sarit Y Lesnik; Mura, Marco

    2012-01-01

    Background To compare anatomical, functional outcomes and complications of high-speed 25-gauge (G) pars plana vitrectomy (PPV) versus 20-G PPV for the management of primary inferior rhegmatogenous retinal detachment (RRD) associated to inferior breaks/holes. Methods Eighty-five eyes from 85 patients with a minimum follow-up of 3 months were retrospectively evaluated. Forty-one patients underwent 25-G and 44 patients underwent 20-G PPV. All patients underwent PPV with fluid-air exchange, sulfu...

  17. Remote systems for inspection and repair of a highly active dissolver

    International Nuclear Information System (INIS)

    An integrated remote handling system has been built to carry out inspections inside a nuclear fuel dissolver vessel. Tooling is provided to effect repairs to the dissolver if required. The system incorporates a novel manipulator, closed circuit television (CCTV), endoscopes, ultrasonic inspection probes, remote machining and remote tungsten inert gas (TIG) welding packages. An advanced computer control system is provided to allow the operator to monitor, interlock and control the complex equipment. Technique research is complete and non-active test results to date are reported. (Author)

  18. Neutrophil activation during acetaminophen hepatotoxicity and repair in mice and humans

    Energy Technology Data Exchange (ETDEWEB)

    Williams, C. David; Bajt, Mary Lynn [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Sharpe, Matthew R. [Department of Internal Medicine, University of Kansas Hospital, Kansas City, KS (United States); McGill, Mitchell R. [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Farhood, Anwar [Department of Pathology, St. David' s North Austin Medical Center, Austin, TX 78756 (United States); Jaeschke, Hartmut, E-mail: hjaeschke@kumc.edu [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States)

    2014-03-01

    Following acetaminophen (APAP) overdose there is an inflammatory response triggered by the release of cellular contents from necrotic hepatocytes into the systemic circulation which initiates the recruitment of neutrophils into the liver. It has been demonstrated that neutrophils do not contribute to APAP-induced liver injury, but their role and the role of NADPH oxidase in injury resolution are controversial. C57BL/6 mice were subjected to APAP overdose and neutrophil activation status was determined during liver injury and liver regeneration. Additionally, human APAP overdose patients (ALT: > 800 U/L) had serial blood draws during the injury and recovery phases for the determination of neutrophil activation. Neutrophils in the peripheral blood of mice showed an increasing activation status (CD11b expression and ROS priming) during and after the peak of injury but returned to baseline levels prior to complete injury resolution. Hepatic sequestered neutrophils showed an increased and sustained CD11b expression, but no ROS priming was observed. Confirming that NADPH oxidase is not critical to injury resolution, gp91{sup phox}−/− mice following APAP overdose displayed no alteration in injury resolution. Peripheral blood from APAP overdose patients also showed increased neutrophil activation status after the peak of liver injury and remained elevated until discharge from the hospital. In mice and humans, markers of activation, like ROS priming, were increased and sustained well after active liver injury had subsided. The similar findings between surviving patients and mice indicate that neutrophil activation may be a critical event for host defense or injury resolution following APAP overdose, but not a contributing factor to APAP-induced injury. - Highlights: • Neutrophil (PMN) function increases during liver repair after acetaminophen overdose. • Liver repair after acetaminophen (APAP)-overdose is not dependent on NADPH oxidase. • Human PMNs do not appear

  19. Neutrophil activation during acetaminophen hepatotoxicity and repair in mice and humans

    International Nuclear Information System (INIS)

    Following acetaminophen (APAP) overdose there is an inflammatory response triggered by the release of cellular contents from necrotic hepatocytes into the systemic circulation which initiates the recruitment of neutrophils into the liver. It has been demonstrated that neutrophils do not contribute to APAP-induced liver injury, but their role and the role of NADPH oxidase in injury resolution are controversial. C57BL/6 mice were subjected to APAP overdose and neutrophil activation status was determined during liver injury and liver regeneration. Additionally, human APAP overdose patients (ALT: > 800 U/L) had serial blood draws during the injury and recovery phases for the determination of neutrophil activation. Neutrophils in the peripheral blood of mice showed an increasing activation status (CD11b expression and ROS priming) during and after the peak of injury but returned to baseline levels prior to complete injury resolution. Hepatic sequestered neutrophils showed an increased and sustained CD11b expression, but no ROS priming was observed. Confirming that NADPH oxidase is not critical to injury resolution, gp91phox−/− mice following APAP overdose displayed no alteration in injury resolution. Peripheral blood from APAP overdose patients also showed increased neutrophil activation status after the peak of liver injury and remained elevated until discharge from the hospital. In mice and humans, markers of activation, like ROS priming, were increased and sustained well after active liver injury had subsided. The similar findings between surviving patients and mice indicate that neutrophil activation may be a critical event for host defense or injury resolution following APAP overdose, but not a contributing factor to APAP-induced injury. - Highlights: • Neutrophil (PMN) function increases during liver repair after acetaminophen overdose. • Liver repair after acetaminophen (APAP)-overdose is not dependent on NADPH oxidase. • Human PMNs do not appear to

  20. Replication Protein A (RPA) deficiency activates the Fanconi anemia DNA repair pathway.

    Science.gov (United States)

    Jang, Seok-Won; Jung, Jin Ki; Kim, Jung Min

    2016-09-01

    The Fanconi anemia (FA) pathway regulates DNA inter-strand crosslink (ICL) repair. Despite our greater understanding of the role of FA in ICL repair, its function in the preventing spontaneous genome instability is not well understood. Here, we show that depletion of replication protein A (RPA) activates the FA pathway. RPA1 deficiency increases chromatin recruitment of FA core complex, leading to FANCD2 monoubiquitination (FANCD2-Ub) and foci formation in the absence of DNA damaging agents. Importantly, ATR depletion, but not ATM, abolished RPA1 depletion-induced FANCD2-Ub, suggesting that ATR activation mediated FANCD2-Ub. Interestingly, we found that depletion of hSSB1/2-INTS3, a single-stranded DNA-binding protein complex, induces FANCD2-Ub, like RPA1 depletion. More interestingly, depletion of either RPA1 or INTS3 caused increased accumulation of DNA damage in FA pathway deficient cell lines. Taken together, these results indicate that RPA deficiency induces activation of the FA pathway in an ATR-dependent manner, which may play a role in the genome maintenance. PMID:27398742

  1. Single-nucleotide polymorphisms in base excision repair, nucleotide excision repair, and double strand break genes as markers for response to radiotherapy in patients with Stage I to II head-and-neck cancer

    International Nuclear Information System (INIS)

    Purpose: Polymorphisms in DNA repair genes can influence response to radiotherapy. We analyzed single-nucleotide polymorphisms (SNP) in nine DNA repair genes in 108 patients with head-and-neck cancer (HNSCC) who had received radiotherapy only. Methods and Materials: From May 1993 to December 2004, patients with Stage I and II histopathologically confirmed HNSCC underwent radiotherapy. DNA was obtained from paraffin-embedded tissue, and SNP analysis was performed using a real-time polymerase chain reaction allelic discrimination TaqMan assay with minor modifications. Results: Patients were 101 men (93.5%) and 7 (6.5%) women, with a median age of 64 years (range, 40 to 89 years). Of the patients, 76 (70.4%) patients were Stage I and 32 (29.6%) were Stage II. The XPF/ERCC1 SNP at codon 259 and XPG/ERCC5 at codon 46 emerged as significant predictors of progression (p 0.00005 and 0.049, respectively) and survival (p = 0.0089 and 0.0066, respectively). Similarly, when variant alleles of XPF/ERCC1, XPG/ERCC5 and XPA were examined in combination, a greater number of variant alleles was associated with shorter time to progression (p = 0.0003) and survival (p 0.0002). Conclusions: Genetic polymorphisms in XPF/ERCC1, XPG/ERCC5, and XPA may significantly influence response to radiotherapy; large studies are warranted to confirm their role in HNSCC

  2. RAG-mediated DNA double-strand breaks activate a cell type-specific checkpoint to inhibit pre-B cell receptor signals.

    Science.gov (United States)

    Bednarski, Jeffrey J; Pandey, Ruchi; Schulte, Emily; White, Lynn S; Chen, Bo-Ruei; Sandoval, Gabriel J; Kohyama, Masako; Haldar, Malay; Nickless, Andrew; Trott, Amanda; Cheng, Genhong; Murphy, Kenneth M; Bassing, Craig H; Payton, Jacqueline E; Sleckman, Barry P

    2016-02-01

    DNA double-strand breaks (DSBs) activate a canonical DNA damage response, including highly conserved cell cycle checkpoint pathways that prevent cells with DSBs from progressing through the cell cycle. In developing B cells, pre-B cell receptor (pre-BCR) signals initiate immunoglobulin light (Igl) chain gene assembly, leading to RAG-mediated DNA DSBs. The pre-BCR also promotes cell cycle entry, which could cause aberrant DSB repair and genome instability in pre-B cells. Here, we show that RAG DSBs inhibit pre-BCR signals through the ATM- and NF-κB2-dependent induction of SPIC, a hematopoietic-specific transcriptional repressor. SPIC inhibits expression of the SYK tyrosine kinase and BLNK adaptor, resulting in suppression of pre-BCR signaling. This regulatory circuit prevents the pre-BCR from inducing additional Igl chain gene rearrangements and driving pre-B cells with RAG DSBs into cycle. We propose that pre-B cells toggle between pre-BCR signals and a RAG DSB-dependent checkpoint to maintain genome stability while iteratively assembling Igl chain genes. PMID:26834154

  3. Flavonoid Compound Icariin Activates Hypoxia Inducible Factor-1α in Chondrocytes and Promotes Articular Cartilage Repair.

    Science.gov (United States)

    Wang, Pengzhen; Zhang, Fengjie; He, Qiling; Wang, Jianqi; Shiu, Hoi Ting; Shu, Yinglan; Tsang, Wing Pui; Liang, Shuang; Zhao, Kai; Wan, Chao

    2016-01-01

    Articular cartilage has poor capability for repair following trauma or degenerative pathology due to avascular property, low cell density and migratory ability. Discovery of novel therapeutic approaches for articular cartilage repair remains a significant clinical need. Hypoxia is a hallmark for cartilage development and pathology. Hypoxia inducible factor-1alpha (HIF-1α) has been identified as a key mediator for chondrocytes to response to fluctuations of oxygen availability during cartilage development or repair. This suggests that HIF-1α may serve as a target for modulating chondrocyte functions. In this study, using phenotypic cellular screen assays, we identify that Icariin, an active flavonoid component from Herba Epimedii, activates HIF-1α expression in chondrocytes. We performed systemic in vitro and in vivo analysis to determine the roles of Icariin in regulation of chondrogenesis. Our results show that Icariin significantly increases hypoxia responsive element luciferase reporter activity, which is accompanied by increased accumulation and nuclear translocation of HIF-1α in murine chondrocytes. The phenotype is associated with inhibiting PHD activity through interaction between Icariin and iron ions. The upregulation of HIF-1α mRNA levels in chondrocytes persists during chondrogenic differentiation for 7 and 14 days. Icariin (10-6 M) increases the proliferation of chondrocytes or chondroprogenitors examined by MTT, BrdU incorporation or colony formation assays. Icariin enhances chondrogenic marker expression in a micromass culture including Sox9, collagen type 2 (Col2α1) and aggrecan as determined by real-time PCR and promotes extracellular matrix (ECM) synthesis indicated by Alcian blue staining. ELISA assays show dramatically increased production of aggrecan and hydroxyproline in Icariin-treated cultures at day 14 of chondrogenic differentiation as compared with the controls. Meanwhile, the expression of chondrocyte catabolic marker genes

  4. Flavonoid Compound Icariin Activates Hypoxia Inducible Factor-1α in Chondrocytes and Promotes Articular Cartilage Repair.

    Directory of Open Access Journals (Sweden)

    Pengzhen Wang

    Full Text Available Articular cartilage has poor capability for repair following trauma or degenerative pathology due to avascular property, low cell density and migratory ability. Discovery of novel therapeutic approaches for articular cartilage repair remains a significant clinical need. Hypoxia is a hallmark for cartilage development and pathology. Hypoxia inducible factor-1alpha (HIF-1α has been identified as a key mediator for chondrocytes to response to fluctuations of oxygen availability during cartilage development or repair. This suggests that HIF-1α may serve as a target for modulating chondrocyte functions. In this study, using phenotypic cellular screen assays, we identify that Icariin, an active flavonoid component from Herba Epimedii, activates HIF-1α expression in chondrocytes. We performed systemic in vitro and in vivo analysis to determine the roles of Icariin in regulation of chondrogenesis. Our results show that Icariin significantly increases hypoxia responsive element luciferase reporter activity, which is accompanied by increased accumulation and nuclear translocation of HIF-1α in murine chondrocytes. The phenotype is associated with inhibiting PHD activity through interaction between Icariin and iron ions. The upregulation of HIF-1α mRNA levels in chondrocytes persists during chondrogenic differentiation for 7 and 14 days. Icariin (10-6 M increases the proliferation of chondrocytes or chondroprogenitors examined by MTT, BrdU incorporation or colony formation assays. Icariin enhances chondrogenic marker expression in a micromass culture including Sox9, collagen type 2 (Col2α1 and aggrecan as determined by real-time PCR and promotes extracellular matrix (ECM synthesis indicated by Alcian blue staining. ELISA assays show dramatically increased production of aggrecan and hydroxyproline in Icariin-treated cultures at day 14 of chondrogenic differentiation as compared with the controls. Meanwhile, the expression of chondrocyte catabolic

  5. Complex DNA repair pathways as possible therapeutic targets to overcome temozolomide resistance in glioblastoma

    Directory of Open Access Journals (Sweden)

    Koji eYoshimoto

    2012-12-01

    Full Text Available Many conventional chemotherapeutic drugs exert their cytotoxic function by inducing DNA damage in the tumor cell. Therefore, a cell-inherent DNA repair pathway, which reverses the DNA-damaging effect of the cytotoxic drugs, can mediate therapeutic resistance to chemotherapy. The monofunctional DNA-alkylating agent temozolomide (TMZ is a commonly used chemotherapeutic drug and the gold standard treatment for glioblastoma. Although the activity of DNA repair protein O6-methylguanine-DNA methyltransferase (MGMT has been described as the main modulator to determine the sensitivity of glioblastoma to TMZ, a subset of glioblastoma does not respond despite MGMT inactivation, suggesting that another DNA repair mechanism may also modulate the tolerance to TMZ. Considerable interest has focused on MGMT, mismatch repair (MMR, and the base-excision repair (BER pathway in the mechanism of mediating TMZ resistance, but emerging roles for the DNA strand-break repair pathway have been demonstrated. In the first part of this review article, we briefly review the significant role of MGMT, MMR, and the BER pathway in the tolerance to TMZ; in the last part, we review the recent publications that demonstrate possible roles of DNA strand-break repair pathways, such as single-strand break (SSB repair and double-strand break (DSB repair, as well as the Fanconi anemia pathway in the repair process after alkylating agent-based therapy. It is possible that all of these repair pathways have a potential to modulate the sensitivity to TMZ and aid in overcoming the therapeutic resistance in the clinic.

  6. Breaking Bat

    Science.gov (United States)

    Aguilar, Isaac-Cesar; Kagan, David

    2013-01-01

    The sight of a broken bat in Major League Baseball can produce anything from a humorous dribbler in the infield to a frightening pointed projectile headed for the stands. Bats usually break at the weakest point, typically in the handle. Breaking happens because the wood gets bent beyond the breaking point due to the wave sent down the bat created…

  7. Cadmium inhibits mismatch repair by blocking the ATPase activity of the MSH2-MSH6 complex.

    Science.gov (United States)

    Banerjee, Sreeparna; Flores-Rozas, Hernan

    2005-01-01

    Cadmium (Cd2+) is a known carcinogen that inactivates the DNA mismatch repair (MMR) pathway. In this study, we have tested the effect of Cd2+ exposure on the enzymatic activity of the mismatch binding complex MSH2-MSH6. Our results indicate that Cd2+ is highly inhibitory to the ATP binding and hydrolysis activities of MSH2-MSH6, and less inhibitory to its DNA mismatch binding activity. The inhibition of the ATPase activity appears to be dose and exposure time dependent. However, the inhibition of the ATPase activity by Cd2+ is prevented by cysteine and histidine, suggesting that these residues are essential for the ATPase activity and are targeted by Cd2+. A comparison of the mechanism of inhibition with N-ethyl maleimide, a sulfhydryl group inhibitor, indicates that this inhibition does not occur through direct inactivation of sulfhydryl groups. Zinc (Zn2+) does not overcome the direct inhibitory effect of Cd2+ on the MSH2-MSH6 ATPase activity in vitro. However, the increase in the mutator phenotype of yeast cells exposed to Cd2+ was prevented by excess Zn2+, probably by blocking the entry of Cd2+ into the cell. We conclude that the inhibition of MMR by Cd2+ is through the inactivation of the ATPase activity of the MSH2-MSH6 heterodimer, resulting in a dominant negative effect and causing a mutator phenotype. PMID:15746000

  8. Role of polynucleotide kinase/phosphatase in mitochondrial DNA repair

    Science.gov (United States)

    Tahbaz, Nasser; Subedi, Sudip; Weinfeld, Michael

    2012-01-01

    Mutations in mitochondrial DNA (mtDNA) are implicated in a broad range of human diseases and in aging. Compared to nuclear DNA, mtDNA is more highly exposed to oxidative damage due to its proximity to the respiratory chain and the lack of protection afforded by chromatin-associated proteins. While repair of oxidative damage to the bases in mtDNA through the base excision repair pathway has been well studied, the repair of oxidatively induced strand breaks in mtDNA has been less thoroughly examined. Polynucleotide kinase/phosphatase (PNKP) processes strand-break termini to render them chemically compatible for the subsequent action of DNA polymerases and ligases. Here, we demonstrate that functionally active full-length PNKP is present in mitochondria as well as nuclei. Downregulation of PNKP results in an accumulation of strand breaks in mtDNA of hydrogen peroxide-treated cells. Full restoration of repair of the H2O2-induced strand breaks in mitochondria requires both the kinase and phosphatase activities of PNKP. We also demonstrate that PNKP contains a mitochondrial-targeting signal close to the C-terminus of the protein. We further show that PNKP associates with the mitochondrial protein mitofilin. Interaction with mitofilin may serve to translocate PNKP into mitochondria. PMID:22210862

  9. DNMT (DNA methyltransferase) inhibitors radiosensitize human cancer cells by suppressing DNA repair activity

    International Nuclear Information System (INIS)

    Histone modifications and DNA methylation are two major factors in epigenetic phenomenon. Unlike the histone deacetylase inhibitors, which are known to exert radiosensitizing effects, there have only been a few studies thus far concerning the role of DNA methyltransferase (DNMT) inhibitors as radiosensitizers. The principal objective of this study was to evaluate the effects of DNMT inhibitors on the radiosensitivity of human cancer cell lines, and to elucidate the mechanisms relevant to that process. A549 (lung cancer) and U373MG (glioblastoma) cells were exposed to radiation with or without six DNMT inhibitors (5-azacytidine, 5-aza-2'-deoxycytidine, zebularine, hydralazine, epigallocatechin gallate, and psammaplin A) for 18 hours prior to radiation, after which cell survival was evaluated via clonogenic assays. Cell cycle and apoptosis were analyzed via flow cytometry. Expressions of DNMT1, 3A/3B, and cleaved caspase-3 were detected via Western blotting. Expression of γH2AX, a marker of radiation-induced DNA double-strand break, was examined by immunocytochemistry. Pretreatment with psammaplin A, 5-aza-2'-deoxycytidine, and zebularine radiosensitized both A549 and U373MG cells. Pretreatment with psammaplin A increased the sub-G1 fraction of A549 cells, as compared to cells exposed to radiation alone. Prolongation of γH2AX expression was observed in the cells treated with DNMT inhibitors prior to radiation as compared with those treated by radiation alone. Psammaplin A, 5-aza-2'-deoxycytidine, and zebularine induce radiosensitivity in both A549 and U373MG cell lines, and suggest that this effect might be associated with the inhibition of DNA repair

  10. Active Achilles tendon kinesitherapy accelerates Achilles tendon repair by promoting neurite regeneration

    Institute of Scientific and Technical Information of China (English)

    Jiasharete Jielile; Beicen Hunapia; Ayidaer Jialihasi; Jingping Bai; Murat Kizaibek; Minawa Aibai; Gulnur Sabirhazi; Nuerai Shawutali; Wulanbai Tangkejie; Aynaz Badelhan; Yeermike Nuerduola; Turde Satewalede; Darehan Buranbai

    2012-01-01

    Active Achilles tendon kinesitherapy facilitates the functional recovery of a ruptured Achilles tendon. However, protein expression during the healing process remains a controversial issue. New Zealand rabbits, aged 14 weeks, underwent tenotomy followed immediately by Achilles tendon microsurgery to repair the Achilles tendon rupture. The tendon was then immobilized or subjected to postoperative early motion treatment (kinesitherapy). Mass spectrography results showed that after 14 days of motion treatment, 18 protein spots were differentially expressed, among which, 12 were up-regulated, consisting of gelsolin isoform b and neurite growth-related protein collapsing response mediator protein 2. Western blot analysis showed that gelsolin isoform b was up-regulated at days 7–21 of motion treatment. These findings suggest that active Achilles tendon kinesitherapy promotes the neurite regeneration of a ruptured Achilles tendon and gelsolin isoform b can be used as a biomarker for Achilles tendon healing after kinesitherapy.

  11. Effects of caffeine upon material repair systems involved in the rejoining of x-ray-induced chromosome breaks in the paternal genome of Drosophila melanogaster

    International Nuclear Information System (INIS)

    Experiments were carried out in which ring-X/B/sup s/Yy+ males were x-irradiated and mated with females which had been fed on either 1.0% caffeine in 10% sucrose, 0.2% caffeine in 10% sucrose, or on 10% sucrose alone. F1 progeny were scored for dominant lethals and sex chromosome losses, while in the F2 generation the frequency of translocations was monitored. In line with previous reports it was found that at a concentration of 0.2% caffeine the frequencies of dominant lethals and sex chromosome losses were increased while the frequency of translocations was depressed. At the higher concentration of 1.0% caffeine the frequencies of dominant lethals and sex chromosome losses were depressed. With respect to translocations, while the formation of translocations between autosomes was enhanced in the presence of 1.0% caffeine, the frequency of translocations between the Y and the autosomes was depressed relative to sucrose controls. The proposal is made that at high effective concentrations, caffeine promotes the rejoining of breaks induced in sperm, supported by evidence of an enhancement in the frequency of autosomal translocations in the 1.0% caffeine series and consistent with the depression in the frequencies of dominant lethals and sex chromosome losses in the 1.0% series as compared to sucrose controls

  12. Induction and repair of DNA double-strand breaks in blood lymphocytes of patients undergoing 18F-FDG PET/CT examinations

    International Nuclear Information System (INIS)

    The purpose of this study was to evaluate DNA double-strand breaks (DSBs) in blood lymphocytes of patients undergoing positron emission tomography (PET)/CT using γ-H2AX immunofluorescence microscopy and to differentiate between 18F-fluorodeoxyglucose (FDG) and CT-induced DNA lesions. This study was approved by the local Ethics Committee and complies with Health Insurance Portability and Accountability Act (HIPAA) requirements. After written informed consent was obtained, 33 patients underwent whole-body 18F-FDG PET/CT (3 MBq/kg body weight, 170/100 reference mAs at 120 kV). The FDG PET and CT portions were performed as an initial CT immediately followed by the PET. Blood samples were obtained before, at various time points following 18F-FDG application and up to 24 h after the CT scan. Distinct foci representing DSBs were quantified in isolated lymphocytes using fluorescence microscopy after staining against the phosphorylated histone variant γ-H2AX. The DSB values at the various time points were significantly different (p 18F-FDG administration (median excess foci 0.11/cell, range 0.06-0.27/cell) and 5 min after CT (median excess foci 0.17/cell, range 0.05-0.54/cell). A significant correlation between CT-induced DSBs and dose length product was obtained (ρ = 0.898, p 18F-FDG injection and 5 min after CT. The radionuclide contributes considerably to the total DSB induction in this setting. (orig.)

  13. Cytosines, but not purines, determine recombination activating gene (RAG)-induced breaks on heteroduplex DNA structures: implications for genomic instability.

    Science.gov (United States)

    Naik, Abani Kanta; Lieber, Michael R; Raghavan, Sathees C

    2010-03-01

    The sequence specificity of the recombination activating gene (RAG) complex during V(D)J recombination has been well studied. RAGs can also act as structure-specific nuclease; however, little is known about the mechanism of its action. Here, we show that in addition to DNA structure, sequence dictates the pattern and efficiency of RAG cleavage on altered DNA structures. Cytosine nucleotides are preferentially nicked by RAGs when present at single-stranded regions of heteroduplex DNA. Although unpaired thymine nucleotides are also nicked, the efficiency is many fold weaker. Induction of single- or double-strand breaks by RAGs depends on the position of cytosines and whether it is present on one or both of the strands. Interestingly, RAGs are unable to induce breaks when adenine or guanine nucleotides are present at single-strand regions. The nucleotide present immediately next to the bubble sequence could also affect RAG cleavage. Hence, we propose "C((d))C((S))C((S))" (d, double-stranded; s, single-stranded) as a consensus sequence for RAG-induced breaks at single-/double-strand DNA transitions. Such a consensus sequence motif is useful for explaining RAG cleavage on other types of DNA structures described in the literature. Therefore, the mechanism of RAG cleavage described here could explain facets of chromosomal rearrangements specific to lymphoid tissues leading to genomic instability. PMID:20051517

  14. Fluoride effect on the process of alveolar bone repair in rats: evaluation of activity of MMP-2 and 9

    Directory of Open Access Journals (Sweden)

    Mileni da Silva Fernandes

    2012-09-01

    Full Text Available Objective: The aim of this study was to evaluate comparatively the effect of fluoride (F on the activity of matrix metalloproteinases 2 and 9 (MMP-2 and MMP-9 involved in process of alveolar bone repair. Material and methods: This study used 4 groups of Wistar rats with 80 days of life (n = 160 which received drinking water containing different doses of fluoride (NaF: 5, 15, 50 ppm and deionized water (control throughout the experiment. These animals had their right upper incisors extracted. After extraction, the animals were euthanized at 7, 14, 21 and 30 days and the hemi-maxillae were collected for microscopic analysis (Hematoxylin and Eosin and immunohistochemistry for MMP-9 and zymography (MMP-2 and 9. Results: Microscopically the process of bone repair was similar in all groups, being noted only a delay of the blood clot resorption and bone formation in the group of 50 ppm F. The expression for MMP-9 showed differences between groups only during the initial repair (7 days. However, the zymography showed no significant differences between treated and control groups. Conclusion: Ours results suggest an effect of fluoride on the activity of MMPs 2 and 9 at the initial period of alveolar repair which could be associated to the process of blood clot remission and delay in bone repair. Further studies are needed to establish the relationship between the initial process of resorption of the blood clot, and the involvement of MMPs 2 and 9 and its regulators/tissue inhibitors.

  15. Electron Transfer Mechanisms of DNA Repair by Photolyase

    Science.gov (United States)

    Zhong, Dongping

    2015-04-01

    Photolyase is a flavin photoenzyme that repairs two DNA base damage products induced by ultraviolet (UV) light: cyclobutane pyrimidine dimers and 6-4 photoproducts. With femtosecond spectroscopy and site-directed mutagenesis, investigators have recently made significant advances in our understanding of UV-damaged DNA repair, and the entire enzymatic dynamics can now be mapped out in real time. For dimer repair, six elementary steps have been characterized, including three electron transfer reactions and two bond-breaking processes, and their reaction times have been determined. A unique electron-tunneling pathway was identified, and the critical residues in modulating the repair function at the active site were determined. The dynamic synergy between the elementary reactions for maintaining high repair efficiency was elucidated, and the biological nature of the flavin active state was uncovered. For 6-4 photoproduct repair, a proton-coupled electron transfer repair mechanism has been revealed. The elucidation of electron transfer mechanisms and two repair photocycles is significant and provides a molecular basis for future practical applications, such as in rational drug design for curing skin cancer.

  16. PHYSICAL PROPERTIES, STAR FORMATION, AND ACTIVE GALACTIC NUCLEUS ACTIVITY IN BALMER BREAK GALAXIES AT 0 < z < 1

    Energy Technology Data Exchange (ETDEWEB)

    Diaz Tello, J.; Donzelli, C. [IATE, Observatorio Astronomico de Cordoba, Universidad Nacional de Cordoba (Argentina); Padilla, N. [Departamento de Astronomia y Astrofisica, Pontificia Universidad Catolica de Chile (Chile); Fujishiro, N.; Yoshikawa, T. [Koyama Astronomical Observatory, Kyoto Sangyo University (Japan); Hanami, H. [Physics Section, Iwate University (Japan); Hatsukade, B., E-mail: jdiazt@oac.uncor.edu [Department of Astronomy, Kyoto University (Japan)

    2013-07-01

    We present a spectroscopic study with the derivation of the physical properties of 37 Balmer break galaxies, which have the necessary lines to locate them in star-forming-active galactic nuclei (AGNs) diagnostic diagrams. These galaxies span a redshift range from 0.045 to 0.93 and are somewhat less massive than similar samples of previous works. The studied sample has multiwavelength photometric data coverage from the ultraviolet to mid-infrared (MIR) Spitzer bands. We investigate the connection between star formation and AGN activity via optical, mass-excitation (MEx), and MIR diagnostic diagrams. Through optical diagrams, 31 (84%) star-forming galaxies, two (5%) composite galaxies, and three (8%) AGNs were classified, whereas from the MEx diagram only one galaxy was classified as AGN. A total of 19 galaxies have photometry available in all the IRAC/Spitzer bands. Of these, three AGN candidates were not classified as AGN in the optical diagrams, suggesting they are dusty/obscured AGNs, or that nuclear star formation has diluted their contributions. By fitting the spectral energy distribution of the galaxies, we derived the stellar masses, dust reddening E(B - V), ages, and UV star formation rates (SFRs). Furthermore, the relationship between SFR surface density ({Sigma}{sub SFR}) and stellar mass surface density per time unit ({Sigma}{sub M{sub */{tau}}}) as a function of redshift was investigated using the [O II] {lambda}3727, 3729, H{alpha} {lambda}6563 luminosities, which revealed that both quantities are larger for higher redshift galaxies. We also studied the SFR and specific SFR (SSFR) versus stellar mass and color relations, with the more massive galaxies having higher SFR values but lower SSFR values than less massive galaxies. These results are consistent with previous ones showing that, at a given mass, high-redshift galaxies have on average larger SFR and SSFR values than low-redshift galaxies. Finally, bluer galaxies have larger SSFR values than redder

  17. Axonal outgrowth is associated with increased ERK 1/2 activation but decreased caspase 3 linked cell death in Schwann cells after immediate nerve repair in rats

    Directory of Open Access Journals (Sweden)

    Kanje Martin

    2011-01-01

    Full Text Available Abstract Background Extracellular-signal regulated kinase (ERK1/2 is activated by nerve damage and its activation precedes survival and proliferation of Schwann cells. In contrast, activation of caspase 3, a cysteine protease, is considered as a marker for apoptosis in Schwann cells. In the present study, axonal outgrowth, activation of ERK1/2 by phosphorylation (p-ERK 1/2 and immunoreactivity of cleaved caspase 3 were examined after immediate, delayed, or no repair of transected rat sciatic nerves. Results Axonal outgrowth, detected by neurofilament staining, was longer after immediate repair than after either the delayed or no repair conditions. Immediate repair also showed a higher expression of p-ERK 1/2 and a lower number of cleaved caspase 3 stained Schwann cells than after delayed nerve repair. If the transected nerve was not repaired a lower level of p-ERK 1/2 was found than in either the immediate or delayed repair conditions. Axonal outgrowth correlated to p-ERK 1/2, but not clearly with cleaved caspase 3. Contact with regenerating axons affected Schwann cells with respect to p-ERK 1/2 and cleaved caspase 3 after immediate nerve repair only. Conclusion The decreased regenerative capacity that has historically been observed after delayed nerve repair may be related to impaired activation of Schwann cells and increased Schwann cell death. Outgrowing axons influence ERK 1/2 activation and apoptosis of Schwann cells.

  18. Early rehabilitation affects functional outcomes and activities of daily living after arthroscopic rotator cuff repair: a case report.

    Science.gov (United States)

    Shimo, Satoshi; Sakamoto, Yuta; Tokiyoshi, Akinari; Yamamoto, Yasuhiro

    2016-01-01

    [Purpose] The effect of early rehabilitation protocols after arthroscopic rotator cuff repair is currently unknown. We examined short-term effects of early rehabilitation on functional outcomes and activities of daily living after arthroscopic rotator cuff repair. [Subject and Methods] An 82-year-old male fell during a walk, resulting in a supraspinatus tear. Arthroscopic rotator cuff repair was performed using a single-row technique. He wore an abduction brace for 6 weeks after surgery. [Results] From day 1 after surgery, passive range of motion exercises, including forward flexion and internal and external rotation were performed twice per day. Starting at 6 weeks after surgery, active range of motion exercises and muscle strengthening exercises were introduced gradually. At 6 weeks after surgery, his active forward flexion was 150°, UCLA shoulder rating scale score was 34 points, and Quick Disabilities of the Arm, Shoulder, and Hand questionnaire disability/symptom score was 36 points. At 20 weeks after surgery, his active forward flexion was 120°, UCLA shoulder rating scale score was 34 points, and Quick Disabilities of the Arm, Shoulder, and Hand questionnaire disability/symptom score was 0 points. [Conclusion] These protocols are recommended to physical therapists during rehabilitation for arthroscopic rotator cuff repair to support rapid reintegration into activities of daily living. PMID:27064886

  19. Early rehabilitation affects functional outcomes and activities of daily living after arthroscopic rotator cuff repair: a case report

    Science.gov (United States)

    Shimo, Satoshi; Sakamoto, Yuta; Tokiyoshi, Akinari; Yamamoto, Yasuhiro

    2016-01-01

    [Purpose] The effect of early rehabilitation protocols after arthroscopic rotator cuff repair is currently unknown. We examined short-term effects of early rehabilitation on functional outcomes and activities of daily living after arthroscopic rotator cuff repair. [Subject and Methods] An 82-year-old male fell during a walk, resulting in a supraspinatus tear. Arthroscopic rotator cuff repair was performed using a single-row technique. He wore an abduction brace for 6 weeks after surgery. [Results] From day 1 after surgery, passive range of motion exercises, including forward flexion and internal and external rotation were performed twice per day. Starting at 6 weeks after surgery, active range of motion exercises and muscle strengthening exercises were introduced gradually. At 6 weeks after surgery, his active forward flexion was 150°, UCLA shoulder rating scale score was 34 points, and Quick Disabilities of the Arm, Shoulder, and Hand questionnaire disability/symptom score was 36 points. At 20 weeks after surgery, his active forward flexion was 120°, UCLA shoulder rating scale score was 34 points, and Quick Disabilities of the Arm, Shoulder, and Hand questionnaire disability/symptom score was 0 points. [Conclusion] These protocols are recommended to physical therapists during rehabilitation for arthroscopic rotator cuff repair to support rapid reintegration into activities of daily living. PMID:27064886

  20. Star formation activity in Balmer break galaxies at $z$ < 1.5

    CERN Document Server

    Tello, J Díaz; Padilla, N; Akiyama, M; Fujishiro, N; Yoshikawa, T; Hanami, H

    2016-01-01

    Aims. We present a spectroscopic study of the properties of 64 Balmer break galaxies that show signs of star formation. The studied sample of star-forming galaxies spans a redshift range from 0.094 to 1.475 with stellar masses in the range 10$^{8}-$10$^{12}$ $M_{\\odot}$. The sample also includes eight broad emission line galaxies with redshifts between 1.5 $break in the correlation, which reveals the presence of massive galaxies with lower SFR values (i.e., decreasing star formation). We also note an anticorrelation for the SSFR with the stellar mass. Again in this case, our data is also consis...

  1. 75 FR 13127 - Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied...

    Science.gov (United States)

    2010-03-18

    ... Exposure Reduction. In the Federal Register dated April 22, 2008 (73 FR 21692), EPA promulgated final TSCA... are conducted in target housing and child-occupied facilities: 1. Establish the discipline of lead... AGENCY Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child...

  2. 75 FR 51808 - Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied...

    Science.gov (United States)

    2010-08-23

    ... April 22, 2008, (73 FR 21692), EPA promulgated final TSCA section 402(c)(3) regulations governing... in target housing and child-occupied facilities. These rules: 1. Establish the discipline of lead... AGENCY Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child...

  3. Metabolism, genomics, and DNA repair in the mouse aging liver

    DEFF Research Database (Denmark)

    Lebel, Michel; de Souza-Pinto, Nadja C; Bohr, Vilhelm A

    2011-01-01

    , such as oxidized bases or persistent breaks, increase with age and correlate well with the presence of senescent hepatocytes. The level of DNA damage and/or mutation can be affected by changes in carcinogen activation, decreased ability to repair DNA, or a combination of these factors. This paper...... covers some of the DNA repair pathways affecting liver homeostasis with age using rodents as model systems....... hepatic metabolic and detoxification activities, with implications for systemic aging and age-related disease. It has become clear, using rodent models as biological tools, that genetic instability in the form of gross DNA rearrangements or point mutations accumulate in the liver with age. DNA lesions...

  4. Lamin A Is an Endogenous SIRT6 Activator and Promotes SIRT6-Mediated DNA Repair

    Directory of Open Access Journals (Sweden)

    Shrestha Ghosh

    2015-11-01

    Full Text Available The nuclear lamins are essential for various molecular events in the nucleus, such as chromatin organization, DNA replication, and provision of mechanical support. A specific point mutation in the LMNA gene creates a truncated prelamin A termed progerin, causing Hutchinson-Gilford progeria syndrome (HGPS. SIRT6 deficiency leads to defective genomic maintenance and accelerated aging similar to HGPS, suggesting a potential link between lamin A and SIRT6. Here, we report that lamin A is an endogenous activator of SIRT6 and facilitates chromatin localization of SIRT6 upon DNA damage. Lamin A promotes SIRT6-dependent DNA-PKcs (DNA-PK catalytic subunit recruitment to chromatin, CtIP deacetylation, and PARP1 mono-ADP ribosylation in response to DNA damage. The presence of progerin jeopardizes SIRT6 activation and compromises SIRT6-mediated molecular events in response to DNA damage. These data reveal a critical role for lamin A in regulating SIRT6 activities, suggesting that defects in SIRT6 functions contribute to impaired DNA repair and accelerated aging in HGPS.

  5. Genetic characterization of cells of homocystinuria patients with disrupted DNA repair system

    International Nuclear Information System (INIS)

    Fibroblasts obtained from biopsy material and lymphocytes of patients with homocystinuria were investigated for repair activity according to the following criteria: rejoined DNA breaks, induced by 4-nitroquinoline-1-oxide and γ-radiation; indices of reactivation and induced mutagenesis of smallpox vaccine virus treated with these mutagens. In lymphocytes a defect of DNA repair was observed according to all criteria investigated. During passage of fibroblast cultures, inhibition of repair activity of cells was preserved according to γ-type. Increase in the number of spontaneous and γ-induced mutations of virus was noted according to degree of passage of fibroblasts

  6. Acetylation regulates WRN catalytic activities and affects base excision DNA repair

    DEFF Research Database (Denmark)

    Muftuoglu, Meltem; Kusumoto, Rika; Speina, Elzbieta;

    2008-01-01

    The Werner protein (WRN), defective in the premature aging disorder Werner syndrome, participates in a number of DNA metabolic processes, and we have been interested in the possible regulation of its function in DNA repair by post-translational modifications. Acetylation mediated by histone...... acetyltransferases is of key interest because of its potential importance in aging, DNA repair and transcription....

  7. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Erhong; Hanna, Ann; Samant, Rajeev S.; Shevde, Lalita A., E-mail: lsamant@uab.edu [Department of Pathology, Comprehensive Cancer Center, University of Alabama at Birmingham, WTI320D, 1824 6th Avenue South, Birmingham, AL 35233 (United States)

    2015-07-21

    Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair). Aberrant activation of the Hedgehog (Hh) signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer.

  8. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    Directory of Open Access Journals (Sweden)

    Erhong Meng

    2015-07-01

    Full Text Available Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair. Aberrant activation of the Hedgehog (Hh signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer.

  9. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    International Nuclear Information System (INIS)

    Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair). Aberrant activation of the Hedgehog (Hh) signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer

  10. Beta-carotene suppression of benzophenone-sensitized lipid peroxidation in hexane through additional chain-breaking activities

    International Nuclear Information System (INIS)

    The aim of this work is to estimate the antioxidant activity of β-carotene in the presence of two different mixtures of phospholipids in hexane solution, under continuous UV-irradiation from three different ranges (UV-A, UV-B, and UV-C). β-Carotene is employed to control lipid peroxidation process generated by UV-irradiation, in the presence and in the absence of selected photosensitizer, benzophenone, by scavenging the involved, created free radicals. The results show that β-carotene undergoes to a substantial, probably structural dependent destruction (bleaching), highly dependent on UV-photons energy input, more expressed in the presence than in the absence of benzophenone. The additional bleaching is synchronized with the further increase in β-carotene antioxidant activity in the presence of benzophenone, implying the same cause: increase in (phospholipids peroxidation) chain-breaking activities.

  11. Beta-carotene suppression of benzophenone-sensitized lipid peroxidation in hexane through additional chain-breaking activities

    Energy Technology Data Exchange (ETDEWEB)

    Cvetkovic, Dragan [Faculty of Technology, 16000 Leskovac (Serbia); Markovic, Dejan, E-mail: dejan_markovic57@yahoo.co [Faculty of Technology, 16000 Leskovac (Serbia)

    2011-01-15

    The aim of this work is to estimate the antioxidant activity of {beta}-carotene in the presence of two different mixtures of phospholipids in hexane solution, under continuous UV-irradiation from three different ranges (UV-A, UV-B, and UV-C). {beta}-Carotene is employed to control lipid peroxidation process generated by UV-irradiation, in the presence and in the absence of selected photosensitizer, benzophenone, by scavenging the involved, created free radicals. The results show that {beta}-carotene undergoes to a substantial, probably structural dependent destruction (bleaching), highly dependent on UV-photons energy input, more expressed in the presence than in the absence of benzophenone. The additional bleaching is synchronized with the further increase in {beta}-carotene antioxidant activity in the presence of benzophenone, implying the same cause: increase in (phospholipids peroxidation) chain-breaking activities.

  12. Repair of X-ray induced ruptures in DNA of blue-green alga Anacystis nidulans

    International Nuclear Information System (INIS)

    The work deals with systems of repair of radiation damage in the DNA of the blue-green alga Anacystis nidulans by the modified method of DNA fractionation by molecular weight with centrifuging in an alkaline sucrose gradient. It is shown that effective post-radiation repair of X-ray-induced breaks in DNA in A. nidulans cells takes place only after irradiation in a tris-HCl buffer at 200C. It is assumed that the system of restoration in actively metabolizing cells is similar to the mechanism of ''slow'' repair, which is responsible for repair synthesis and the elimination of the gaps formed during excision or post-replicative repair. On the basis of the differences found in the DNA sedimentation profiles immediately after irradiation of cells at 00 or 200 in a tris-HCl or a cerium buffer, the authors conclude that A. nidulans cells also have ''rapid'' repair systems which operate right in the irradiation period and resotre the single-strand breaks in DNA. Irradiation in a cerium buffer or at low temperature inhibited both the ''rapid'' and the ''slow'' repair of breaks in DNA. (V.A.P.)

  13. MR imaging and T2 measurements in peripheral nerve repair with activation of Toll-like receptor 4 of neurotmesis

    International Nuclear Information System (INIS)

    To investigate the role of MR imaging in neurotmesis combined with surgical repair and Toll-like receptor 4 (TLR4) activation. Forty-eight rats received subepineurial microinjection of the TLR4 agonist lipopolysaccharide (LPS, n = 24) or phosphate buffered saline (PBS, n = 24) immediately after surgical repair of the transected sciatic nerve. Sequential fat-suppressed T2-weighted imaging and quantitative T2 measurements were obtained at 3, 7, 14 and 21 days after surgery, with histologic assessments performed at regular intervals. T2 relaxation times and histological quantification of the distal stumps were measured and compared. The distal stumps of transected nerves treated with LPS or PBS both showed persistent enlargement and hyperintense signal. T2 values of the distal stumps showed a rapid rise to peak level followed by a rapid decline pattern in nerves treated with LPS, while exhibiting a slow rise to peak value followed by a slow decline in nerves treated with PBS. Nerves treated with LPS exhibited more prominent macrophage recruitment, faster myelin debris clearance and more pronounced nerve regeneration. Nerves treated with TLR4 activation had a characteristic pattern of T2 value change over time. Longitudinal T2 measurements can be used to detect the enhanced repair effect associated with TLR4 activation in the surgical repair of neurotmesis. (orig.)

  14. MR imaging and T2 measurements in peripheral nerve repair with activation of Toll-like receptor 4 of neurotmesis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiang; Zhang, Fang; Lu, Liejing; Li, Haojiang; Wen, Xuehua; Shen, Jun [Sun Yat-Sen University, Department of Radiology, Sun Yat-Sen Memorial Hospital, Guangzhou, Guangdong (China)

    2014-05-15

    To investigate the role of MR imaging in neurotmesis combined with surgical repair and Toll-like receptor 4 (TLR4) activation. Forty-eight rats received subepineurial microinjection of the TLR4 agonist lipopolysaccharide (LPS, n = 24) or phosphate buffered saline (PBS, n = 24) immediately after surgical repair of the transected sciatic nerve. Sequential fat-suppressed T2-weighted imaging and quantitative T2 measurements were obtained at 3, 7, 14 and 21 days after surgery, with histologic assessments performed at regular intervals. T2 relaxation times and histological quantification of the distal stumps were measured and compared. The distal stumps of transected nerves treated with LPS or PBS both showed persistent enlargement and hyperintense signal. T2 values of the distal stumps showed a rapid rise to peak level followed by a rapid decline pattern in nerves treated with LPS, while exhibiting a slow rise to peak value followed by a slow decline in nerves treated with PBS. Nerves treated with LPS exhibited more prominent macrophage recruitment, faster myelin debris clearance and more pronounced nerve regeneration. Nerves treated with TLR4 activation had a characteristic pattern of T2 value change over time. Longitudinal T2 measurements can be used to detect the enhanced repair effect associated with TLR4 activation in the surgical repair of neurotmesis. (orig.)

  15. Break-Induced Replication Requires DNA Damage-Induced Phosphorylation of Pif1 and Leads to Telomere Lengthening

    OpenAIRE

    Yulia Vasianovich; Harrington, Lea A.; Svetlana Makovets

    2014-01-01

    Broken replication forks result in DNA breaks that are normally repaired via homologous recombination or break induced replication (BIR). Mild insufficiency in the replicative ligase Cdc9 in budding yeast Saccharomyces cerevisiae resulted in a population of cells with persistent DNA damage, most likely due to broken replication forks, constitutive activation of the DNA damage checkpoint and longer telomeres. This telomere lengthening required functional telomerase, the core DNA damage signali...

  16. Leakage of high active liquid waste into the thermowell of HALW evaporator (4/4). Repair work for leakage prevention

    International Nuclear Information System (INIS)

    Leakage of high active liquid waste into the thermowell of High Active Liquid Waste (HALW) Evaporator was confirmed when thermometers were replaced in Rokkasho Reprocessing Plant. We estimate that the cause of the leakage is tunnel corrosion at the bottom cap of the thermowell due to high temperature at the bottom of the evaporator. This paper deals with the repair work for the leakage prevention. (author)

  17. Quaternary ammonium silane-functionalized, methacrylate resin composition with antimicrobial activities and self-repair potential.

    Science.gov (United States)

    Gong, Shi-qiang; Niu, Li-Na; Kemp, Lisa K; Yiu, Cynthia K Y; Ryou, Heonjune; Qi, Yi-Pin; Blizzard, John D; Nikonov, Sergey; Brackett, Martha G; Messer, Regina L W; Wu, Christine D; Mao, Jing; Bryan Brister, L; Rueggeberg, Frederick A; Arola, Dwayne D; Pashley, David H; Tay, Franklin R

    2012-09-01

    The design of antimicrobial polymers to address healthcare issues and minimize environmental problems is an important endeavor with both fundamental and practical implications. Quaternary ammonium silane-functionalized methacrylate (QAMS) represents an example of antimicrobial macromonomers synthesized by a sol-gel chemical route; these compounds possess flexible Si-O-Si bonds. In present work, a partially hydrolyzed QAMS co-polymerized with 2,2-[4(2-hydroxy 3-methacryloxypropoxy)-phenyl]propane is introduced. This methacrylate resin was shown to possess desirable mechanical properties with both a high degree of conversion and minimal polymerization shrinkage. The kill-on-contact microbiocidal activities of this resin were demonstrated using single-species biofilms of Streptococcus mutans (ATCC 36558), Actinomyces naeslundii (ATCC 12104) and Candida albicans (ATCC 90028). Improved mechanical properties after hydration provided the proof-of-concept that QAMS-incorporated resin exhibits self-repair potential via water-induced condensation of organic modified silicate (ormosil) phases within the polymerized resin matrix. PMID:22659173

  18. A baculovirus photolyase with DNA repair activity and circadian clock regulatory function

    NARCIS (Netherlands)

    Biernat, M.A.; Eker, A.P.M.; Oers, van M.M.; Vlak, J.M.; Horst, van der G.T.J.; Chaves, I.

    2012-01-01

    Cryptochromes and photolyases belong to the same family of flavoproteins but, despite being structurally conserved, display distinct functions. Photolyases use visible light to repair ultraviolet-induced DNA damage. Cryptochromes, however, function as blue-light receptors, circadian photoreceptors,

  19. Active transcriptomic and proteomic reprogramming in the C. elegans nucleotide excision repair mutant xpa-1.

    Science.gov (United States)

    Kassahun, Henok; Nilsen, Hilde

    2013-10-01

    Oxidative stress promotes human aging and contributes to common neurodegenerative diseases. Endogenous DNA damage induced by oxidative stress is believed to be an important promoter of neurodegenerative diseases. Although a large amount of evidence correlates a reduced DNA repair capacity with aging and neurodegenerative disease, there is little direct evidence of causality. Moreover, the contribution of oxidative DNA damage to the aging process is poorly understood. We have used the nematode Caenorhabditis elegans to study the contribution of oxidative DNA damage and repair to aging. C. elegans is particularly well suited to tackle this problem because it has a minimum complexity DNA repair system, which enables us to circumvent the important limitation presented by the extensive redundancy of DNA repair enzymes in mammals. PMID:24744987

  20. A critical role for topoisomerase IIb and DNA double strand breaks in transcription.

    Science.gov (United States)

    Calderwood, Stuart K

    2016-05-26

    Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb. PMID:27100743

  1. HCMV-infected cells maintain efficient nucleotide excision repair of the viral genome while abrogating repair of the host genome.

    Directory of Open Access Journals (Sweden)

    John M O'Dowd

    Full Text Available Many viruses subvert the host cell's ability to mount and complete various DNA damage responses (DDRs after infection. HCMV infection of permissive fibroblasts activates host DDRs at the time of viral deposition and during replication, but the DDRs remain uncompleted without arrest or apoptosis. We believe this was in part due to partitioning of the damage response and double strand break repair components. After extraction of soluble proteins, the localization of these components fell into three groups: specifically associated with the viral replication centers (RCs, diffused throughout the nucleoplasm and excluded from the RCs. Others have shown that cells are incapable of processing exogenously introduced damage after infection. We hypothesized that the inability of the cells to process damage might be due to the differential association of repair components within the RCs and, in turn, potentially preferential repair of the viral genome and compromised repair of the host genome. To test this hypothesis we used multiple strategies to examine repair of UV-induced DNA damage in mock and virus-infected fibroblasts. Comet assays indicated that repair was initiated, but was not completed in infected cells. Quantitative analysis of immunofluorescent localization of cyclobutane pyrimidine dimers (CPDs revealed that after 24 h of repair, CPDs were significantly reduced in viral DNA, but not significantly changed in the infected host DNA. To further quantitate CPD repair, we developed a novel dual-color Southern protocol allowing visualization of host and viral DNA simultaneously. Combining this Southern methodology with a CPD-specific T4 endonuclease V alkaline agarose assay to quantitate repair of adducts, we found efficient repair of CPDs from the viral DNA but not host cellular DNA. Our data confirm that NER functions in HCMV-infected cells and almost exclusively repairs the viral genome to the detriment of the host's genome.

  2. Global endometrial transcriptomic profiling: transient immune activation precedes tissue proliferation and repair in healthy beef cows

    Directory of Open Access Journals (Sweden)

    Foley Cathriona

    2012-09-01

    Full Text Available Abstract Background All cows experience bacterial contamination and tissue injury in the uterus postpartum, instigating a local inflammatory immune response. However mechanisms that control inflammation and achieve a physiologically functioning endometrium, while avoiding disease in the postpartum cow are not succinctly defined. This study aimed to identify novel candidate genes indicative of inflammation resolution during involution in healthy beef cows. Previous histological analysis of the endometrium revealed elevated inflammation 15 days postpartum (DPP which was significantly decreased by 30 DPP. The current study generated a genome-wide transcriptomic profile of endometrial biopsies from these cows at both time points using mRNA-Seq. The pathway analysis tool GoSeq identified KEGG pathways enriched by significantly differentially expressed genes at both time points. Novel candidate genes associated with inflammatory resolution were subsequently validated in additional postpartum animals using quantitative real-time PCR (qRT-PCR. Results mRNA-Seq revealed 1,107 significantly differentially expressed genes, 73 of which were increased 15 DPP and 1,034 were increased 30 DPP. Early postpartum, enriched immune pathways (adjusted P P SAA1/2, GATA2, IGF1, SHC2, and SERPINA14 genes were significantly elevated 30 DPP and are functionally associated with tissue repair and the restoration of uterine homeostasis postpartum. Conclusions The results of this study reveal an early activation of the immune response which undergoes a temporal functional change toward tissue proliferation and regeneration during endometrial involution in healthy postpartum cows. These molecular changes mirror the activation and resolution of endometrial inflammation during involution previously classified by the degree of neutrophil infiltration. SAA1/2, GATA2, IGF1, SHC2, and SERPINA14 genes may become potential markers for resolution of endometrial inflammation in

  3. DNA repair: Dynamic defenders against cancer and aging

    Energy Technology Data Exchange (ETDEWEB)

    Fuss, Jill O.; Cooper, Priscilla K.

    2006-04-01

    (UV) component of sunlight. NER can be divided into two classes based on where the repair occurs. NER occurring in DNA that is not undergoing transcription (i.e., most of the genome) is called global genome repair (GGR or GGNER), while NER taking place in the transcribed strand of active genes is called transcription-coupled repair (TCR or TC-NER). We will explore NER in more detail below. Mismatch repair (MMR) is another type of excision repair that specifically removes mispaired bases resulting from replication errors. DNA damage can also result in breaks in the DNA backbone, in one or both strands. Single-strand breaks (SSBs) are efficiently repaired by a mechanism that shares common features with the later steps in BER. Double-strand breaks (DSBs) are especially devastating since by definition there is no intact complementary strand to serve as a template for repair, and even one unrepaired DSB can be lethal [3]. In cells that have replicated their DNA prior to cell division, the missing information can be supplied by the duplicate copy, or sister chromatid, and DSBs in these cells are faithfully repaired by homologous recombination involving the exchange of strands of DNA between the two copies. However, most cells in the body are non-dividing, and in these cells the major mechanism for repairing DSBs is by non-homologous end joining (NHEJ), which as the name implies involves joining two broken DNA ends together without a requirement for homologous sequence and which therefore has a high potential for loss of genetic information.

  4. DNA repair in PHA stimulated human lymphocytes

    International Nuclear Information System (INIS)

    Damage an repair of radiation induced DNA strand breaks were measured by alkaline lysis and hydroxyapatite chromatography. PHA stimulated human lymphocytes show that the rejoining process is complete within the first 50 min., afterwords secondary DNA damage and chromatid aberration. DNA repair, in synchronized culture, allows to evaluate individual repair capacity and this in turn can contribute to the discovery of individual who, although they do not demonstrate apparent clinical signs, are carriers of DNA repair deficiency. Being evident that a correlation exists between DNA repair capacity and carcinogenesis, the possibility of evaluating the existent relationship between DNA repair and survival in tumor cells comes therefore into discussion

  5. Mutagenicity of 2-amino-3-methylimidazo[4,5-f]quinoline in colon and liver of Big Blue Rats: role of DNA adducts, strand breaks, DNA repair and oxidative stress

    DEFF Research Database (Denmark)

    Møller, Peter; Wallin, Håkan; Vogel, Ulla;

    2002-01-01

    The contribution of oxidative stress, different types of DNA damage and expression of DNA repair enzymes in colon and liver mutagenesis induced by 2-amino-3-methylimidazo [4,5-f]quinoline (IQ) was investigated in four groups of six Big Blue rats fed diets with 0, 20, 70, and 200 mg IQ/kg for 3....... Investigations of oxidative stress biomarkers produced inconclusive results. Oxidative DNA damage detected by the endonuclease III enzyme and 7-hydro-8-oxo-2'-deoxyguanosine in colon, liver and/or urine was unaltered by IQ. However, there was increased level of gamma-glutamyl semialdehyde in liver proteins......, indicating a higher rate of protein oxidation in the liver following IQ administration. In plasma and erythrocytes there were unaltered levels of oxidized protein, malondialdehyde, and antioxidant enzyme activities (superoxide dismutase, glutathione peroxidase, catalase, glutathione reductase) indicating...

  6. Mutagenicity of 2-amino-3-methylimidazo[4,5-f]quinoline in colon and liver of Big Blue rats: role of DNA adducts, strand breaks, DNA repair and oxidative stress

    DEFF Research Database (Denmark)

    Moller, P.; Wallin, H.; Vogel, U.;

    2002-01-01

    The contribution of oxidative stress, different types of DNA damage and expression of DNA repair enzymes in colon and liver mutagenesis induced by 2-amino-3-methylimidazo [4,5-f]quinoline (IQ) was investigated in four groups of six Big Blue rats fed diets with 0, 20, 70, and 200 mg IQ/kg for 3....... Investigations of oxidative stress biomarkers produced inconclusive results. Oxidative DNA damage detected by the endonuclease III enzyme and 7-hydro-8-oxo-2'-deoxyguanosine in colon, liver and/or urine was unaltered by IQ. However, there was increased level of gamma-glutamyl semialdehyde in liver proteins......, indicating a higher rate of protein oxidation in the liver following IQ administration. In plasma and erythrocytes there were unaltered levels of oxidized protein, malondialdehyde, and antioxidant enzyme activities (superoxide dismutase, glutathione peroxidase, catalase, glutathione reductase) indicating...

  7. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage-induced cell senescence.

    Science.gov (United States)

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A; Kumar, Sheetal; Kalab, Petr

    2016-04-15

    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase-regulated nuclear-cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage-induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β-dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP-regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  8. Deficient repair of potentially lethal damage in actively growing ataxia telangiectasia cells

    International Nuclear Information System (INIS)

    The repair of potentially lethal damage after X rays was studied in exponentially growing normal and ataxia telangiectasia (A-T) strains of human fibroblasts. X-ray killing of all normal strains from six healthy persons was enhanced when cells were treated with hypertonic phosphate-buffered saline immediately after irradiation. This treatment is not toxic to unirradiated cells and demonstrates that ordinarily these cells repair potentially lethal damage. The potentially lethal damage in normal cells is repaired within 1 hr. In contrast, all A-T strains from four A-T patients were completely deficient in their ability to repair potentially lethal damage. Treatment with a hypertonic solution after X irradiation is known to increase the frequency of chromosomal aberrations and to enhance cell killing, as though hypertonicity had induced the A-T state in normal cells. These results support the inference that the increased radiosensitivity of A-T cells can be attributed to some defect in the repair of DNA damage rather than abnormal DNA synthesis following irradiation

  9. Histone H2AX phosphorylation as a measure of DNA double-strand breaks and a marker of environmental stress and disease activity in lupus

    Science.gov (United States)

    Namas, Rajaie; Renauer, Paul; Ognenovski, Mikhail; Tsou, Pei-Suen; Sawalha, Amr H

    2016-01-01

    Objective Defective or inefficient DNA double-strand break (DSB) repair results in failure to preserve genomic integrity leading to apoptotic cell death, a hallmark of systemic lupus erythematosus (SLE). Compelling evidence linked environmental factors that increase oxidative stress with SLE risk and the formation of DSBs. In this study, we sought to further explore genotoxic stress sensitivity in SLE by investigating DSB accumulation as a marker linking the effect of environmental stressors and the chromatin microenvironment. Methods DSBs were quantified in peripheral blood mononuclear cell subsets from patients with SLE, healthy controls, and patients with rheumatoid arthritis (RA) by measuring phosphorylated H2AX (phospho-H2AX) levels with flow cytometry. Phospho-H2AX levels were assessed in G0/G1, S and G2 cell-cycle phases using propidium iodide staining, and after oxidative stress using 0.5 µM hydrogen peroxide exposure for 0, 2, 5, 10, 30 and 60 min. Results DSB levels were significantly increased in CD4+ T cells, CD8+ T cells and monocytes in SLE compared with healthy controls (p=2.16×10−4, 1.68×10−3 and 4.74×10−3, respectively) and RA (p=1.05×10−3, 1.78×10−3 and 2.43×10−2, respectively). This increase in DSBs in SLE was independent of the cell-cycle phase, and correlated with disease activity. In CD4+ T cells, CD8+ T cells and monocytes, oxidative stress exposure induced significantly higher DSB accumulation in SLE compared with healthy controls (60 min; p=1.64×10−6, 8.11×10−7 and 2.04×10−3, respectively). Conclusions Our data indicate that SLE T cells and monocytes have increased baseline DSB levels and an increased sensitivity to acquiring DSBs in response to oxidative stress. Although the mechanism underlying DSB sensitivity in SLE requires further investigation, accumulation of DSB may serve a biomarker for disease activity in SLE and help explain increased apoptotic cell accumulation in this disease. PMID:27158526

  10. String breaking

    CERN Document Server

    Bali, G S; Lippert, T; Neff, H; Prkacin, Z; Schilling, K; Bali, Gunnar S; Dussel, Thomas; Lippert, Thomas; Neff, Hartmut; Prkacin, Zdravko; Schilling, Klaus

    2006-01-01

    We numerically investigate the transition of the static quark-antiquark string into a static-light meson-antimeson system. Improving noise reduction techniques, we are able to resolve the signature of string breaking dynamics for Nf=2 lattice QCD at zero temperature. We discuss the lattice techniques used and present results on energy levels and mixing angle of the static two-state system. We visualize the action density distribution in the region of string breaking as a function of the static colour source-antisource separation. The results can be related to properties of quarkonium systems.

  11. TECHNICAL NOTE: A real-time active smart patch system for monitoring the integrity of bonded repair on an aircraft structure

    Science.gov (United States)

    Qing, Xinlin P.; Beard, Shawn J.; Kumar, Amrita; Hannum, Robert

    2006-06-01

    There currently exists a need to develop a cost-effective, in-service structural health monitoring (SHM) system for determining the initial quality of a bonded repair and assessing the long-term durability of the bonded repair on an aircraft structure. In this paper, a real-time active smart patch system (SPS) based on SMART layer technology is introduced for monitoring the integrity of bonded repairs. First, an overview of the SPS is given for typical metal and composite repairs. To illustrate the capability of the SPS, three applications are presented: (1) monitoring of the cure progress of the bonded repair adhesive, (2) detection of the initial artificial disbond between the composite patch and the metal structure, and (3) monitoring of damage in and around a bonded repair during fatigue cycling. The results show that, through the use of a real-time active SPS approach of using sensors placed in, on or around the repair, the initial quality and long-term durability of the repair can be evaluated and monitored.

  12. Functional analysis of the RAD50/MRE11 protein complex through targeted disruption of the murine RAD50 genomic locus: implications for DNA double strand break repair. An astro research fellowship presentation

    International Nuclear Information System (INIS)

    Purpose/Objective: The products of the S. cerevisiae genes ScRAD50 and ScMRE11 act in a protein complex and are required for non-homologous end-joining, the predominant mechanism of DNA double strand break (dsb) repair in mammalian cells. Mutation of these genes results in sensitivity to ionizing radiation (IR), a defect in initiation of meiosis, increased and error-prone recombination during mitosis, and overall genomic instability. This resultant phenotype is reminiscent of that seen in mammalian syndromes of genomic instability such as ataxia-telangiectasia and Bloom syndrome, hallmarks of which are radiation sensitivity and predisposition to malignancy. The murine homologues to ScRAD50 and ScMRE11 have recently been identified; both demonstrate impressive primary sequence conservation with their yeast counterparts, and are expected to mediate conserved functions. The roles of muRAD50 in genomic maintenance and in dsb repair will be examined in two parts. The first will include a determination of normal muRAD50 expression patterns. Second, the effects of disruption of the muRAD50 gene will be assessed. A specific targeting event has introduced a conditional murad50 null mutation into the genome of murine embryonic stem (ES) cells. These mutant ES cells are being used to create mutant mice, thus allowing functional characterization of muRAD50 on both the cellular and organismic levels. Such analyses will contribute to the delineation of the mammalian dsb repair pathway and to the cellular response to IR, and will serve as a mammalian model system for genomic instability. Materials and Methods: Wild-type tissue expression patterns and protein-protein interactions were determined by standard biochemical techniques, including immunoprecipitation, polyacrylamide gel electrophoresis, and Western blotting. Molecular cloning techniques were used to create the gene targeting vectors, which were designed to result in either a deletion of exon 1 (equivalent to a null

  13. A rapid transcriptional activation is induced by the dormancy-breaking chemical hydrogen cyanamide in kiwifruit (Actinidia deliciosa) buds

    Science.gov (United States)

    Walton, Eric F.; Wu, Rong-Mei; Richardson, Annette C.; Davy, Marcus; Hellens, Roger P.; Thodey, Kate; Janssen, Bart J.; Gleave, Andrew P.; Rae, Georgina M.; Wood, Marion; Schaffer, Robert J.

    2009-01-01

    Budbreak in kiwifruit (Actinidia deliciosa) can be poor in locations that have warm winters with insufficient winter chilling. Kiwifruit vines are often treated with the dormancy-breaking chemical hydrogen cyanamide (HC) to increase and synchronize budbreak. This treatment also offers a tool to understand the processes involved in budbreak. A genomics approach is presented here to increase our understanding of budbreak in kiwifruit. Most genes identified following HC application appear to be associated with responses to stress, but a number of genes appear to be associated with the reactivation of growth. Three patterns of gene expression were identified: Profile 1, an HC-induced transient activation; Profile 2, an HC-induced transient activation followed by a growth-related activation; and Profile 3, HC- and growth-repressed. One group of genes that was rapidly up-regulated in response to HC was the glutathione S-transferase (GST) class of genes, which have been associated with stress and signalling. Previous budbreak studies, in three other species, also report up-regulated GST expression. Phylogenetic analysis of these GSTs showed that they clustered into two sub-clades, suggesting a strong correlation between their expression and budbreak across species. PMID:19651683

  14. Effect of low dose {gamma} radiation on the dormancy breaking and physiological activity of 'Dejima' seed potato

    Energy Technology Data Exchange (ETDEWEB)

    Kim, J. S.; Kim, D. H.; Baek, M. H.; Lee, Y. K. [KAERI, Taejon (Korea, Republic of); Lee, Y. B. [Chungnam National Univ., Taejon (Korea, Republic of)

    2001-05-01

    To observe the stimulating effects of low dose {gamma}-radiation on the dormancy breaking and physiological activity, potato (Solanum tuberosum L. cv. Dejima) were irradiated at the dose of 0.5 {approx} 30 Gy. Low dose {gamma}-radiation had promoting effects on the srouting rate the optimum dose of 1 Gy and 2 Gy and on the sprout length at the optimum dose of 2 Gy and 4 Gy. In case of number of sprouts, there were increased in all of the low dose irradiation groups and period storages, which showed very significant promoting effects at 4,8,16 Gy of 15 DAP. The field growth of 45 DAP were increased at all of the low dose irradiation group, which particularly were very significant promoting effect at 4 Gy irradiation group. Irradiation didn't have significant effects on the antioxidant enzyme activity of potato plantlet, but the peroxidase activity of 45 DAP plantlet increased at 4 Gy irradiation group.

  15. Signalization and repair of the DNA double-strand breaks of in the cerebral tumors: modulation of the radiation response with the chemotherapy treatments; Signalization et reparation des cassures double-brin de l'ADN dans les gliomes: modulation de la reponse aux traitements chimio-radiotherapeutiques

    Energy Technology Data Exchange (ETDEWEB)

    Marcinkova-Bencokova, Z

    2007-07-15

    There are about 6000 new cases of nervous system tumours each year in France. However, the current radio chemotherapeutic approaches against brain tumours remain still insufficient to produce a satisfactory therapeutic index. In parallel, the knowledge of the early radiobiological events has considerably progressed in the last few years. This thesis aims to provide new insights in the molecular and cellular response of brain tumours to radio chemotherapy. This thesis was divided into four stages. Stage 1: a novel DNA double-strand breaks repair pathway depending on the MRE11 protein but independent of the phosphorylation of H2AX emerged from the study of artefacts of the immunofluorescence technique and a systematic analysis of the radiosensitivity of human cells. Stage 2: the radiobiological features of 3 rodent models of glioma among the most used in preclinical trials and of 7 human glioma cell lines were investigated. Functional impairments of the BRCA1 protein in response to radiation and/or cisplatin were observed in the majority of the models tested, raising the question of the role of this protein in the anti-glioma treatments and in glioma genesis. Stage 3: in order to extend our approach to genetic syndromes associated with cerebral tumours predisposition, the radiobiological characteristics of the fibroblasts resulting from patients suffering from neurofibromatosis type 1 (NF1), a pathology associated with a strong incidence of peripheral nervous system tumours, were investigated. NF1 appeared to be a syndrome with moderated radiosensitivity, associated with a weak deficiency of DNA end-joining repair but with a strong activity of MRE11. These results enabled us to propose a preliminary model involving both proteins BRCA1 and NF1. Stage 4: considering the role of BRCA1 in the inhibition of some tyrosine kinase activity and in the response to cisplatin, we tested the radiobiological effects of treatments combining radiation, cisplatin and tyrosine kinase

  16. Supersymmetry breaking

    Indian Academy of Sciences (India)

    Emilian Dudas

    2009-01-01

    We review the various mechanisms of supersymmetry breaking and its trans-mission to the observable sector. We argue that hybrid models where gauge dominates over gravity mediation, but gravity provides the main contributions to the Higgs sector masses and the neutralino mass, are able to combine the advantages and reduce the disadvantages of the two transmission mechanisms.

  17. The effects of over-expressing Tip60 on cellular DNA damage repair and cell cycle progression

    International Nuclear Information System (INIS)

    To investigate the effects of Tip60 on DNA damage repair, cell cycle and the related mechanism as well, the proliferative activity, DNA double strand break (DSB) repair competency and cell cycle arrest were analyzed in stable Tip60-overexpression U2OS cells established by transfecting with exogenous Tip60 gene. It was found that the overexpression of Tip60 inhibited the proliferative activity but increased the DNA damage repair competency. The radiation-induced G2/M arrest was prolonged in Tip60 over-expressed U2OS cells, which was associated with a decreasing level of cell cycle checkpoint protein Cyclin B/CDC2 complex. (authors)

  18. Impaired antioxidant enzyme activity and increased DNA repair enzyme expression in hamster liver tissues related to cholangiocarcinoma development.

    Science.gov (United States)

    Loilome, Watcharin; Kadsanit, Sasithorn; Namwat, Nisana; Techasen, Anchalee; Puapairoj, Anucha; Dechakhamphu, Ananya; Pinitsoontorn, Chadamas; Yongvanit, Puangrat

    2012-01-01

    A possible mechanism of liver fluke (Opisthorchis viverrini; Ov) -associated cholangiocarcinoma (CCA) genesis may be imbalance in responses of antioxidant enzymes and/or DNA repair enzymes which are the consequence of oxidative/nitrative stress, arising from inflammatory processes. This study aimed to investigate changes in the expression patterns of antioxidant enzymes, including superoxide dismutase 2 (SOD2) and catalase (CAT), as well as their activities in Ov-associated hamster CCA tissues. Expression of DNA repair enzymes including apurinic endonuclease (APE) and DNA polymerase beta (DNA pol β) was also investigated. Our results showed that SOD2 and CAT levels were increased in CCA-induced liver hamster tissues at every time point during cholangiocarcinogenesis. However, once tumors were well established, activities of both enzymes were significantly decreased. Expression of APE and DNA pol β was increased in the acute phase of Ov infection and this persisted until tumors developed. These findings suggest that a reduction in antioxidant enzymes and an increase in DNA repair enzymes may contribute to DNA translesion-mediated CCA in liver fluke-associated cholangiocarcinogenesis in the hamster model. PMID:23480773

  19. Base excision repair activities differ in human lung cancer cells and corresponding normal controls

    DEFF Research Database (Denmark)

    Karahalil, Bensu; Bohr, Vilhelm A; De Souza-Pinto, Nadja C

    2010-01-01

    Oxidative damage to DNA is thought to play a role in carcinogenesis by causing mutations, and indeed accumulation of oxidized DNA bases has been observed in samples obtained from tumors but not from surrounding tissue within the same patient. Base excision repair (BER) is the main pathway for the...

  20. Positioning Effects of KillerRed inside of Cells correlate with DNA Strand Breaks after Activation with Visible Light

    Directory of Open Access Journals (Sweden)

    Waldemar Waldeck, Gabriele Mueller, Manfred Wiessler, Katalin Tóth, Klaus Braun

    2011-01-01

    Full Text Available Fluorescent proteins (FPs are established tools for new applications, not-restricted to the cell biological research. They could also be ideal in surgery enhancing the precision to differentiate between the target tissue and the surrounding healthy tissue. FPs like the KillerRed (KRED, used here, can be activated by excitation with visible day-light for emitting active electrons which produce reactive oxygen species (ROS resulting in photokilling processes. It is a given that the extent of the KRED's cell toxicity depends on its subcellular localization. Evidences are documented that the nuclear lamina as well as especially the chromatin are critical targets for KRED-mediated ROS-based DNA damaging. Here we investigated the damaging effects of the KRED protein fused to the nuclear lamina and to the histone H2A DNA-binding protein. We detected a frequency of DNA strand breaks, dependent first on the illumination time, and second on the spatial distance between the localization at the chromatin and the site of ROS production. As a consequence we could identify defined DNA bands with 200, 400 and (600 bps as most prominent degradation products, presumably representing an internucleosomal DNA cleavage induced by KRED. These findings are not restricted to the detection of programmed cell death processes in the therapeutic field like PDT, but they can also contribute to a better understanding of the structure-function relations in the epigenomic world.

  1. Positioning Effects of KillerRed inside of Cells correlate with DNA Strand Breaks after Activation with Visible Light

    Science.gov (United States)

    Waldeck, Waldemar; Mueller, Gabriele; Wiessler, Manfred; Tóth, Katalin; Braun, Klaus

    2011-01-01

    Fluorescent proteins (FPs) are established tools for new applications, not-restricted to the cell biological research. They could also be ideal in surgery enhancing the precision to differentiate between the target tissue and the surrounding healthy tissue. FPs like the KillerRed (KRED), used here, can be activated by excitation with visible day-light for emitting active electrons which produce reactive oxygen species (ROS) resulting in photokilling processes. It is a given that the extent of the KRED's cell toxicity depends on its subcellular localization. Evidences are documented that the nuclear lamina as well as especially the chromatin are critical targets for KRED-mediated ROS-based DNA damaging. Here we investigated the damaging effects of the KRED protein fused to the nuclear lamina and to the histone H2A DNA-binding protein. We detected a frequency of DNA strand breaks, dependent first on the illumination time, and second on the spatial distance between the localization at the chromatin and the site of ROS production. As a consequence we could identify defined DNA bands with 200, 400 and (600) bps as most prominent degradation products, presumably representing an internucleosomal DNA cleavage induced by KRED. These findings are not restricted to the detection of programmed cell death processes in the therapeutic field like PDT, but they can also contribute to a better understanding of the structure-function relations in the epigenomic world. PMID:21278894

  2. Autophagic UVRAG Promotes UV-Induced Photolesion Repair by Activation of the CRL4(DDB2) E3 Ligase.

    Science.gov (United States)

    Yang, Yongfei; He, Shanshan; Wang, Qiaoxiu; Li, Fan; Kwak, Mi-Jeong; Chen, Sally; O'Connell, Douglas; Zhang, Tian; Pirooz, Sara Dolatshahi; Jeon, YongHeui; Chimge, Nyam-Osor; Frenkel, Baruch; Choi, Younho; Aldrovandi, Grace M; Oh, Byung-Ha; Yuan, Zengqiang; Liang, Chengyu

    2016-05-19

    UV-induced DNA damage, a major risk factor for skin cancers, is primarily repaired by nucleotide excision repair (NER). UV radiation resistance-associated gene (UVRAG) is a tumor suppressor involved in autophagy. It was initially isolated as a cDNA partially complementing UV sensitivity in xeroderma pigmentosum (XP), but this was not explored further. Here we show that UVRAG plays an integral role in UV-induced DNA damage repair. It localizes to photolesions and associates with DDB1 to promote the assembly and activity of the DDB2-DDB1-Cul4A-Roc1 (CRL4(DDB2)) ubiquitin ligase complex, leading to efficient XPC recruitment and global genomic NER. UVRAG depletion decreased substrate handover to XPC and conferred UV-damage hypersensitivity. We confirmed the importance of UVRAG for UV-damage tolerance using a Drosophila model. Furthermore, increased UV-signature mutations in melanoma correlate with reduced expression of UVRAG. Our results identify UVRAG as a regulator of CRL4(DDB2)-mediated NER and suggest that its expression levels may influence melanoma predisposition. PMID:27203177

  3. The Break

    DEFF Research Database (Denmark)

    Strand, Anete Mikkala Camille

    2016-01-01

    The chapter elaborates on how to deal with one of the major challenges facing organizations worldwide; Stress. The Break enacts a quantum approach to meet the challenges by proposing a combination of three different quantum storytelling technologies; protreptic mentoring, walking and material sto...... provider and witness to your elaborations. It’s really that simple! The chapter concludes towards a set of Dogmas for future reference in addressing these challenges in this manner....

  4. Equipment maintenance and repair

    Directory of Open Access Journals (Sweden)

    Walia DS

    2010-10-01

    Full Text Available The repair and maintenance of ophthalmic equipment, including surgical instruments and diagnostic devices, can be compared to the maintenance of a motor vehicle, something many of us understand well.If you had a car, would you drive it until the fuel runs out or until a tyre punctures, and then abandon it to buy a new car? Of course not. However, many eye care units purchase (or receive as a donation expensive and delicate equipment which, because of poor maintenance, ends up breaking down. If there is not a system in place to report breakdowns and to plan or carry out repairs, equipment can remain unusable for long periods of time. Sometimes, this equipment ends up being dumped. Good maintenance habits and an effective repair system will minimise the amount of time equipment is unusable.

  5. Repair activities on the LHC cryogenic distribution line in charge of TS/MME

    CERN Document Server

    Atieh, S; CERN. Geneva. TS Department

    2005-01-01

    The Cryogenic Distribution Line (QRL), running inside the machine tunnel parallel to the regular lattice of superconducting quadrupole and dipole magnets of LHC, transports the refrigeration power produced by the refrigerators over long distances. With a total length of about 25.8 km, QRL consists of a modular set-up of pipe and Service Modules (SM), Vacuum Barriers (VB), Fixed Points (FP), steps and elbows. TS department was charged to replace non-conform sliding tables included in the Cryogenic Distribution Line QRL. For this repair work, based on technologically advanced methods, TS/MME imposed a high level of quality assurance and follow-up for mechanical repair works as well as for the metrological measurements carried out which an innovative polyarticulated arm, a portable measuring device, and leak testing by argon.

  6. Active transcriptomic and proteomic reprogramming in the C. elegans nucleotide excision repair mutant xpa-1

    OpenAIRE

    Kassahun, Henok; Nilsen, Hilde

    2013-01-01

    Oxidative stress promotes human aging and contributes to common neurodegenerative diseases. Endogenous DNA damage induced by oxidative stress is believed to be an important promoter of neurodegenerative diseases. Although a large amount of evidence correlates a reduced DNA repair capacity with aging and neurodegenerative disease, there is little direct evidence of causality. Moreover, the contribution of oxidative DNA damage to the aging process is poorly understood. We have used the nematode...

  7. Three-dimensionally Specific Inhibition of DNA Repair-Related Genes by Activated KRAS in Colon Crypt Model1 2

    Science.gov (United States)

    Tsunoda, Toshiyuki; Takashima, Yasuo; Fujimoto, Takahiro; Koyanagi, Midori; Yoshida, Yasuhiro; Doi, Keiko; Tanaka, Yoko; Kuroki, Masahide; Sasazuki, Takehiko; Shirasawa, Senji

    2010-01-01

    Growth and differentiation of colonic epithelium are regulated in the three-dimensional (3D) physiological architecture, colonic crypt, and deregulation of 3D interactions is involved in tumorigenesis. Cell-based 3D culture systems provide a suitable approach bridging the gap between two-dimensional (2D) culture and animal models. KRAS mutations are found at high frequencies in human colorectal cancer (CRC); however, KRAS-targeted cancer therapy has not been developed. Here, we have established a 3D cell culture model resembling the colonic crypt by use of HKe3 cells, human CRC HCT116 cells disrupted at activated KRAS. In this 3D colonic crypt model, HKe3 cells showed the features of time course-dependent transit-amplifying and terminal-differentiated stages, which are characteristic of normal colonic crypt. On the basis of the features of HCT116 cells, activated KRAS inhibited normal cell polarity and apoptosis in 3D culture. The expression of DNA repair-related tumor suppressor genes including TP53, BRCA1, BRCA2, and EXO-1 was markedly suppressed by activated KRAS in 3D culture but not in 2D culture. These results together suggest that activated KRAS plays critical roles in the accumulation of genetic alterations through inhibition of DNA repair genes and apoptosis and that this 3D culture model will provide a useful tool for investigating the molecular mechanisms of CRC development. PMID:20454511

  8. Three-dimensionally Specific Inhibition of DNA Repair-Related Genes by Activated KRAS in Colon Crypt Model

    Directory of Open Access Journals (Sweden)

    Toshiyuki Tsunoda

    2010-05-01

    Full Text Available Growth and differentiation of colonic epithelium are regulated in the three-dimensional (3D physiological architecture, colonic crypt, and deregulation of 3D interactions is involved in tumorigenesis. Cell-based 3D culture systems provide a suitable approach bridging the gap between two-dimensional (2D culture and animal models. KRAS mutations are found at high frequencies in human colorectal cancer (CRC; however, KRAS-targeted cancer therapy has not been developed. Here, we have established a 3D cell culture model resembling the colonic crypt by use of HKe3 cells, human CRC HCT116 cells disrupted at activated KRAS. In this 3D colonic crypt model, HKe3 cells showed the features of time course-dependent transit-amplifying and terminal-differentiated stages, which are characteristic of normal colonic crypt. On the basis of the features of HCT116 cells, activated KRAS inhibited normal cell polarity and apoptosis in 3D culture. The expression of DNA repair-related tumor suppressor genes including TP53, BRCA1, BRCA2, and EXO-1 was markedly suppressed by activated KRAS in 3D culture but not in 2D culture. These results together suggest that activated KRAS plays critical roles in the accumulation of genetic alterations through inhibition of DNA repair genes and apoptosis and that this 3D culture model will provide a useful tool for investigating the molecular mechanisms of CRC development.

  9. Three-dimensionally specific inhibition of DNA repair-related genes by activated KRAS in colon crypt model.

    Science.gov (United States)

    Tsunoda, Toshiyuki; Takashima, Yasuo; Fujimoto, Takahiro; Koyanagi, Midori; Yoshida, Yasuhiro; Doi, Keiko; Tanaka, Yoko; Kuroki, Masahide; Sasazuki, Takehiko; Shirasawa, Senji

    2010-05-01

    Growth and differentiation of colonic epithelium are regulated in the three-dimensional (3D) physiological architecture, colonic crypt, and deregulation of 3D interactions is involved in tumorigenesis. Cell-based 3D culture systems provide a suitable approach bridging the gap between two-dimensional (2D) culture and animal models. KRAS mutations are found at high frequencies in human colorectal cancer (CRC); however, KRAS-targeted cancer therapy has not been developed. Here, we have established a 3D cell culture model resembling the colonic crypt by use of HKe3 cells, human CRC HCT116 cells disrupted at activated KRAS. In this 3D colonic crypt model, HKe3 cells showed the features of time course-dependent transit-amplifying and terminal-differentiated stages, which are characteristic of normal colonic crypt. On the basis of the features of HCT116 cells, activated KRAS inhibited normal cell polarity and apoptosis in 3D culture. The expression of DNA repair-related tumor suppressor genes including TP53, BRCA1, BRCA2, and EXO-1 was markedly suppressed by activated KRAS in 3D culture but not in 2D culture. These results together suggest that activated KRAS plays critical roles in the accumulation of genetic alterations through inhibition of DNA repair genes and apoptosis and that this 3D culture model will provide a useful tool for investigating the molecular mechanisms of CRC development. PMID:20454511

  10. Xeroderma pigmentosum, DNA repair and carcinogenesis

    International Nuclear Information System (INIS)

    The following topics are reviewed: Symptoms of xeroderma pigmentosum; xeroderma pigmentosum as a defect in the biochemistry of repair of radiation damage; major classes of DNA damage and repair mechanisms; excision repair in relation to biochemical steps and the XP defect; sensitivity of xeroderma pigmentosum cells; host-cell reactivation of UV-damaged viruses; excision of pyrimidine dimers from human cells; formation and sealing of single strand breaks during dimer excision; insertion of new bases to repair DNA; and DNA repair, carcinogens, and carcinogenesis

  11. Stripped-down DNA repair in a highly reduced parasite

    Directory of Open Access Journals (Sweden)

    Fast Naomi M

    2007-03-01

    Full Text Available Abstract Background Encephalitozoon cuniculi is a member of a distinctive group of single-celled parasitic eukaryotes called microsporidia, which are closely related to fungi. Some of these organisms, including E. cuniculi, also have uniquely small genomes that are within the prokaryotic range. Thus, E. cuniculi has undergone a massive genome reduction which has resulted in a loss of genes from diverse biological pathways, including those that act in DNA repair. DNA repair is essential to any living cell. A loss of these mechanisms invariably results in accumulation of mutations and/or cell death. Six major pathways of DNA repair in eukaryotes include: non-homologous end joining (NHEJ, homologous recombination repair (HRR, mismatch repair (MMR, nucleotide excision repair (NER, base excision repair (BER and methyltransferase repair. DNA polymerases are also critical players in DNA repair processes. Given the close relationship between microsporidia and fungi, the repair mechanisms present in E. cuniculi were compared to those of the yeast Saccharomyces cerevisiae to ascertain how the process of genome reduction has affected the DNA repair pathways. Results E. cuniculi lacks 16 (plus another 6 potential absences of the 56 DNA repair genes sought via BLASTP and PSI-BLAST searches. Six of 14 DNA polymerases or polymerase subunits are also absent in E. cuniculi. All of these genes are relatively well conserved within eukaryotes. The absence of genes is not distributed equally among the different repair pathways; some pathways lack only one protein, while there is a striking absence of many proteins that are components of both double strand break repair pathways. All specialized repair polymerases are also absent. Conclusion Given the large number of DNA repair genes that are absent from the double strand break repair pathways, E. cuniculi is a prime candidate for the study of double strand break repair with minimal machinery. Strikingly, all of the

  12. Feasibility of externally activated self-repairing concrete with epoxy injection network and Cu-Al-Mn superelastic alloy reinforcing bars

    International Nuclear Information System (INIS)

    This paper studies the effectiveness of an externally activated self-repairing technique for concrete members with epoxy injection network and Cu-Al-Mn superelastic alloy (SEA) reinforcing bars (rebars). Compared to existing crack self-repairing and self-healing techniques, the epoxy injection network has the following strengths: (1) Different from the self-repairing methods using brittle containers or tubes for adhesives, the proposed self-repair process can be performed repeatedly and is feasible for onsite concrete casting. (2) Different from the autogenic self-healing techniques, full strength recovery can be achieved in a shorter time period without the necessity of water. This paper attempts to enhance the self-repairing capability of the epoxy injection network by reducing residual cracks by using cost-effective Cu-based SEA bars. The effectiveness of the present technique is examined using concrete beam specimens reinforced by 3 types of bars. The first specimen is reinforced by steel deformed bars, the second by steel threaded bars, and finally by SEA threaded rebars. The tests were performed with a 3 point cyclic loading with increasing amplitude. From the test results, effective self-repairing was confirmed for small deformation levels irrespective of the reinforcement types. Effective self-repairing was observed in the SEA reinforced specimen even under much larger deformations. Nonlinear finite element analysis was performed to confirm the experimental findings. (paper)

  13. Breaking Symmetries

    CERN Document Server

    Peters, Kirstin

    2010-01-01

    A well-known result by Palamidessi tells us that {\\pi}mix (the {\\pi}-calculus with mixed choice) is more expressive than {\\pi}sep (its subset with only separate choice). The proof of this result argues with their different expressive power concerning leader election in symmetric networks. Later on, Gorla of- fered an arguably simpler proof that, instead of leader election in symmetric networks, employed the reducibility of "incestual" processes (mixed choices that include both enabled senders and receivers for the same channel) when running two copies in parallel. In both proofs, the role of breaking (ini- tial) symmetries is more or less apparent. In this paper, we shed more light on this role by re-proving the above result-based on a proper formalization of what it means to break symmetries-without referring to another layer of the distinguishing problem domain of leader election. Both Palamidessi and Gorla rephrased their results by stating that there is no uniform and reason- able encoding from {\\pi}mix i...

  14. The Break

    DEFF Research Database (Denmark)

    Strand, Anete Mikkala Camille; Larsen, Jens

    2015-01-01

    to Explore your Leadership” . ”Time to reflect closer to heaven as we did in the Pyrenees, makes me humble and simplifies the thoughts on how to lead within my own set of values. It´s all about energy”, (Lars Lund Hansen, manager, Novo Nordisk) A few objects; a neckless, a candle, a dragon and five crystal...... terrain break elaborates the terrain of Organizations anno 2015 as a terrain of complexity, streamlining, language-orientation and dis-functionality. The latter in regard to a WHO acknowledged concern for health issues related to work-related stress (Prætorius, 2012) and an ongoing urge for learning...... that language and the social has been granted too much power on the dispense of the bodily, physical and biological – or in short, in dispense of the material. The break To be or not to be poses the theoretical notion of dis-/continuity (Barad, 2007, 2010) from the quantum approach to storytelling (Strand 2012...

  15. Role of ubiquitination in meiotic recombination repair

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Programmed and unprogrammed double-strand breaks (DSBs) often arise from such physiological requirements as meiotic recombination, and exogenous insults, such as ionizing radiation (IR). Due to deleterious impacts on genome stability, DSBs must be appropriately processed and repaired in a regulatory manner. Recent investigations have indicated that ubiquitination is a critical factor in DNA damage response and meiotic recombination repair. This review summarizes the effects of proteins and complexes associated with ubiquitination with regard to homologous recombination (HR)-dependent DSB repair.

  16. Radiation-Induced Survivin Nuclear Accumulation is Linked to DNA Damage Repair

    International Nuclear Information System (INIS)

    Purpose: Increased expression of survivin has been identified as a negative prognostic marker in a variety of human cancers. We have previously shown that survivin is a radiation-resistance factor and that the therapeutic effect of survivin knock-down might result from an impaired DNA repair capacity. In this study, we aimed to elucidate an interrelationship between survivin's cellular localization and DNA double-strand break repair. Methods and Materials: Survivin's cellular distribution and nuclear complex formation were assayed by Western blotting of subcellular fractions, by immunofluorescence staining, and co-immunoprecipitation in SW480 colorectal cancer cells. DNA repair capacity was analyzed by kinetics of γ-H2AX foci formation, and by DNA-dependent protein kinase (DNA-PKcs) assays in the presence of survivin-specific or nonspecific control siRNA. Results: Following irradiation, we observed a rapid nuclear accumulation of survivin and subsequent phosphorylation of the protein in the nucleus. Co-immunoprecipitation analyses from nuclear extracts revealed an interaction among survivin, Ku70, γ-H2AX, MDC1, and DNA-PKcs that was confirmed by immunofluorescence co-localization in nuclear foci. Survivin knock down by siRNA resulted in an impaired DNA double strand break repair, as demonstrated by an increased detection of γ-H2AX foci/nucleus at 60 min and a higher amount of residual γ-H2AX foci at 24 hr postirradiation. Furthermore, we detected in survivin-depleted cells a hampered S2056 autophosphorylation of DNA-PKcs and a significantly decreased DNA-PKcs kinase activity. Conclusion: These data indicate that nuclear survivin is linked to DNA double-strand break repair by interaction with members of the DNA double-strand breaks repair machinery, thus regulating DNA-PKcs activity.

  17. Polymorphisms in DNA repair genes, recreational physical activity and breast cancer risk

    Czech Academy of Sciences Publication Activity Database

    McCullough, L. E.; Santella, R. M.; Cleveland, R. J.; Millikan, R. C.; Olshan, A. F.; North, K. E.; Bradshaw, P. T.; Eng, S. M.; Terry, M. B.; Shen, J.; Crew, C. D.; Rössner ml., Pavel; Teitelbaum, S. L.; Neugut, A. I.; Grammon, M. D.

    2014-01-01

    Roč. 134, č. 3 (2014), s. 654-663. ISSN 0020-7136 Grant ostatní: National Institute of Environmental Health Sciences(US) P30ES009089; National Institute of Environmental Health Sciences(US) P30ES10126; Department of Defense Breast Cancer Research Program(US) BC093608; National Institute of Environmental Health Sciences(US) UO1CA/ES66572 Institutional support: RVO:68378041 Keywords : breast cacner * epidemiology * DNA repair Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.085, year: 2014

  18. Role of DNA repair in the mechanism underlying antitumor activity of platinum coordination complexes

    Czech Academy of Sciences Publication Activity Database

    Brabec, Viktor

    Smolenice Castle, 2008. s. 28. [5th DNA Repair Workshop. 25.05.2008-29.05.2008, Smolenice Castle] R&D Projects: GA MŠk(CZ) LC06030; GA MŠk(CZ) ME08017; GA MŠk(CZ) OC08003; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) KAN200200651; GA AV ČR(CZ) IAA400040803; GA MZd(CZ) NR8562 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA * platinum * cancer Subject RIV: BO - Biophysics

  19. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    OpenAIRE

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.

    2005-01-01

    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S](2+) cluster of MutY to [4Fe-4S](3+) and its decomposition product [3Fe-4S](1+). Flash/quench experiments monitored by EPR spec...

  20. A cell-free system for studying a priming factor involved in repair of bleomycin-damaged DNA.

    Directory of Open Access Journals (Sweden)

    Seki,Shuji

    1989-04-01

    Full Text Available A simple cell-free system for studying a priming factor involved in the repair of bleomycin-damaged DNA was established. The template-primer used for the repair DNA synthesis was prepared by treating the closed circular, superhelical form of pUC19 plasmid DNA with 2.2 microM bleomycin and 20 microM ferrous ions. Single-strand breaks were introduced into pUC19 DNA by the bleomycin treatment, and the DNA was consequently converted largely into the open circular form. A system for repair of this bleomycin-damaged DNA was constructed with a priming factor, DNA polymerase (DNA polymerase beta or Klenow fragment of DNA polymerase I, ATP, T4 DNA ligase and four deoxynucleoside triphosphates. After incubation, the conformation of the DNA was analyzed by agarose gel electrophoresis and electron microscopy. The open circular DNA was largely converted to the closed circular DNA, indicating that the single-strand breaks of DNA were repaired. When the priming factor was omitted, DNA repair did not occur. The present system seemed to be applicable to the study of priming factors involved in the repair of DNA with single-strand breaks caused not only by bleomycin but also by ionizing radiation or active oxygen.

  1. Process for Self-Repair of Insulation Material

    Science.gov (United States)

    Parrish, Clyde F. (Inventor)

    2007-01-01

    A self-healing system for an insulation material initiates a self-repair process by rupturing a plurality of microcapsules disposed on the insulation material. When the plurality of microcapsules are ruptured reactants witlun the plurality of microcapsules react to form a replacement polymer in a break of the insulation material. This self-healing system has the ability to repair multiple breaks in a length of insulation material without exhausting the repair properties of the material.

  2. Repair of gamma radiation-induced damage : Micrococcus radiophilus

    International Nuclear Information System (INIS)

    The gamma radiation survival curve of M. radiophilus exhibits an extensive shoulder followed by exponential kill, indicating the efficiency of this bacterium for repairing gamma radiation induced damage. It differs morphologically, biochemically and genetically from M. radiodurans. Examination of DNA strand breaks using sucrose density gradient revealed the cell's ability to repair double and single strand breaks. Studies with alkaline gradients suggest that the fast repair of single strand scissions in M. radiophilus cellular DNA may be instantaneous. (author)

  3. Coupling end resection with the checkpoint response at DNA double-strand breaks.

    Science.gov (United States)

    Villa, Matteo; Cassani, Corinne; Gobbini, Elisa; Bonetti, Diego; Longhese, Maria Pia

    2016-10-01

    DNA double-strand breaks (DSBs) are a nasty form of damage that needs to be repaired to ensure genome stability. The DSB ends can undergo a strand-biased nucleolytic processing (resection) to generate 3'-ended single-stranded DNA (ssDNA) that channels DSB repair into homologous recombination. Generation of ssDNA also triggers the activation of the DNA damage checkpoint, which couples cell cycle progression with DSB repair. The checkpoint response is intimately linked to DSB resection, as some checkpoint proteins regulate the resection process. The present review will highlight recent works on the mechanism and regulation of DSB resection and its interplays with checkpoint activation/inactivation in budding yeast. PMID:27141941

  4. Proteinase-activated receptor-2 is required for normal osteoblast and osteoclast differentiation during skeletal growth and repair.

    Science.gov (United States)

    Georgy, S R; Pagel, C N; Ghasem-Zadeh, A; Zebaze, R M D; Pike, R N; Sims, N A; Mackie, E J

    2012-03-01

    Proteinase-activated receptor-2 (PAR(2)) is a G-protein coupled receptor expressed by osteoblasts and monocytes. PAR(2) is activated by a number of proteinases including coagulation factors and proteinases released by inflammatory cells. The aim of the current study was to investigate the role of PAR(2) in skeletal growth and repair using wild type (WT) and PAR(2) knockout (KO) mice. Micro computed tomography and histomorphometry were used to examine the structure of tibias isolated from uninjured mice at 50 and 90 days of age, and from 98-day-old mice in a bone repair model in which a hole had been drilled through the tibias. Bone marrow was cultured and investigated for the presence of osteoblast precursors (alkaline phosphatase-positive fibroblastic colonies), and osteoclasts were counted in cultures treated with M-CSF and RANKL. Polymerase chain reaction (PCR) was used to determine which proteinases that activate PAR(2) are expressed in bone marrow. Regulation of PAR(2) expression in primary calvarial osteoblasts from WT mice was investigated by quantitative PCR. Cortical and trabecular bone volumes were significantly greater in the tibias of PAR(2) KO mice than in those of WT mice at 50 days of age. In trabecular bone, osteoclast surface, osteoblast surface and osteoid volume were significantly lower in KO than in WT mice. Bone marrow cultures from KO mice showed significantly fewer alkaline phosphatase-positive colony-forming units and osteoclasts compared to cultures from WT mice. Significantly less new bone and significantly fewer osteoclasts were observed in the drill sites of PAR(2) KO mice compared to WT mice 7 days post-surgery. A number of activators of PAR(2), including matriptase and kallikrein 4, were found to be expressed by normal bone marrow. Parathyroid hormone, 1,25 dihydroxyvitamin D(3), or interleukin-6 in combination with its soluble receptor down-regulated PAR(2) mRNA expression, and fibroblast growth factor-2 or thrombin stimulated PAR(2

  5. Radiation damage and its repair in non-sporulating bacteria

    International Nuclear Information System (INIS)

    A review is given of radiation damage and its repair in non-sporulating bacteria. The identification and measurement of radiation damage in the DNA of the bacteria after exposure to ultraviolet radiation and ionizing radiation is described. Measuring the extent of DNA repair and ways of isolating repair mutants are also described. The DNA repair mechanisms for UV-induced damage are discussed including photoreactivation repair, excision repair, post-replication recombination repair and induced error-prone repair. The DNA repair mechanisms for ionizing radiation damage are also discussed including the repair of both single and double-strand breaks. Other aspects discussed include the effects of growth, irradiation medium and recovery medium on survival, DNA repair in humans, the commercial use of UV and ionizing radiations and the future of ionizing irradiation as a food treatment process. (U.K.)

  6. DNA repair and radiation sensitivity in mammalian cells

    International Nuclear Information System (INIS)

    Ionizing radiation induces various types of damage in mammalian cells including DNA single-strand breaks, DNA double-strand breaks (DSB), DNA-protein cross links, and altered DNA bases. Although human cells can repair many of these lesions there is little detailed knowledge of the nature of the genes and the encoded enzymes that control these repair processes. We report here on the cellular and genetic analyses of DNA double-strand break repair deficient mammalian cells. It has been well established that the DNA double-strand break is one of the major lesions induced by ionizing radiation. Utilizing rodent repair-deficient mutant, we have shown that the genes responsible for DNA double-strand break repair are also responsible for the cellular expression of radiation sensitivity. The molecular genetic analysis of DSB repair in rodent/human hybrid cells indicate that at least 6 different genes in mammalian cells are responsible for the repair of radiation-induced DNA double-strand breaks. Mapping and the prospect of cloning of human radiation repair genes are reviewed. Understanding the molecular and genetic basis of radiation sensitivity and DNA repair in man will provide a rational foundation to predict the individual risk associated with radiation exposure and to prevent radiation-induced genetic damage in the human population

  7. Experimental Study of Big Break Sports Activity in Primary School%开展体育大课间活动的实验研究

    Institute of Scientific and Technical Information of China (English)

    王浩龙

    2014-01-01

    长期以来,南京市琅琊路小学明发滨江分校大课间体育活动内容单一,流于形式,约束了学生的活动,运动方式不利于学生的全面发展。所以打破传统大课间活动方式,在大课间体育活动中开展橄榄球、健脑操、武术操、舞蹈、趣味游戏、冬季长跑等多种体育项目,增强学生体质,激发学生对体育的兴趣和爱好,培养学生坚持锻炼身体的习惯,便成为我们开展大课间体育活动研究的方向。%For a long time, the content of big break sport activities in Langya Road Primary School Mingfa Binjiang Campus is single and becomes a mere formality, which restrict students' activities, and the exercise is not conducive to the all-round development of students. So to break the traditional big break activities, carry out a variety of sports, like, football, brain gym, Wushu gymnastics, dance, fun games, winter long-distance running, enhance the physical fitness of students, stimulate students' interest in sports, and cultivate students' exercise habit has become the direction of the research on big break activities.

  8. DNA double-strand break signaling and human disorders

    Directory of Open Access Journals (Sweden)

    Bohgaki Toshiyuki

    2010-11-01

    Full Text Available Abstract DNA double-strand breaks are among the most serious types of DNA damage and their signaling and repair is critical for all cells and organisms. The repair of both induced and programmed DNA breaks is fundamental as demonstrated by the many human syndromes, neurodegenerative diseases, immunodeficiency and cancer associated with defective repair of these DNA lesions. Homologous recombination and non-homologous end-joining pathways are the two major DNA repair pathways responsible for mediating the repair of DNA double-strand breaks. The signaling of DNA double-strand breaks is critical for cells to orchestrate the repair pathways and maintain genomic integrity. This signaling network is highly regulated and involves a growing number of proteins and elaborated posttranslational modifications including phosphorylation and ubiquitylation. Here, we highlight the recent progress in the signaling of DNA double-strand breaks, the major proteins and posttranslational modifications involved and the diseases and syndromes associated with impaired signaling of these breaks.

  9. Sharpening the ends for repair: mechanisms and regulation of DNA resection.

    Science.gov (United States)

    Paudyal, Sharad C; You, Zhongsheng

    2016-07-01

    DNA end resection is a key process in the cellular response to DNA double-strand break damage that is essential for genome maintenance and cell survival. Resection involves selective processing of 5' ends of broken DNA to generate ssDNA overhangs, which in turn control both DNA repair and checkpoint signaling. DNA resection is the first step in homologous recombination-mediated repair and a prerequisite for the activation of the ataxia telangiectasia mutated and Rad3-related (ATR)-dependent checkpoint that coordinates repair with cell cycle progression and other cellular processes. Resection occurs in a cell cycle-dependent manner and is regulated by multiple factors to ensure an optimal amount of ssDNA required for proper repair and genome stability. Here, we review the latest findings on the molecular mechanisms and regulation of the DNA end resection process and their implications for cancer formation and treatment. PMID:27174871

  10. Complex formation by the human Rad51B and Rad51C DNA repair proteins and their activities in vitro

    Science.gov (United States)

    Lio, Yi-Ching; Mazin, Alexander V.; Kowalczykowski, Stephen C.; Chen, David J.

    2003-01-01

    The human Rad51 protein is essential for DNA repair by homologous recombination. In addition to Rad51 protein, five paralogs have been identified: Rad51B/Rad51L1, Rad51C/Rad51L2, Rad51D/Rad51L3, XRCC2, and XRCC3. To further characterize a subset of these proteins, recombinant Rad51, Rad51B-(His)(6), and Rad51C proteins were individually expressed employing the baculovirus system, and each was purified from Sf9 insect cells. Evidence from nickel-nitrilotriacetic acid pull-down experiments demonstrates a highly stable Rad51B.Rad51C heterodimer, which interacts weakly with Rad51. Rad51B and Rad51C proteins were found to bind single- and double-stranded DNA and to preferentially bind 3'-end-tailed double-stranded DNA. The ability to bind DNA was elevated with mixed Rad51 and Rad51C, as well as with mixed Rad51B and Rad51C, compared with that of the individual protein. In addition, both Rad51B and Rad51C exhibit DNA-stimulated ATPase activity. Rad51C displays an ATP-independent apparent DNA strand exchange activity, whereas Rad51B shows no such activity; this apparent strand exchange ability results actually from a duplex DNA destabilization capability of Rad51C. By analogy to the yeast Rad55 and Rad57, our results suggest that Rad51B and Rad51C function through interactions with the human Rad51 recombinase and play a crucial role in the homologous recombinational repair pathway.

  11. Sublethal gamma irradiation affects reproductive impairment and elevates antioxidant enzyme and DNA repair activities in the monogonont rotifer Brachionus koreanus

    International Nuclear Information System (INIS)

    Highlights: • No mortality within 96 h even at a high intensity (1200 Gy). • A reduced fecundity of Brachionus koreanus at over 150 Gy with a decrease in lifespan. • Dose-dependent ROS increase with GST enzyme activity at sub-lethal doses. • Significant impact on life table parameters, particularly fecundity. • Significant up-regulation of DNA repair-associated genes at sublethal doses. - Abstract: To examine the effects of gamma radiation on marine organisms, we irradiated several doses of gamma ray to the microzooplankton Brachionus koreanus, and measured in vivo and in vitro endpoints including the survival rate, lifespan, fecundity, population growth, gamma ray-induced oxidative stress, and modulated patterns of enzyme activities and gene expressions after DNA damage. After gamma radiation, no individuals showed any mortality within 96 h even at a high intensity (1200 Gy). However, a reduced fecundity (e.g. cumulated number of offspring) of B. koreanus at over 150 Gy was observed along with a slight decrease in lifespan. At 150 Gy and 200 Gy, the reduced fecundity of the rotifers led to a significant decrease in population growth, although in the second generation the population growth pattern was not affected even at 200 Gy when compared to the control group. At sub-lethal doses, reactive oxygen species (ROS) levels dose-dependently increased with GST enzyme activity. In addition, up-regulations of the antioxidant and chaperoning genes in response to gamma radiation were able to recover cellular damages, and life table parameters were significantly influenced, particularly with regard to fecundity. DNA repair-associated genes showed significantly up-regulated expression patterns in response to sublethal doses (150 and 200 Gy), as shown in the expression of the gamma-irradiated B. koreanus p53 gene, suggesting that these sublethal doses were not significantly fatal to B. koreanus but induced DNA damages leading to a decrease of the population size

  12. Sublethal gamma irradiation affects reproductive impairment and elevates antioxidant enzyme and DNA repair activities in the monogonont rotifer Brachionus koreanus

    Energy Technology Data Exchange (ETDEWEB)

    Han, Jeonghoon; Won, Eun-Ji [Department of Biological Sciences, College of Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Kim, Il-Chan; Yim, Joung Han [Division of Life Sciences, Korea Polar Research Institute, Incheon 406-840 (Korea, Republic of); Lee, Su-Jae [Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Sciences, College of Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of)

    2014-10-15

    Highlights: • No mortality within 96 h even at a high intensity (1200 Gy). • A reduced fecundity of Brachionus koreanus at over 150 Gy with a decrease in lifespan. • Dose-dependent ROS increase with GST enzyme activity at sub-lethal doses. • Significant impact on life table parameters, particularly fecundity. • Significant up-regulation of DNA repair-associated genes at sublethal doses. - Abstract: To examine the effects of gamma radiation on marine organisms, we irradiated several doses of gamma ray to the microzooplankton Brachionus koreanus, and measured in vivo and in vitro endpoints including the survival rate, lifespan, fecundity, population growth, gamma ray-induced oxidative stress, and modulated patterns of enzyme activities and gene expressions after DNA damage. After gamma radiation, no individuals showed any mortality within 96 h even at a high intensity (1200 Gy). However, a reduced fecundity (e.g. cumulated number of offspring) of B. koreanus at over 150 Gy was observed along with a slight decrease in lifespan. At 150 Gy and 200 Gy, the reduced fecundity of the rotifers led to a significant decrease in population growth, although in the second generation the population growth pattern was not affected even at 200 Gy when compared to the control group. At sub-lethal doses, reactive oxygen species (ROS) levels dose-dependently increased with GST enzyme activity. In addition, up-regulations of the antioxidant and chaperoning genes in response to gamma radiation were able to recover cellular damages, and life table parameters were significantly influenced, particularly with regard to fecundity. DNA repair-associated genes showed significantly up-regulated expression patterns in response to sublethal doses (150 and 200 Gy), as shown in the expression of the gamma-irradiated B. koreanus p53 gene, suggesting that these sublethal doses were not significantly fatal to B. koreanus but induced DNA damages leading to a decrease of the population size.

  13. X-ray repair cross complementing protein 1 in base excision repair

    DEFF Research Database (Denmark)

    Hanssen-Bauer, Audun; Solvang-Garten, Karin; Akbari, Mansour;

    2012-01-01

    X-ray Repair Cross Complementing protein 1 (XRCC1) acts as a scaffolding protein in the converging base excision repair (BER) and single strand break repair (SSBR) pathways. XRCC1 also interacts with itself and rapidly accumulates at sites of DNA damage. XRCC1 can thus mediate the assembly of large...... multiprotein DNA repair complexes as well as facilitate the recruitment of DNA repair proteins to sites of DNA damage. Moreover, XRCC1 is present in constitutive DNA repair complexes, some of which associate with the replication machinery. Because of the critical role of XRCC1 in DNA repair, its common...... variants Arg194Trp, Arg280His and Arg399Gln have been extensively studied. However, the prevalence of these variants varies strongly in different populations, and their functional influence on DNA repair and disease remains elusive. Here we present the current knowledge about the role of XRCC1 and its...

  14. Seed dormancy breaking diterpenoids from the liverwort Plagiochila sciophila and their differentiation inducing activity in human promyelocytic leukemia HL-60 cells.

    Science.gov (United States)

    Kenmoku, Hiromichi; Tada, Hiroyuki; Oogushi, Megumi; Esumi, Tomoyuki; Takahashi, Hironobu; Noji, Masaaki; Sassa, Takeshi; Toyota, Masao; Asakawa, Yoshinori

    2014-07-01

    To obtain the structural diversity of bioactive compounds similar to cotylenins and fusicoccins that modulate 14-3-3 protein-protein interactions in eukaryotes, screening tests were carried out using the lettuce seed dormancy breaking-assay. An acetone extract of the liverwort Plagiochila sciophila exhibited significant activity against the seeds in the presence of the plant hormone abscisic acid. Activity-guided fractionation of the extract afforded the isolation of seven novel fusicoccane-type diterpenoids, named fusicosciophins A-E (1-5), 8-deacetyl (6) and 9-deacetyl fusicosciophin E (7). Their structures were determined by spectroscopic methods and X-ray crystallographic analyses. All the pure isolated compounds (1-7) exhibited moderate lettuce seed dormancy breaking activity. In addition, the differentiation-inducing activity and cytotoxicity of these isolates, together with fusicoccin A (FC-A) and all-trans retinoic acid (ATRA), were evaluated in human promyelocytic leukemia HL-60 cells and human mouth epidermal carcinoma KB cells, respectively. Fusicosciophins (2 and 4) and FC-A exhibited moderate differentiation-inducing activity (EC50 31.2-59.1 microM) compared with ATRA (EC50 0.3 microM), while 2, 4 and ATRA exhibited higher selectivity indices (IC50/EC50 >3.38-667) than FC-A (IC50/EC50 1.05). This is the first report on the isolation of fusicoccane-type diterpenoids from liverworts having seed dormancy breaking activity and differentiation-inducing activity in mammal cells. PMID:25230492

  15. INTERNAL REPAIR OF PIPELINES

    Energy Technology Data Exchange (ETDEWEB)

    Bill Bruce; Nancy Porter; George Ritter; Matt Boring; Mark Lozev; Ian Harris; Bill Mohr; Dennis Harwig; Robin Gordon; Chris Neary; Mike Sullivan

    2005-07-20

    liners, indicating that this type of liner is only marginally effective at restoring the pressure containing capabilities of pipelines. Failure pressures for larger diameter pipe repaired with a semi-circular patch of carbon fiber-reinforced composite lines were also marginally greater than that of a pipe section with un-repaired simulated damage without a liner. These results indicate that fiber reinforced composite liners have the potential to increase the burst pressure of pipe sections with external damage Carbon fiber based liners are viewed as more promising than glass fiber based liners because of the potential for more closely matching the mechanical properties of steel. Pipe repaired with weld deposition failed at pressures lower than that of un-repaired pipe in both the virgin and damaged conditions, indicating that this repair technology is less effective at restoring the pressure containing capability of pipe than a carbon fiber-reinforced liner repair. Physical testing indicates that carbon fiber-reinforced liner repair is the most promising technology evaluated to-date. In lieu of a field installation on an abandoned pipeline, a preliminary nondestructive testing protocol is being developed to determine the success or failure of the fiber-reinforced liner pipeline repairs. Optimization and validation activities for carbon-fiber repair methods are ongoing.

  16. Parasympathetic nervous system activity predicts mood repair use and its effectiveness among adolescents with and without histories of major depression.

    Science.gov (United States)

    Yaroslavsky, Ilya; Rottenberg, Jonathan; Bylsma, Lauren M; Jennings, J Richard; George, Charles; Baji, Ildikó; Benák, István; Dochnal, Roberta; Halas, Kitti; Kapornai, Krisztina; Kiss, Enikő; Makai, Attila; Varga, Hedvig; Vetró, Ágnes; Kovacs, Maria

    2016-04-01

    Depressive disorders that onset in the juvenile years have been linked to far-reaching adverse consequences, making it imperative to elucidate key mechanisms and contributory factors. Excessive use of regulatory responses that exacerbate sadness (maladaptive mood repair) or insufficient use of regulatory responses that reduce it (adaptive mood repair) may reflect behavioral mechanisms of depression risk. Cardiac vagal control, indexed by patterns of respiratory sinus arrhythmia (RSA), has received attention as a putative physiological risk factor for depression. Although mood repair and RSA are related, the nature of this relationship is not well characterized in the context of depression risk. Therefore, we tested alternative models of the relationships between RSA patterns (at rest and in response to a sad film), trait mood repair, and the effectiveness of a mood repair response in the laboratory (state mood repair) among adolescents with depression histories (n = 210) and emotionally healthy peers (n = 161). In our data, a mediation model best explained the association between the key constructs: Adolescents with normative RSA patterns exhibited lower levels of depression and trait maladaptive mood repair, and benefited more from instructed (state) mood repair in the laboratory. By contrast, adolescents with atypical RSA patterns exhibited higher levels of depression and dispositional maladaptive mood repair, which, in turn, mediated the relations of RSA patterns and depression symptoms. Atypical RSA patterns also predicted reduced benefits from laboratory mood repair. (PsycINFO Database Record PMID:26950752

  17. DNA Repair Defects and Chromosomal Aberrations

    Science.gov (United States)

    Hada, Megumi; George, K. A.; Huff, J. L.; Pluth, J. M.; Cucinotta, F. A.

    2009-01-01

    Yields of chromosome aberrations were assessed in cells deficient in DNA doublestrand break (DSB) repair, after exposure to acute or to low-dose-rate (0.018 Gy/hr) gamma rays or acute high LET iron nuclei. We studied several cell lines including fibroblasts deficient in ATM (ataxia telangiectasia mutated; product of the gene that is mutated in ataxia telangiectasia patients) or NBS (nibrin; product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase (DNA-PK) activity. Chromosomes were analyzed using the fluorescence in situ hybridization (FISH) chromosome painting method in cells at the first division post irradiation, and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma irradiation induced greater yields of both simple and complex exchanges in the DSB repair-defective cells than in the normal cells. The quadratic dose-response terms for both simple and complex chromosome exchanges were significantly higher for the ATM- and NBS-deficient lines than for normal fibroblasts. However, in the NBS cells the linear dose-response term was significantly higher only for simple exchanges. The large increases in the quadratic dose-response terms in these repair-defective cell lines points the importance of the functions of ATM and NBS in chromatin modifications to facilitate correct DSB repair and minimize the formation of aberrations. The differences found between ATM- and NBS-deficient cells at low doses suggest that important questions should with regard to applying observations of radiation sensitivity at high dose to low-dose exposures. For aberrations induced by iron nuclei, regression models preferred purely linear dose responses for simple exchanges and quadratic dose responses for complex exchanges. Relative biological effectiveness (RBE) factors of all of

  18. Polychlorinated biphenyl quinone induces oxidative DNA damage and repair responses: The activations of NHEJ, BER and NER via ATM-p53 signaling axis

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Hui; Shi, Qiong; Song, Xiufang; Fu, Juanli; Hu, Lihua; Xu, Demei; Su, Chuanyang; Xia, Xiaomin; Song, Erqun; Song, Yang, E-mail: songyangwenrong@hotmail.com

    2015-07-01

    Our previous studies demonstrated that polychlorinated biphenyl (PCB) quinone induced oxidative DNA damage in HepG2 cells. To promote genomic integrity, DNA damage response (DDR) coordinates cell-cycle transitions, DNA repair and apoptosis. PCB quinone-induced cell cycle arrest and apoptosis have been documented, however, whether PCB quinone insult induce DNA repair signaling is still unknown. In this study, we identified the activation of DDR and corresponding signaling events in HepG2 cells upon the exposure to a synthetic PCB quinone, PCB29-pQ. Our data illustrated that PCB29-pQ induces the phosphorylation of p53, which was mediated by ataxia telangiectasia mutated (ATM) protein kinase. The observed phosphorylated histone H2AX (γ-H2AX) foci and the elevation of 8-hydroxy-2′-deoxyguanosine (8-OHdG) indicated that DDR was stimulated by PCB29-pQ treatment. Additionally, we found PCB29-pQ activates non-homologous end joining (NHEJ), base excision repair (BER) and nucleotide excision repair (NER) signalings. However, these repair pathways are not error-free processes and aberrant repair of DNA damage may cause the potential risk of carcinogenesis and mutagenesis. - Highlights: • Polychlorinated biphenyl quinone induces oxidative DNA damage in HepG2 cells. • The elevation of γ-H2AX and 8-OHdG indicates the activation of DNA damage response. • ATM-p53 signaling acts as the DNA damage sensor and effector. • Polychlorinated biphenyl quinone activates NHEJ, BER and NER signalings.

  19. Polychlorinated biphenyl quinone induces oxidative DNA damage and repair responses: The activations of NHEJ, BER and NER via ATM-p53 signaling axis

    International Nuclear Information System (INIS)

    Our previous studies demonstrated that polychlorinated biphenyl (PCB) quinone induced oxidative DNA damage in HepG2 cells. To promote genomic integrity, DNA damage response (DDR) coordinates cell-cycle transitions, DNA repair and apoptosis. PCB quinone-induced cell cycle arrest and apoptosis have been documented, however, whether PCB quinone insult induce DNA repair signaling is still unknown. In this study, we identified the activation of DDR and corresponding signaling events in HepG2 cells upon the exposure to a synthetic PCB quinone, PCB29-pQ. Our data illustrated that PCB29-pQ induces the phosphorylation of p53, which was mediated by ataxia telangiectasia mutated (ATM) protein kinase. The observed phosphorylated histone H2AX (γ-H2AX) foci and the elevation of 8-hydroxy-2′-deoxyguanosine (8-OHdG) indicated that DDR was stimulated by PCB29-pQ treatment. Additionally, we found PCB29-pQ activates non-homologous end joining (NHEJ), base excision repair (BER) and nucleotide excision repair (NER) signalings. However, these repair pathways are not error-free processes and aberrant repair of DNA damage may cause the potential risk of carcinogenesis and mutagenesis. - Highlights: • Polychlorinated biphenyl quinone induces oxidative DNA damage in HepG2 cells. • The elevation of γ-H2AX and 8-OHdG indicates the activation of DNA damage response. • ATM-p53 signaling acts as the DNA damage sensor and effector. • Polychlorinated biphenyl quinone activates NHEJ, BER and NER signalings

  20. INTERNAL REPAIR OF PIPELINES

    Energy Technology Data Exchange (ETDEWEB)

    Robin Gordon; Bill Bruce; Ian Harris; Dennis Harwig; George Ritter; Bill Mohr; Matt Boring; Nancy Porter; Mike Sullivan; Chris Neary

    2004-12-31

    liners, indicating that this type of liner is only marginally effective at restoring the pressure containing capabilities of pipelines. Failure pressures for larger diameter pipe repaired with a semi-circular patch of carbon fiber-reinforced composite lines were also marginally greater than that of a pipe section with un-repaired simulated damage without a liner. These results indicate that fiber reinforced composite liners have the potential to increase the burst pressure of pipe sections with external damage Carbon fiber based liners are viewed as more promising than glass fiber based liners because of the potential for more closely matching the mechanical properties of steel. Pipe repaired with weld deposition failed at pressures lower than that of un-repaired pipe in both the virgin and damaged conditions, indicating that this repair technology is less effective at restoring the pressure containing capability of pipe than a carbon fiber-reinforced liner repair. Physical testing indicates that carbon fiber-reinforced liner repair is the most promising technology evaluated to-date. The first round of optimization and validation activities for carbon-fiber repairs are complete. Development of a comprehensive test plan for this process is recommended for use in the field trial portion of this program.

  1. The Trichoderma reesei Cry1 protein is a member of the cryptochrome/photolyase family with 6-4 photoproduct repair activity.

    Directory of Open Access Journals (Sweden)

    Jesús Guzmán-Moreno

    Full Text Available DNA-photolyases use UV-visible light to repair DNA damage caused by UV radiation. The two major types of DNA damage are cyclobutane pyrimidine dimers (CPD and 6-4 photoproducts (6-4PP, which are repaired under illumination by CPD and 6-4 photolyases, respectively. Cryptochromes are proteins related to DNA photolyases with strongly reduced or lost DNA repair activity, and have been shown to function as blue-light photoreceptors and to play important roles in circadian rhythms in plants and animals. Both photolyases and cryptochromes belong to the cryptochrome/photolyase family, and are widely distributed in all organisms. Here we describe the characterization of cry1, a member of the cryptochrome/photolyase protein family of the filamentous fungus Trichoderma reesei. We determined that cry1 transcript accumulates when the fungus is exposed to light, and that such accumulation depends on the photoreceptor Blr1 and is modulated by Envoy. Conidia of cry1 mutants show decreased photorepair capacity of DNA damage caused by UV light. In contrast, strains over-expressing Cry1 show increased repair, as compared to the parental strain even in the dark. These observations suggest that Cry1 may be stimulating other systems involved in DNA repair, such as the nucleotide excision repair system. We show that Cry1, heterologously expressed and purified from E. coli, is capable of binding to undamaged and 6-4PP damaged DNA. Photorepair assays in vitro clearly show that Cry1 repairs 6-4PP, but not CPD and Dewar DNA lesions.

  2. Role of deoxyribonucleic acid polymerases and deoxyribonucleic acid ligase in x-ray-induced repair synthesis in toluene-treated Escherichia coli K-12

    International Nuclear Information System (INIS)

    Toluene-treated Escherichia coli mutants have been used to study the roles of deoxyribonucleic acid (DNA) polymerases I, II, and III, and of DNA ligase in repair synthesis and strand rejoining following x irradiation. In cells possessing all three DNA polymerases, both a greater amount of repair synthesis (''exaggerated'' repair synthesis) and failure of ligation are observed when DNA ligase activity is inhibited. In a mutant lacking the polymerizing activity of DNA polymerase I, exaggerated repair synthesis is not observed, and strand rejoining does not occur even if DNA ligase is fully activated. In a mutant possessing the polymerizing activity of DNA polymerase I but lacking its 5' → 3' exonuclease activity, exaggerated repair synthesis is minimal. After irradiation, DNA polymerases II and III are capable of carrying out an adenosine 5'-triphosphate-dependent repair synthesis, but rejoining of strand breaks does not occur and exaggerated synthesis is not seen whether DNA ligase is active or not. These results suggest that DNA polymerase I and DNA ligase act together to limit repair synthesis after x irradiation and that both are necessary in toluene-treated cells for strand rejoining. DNA polymerases II and III apparently cannot complete chain elongation and gap filling, and therefore repair carried out by these enzymes does not respond to ligase action

  3. Role of deoxyribonucleic acid polymerases and deoxyribonucleic acid ligase in x-ray-induced repair synthesis in toluene-treated Escherichia coli K-12

    International Nuclear Information System (INIS)

    Toluene-treated Escherichia coli mutants have been used to study the roles of deoxyribonucleic acid (DNA) polymerases I, II, and III, and of DNA ligase in repair synthesis and strand rejoining following X-irradiation. In cells possessing all three DNA polymerases, both a greater amount of repair synthesis (''exaggerated'' repair synthesis) and failure of ligation are observed when DNA ligase activity is inhibited. In a mutant lacking the polymerizing activity of DNA polymerase I, exaggerated repair synthesis is not observed, and strand rejoining does not occur even if DNA ligase is fully activated. In a mutant possessing the polymerizing activity of DNA polymerase I but lacking its 5' → 3' exonuclease activity, exaggerated repair synthesis is minimal. After irradiation, DNA polymerases II and III are capable of carrying out an adenosine 5'-triphosphate-dependent repair synthesis, but rejoining of strand breaks does not occur and exaggerated synthesis is not seen whether DNA ligase is active or not. These results suggest that DNA polymerase I and DNA ligase act together to limit repair synthesis after X irradiation and that both are necessary in toluene-treated cells for strand rejoining. DNA polymerases II and III apparently cannot complete chain elongation and gap filling, and therefore repair carried out by these enzymes does not respond to ligase action

  4. Complementary Roles of Yeast Rad4p and Rad34p in Nucleotide Excision Repair of Active and Inactive rRNA Gene Chromatin▿

    OpenAIRE

    Tremblay, Maxime; Teng, Yumin; Paquette, Michel; Waters, Raymond; Conconi, Antonio

    2008-01-01

    Nucleotide excision repair (NER) removes a plethora of DNA lesions. It is performed by a large multisubunit protein complex that finds and repairs damaged DNA in different chromatin contexts and nuclear domains. The nucleolus is the most transcriptionally active domain, and in yeast, transcription-coupled NER occurs in RNA polymerase I-transcribed genes (rDNA). Here we have analyzed the roles of two members of the xeroderma pigmentosum group C family of proteins, Rad4p and Rad34p, during NER ...

  5. Health physics activities in support of the thermal shield removal/disposal and core support barrel repair at the St. Lucie Nuclear Power Plant

    International Nuclear Information System (INIS)

    The health physics activities related to the removal and disposal of a thermal shield at a nuclear power plant and subsequent repairs to the core support barrel required increased planning relative to a normal refueling/maintenance outage. The repair of the core support barrel was a first in the nuclear power industry. Pre-job planning was of great concern because of extremely high radiation levels associated with the irradiated stainless steel thermal shield and core support barrel. ALARA techniques used in the preparation of the thermal shield for removal and shipment to the disposal site are discussed

  6. INGUINAL HERNIA REPAIR - ACTUAL STATUS

    Directory of Open Access Journals (Sweden)

    R.Van Hee

    2007-04-01

    Full Text Available Even in 2006, there are a lot of controversy about the best technique for inguinal hernia repair. The factors that influence the choice of the technique are: uni- or bilateral hernia, “Nyhus” type of hernia, complicated hernia, large inguino-scrotal hernia, recurrent hernia or previous surgery, preferred type of anaesthesia. Surgeon has to answer to three question when he choices a type of hernia repair: What are there specific indications for this repair? What are the specific complications of the repair technique? What are the results with the repair technique? In the literature there are a lot of studies which give comparisons about the techniques of hernia repair: type and rate of complications, recurrence rate, costs and economic impact. There are various types of evidence: retrospective studies, prospective randomized trials, meta-analyses. This paper reviews some of the literature studies about: techniques of open non-mesh hernia repair, types of open mesh repair, mesh vs non-mesh open techniques, open vs laparoscopique techniques and types of laparoscopic hernia repair techniques. Conclusion: Open non-mesh repairs should be avoided. Lichtenstein mesh repair is the best open technique. Laparoscopic techniques (TAPP &TEP induce: less pain, shorter hospital stay, earlier return to work, more rapid resumption of activities and lower recurrence rates but at a higher cost, especially in “non-working” population.

  7. The Mismatch-Binding Factor MutSβ Can Mediate ATR Activation in Response to DNA Double-Strand Breaks

    Czech Academy of Sciences Publication Activity Database

    Burdová, Kamila; Mihaljevic, B.; Sturzenegger, A.; Chappidi, N.; Janščák, Pavel

    2015-01-01

    Roč. 59, č. 4 (2015), s. 603-614. ISSN 1097-2765 R&D Projects: GA ČR GAP305/10/0281; GA ČR(CZ) GA14-05743S Grant ostatní: Oncosuisse(CH) KLS-02344-02-2009; Swiss National Science Foundation(CH) 31003A_146206; Novartis Foundation for Medical and Biological Research(CH) 11A16 Institutional support: RVO:68378050 Keywords : Ataxia telangiectasia-mutated and Rad3-related (ATR) protein kinase * DNA-damage response * DNA Double-Strand Breaks Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 14.018, year: 2014

  8. Mitochondrial base excision repair assays

    DEFF Research Database (Denmark)

    Maynard, Scott; de Souza-Pinto, Nadja C; Scheibye-Knudsen, Morten;

    2010-01-01

    The main source of mitochondrial DNA (mtDNA) damage is reactive oxygen species (ROS) generated during normal cellular metabolism. The main mtDNA lesions generated by ROS are base modifications, such as the ubiquitous 8-oxoguanine (8-oxoG) lesion; however, base loss and strand breaks may also occur....... Many human diseases are associated with mtDNA mutations and thus maintaining mtDNA integrity is critical. All of these lesions are repaired primarily by the base excision repair (BER) pathway. It is now known that mammalian mitochondria have BER, which, similarly to nuclear BER, is catalyzed by DNA...

  9. Defective DNA Repair and Increased Genomic Instability in Artemis-deficient Murine Cells

    OpenAIRE

    Rooney, Sean; Alt, Frederick W.; Lombard, David; Whitlow, Scott; Eckersdorff, Mark; Fleming, James; Fugmann, Sebastian; Ferguson, David O.; Schatz, David G.; Sekiguchi, JoAnn

    2003-01-01

    In developing lymphocytes, the recombination activating gene endonuclease cleaves DNA between V, D, or J coding and recombination signal (RS) sequences to form hairpin coding and blunt RS ends, which are fused to form coding and RS joins. Nonhomologous end joining (NHEJ) factors repair DNA double strand breaks including those induced during VDJ recombination. Human radiosensitive severe combined immunodeficiency results from lack of Artemis function, an NHEJ factor with in vitro endonuclease/...

  10. Breaking Routines

    DEFF Research Database (Denmark)

    Kesting, Peter; Jørgensen, Frances

    such cognitive shifts. Specifically, we intend to challenge individuals' learned routines in a controlled environment while observing changes in brain activities via MMR scans. The intention with this workshop is to discuss the experimental design and to gather input from other researchers who have...

  11. A new dimension in improved radiation protection by enhanced DNA repair

    International Nuclear Information System (INIS)

    Radioprotection and photo protection were dependent until now on measures to reduce the amount of damage formed by ionizing and ultraviolet radiations. In both cases the measures are not completely satisfactory: the classical radioprotectors are toxic arid exert serious side effects, and afford a protection factor not higher than around 2. The sunscreens filters are effective for certain wavelength ranges only, and not enough is known about the possible effects of the filters when they absorb light and turn into other chemical entities. Both approaches do not give an answer to damages which are formed in spite of the partial reduction of damage. A new approach offered here is dealing with the damage on a cellular / molecular level, by enhancing the activity of the natural repair enzymes whose task is to remove radiation and photoproducts, rejoin DNA strand breaks and repair the DNA. A combination of vitamins and antioxidants is fulfilling these tasks and provides protection from both ionizing and ultraviolet radiations by enhancing several folds the repair of DNA in living cells. Such a combination which contains the repair enhancers niacinamide and nordihydroguaiaretic acid is employed in preparations named EDNAR ( Enhanced DNA Repair, Patent pending) which demonstrate excellent results of enhancing DNA repair as measured by repair synthesis, and protecting the skin from sunburns as well as skin burns following radiotherapy. These lotions and creams, when not containing any chemical filters yet demonstrating a protective effect, may be called 'the sunscreens without sunscreens'. (author)

  12. Tribute to dr louis keith: twin and physician extraordinaire/twin research reports: influences on asthma severity; chimerism revisited; DNA strand break repair/media reports: twins born apart; elevated twin frequencies; celebrity father of twins; conjoined twinning.

    Science.gov (United States)

    Segal, Nancy L

    2014-10-01

    The International Society for Twin Studies has lost a valued friend and colleague. Dr Louis Keith, Emeritus Professor of Obstetrics and Gynecology at Northwestern University, in Chicago, passed away on Sunday, July 6, 2014. His life and work with twins will be acknowledged at the November 2014 International Twin Congress in Budapest, Hungary. Next, twin research reports on the severity of asthma symptoms, a case of chimerism, and factors affecting DNA breakage and repair mechanisms are reviewed. Media reports cover twins born apart, elevated twin frequencies, a celebrity father of twins, and a family's decision to keep conjoined twins together. PMID:25213730

  13. Ku protein complex is involved in nucleotide excision repair of DNA

    International Nuclear Information System (INIS)

    The repair of ultraviolet light (UV-C, 254 nm) DNA lesions by nucleotide excision repair (NER) has been studied in the rodent cell line xrs6 belonging to complementation group 5 of ionising radiation sensitive (IRs) mutants. xrs6 cell line shows e defect in he DNA-end binding protein complex Ku which is involved in the repair of double-strand breaks (DSB) due to IR. In agreement with IR sensitivity, a bleomycin sensitive phenotype of xrs6 cell line was found as compared to the parental CHO-Kl line (factor> 8 fold). xrs6 exhibited also a slight (factor 2) but reproducible sensitivity to UV-C-light, while a revertant cell line for Ku DNA-end binding activity, xrs6rev, showed a restoration of both IR and UV-C sensitivities to the parental level. The NER activity of these cell lines was measured in vitro in nuclear protein extracts in the presence of plasmid DNA repair substrate damaged with UV-C lesions repaired by NER: xrs6 cell extracts exhibited only 55 % of NER activity as compared to the control CHO-Kl and xrs6rev cell extracts. These indicate that the Ku DSB repair protein in involved also in the NER process. (authors). 31 refs., 1 fig., 1 tab

  14. Supplementary motor area and primary auditory cortex activation in an expert break-dancer during the kinesthetic motor imagery of dance to music.

    Science.gov (United States)

    Olshansky, Michael P; Bar, Rachel J; Fogarty, Mary; DeSouza, Joseph F X

    2015-01-01

    The current study used functional magnetic resonance imaging to examine the neural activity of an expert dancer with 35 years of break-dancing experience during the kinesthetic motor imagery (KMI) of dance accompanied by highly familiar and unfamiliar music. The goal of this study was to examine the effect of musical familiarity on neural activity underlying KMI within a highly experienced dancer. In order to investigate this in both primary sensory and motor planning cortical areas, we examined the effects of music familiarity on the primary auditory cortex [Heschl's gyrus (HG)] and the supplementary motor area (SMA). Our findings reveal reduced HG activity and greater SMA activity during imagined dance to familiar music compared to unfamiliar music. We propose that one's internal representations of dance moves are influenced by auditory stimuli and may be specific to a dance style and the music accompanying it. PMID:25301352

  15. Cellular and molecular repair of X-ray-induced damage: dependence on oxygen tension and nutritional status

    International Nuclear Information System (INIS)

    Cellular and molecular repair was studied at 230C using split-dose recovery and alkaline elution techniques, respectively, as a function of cellular oxygen and nutrient conditions. Hypoxic cells in full medium showed a partial reduction in the level of sublethal damage (SLD) repair relative to aerated cells; the respective repair kinetics were similar with a common repair half-time of 30 min. Similarly, hypoxic cells showed a slight reduction in strand break rejoining capacity compared to aerated cells. Under nutrient deprivation, anoxic cells displayed no SLD repair or strand break repair, while aerated cells exhibited the same level of SLD and strand break repair as for well-fed cells. In addition, nutrient deprived cells at low O2 levels displayed normal SLD and strand break repair capability. These results indicate that both nutrient and O2 deprivation are necessary for complete inhibition of cellular and molecular repair, and low levels of O2 can effectively reverse this inhibition

  16. Activation of pozzolanic and latent-hydraulic reactions by Alkalis in order to repair concrete cracks

    OpenAIRE

    Gruyaert, Elke; Van Tittelboom, Kim; Rahier, Hubert; De Belie, Nele

    2015-01-01

    The low degree of hydration of fly ash (FA) and slag (BFS) particles in high-volume FA and BFS concrete offers the possibility to activate the unreacted particles upon crack formation to close the crack. In this paper, a preliminary study is performed to evaluate the use of alkaline activators to stimulate the formation of reaction products in the crack. First, the reaction rates of crushed pastes mixed with alkaline solutions or water were monitored by calorimetry. These tests showed that al...

  17. Transcriptomic analysis of tail regeneration in the lizard Anolis carolinensis reveals activation of conserved vertebrate developmental and repair mechanisms.

    Directory of Open Access Journals (Sweden)

    Elizabeth D Hutchins

    Full Text Available Lizards, which are amniote vertebrates like humans, are able to lose and regenerate a functional tail. Understanding the molecular basis of this process would advance regenerative approaches in amniotes, including humans. We have carried out the first transcriptomic analysis of tail regeneration in a lizard, the green anole Anolis carolinensis, which revealed 326 differentially expressed genes activating multiple developmental and repair mechanisms. Specifically, genes involved in wound response, hormonal regulation, musculoskeletal development, and the Wnt and MAPK/FGF pathways were differentially expressed along the regenerating tail axis. Furthermore, we identified 2 microRNA precursor families, 22 unclassified non-coding RNAs, and 3 novel protein-coding genes significantly enriched in the regenerating tail. However, high levels of progenitor/stem cell markers were not observed in any region of the regenerating tail. Furthermore, we observed multiple tissue-type specific clusters of proliferating cells along the regenerating tail, not localized to the tail tip. These findings predict a different mechanism of regeneration in the lizard than the blastema model described in the salamander and the zebrafish, which are anamniote vertebrates. Thus, lizard tail regrowth involves the activation of conserved developmental and wound response pathways, which are potential targets for regenerative medical therapies.

  18. Transcriptomic analysis of tail regeneration in the lizard Anolis carolinensis reveals activation of conserved vertebrate developmental and repair mechanisms.

    Science.gov (United States)

    Hutchins, Elizabeth D; Markov, Glenn J; Eckalbar, Walter L; George, Rajani M; King, Jesse M; Tokuyama, Minami A; Geiger, Lauren A; Emmert, Nataliya; Ammar, Michael J; Allen, April N; Siniard, Ashley L; Corneveaux, Jason J; Fisher, Rebecca E; Wade, Juli; DeNardo, Dale F; Rawls, J Alan; Huentelman, Matthew J; Wilson-Rawls, Jeanne; Kusumi, Kenro

    2014-01-01

    Lizards, which are amniote vertebrates like humans, are able to lose and regenerate a functional tail. Understanding the molecular basis of this process would advance regenerative approaches in amniotes, including humans. We have carried out the first transcriptomic analysis of tail regeneration in a lizard, the green anole Anolis carolinensis, which revealed 326 differentially expressed genes activating multiple developmental and repair mechanisms. Specifically, genes involved in wound response, hormonal regulation, musculoskeletal development, and the Wnt and MAPK/FGF pathways were differentially expressed along the regenerating tail axis. Furthermore, we identified 2 microRNA precursor families, 22 unclassified non-coding RNAs, and 3 novel protein-coding genes significantly enriched in the regenerating tail. However, high levels of progenitor/stem cell markers were not observed in any region of the regenerating tail. Furthermore, we observed multiple tissue-type specific clusters of proliferating cells along the regenerating tail, not localized to the tail tip. These findings predict a different mechanism of regeneration in the lizard than the blastema model described in the salamander and the zebrafish, which are anamniote vertebrates. Thus, lizard tail regrowth involves the activation of conserved developmental and wound response pathways, which are potential targets for regenerative medical therapies. PMID:25140675

  19. 46 CFR 196.30-20 - Breaking of safety valve seal.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Breaking of safety valve seal. 196.30-20 Section 196.30... OPERATIONS Reports of Accidents, Repairs, and Unsafe Equipment § 196.30-20 Breaking of safety valve seal. (a) If at any time it is necessary to break the seal on a safety valve for any purpose, the...

  20. Of Heart & Kidneys: Hands-On Activities for Demonstrating Organ Function & Repair

    Science.gov (United States)

    Kao, Robert M.

    2014-01-01

    A major challenge in teaching organ development and disease is deconstructing a complex choreography of molecular and cellular changes over time into a linear stepwise process for students. As an entry toward learning developmental concepts, I propose two inexpensive hands-on activities to help facilitate learning of (1) how to identify defects in…