Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

Science.gov (United States)

Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

2013-01-01

Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

Brassica villosa, a system for studying non-glandular trichomes and genes in the Brassicas.

Science.gov (United States)

Nayidu, Naghabushana K; Tan, Yifang; Taheri, Ali; Li, Xiang; Bjorndahl, Trent C; Nowak, Jacek; Wishart, David S; Hegedus, Dwayne; Gruber, Margaret Y

2014-07-01

Brassica villosa is a wild Brassica C genome species with very dense trichome coverage and strong resistance to many insect pests of Brassica oilseeds and vegetables. Transcriptome analysis of hairy B. villosa leaves indicated higher expression of several important trichome initiation genes compared with glabrous B. napus leaves and consistent with the Arabidopsis model of trichome development. However, transcripts of the TRY inhibitory gene in hairy B. villosa were surprisingly high relative to B. napus and relative transcript levels of SAD2, EGL3, and several XIX genes were low, suggesting potential ancillary or less important trichome-related roles for these genes in Brassica species compared with Arabidopsis. Several antioxidant, calcium, non-calcium metal and secondary metabolite genes also showed differential expression between these two species. These coincided with accumulation of two alkaloid-like compounds, high levels of calcium, and other metals in B. villosa trichomes that are correlated with the known tolerance of B. villosa to high salt and the calcium-rich natural habitat of this wild species. This first time report on the isolation of large amounts of pure B. villosa trichomes, on trichome content, and on relative gene expression differences in an exceptionally hairy Brassica species compared with a glabrous species opens doors for the scientific community to understand trichome gene function in the Brassicas and highlights the potential of B. villosa as a trichome research platform.

Transcriptomic basis for drought-resistance in Brassica napus L.

Science.gov (United States)

Wang, Pei; Yang, Cuiling; Chen, Hao; Song, Chunpeng; Zhang, Xiao; Wang, Daojie

2017-01-01

Based on transcriptomic data from four experimental settings with drought-resistant and drought-sensitive cultivars under drought and well-watered conditions, statistical analysis revealed three categories encompassing 169 highly differentially expressed genes (DEGs) in response to drought in Brassica napus L., including 37 drought-resistant cultivar-related genes, 35 drought-sensitive cultivar-related genes and 97 cultivar non-specific ones. We provide evidence that the identified DEGs were fairly uniformly distributed on different chromosomes and their expression patterns are variety specific. Except commonly enriched in response to various stimuli or stresses, different categories of DEGs show specific enrichment in certain biological processes or pathways, which indicated the possibility of functional differences among the three categories. Network analysis revealed relationships among the 169 DEGs, annotated biological processes and pathways. The 169 DEGs can be classified into different functional categories via preferred pathways or biological processes. Some pathways might simultaneously involve a large number of shared DEGs, and these pathways are likely to cross-talk and have overlapping biological functions. Several members of the identified DEGs fit to drought stress signal transduction pathway in Arabidopsis thaliana. Finally, quantitative real-time PCR validations confirmed the reproducibility of the RNA-seq data. These investigations are profitable for the improvement of crop varieties through transgenic engineering.

Comparative transcriptomic analysis of two Brassica napus near-isogenic lines reveals a network of genes that influences seed oil accumulation

Directory of Open Access Journals (Sweden)

Jingxue Wang

2016-09-01

Full Text Available Rapeseed (Brassica napus is an important oil seed crop, providing more than 13% of the world’s supply of edible oils. An in-depth knowledge of the gene network involved in biosynthesis and accumulation of seed oil is critical for the improvement of B. napus. Using available genomic and transcriptomic resources, we identified 1,750 acyl lipid metabolism (ALM genes that are distributed over 19 chromosomes in the B. napus genome. B. rapa and B. oleracea, two diploid progenitors of B. napus, contributed almost equally to the ALM genes. Genome collinearity analysis demonstrated that the majority of the ALM genes have arisen due to genome duplication or segmental duplication events. In addition, we profiled the expression patterns of the ALM genes in four different developmental stages. Furthermore, we developed two B. napus near isogenic lines (NILs. The high oil NIL, YC13-559, accumulates more than 10% of seed oil compared to the other, YC13-554. Comparative gene expression analysis revealed upregulation of lipid biosynthesis-related regulatory genes in YC13-559, including SHOOTMERISTEMLESS, LEAFY COTYLEDON 1 (LEC1, LEC2, FUSCA3, ABSCISIC ACID INSENSITIVE 3 (ABI3, ABI4, ABI5, and WRINKLED1, as well as structural genes, such as ACETYL-CoA CARBOXYLASE, ACYL-CoA DIACYLGLYCEROL ACYLTRANSFERASE, and LONG-CHAIN ACYL-CoA SYNTHETASES. We observed that several genes related to the phytohormones, gibberellins, jasmonate, and indole acetic acid, were differentially expressed in the NILs. Our findings provide a broad account of the numbers, distribution, and expression profiles of acyl lipid metabolism genes, as well as gene networks that potentially control oil accumulation in B. napus seeds. The upregulation of key regulatory and structural genes related to lipid biosynthesis likely plays a major role for the increased seed oil in YC13-559.

Availability of phosphorus from ground phosphate rocks for rape (Brassica napus L.)

International Nuclear Information System (INIS)

Zhu Yongyi; Yang Juncheng; Chen Jingjian; Liu Delin; Zhu Zhaomin; Wu Ming

1996-09-01

The availability of phosphorus from the ground phosphate rock, which is provided by Kaiyang mining plant, Guizhou Province of China, is investigated in pot experiment with acid red soil for rape (Brassica napus L. No. 13 Xingyou, Chinese Olive Group) by 32 P indirect labelling method. The results show that the yield increased significantly by applying ground phosphate rock (GPR) and the efficiency of GPR is equal to 17.1% of that from calcium superphosphate. It is calculated as that the fertilizer efficiency of 1 kg of calcium superphosphate is the same as that of 8.53 kg ground phosphate rock in Guizhou Province of China. The effect on the grain yield is evaluated by pot and field microplot experiments, and it is found that the main effect is to increase the pod number. The fertilizer efficiency in field experiment is the same as that in pot experiment. (9 refs., 1 fig., 7 tabs.)

Differential flavonoid response to enhanced UV-B radiation in Brassica napus

International Nuclear Information System (INIS)

Olsson, L.C.; Veit, M.; Weissenböck, G.; Bornman, J.F.

1998-01-01

We have examined the qualitative and quantitative differences in methanol-soluble flavonoids of leaves of two cultivars of Brassica napus, which were grown with or without (control) supplemental UV-B radiation. The flavonoids were identified using HPLC-diode array spectroscopy (-DAS), -electrospray ionization-mass spectroscopy (-ESI-MS) and 1H and 13C NMR, and quantitatively analysed by HPLC-DAS. After exposure to supplementary UV-B radiation, the overall amount of soluble flavonoids, kaempferol and quercetin glycosides, increased by ca 150% in cv. Paroll, compared to control plants. Cultivar Stallion showed a 70% increase, and also a lower overall content of soluble flavonoids compared to Paroll. The supplementary UV-B radiation resulted in a marked, specific increase in the amount of quercetin glycosides relative to the kaempferol glycosides with a 36- and 23-fold increase in cvs Paroll and Stallion, respectively. Four of the flavonol glycosides appearing after supplemental UV-B exposure were identified as quercetin- and kaempferol 3-sophoroside-7-glucoside and 3-(2″′-E-sinapoylsophoroside)-7-glucoside. (author)

A mutant Brassica napus (canola population for the identification of new genetic diversity via TILLING and next generation sequencing.

Directory of Open Access Journals (Sweden)

Erin J Gilchrist

Full Text Available We have generated a Brassica napus (canola population of 3,158 EMS-mutagenised lines and used TILLING to demonstrate that the population has a high enough mutation density that it will be useful for identification of mutations in genes of interest in this important crop species. TILLING is a reverse genetics technique that has been successfully used in many plant and animal species. Classical TILLING involves the generation of a mutagenised population, followed by screening of DNA samples using a mismatch-specific endonuclease that cleaves only those PCR products that carry a mutation. Polyacrylamide gel detection is then used to visualise the mutations in any gene of interest. We have used this TILLING technique to identify 432 unique mutations in 26 different genes in B. napus (canola cv. DH12075. This reflects a mutation density ranging from 1/56 kb to 1/308 kb (depending on the locus with an average of 1/109 kb. We have also successfully verified the utility of next generation sequencing technology as a powerful approach for the identification of rare mutations in a population of plants, even in polyploid species such as B. napus. Most of the mutants we have identified are publically available.

Genome-wide identification, functional prediction, and evolutionary analysis of the R2R3-MYB superfamily in Brassica napus.

Science.gov (United States)

Hajiebrahimi, Ali; Owji, Hajar; Hemmati, Shiva

2017-10-01

R2R3-MYB transcription factors (TFs) have been shown to play important roles in plants, including in development and in various stress conditions. Phylogenetic analysis showed the presence of 249 R2R3-MYB TFs in Brassica napus, called BnaR2R3-MYB TFs, clustered into 38 clades. BnaR2R3-MYB TFs were distributed on 19 chromosomes of B. napus. Sixteen gene clusters were identified. BnaR2R3-MYB TFs were characterized by motif prediction, gene structure analysis, and gene ontology. Evolutionary analysis revealed that BnaR2R3-MYB TFs are mainly formed as a result of whole-genome duplication. Orthologs and paralogs of BnaR2R3-MYB TFs were identified in B. napus, B. rapa, B. oleracea, and Arabidopsis thaliana using synteny-based methods. Purifying selection was pervasive within R2R3-MYB TFs. K n /K s values lower than 0.3 indicated that BnaR2R3-MYB TFs are being functionally converged. The role of gene conversion in the formation of BnaR2R3-MYB TFs was significant. Cis-regulatory elements in the upstream regions of BnaR2R3-MYB genes, miRNA targeting BnaR2R3MYB TFs, and post translational modifications were identified. Digital expression data revealed that BnaR2R3-MYB genes were highly expressed in the roots and under high salinity treatment after 24 h. BnaMYB21, BnaMYB141, and BnaMYB148 have been suggested for improving salt-tolerant B. napus. BnaR2R3-MYB genes were mostly up regulated on the 14th day post inoculation with Leptosphaeria biglobosa and L. maculan. BnaMYB150 is a candidate for increased tolerance to Leptospheria in B. napus.

Maghemite Nanoparticles Acts as Nanozymes, Improving Growth and Abiotic Stress Tolerance in Brassica napus

Science.gov (United States)

Palmqvist, N. G. Martin; Seisenbaeva, Gulaim A.; Svedlindh, Peter; Kessler, Vadim G.

2017-12-01

Yttrium doping-stabilized γ-Fe2O3 nanoparticles were studied for its potential to serve as a plant fertilizer and, through enzymatic activity, support drought stress management. Levels of both hydrogen peroxide and lipid peroxidation, after drought, were reduced when γ-Fe2O3 nanoparticles were delivered by irrigation in a nutrient solution to Brassica napus plants grown in soil. Hydrogen peroxide was reduced from 151 to 83 μM g-1 compared to control, and the malondialdehyde formation was reduced from 36 to 26 mM g-1. Growth rate of leaves was enhanced from 33 to 50% growth compared to fully fertilized plants and SPAD-measurements of chlorophyll increased from 47 to 52 suggesting improved agronomic properties by use of γ-Fe2O3 nanoparticles as fertilizer as compared to chelated iron.

Analysis of gene expression in resynthesized Brassica napus Allopolyploids using arabidopsis 70mer oligo microarrays.

Directory of Open Access Journals (Sweden)

Robert T Gaeta

Full Text Available BACKGROUND: Studies in resynthesized Brassica napus allopolyploids indicate that homoeologous chromosome exchanges in advanced generations (S(5ratio6 alter gene expression through the loss and doubling of homoeologous genes within the rearrangements. Rearrangements may also indirectly affect global gene expression if homoeologous copies of gene regulators within rearrangements have differential affects on the transcription of genes in networks. METHODOLOGY/PRINCIPAL FINDINGS: We utilized Arabidopsis 70mer oligonucleotide microarrays for exploring gene expression in three resynthesized B. napus lineages at the S(0ratio1 and S(5ratio6 generations as well as their diploid progenitors B. rapa and B. oleracea. Differential gene expression between the progenitors and additive (midparent expression in the allopolyploids were tested. The S(5ratio6 lines differed in the number of genetic rearrangements, allowing us to test if the number of genes displaying nonadditive expression was related to the number of rearrangements. Estimates using per-gene and common variance ANOVA models indicated that 6-15% of 26,107 genes were differentially expressed between the progenitors. Individual allopolyploids showed nonadditive expression for 1.6-32% of all genes. Less than 0.3% of genes displayed nonadditive expression in all S(0ratio1 lines and 0.1-0.2% were nonadditive among all S(5ratio6 lines. Differentially expressed genes in the polyploids were over-represented by genes differential between the progenitors. The total number of differentially expressed genes was correlated with the number of genetic changes in S(5ratio6 lines under the common variance model; however, there was no relationship using a per-gene variance model, and many genes showed nonadditive expression in S(0ratio1 lines. CONCLUSIONS/SIGNIFICANCE: Few genes reproducibly demonstrated nonadditive expression among lineages, suggesting few changes resulted from a general response to polyploidization

Studies on nitrogen uptake and utilization by rape (Brassica napus L.) under different sowing dates

International Nuclear Information System (INIS)

Liu Qixin; Nie Guangming

1992-01-01

The nitrogen uptake and utilization by low erucic acid variety, Zhong You Di Gai No.2, of rape (Brassica napus L.) under different sowing dates were studied. Total N uptake, the percentage N derived from the fertilizer, the rate of utilization of nitrogenous fertilizer, the production efficiency of N-fertilizer (seed yield g/gN derived by rape plant from the fertilizer), total P uptake and the production efficiency of phosphorus (seed yield g/gP derived by rape plant from fertilizer and soil) were all significantly higher at early sowing than that at later sowing within the range of normal sowing dates. Therefore, the biomass yield, the seed yield and oil content all increased significantly at early sowing treatment, but erucic acid content showed no significant difference

Systemic Resistance to Powdery Mildew in Brassica napus (AACC) and Raphanus alboglabra (RRCC) by Trichoderma harzianum TH12.

Science.gov (United States)

Alkooranee, Jawadayn Talib; Yin, Yongtai; Aledan, Tamarah Raad; Jiang, Yingfen; Lu, Guangyuan; Wu, Jiangsheng; Li, Maoteng

2015-01-01

Trichoderma harzianum TH12 is a microbial pesticide for certain rapeseed diseases. The mechanism of systemic resistance induced by TH12 or its cell-free culture filtrate (CF) in Brassica napus (AACC) and Raphanus alboglabra (RRCC) to powdery mildew disease caused by ascomycete Erysiphe cruciferarum was investigated. In this study, we conducted the first large-scale global study on the cellular and molecular aspects of B. napus and R. alboglabra infected with E. cruciferarum. The histological study showed the resistance of R. alboglabra to powdery mildew disease. The growth of fungal colonies was not observed on R. alboglabra leaves at 1, 2, 4, 6, 8, and 10 days post-inoculation (dpi), whereas this was clearly observed on B. napus leaves after 6 dpi. In addition, the gene expression of six plant defense-related genes, namely, PR-1, PR-2 (a marker for SA signaling), PR-3, PDF 1.2 (a marker for JA/ET signaling), CHI620, and CHI570, for both genotypes were analyzed in the leaves of B. napus and R. alboglabra after treatment with TH12 or CF and compared with the non-treated ones. The qRT-PCR results showed that the PR-1 and PR-2 expression levels increased in E. cruciferarum-infected leaves, but decreased in the TH12-treated leaves compared with leaves treated with CF. The expression levels of PR-3 and PDF1.2 decreased in plants infected by E. cruciferarum. However, expression levels increased when the leaves were treated with TH12. For the first time, we disclosed the nature of gene expression in B. napus and R. alboglabra to explore the resistance pathways in the leaves of both genotypes infected and non-infected by powdery mildew and inoculated or non-inoculated with elicitor factors. Results suggested that R. alboglabra exhibited resistance to powdery mildew disease, and the application of T. harzianum and its CF are a useful tool to facilitate new protection methods for resist or susceptible plants.

Genetic load and transgenic mitigating genes in transgenic Brassica rapa (field mustard × Brassica napus (oilseed rape hybrid populations

Directory of Open Access Journals (Sweden)

Warwick Suzanne I

2009-10-01

Full Text Available Abstract Background One theoretical explanation for the relatively poor performance of Brassica rapa (weed × Brassica napus (crop transgenic hybrids suggests that hybridization imparts a negative genetic load. Consequently, in hybrids genetic load could overshadow any benefits of fitness enhancing transgenes and become the limiting factor in transgenic hybrid persistence. Two types of genetic load were analyzed in this study: random/linkage-derived genetic load, and directly incorporated genetic load using a transgenic mitigation (TM strategy. In order to measure the effects of random genetic load, hybrid productivity (seed yield and biomass was correlated with crop- and weed-specific AFLP genomic markers. This portion of the study was designed to answer whether or not weed × transgenic crop hybrids possessing more crop genes were less competitive than hybrids containing fewer crop genes. The effects of directly incorporated genetic load (TM were analyzed through transgene persistence data. TM strategies are proposed to decrease transgene persistence if gene flow and subsequent transgene introgression to a wild host were to occur. Results In the absence of interspecific competition, transgenic weed × crop hybrids benefited from having more crop-specific alleles. There was a positive correlation between performance and number of B. napus crop-specific AFLP markers [seed yield vs. marker number (r = 0.54, P = 0.0003 and vegetative dry biomass vs. marker number (r = 0.44, P = 0.005]. However under interspecific competition with wheat or more weed-like conditions (i.e. representing a situation where hybrid plants emerge as volunteer weeds in subsequent cropping systems, there was a positive correlation between the number of B. rapa weed-specific AFLP markers and seed yield (r = 0.70, P = 0.0001, although no such correlation was detected for vegetative biomass. When genetic load was directly incorporated into the hybrid genome, by inserting a

Conserved Function of ACYL–ACYL CARRIER PROTEIN DESATURASE 5 on Seed Oil and Oleic Acid Biosynthesis between Arabidopsis thaliana and Brassica napus

Directory of Open Access Journals (Sweden)

Changyu Jin

2017-07-01

Full Text Available Previous studies have shown that several ACYL–ACYL CARRIER PROTEIN DESATURASE (AtAAD members in Arabidopsis thaliana are responsible for oleic acid (C18:1 biosynthesis. Limited research has been conducted on another member, AtAAD5, and its paralog BnAAD5 in the closely related and commercially important plant, Brassica napus. Here, we found that AtAAD5 was predominantly and exclusively expressed in developing embryos at the whole seed developmental stages. The aad5 mutation caused a significant decrease in the amounts of oil and C18:1, and a considerable increase in the content of stearic acid (C18:0 in mature seeds, suggesting that AtAAD5 functioned as an important facilitator of seed oil biosynthesis. We also cloned the full-length coding sequence of BnAAD5-1 from the A3 subgenome of the B. napus inbred line L111. We showed that ectopic expression of BnAAD5-1 in the A. thaliana aad5-2 mutant fully complemented the phenotypes of the mutant, such as lower oil content and altered contents of C18:0 and C18:1. These results help us to better understand the functions of AAD members in A. thaliana and B. napus and provide a promising target for genetic manipulation of B. napus.

A candidate gene-based association study of tocopherol content and composition in rapeseed (Brassica napus

Directory of Open Access Journals (Sweden)

Steffi eFritsche

2012-06-01

Full Text Available Rapeseed (Brassica napus L. is the most important oil crop of temperate climates. Rapeseed oil contains tocopherols, also known as vitamin E, which is an indispensable nutrient for humans and animals due to its antioxidant and radical scavenging abilities. Moreover, tocopherols are also important for the oxidative stability of vegetable oils. Therefore, seed oil with increased tocopherol content or altered tocopherol composition is a target for breeding. We investigated the role of nucleotide variations within candidate genes from the tocopherol biosynthesis pathway. Field trials were carried out with 229 accessions from a worldwide B. napus collection which was divided into two panels of 96 and 133 accessions. Seed tocopherol content and composition were measured by HPLC. High heritabilities were found for both traits, ranging from 0.62 to 0.94. We identified polymorphisms by sequencing selected regions of the tocopherol genes from the 96 accession panel. Subsequently, we determined the population structure (Q and relative kinship (K as detected by genotyping with genome-wide distributed SSR markers. Association studies were performed using two models, the structure-based GLM+Q and the PK mixed model. Between 26 and 12 polymorphisms within two genes (BnaX.VTE3.a, BnaA.PDS1.c were significantly associated with tocopherol traits. The SNPs explained up to 16.93 % of the genetic variance for tocopherol composition and up to 10.48 % for total tocopherol content. Based on the sequence information we designed CAPS markers for genotyping the 133 accessions from the 2nd panel. Significant associations with various tocopherol traits confirmed the results from the first experiment. We demonstrate that the polymorphisms within the tocopherol genes clearly impact tocopherol content and composition in B. napus seeds. We suggest that these nucleotide variations may be used as selectable markers for breeding rapeseed with enhanced tocopherol quality.

Microspore culture of winter oilseed rape (Brassica napus L.) in conjunction with other in vitro technologies

International Nuclear Information System (INIS)

Cegielska-Taras, T.; Szala, L.; Bartkowiak-Broda, I.

2001-01-01

Microspore culture in conjunction with other technologies such as selection, mutagenesis and transformation has been used for the production of novel genotypes of Brassica napus L. for crop improvement. The example of in vitro selection of microspore - derived embryos includes: a) ploidy level, b) seed oil composition (for example: high level of erucic acid), c) genotypes with restorer gene for CMS-ogura system (by means of isozyme marker PGI-2 ), d) herbicide resistant forms. Efficiency of microspore mutagenesis has been tested by the treatment of freshly isolated microspores with UV and MNU. Direct delivery of foreign gene to the microspores (microprojectile bombardment) combined with the use of Agrobacterium tumefaciens to microspore derived embryos seems to be a promising way of oilseed rape transformation. (author)

The compact genome of the plant pathogen Plasmodiophora brassicae is adapted to intracellular interactions with host Brassica spp.

Science.gov (United States)

Rolfe, Stephen A; Strelkov, Stephen E; Links, Matthew G; Clarke, Wayne E; Robinson, Stephen J; Djavaheri, Mohammad; Malinowski, Robert; Haddadi, Parham; Kagale, Sateesh; Parkin, Isobel A P; Taheri, Ali; Borhan, M Hossein

2016-03-31

The protist Plasmodiophora brassicae is a soil-borne pathogen of cruciferous species and the causal agent of clubroot disease of Brassicas including agriculturally important crops such as canola/rapeseed (Brassica napus). P. brassicae has remained an enigmatic plant pathogen and is a rare example of an obligate biotroph that resides entirely inside the host plant cell. The pathogen is the cause of severe yield losses and can render infested fields unsuitable for Brassica crop growth due to the persistence of resting spores in the soil for up to 20 years. To provide insight into the biology of the pathogen and its interaction with its primary host B. napus, we produced a draft genome of P. brassicae pathotypes 3 and 6 (Pb3 and Pb6) that differ in their host range. Pb3 is highly virulent on B. napus (but also infects other Brassica species) while Pb6 infects only vegetable Brassica crops. Both the Pb3 and Pb6 genomes are highly compact, each with a total size of 24.2 Mb, and contain less than 2 % repetitive DNA. Clustering of genome-wide single nucleotide polymorphisms (SNP) of Pb3, Pb6 and three additional re-sequenced pathotypes (Pb2, Pb5 and Pb8) shows a high degree of correlation of cluster grouping with host range. The Pb3 genome features significant reduction of intergenic space with multiple examples of overlapping untranslated regions (UTRs). Dependency on the host for essential nutrients is evident from the loss of genes for the biosynthesis of thiamine and some amino acids and the presence of a wide range of transport proteins, including some unique to P. brassicae. The annotated genes of Pb3 include those with a potential role in the regulation of the plant growth hormones cytokinin and auxin. The expression profile of Pb3 genes, including putative effectors, during infection and their potential role in manipulation of host defence is discussed. The P. brassicae genome sequence reveals a compact genome, a dependency of the pathogen on its host for some

Evaluation of Yield Component Traits of Honeybee-Pollinated (Apis mellifera L.Rapeseed Canola (Brassica napus L. Evaluación de Parámetros de Rendimiento del Raps (Brassica napus L. Polinizado por Abejas (Apis mellifera L.

Directory of Open Access Journals (Sweden)

Ximena Araneda Durán

2010-06-01

Full Text Available Recent introduction of hybrid varieties raises the question if bees (Apis mellifera L. contribute as pollinator agents in developing the full yield potential of rapeseed (Brassica napus L.. In order to evaluate the yield achieved by B. napus cv. Artus pollinated by A. mellifera testing was carried out in the district of Freire, La Araucanía Region, Chile. This consisted in isolating or excluding rapeseed plants from pollinators with exclusion cages. Treatments applied were total exclusion (T1, partial exclusion (T2 and free pollination (T0 with a density of 6.5 hives ha-1, in order to determine the following yield components traits: grains per silique, siliques per plant, 1000 grain weight and yield. The experimental design used was randomized complete blocks with three treatments and three replicates. Results obtained show that the parameter least affected by bee intervention was the grains per silique variable. In contrast, siliques per plant and 1000 grain weight parameters presented significant differences, contributing to a yield greater than 5 t ha-1; which represented a figure 50.34% higher than in the treatment without bees. It may be concluded that the inclusion of bees in crops is fully justified as a production tool.La reciente introducción de variedades híbridas plantea la interrogante de la contribución que pueda tener la presencia de abejas (Apis mellifera L. como agentes polinizadores para desarrollar en pleno el potencial productivo del raps (Brassica napus L.. Con el objetivo de evaluar el rendimiento alcanzado por B. napus cv. Artus polinizado por A. mellifera, se realizó un ensayo en la localidad de Freire, Región de La Araucanía, Chile. Éste consistió en aislar o excluir las plantas de raps de los polinizadores mediante el uso de jaulas excluidoras. Los tratamientos consistieron en la exclusión total (T1, exclusión parcial (T2 y libre polinización (T0 con una densidad de 6,5 colmenas ha-1, con el fin de determinar

SSR marker variations in Brassica species provide insight into the origin and evolution of Brassica amphidiploids.

Science.gov (United States)

Thakur, Ajay Kumar; Singh, Kunwar Harendra; Singh, Lal; Nanjundan, Joghee; Khan, Yasin Jeshima; Singh, Dhiraj

2018-01-01

Oilseed Brassica represents an important group of oilseed crops with a long history of evolution and cultivation. To understand the origin and evolution of Brassica amphidiploids, simple sequence repeat (SSR) markers were used to unravel genetic variations in three diploids and three amphidiploid Brassica species of U's triangle along with Eruca sativa as an outlier. Of 124 Brassica-derived SSR loci assayed, 100% cross-transferability was obtained for B. juncea and three subspecies of B. rapa , while lowest cross-transferability (91.93%) was obtained for Eruca sativa . The average % age of cross-transferability across all the seven species was 98.15%. The number of alleles detected at each locus ranged from one to six with an average of 3.41 alleles per primer pair. Neighbor-Joining-based dendrogram divided all the 40 accessions into two main groups composed of B. juncea / B. nigra/B. rapa and B. carinata/B. napus/B. oleracea . C-genome of oilseed Brassica species remained relatively more conserved than A- and B-genome. A- genome present in B. juncea and B. napus seems distinct from each other and hence provides great opportunity for generating diversity through synthesizing amphidiploids from different sources of A- genome. B. juncea had least intra-specific distance indicating narrow genetic base. B. rapa appears to be more primitive species from which other two diploid species might have evolved. The SSR marker set developed in this study will assist in DNA fingerprinting of various Brassica species cultivars, evaluating the genetic diversity in Brassica germplasm, genome mapping and construction of linkage maps, gene tagging and various other genomics-related studies in Brassica species. Further, the evolutionary relationship established among various Brassica species would assist in formulating suitable breeding strategies for widening the genetic base of Brassica amphidiploids by exploiting the genetic diversity present in diploid progenitor gene pools.

Genetic Diversity in Commercial Rapeseed (Brassica napus L. Varieties from Turkey as Revealed by RAPD

Directory of Open Access Journals (Sweden)

Özlem ÖZBEK

2013-02-01

Full Text Available In cultivated commercial crop species, genetic diversity tends to decrease because of the extensive breeding processes. Therefore, germplasm of commercial crop species, such as Brassica napus L. should be evaluated and the genotypes, which have higher genetic diversity index, should be addressed as potential parental cross materials in breeding programs. In this study, the genetic diversity was analysed by using randomly amplified polymorphic DNA analysis (RAPD technique in nine Turkish commercial rapeseed varieties. The RAPD primers (10-mer oligonucleotides produced 51 scorable loci, 31 loci of which were polymorphic (60.78% and 20 loci (39.22% were monomorphic The RAPD bands were scored as binary matrix data and were analysed using POPGENE version 1.32. At locus level, the values of genetic diversity within population (Hs and total (HT were 0.15 and 0.19 respectively. The genetic differentiation (GST and the gene flow (Nm values between the populations were 0.20 and 2.05 respectively. The mean number of alleles (na, the mean number of effective alleles (nae, and the mean value of genetic diversity (He were 2.00, 1.26, and 0.19 respectively. According to Pearson’s correlation, multiple regression and principal component analyses, eco-geographical conditions in combination had significant effect on genetic indices of commercial B. napus L. varieties were discussed.

Variations in fatty acid composition, glucosinolate profile and some phytochemical contents in selected oil seed rape (Brassica napus L.) cultivars

OpenAIRE

Amin Mohamed, Amal; El-Din Saad El-Beltagi, Hossam

2010-01-01

Rapeseed (Brassica napus L.) is now the third most important source of edible oil in the world after soybean and palm oil. In this study seeds of five different rapeseed cultivars namely; pactol, silvo, topas, serw 4 and serw 6 were evaluated for their fatty acid composition, glucosinolate profile, amino acids, total tocopherols and phenolic content. Among all cultivars significant variability in fatty acids were observed. The oleic acid (C18:1) ranged from 56.31% to 58.67%, linoleic acid (C1...

The use of protein patterns in genetic diversity analysis in some Brassica napus cultivars

Directory of Open Access Journals (Sweden)

Roya Razavizadeh

2013-11-01

Full Text Available In this study, protein variations of seeds and five-day old cotyledonal leaves of four selected Brassica napus cultivars including Elite, Ocapy, Tasilo and Zarfam were analyzed by SDS-PAGE to identify protein markers. The amount of total soluble protein of seed storage proteins did not show significant differences in all cultivars whereas it was different in cotyledonal leaves. Protein patterns of seeds and cotyledonal leaves showed significant differences using SDS-PAGE and consequence analysis of bands by ImageJ program. Relative expression of six protein bands in seeds and five-day old cotyledonal leaves were significantly different. Three protein markers were identified by protein patterns of seed and cotyledonal leaves. The results of relationship analysis based on presence and absence of the specific protein bands in protein pattern of seed storage proteins showed that Tasilo and Elite cultivars had the highest similarities.

Effect of Sugarcane Filter Muds, Chemical and Biological Fertilizers on Absorption of Some Macro- and Micro-Elementsand Heavy Metals by Canola (Brassica napus L.)

OpenAIRE

H. Monjezi; M. R Moradi-Telavat; S. A. Siadat; A. Koochakzadeh; H. Hamdi

2015-01-01

In order to evaluate the effect of sugarcane (Sacharum officinarum L.) filter muds and chemical and biological fertilizers application on macro- and micronutrient elements and some heavy metals (Pb and Cd) absorption by canola (Brassica napus L.) grains, a factorial experiment was conducted in 2012 in the Experimental Farm of Ramin (Mollasani) Agriculture and Natural Resources University of Khouzestan, Iran. A complete blocks design was used for the experiment with three replications. Differe...

Production and genetic analysis of resynthesized Brassica napus from a B. rapa landrace from the Qinghai-Tibet Plateau and B. alboglabra.

Science.gov (United States)

Liu, H D; Zhao, Z G; Du, D Z; Deng, C R; Fu, G

2016-01-08

This study aimed to reveal the genetic and epigenetic variations involved in a resynthesized Brassica napus (AACC) generated from a hybridization between a B. rapa (AA) landrace and B. alboglabra (CC). Amplified fragment length polymorphism (AFLP), methylation-sensitive amplified polymorphism, and the cDNA-AFLP technique were performed to detect changes between different generations at the genome, methylation, and transcription levels. We obtained 30 lines of resynthesized B. napus with a mean 1000-seed weight of over 7.50 g. All of the lines were self-compatible, probably because both parents were self-compatible. At the genome level, the S0 generation had the lowest frequency of variations (0.18%) and the S3 generation had the highest (6.07%). The main variation pattern was the elimination of amplified restriction fragments on the CC genome from the S0 to the S4 generations. At the methylation level, we found three loci that exhibited altered methylation patterns on the parental A genome; the variance rate was 1.35%. At the transcription level, we detected 43.77% reverse mutations and 37.56% deletion mutations that mainly occurred on the A and C genomes, respectively, in the S3 generation. Our results highlight the genetic variations that occur during the diploidization of resynthesized B. napus.

Fatty Acid and Transcript Profiling in Developing Seeds of Three Brassica napus Cultivars

Directory of Open Access Journals (Sweden)

Petkova Mariana

2015-12-01

Full Text Available Fatty acid levels and gene expression profiles for selected genes associated with the synthesis of fatty acids (FA, triacylglycerol, and oil body proteins were examined in three oilseed rape (Brassica napus cultivars that have utility for cultivar development in our spring canola breeding program. The seed oil content of Bronowski, Q2, and Westar was 39.0, 40.1, and 40.6%, respectively at 40 days after flowering (DAF. During the 20 to 40 day period of seed development, cultivars had varying levels of palmitic, stearic, oleic, linoleic, α-linolenic, eicosenoic, and erucic acid. In general, the percentage of each FA was similar among the cultivars during seed development. However, the level of oleic acid was lower and the levels of eicosenoic acid and erucic acid were higher in Bronowski than in Q2 and Westar seeds; linoleic acid also tended to be lower in Bronowski. Gene expression among the cultivars was similar from 10 to 40 DAF. The few exceptions were that expression of KAS1 and SAD were higher in Westar and Q2 than in Bronowski at 25 DAF, SAD was highest in Q2, intermediate in Westar, and lowest in Bronowski at 35 DAF, FAD2 was higher in Q2 than in Bronowski at 35 DAF, FAD3 was higher in Q2 than in Bronowski at 15 DAF and Q2 and Westar at 25 and 30 DAF, and FAE1 was higher in Westar and Q2 than in Bronowski at 30 DAF. Correlation analysis for gene expression against DAF for each genotype supported a common trend in gene expression among the three cultivars with gene expression tending to decrease over time; except for LPAAT, which tended to increase. The correlation between the level of FAs and expression of genes by genotype indicated no general trend; rather correlations seem to depend on the genotype.

Neofunctionalization of duplicated Tic40 genes caused a gain-of-function variation related to male fertility in Brassica oleracea lineages.

Science.gov (United States)

Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

2014-11-01

Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. © 2014 American Society of Plant Biologists. All Rights Reserved.

A Phylogenetic Analysis of Chloroplast Genomes Elucidates the Relationships of the Six Economically Important Brassica Species Comprising the Triangle of U

NARCIS (Netherlands)

Li, Peirong; Zhang, Shujiang; Li, Fei; Zhang, Shifan; Zhang, Hui; Wang, Xiaowu; Sun, Rifei; Bonnema, Guusje; Borm, Theo J.A.

2017-01-01

The Brassica genus comprises many economically important worldwide cultivated crops. The well-established model of the Brassica genus, U’s triangle, consists of three basic diploid plant species (Brassica rapa, Brassica oleracea, and Brassica nigra) and three amphidiploid species (Brassica napus,

Brassica napusGLABRA3-1 promotes anthocyanin biosynthesis and trichome formation in true leaves when expressed in Arabidopsis thaliana.

Science.gov (United States)

Gao, C; Guo, Y; Wang, J; Li, D; Liu, K; Qi, S; Jin, C; Duan, S; Gong, J; Li, Z; Chen, M

2018-01-01

Previous studies have shown that GLABRA3 (AtGL3), a bHLH transcription factor, plays essential roles in anthocyanin biosynthesis and trichome formation in Arabidopsis thaliana. However, there have been no such studies of a homologue, BnGL3, from the closely related crop, Brassica napus. Here, we analysed the BnGL3-1 coding domain sequence from the B. napus cultivar QINYOU Seven, identified conserved protein domains and performed a phylogenetic analysis to elucidate its relationship with homologues form a range of plant species. When expressed in tobacco leaves as a fusion protein with green fluorescent protein, BnGL3-1 accumulated in the nucleus, consistent with its predicted function as a transcription factor. Ectopic expression of the BnGL3-1 gene in the A. thaliana gl3-3 mutant resulted in levels of anthocyanins and numbers of trichomes in true leaves that were higher than in wild-type plants. Moreover, overexpression of BnGL3-1 in gl3-3 compensated for the promotion and repression of genes involved in anthocyanin biosynthesis and trichome formation, respectively, that has been reported in gl3-3 young shoots and expanding true leaves. This study provides new insights into GL3 function in anthocyanin biosynthesis and trichome formation in crucifers, and represents a promising target for genetic manipulation of B. napus. © 2017 German Society for Plant Sciences and The Royal Botanical Society of the Netherlands.

Greenhouse gas emissions from the energy crop oilseed rape (Brassica napus); the role of photosynthetically active radiation in diurnal N2O flux variation.

OpenAIRE

Keane, J.Ben; Ineson, P.; Vallack, Harry W.; Blei, Emanuel; Howarth, Steve; McNamara, Niall P.; Rowe, Rebecca; Williams, Mathew; Toet, Sylvia

2017-01-01

Oilseed rape (OSR, Brassica napus L.) is an important feedstock for biodiesel; hence, carbon dioxide (CO2), methane (CH4) and particularly fertilizer-derived nitrous oxide (N2O) emissions during cultivation must be quantified to assess putative greenhouse gas (GHG) savings, thus creating an urgent and increasing need for such data. Substrates of nitrification [ammonium (NH4)] and denitrification [nitrate (NO3)], the predominant N2O production pathways, were supplied separately and in combinat...

A comprehensive transcriptome analysis of silique development and dehiscence in Arabidopsis and Brassica integrating genotypic, interspecies and developmental comparisons

Science.gov (United States)

Jaradat, Masrur R; Ruegger, Max; Bowling, Andrew; Butler, Holly; Cutler, Adrian J

2014-01-01

Asynchronous flowering of Brassica napus (canola) leads to seeds and siliques at varying stages of maturity as harvest approaches. This range of maturation can result in premature silique dehiscence (pod shattering), resulting in yield losses, which may be worsened by environmental stresses. Therefore, a goal for canola crop improvement is to reduce shattering in order to maximize yield. We performed a comprehensive transcriptome analysis on the dehiscence zone (DZ) and valve of Arabidopsis and Brassica siliques in shatter resistant and sensitive genotypes at several developmental stages. Among known Arabidopsis dehiscence genes, we confirmed that homologs of SHP1/2, FUL, ADPG1, NST1/3 and IND were associated with shattering in B. juncea and B. napus. We noted a correlation between reduced pectin degradation genes and shatter-resistance. Tension between lignified and non-lignified cells in the silique DZ plays a major role in dehiscence. Light microscopy revealed a smaller non-lignified separation layer in relatively shatter-resistant B. juncea relative to B. napus and this corresponded to increased expression of peroxidases involved in monolignol polymerization. Sustained repression of auxin biosynthesis, transport and signaling in B. juncea relative to B. napus may cause differences in dehiscence zone structure and cell wall constituents. Tension on the dehiscence zone is a consequence of shrinkage and loss of flexibility in the valves, which is caused by senescence and desiccation. Reduced shattering was generally associated with upregulation of ABA signaling and down-regulation of ethylene and jasmonate signaling, corresponding to more pronounced stress responses and reduced senescence and photosynthesis. Overall, we identified 124 cell wall related genes and 103 transcription factors potentially involved in silique dehiscence. PMID:25523176

A comprehensive transcriptome analysis of silique development and dehiscence in Arabidopsis and Brassica integrating genotypic, interspecies and developmental comparisons.

Science.gov (United States)

Jaradat, Masrur R; Ruegger, Max; Bowling, Andrew; Butler, Holly; Cutler, Adrian J

2014-01-01

Asynchronous flowering of Brassica napus (canola) leads to seeds and siliques at varying stages of maturity as harvest approaches. This range of maturation can result in premature silique dehiscence (pod shattering), resulting in yield losses, which may be worsened by environmental stresses. Therefore, a goal for canola crop improvement is to reduce shattering in order to maximize yield. We performed a comprehensive transcriptome analysis on the dehiscence zone (DZ) and valve of Arabidopsis and Brassica siliques in shatter resistant and sensitive genotypes at several developmental stages. Among known Arabidopsis dehiscence genes, we confirmed that homologs of SHP1/2, FUL, ADPG1, NST1/3 and IND were associated with shattering in B. juncea and B. napus. We noted a correlation between reduced pectin degradation genes and shatter-resistance. Tension between lignified and non-lignified cells in the silique DZ plays a major role in dehiscence. Light microscopy revealed a smaller non-lignified separation layer in relatively shatter-resistant B. juncea relative to B. napus and this corresponded to increased expression of peroxidases involved in monolignol polymerization. Sustained repression of auxin biosynthesis, transport and signaling in B. juncea relative to B. napus may cause differences in dehiscence zone structure and cell wall constituents. Tension on the dehiscence zone is a consequence of shrinkage and loss of flexibility in the valves, which is caused by senescence and desiccation. Reduced shattering was generally associated with upregulation of ABA signaling and down-regulation of ethylene and jasmonate signaling, corresponding to more pronounced stress responses and reduced senescence and photosynthesis. Overall, we identified 124 cell wall related genes and 103 transcription factors potentially involved in silique dehiscence.

In silico studies on structure-function of DNA GCC- box binding domain of brassica napus DREB1 protein

International Nuclear Information System (INIS)

Qamarunnisa, S.; Hussain, M.

2012-01-01

DREB1 is a transcriptional factor, which selectively binds with the promoters of the genes involved in stress response in the plants. Homology of DREB protein and its binding element have been detected in the genome of many plants. However, only a few reports exist that discusses the binding properties of this protein with the gene (s) promoter. In the present study, we have undertaken studies exploring the structure-function relationship of Brassica napus DREB1. Multiple sequence alignment, protein homology modeling and intermolecular docking of GCC-box binding domain (GBD) of the said protein was carried out using atomic coordinates of GBD from Arabdiopsis thaliana and GCC-box containing DNA respectively. Similarities and/or identities in multiple, sequence alignment, particularly at the functionally important amino acids, strongly suggested the binding specificity of B. napus DREB1 to GCC-box. Similarly, despite 56% sequence homology, tertiary structures of both template and modeled protein were found to be extremely similar as indicated by root mean square deviation of 0.34 A. More similarities were established between GBD of both A. thaliana and B. napus DREB1 by conducting protein docking with the DNA containing GCC-box. It appears that both proteins interact through their beta-sheet with the major DNA groove including both nitrogen bases and phosphate and sugar moieties. Additionally, in most cases the interacting residues were also found to be identical. Briefly, this study attempts to elucidate the molecular basis of DREB1 interaction with its target sequence in the promoter. (author)

Genome-wide survey of flavonoid biosynthesis genes and gene expression analysis between black- and yellow-seeded Brassica napus

Directory of Open Access Journals (Sweden)

Cunmin Qu

2016-12-01

Full Text Available Flavonoids, the compounds that impart color to fruits, flowers, and seeds, are the most widespread secondary metabolites in plants. However, a systematic analysis of these loci has not been performed in Brassicaceae. In this study, we isolated 649 nucleotide sequences related to flavonoid biosynthesis, i.e., the Transparent Testa (TT genes, and their associated amino acid sequences in 17 Brassicaceae species, grouped into Arabidopsis or Brassicaceae subgroups. Moreover, 36 copies of 21 genes of the flavonoid biosynthesis pathway were identified in A. thaliana, 53 were identified in B. rapa, 50 in B. oleracea, and 95 in B. napus, followed the genomic distribution, collinearity analysis and genes triplication of them among Brassicaceae species. The results showed that the extensive gene loss, whole genome triplication, and diploidization that occurred after divergence from the common ancestor. Using qRT-PCR methods, we analyzed the expression of eighteen flavonoid biosynthesis genes in 6 yellow- and black-seeded B. napus inbred lines with different genetic background, found that 12 of which were preferentially expressed during seed development, whereas the remaining genes were expressed in all B. napus tissues examined. Moreover, fourteen of these genes showed significant differences in expression level during seed development, and all but four of these (i.e., BnTT5, BnTT7, BnTT10, and BnTTG1 had similar expression patterns among the yellow- and black-seeded B. napus. Results showed that the structural genes (BnTT3, BnTT18 and BnBAN, regulatory genes (BnTTG2 and BnTT16 and three encoding transfer proteins (BnTT12, BnTT19, and BnAHA10 might play an crucial roles in the formation of different seed coat colors in B. napus. These data will be helpful for illustrating the molecular mechanisms of flavonoid biosynthesis in Brassicaceae species.

Proteomic Analysis of Pollen and Blossom Honey from Rape Seed Brassica Napus L.

Directory of Open Access Journals (Sweden)

Borutinskaitė Veronika

2017-06-01

Full Text Available In the study, honey from oilseed rape Brassica napus L., and both hand-collected (winter rape Visby and Cult and bee-collected pollen of oilseed rape were analyzed for their proteome content, in order to see if any plant proteins were present to allow the proteo-typing of the oilseed rape honey. Proteins were fractionated by two-dimensional gel electrophoresis (2DE, stained by Coomassie blue and then analyzed by mass spectrometry. All identified proteins were divided into few groups due to their biological function. In 2DE gels with separated proteins from blossom honey, only bee (Apis mellifera main proteins (Major royal jelly protein 1-5 and Glucosidase were found. So we analyzed all proteins using gel-free based analysis with the SYNAPT G2 high definition mass spectrometry. We identified proteins that were present in both oilseed rape pollen and honey (Bna, Polygalacturonase, Non-specific lipid-transfer protein, GAPDH and others. We believe that these proteins are important for the nutritional value of plant pollen-enriched honey and further research is required on honey and honeybee pollen protein.

Senescence-specific alteration of hydrogen peroxide levels in Arabidopsis thaliana and oilseed rape spring variety Brassica napus L. cv. Mozart.

Science.gov (United States)

Bieker, Stefan; Riester, Lena; Stahl, Mark; Franzaring, Jürgen; Zentgraf, Ulrike

2012-08-01

In order to analyze the signaling function of hydrogen peroxide (H(2)O(2)) production in senescence in more detail, we manipulated intracellular H(2)O(2) levels in Arabidopsis thaliala (L.) Heynh by using the hydrogen-peroxide-sensitive part of the Escherichia coli transcription regulator OxyR, which was directed to the cytoplasm as well as into the peroxisomes. H(2)O(2) levels were lowered and senescence was delayed in both transgenic lines, but OxyR was found to be more effective in the cytoplasm. To transfer this knowledge to crop plants, we analyzed oilseed rape plants Brassica napus L. cv. Mozart for H(2)O(2) and its scavenging enzymes catalase (CAT) and ascorbate peroxidase (APX) during leaf and plant development. H(2)O(2) levels were found to increase during bolting and flowering time, but no increase could be observed in the very late stages of senescence. With increasing H(2)O(2) levels, CAT and APX activities declined, so it is likely that similar mechanisms are used in oilseed rape and Arabidopsis to control H(2)O(2) levels. Under elevated CO(2) conditions, oilseed rape senescence was accelerated and coincided with an earlier increase in H(2)O(2) levels, indicating that H(2)O(2) may be one of the signals to inducing senescence in a broader range of Brassicaceae. © 2012 Institute of Botany, the Chinese Academy of Sciences.

Dinâmica floral e abortamento de flores em híbridos de canola e mostarda castanha Floral dynamics and flower abortion in hybrids of canola and Indian mustard

Directory of Open Access Journals (Sweden)

Rafael Battisti

2013-02-01

Full Text Available O objetivo deste trabalho foi avaliar a dinâmica floral e determinar o índice de abortamento de flores de híbridos de canola (Brassica napus e de mostarda castanha (Brassica juncea, bem como determinar suas relações com as condições meteorológicas do Sul do Brasil. Durante a floração, dez híbridos de canola e dois de mostarda foram avaliados a cada três dias quanto ao número de flores abertas, de síliquas e de flores abortadas. O número acumulado e relativo de flores foi usado para avaliação da dinâmica floral. A relação desses números com a soma térmica acumulada durante a floração foi determinada por meio de modelo logístico. A partir dos coeficientes desse modelo, identificaram-se grupos de genótipos com diferentes taxas de emissão de flores. O abortamento de flores entre híbridos variou de 10,53 a 45,96% e correlacionou-se com a temperatura e a demanda evaporativa da atmosfera. Genótipos com maiores tempos térmicos entre o período de máxima emissão de flores e o final da floração geralmente apresentam maiores percentagens de abortamento de flores. O ajuste dos dados de emissão de flores aos de soma térmica do período da floração, por meio de modelo logístico, permite simular a dinâmica floral de híbridos de canola e mostarda castanha.The objective of this work was to evaluate the floral dynamics and to determine the index of flower abortion in canola (Brassica napus and Indian mustard (Brassica juncea hybrids, as well as to determine their relation with meteorological conditions of southern Brazil. During flowering, ten hybrids of canola and two of Indian mustard were evaluated every three days as to the number of open flowers, pods, and aborted flowers. The cumulative and the relative number of flowers were used to evaluate floral dynamics. The relation of these numbers with the accumulated thermal sum during flowering was determined with a logistic model. Groups of genotypes with different

Indications of selenium protection against cadmium and lead toxicity in oilseed rape (Brassica napus L.

Directory of Open Access Journals (Sweden)

Zhilin Wu

2016-12-01

Full Text Available The present study investigated the beneficial role of selenium (Se in protecting oilseed rape (Brassica napus L. plants from cadmium (Cd+2 and lead (Pb+2 toxicity. Exogenous Se markedly reduced Cd and Pb concentration in both roots and shoots. Supplementation of the medium with Se (5, 10 and 15 mg kg-1 alleviated the negative effect of Cd and Pb on growth and led to a decrease in oxidative damages caused by Cd and Pb. Furthermore, Se enhanced superoxide free radicals (O2-, hydrogen peroxide (H2O2 and lipid peroxidation, as indicated by malondialdehyde (MDA accumulation, but decreased superoxide dismutase (SOD and glutathione peroxidase (GPx activities. Meanwhile, the presence of Cd and Pb in the medium affected Se speciation in shoots. The results suggest that Se could alleviate Cd and Pb toxicity by preventing oxidative stress in oilseed rape plant.

Development of a novel Sinapis arvensis disomic addition line in Brassica napus containing the restorer gene for Nsa CMS and improved resistance to Sclerotinia sclerotiorum and pod shattering.

Science.gov (United States)

Wei, Wenhui; Li, Yunchang; Wang, Lijun; Liu, Shengyi; Yan, Xiaohong; Mei, Desheng; Li, Yinde; Xu, Yusong; Peng, Pengfei; Hu, Qiong

2010-04-01

An allo-cytoplasmic male sterile line, which was developed through somatic hybridization between Brassica napus and Sinapis arvensis (thus designated as Nsa CMS line), possesses high potential for hybrid production of rapeseed. In order to select for restorer lines, fertile plants derived from the same somatic hybridization combination were self-pollinated and testcrossed with the parental Nsa CMS line for six generations. A novel disomic alien addition line, B. napus-S. arvensis, has been successfully developed. GISH analysis showed that it contains one pair of chromosomes from S. arvensis and 19 pairs from B. napus, and retains stable and regular mitotic and meiotic processes. The addition line displays very strong restoration ability to Nsa CMS line, high resistance to Sclerotinia sclerotiorum and a low incidence of pod shattering. Because the addition line shares these very important agricultural characters, it is a valuable restorer to Nsa CMS line, and is named NR1 here (Nsa restorer no. 1).

Effects of Drought Stress on Canola (Brassica napus L. Genotypes Yield and Yield Components

Directory of Open Access Journals (Sweden)

R Khani

2018-02-01

Full Text Available Introduction Canola (Brassica napus L. genotypes with wide adaptability to environmental conditions could play a major role in Iran’s oilseed crop production. Selection of high performing genotypes is very important for developing canola cultivation. Water stress can reduce crop yield by affecting both source and sink for assimilation. Canola yield depends on genotype and environmental conditions and response of genotypes to environmental factors. Canola genotypes response to stress depends on the developmental stage and the events occurring prior to and during flowering stage. Resistance to water stress is divided to avoidance and tolerance. Some species are tolerable against water stress. In a while, other species respond ending life cycle, falling leaves and other reactions into water stress. Therefore, investigation of canola genotypes response to water stress in phenological growth stages can be valuable in order to determine resistant or tolerant genotypes. Materials and Methods In order to study the effect of drought stress on canola genotypes yield and its components, an experiment was conducted in 2013-2014 as a split plot based on randomized complete block design with three replications at the research farm, Agricultural and Natural Resources Research Center of East-Azarbaijan, Tabriz-Iran. Three levels of drought stress were considered as main plot (No-stress, stress at the flowering and pod setting growth stages and 18 canola genotypes including HW113, RS12, Karaj1, KR18, L73, L72, HW101, L146, L210, L183, SW101, L5, L201, HW118, KR4, Karaj2, Karaj3 and KS7 as subplots. Flood irrigation was scheduled at 50% field capacity, 30 and 30% field capacity for no-stress, stress at the flowering and pod setting growth stages, respectively; i.e. soil moisture capacity was maintained at 30% by irrigating to 100% field capacity when available moisture reached 30% in drought stress treatments. An ANOVA was conducted using the PROC-GLM procedure

Overexpression of phyA and appA Genes Improves Soil Organic Phosphorus Utilisation and Seed Phytase Activity in Brassica napus

Science.gov (United States)

Wang, Yi; Ye, Xiangsheng; Ding, Guangda; Xu, Fangsen

2013-01-01

Phytate is the major storage form of organic phosphorus in soils and plant seeds, and phosphorus (P) in this form is unavailable to plants or monogastric animals. In the present study, the phytase genes phyA and appA were introduced into Brassica napus cv Westar with a signal peptide sequence and CaMV 35S promoter, respectively. Three independent transgenic lines, P3 and P11 from phyA and a18 from appA, were selected. The three transgenic lines exhibited significantly higher exuded phytase activity when compared to wild-type (WT) controls. A quartz sand culture experiment demonstrated that transgenic Brassica napus had significantly improved P uptake and plant biomass. A soil culture experiment revealed that seed yields of transgenic lines P11 and a18 increased by 20.9% and 59.9%, respectively, when compared to WT. When phytate was used as the sole P source, P accumulation in seeds increased by 20.6% and 46.9% with respect to WT in P11 and a18, respectively. The P3 line accumulated markedly more P in seeds than WT, while no significant difference was observed in seed yields when phytate was used as the sole P source. Phytase activities in transgenic canola seeds ranged from 1,138 to 1,605 U kg–1 seeds, while no phytase activity was detected in WT seeds. Moreover, phytic acid content in P11 and a18 seeds was significantly lower than in WT. These results introduce an opportunity for improvement of soil and seed phytate-P bioavailability through genetic manipulation of oilseed rape, thereby increasing plant production and P nutrition for monogastric animals. PMID:23573285

Overexpression of phyA and appA genes improves soil organic phosphorus utilisation and seed phytase activity in Brassica napus.

Directory of Open Access Journals (Sweden)

Yi Wang

Full Text Available Phytate is the major storage form of organic phosphorus in soils and plant seeds, and phosphorus (P in this form is unavailable to plants or monogastric animals. In the present study, the phytase genes phyA and appA were introduced into Brassica napus cv Westar with a signal peptide sequence and CaMV 35S promoter, respectively. Three independent transgenic lines, P3 and P11 from phyA and a18 from appA, were selected. The three transgenic lines exhibited significantly higher exuded phytase activity when compared to wild-type (WT controls. A quartz sand culture experiment demonstrated that transgenic Brassica napus had significantly improved P uptake and plant biomass. A soil culture experiment revealed that seed yields of transgenic lines P11 and a18 increased by 20.9% and 59.9%, respectively, when compared to WT. When phytate was used as the sole P source, P accumulation in seeds increased by 20.6% and 46.9% with respect to WT in P11 and a18, respectively. The P3 line accumulated markedly more P in seeds than WT, while no significant difference was observed in seed yields when phytate was used as the sole P source. Phytase activities in transgenic canola seeds ranged from 1,138 to 1,605 U kg(-1 seeds, while no phytase activity was detected in WT seeds. Moreover, phytic acid content in P11 and a18 seeds was significantly lower than in WT. These results introduce an opportunity for improvement of soil and seed phytate-P bioavailability through genetic manipulation of oilseed rape, thereby increasing plant production and P nutrition for monogastric animals.

Mass spectrometric amino acid sequencing of a mixture of seed storage proteins (napin) from Brassica napus, products of a multigene family.

OpenAIRE

Gehrig, P M; Krzyzaniak, A; Barciszewski, J; Biemann, K

1996-01-01

The amino acid sequences of a number of closely related proteins ("napin") isolated from Brassica napus were determined by mass spectrometry without prior separation into individual components. Some of these proteins correspond to those previously deduced (napA, BngNAP1, and gNa), chiefly from DNA sequences. Others were found to differ to a varying extent (BngNAP1', BngNAP1A, BngNAP1B, BngNAP1C, gNa', and gNaA). The short chains of gNa and gNa' and of BngNAP1 and BngNAP1' differ by the replac...

Could nitrile derivatives of turnip (Brassica rapa) glucosinolates be Hepato-and/or cholangiotoxic in cattle?

Science.gov (United States)

Turnip (Brassica rapa ssp. rapa) and rape (Brassica napus ssp. biennis) and other brassica forage crops are generally regarded as “safe” feed for cattle during late summer and fall in New Zealand. However, when Pithomyces chartarum spore counts are high there are epidemics of sporidesmin toxicity (...

Phytoextraction of heavy metals by canola (Brassica napus) and radish (Raphanus sativus) grown on multicontaminated soil.

Science.gov (United States)

Marchiol, L; Assolari, S; Sacco, P; Zerbi, G

2004-11-01

Phytoextraction can provide an effective in situ technique for removing heavy metals from polluted soils. The experiment reported in this paper was undertaken to study the basic potential of phytoextraction of Brassica napus (canola) and Raphanus sativus (radish) grown on a multi-metal contaminated soil in the framework of a pot-experiment. Chlorophyll contents and gas exchanges were measured during the experiment; the heavy metal phytoextraction efficiency of canola and radish were also determined and the phytoextraction coefficient for each metal calculated. Data indicated that both species are moderately tolerant to heavy metals and that radish is more so than canola. These species showed relatively low phytoremediation potential of multicontaminated soils. They could possibly be used with success in marginally polluted soils where their growth would not be impaired and the extraction of heavy metals could be maintained at satisfying levels.

Phytoextraction of heavy metals by canola (Brassica napus) and radish (Raphanus sativus) grown on multicontaminated soil

International Nuclear Information System (INIS)

Marchiol, L.; Assolari, S.; Sacco, P.; Zerbi, G.

2004-01-01

Phytoextraction can provide an effective in situ technique for removing heavy metals from polluted soils. The experiment reported in this paper was undertaken to study the basic potential of phytoextraction of Brassica napus (canola) and Raphanus sativus (radish) grown on a multi-metal contaminated soil in the framework of a pot-experiment. Chlorophyll contents and gas exchanges were measured during the experiment; the heavy metal phytoextraction efficiency of canola and radish were also determined and the phytoextraction coefficient for each metal calculated. Data indicated that both species are moderately tolerant to heavy metals and that radish is more so than canola. These species showed relatively low phytoremediation potential of multicontaminated soils. They could possibly be used with success in marginally polluted soils where their growth would not be impaired and the extraction of heavy metals could be maintained at satisfying levels

Phytoextraction of heavy metals by canola (Brassica napus) and radish (Raphanus sativus) grown on multicontaminated soil

Energy Technology Data Exchange (ETDEWEB)

Marchiol, L.; Assolari, S.; Sacco, P.; Zerbi, G

2004-11-01

Phytoextraction can provide an effective in situ technique for removing heavy metals from polluted soils. The experiment reported in this paper was undertaken to study the basic potential of phytoextraction of Brassica napus (canola) and Raphanus sativus (radish) grown on a multi-metal contaminated soil in the framework of a pot-experiment. Chlorophyll contents and gas exchanges were measured during the experiment; the heavy metal phytoextraction efficiency of canola and radish were also determined and the phytoextraction coefficient for each metal calculated. Data indicated that both species are moderately tolerant to heavy metals and that radish is more so than canola. These species showed relatively low phytoremediation potential of multicontaminated soils. They could possibly be used with success in marginally polluted soils where their growth would not be impaired and the extraction of heavy metals could be maintained at satisfying levels.

High Density Linkage Map Construction and QTL Detection for Three Silique-Related Traits in Orychophragmus violaceus Derived Brassica napus Population

Directory of Open Access Journals (Sweden)

Yi Yang

2017-09-01

Full Text Available Seeds per silique (SS, seed weight (SW, and silique length (SL are important determinant traits of seed yield potential in rapeseed (Brassica napus L., and are controlled by naturally occurring quantitative trait loci (QTLs. Mapping QTLs to narrow chromosomal regions provides an effective means of characterizing the genetic basis of these complex traits. Orychophragmus violaceus is a crucifer with long siliques, many SS, and heavy seeds. A novel B. napus introgression line with many SS was previously selected from multiple crosses (B. rapa ssp. chinesis × O. violaceus × B. napus. In present study, a doubled haploid (DH population with 167 lines was established from a cross between the introgression line and a line with far fewer SS, in order to detect QTLs for silique-related traits. By screening with a Brassica 60K single nucleotide polymorphism (SNP array, a high-density linkage map consisting of 1,153 bins and spanning a cumulative length of 2,209.1 cM was constructed, using 12,602 high-quality polymorphic SNPs in the DH population. The average recombination bin densities of the A and C subgenomes were 1.7 and 2.4 cM, respectively. 45 QTLs were identified for the three traits in all, which explained 4.0–34.4% of the total phenotypic variation; 20 of them were integrated into three unique QTLs by meta-analysis. These unique QTLs revealed a significant positive correlation between SS and SL and a significant negative correlation between SW and SS, and were mapped onto the linkage groups A05, C08, and C09. A trait-by-trait meta-analysis revealed eight, four, and seven consensus QTLs for SS, SW, and SL, respectively, and five major QTLs (cqSS.A09b, cqSS.C09, cqSW.A05, cqSW.C09, and cqSL.C09 were identified. Five, three, and four QTLs for SS, SW, and SL, respectively, might be novel QTLs because of the existence of alien genetic loci for these traits in the alien introgression. Thirty-eight candidate genes underlying nine QTLs for silique

Response to multi-generational selection under elevated [CO₂] in two temperature regimes suggests enhanced carbon assimilation and increased reproductive output in Brassica napus L

DEFF Research Database (Denmark)

Frenck, Georg; van der Linden, Leon; Mikkelsen, Teis Nørgaard

2013-01-01

Functional plant traits are likely to adapt under the sustained pressure imposed by environmental changes through natural selection. Employing Brassica napus as a model, a multi-generational study was performed to investigate the potential trajectories of selection at elevated [CO2] in two differ...... ameliorate depressions in plant reproductive fitness caused by higher temperatures in situations where both factors co-occur....

Growth and "1"3"7Cs uptake and accumulation among 56 Japanese cultivars of Brassica rapa, Brassica juncea and Brassica napus grown in a contaminated field in Fukushima: Effect of inoculation with a Bacillus pumilus strain

International Nuclear Information System (INIS)

Djedidi, Salem; Kojima, Katsuhiro; Ohkama-Ohtsu, Naoko; Bellingrath-Kimura, Sonoko Dorothea; Yokoyama, Tadashi

2016-01-01

Fifty six local Japanese cultivars of Brassica rapa (40 cultivars), Brassica juncea (10 cultivars) and Brassica napus (6 cultivars) were assessed for variability in growth and "1"3"7Cs uptake and accumulation in association with a Bacillus pumilus strain. Field trial was conducted at a contaminated farmland in Nihonmatsu city, in Fukushima prefecture. Inoculation resulted in different responses of the cultivars in terms of growth and radiocesium uptake and accumulation. B. pumilus induced a significant increase in shoot dry weight in 12 cultivars that reached up to 40% in one B. rapa and three B. juncea cultivars. Differences in radiocesium uptake were observed between the cultivars of each Brassica species. Generally, inoculation resulted in a significant increase in "1"3"7Cs uptake in 22 cultivars, while in seven cultivars it was significantly decreased. Regardless of plant cultivar and bacterial inoculation, the transfer of "1"3"7Cs to the plant shoots (TF) varied by a factor of up to 5 and it ranged from to 0.011 to 0.054. Five inoculated cultivars, showed enhanced shoot dry weights and decreased "1"3"7Cs accumulations, among which two B. rapa cultivars named Bitamina and Nozawana had a significantly decreased "1"3"7Cs accumulation in their shoots. Such cultivars could be utilized to minimize the entry of radiocesium into the food chain; however, verifying the consistency of their radiocesium accumulation in other soils is strongly required. Moreover, the variations in growth and radiocesium accumulation, as influenced by Bacillus inoculation, could help selecting well grown inoculated Brassica cultivars with low radiocesium accumulation in their shoots. - Highlights: • Out of 56 Brassica cultivars, inoculation significantly increased shoot dry weight in 12 cultivars. • Inoculation triggered a significant increase and decrease in "1"3"7Cs uptake, respectively in 22 and 7 cultivars. • Five cultivars had an enhanced shoot dry weight and decreased "1"3"7Cs

Identification of the Relationship between Oil Body Morphology and Oil Content by Microstructure Comparison Combining with QTL Analysis in Brassica napus.

Science.gov (United States)

Gu, Jianwei; Chao, Hongbo; Wang, Hao; Li, Yonghong; Li, Dianrong; Xiang, Jun; Gan, Jianping; Lu, Guangyuan; Zhang, Xuekun; Long, Yan; Li, Maoteng

2016-01-01

Oil bodies (OBs) are relatively simple but very important organelles comprising a matrix of triacylglycerol (TAG) surrounded by a phospholipid monolayer embedded and covered with unique proteins. The OB structure in Brassica napus with different oil content and the relationship between the oil content and the OB structure needs to be better understood. In this paper, the characteristics of OBs in the embryo of a series of B. napus materials with different oil content ranging from 34% to over 60% were studied. The results indicated that the OB size was significantly positively correlated with the oil content but was significantly negatively correlated with the glucosinolates and the protein content. Many genes associated with TAG synthesis, OB-membrane proteins, and the cell progress regulatory pathway were identified in the confidence interval of co-located QTLs for oil content, fatty acid (FA) compositions, and protein content. Our results suggested that the morphology of OBs might be directly controlled by the genes associated with OB-membrane proteins and indirectly controlled by the genes associated with TAG synthesis and cell progress regulatory pathway.

Impact of Transgenic Brassica napus Harboring the Antifungal Synthetic Chitinase (NiC Gene on Rhizosphere Microbial Diversity and Enzyme Activities

Directory of Open Access Journals (Sweden)

Mohammad S. Khan

2017-07-01

Full Text Available Transgenic Brassica napus harboring the synthetic chitinase (NiC gene exhibits broad-spectrum antifungal resistance. As the rhizosphere microorganisms play an important role in element cycling and nutrient transformation, therefore, biosafety assessment of NiC containing transgenic plants on soil ecosystem is a regulatory requirement. The current study is designed to evaluate the impact of NiC gene on the rhizosphere enzyme activities and microbial community structure. The transgenic lines with the synthetic chitinase gene (NiC showed resistance to Alternaria brassicicola, a common disease causing fungal pathogen. The rhizosphere enzyme analysis showed no significant difference in the activities of fivesoil enzymes: alkalyine phosphomonoestarase, arylsulphatase, β-glucosidase, urease and sucrase between the transgenic and non-transgenic lines of B. napus varieties, Durr-e-NIFA (DN and Abasyne-95 (AB-95. However, varietal differences were observed based on the analysis of molecular variance. Some individual enzymes were significantly different in the transgenic lines from those of non-transgenic but the results were not reproducible in the second trail and thus were considered as environmental effect. Genotypic diversity of soil microbes through 16S–23S rRNA intergenic spacer region amplification was conducted to evaluate the potential impact of the transgene. No significant diversity (4% for bacteria and 12% for fungal between soil microbes of NiC B. napus and the non-transgenic lines was found. However, significant varietal differences were observed between DN and AB-95 with 79% for bacterial and 54% for fungal diversity. We conclude that the NiC B. napus lines may not affect the microbial enzyme activities and community structure of the rhizosphere soil. Varietal differences might be responsible for minor changes in the tested parameters.

Neofunctionalization of Duplicated Tic40 Genes Caused a Gain-of-Function Variation Related to Male Fertility in Brassica oleracea Lineages1[W][OPEN

Science.gov (United States)

Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

2014-01-01

Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. PMID:25185122

Identification of microRNAs actively involved in fatty acid biosynthesis in developing Brassica napus seeds using high-throughput sequencing

Directory of Open Access Journals (Sweden)

Jia Wang

2016-10-01

Full Text Available Seed development has a critical role during the spermatophyte life cycle. In Brassica napus, a major oil crop, fatty acids are synthesized and stored in specific tissues during embryogenesis, and understanding the molecular mechanism underlying fatty acid biosynthesis during seed development is an important research goal. In this study, we constructed three small RNA libraries from early seeds at 14, 21 and 28 days after flowering (DAF and used high-throughput sequencing to examine microRNA (miRNA expression. A total of 85 known miRNAs from 30 families and 1,160 novel miRNAs were identified, of which 24, including 5 known and 19 novel miRNAs, were found to be involved in fatty acid biosynthesis. bna-miR156b, bna-miR156c, bna-miR156g, novel_mir_1706, novel_mir_1407, novel_mir_173, and novel_mir_104 were significantly down-regulated at 21 DAF and 28 DAF, whereas bna-miR159, novel_mir_1081, novel_mir_19 and novel_mir_555 were significantly up-regulated. In addition, we found that some miRNAs regulate functional genes that are directly involved in fatty acid biosynthesis and that other miRNAs regulate the process of fatty acid biosynthesis by acting on a large number of transcription factors. The miRNAs and their corresponding predicted targets were partially validated by quantitative RT-PCR. Our data suggest that diverse and complex miRNAs are involved in the seed development process and that miRNAs play important roles in fatty acid biosynthesis during seed development.

Structural Properties of Cruciferin and Napin of Brassica napus (Canola Show Distinct Responses to Changes in pH and Temperature

Directory of Open Access Journals (Sweden)

Suneru P. Perera

2016-09-01

Full Text Available The two major storage proteins identified in Brassica napus (canola were isolated and studied for their molecular composition, structural characteristics and the responses of structural features to the changes in pH and temperature. Cruciferin, a complex of six monomers, has a predominantly β-sheet-containing secondary structure. This protein showed low pH unstable tertiary structure, and distinctly different solubility behaviour with pH when intact in the seed cellular matrix. Cruciferin structure unfolds at pH 3 even at ambient temperature. Temperature-induced structure unfolding was observed above the maximum denaturation temperature of cruciferin. Napin was soluble in a wider pH range than cruciferin and has α-helices dominating secondary structure. Structural features of napin showed less sensitivity to the changes in medium pH and temperature. The surface hydrophobicity (S0 and intrinsic fluorescence of tryptophan residue appear to be good indicators of cruciferin unfolding, however they were not the best to demonstrate structural changes of napin. These two storage proteins of B. napus have distinct molecular characteristics, therefore properties and functionalities they provide are contrasting rather than complementary.

BnEPFL6, an EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) secreted peptide gene, is required for filament elongation in Brassica napus.

Science.gov (United States)

Huang, Yi; Tao, Zhangsheng; Liu, Qiong; Wang, Xinfa; Yu, Jingyin; Liu, Guihua; Wang, Hanzhong

2014-07-01

Inflorescence architecture, pedicel length and stomata patterning in Arabidopsis thaliana are specified by inter-tissue communication mediated by ERECTA and its signaling ligands in the EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) family of secreted cysteine-rich peptides. Here, we identified and characterized BnEPFL6 from Brassica napus. Heterologous expression of this gene under the double enhanced CaMV promoter (D35S) in Arabidopsis resulted in shortened stamen filaments, filaments degradation, and reduced filament cell size that displayed down-regulated expression of AHK2, in which phenotypic variation of ahk2-1 mutant presented highly consistent with that of BnEPFL6 transgenic lines. Especially, the expression level of BnEPFL6 in the shortened filaments of four B. napus male sterile lines (98A, 86A, SA, and Z11A) was similar to that of BnEPFL6 in the transgenic Arabidopsis lines. The activity of pBnEPFL6.2::GUS was intensive in the filaments of transgenic lines. These observations reveal that BnEPFL6 plays an important role in filament elongation and may also affect organ morphology and floral organ specification via a BnEPFL6-mediated cascade.

Flower infection of Brassica oleracea with Xanthomonas campestris pv. campestris results in high levels of seed infection

NARCIS (Netherlands)

Wolf, van der J.M.; Zouwen, van der P.S.; Heijden, van der L.

2013-01-01

During seed production, Brassica seed may become infected with Xanthomonas campestris pv. campestris after systemic colonization of plants upon leaf infection, or alternatively, after flower infection. Polytunnel experiments were conducted in 2007 and 2008 to study the relative importance of these

Enteric methane production and ruminal fermentation of forage brassica diets fed in continuous culture

Science.gov (United States)

The aim of the current study was to determine nutrient digestibility, VFA production, N metabolism, and CH4 production of canola (Brassica napus L.), rapeseed (B. napus L.), turnip (B. rapa L.), and annual ryegrass (Lolium multiflorum Lam.) fed with orchardgrass (Dactylis glomerata L.) in continuous...

Effects of thermal stress of protein synthesis and gene expression in Brassica napus

International Nuclear Information System (INIS)

Halle, J.R.; Ghosh, S.; Dumbroff, E.B.; Heikkila, J.J.

1989-01-01

Leaf segments of Brassica napus were exposed to 22 degrees, 35 degrees, 38 degrees or 40 degrees C for up to 4 h. Analysis of radiolabelled proteins by 2-D SDS-PAGE and fluorography revealed two major groups of heat shock proteins (HSPs). One group comprised HSPs, 70, 76 and 87, with pIs ranging from 5.7 to 6.1, whereas the second group had molecular weights ranging from 23 to 16 kD and pIs from 5.6 to 6.9. Immunoblot analysis using antibodies directed against the large (RLSU) and small (RSSU) subunits of ribulose-1,5-bisphosphate carboxylase (RUBISCO) showed that increasing temperatures from 35 degrees to 38 degrees or 40 degrees C or the duration of thermal stress from 1 to 5 h did not affect levels of the RSSU (15 kd) whereas levels of the RLSU (52 kD) fell sharply. Nevertheless, RUBISCO activity was not adversely affected at 38 degree C for periods of up to 5 h. The increase observed in HSP 70 during heat shock was transcriptionally regulated, but the decrease in the RLSU was not accompanied by any detectable change in levels of its mRNA

Effect of arabinogalactan proteins from the root caps of pea and Brassica napus on Aphanomyces euteiches zoospore chemotaxis and germination.

Science.gov (United States)

Cannesan, Marc Antoine; Durand, Caroline; Burel, Carole; Gangneux, Christophe; Lerouge, Patrice; Ishii, Tadashi; Laval, Karine; Follet-Gueye, Marie-Laure; Driouich, Azeddine; Vicré-Gibouin, Maïté

2012-08-01

Root tips of many plant species release a number of border, or border-like, cells that are thought to play a major role in the protection of root meristem. However, little is currently known on the structure and function of the cell wall components of such root cells. Here, we investigate the sugar composition of the cell wall of the root cap in two species: pea (Pisum sativum), which makes border cells, and Brassica napus, which makes border-like cells. We find that the cell walls are highly enriched in arabinose and galactose, two major residues of arabinogalactan proteins. We confirm the presence of arabinogalactan protein epitopes on root cap cell walls using immunofluorescence microscopy. We then focused on these proteoglycans by analyzing their carbohydrate moieties, linkages, and electrophoretic characteristics. The data reveal (1) significant structural differences between B. napus and pea root cap arabinogalactan proteins and (2) a cross-link between these proteoglycans and pectic polysaccharides. Finally, we assessed the impact of root cap arabinogalactan proteins on the behavior of zoospores of Aphanomyces euteiches, an oomycetous pathogen of pea roots. We find that although the arabinogalactan proteins of both species induce encystment and prevent germination, the effects of both species are similar. However, the arabinogalactan protein fraction from pea attracts zoospores far more effectively than that from B. napus. This suggests that root arabinogalactan proteins are involved in the control of early infection of roots and highlights a novel role for these proteoglycans in root-microbe interactions.

Genetic variants associated with the root system architecture of oilseed rape (Brassica napus L.) under contrasting phosphate supply.

Science.gov (United States)

Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei

2017-08-01

Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Comparative analysis of Brassica napus plasma membrane proteins under phosphorus deficiency using label-free and MaxQuant-based proteomics approaches.

Science.gov (United States)

Chen, Shuisen; Luo, Ying; Ding, Guangda; Xu, Fangsen

2016-02-05

Phosphorus (P) deficiency is a primary constraint for plant growth in terrestrial ecosystems. To better understand the genotypic differences in the adaptation mechanism of Brassica napus to P deficiency, we purified the plasma membrane (PM) from the roots of two genotypes: P-efficient "Eyou Changjia" and P-inefficient "B104-2". Combining label-free quantitative proteomics with the MaxQuant approach, a total of 71 proteins that significantly changed in abundances were identified in the two genotypes in response to P-free starvation, including 31 in "Eyou Changjia" and 40 in "B104-2". Based on comparative genomics study, 28 proteins were mapped to the confidence intervals of quantitative trait loci (QTLs) for P efficiency related traits. Seven decreased proteins with transporter activity were found to be located in the PM by subcellular localization analyses. These proteins involved in intracellular protein transport and ATP hydrolysis coupled proton transport were mapped to the QTL for P content and dry weight. Compared with "B104-2", more decreased proteins referring to transporter activity were found in "Eyou Changjia", showing that substance exchange was decreased in response to short-term P-free starvation. Together with the finding, more decreased proteins functioning in signal transduction and protein synthesis/degradation suggested that "Eyou Changjia" could slow the progression of growth and save more P in response to short-term P-free starvation. P deficiency seriously limits the production and quality of B. napus. Roots absorb water and nutrients and anchor the plant in the soil. Therefore, to study root PM proteome under P stress would be helpful to understand the adaptation mechanism for P deficiency. However, PM proteome analysis in B. napus has been seldom reported due to the high hydrophobicity and low abundance of PM. Thus, we herein investigated the PM proteome alteration of roots in two B. napus genotypes, with different P deficient tolerances, in

Characterization and tissue-differential expression of fad2 genes in brassica napus

International Nuclear Information System (INIS)

Zhuang, Li.; Cong, Y. S.; Hao, L.; Ze, L. Y.; Cheng, W. Y.; Xing, G. S.; Lili, L.

2017-01-01

In this study, genome DNA and RNA of fad2 genes from three types of oleic acid content from B. napus were isolated by PCR amplification, respectively, the results showed that not only had nucleotides sequences little differences from three types of oleic acid content B. napus, but also that of genome DNA and cDNA had still little differences from B. napus as far as specific one type of rape. Different genotypes fad2-I and fad2-II could be easily distinguished by sequence analysis of the cDNAs in G type and CK type except in D type. By analysis on cDNAs, specific differences could be found in three types of rape when compared with the sequence from Genebank. Conserved domains prediction and phylogenetic analysis showed that both six transmembrane domains and three H boxes could be found in FAD2 protein from three types of oleic acid content B. napus, respectively. BnFAD2-I and BnFAD2-II belonged to different classes and class I could be divided into two kinds. By QPCR, expression pattern of fad2 gene in different tissues showed that simple division of fad2-I and fad2-II was not apply to all oleic acid content B. napus. By southern blot, there were differences in copy numbers of fad2 genes on different oleic acid content B. napus. (author)

The receptor-like kinase SOBIR1 interacts with Brassica napus LepR3 and is required for Leptosphaeria maculans AvrLm1-triggered immunity

Directory of Open Access Journals (Sweden)

Lisong eMa

2015-10-01

Full Text Available AbstractThe fungus Leptosphaeria maculans (L. maculans is the causal agent of blackleg disease of canola/oilseed rape (Brassica napus worldwide. We previously reported cloning of the B. napus blackleg resistance gene, LepR3, which encodes a receptor-like protein. LepR3 triggers localised cell death upon recognition of its cognate Avr protein, AvrLm1. Here, we exploited the Nicotiana benthamiana model plant to investigate the recognition mechanism of AvrLm1 by LepR3. Co-expression of the LepR3/AvrLm1 gene pair in N. benthamiana resulted in development of a hypersensitive response (HR. However, a truncated AvrLm1 lacking its indigenous signal peptide was compromised in its ability to induce LepR3-mediated HR, indicating that AvrLm1 is perceived by LepR3 extracellularly. Structure-function analysis of the AvrLm1 protein revealed that the C-terminal region of AvrLm1 was required for LepR3-mediated HR in N. benthamiana and for resistance to L. maculans in B. napus. LepR3 was shown to be physically interacting with the B. napus receptor like kinase, SOBIR1 (BnSOBIR1. Silencing of NbSOBIR1 or NbSERK3 (BAK1 compromised LepR3-AvrLm1-dependent HR in N. benthamiana, suggesting that LepR3-mediated resistance to L. maculans in B. napus requires SOBIR1 and BAK1/SERK3. Using this model system, we determined that BnSOBIR1 and SERK3/BAK1 are essential partners in the LepR3 signalling complex and were able to define the AvrLm1 effector domain.

Physical, biochemical and physiological effects of ultraviolet radiation on Brassica napus and Phaseolus vulgaris

International Nuclear Information System (INIS)

Cen Yan-Ping.

1993-01-01

In order to follow some of the changes induced by ultraviolet-B (UV-B, 280-320 nm) radiation in Phaseolus vulgaris and Brassica napus, experiments were designed to localize sites of changes in leaves and to correlate some of the physiological and biochemical changes with penetration of UV-B radiation. B.napus was exposed to 8.9 kJ m -2 day -1 biologically effective UV-B radiation (UV-B BE ). The penetration of UV-B radiation into the leaf was followed using a quartz fibre optic microprobe. Monochromatic radiation at 310 nm was decreased by ca 50 and 34% in the adaxial and abaxial epidermis, respectively, in plants not exposed to UV-B, whereas the radiation was decreased by ca 70 and 42%, respectively, in the same region in UV-treated plants. Polychromatic radiation showed a wavelength dependent change mainly for the collimated radiation. The results correlated with the distribution of phenolic compounds analysed from 40 μm paradermal leaf sections. The first adaxial section (40μm) contained 35% of the whole leaf sample flavonoid glycosides in control plants, and 66% in UV-treated plants. Hydroxycinnamic acid derivatives increased by 26% in UV-treated plants relative to controls. The ratio of quercetin to kaempferol derivatives increased from 0.11 in controls to 0.91 in leaves of UV-treated plants. The leaf epidermis protected the inner leaf tissue where most of the photosynthetic apparatus is located. P. vulgaris was subjected to 6.17 kJ m -2 day -1 UV-B BE with different levels of visible light. The largest UV-induced changes in photosynthesis, chlorophyll, carotenoids, UV-screening pigments, and surface leaf reflectance occurred under growth conditions of low levels of visible light together with UV radiation

Physical, biochemical and physiological effects of ultraviolet radiation on Brassica napus and Phaseolus vulgaris

Energy Technology Data Exchange (ETDEWEB)

Cen Yan-Ping

1993-12-31

In order to follow some of the changes induced by ultraviolet-B (UV-B, 280-320 nm) radiation in Phaseolus vulgaris and Brassica napus, experiments were designed to localize sites of changes in leaves and to correlate some of the physiological and biochemical changes with penetration of UV-B radiation. B.napus was exposed to 8.9 kJ m{sup -2} day{sup -1} biologically effective UV-B radiation (UV-B{sub BE}). The penetration of UV-B radiation into the leaf was followed using a quartz fibre optic microprobe. Monochromatic radiation at 310 nm was decreased by ca 50 and 34% in the adaxial and abaxial epidermis, respectively, in plants not exposed to UV-B, whereas the radiation was decreased by ca 70 and 42%, respectively, in the same region in UV-treated plants. Polychromatic radiation showed a wavelength dependent change mainly for the collimated radiation. The results correlated with the distribution of phenolic compounds analysed from 40 {mu}m paradermal leaf sections. The first adaxial section (40{mu}m) contained 35% of the whole leaf sample flavonoid glycosides in control plants, and 66% in UV-treated plants. Hydroxycinnamic acid derivatives increased by 26% in UV-treated plants relative to controls. The ratio of quercetin to kaempferol derivatives increased from 0.11 in controls to 0.91 in leaves of UV-treated plants. The leaf epidermis protected the inner leaf tissue where most of the photosynthetic apparatus is located. P. vulgaris was subjected to 6.17 kJ m{sup -2} day{sup -1} UV-B{sub BE} with different levels of visible light. The largest UV-induced changes in photosynthesis, chlorophyll, carotenoids, UV-screening pigments, and surface leaf reflectance occurred under growth conditions of low levels of visible light together with UV radiation.

QTL meta-analysis of root traits in Brassica napus under contrasting phosphorus supply in two growth systems.

Science.gov (United States)

Zhang, Ying; Thomas, Catherine L; Xiang, Jinxia; Long, Yan; Wang, Xiaohua; Zou, Jun; Luo, Ziliang; Ding, Guangda; Cai, Hongmei; Graham, Neil S; Hammond, John P; King, Graham J; White, Philip J; Xu, Fangsen; Broadley, Martin R; Shi, Lei; Meng, Jinling

2016-09-14

A high-density SNP-based genetic linkage map was constructed and integrated with a previous map in the Tapidor x Ningyou7 (TNDH) Brassica napus population, giving a new map with a total of 2041 molecular markers and an average marker density which increased from 0.39 to 0.97 (0.82 SNP bin) per cM. Root and shoot traits were screened under low and 'normal' phosphate (Pi) supply using a 'pouch and wick' system, and had been screened previously in an agar based system. The P-efficient parent Ningyou7 had a shorter primary root length (PRL), greater lateral root density (LRD) and a greater shoot biomass than the P-inefficient parent Tapidor under both treatments and growth systems. Quantitative trait loci (QTL) analysis identified a total of 131 QTL, and QTL meta-analysis found four integrated QTL across the growth systems. Integration reduced the confidence interval by ~41%. QTL for root and shoot biomass were co-located on chromosome A3 and for lateral root emergence were co-located on chromosomes A4/C4 and C8/C9. There was a major QTL for LRD on chromosome C9 explaining ~18% of the phenotypic variation. QTL underlying an increased LRD may be a useful breeding target for P uptake efficiency in Brassica.

Hyperspectral and thermal imaging of oilseed rape (Brassica napus response to fungal species of the genus Alternaria.

Directory of Open Access Journals (Sweden)

Piotr Baranowski

Full Text Available In this paper, thermal (8-13 µm and hyperspectral imaging in visible and near infrared (VNIR and short wavelength infrared (SWIR ranges were used to elaborate a method of early detection of biotic stresses caused by fungal species belonging to the genus Alternaria that were host (Alternaria alternata, Alternaria brassicae, and Alternaria brassicicola and non-host (Alternaria dauci pathogens to oilseed rape (Brassica napus L.. The measurements of disease severity for chosen dates after inoculation were compared to temperature distributions on infected leaves and to averaged reflectance characteristics. Statistical analysis revealed that leaf temperature distributions on particular days after inoculation and respective spectral characteristics, especially in the SWIR range (1000-2500 nm, significantly differed for the leaves inoculated with A. dauci from the other species of Alternaria as well as from leaves of non-treated plants. The significant differences in leaf temperature of the studied Alternaria species were observed in various stages of infection development. The classification experiments were performed on the hyperspectral data of the leaf surfaces to distinguish days after inoculation and Alternaria species. The second-derivative transformation of the spectral data together with back-propagation neural networks (BNNs appeared to be the best combination for classification of days after inoculation (prediction accuracy 90.5% and Alternaria species (prediction accuracy 80.5%.

Increased Agrobacterium-mediated transformation and rooting efficiencies in canola (Brassica napus L.) from hypocotyl segment explants

Science.gov (United States)

Cardoza, V.; Stewart, C. N.

2003-01-01

An efficient protocol for the production of transgenic Brassica napus cv. Westar plants was developed by optimizing two important parameters: preconditioning time and co-cultivation time. Agrobacterium tumefaciens-mediated transformation was performed using hypocotyls as explant tissue. Two variants of a green fluorescent protein (GFP)-encoding gene--mGFP5-ER and eGFP--both under the constitutive expression of the cauliflower mosaic virus 35S promoter, were used for the experiments. Optimizing the preconditioning time to 72 h and co-cultivation time with Agrobacterium to 48 h provided the increase in the transformation efficiency from a baseline of 4% to 25%. With mGFP5-ER, the transformation rate was 17% and with eGFP it was 25%. Transgenic shoots were selected on 200 mg/l kanamycin. Rooting efficiency was 100% on half-strength Murashige and Skoog medium with 10 g/l sucrose and 0.5 mg/l indole butyric acid in the presence of kanamycin.

Cysteine- and glutathione-mediated uptake of lead and cadmium into Zea mays and Brassica napus roots

International Nuclear Information System (INIS)

Vadas, Timothy M.; Ahner, Beth A.

2009-01-01

This study examines a new mechanism for the uptake of Pb and Cd into Brassica napus and Zea mays roots. During hydroponic experiments, the uptake of Pb and Cd was enhanced in the presence of cysteine and glutathione, whereas no or very low uptake was observed in EDTA and penicillamine controls. Uptake rates were also enhanced after pre-exposure to cysteine or glutathione and inhibited in the presence of vanadate, suggesting a biological mechanism of uptake. Increasing concentrations of glutathione in solution resulted in decreasing Pb uptake rates, indicating competition for transport between free-glutathione and Pb-glutathione species. Pb uptake in the presence of increasing cysteine concentrations resulted in decreased uptake initially but linearly increasing uptake at higher concentrations. Experimentation showed concentration dependent Pb uptake rates. We speculate that there are specific transporters for these thiol ligands and describe what barriers remain for application of this novel transport mechanism in chelator-assisted phytoremediation. - Cysteine and glutathione mediate the transport of lead and cadmium into plant roots.

Cysteine- and glutathione-mediated uptake of lead and cadmium into Zea mays and Brassica napus roots

Energy Technology Data Exchange (ETDEWEB)

Vadas, Timothy M., E-mail: tvadas@umbc.ed [Department of Biological and Environmental Engineering, Cornell University, 320 Riley-Robb Hall, Ithaca, NY 14853 (United States); Ahner, Beth A., E-mail: baa7@cornell.ed [Department of Biological and Environmental Engineering, Cornell University, 320 Riley-Robb Hall, Ithaca, NY 14853 (United States)

2009-08-15

This study examines a new mechanism for the uptake of Pb and Cd into Brassica napus and Zea mays roots. During hydroponic experiments, the uptake of Pb and Cd was enhanced in the presence of cysteine and glutathione, whereas no or very low uptake was observed in EDTA and penicillamine controls. Uptake rates were also enhanced after pre-exposure to cysteine or glutathione and inhibited in the presence of vanadate, suggesting a biological mechanism of uptake. Increasing concentrations of glutathione in solution resulted in decreasing Pb uptake rates, indicating competition for transport between free-glutathione and Pb-glutathione species. Pb uptake in the presence of increasing cysteine concentrations resulted in decreased uptake initially but linearly increasing uptake at higher concentrations. Experimentation showed concentration dependent Pb uptake rates. We speculate that there are specific transporters for these thiol ligands and describe what barriers remain for application of this novel transport mechanism in chelator-assisted phytoremediation. - Cysteine and glutathione mediate the transport of lead and cadmium into plant roots.

Variations in fatty acid composition, glucosinolate profile and some phyto chemical contents in selected oil seed rape (Brassica napus L.) cultivars

Energy Technology Data Exchange (ETDEWEB)

El-Din Saad El-Beltag, H.; Mohamed, A. A.

2010-07-01

Rapeseed (Brassica napus L.) is now the third most important source of edible oil in the world after soybean and palm oil. In this study seeds of five different rapeseed cultivars namely; pactol, silvo, topas, serw 4 and serw 6 were evaluated for their fatty acid composition, glucosinolate profile, amino acids, total tocopherols and phenolic content. Among all cultivars significant variability in fatty acids were observed. The oleic acid (C18:1) ranged from 56.31% to 58.67%, linoleic acid (C18:2) from 10.52% to 13.74%, {alpha}-linolenic acid (C18:3) from 8.83% to 10.32% and erucic acid (22:1) from 0.15% to 0.91%. The glucosinolate profile of rapeseed was also separated and identified using high-performance liquid chromatography. Small variations in the glucosinolate profile were observed among all tested cultivars; however, progoitrin and gluconapin were the major glucosinolate found. Additionally, silvo cultivar showed the highest total glucosinolate contents (5.97 {mu}mol/g dw). Generally, the contents of aspartic, glutamic, arginine and leucine were high, while the contents of tyrosine and isoleucine were low among all cultivars. For total tocopherols, the results indicated that both serw 6 and pactol cultivars had the highest total tocopherol contents (138.3 and 102.8 mg/100 g oil, respectively). Total phenolic contents varied from 28.0 to 35.4 mg/g dw. The highest total phenolic content was found in topas while the lowest value was detected in serw 6. These parameters; fatty acid contents, glucosinolate profile and amino acids together with total tocopherols and phenolic contents, could be taken into consideration by oilseed rape breeders as selection criteria for developing genotypes with modified seed quality traits in Brassica napus L. (Author)

Genetic diversity of notary-national uniform rape seed yield trial and brassica napus varieties using raped markers and biochemical analysis

International Nuclear Information System (INIS)

Bakhat, J.; Fareed, A.; Swati, Z.A.; Shafi, M.

2011-01-01

In Pakistan, Brassica is the second most important source of oil after cotton. Seventeen NURYT (National Uniform Rape Seed Yield Trial) lines and 5 Brassica napus varieties were assessed through RAPD primers and biochemical assays. Seven different Randomly Amplified Polymorphic DNA markers (RAPD) were employed during the present study. A total of 30 RAPD bands were scored by these primers. Size of the scorable fragments ranged from approximately 250 to 2000 bp. Diversity index was estimated to be 42%. Mean genetic distance estimates ranged between 0.10 and 1.00. For the assessment of various biochemical parameters, Near Infrared Reflectance Spectroscopy (NIRS) was used. Oil content ranged from 38.30 to 49% and protein content from 19.80 to 29.10% among the 22 genotypes. Maximum protein content was assayed in genotype RBN 3046 while minimum in Hyola 405. Glucosinolates ranged between 2 and 84% for genotype CRH 60/08 and CRH05/08 showing the maximum and minimum values respectively. Oleic acid (52 to 72.5%), linolenic acid (7.07 and 9.90%) and erucic acid content (9.57 to 38.3%) was also recorded during the present study. (author)

Defective APETALA2 Genes Lead to Sepal Modification in Brassica Crops

Science.gov (United States)

Zhang, Yanfeng; Huang, Shuhua; Wang, Xuefang; Liu, Jianwei; Guo, Xupeng; Mu, Jianxin; Tian, Jianhua; Wang, Xiaofeng

2018-01-01

Many vegetable and oilseed crops belong to Brassica species. The seed production of these crops is hampered often by abnormal floral organs, especially under the conditions of abiotic conditions. However, the molecular reasons for these abnormal floral organs remains poorly understood. Here, we report a novel pistil-like flower mutant of B. rapa. In the flower of this mutant, the four sepals are modified to one merged carpel that look like a ring in the sepal positions, enveloping some abnormal stamens and a pistil, and resulting in poor seed production. This novel mutant is named sepal-carpel modification (scm). DNA sequencing showed that the BrAP2a gene, the ortholog of Arabidopsis APETALA2 (AP2) that specifies sepal identity, losses the function of in scm mutant due to a 119-bp repeated sequence insertion that resulted in an early transcription termination. BrAP2b, the paralog of BrAP2a featured two single-nucleotide substitutions that cause a single amino acid substitution in the highly conserved acidic serine-rich transcriptional activation domain. Each of the two BrAP2 genes rescues the sepal defective phenotype of the ap2-5 mutant of Arabidopsis. Furthermore, the knockout mutation of the corresponding BnAP2 genes of oilseed rape (B. napus) by CRISPR/Cas9-mediated genome editing system resulted in scm-like phenotype. These results suggest that BrAP2 gene plays a key role in sepal modification. Our finding provides an insight into molecular mechanism underlying morphological modification of floral organs and is useful for genetic manipulation of flower modification and improvement of seed production of Brassica crops. PMID:29616073

Defective APETALA2 Genes Lead to Sepal Modification in Brassica Crops

Directory of Open Access Journals (Sweden)

Yanfeng Zhang

2018-03-01

Full Text Available Many vegetable and oilseed crops belong to Brassica species. The seed production of these crops is hampered often by abnormal floral organs, especially under the conditions of abiotic conditions. However, the molecular reasons for these abnormal floral organs remains poorly understood. Here, we report a novel pistil-like flower mutant of B. rapa. In the flower of this mutant, the four sepals are modified to one merged carpel that look like a ring in the sepal positions, enveloping some abnormal stamens and a pistil, and resulting in poor seed production. This novel mutant is named sepal-carpel modification (scm. DNA sequencing showed that the BrAP2a gene, the ortholog of Arabidopsis APETALA2 (AP2 that specifies sepal identity, losses the function of in scm mutant due to a 119-bp repeated sequence insertion that resulted in an early transcription termination. BrAP2b, the paralog of BrAP2a featured two single-nucleotide substitutions that cause a single amino acid substitution in the highly conserved acidic serine-rich transcriptional activation domain. Each of the two BrAP2 genes rescues the sepal defective phenotype of the ap2-5 mutant of Arabidopsis. Furthermore, the knockout mutation of the corresponding BnAP2 genes of oilseed rape (B. napus by CRISPR/Cas9-mediated genome editing system resulted in scm-like phenotype. These results suggest that BrAP2 gene plays a key role in sepal modification. Our finding provides an insight into molecular mechanism underlying morphological modification of floral organs and is useful for genetic manipulation of flower modification and improvement of seed production of Brassica crops.

Application of Endophytic Pseudomonas fluorescens and a Bacterial Consortium to Brassica napus Can Increase Plant Height and Biomass under Greenhouse and Field Conditions

Directory of Open Access Journals (Sweden)

Richard D. Lally

2017-12-01

Full Text Available Plant associated bacteria with plant growth promotion (PGP properties have been proposed for use as environmentally friendly biofertilizers for sustainable agriculture; however, analysis of their efficacy in the field is often limited. In this study, greenhouse and field trials were carried out using individual endophytic Pseudomonas fluorescens strains, the well characterized rhizospheric P. fluorescens F113 and an endophytic microbial consortium of 10 different strains. These bacteria had been previously characterized with respect to their PGP properties in vitro and had been shown to harbor a range of traits associated with PGP including siderophore production, 1-aminocyclopropane-1-carboxylic acid (ACC deaminase activity, and inorganic phosphate solubilization. In greenhouse experiments individual strains tagged with gfp and Kmr were applied to Brassica napus as a seed coat and were shown to effectively colonize the rhizosphere and root of B. napus and in addition they demonstrated a significant increase in plant biomass compared with the non-inoculated control. In the field experiment, the bacteria (individual and consortium were spray inoculated to winter oilseed rape B. napus var. Compass which was grown under standard North Western European agronomic conditions. Analysis of the data provides evidence that the application of the live bacterial biofertilizers can enhance aspects of crop development in B. napus at field scale. The field data demonstrated statistically significant increases in crop height, stem/leaf, and pod biomass, particularly, in the case of the consortium inoculated treatment. However, although seed and oil yield were increased in the field in response to inoculation, these data were not statistically significant under the experimental conditions tested. Future field trials will investigate the effectiveness of the inoculants under different agronomic conditions.

Productivity and nutritive quality of three brassica varieties for use in pasture-based systems

Science.gov (United States)

Brassicas are gaining popularity among pasture-based livestock producers to extend grazing during the ‘summer slump’ and throughout the fall. A 2-yr study was conducted to compare biomass production and nutrient composition of ‘Barisca’ rapeseed (RAP; Brassica napus L.), ‘Inspiration’ canola (CAN; B...

Different zinc sensitivity of Brassica organs is accompanied by distinct responses in protein nitration level and pattern.

Science.gov (United States)

Feigl, Gábor; Kolbert, Zsuzsanna; Lehotai, Nóra; Molnár, Árpád; Ördög, Attila; Bordé, Ádám; Laskay, Gábor; Erdei, László

2016-03-01

Zinc is an essential microelement, but its excess exerts toxic effects in plants. Heavy metal stress can alter the metabolism of reactive oxygen (ROS) and nitrogen species (RNS) leading to oxidative and nitrosative damages; although the participation of these processes in Zn toxicity and tolerance is not yet known. Therefore this study aimed to evaluate the zinc tolerance of Brassica organs and the putative correspondence of it with protein nitration as a relevant marker for nitrosative stress. Both examined Brassica species (B. juncea and B. napus) proved to be moderate Zn accumulators; however B. napus accumulated more from this metal in its organs. The zinc-induced damages (growth diminution, altered morphology, necrosis, chlorosis, and the decrease of photosynthetic activity) were slighter in the shoot system of B. napus than in B. juncea. The relative zinc tolerance of B. napus shoot was accompanied by moderate changes of the nitration pattern. In contrast, the root system of B. napus suffered more severe damages (growth reduction, altered morphology, viability loss) and slighter increase in nitration level compared to B. juncea. Based on these, the organs of Brassica species reacted differentially to excess zinc, since in the shoot system modification of the nitration pattern occurred (with newly appeared nitrated protein bands), while in the roots, a general increment in the nitroproteome could be observed (the intensification of the same protein bands being present in the control samples). It can be assumed that the significant alteration of nitration pattern is coupled with enhanced zinc sensitivity of the Brassica shoot system and the general intensification of protein nitration in the roots is attached to relative zinc endurance. Copyright © 2015 Elsevier Inc. All rights reserved.

Biology and harmfulness of Brassica pod midge (Dasineura brassicae Winn. in winter oilseed rape

Directory of Open Access Journals (Sweden)

Draga Graora

2015-04-01

Full Text Available The Brassica pod midge (Dasineura brassicae Winn. is an important pest in oilseed rape (Brasica napus L.. It develops two generations per year and overwinters in the larval stage in cocoons in soil. Immigration of the first generation adults lasted from the beginning of April until the end of May. Larvae developed in pods from mid-April to mid-June, causing pod deformation and cracking, which resulted in premature falling out of seeds and yield reduction. Pod damage amounted to 11.6%. The emergence of the second generation adults was detected at the end of May and in the first ten days of June. D. brassicae was found to lay eggs in healthy pods and no correlation was found with the cabbage seed weevil, Ceutorhynchus assimilis Paykull.

Ameliorating influence of sulfur on germination attributes of canola (brassica napus l.) under chromium stress

International Nuclear Information System (INIS)

Jahan, S.; Iqbal, S.; Jabeen, K.; Sadaf, S.

2015-01-01

An experiment was performed to evaluate the role of sulfur to induce tolerance in Brassica napus L. against chromium stress by estimating the changes in germination parameters. Petriplates were assembled in Randomized Complete Block Design. A total 9 sets of treatments viz., control, chromium treated (40 and 160ppm), sulfur treated (50 and 150ppm) and sulfur (50 and 150ppm) combined with chromium (40 and 160ppm) with three replicates was used. Chromium under both concentrations was responsible for significant decline in germination parameters i.e. germination percentage, germination rate, seedling vigor index, shoot and root length, fresh weight and dry weight of seedlings. Sulfur application under chromium stress resulted in improvement of germination parameters such as germination percentage, germination rate, seedling vigor index, shoot and root length, fresh weight and dry weight of seedlings in contrast to chromium treatment. So, it can be concluded that sulfur in appropriate dose can be used to ameliorate the negative effects of chromium by increasing the germination potential of canola. (author)

Effect of Pre-culture Irradiation and Explant Types on Efficiency of Brassica napus Genetic Transformation

International Nuclear Information System (INIS)

Amer, I.M.; Moustafa, H.A.M.; Azzam, C.R.

2008-01-01

The irradiated seeds of canola cv. Drakkar ( Brassica napus l. ) were germinated under aspect conditions, cotyledonary petioles and hypocotyl of 6 days old seedlings were used for Agrobacterium-mediated transformation. Agrobacterium tumefaciens has construct with the selectable marker gene (NPT II) and the desirable gene (HPPD). Direct and indirect shoot organogenesis were obtained from the both explants. Cotyledonary petioles was higher responded than hypocotyl with respective 26% and 14% of the explants producing NPT II-positive shoots after the selection on 50mg/l kanamycin. Calli might develop on and not in the agar medium were un transformation. This explains the higher number of escapes detected in hypocotyl explants than in experiments with cotyledons. The frequency of transformation plants as a function of indirect organogenesis was more than direct shoot regeneration from explants. The pre- irradiation with 75 Gy of gamma rays enhanced the genetic transformation frequencies by about 10 % as compared to that of the un-irradiated material. The obtained shoots were rooted and regenerated mature plants

Sequential light programs shape kale (Brassica napus) sprout appearance and alter metabolic and nutrient content

Science.gov (United States)

Carvalho, Sofia D; Folta, Kevin M

2014-01-01

Different light wavelengths have specific effects on plant growth and development. Narrow-bandwidth light-emitting diode (LED) lighting may be used to directionally manipulate size, color and metabolites in high-value fruits and vegetables. In this report, Red Russian kale (Brassica napus) seedlings were grown under specific light conditions and analyzed for photomorphogenic responses, pigment accumulation and nutraceutical content. The results showed that this genotype responds predictably to darkness, blue and red light, with suppression of hypocotyl elongation, development of pigments and changes in specific metabolites. However, these seedlings were relatively hypersensitive to far-red light, leading to uncharacteristically short hypocotyls and high pigment accumulation, even after growth under very low fluence rates (<1 μmol m−2 s−1). General antioxidant levels and aliphatic glucosinolates are elevated by far-red light treatments. Sequential treatments of darkness, blue light, red light and far-red light were applied throughout sprout development to alter final product quality. These results indicate that sequential treatment with narrow-bandwidth light may be used to affect key economically important traits in high-value crops. PMID:26504531

Multiple NUCLEAR FACTOR Y transcription factors respond to abiotic stress in Brassica napus L.

Directory of Open Access Journals (Sweden)

Li Xu

Full Text Available Members of the plant NUCLEAR FACTOR Y (NF-Y family are composed of the NF-YA, NF-YB, and NF-YC subunits. In Brassica napus (canola, each of these subunits forms a multimember subfamily. Plant NF-Ys were reported to be involved in several abiotic stresses. In this study, we demonstrated that multiple members of thirty three BnNF-Ys responded rapidly to salinity, drought, or ABA treatments. Transcripts of five BnNF-YAs, seven BnNF-YBs, and two BnNF-YCs were up-regulated by salinity stress, whereas the expression of thirteen BnNF-YAs, ten BnNF-YBs, and four BnNF-YCs were induced by drought stress. Under NaCl treatments, the expression of one BnNF-YA10 and four NF-YBs (BnNF-YB3, BnNF-YB7, BnNF-YB10, and BnNF-YB14 were greatly increased. Under PEG treatments, the expression levels of four NF-YAs (BnNF-YA9, BnNF-YA10, BnNF-YA11, and BnNF-YA12 and five NF-YBs (BnNF-YB1, BnNF-YB8, BnNF-YB10, BnNF-YB13, and BnNF-YB14 were greatly induced. The expression profiles of 20 of the 27 salinity- or drought-induced BnNF-Ys were also affected by ABA treatment. The expression levels of six NF-YAs (BnNF-YA1, BnNF-YA7, BnNF-YA8, BnNF-YA9, BnNF-YA10, and BnNF-YA12 and seven BnNF-YB members (BnNF-YB2, BnNF-YB3, BnNF-YB7, BnNF-YB10, BnNF-YB11, BnNF-YB13, and BnNF-YB14 and two NF-YC members (BnNF-YC2 and BnNF-YC3 were greatly up-regulated by ABA treatments. Only a few BnNF-Ys were inhibited by the above three treatments. Several NF-Y subfamily members exhibited collinear expression patterns. The promoters of all stress-responsive BnNF-Ys harbored at least two types of stress-related cis-elements, such as ABRE, DRE, MYB, or MYC. The cis-element organization of BnNF-Ys was similar to that of Arabidopsis thaliana, and the promoter regions exhibited higher levels of nucleotide sequence identity with Brassica rapa than with Brassica oleracea. This work represents an entry point for investigating the roles of canola NF-Y proteins during abiotic stress responses and provides

Multiple NUCLEAR FACTOR Y transcription factors respond to abiotic stress in Brassica napus L.

Science.gov (United States)

Xu, Li; Lin, Zhongyuan; Tao, Qing; Liang, Mingxiang; Zhao, Gengmao; Yin, Xiangzhen; Fu, Ruixin

2014-01-01

Members of the plant NUCLEAR FACTOR Y (NF-Y) family are composed of the NF-YA, NF-YB, and NF-YC subunits. In Brassica napus (canola), each of these subunits forms a multimember subfamily. Plant NF-Ys were reported to be involved in several abiotic stresses. In this study, we demonstrated that multiple members of thirty three BnNF-Ys responded rapidly to salinity, drought, or ABA treatments. Transcripts of five BnNF-YAs, seven BnNF-YBs, and two BnNF-YCs were up-regulated by salinity stress, whereas the expression of thirteen BnNF-YAs, ten BnNF-YBs, and four BnNF-YCs were induced by drought stress. Under NaCl treatments, the expression of one BnNF-YA10 and four NF-YBs (BnNF-YB3, BnNF-YB7, BnNF-YB10, and BnNF-YB14) were greatly increased. Under PEG treatments, the expression levels of four NF-YAs (BnNF-YA9, BnNF-YA10, BnNF-YA11, and BnNF-YA12) and five NF-YBs (BnNF-YB1, BnNF-YB8, BnNF-YB10, BnNF-YB13, and BnNF-YB14) were greatly induced. The expression profiles of 20 of the 27 salinity- or drought-induced BnNF-Ys were also affected by ABA treatment. The expression levels of six NF-YAs (BnNF-YA1, BnNF-YA7, BnNF-YA8, BnNF-YA9, BnNF-YA10, and BnNF-YA12) and seven BnNF-YB members (BnNF-YB2, BnNF-YB3, BnNF-YB7, BnNF-YB10, BnNF-YB11, BnNF-YB13, and BnNF-YB14) and two NF-YC members (BnNF-YC2 and BnNF-YC3) were greatly up-regulated by ABA treatments. Only a few BnNF-Ys were inhibited by the above three treatments. Several NF-Y subfamily members exhibited collinear expression patterns. The promoters of all stress-responsive BnNF-Ys harbored at least two types of stress-related cis-elements, such as ABRE, DRE, MYB, or MYC. The cis-element organization of BnNF-Ys was similar to that of Arabidopsis thaliana, and the promoter regions exhibited higher levels of nucleotide sequence identity with Brassica rapa than with Brassica oleracea. This work represents an entry point for investigating the roles of canola NF-Y proteins during abiotic stress responses and provides insight into

Variations in fatty acid composition, glucosinolate profile and some phytochemical contents in selected oil seed rape (Brassica napus L. cultivars

Directory of Open Access Journals (Sweden)

Amin Mohamed, Amal

2010-06-01

Full Text Available Rapeseed (Brassica napus L. is now the third most important source of edible oil in the world after soybean and palm oil. In this study seeds of five different rapeseed cultivars namely; pactol, silvo, topas, serw 4 and serw 6 were evaluated for their fatty acid composition, glucosinolate profile, amino acids, total tocopherols and phenolic content. Among all cultivars significant variability in fatty acids were observed. The oleic acid (C18:1 ranged from 56.31% to 58.67%, linoleic acid (C18:2 from 10.52% to 13.74%, α-linolenic acid (C18:3 from 8.83% to 10.32% and erucic acid (22:1 from 0.15% to 0.91%. The glucosinolate profile of rapeseed was also separated and identified using high-performance liquid chromatography. Small variations in the glucosinolate profile were observed among all tested cultivars; however, progoitrin and gluconapin were the major glucosinolate found. Additionally, silvo cultivar showed the highest total glucosinolate c ontents (5.97 μmol/g dw. Generally, the contents of aspartic, glutamic, arginine and leucine were high, while the contents of tyrosine and isoleucine were low among all cultivars. For total tocopherols, the results indicated that both serw 6 and pactol cultivars had the highest total tocopherol contents (138.3 and 102.8 mg/100 g oil, respectively. Total phenolic contents varied from 28.0 to 35.4 mg/g dw. The highest total phenolic content was found in topas while the lowest value was detected in serw 6. These parameters; fatty acid contents, glucosinolate profile and amino acids together with total tocopherols and phenolic contents, could be taken into consideration by oilseed rape breeders as selection criteria for developing genotypes with modified seed quality traits in Brassica napus L.La colza (Brassica napus L. es hoy en día el tercer cultivo más importante de aceites comestibles en el mundo tras el aceite de soja y de palma. En este estudio semillas de cinco cultivos diferentes de colza

Effect of Heavy Metals in Plants of the Genus Brassica

Science.gov (United States)

Mourato, Miguel P.; Moreira, Inês N.; Leitão, Inês; Pinto, Filipa R.; Sales, Joana R.; Louro Martins, Luisa

2015-01-01

Several species from the Brassica genus are very important agricultural crops in different parts of the world and are also known to be heavy metal accumulators. There have been a large number of studies regarding the tolerance, uptake and defense mechanism in several of these species, notably Brassica juncea and B. napus, against the stress induced by heavy metals. Numerous studies have also been published about the capacity of these species to be used for phytoremediation purposes but with mixed results. This review will focus on the latest developments in the study of the uptake capacity, oxidative damage and biochemical and physiological tolerance and defense mechanisms to heavy metal toxicity on six economically important species: B. juncea, B. napus, B. oleracea, B. carinata, B. rapa and B. nigra. PMID:26247945

Unraveling the genetic basis of seed tocopherol content and composition in rapeseed (Brassica napus L.).

Science.gov (United States)

Wang, Xingxing; Zhang, Chunyu; Li, Lingjuan; Fritsche, Steffi; Endrigkeit, Jessica; Zhang, Wenying; Long, Yan; Jung, Christian; Meng, Jinling

2012-01-01

Tocopherols are important antioxidants in vegetable oils; when present as vitamin E, tocopherols are an essential nutrient for humans and livestock. Rapeseed (Brassica napus L, AACC, 2 n = 38) is one of the most important oil crops and a major source of tocopherols. Although the tocopherol biosynthetic pathway has been well elucidated in the model photosynthetic organisms Arabidopsis thaliana and Synechocystis sp. PCC6803, knowledge about the genetic basis of tocopherol biosynthesis in seeds of rapeseed is scant. This project was carried out to dissect the genetic basis of seed tocopherol content and composition in rapeseed through quantitative trait loci (QTL) detection, genome-wide association analysis, and homologous gene mapping. We used a segregating Tapidor × Ningyou7 doubled haploid (TNDH) population, its reconstructed F(2) (RC-F(2)) population, and a panel of 142 rapeseed accessions (association panel). Genetic effects mainly contributed to phenotypic variations in tocopherol content and composition; environmental effects were also identified. Thirty-three unique QTL were detected for tocopherol content and composition in TNDH and RC-F(2) populations. Of these, seven QTL co-localized with candidate sequences associated with tocopherol biosynthesis through in silico and linkage mapping. Several near-isogenic lines carrying introgressions from the parent with higher tocopherol content showed highly increased tocopherol content compared with the recurrent parent. Genome-wide association analysis was performed with 142 B. napus accessions. Sixty-one loci were significantly associated with tocopherol content and composition, 11 of which were localized within the confidence intervals of tocopherol QTL. This joint QTL, candidate gene, and association mapping study sheds light on the genetic basis of seed tocopherol biosynthesis in rapeseed. The sequences presented here may be used for marker-assisted selection of oilseed rape lines with superior tocopherol

Unraveling the genetic basis of seed tocopherol content and composition in rapeseed (Brassica napus L..

Directory of Open Access Journals (Sweden)

Xingxing Wang

Full Text Available BACKGROUND: Tocopherols are important antioxidants in vegetable oils; when present as vitamin E, tocopherols are an essential nutrient for humans and livestock. Rapeseed (Brassica napus L, AACC, 2 n = 38 is one of the most important oil crops and a major source of tocopherols. Although the tocopherol biosynthetic pathway has been well elucidated in the model photosynthetic organisms Arabidopsis thaliana and Synechocystis sp. PCC6803, knowledge about the genetic basis of tocopherol biosynthesis in seeds of rapeseed is scant. This project was carried out to dissect the genetic basis of seed tocopherol content and composition in rapeseed through quantitative trait loci (QTL detection, genome-wide association analysis, and homologous gene mapping. METHODOLOGY/PRINCIPAL FINDINGS: We used a segregating Tapidor × Ningyou7 doubled haploid (TNDH population, its reconstructed F(2 (RC-F(2 population, and a panel of 142 rapeseed accessions (association panel. Genetic effects mainly contributed to phenotypic variations in tocopherol content and composition; environmental effects were also identified. Thirty-three unique QTL were detected for tocopherol content and composition in TNDH and RC-F(2 populations. Of these, seven QTL co-localized with candidate sequences associated with tocopherol biosynthesis through in silico and linkage mapping. Several near-isogenic lines carrying introgressions from the parent with higher tocopherol content showed highly increased tocopherol content compared with the recurrent parent. Genome-wide association analysis was performed with 142 B. napus accessions. Sixty-one loci were significantly associated with tocopherol content and composition, 11 of which were localized within the confidence intervals of tocopherol QTL. CONCLUSIONS/SIGNIFICANCE: This joint QTL, candidate gene, and association mapping study sheds light on the genetic basis of seed tocopherol biosynthesis in rapeseed. The sequences presented here may be used

Significant reductions in oil quality and lipid content of oilseed rape (Brassica napus L.) under climate change

DEFF Research Database (Denmark)

Namazkar, Shahla; Egsgaard, Helge; Frenck, Georg

2015-01-01

Despite of the potential importance to food and bioenergy purposes, effects from climate change on plant oil quality have hardly been characterized.On a global basis Brassica napus L., rapeseed or oilseed rape, is the second largest source of vegetable oil after soybean and the predominant oil crop...... in Europe. We found significant changes in oil quality and quantity of four cultivars of oilseed rape grown in five future climate scenarios with elevated [CO2], [O-3] temperature and combinations hereof (similar to RCP8.5,(1)). Populations of the cultivars were grown under ambient and climate change...... conditions in a climate-phytotron. The treatments were ambient (360 ppm CO2, 19/12 degrees C (day/night), 20/20 ppb O-3 (day/night)), all factors elevated (650 ppm CO2, 24/17 degrees C, 60/20 ppb O-3), as well as two- and single-factor treatments with the elevated factors.The overall trend was that oil...

Contrastive response of Brassica napus L. to exogenous salicylic acid, selenium and silicon supplementation under water stress

Directory of Open Access Journals (Sweden)

Habibi Ghader

2015-01-01

Full Text Available The present research was designed to determine the effects of exogenous salicylic acid (SA, selenium (Se and silicon (Si on the resistance of canola (Brassica napus L. cv Okapi seedlings to salt stress. Foliar application of SA (0.1 mM in canola plants under drought stress for 25 days exhibited a significantly positive effect on shoot dry mass and raised the levels of total chlorophyll as well as boosting the activity of superoxide dismutase (SOD and catalase (CAT. In addition, soil application of silicon (0.35 g Na2SiO3/kg soil had ameliorative effects on canola root growth under drought. It is concluded that SA and Si enhanced the salt tolerance of canola by protecting the cell membrane against lipid peroxidation. However, the foliar application of Se (10 mg/l had no ameliorative effects on canola growth and antioxidant capacity under drought stress, as could be judged by accumulation of malondialdehyde (MDA.

Brassica napus has a key role in the recovery of the health of soils contaminated with metals and diesel by rhizoremediation.

Science.gov (United States)

Lacalle, Rafael G; Gómez-Sagasti, María T; Artetxe, Unai; Garbisu, Carlos; Becerril, José M

2018-03-15

Contaminated soils are frequently characterized by the simultaneous presence of organic and inorganic contaminants, as well as a poor biological and nutritional status. Rhizoremediation, the combined use of phytoremediation and bioremediation, has been proposed as a Gentle Remediation Option to rehabilitate multi-contaminated soils. Recently, newer techniques, such as the application of metallic nanoparticles, are being deployed in an attempt to improve traditional remediation options. In order to implement a phytomanagement strategy on calcareous alkaline peri-urban soils simultaneously contaminated with several metals and diesel, we evaluated the effectiveness of Brassica napus L., a profitable crop species, assisted with organic amendment and zero-valent iron nanoparticles (nZVI). A two-month phytotron experiment was carried out using two soils, i.e. amended and unamended with organic matter. Soils were artificially contaminated with Zn, Cu and Cd (1500, 500 and 50mgkg -1 , respectively) and diesel (6000mgkg -1 ). After one month of stabilization, soils were treated with nZVI and/or planted with B. napus. The experiment was conducted with 16 treatments resulting from the combination of the following factors: amended/unamended, contaminated/non-contaminated, planted/unplanted and nZVI/no-nZVI. Soil physicochemical characteristics and biological indicators (plant performance and soil microbial properties) were determined at several time points along the experiment. Carbonate content of soils was the crucial factor for metal immobilization and, concomitantly, reduction of metal toxicity. Organic amendment was essential to promote diesel degradation and to improve the health and biomass of B. napus. Soil microorganisms degraded preferably diesel hydrocarbons of biological origin (biodiesel). Plants had a remarkable positive impact on the activity and functional diversity of soil microbial communities. The nZVI were ineffective as soil remediation tools, but did not

The microbe-secreted isopeptide poly-γ-glutamic acid induces stress tolerance in Brassica napus L. seedlings by activating crosstalk between H2O2 and Ca2+

Science.gov (United States)

Lei, Peng; Pang, Xiao; Feng, Xiaohai; Li, Sha; Chi, Bo; Wang, Rui; Xu, Zongqi; Xu, Hong

2017-01-01

Poly-γ-glutamic acid (γ-PGA) is a microbe-secreted isopeptide that has been shown to promote growth and enhance stress tolerance in crops. However, its site of action and downstream signaling pathways are still unknown. In this study, we investigated γ-PGA-induced tolerance to salt and cold stresses in Brassica napus L. seedlings. Fluorescent labeling of γ-PGA was used to locate the site of its activity in root protoplasts. The relationship between γ-PGA-induced stress tolerance and two signal molecules, H2O2 and Ca2+, as well as the γ-PGA-elicited signaling pathway at the whole plant level, were explored. Fluorescent labeling showed that γ-PGA did not enter the cytoplasm but instead attached to the surface of root protoplasm. Here, it triggered a burst of H2O2 in roots by enhancing the transcription of RbohD and RbohF, and the elicited H2O2 further activated an influx of Ca2+ into root cells. Ca2+ signaling was transmitted via the stem from roots to leaves, where it elicited a fresh burst of H2O2, thus promoting plant growth and enhancing stress tolerance. On the basis of these observation, we propose that γ-PGA mediates stress tolerance in Brassica napus seedlings by activating an H2O2 burst and subsequent crosstalk between H2O2 and Ca2+ signaling. PMID:28198821

Influence of a Vertical Cutting Device on Brassica Napus Seed Loss in Direct Combining

Energy Technology Data Exchange (ETDEWEB)

Pari, L.; Fedrizzi, M.; Assirelli, A. (Consiglio per la Ricerca e la Sperimentazione in Agricoltura, Unita di Ricerca per l' Ingegneria Agraria, Monterotondo, RM (Italy))

2008-10-15

EU requires that by 2010 5.65% of diesel fuel must be of vegetable origin. To reduce Italian dependence from imported palm oil, it is necessary to increase national production of vegetable oils: together with sunflower and soybean, canola (Brassica napus or Brassica napus oleifera) is an interesting possibility to satisfy vegetable oil demand, that is rapidly increasing for its use in biodiesel production. In Italy potential areas are available for the cultivation in relation to adequate rainfall and mild winters, that are very promising factors for canola production. However, the long period of seed maturity, non uniform growth, natural dehiscent process and variable weather conditions, such as wind and rain, are some of the factors which can lead to large seed losses: this is the main problem limiting this specie diffusion. Amongst available harvesting techniques, direct harvest of canola is an hazardous practice because there are several important questions related to it. The success of canola may depend on research initiatives to reduce some of the obstacles associated with its growing. The objective of this study is to determine if different cropping heads in direct combining can reduce seed losses. In Northern Italy (Piedmont) the trials were conducted in a 16 ha canola cultivation, in which was seeded the -Lion variety of canola. In order to realize direct harvest, the combine cylinder speed was regulated as slow as possible (500 rpm), the concave was opened at 3/4 of the way (about 25 mm clearance) and the fan speed was set at 2/3 of small grain settings (800 rpm). Only one combine was used for the trials, a New Holland CX 9080, in order to avoid any influence on seed losses. The combine was equipped with two different cutting heads: a common wheat type (type 1) and another, similar to the first, but equipped with vertical cutting devices on both ends of the head (type 2), because the plants are very dense and entangled. The losses of seeds were measured

BnDGAT1s Function Similarly in Oil Deposition and Are Expressed with Uniform Patterns in Tissues of Brassica napus

Directory of Open Access Journals (Sweden)

Cuizhu Zhao

2017-12-01

Full Text Available As an allotetraploid oilcrop, Brassica napus contains four duplicated Acyl-CoA:diacylglycerol acyltransferase 1 (DGAT1 genes, which catalyze one of the rate-limiting steps in triacylglycerol (TAG biosynthesis in plants. While all four BnDGAT1s have been expressed functionally in yeast, their expression patterns in different germplasms and tissues and also consequent contribution to seed oil accumulation in planta remain to be elucidated. In this study, the coding regions of the four BnDGAT1s were expressed in an Arabidopsis dgat1 mutant. All four BnDGAT1s showed similar effects on oil content and fatty acid composition, a result which is different from that observed in previous studies of their expression in yeast. Expression patterns of BnDGAT1s were analyzed in developing seeds of 34 B. napus inbred lines and in different tissues of 14 lines. Different expression patterns were observed for the four BnDGAT1s, which suggests that they express independently or randomly in different germplasm sources. Higher expression of BnDGAT1s was correlated with higher seed oil content lines. Tissue-specific analyses showed that the BnDGAT1s were expressed in a uniform pattern in different tissues. Our results suggest that it is important to maintain expression of the four BnDGAT1s for maximum return on oil content.

Effects of Gamma Irradiation on Quality Characteristic and Microbiological Safety of Rape (Brassica napus) Pollen

International Nuclear Information System (INIS)

Kim, Kyoung-Hee; Jeong, Su-Ji; Kim, Dam; Yook, Hong-Sun; Kim, Kwang-Hun

2013-01-01

This study is carried out to sanitize rape (Brassica napus) pollen by gamma irradiation. Rape pollens were treated with 0, 5, 10 and 15 kGy gamma irradiations, and then analyzed for the following: general composition, microbial population, reducing sugar, Hunter color values, TBARS (2-thiobarbituric acid reactive substances) values, and VBN (volatile basic nitrogen). Mold and coliform bacteria were not detected in the samples irradiated at 5 kGy or more. Yeasts and total aerobic bacteria were not detected in the samples irradiated at 10 kGy or more (102 CFU/g). Moisture, ash, crude protein, crude fat, carbohydrate, reducing sugar and the contents of volatile basic nitrogen in the irradiated pollen did not show any significant changes by irradiation. Hunter color values, L, a and b values were decreased with increment of irradiation dose. TBARS values were increased with an increment of irradiation dose. In conclusion, gamma irradiation at 5 kGy was considered to be an effective treatment to control for mycotoxin producing fungi in rape pollen to minimize changes of general composition and physicochemical properties. Further studies should be investigated to reduce the detrimental effects induced by irradiation

Effect of Arabinogalactan Proteins from the Root Caps of Pea and Brassica napus on Aphanomyces euteiches Zoospore Chemotaxis and Germination12[C][W

Science.gov (United States)

Cannesan, Marc Antoine; Durand, Caroline; Burel, Carole; Gangneux, Christophe; Lerouge, Patrice; Ishii, Tadashi; Laval, Karine; Follet-Gueye, Marie-Laure; Driouich, Azeddine; Vicré-Gibouin, Maïté

2012-01-01

Root tips of many plant species release a number of border, or border-like, cells that are thought to play a major role in the protection of root meristem. However, little is currently known on the structure and function of the cell wall components of such root cells. Here, we investigate the sugar composition of the cell wall of the root cap in two species: pea (Pisum sativum), which makes border cells, and Brassica napus, which makes border-like cells. We find that the cell walls are highly enriched in arabinose and galactose, two major residues of arabinogalactan proteins. We confirm the presence of arabinogalactan protein epitopes on root cap cell walls using immunofluorescence microscopy. We then focused on these proteoglycans by analyzing their carbohydrate moieties, linkages, and electrophoretic characteristics. The data reveal (1) significant structural differences between B. napus and pea root cap arabinogalactan proteins and (2) a cross-link between these proteoglycans and pectic polysaccharides. Finally, we assessed the impact of root cap arabinogalactan proteins on the behavior of zoospores of Aphanomyces euteiches, an oomycetous pathogen of pea roots. We find that although the arabinogalactan proteins of both species induce encystment and prevent germination, the effects of both species are similar. However, the arabinogalactan protein fraction from pea attracts zoospores far more effectively than that from B. napus. This suggests that root arabinogalactan proteins are involved in the control of early infection of roots and highlights a novel role for these proteoglycans in root-microbe interactions. PMID:22645070

Hydroponics versus field lysimeter studies of urea, ammonium and nitrate uptake by oilseed rape (Brassica napus L.).

Science.gov (United States)

Arkoun, Mustapha; Sarda, Xavier; Jannin, Laëtitia; Laîné, Philippe; Etienne, Philippe; Garcia-Mina, José-Maria; Yvin, Jean-Claude; Ourry, Alain

2012-09-01

N-fertilizer use efficiencies are affected by their chemical composition and suffer from potential N-losses by volatilization. In a field lysimeter experiment, (15)N-labelled fertilizers were used to follow N uptake by Brassica napus L. and assess N-losses by volatilization. Use of urea with NBPT (urease inhibitor) showed the best efficiency with the lowest N losses (8% of N applied compared with 25% with urea alone). Plants receiving ammonium sulphate, had similar yield achieved through a better N mobilization from vegetative tissues to the seeds, despite a lower N uptake resulting from a higher volatilization (43% of applied N). Amounts of (15)N in the plant were also higher when plants were fertilized with ammonium nitrate but N-losses reached 23% of applied N. In parallel, hydroponic experiments showed a deleterious effect of ammonium and urea on the growth of oilseed rape. This was alleviated by the nitrate supply, which was preferentially taken up. B. napus was also characterized by a very low potential for urea uptake. BnDUR3 and BnAMT1, encoding urea and ammonium transporters, were up-regulated by urea, suggesting that urea-grown plants suffered from nitrogen deficiency. The results also suggested a role for nitrate as a signal for the expression of BnDUR3, in addition to its role as a major nutrient. Overall, the results of the hydroponic study showed that urea itself does not contribute significantly to the N nutrition of oilseed rape. Moreover, it may contribute indirectly since a better use efficiency for urea fertilizer, which was further increased by the application of a urease inhibitor, was observed in the lysimeter study.

Cerium oxide nanoparticles alter the salt stress tolerance of Brassica napus L. by modifying the formation of root apoplastic barriers.

Science.gov (United States)

Rossi, Lorenzo; Zhang, Weilan; Ma, Xingmao

2017-10-01

Rapidly growing global population adds significant strains on the fresh water resources. Consequently, saline water is increasingly tapped for crop irrigation. Meanwhile, rapid advancement of nanotechnology is introducing more and more engineered nanoparticles into the environment and in agricultural soils. While some negative effects of ENPs on plant health at very high concentrations have been reported, more beneficial effects of ENPs at relatively low concentrations are increasingly noticed, opening doors for potential applications of nanotechnology in agriculture. In particular, we found that cerium oxide nanoparticles (CeO 2 NPs) improved plant photosynthesis in salt stressed plants. Due to the close connections between salt stress tolerance and the root anatomical structures, we postulated that CeO 2 NPs could modify plant root anatomy and improve plant salt stress tolerance. This study aimed at testing the hypothesis with Brassica napus in the presence of CeO 2 NPs (0, 500 mg kg -1 dry sand) and/or NaCl (0, 50 mM) in a growth chamber. Free hand sections of fresh roots were taken every seven days for three weeks and the suberin lamellae development was examined under a fluorescence microscope. The results confirmed the hypothesis that CeO 2 NPs modified the formation of the apoplastic barriers in Brassica roots. In salt stressed plants, CeO 2 NPs shortened the root apoplastic barriers which allowed more Na + transport to shoots and less accumulation of Na + in plant roots. The altered Na + fluxes and transport led to better physiological performance of Brassica and may lead to new applications of nanotechnology in agriculture. Copyright © 2017 Elsevier Ltd. All rights reserved.

Experimental evidence that honeybees depress wild insect densities in a flowering crop.

Science.gov (United States)

Lindström, Sandra A M; Herbertsson, Lina; Rundlöf, Maj; Bommarco, Riccardo; Smith, Henrik G

2016-11-30

While addition of managed honeybees (Apis mellifera) improves pollination of many entomophilous crops, it is unknown if it simultaneously suppresses the densities of wild insects through competition. To investigate this, we added 624 honeybee hives to 23 fields of oilseed rape (Brassica napus L.) over 2 years and made sure that the areas around 21 other fields were free from honeybee hives. We demonstrate that honeybee addition depresses the densities of wild insects (bumblebees, solitary bees, hoverflies, marchflies, other flies, and other flying and flower-visiting insects) even in a massive flower resource such as oilseed rape. The effect was independent of the complexity of the surrounding landscape, but increased with the size of the crop field, which suggests that the effect was caused by spatial displacement of wild insects. Our results have potential implications both for the pollination of crops (if displacement of wild pollinators offsets benefits achieved by adding honeybees) and for conservation of wild insects (if displacement results in negative fitness consequences). © 2016 The Author(s).

Cryptochrome 1 regulates growth and development in Brassica through alteration in the expression of genes involved in light, phytohormone and stress signalling.

Science.gov (United States)

Sharma, Pooja; Chatterjee, Mithu; Burman, Naini; Khurana, Jitendra P

2014-04-01

The blue light photoreceptors cryptochromes are ubiquitous in higher plants and are vital for regulating plant growth and development. In spite of being involved in controlling agronomically important traits like plant height and flowering time, cryptochromes have not been extensively characterized from agriculturally important crops. Here we show that overexpression of CRY1 from Brassica napus (BnCRY1), an oilseed crop, results in short-statured Brassica transgenics, likely to be less prone to wind and water lodging. The overexpression of BnCRY1 accentuates the inhibition of cell elongation in hypocotyls of transgenic seedlings. The analysis of hypocotyl growth inhibition and anthocyanin accumulation responses in BnCRY1 overexpressors substantiates that regulation of seedling photomorphogenesis by cry1 is dependent on light intensity. This study highlights that the photoactivated cry1 acts through coordinated induction and suppression of specific downstream genes involved in phytohormone synthesis or signalling, and those involved in cell wall modification, during de-etiolation of Brassica seedlings. The microarray-based transcriptome profiling also suggests that the overexpression of BnCRY1 alters abiotic/biotic stress signalling pathways; the transgenic seedlings were apparently oversensitive to abscisic acid (ABA) and mannitol. © 2013 John Wiley & Sons Ltd.

Yield performance of brassica varieties under rainfed condition

International Nuclear Information System (INIS)

Hassan, M.Z.U.; Wahla, A.J.; Waqar, M.Q.

2014-01-01

A field study was conducted to evaluate crop growth and seed yield performance of Brassica varieties under Rainfed conditions. The varieties, included in the study, were BSA, Zafar-2000, Pakola, Con.1, Con.2, Abaseen, Rainbow, SPS-5, Bard-1, and KJ-119. KJ-119 (2500.0 KG/HA) among Brassica juncea L. varieties and Abaseen (2425.9 kg/ha) among Brassica napusL. Varieties produced with maximum seed yield as compared to rest of varieties. Significantly, minimum seed yield was observed in check variety BSA. The significant difference in seed yield of Brassica varieties, Abaseen and KJ 119, was attributed to improve yield components over other varieties. Maximum pods per plant and seeds per pod led these varieties to attain maximum yield. Inspite of weather variations existence during years 2007-09,the same varieties produced with maximum seed yield. (author)

Production and cytogenetics of Brassica campestris-alboglabra chromosome addition lines

DEFF Research Database (Denmark)

Chen, B.Y.; Cheng, B.F.; Bagger Jørgensen, Rikke

1997-01-01

Four different Brassica campestris-alboglabra monosomic addition lines (AA + 1 chromosome from C, 2n = 21) were obtained after consecutive backcrosses between resynthesized B. napus (AACC, 2n = 38) and the parental B. campestris (AA, 2n = 20) accession. The alien chromosomes of B. alboglabra (CC, 2...

Comparison of sugars, iridoid glycosides and amino acids in nectar and phloem sap of Maurandya barclayana, Lophospermum erubescens, and Brassica napus.

Science.gov (United States)

Lohaus, Gertrud; Schwerdtfeger, Michael

2014-01-01

Floral nectar contains sugars and amino acids to attract pollinators. In addition, nectar also contains different secondary compounds, but little is understood about their origin or function. Does nectar composition reflect phloem composition, or is nectar synthesized and/or modified in nectaries? Studies where both, the nectar as well as the phloem sap taken from the same plant species were analyzed in parallel are rare. Therefore, phloem sap and nectar from different plant species (Maurandya barclayana, Lophospermum erubescens, and Brassica napus) were compared. Nectar was collected with microcapillary tubes and phloem sap with the laser-aphid-stylet technique. The nectar of all three plant species contained high amounts of sugars with different percentages of glucose, fructose, and sucrose, whereas phloem sap sugars consisted almost exclusively of sucrose. One possible reason for this could be the activity of invertases in the nectaries. The total concentration of amino acids was much lower in nectars than in phloem sap, indicating selective retention of nitrogenous solutes during nectar formation. Nectar amino acid concentrations were negatively correlated with the nectar volumes per flower of the different plant species. Both members of the tribe Antirrhineae (Plantaginaceae) M. barclayana and L. erubescens synthesized the iridoid glycoside antirrhinoside. High amounts of antirrhinoside were found in the phloem sap and lower amounts in the nectar of both plant species. The parallel analyses of nectar and phloem sap have shown that all metabolites which were found in nectar were also detectable in phloem sap with the exception of hexoses. Otherwise, the composition of both aqueous solutions was not the same. The concentration of several metabolites was lower in nectar than in phloem sap indicating selective retention of some metabolites. Furthermore, the existence of antirrhinoside in nectar could be based on passive secretion from the phloem.

Comparison of sugars, iridoid glycosides and amino acids in nectar and phloem sap of Maurandya barclayana, Lophospermum erubescens, and Brassica napus.

Directory of Open Access Journals (Sweden)

Gertrud Lohaus

Full Text Available BACKGROUND: Floral nectar contains sugars and amino acids to attract pollinators. In addition, nectar also contains different secondary compounds, but little is understood about their origin or function. Does nectar composition reflect phloem composition, or is nectar synthesized and/or modified in nectaries? Studies where both, the nectar as well as the phloem sap taken from the same plant species were analyzed in parallel are rare. Therefore, phloem sap and nectar from different plant species (Maurandya barclayana, Lophospermum erubescens, and Brassica napus were compared. METHODOLOGY AND PRINCIPAL FINDINGS: Nectar was collected with microcapillary tubes and phloem sap with the laser-aphid-stylet technique. The nectar of all three plant species contained high amounts of sugars with different percentages of glucose, fructose, and sucrose, whereas phloem sap sugars consisted almost exclusively of sucrose. One possible reason for this could be the activity of invertases in the nectaries. The total concentration of amino acids was much lower in nectars than in phloem sap, indicating selective retention of nitrogenous solutes during nectar formation. Nectar amino acid concentrations were negatively correlated with the nectar volumes per flower of the different plant species. Both members of the tribe Antirrhineae (Plantaginaceae M. barclayana and L. erubescens synthesized the iridoid glycoside antirrhinoside. High amounts of antirrhinoside were found in the phloem sap and lower amounts in the nectar of both plant species. CONCLUSIONS/SIGNIFICANCE: The parallel analyses of nectar and phloem sap have shown that all metabolites which were found in nectar were also detectable in phloem sap with the exception of hexoses. Otherwise, the composition of both aqueous solutions was not the same. The concentration of several metabolites was lower in nectar than in phloem sap indicating selective retention of some metabolites. Furthermore, the existence of

Functional characterization of a heterologously expressed Brassica napus WRKY41-1 transcription factor in regulating anthocyanin biosynthesis in Arabidopsis thaliana.

Science.gov (United States)

Duan, Shaowei; Wang, Jianjun; Gao, Chenhao; Jin, Changyu; Li, Dong; Peng, Danshuai; Du, Guomei; Li, Yiqian; Chen, Mingxun

2018-03-01

Previous studies have shown that a plant WRKY transcription factor, WRKY41, has multiple functions, and regulates seed dormancy, hormone signaling pathways, and both biotic and abiotic stress responses. However, it is not known about the roles of AtWRKY41 from the model plant, Arabidopsis thaliana, and its ortholog, BnWRKY41, from the closely related and important oil-producing crop, Brassica napus, in the regulation of anthocyanin biosynthesis. Here, we found that the wrky41 mutation in A. thaliana resulted in a significant increase in anthocyanin levels in rosette leaves, indicating that AtWRKY41 acts as repressor of anthocyanin biosynthesis. RNA sequencing and quantitative real-time PCR analysis revealed increased expression of three regulatory genes AtMYB75, AtMYB111, and AtMYBD, and two structural genes, AT1G68440 and AtGSTF12, all of which contribute to anthocyanin biosynthesis, in the sixth rosette leaves of wrky41-2 plants at 20 days after germination. We cloned the full length complementary DNA of BnWRKY41-1 from the C2 subgenome of the B. napus genotype Westar and observed that, when overexpressed in tobacco leaves as a fusion protein with green fluorescent protein, BnWRKY41-1 is localized to the nucleus. We further showed that overexpression of BnWRKY41-1 in the A. thaliana wrky41-2 mutant rescued the higher anthocyanin content phenotype in rosette leaves of the mutant. Moreover, the elevated expression levels in wrky41-2 rosette leaves of several important regulatory and structural genes regulating anthocyanin biosynthesis were not observed in the BnWRKY41-1 overexpressing lines. These results reveal that BnWRKY41-1 has a similar role with AtWRKY41 in regulating anthocyanin biosynthesis when overexpressed in A. thaliana. This gene represents a promising target for genetically manipulating B. napus to increase the amounts of anthocyanins in rosette leaves. Copyright © 2017 Elsevier B.V. All rights reserved.

Persistence of seeds from crops of conventional and herbicide tolerant oilseed rape (Brassica napus).

Science.gov (United States)

Lutman, Peter J W; Berry, Kate; Payne, Roger W; Simpson, Euan; Sweet, Jeremy B; Champion, Gillian T; May, Mike J; Wightman, Pat; Walker, Kerr; Lainsbury, Martin

2005-09-22

A series of rotation experiments at five sites over four years has explored the environmental and agronomic implications of growing herbicide tolerant oilseed rape and sugar beet. This paper reports on the population dynamics of volunteer rape (Brassica napus). The experiments compared four winter oilseed rape (WOSR) cultivars: a conventional cultivar (Apex) and three developmental cultivars either genetically modified (GM) to be tolerant to glyphosate or glufosinate, or conventionally bred to be tolerant to herbicides of the imidazolinone group. Seed losses at harvest averaged 3575 seeds m(-2) but ranged from less than 2000 up to more than 10000 seeds m(-2). There was a rapid decline in seed numbers during the first few months after harvest, resulting in a mean loss of seeds of 60%. In subsequent seasons, the seedbank declined much more slowly at four of the five sites (ca 20% per year) and the models predicted 95% seed loss after approximately 9 years. Seed decline was much faster at the fifth site. There were no clear differences between the four cultivars in either the numbers of seeds shed at harvest or in their subsequent persistence. The importance of the persistence of GM rape seeds, in the context of the coexistence of GM and non-GM crops and the role of good management practices that minimize seed persistence, are discussed.

Study of total seed storage protein in indigenous Brassica species ...

African Journals Online (AJOL)

hope&shola

2010-11-08

Nov 8, 2010 ... Brassica napus. Acc. No Location. Acc. No Location. Acc. No Location. Acc. No Location. 500. Islamsbad. 522. Hassan Abdal. 544. Naseer abad. 566. Rawalpindi. 501. Islamsbad. 523. Bannu. 545. Jaglot. 567. Karak. 502. Rawalakot. 524. Karak. 546. Haripur North. 568. Akora Khattack. 503. Sibi. 525.

Embryonal Control of Yellow Seed Coat Locus ECY1 Is Related to Alanine and Phenylalanine Metabolism in the Seed Embryo of Brassica napus.

Science.gov (United States)

Wang, Fulin; He, Jiewang; Shi, Jianghua; Zheng, Tao; Xu, Fei; Wu, Guanting; Liu, Renhu; Liu, Shengyi

2016-04-07

Seed coat color is determined by the type of pigment deposited in the seed coat cells. It is related to important agronomic traits of seeds such as seed dormancy, longevity, oil content, protein content and fiber content. In Brassica napus, inheritance of seed coat color is related to maternal effects and pollen effects (xenia effects). In this research we isolated a mutation of yellow seeded B. napus controlled by a single Mendelian locus, which is named Embryonal Control of Yellow seed coat 1 (Ecy1). Microscopy of transverse sections of the mature seed show that pigment is deposited only in the outer layer of the seed coat. Using Illumina Hisequation 2000 sequencing technology, a total of 12 GB clean data, 116× coverage of coding sequences of B. napus, was achieved from seeds 26 d after pollination (DAP). It was assembled into 172,238 independent transcripts, and 55,637 unigenes. A total of 139 orthologous genes of Arabidopsis transparent testa (TT) genes were mapped in silico to 19 chromosomes of B. napus Only 49 of the TT orthologous genes are transcribed in seeds. However transcription of all orthologs was independent of embryonal control of seed coat color. Only 55 genes were found to be differentially expressed between brown seeds and the yellow mutant. Of these 55, 50 were upregulated and five were downregulated in yellow seeds as compared to their brown counterparts. By KEGG classification, 14 metabolic pathways were significantly enriched. Of these, five pathways: phenylpropanoid biosynthesis, cyanoamino acid metabolism, plant hormone signal transduction, metabolic pathways, and biosynthesis of secondary metabolites, were related with seed coat pigmentation. Free amino acid quantification showed that Ala and Phe were present at higher levels in the embryos of yellow seeds as compared to those of brown seeds. This increase was not observed in the seed coat. Moreover, the excess amount of free Ala was exactly twice that of Phe in the embryo. The pigment

Embryonal Control of Yellow Seed Coat Locus ECY1 Is Related to Alanine and Phenylalanine Metabolism in the Seed Embryo of Brassica napus

Directory of Open Access Journals (Sweden)

Fulin Wang

2016-04-01

Full Text Available Seed coat color is determined by the type of pigment deposited in the seed coat cells. It is related to important agronomic traits of seeds such as seed dormancy, longevity, oil content, protein content and fiber content. In Brassica napus, inheritance of seed coat color is related to maternal effects and pollen effects (xenia effects. In this research we isolated a mutation of yellow seeded B. napus controlled by a single Mendelian locus, which is named Embryonal Control of Yellow seed coat 1 (Ecy1. Microscopy of transverse sections of the mature seed show that pigment is deposited only in the outer layer of the seed coat. Using Illumina Hisequation 2000 sequencing technology, a total of 12 GB clean data, 116× coverage of coding sequences of B. napus, was achieved from seeds 26 d after pollination (DAP. It was assembled into 172,238 independent transcripts, and 55,637 unigenes. A total of 139 orthologous genes of Arabidopsis transparent testa (TT genes were mapped in silico to 19 chromosomes of B. napus. Only 49 of the TT orthologous genes are transcribed in seeds. However transcription of all orthologs was independent of embryonal control of seed coat color. Only 55 genes were found to be differentially expressed between brown seeds and the yellow mutant. Of these 55, 50 were upregulated and five were downregulated in yellow seeds as compared to their brown counterparts. By KEGG classification, 14 metabolic pathways were significantly enriched. Of these, five pathways: phenylpropanoid biosynthesis, cyanoamino acid metabolism, plant hormone signal transduction, metabolic pathways, and biosynthesis of secondary metabolites, were related with seed coat pigmentation. Free amino acid quantification showed that Ala and Phe were present at higher levels in the embryos of yellow seeds as compared to those of brown seeds. This increase was not observed in the seed coat. Moreover, the excess amount of free Ala was exactly twice that of Phe in the

Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.).

Science.gov (United States)

Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na

2018-03-16

Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

Plant hormones in defense response of Brassica napus to Sclerotinia sclerotiorum - reassessing the role of salicylic acid in the interaction with a necrotroph.

Science.gov (United States)

Nováková, Miroslava; Sašek, Vladimír; Dobrev, Petre I; Valentová, Olga; Burketová, Lenka

2014-07-01

According to general model, jasmonic acid (JA) and ethylene (ET) signaling pathways are induced in Arabidopsis after an attack of necrotroph, Sclerotinia sclerotiorum (Lib.) de Bary. However, abscisic acid (ABA) and salicylic acid (SA) also seem to play a role. While signaling events in Arabidopsis have been intensively studied recently, information for the natural host Brassica napus is limited. In this study, multiple plant hormone quantification and expression analysis of marker genes of the signaling pathways was used to gain a complete view of the interaction of B. napus with S. sclerotiorum. Strong response of ET biosynthetic gene ACS2 was observed, accompanied by increases of SA and JA levels that correspond to the elevated expression of marker genes PR1 and LOX3. Interestingly, the level of ABA and the expression of its marker gene RD26 were also elevated. Furthermore, induction of the SA-dependent defense decreased disease symptoms. In addition, SA signaling is suggested as a possible target for manipulation by S. sclerotiorum. A gene for putative chorismate mutase SS1G_14320 was identified that is highly expressed during infection but not in vitro. Our results bring the evidence of SA involvement in the interaction of plant with the necrotroph that conflict with the current model. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Microwave irradiation and citric acid assisted seed germination and phytoextraction of nickel (Ni) by Brassica napus L.: morpho-physiological and biochemical alterations under Ni stress.

Science.gov (United States)

Farid, Mujahid; Ali, Shafaqat; Rizwan, Muhammad; Saeed, Rashid; Tauqeer, Hafiz Muhammad; Sallah-Ud-Din, Rasham; Azam, Ahmed; Raza, Nighat

2017-09-01

The complex bio-geochemistry of soil allows pollutant to persist for a longer period of time which further decreased the fertility and natural composition of land. Nickel, an inorganic pollutant, coming from a wide range of industrial and manufacturing units possesses serious threat to soil degradation and crop productivity around the world. The present study was carried to evaluate the combined role of microwave irradiation (MR) and citric acid (CA) on the phytoextraction potential of Brassica napus L. under Ni stress. An initial seed germination test was conducted to select effective time scale of MR exposure. Highest seed germination was observed at exposure of 2.45 GHz frequency for 30 s. Healthy seeds of B. napus L. genotype Faisal Canola (RBN-03060) treated with MR at 2.45 GHz for 30 s were sown in plastic pots filled with 5 kg of soil. Nickel and CA applied exogenously in solution form with different combinations to both MR-treated and untreated B. napus plants. The MR-treated plants showed higher growth, biomass, photosynthetic pigments (Chl a, b, total, and carotenoids) and activities of antioxidant enzymes (SOD, POD, APX, CAT) as compared to untreated plants who showed higher reactive oxygen species (MDA, H 2 O 2 ) and electrolyte leakage. Increasing Ni concentration significantly decreased the physiological and biochemical attributes of B. napus both in MR-treated and untreated plants. The addition of CA alleviated Ni-induced toxic effects in both MR-treated and untreated plants by improving antioxidant defense system. The degree of Ni stress mitigation was higher in MR-treated plants. The Ni concentration was higher in root, stem, and leaves of MR-treated plants under CA application as compared to untreated plants. The present study concluded that seeds treated with MR before sowing showed higher accumulation and concentration of Ni from soil, and this phenomenon boosted with the application of CA.

Different roles of glutathione in copper and zinc chelation in Brassica napus roots.

Science.gov (United States)

Zlobin, Ilya E; Kartashov, Alexander V; Shpakovski, George V

2017-09-01

We investigated the specific features of copper and zinc excess action on the roots of canola (Brassica napus L.) plants. Copper rapidly accumulated in canola root cells and reached saturation during several hours of treatment, whereas the root zinc content increased relatively slowly. Excessive copper and zinc entry inside the cell resulted in significant cell damage, as evidenced by alterations in plasmalemma permeability and decreases in cellular enzymatic activity. Zinc excess specifically damaged root hair cells, which correlated with a pronounced elevation of their labile zinc level. In vitro, we showed that reduced glutathione (GSH) readily reacted with copper ions to form complexes with blocked sulfhydryl groups. In contrast, zinc ions were ineffective as glutathione blockers, and glutathione molecules did not lose their specific chemical activity in the presence of Zn 2+ ions. The effect of copper and zinc excess on the glutathione pool in canola root cells was analysed by a combination of biochemical determination of total and oxidized glutathione contents and fluorescent staining of free reduced glutathione with monochlorobimane dye. Excess copper led to dose-dependent diminution of free reduced glutathione contents in the root cells, which could not be explained by the loss of total cellular glutathione or its oxidation. In contrast, we observed little effect of much higher intracellular zinc concentrations on the free reduced glutathione content. We concluded that GSH plays an important role in copper excess, but not zinc excess chelation, in canola root cells. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Methyl jasmonate regulates antioxidant defense and suppresses arsenic uptake in Brassica napus L.

Directory of Open Access Journals (Sweden)

Muhammad A Farooq

2016-04-01

Full Text Available Methyl jasmonate (MJ is an important plant growth regulator, involved in plant defense against abiotic stresses, however its possible function in response to metal stress is poorly understood. In the present study, the effect of MJ on physiological and biochemical changes of the plants exposed to arsenic (As stress were investigated in two Brassica napus L. cultivars (ZS 758 – a black seed type, and Zheda 622 – a yellow seed type. The As treatment at 200 µM was more phytotoxic, however its combined application with MJ resulted in significant increase in leaf chlorophyll fluorescence, biomass production and reduced malondialdehyde content compared with As stressed plants. The application of MJ minimized the oxidative stress, as revealed via a lower level of reactive oxygen species (ROS synthesis (H2O2 and OH- in leaves and the maintenance of high redox states of glutathione and ascorbate. Enhanced enzymatic activities and gene expression of important antioxidants (SOD, APX, CAT, POD, secondary metabolites (PAL, PPO, CAD and induction of lypoxygenase gene suggest that MJ plays an effective role in the regulation of multiple transcriptional pathways which were involved in oxidative stress responses. The content of As was higher in yellow seeded plants (cv. Zheda 622 as compared to black seeded plants (ZS 758. The application of MJ significantly reduced the As content in leaves and roots of both cultivars. Findings of the present study reveal that MJ improves ROS scavenging through enhanced antioxidant defense system, secondary metabolite and reduced As contents in both the cultivars.

ANALYSIS OF SEQUENCE POLYMORPHISM OF SCR CLASS I AND II ALLELES AND STUDY REGULATION OF THEIR EXPRESSION

Directory of Open Access Journals (Sweden)

Jana ŽALUDOVÁ

2012-06-01

Full Text Available Self-incompatibility (AI is a widespread mechanism used by flowering plants to prevent inbreeding depression and helps create and maintain genetic diversity within a species. Oilseed rape (Brassica napus L. and especially its modern varieties are characterized by high level of self-fertility. In an effort to increase the production current breeding is focused on the production of inbred lines for making the F1 hybrids and the self-incompatibility can be an interesting tool for production self- sterile lines. In Brassica napus, we found two recessive alleles of a gene SCR II. Different expression of both alleles does not correspond to phenotypic manifestation of self-incompatibility and we can assume that it is prevailed by repressor gene that does not lie on the S-locus. This is also reason, why the SCR gene cannot serve as a molecular marker of self-incompatibility in Brassica napus, although many authors believe that this gene is essential in AI reaction. Brassica napus belong to plants with complex genetic constitution, is composed by two genomes, A and C, which give the possibility of different interactions and makes it difficult to study compared with diploid B. rapa and B. oleracea. In further study it is therefore important to focus on the interactions between genes SCR, SRK and SLG, and their influence on others, such as supressor gene systems.

Construction of chromosome segment substitution lines enables QTL mapping for flowering and morphological traits in Brassica rapa

Directory of Open Access Journals (Sweden)

Xiaonan eLi

2015-06-01

Full Text Available Chromosome segment substitution lines (CSSLs represent a powerful method for precise quantitative trait loci (QTL detection of complex agronomical traits in plants. In this study, we used a marker-assisted backcrossing strategy to develop a population consisting of 63 CSSLs, derived from backcrossing of the F1 generated from a cross between two Brassica rapa subspecies: ‘Chiifu’ (ssp. pekinensis, the Brassica A genome-represented line used as the donor, and ‘49caixin’ (ssp. parachinensis, a non-heading cultivar used as the recipient. The 63 CSSLs covered 87.95% of the B. rapa genome. Among them, 39 lines carried a single segment; 15 lines, two segments; and nine lines, three or more segments of the donor parent chromosomes. To verify the potential advantage of these CSSL lines, we used them to locate QTL for six morphology-related traits. A total of 58 QTL were located on eight chromosomes for all six traits: 17 for flowering time, 14 each for bolting time and plant height, 6 for plant diameter, 2 for leaf width, and 5 for flowering stalk diameter. Co-localized QTL were mainly distributed on eight genomic regions in A01, A02, A05, A06, A08, A09, and A10, present in the corresponding CSSLs. Moreover, new chromosomal fragments that harbored QTL were identified using the findings of previous studies. The CSSL population constructed in our study paves the way for fine mapping and cloning of candidate genes involved in late bolting, flowering, and plant architecture-related traits in B. rapa. Furthermore, it has great potential for future marker-aided gene/QTL pyramiding of other interesting traits in B. rapa breeding.

Effect of rhizobacteria inoculation and humic acid application on canola (Brassica napus L.) crop

International Nuclear Information System (INIS)

Ahmad, S.; Duar, I.; Solaimani, S.G.A.; Mahmood, S.

2016-01-01

This study investigated eco-friendly approach of utilizing plant growth promoting rhizobacteria (PGPR) and humic acid (HA) as bio-stimulants to improve the growth, yield and nutrition of canola (Brassica napus L.). In this study, we isolated 20 indigenous rhizobacterial strains that were subsequently screened and characterized for their plant growth promoting traits. After that one promising PGPR strain identified as Acinetobacter pittii by 16S rRNA gene sequencing was selected for field trial. The field experiment was conducted using RCB design with split-plot arrangement that was replicated four times. Three levels of humic acid (0, 10 and 20 kg ha-1) as main plot factor and two treatments of PGPR (with and without PGPR) as sub-plot factor were used. Data was recorded on plant height (cm), root dry matter plant-1, number of lateral root plant-1, number of pods plant-1, number of seeds pod-1, 1000 seed weight (g), seed yield(kg ha-1), oil content (%), nitrogen (N), phosphorus (P) and potassium (K) contents and uptake. For most of the above mentioned parameters, significant enhancement was observed with the increment of humic acid, and also PGPR treatments were better than their respective control treatments. Maximum values of these parameters were recorded for the interaction of 20 kg HA ha-1 with the PGPR strain. It can be concluded that integrated application of HA and PGPR is a better strategy to improve nutrition and yield of canola. (author)

Effects on Brassica napus L. Yield and Yield Components of Super Absorbent Polymer under Different Irrigation Regimes

Directory of Open Access Journals (Sweden)

Alireza PIRZAD

2014-09-01

Full Text Available For evaluation of the effects of super absorbent polymer under different irrigation regimes on the yield and yield components of Brassica napus L., a factorial experiment was carried out, based on randomized complete block design with four replicas. Treatments included super absorbent polymer (0, 1, 2, 3, 4 and 5 g/kg soil and induced drought stress (irrigation at 25, 50 and 75 mm evaporation from class A pan. The experiment was conducted in pots with 5 kg of soil. Data analysis of variance showed the significant interaction effect between polymer and irrigation on the stem length, width and weight, the number of seeds per sheath, number of seeds per plant, the number of sterile and fertile sheath per plant, fertile sheath percentage (fertile sheath/ total sheath ×100, 1000 seeds weight, seed weight per plant, sheath weight per plant and the number of total sheath. The present study revealed that indifferent from the applied amounts of the super absorbent polymer, in all cases the measured characters have been more affected by induced drought stress.

Estimation of heritability of the nectar guide of flowers in Brassica rapa L

International Nuclear Information System (INIS)

Syafaruddin; Kobayashi, K.; Yoshioka, Y.; Horisaki, A.; Niikura, S.

2006-01-01

Flowers of Brassica rapa L, produce a nectar guide, which consists of a coloured pattern (the dark, UV-absorbing centre of the flower) invisible to humans but visible to insect pollinators. As a result, the colour of the flowers typically appears as uniform light yellow to human eyes. The objective of the present study was to investigate the mode of inheritance of this character by using two inbred lines and their Fsub(1), Fsub(2) and Fsub(3) progenies with a view to improving this character. After digitizing UV-photographs of each flower, we measured the UV-absorbing area (UVA) and the total flower area (FA), based on image analysis. The ratio of UVA to FA represented the UV colour proportion (UVP). We estimated the broad-sense and narrow-sense heritabilities from within-generation variances in the UVP scores and environmental variance from the average value of the variances in the parental lines. The value of broad-sense heritability of UVP was high (0.75) in the Fsub(2) generation (hBsup2[Fsub(2)]) and higher (0.84) in the Fsub(3) generation (hBsup2[Fsub(3)]), indicating that UVP is a heritable character. Moreover, the high value of broad-sense heritability of UVP indicates that breeders have not focused their selection intentionally on this character in B. rapa. In contrast, the value of narrow-sense heritability was much lower: 0.12 (hBsup2[Fsub(2)]) and 0.24 (hBsup2[Fsub(3)]), respectively, suggesting that the genetic variation in UVP was mainly due to dominance effects. If we attempt to breed new lines with larger or smaller UVP values, we need to select this trait in advanced generations, in which additive effects become larger

Diversity and Genome Analysis of Australian and Global Oilseed Brassica napus L. Germplasm Using Transcriptomics and Whole Genome Re-sequencing

Directory of Open Access Journals (Sweden)

M. Michelle Malmberg

2018-04-01

Full Text Available Intensive breeding of Brassica napus has resulted in relatively low diversity, such that B. napus would benefit from germplasm improvement schemes that sustain diversity. As such, samples representative of global germplasm pools need to be assessed for existing population structure, diversity and linkage disequilibrium (LD. Complexity reduction genotyping-by-sequencing (GBS methods, including GBS-transcriptomics (GBS-t, enable cost-effective screening of a large number of samples, while whole genome re-sequencing (WGR delivers the ability to generate large numbers of unbiased genomic single nucleotide polymorphisms (SNPs, and identify structural variants (SVs. Furthermore, the development of genomic tools based on whole genomes representative of global oilseed diversity and orientated by the reference genome has substantial industry relevance and will be highly beneficial for canola breeding. As recent studies have focused on European and Chinese varieties, a global diversity panel as well as a substantial number of Australian spring types were included in this study. Focusing on industry relevance, 633 varieties were initially genotyped using GBS-t to examine population structure using 61,037 SNPs. Subsequently, 149 samples representative of global diversity were selected for WGR and both data sets used for a side-by-side evaluation of diversity and LD. The WGR data was further used to develop genomic resources consisting of a list of 4,029,750 high-confidence SNPs annotated using SnpEff, and SVs in the form of 10,976 deletions and 2,556 insertions. These resources form the basis of a reliable and repeatable system allowing greater integration between canola genomics studies, with a strong focus on breeding germplasm and industry applicability.

Cultivar Variation in Hormonal Balance Is a Significant Determinant of Disease Susceptibility to Xanthomonas campestris pv. campestris in Brassica napus

Directory of Open Access Journals (Sweden)

Md. Tabibul Islam

2017-12-01

Full Text Available This study aimed to directly elucidate cultivar variation in disease susceptibility and disease responses in relation to hormonal status in the interaction of Brassica napus cultivars and Xanthomonas campestris pv. campestris (Xcc, the causal agent of black rot disease. Fully expanded leaves of six B. napus cultivars (cvs. Capitol, Youngsan, Saturnin, Colosse, Tamra, and Mosa were inoculated with Xcc. At 14 days post-inoculation with Xcc, cultivar variation in susceptibility or resistance was interpreted with defense responses as estimated by redox status, defensive metabolites, and expression of phenylpropanoid synthesis-related genes in relation to endogenous hormonal status. Disease susceptibility of six cultivars was distinguished by necrotic lesions in the Xcc-inoculated leaves and characterized concurrently based on the higher increase in reactive oxygen species and lipid peroxidation. Among these cultivars, as the susceptibility was higher, the ratios of abscisic acid (ABA/jasmonic acid (JA and salicylic acid (SA/JA tended to increase with enhanced expression of SA signaling regulatory gene NPR1 and transcriptional factor TGA1 and antagonistic suppression of JA-regulated gene PDF 1.2. In the resistant cultivar (cv. Capitol, accumulation of defensive metabolites with enhanced expression of genes involved in flavonoids (chalcone synthase, proanthocyanidins (anthocyanidin reductase, and hydroxycinnamic acids (ferulate-5-hydroxylase biosynthesis and higher redox status were observed, whereas the opposite results were obtained for susceptible cultivars (cvs. Mosa and Tamra. These results clearly indicate that cultivar variation in susceptibility to infection by Xcc was determined by enhanced alteration of the SA/JA ratio, as a negative regulator of redox status and phenylpropanoid synthesis in the Brasica napus–Xcc pathosystem.

Role of nitric oxide in cadmium-induced stress on growth, photosynthetic components and yield of Brassica napus L.

Science.gov (United States)

Jhanji, Shalini; Setia, R C; Kaur, Navjyot; Kaur, Parminder; Setia, Neelam

2012-11-01

Experiments were carried out to study the effect of cadmium (Cd) and exogenous nitric oxide (NO) on growth, photosynthetic attributes, yield components and structural features of Brassica napus L. (cv. GSL 1). Cadmium in the growth medium at different levels (1, 2 and 4 Mm) retarded plant growth viz. shoot (27%) and root (51%) length as compared to control. The accumulation of total dry matter and its partitioning to different plant parts was also reduced by 31% due to Cd toxicity. Photosynthetic parameters viz., leaf area plant(-1) (51%), total Chl (27%), Chl a / Chl b ratio (22%) and Hill reaction activity of chloroplasts (42%) were greatly reduced in Cd-treated plants. Cd treatments adversely affected various yield parameters viz., number of branches (23) and siliquae plant(-1) (246), seed number siliqua(-1) (10.3), 1000-seed weight (2.30g) and seed yield plant(-1) (7.09g). Different Cd treatments also suppressed the differentiation of various tissues like vessels in the root with a maximum inhibition caused by 4mM Cd. Exogenous application of nitric oxide (NO) improved the various morpho-physiological and photosynthetic parameters in control as well as Cd-treated plants.

Identification of QTLs for resistance to sclerotinia stem rot and BnaC.IGMT5.a as a candidate gene of the major resistant QTL SRC6 in Brassica napus.

Directory of Open Access Journals (Sweden)

Jian Wu

Full Text Available Stem rot caused by Sclerotinia sclerotiorum in many important dicotyledonous crops, including oilseed rape (Brassica napus, is one of the most devastating fungal diseases and imposes huge yield loss each year worldwide. Currently, breeding for Sclerotinia resistance in B. napus, as in other crops, can only rely on germplasms with quantitative resistance genes. Thus, the identification of quantitative trait locus (QTL for S. sclerotiorum resistance/tolerance in this crop holds immediate promise for the genetic improvement of the disease resistance. In this study, ten QTLs for stem resistance (SR at the mature plant stage and three QTLs for leaf resistance (LR at the seedling stage in multiple environments were mapped on nine linkage groups (LGs of a whole genome map for B. napus constructed with SSR markers. Two major QTLs, LRA9 on LG A9 and SRC6 on LG C6, were repeatedly detected across all environments and explained 8.54-15.86% and 29.01%-32.61% of the phenotypic variations, respectively. Genotypes containing resistant SRC6 or LRA9 allele showed a significant reduction in disease lesion after pathogen infection. Comparative mapping with Arabidopsis and data mining from previous gene profiling experiments identified that the Arabidopsis homologous gene of IGMT5 (At1g76790 was related to the SRC6 locus. Four copies of the IGMT5 gene in B. napus were isolated through homologous cloning, among which, only BnaC.IGMT5.a showed a polymorphism between parental lines and can be associated with the SRC6. Furthermore, two parental lines exhibited a differential expression pattern of the BnaC.IGMT5.a gene in responding to pathogen inoculation. Thus, our data suggested that BnaC.IGMT5.a was very likely a candidate gene of this major resistance QTL.

MATERNAL EFFECTS IN ADVANCED HYBRIDS OF GENETICALLY MODIFIED AND NON-GENETICALLY MODIFIED BRASSICA SPECIES

Science.gov (United States)

Identification of fitness traits potentially impacted by gene flow from genetically modified (GM) crops to compatible relatives is of interest in risk assessments for GM crops. Reciprocal crosses were made between GM canola, Brassica napus cv. RaideRR that expresses CP4 EPSPS fo...

Response to multi-generational selection under elevated [CO2] in two temperature regimes suggests enhanced carbon assimilation and increased reproductive output in Brassica napus L

DEFF Research Database (Denmark)

Frenck, Georg; van der Linden, Leon; Mikkelsen, Teis Nørgaard

2013-01-01

different temperature regimes. To reveal phenotypic divergence at the manipulated [CO2] and temperature conditions, a full-factorial natural selection regime was established in a phytotron environment over the range of four generations. It is demonstrated that a directional response to selection at elevated......Functional plant traits are likely to adapt under the sustained pressure imposed by environmental changes through natural selection. Employing Brassica napus as a model, a multi-generational study was performed to investigate the potential trajectories of selection at elevated [CO2] in two...... subjected to increased levels of CO2 over the generational range investigated. The results of this study suggest that phenotypic divergence of plants selected under elevated atmospheric CO2 concentration may drive the future functions of plant productivity to be different from projections that do...

Properties of a membrane-bound triglyceride lipase of rapeseed (Brassica napus L.) cotyledons.

Science.gov (United States)

Rosnitschek, I; Theimer, R R

1980-04-01

The properties of the alkaline lipase activity (EC 3.1.1.3) that was recovered almost completely from a microsomal membrane fraction of 4-d-old rapeseed (Brassica napus L.) cotyledons were studied employing a titrimetric test procedure. The apparent KM was 6.5 mmol l(-1), with emulgated sunflower oil as the substrate. The products of triglyceride hydrolysis in vitro were glycerol, free fatty acids, and minor amounts of mono- and diglycerides. Maximum lipase activity depended on the preincubation of the lipolytic membrane fraction in 0.15 mol l(-1) NaCl and on the presence of at least 0.1 mol l(-1) NaCl in the test mixture. Desoxycholate and up to 0.1 mol l(-1) CaCl2 also activated the enzyme while EDTA and detergents such as trito x-100, digitonin, tween 85, and sodium dodecylsulfate were inhibitory. The rapeseed lipase displayed a conspicuous substrate selectivity among different plant triglycerides; the activity was inversely correlated with the oleic acid content of the oils. Water-soluble triacetin and the phospholipid lecithin were not hydrolyzed. Increasing amounts of free fatty acids reduced lipase activity; erucic acid, a major component of rapeseed oil, exhibited the strongest effect, suggesting a possible role in the regulation of lipase activity in vivo. The data demonstrate that the lipolytic membrane fraction houses a triglyceride lipase with properties similar to other plant and animal lipases. It can both qualitatively and quantitatively account for the fat degradation in rapeseed cotyledons. The evidence that provides further reason to acknowledge the membranous appendices of the spherosomes as the intracellular site of lipolysis is discussed.

Say it with flowers: Flowering acceleration by root communication

OpenAIRE

Falik, Omer; Hoffmann, Ishay; Novoplansky, Ariel

2014-01-01

The timing of reproduction is a critical determinant of fitness, especially in organisms inhabiting seasonal environments. Increasing evidence suggests that inter-plant communication plays important roles in plant functioning. Here, we tested the hypothesis that flowering coordination can involve communication between neighboring plants. We show that soil leachates from Brassica rapa plants growing under long-day conditions accelerated flowering and decreased allocation to vegetative organs i...

Genomic change, retrotransposon mobilization and extensive cytosine methylation alteration in Brassica napus introgressions from two intertribal hybridizations.

Science.gov (United States)

Zhang, Xueli; Ge, Xianhong; Shao, Yujiao; Sun, Genlou; Li, Zaiyun

2013-01-01

Hybridization and introgression represent important means for the transfer and/or de novo origination of traits and play an important role in facilitating speciation and plant breeding. Two sets of introgression lines in Brassica napus L. were previously established by its intertribal hybridizations with two wild species and long-term selection. In this study, the methods of amplified fragment length polymorphisms (AFLP), sequence-specific amplification polymorphism (SSAP) and methylation-sensitive amplified polymorphism (MSAP) were used to determine their genomic change, retrotransposon mobilization and cytosine methylation alteration in these lines. The genomic change revealed by the loss or gain of AFLP bands occurred for ∼10% of the total bands amplified in the two sets of introgressions, while no bands specific for wild species were detected. The new and absent SSAP bands appeared for 9 out of 11 retrotransposons analyzed, with low frequency of new bands and their total percentage of about 5% in both sets. MSAP analysis indicated that methylation changes were common in these lines (33.4-39.8%) and the hypermethylation was more frequent than hypomethylation. Our results suggested that certain extents of genetic and epigenetic alterations were induced by hybridization and alien DNA introgression. The cryptic mechanism of these changes and potential application of these lines in breeding were also discussed.

Cadmium stress alters the redox reaction and hormone balance in oilseed rape (Brassica napus L.) leaves.

Science.gov (United States)

Yan, Hui; Filardo, Fiona; Hu, Xiaotao; Zhao, Xiaomin; Fu, DongHui

2016-02-01

In order to understand the physiological response of oilseed rape (Brassica napus L.) leaves to cadmium (Cd) stress and exploit the physiological mechanisms involved in Cd tolerance, macro-mineral and chlorophyll concentrations, reactive oxygen species (ROS) accumulation, activities of enzymatic antioxidants, nonenzymatic compounds metabolism, endogenous hormonal changes, and balance in leaves of oilseed rape exposed to 0, 100, or 200 μM CdSO4 were investigated. The results showed that under Cd exposure, Cd concentrations in the leaves continually increased while macro-minerals and chlorophyll concentrations decreased significantly. Meanwhile, with increased Cd stress, superoxide anion (O2(• -)) production rate and hydrogen peroxide (H2O2) concentrations in the leaves increased significantly, which caused malondialdehyde (MDA) accumulation and oxidative stress. For scavenging excess accumulated ROS and alleviating oxidative injury in the leaves, the activity of enzymatic antioxidants, such as superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), was increased significantly at certain stress levels. However, with increased Cd stress, the antioxidant enzyme activities all showed a trend towards reduction. The nonenzymatic antioxidative compounds, such as proline and total soluble sugars, accumulated continuously with increased Cd stress to play a long-term role in scavenging ROS. In addition, ABA levels also increased continuously with Cd stress while ZR decreased and the ABA/ZR ratio increased, which might also be providing a protective role against Cd toxicity.

Evaluating relative contribution of osmotolerance and tissue tolerance mechanisms toward salinity stress tolerance in three Brassica species.

Science.gov (United States)

Chakraborty, Koushik; Bose, Jayakumar; Shabala, Lana; Eyles, Alieta; Shabala, Sergey

2016-10-01

Three different species of Brassica, with differential salt sensitivity were used to understand physiological mechanisms of salt tolerance operating in these species and to evaluate the relative contribution of different strategies to cope with salt load. Brassica napus was the most tolerant species in terms of the overall performance, with Brassica juncea and Brassica oleracea being much more sensitive to salt stress with no obvious difference between them. While prominent reduction in net CO2 assimilation was observed in both sensitive species, physiological mechanisms beyond this reduction differed strongly. Brassica juncea plants possessed high osmotolerance and were able to maintain high transpiration rate but showed a significant reduction in leaf chlorophyll content and efficiency of leaf photochemistry. On the contrary, B. oleracea plants possessed the highest (among the three species) tissue tolerance but showed a very significant stomatal limitation of photosynthesis. Electrophysiological experiments revealed that the high tissue tolerance in B. oleracea was related to the ability of leaf mesophyll cells to maintain highly negative membrane potential in the presence of high apoplastic Na(+) . In addition to high osmotolerance, the most tolerant B. napus showed also lesser accumulation of toxic Na(+) and Cl(-) in the leaf, possessed moderate tissue tolerance and had a superior K(+) retention ability. Taken together, the results from this study indicate that the three Brassica species employ very different mechanisms to cope with salinity and, despite its overall sensitivity to salinity, B. oleracea could be recommended as a valuable 'donor' of tissue tolerance genes to confer this trait for marker-assisted breeding programs. © 2016 Scandinavian Plant Physiology Society.

Refined global methyl halide budgets with respect to rapeseed (Brassica napus) by life-cycle measurements

Science.gov (United States)

Jiao, Y.; Acdan, J.; Xu, R.; Deventer, M. J.; Rhew, R. C.

2017-12-01

A precise quantification of global methyl halide budgets is needed to evaluate the ozone depletion potential of these compounds and to predict future changes of stratospheric ozone. However, the global budgets of methyl halides are not balanced between currently identified and quantified sources and sinks. Our study re-evaluated the methyl bromide budget from global cultivated rapeseed (Brassica napus) through life-cycle flux measurements both in the greenhouse and in the field, yielding a methyl bromide emission rate that scales globally to 1.0 - 1.2 Gg yr-1. While this indicates a globally significant source, it is much smaller than the previously widely cited value of 5 - 6 Gg yr-1(Mead et al., 2008), even taking into account the near tripling of annual global yield of rapeseed since the previous evaluation was conducted. Our study also evaluated the methyl chloride and methyl iodide emission levels from rapeseed, yielding emission rates that scale to 5.4 Gg yr-1 for methyl chloride and 1.8 Gg yr-1 of methyl iodide. The concentrations of the methyl donor SAM (S-adenosyl methionine) and the resultant product SAH (S-Adenosyl-L-homocysteine) were also analyzed to explore their role in biogenic methyl halide formation. Halide gradient incubations showed that the magnitude of methyl halide emissions from rapeseed is highly correlated to soil halide levels, thus raising the concern that the heterogeneity of soil halide contents geographically should be considered when extrapolating to global budget.

Use of Plackett-Burman design for rapid screening of nitrogen and carbon sources for the production of lipase in solid state fermentation by Yarrowia lipolytica from mustard oil cake (Brassica napus

Directory of Open Access Journals (Sweden)

Sarat Babu Imandi

2013-09-01

Full Text Available Mustard oil cake (Brassica napus, the residue obtained after extraction of mustard oil from mustard oil seeds, was investigated for the production of lipase under solid state fermentation (SSF using the marine yeast Yarrowia lipolytica NCIM 3589. Process parameters such as incubation time, biomass concentration, initial moisture content, carbon source concentration and nitrogen source concentration of the medium were optimized. Screening of ten nitrogen and five carbon sources has been accomplished with the help of Plackett-Burman design. The highest lipase activity of 57.89 units per gram of dry fermented substrate (U/gds was observed with the substrate of mustard oil cake in four days of fermentation.

Irradiation effect on the seed vigor, SOD activity and MDA content in germinating seeds of yellow-seeded and black-seeded rape seed (Brassica napus L.)

International Nuclear Information System (INIS)

Han Jixiang; Hu Danhong; Liu Houli

1993-01-01

Seeds of a set of near-isogenic lines (Brassica napus L.) with different seed coat color from yellow to black were irradiated by 60 Co γ-rays of 150 krad. Seed vigor, superoxide dismutase (SOD) and malondialdehyde (MDA) in germinating seeds were analysed. In these characters, no significant difference between yellow-seeded lines (YLs) and black-seeded lines (BLs) showed before irradiation. But after irradiation, SOD activity in YLs was lower than that in BLs. While MDA content in YLs was obviously higher that that in DLs. As a result of irradiation, seed vigor of YLs was lower than that in BLs. these results indicated that the irradiation resistance of rape seed was related to the level of SOD as well as protective structure or substances in seed coat and that the radiosensitivity of YLs was higher than that of DLs

Difference in root K+ retention ability and reduced sensitivity of K+-permeable channels to reactive oxygen species confer differential salt tolerance in three Brassica species.

Science.gov (United States)

Chakraborty, Koushik; Bose, Jayakumar; Shabala, Lana; Shabala, Sergey

2016-08-01

Brassica species are known to possess significant inter and intraspecies variability in salinity stress tolerance, but the cell-specific mechanisms conferring this difference remain elusive. In this work, the role and relative contribution of several key plasma membrane transporters to salinity stress tolerance were evaluated in three Brassica species (B. napus, B. juncea, and B. oleracea) using a range of electrophysiological assays. Initial root growth assay and viability staining revealed that B. napus was most tolerant amongst the three species, followed by B. juncea and B. oleracea At the mechanistic level, this difference was conferred by at least three complementary physiological mechanisms: (i) higher Na(+) extrusion ability from roots resulting from increased expression and activity of plasma membrane SOS1-like Na(+)/H(+) exchangers; (ii) better root K(+) retention ability resulting from stress-inducible activation of H(+)-ATPase and ability to maintain more negative membrane potential under saline conditions; and (iii) reduced sensitivity of B. napus root K(+)-permeable channels to reactive oxygen species (ROS). The last two mechanisms played the dominant role and conferred most of the differential salt sensitivity between species. Brassica napus plants were also more efficient in preventing the stress-induced increase in GORK transcript levels and up-regulation of expression of AKT1, HAK5, and HKT1 transporter genes. Taken together, our data provide the mechanistic explanation for differential salt stress sensitivity amongst these species and shed light on transcriptional and post-translational regulation of key ion transport systems involved in the maintenance of the root plasma membrane potential and cytosolic K/Na ratio as a key attribute for salt tolerance in Brassica species. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Genomic change, retrotransposon mobilization and extensive cytosine methylation alteration in Brassica napus introgressions from two intertribal hybridizations.

Directory of Open Access Journals (Sweden)

Xueli Zhang

Full Text Available Hybridization and introgression represent important means for the transfer and/or de novo origination of traits and play an important role in facilitating speciation and plant breeding. Two sets of introgression lines in Brassica napus L. were previously established by its intertribal hybridizations with two wild species and long-term selection. In this study, the methods of amplified fragment length polymorphisms (AFLP, sequence-specific amplification polymorphism (SSAP and methylation-sensitive amplified polymorphism (MSAP were used to determine their genomic change, retrotransposon mobilization and cytosine methylation alteration in these lines. The genomic change revealed by the loss or gain of AFLP bands occurred for ∼10% of the total bands amplified in the two sets of introgressions, while no bands specific for wild species were detected. The new and absent SSAP bands appeared for 9 out of 11 retrotransposons analyzed, with low frequency of new bands and their total percentage of about 5% in both sets. MSAP analysis indicated that methylation changes were common in these lines (33.4-39.8% and the hypermethylation was more frequent than hypomethylation. Our results suggested that certain extents of genetic and epigenetic alterations were induced by hybridization and alien DNA introgression. The cryptic mechanism of these changes and potential application of these lines in breeding were also discussed.

Wastewater impact on physiology, biomass and yield of canola (brassica napus L.)

International Nuclear Information System (INIS)

Khan, I.U.; Khan, M.J.

2012-01-01

The impact of domestic/municipal wastewater (mww) of Dera Ismail Khan, Pakistan was assessed through its effects on biomass, physiology and yield of canola (Brassica napus L.). The pot experiments were conducted in a completely randomized design with three replications in net house during winter season 2006-07 and 2007-08 at Gomal University, Dera Ismail Khan, Pakistan. Treatments included were T0 (tube well/tap water), T/sub 1/ (20% mww), T/sub 2/ (40% mww), T/sub 3/ (80% mww) and T/sub 4/ (100% mww/raw-form municipal wastewater). The quality and chemical composition of wastewater was deviating from international (Anon., 1985) as well as NEQS (2005) standard. Analysis of wastewater showed that biochemical oxygen demand (BOD), chemical oxygen demand (COD), sodium adsorption ratio (SAR) and total suspended solids (TSS) were above the permissible limit of irrigation. In pods per plant, the reduction was 61.55% by recording 110 pods per plant with T/sub 4/ (100% mww) as compared to control T0 (286.1 pods per plant). Similarly pod length (reduced by 59.72%), seeds per pod (reduced by 42.53%), Seeds per plant (reduced by 82%), seed weight per plant (reduced by 88%), 100-seed weight (reduced by 19.54%) and straw yield (reduced by 54.23%) were significantly reduced by applying 100% wastewater. The most affected yield contributing traits were seeds per plant and seed weight per plant with 82% and 88% reduction, respectively due to T/sub 4/ (100% mww). On average, the decrease was 60% in the first stage and a further decrement of 4.83% was observed when the obtained seeds were re-sown in 2007-08. Results revealed that utilizing municipal wastewater of the area under investigation for irrigation purpose of food and feed crops might not be safe. The major reason seems to be the high salinity and sodium adsorption ratio that restricted crop growth and yield. (author)

Genome-wide microsatellite characterization and marker development in the sequenced Brassica crop species.

Science.gov (United States)

Shi, Jiaqin; Huang, Shunmou; Zhan, Jiepeng; Yu, Jingyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

2014-02-01

Although much research has been conducted, the pattern of microsatellite distribution has remained ambiguous, and the development/utilization of microsatellite markers has still been limited/inefficient in Brassica, due to the lack of genome sequences. In view of this, we conducted genome-wide microsatellite characterization and marker development in three recently sequenced Brassica crops: Brassica rapa, Brassica oleracea and Brassica napus. The analysed microsatellite characteristics of these Brassica species were highly similar or almost identical, which suggests that the pattern of microsatellite distribution is likely conservative in Brassica. The genomic distribution of microsatellites was highly non-uniform and positively or negatively correlated with genes or transposable elements, respectively. Of the total of 115 869, 185 662 and 356 522 simple sequence repeat (SSR) markers developed with high frequencies (408.2, 343.8 and 356.2 per Mb or one every 2.45, 2.91 and 2.81 kb, respectively), most represented new SSR markers, the majority had determined physical positions, and a large number were genic or putative single-locus SSR markers. We also constructed a comprehensive database for the newly developed SSR markers, which was integrated with public Brassica SSR markers and annotated genome components. The genome-wide SSR markers developed in this study provide a useful tool to extend the annotated genome resources of sequenced Brassica species to genetic study/breeding in different Brassica species.

Tolerance of transgenic canola plants (Brassica napus) amended with plant growth-promoting bacteria to flooding stress at a metal-contaminated field site

International Nuclear Information System (INIS)

Farwell, Andrea J.; Vesely, Susanne; Nero, Vincent; Rodriguez, Hilda; McCormack, Kimberley; Shah, Saleh; Dixon, D. George; Glick, Bernard R.

2007-01-01

The growth of transgenic canola (Brassica napus) expressing a gene for the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase was compared to non-transformed canola exposed to flooding and elevated soil Ni concentration, in situ. In addition, the ability of the plant growth-promoting bacterium Pseudomonas putida UW4, which also expresses ACC deaminase, to facilitate the growth of non-transformed and transgenic canola under the above mentioned conditions was examined. Transgenic canola and/or canola treated with P. putida UW4 had greater shoot biomass compared to non-transformed canola under low flood-stress conditions. Under high flood-stress conditions, shoot biomass was reduced and Ni accumulation was increased in all instances relative to low flood-stress conditions. This is the first field study to document the increase in plant tolerance utilizing transgenic plants and plant growth-promoting bacteria exposed to multiple stressors. - Using transgenic plants and plant growth-promoting bacteria as phytoremediation methods increased plant tolerance at a metal-contaminated field site under low flood conditions

Modification of "1"3"7Cs transfer to rape (Brassica napus L.) phytomass under the influence of soil microorganisms

International Nuclear Information System (INIS)

Pareniuk, O.; Shavanova, K.; Laceby, J.P.; Illienko, V.; Tytova, L.; Levchuk, S.; Gudkov, I.; Nanba, K.

2015-01-01

After nuclear accidents, such as those experienced in Chernobyl and Fukushima, microorganisms may help purify contaminated soils by changing the mobility of radionuclides and their availability for plants by altering the physical and chemical properties of the substrate. Here, using model experiments with quartz sand as a substrate we investigate the influence of microorganisms on "1"3"7Cs transfer from substrate to plants. The highest transition of "1"3"7Cs from substrate to plants (50% increase compared to the control) was observed after Brassica napus L. seeds were inoculated by Azotobacter chroococcum. The best results for reducing the accumulation of "1"3"7Cs radionuclides (30% less) were noted after the inoculation by Burkholderia sp.. Furthermore, Bacillus megaterium demonstrated an increased ability to accumulate "1"3"7Cs. This research improves our prediction of the behavior of radionuclides in soil and may contribute towards new, microbiological countermeasures for soil remediation following nuclear accidents. - Highlights: • Representatives of soil bacteria can alter "1"3"7Cs soil-to-plant transfer factor. • This ability does not depend on the localization of bacteria on the root surface. • Selection of bacteria to increase or decrease the "1"3"7Cs transfer factor is possible.

Say it with flowers: Flowering acceleration by root communication.

Science.gov (United States)

Falik, Omer; Hoffmann, Ishay; Novoplansky, Ariel

2014-01-01

The timing of reproduction is a critical determinant of fitness, especially in organisms inhabiting seasonal environments. Increasing evidence suggests that inter-plant communication plays important roles in plant functioning. Here, we tested the hypothesis that flowering coordination can involve communication between neighboring plants. We show that soil leachates from Brassica rapa plants growing under long-day conditions accelerated flowering and decreased allocation to vegetative organs in target plants growing under non-inductive short-day conditions. The results suggest that besides endogenous signaling and external abiotic cues, flowering timing may involve inter-plant communication, mediated by root exudates. The study of flowering communication is expected to illuminate neglected aspects of plant reproductive interactions and to provide novel opportunities for controlling the timing of plant reproduction in agricultural settings.

Centromere Locations in Brassica A and C Genomes Revealed Through Half-Tetrad Analysis.

Science.gov (United States)

Mason, Annaliese S; Rousseau-Gueutin, Mathieu; Morice, Jérôme; Bayer, Philipp E; Besharat, Naghmeh; Cousin, Anouska; Pradhan, Aneeta; Parkin, Isobel A P; Chèvre, Anne-Marie; Batley, Jacqueline; Nelson, Matthew N

2016-02-01

Locating centromeres on genome sequences can be challenging. The high density of repetitive elements in these regions makes sequence assembly problematic, especially when using short-read sequencing technologies. It can also be difficult to distinguish between active and recently extinct centromeres through sequence analysis. An effective solution is to identify genetically active centromeres (functional in meiosis) by half-tetrad analysis. This genetic approach involves detecting heterozygosity along chromosomes in segregating populations derived from gametes (half-tetrads). Unreduced gametes produced by first division restitution mechanisms comprise complete sets of nonsister chromatids. Along these chromatids, heterozygosity is maximal at the centromeres, and homologous recombination events result in homozygosity toward the telomeres. We genotyped populations of half-tetrad-derived individuals (from Brassica interspecific hybrids) using a high-density array of physically anchored SNP markers (Illumina Brassica 60K Infinium array). Mapping the distribution of heterozygosity in these half-tetrad individuals allowed the genetic mapping of all 19 centromeres of the Brassica A and C genomes to the reference Brassica napus genome. Gene and transposable element density across the B. napus genome were also assessed and corresponded well to previously reported genetic map positions. Known centromere-specific sequences were located in the reference genome, but mostly matched unanchored sequences, suggesting that the core centromeric regions may not yet be assembled into the pseudochromosomes of the reference genome. The increasing availability of genetic markers physically anchored to reference genomes greatly simplifies the genetic and physical mapping of centromeres using half-tetrad analysis. We discuss possible applications of this approach, including in species where half-tetrads are currently difficult to isolate. Copyright © 2016 by the Genetics Society of America.

Transcriptome profile analysis of young floral buds of fertile and sterile plants from the self-pollinated offspring of the hybrid between novel restorer line NR1 and Nsa CMS line in Brassica napus

Directory of Open Access Journals (Sweden)

Yan Xiaohong

2013-01-01

Full Text Available Abstract Background The fertile and sterile plants were derived from the self-pollinated offspring of the F1 hybrid between the novel restorer line NR1 and the Nsa CMS line in Brassica napus. To elucidate gene expression and regulation caused by the A and C subgenomes of B. napus, as well as the alien chromosome and cytoplasm from Sinapis arvensis during the development of young floral buds, we performed a genome-wide high-throughput transcriptomic sequencing for young floral buds of sterile and fertile plants. Results In this study, equal amounts of total RNAs taken from young floral buds of sterile and fertile plants were sequenced using the Illumina/Solexa platform. After filtered out low quality data, a total of 2,760,574 and 2,714,441 clean tags were remained in the two libraries, from which 242,163 (Ste and 253,507 (Fer distinct tags were obtained. All distinct sequencing tags were annotated using all possible CATG+17-nt sequences of the genome and transcriptome of Brassica rapa and those of Brassica oleracea as the reference sequences, respectively. In total, 3231 genes of B. rapa and 3371 genes of B. oleracea were detected with significant differential expression levels. GO and pathway-based analyses were performed to determine and further to understand the biological functions of those differentially expressed genes (DEGs. In addition, there were 1089 specially expressed unknown tags in Fer, which were neither mapped to B. oleracea nor to B. rapa, and these unique tags were presumed to arise basically from the added alien chromosome of S. arvensis. Fifteen genes were randomly selected and their expression levels were confirmed by quantitative RT-PCR, and fourteen of them showed consistent expression patterns with the digital gene expression (DGE data. Conclusions A number of genes were differentially expressed between the young floral buds of sterile and fertile plants. Some of these genes may be candidates for future research on CMS in

Transcriptome profile analysis of young floral buds of fertile and sterile plants from the self-pollinated offspring of the hybrid between novel restorer line NR1 and Nsa CMS line in Brassica napus.

Science.gov (United States)

Yan, Xiaohong; Dong, Caihua; Yu, Jingyin; Liu, Wanghui; Jiang, Chenghong; Liu, Jia; Hu, Qiong; Fang, Xiaoping; Wei, Wenhui

2013-01-16

The fertile and sterile plants were derived from the self-pollinated offspring of the F1 hybrid between the novel restorer line NR1 and the Nsa CMS line in Brassica napus. To elucidate gene expression and regulation caused by the A and C subgenomes of B. napus, as well as the alien chromosome and cytoplasm from Sinapis arvensis during the development of young floral buds, we performed a genome-wide high-throughput transcriptomic sequencing for young floral buds of sterile and fertile plants. In this study, equal amounts of total RNAs taken from young floral buds of sterile and fertile plants were sequenced using the Illumina/Solexa platform. After filtered out low quality data, a total of 2,760,574 and 2,714,441 clean tags were remained in the two libraries, from which 242,163 (Ste) and 253,507 (Fer) distinct tags were obtained. All distinct sequencing tags were annotated using all possible CATG+17-nt sequences of the genome and transcriptome of Brassica rapa and those of Brassica oleracea as the reference sequences, respectively. In total, 3231 genes of B. rapa and 3371 genes of B. oleracea were detected with significant differential expression levels. GO and pathway-based analyses were performed to determine and further to understand the biological functions of those differentially expressed genes (DEGs). In addition, there were 1089 specially expressed unknown tags in Fer, which were neither mapped to B. oleracea nor to B. rapa, and these unique tags were presumed to arise basically from the added alien chromosome of S. arvensis. Fifteen genes were randomly selected and their expression levels were confirmed by quantitative RT-PCR, and fourteen of them showed consistent expression patterns with the digital gene expression (DGE) data. A number of genes were differentially expressed between the young floral buds of sterile and fertile plants. Some of these genes may be candidates for future research on CMS in Nsa line, fertility restoration and improved agronomic

The responses of crop - wild Brassica hybrids to simulated herbivory and interspecific competition: implications for transgene introgression.

Science.gov (United States)

Sutherland, Jamie P; Justinova, Lenka; Poppy, Guy M

2006-01-01

Brassica rapa grows as a wild and weedy species throughout the world and is the most likely recipient of transgenes from GM oilseed rape. For transgene introgression to occur, the critical step which must be realized, is the formation of an F1 hybrid. Concerns exist that hybrid populations could be more vigorous and competitive compared to the parental species. This study examines the effect of simulated herbivory and interspecific competition on the vegetative and reproductive performance of non-transgenic F1 hybrids and their parental lines. Several vegetative and reproductive performance measures were used to determine the effect of simulated herbivory and competition on the Brassica lines, including leaf length and biomass for herbivory and seedling height and biomass for competition. For defoliation experiments, B. rapa showed little response in terms of leaf length but B. napus and the F1 hybrid responded negatively. Brassica rapa showed elevated biomass responses, but B. napus and the hybrid demonstrated negative responses to defoliation. Defoliation at the cotyledon stage had a slight effect upon final biomass with the F1 hybrid performing significantly worse than B. napus, although seed counts were not significantly different. For the series of competition experiments, hybrids seemed to be more similar to B. rapa in terms of early seedling growth and reproductive measures. The underperformance of hybrid plants when challenged by herbivory and competition, could potentially decrease survivorship and explain the rarity of hybrids in field surveys. However, should transgene introgression occur, the dynamics of hybrids could change radically thus increasing the risk of gene flow from a transgenic oilseed rape crop to the wild recipient.

of integrated application of farmyard manure, plant growth promoting rhizobacteria and chemical fertilizers on production of canola (Brassica napus L. in saline soil of Qum

Directory of Open Access Journals (Sweden)

H. Sabahi

2016-04-01

Full Text Available Canola (Brassica napus L. is one of the most important oil seed crops. In order to evaluate the effects of integrated fertilization (chemical, manure and biofertilizers on canola (B. napus variety Hyola 401 yield and uptake of mineral nutrients in saline soil and water, a field experiment was conducted in randomized complete blocks (RCBD arrangement with eight treatments in three replications in Qum Province, Iran. Treatments were: (1 Control, P%100 (Phosphorus %100, (2 P%75B1 (Phosphorus %75+ Barvar biofertilizer, (3 P%75B2 (Phosphorus %75+ Nitroxin biofertilizer, (4 P%75M (Phosphorus %75+ farmyard manure, (5 P%75B1M (Phosphorus %75+ Barvar + Farmyard manure, (6 P%75B2M (Phosphorus %75+ Nitroxin+ Farmyard manure, (7 P%100B1 (Phosphorus %100 + Barvar and (8 P%125B2 (Phosphorus %125+ Nitroxin. The results showed that the highest yield was obtained from P%75B1M. Difference between integrated fertilization of farmyard manure and other treatments was significant. Farmyard manure increased canola yield which was attributed to increase in availability of mineral nutrients, decreasing effects of salinity and toxic ions. Integrated application of 5 t. ha-1 of farmyard manure and %75 recommended chemical P increased yield and decreased fertilizer consumption. The results revealed that integrated applications of farmyard manure and chemical fertilizer and after that integrated use of bio- and chemical fertilizer are the best strategies to increase nutrient availability and improving canola yield in saline soil.

A- or C-chromosomes, does it matter for the transfer of transgenes from ¤Brassica napus¤

DEFF Research Database (Denmark)

Tomiuk, J.; Hauser, T.P.; Bagger Jørgensen, Rikke

2000-01-01

of herbicide-tolerant plants was explained by selection against the C-chromosomes of B. napus in favor of the homeologous ii-chromosomes. Obviously, such C-chromosomes could be potential candidates as safe integration sites for transgenes. We considered these safety aspects using a simple population genetic...... model. Theory and experiments, however, do not favor the chromosomes of B. napus as safe candidates with respect to the introgression of transgenes into wild populations of B. rapa....

A rich TILLING resource for studying gene function in Brassica rapa

Directory of Open Access Journals (Sweden)

Amoah Stephen

2010-04-01

Full Text Available Abstract Background The Brassicaceae family includes the model plant Arabidopsis thaliana as well as a number of agronomically important species such as oilseed crops (in particular Brassica napus, B. juncea and B. rapa and vegetables (eg. B. rapa and B. oleracea. Separated by only 10-20 million years, Brassica species and Arabidopsis thaliana are closely related, and it is expected that knowledge obtained relating to Arabidopsis growth and development can be translated into Brassicas for crop improvement. Moreover, certain aspects of plant development are sufficiently different between Brassica and Arabidopsis to warrant studies to be carried out directly in the crop species. However, mutating individual genes in the amphidiploid Brassicas such as B. napus and B. juncea may, on the other hand, not give rise to expected phenotypes as the genomes of these species can contain up to six orthologues per single-copy Arabidopsis gene. In order to elucidate and possibly exploit the function of redundant genes for oilseed rape crop improvement, it may therefore be more efficient to study the effects in one of the diploid Brassica species such as B. rapa. Moreover, the ongoing sequencing of the B. rapa genome makes this species a highly attractive model for Brassica research and genetic resource development. Results Seeds from the diploid Brassica A genome species, B. rapa were treated with ethyl methane sulfonate (EMS to produce a TILLING (Targeting Induced Local Lesions In Genomes population for reverse genetics studies. We used the B. rapa genotype, R-o-18, which has a similar developmental ontogeny to an oilseed rape crop. Hence this resource is expected to be well suited for studying traits with relevance to yield and quality of oilseed rape. DNA was isolated from a total of 9,216 M2 plants and pooled to form the basis of the TILLING platform. Analysis of six genes revealed a high level of mutations with a density of about one per 60 kb. This

High-density single nucleotide polymorphism (SNP) array mapping in Brassica oleracea: identification of QTL associated with carotenoid variation in broccoli florets.

Science.gov (United States)

Brown, Allan F; Yousef, Gad G; Chebrolu, Kranthi K; Byrd, Robert W; Everhart, Koyt W; Thomas, Aswathy; Reid, Robert W; Parkin, Isobel A P; Sharpe, Andrew G; Oliver, Rebekah; Guzman, Ivette; Jackson, Eric W

2014-09-01

A high-resolution genetic linkage map of B. oleracea was developed from a B. napus SNP array. The work will facilitate genetic and evolutionary studies in Brassicaceae. A broccoli population, VI-158 × BNC, consisting of 150 F2:3 families was used to create a saturated Brassica oleracea (diploid: CC) linkage map using a recently developed rapeseed (Brassica napus) (tetraploid: AACC) Illumina Infinium single nucleotide polymorphism (SNP) array. The map consisted of 547 non-redundant SNP markers spanning 948.1 cM across nine chromosomes with an average interval size of 1.7 cM. As the SNPs are anchored to the genomic reference sequence of the rapid cycling B. oleracea TO1000, we were able to estimate that the map provides 96 % coverage of the diploid genome. Carotenoid analysis of 2 years data identified 3 QTLs on two chromosomes that are associated with up to half of the phenotypic variation associated with the accumulation of total or individual compounds. By searching the genome sequences of the two related diploid species (B. oleracea and B. rapa), we further identified putative carotenoid candidate genes in the region of these QTLs. This is the first description of the use of a B. napus SNP array to rapidly construct high-density genetic linkage maps of one of the constituent diploid species. The unambiguous nature of these markers with regard to genomic sequences provides evidence to the nature of genes underlying the QTL, and demonstrates the value and impact this resource will have on Brassica research.

Effects of Source and Rate of Nitrogen Fertilizer on Yield, Yield Components and Quality of Winter Rapeseed (Brassica napus L. Efecto de la Fuente y Dosis de Fertilizantes Nitrogenados en el Rendimiento, Componentes de Rendimiento y Calidad de Semilla de Canola (Brassica napus L.

Directory of Open Access Journals (Sweden)

Özden Öztürk

2010-03-01

Full Text Available Winter rapeseed (Brassica napus L. has potential to become an alternate oilseed crop both for edible oil production and energy agriculture (biofuel production for Turkey. This study was conducted to determine the effect of year, N sources and doses on the yield and quality traits of winter rapeseed in a cereal system in calcareous soils over two seasons, 2000-2001 and 2001-2002, in Central Anatolia. Three N sources, ammonium sulfate, ammonium nitrate and urea, were applied as hand broadcast on the soil surface at five doses (0, 50, 100, 150, and 200 kg N ha-1. The traits investigated were plant height, number of branches and pods per plant, number of seed per pod, thousand seed weight, seed yield, oil and protein content. There were significantly effects on seed yield, oil and protein content, and other yield components due to N sources and rates. In general, ammonium sulfate and urea gave higher seed yield than ammonium nitrate. Mean values of both seasons indicated that 100 and 150 kg N ha-1 rate increased significantly yield and quality traits with regard to other N treatments. The present results highlight the practical importance of adequate N fertilization and true N source in seed yield in winter rapeseed and suggest that ammonium sulfate at 150 kg N ha-1 will be about adequate to meet crop N requirements.El raps (Brassica napus L. tiene potencial para convertirse en un cultivo oleaginoso alternativo para producción de aceite comestible y agricultura energética (producción de biodiesel en Turquía. Este estudio fue conducido para determinar el efecto del año, fuente y dosis de N en las características de rendimiento y calidad de raps en un sistema cerealero en suelos calcáreos en dos temporadas, 2000-2001 y 2001-2002, en Anatolia Central. Se aplicaron al voleo tres fuentes de N (sulfato de amonio, nitrato de amonio y urea en cinco dosis (0, 50, 100, 150 y 200 kg N ha-1. Las características investigadas fueron altura de planta, n

Effects of Cd, Pb, Zn, Cu-resistant endophytic Enterobacter sr CBSB1 and Rhodotorula sp. CBSB79 on the growth and phytoextraction of Brassica plants in multimetal contaminated soils.

Science.gov (United States)

Wang, Wenfeng; Deng, Zujun; Tan, Hongming; Cao, Lixiang

2013-01-01

To survey the effects of endophytic Enterobacter sp. CBSB1 and Rhodotorula sp. CBSB79 resistant to Cd2+, Pb2+, Zn2+, and Cu2+ on the growth and phytoextraction of Brassica, the endophytes were isolated by surface- sterilized methods and characterized. The CBSB1 significantly increased 44.2% of the dry weight of Brassica napus in the multimetal contaminated soil (P Rhodotorula sp CBSB79 showed higher potentials to improve extraction efficacy of Cd, Pb, Zn, and Cu by Brassica seedlings in the field.

Physiological responses of Brassica napus to fulvic acid under water stress: Chlorophyll a fluorescence and antioxidant enzyme activity

Directory of Open Access Journals (Sweden)

Ramin Lotfi

2015-10-01

Full Text Available The ameliorative effect of fulvic acid (0, 300, and 600 mg L− 1 on photosystem II and antioxidant enzyme activity of the rapeseed (Brassica napus L. plant under water stress (60, 100, and 140 mm evaporation from class A pan was studied using split plots in a randomized complete block design with three replications. Results indicated that application of fulvic acid (FA improved the maximum quantum efficiency of PSII (Fv/Fm and performance index (PI of plants under both well-watered and limited-water conditions. The time span from Fo to Fm and the energy necessary for the closure of all reaction centers was significantly increased, but the size of the plastoquinone pool was reduced with increasing water stress levels. Plants treated with FA had higher peroxidase and catalase activities under all irrigation conditions. Activities of ascorbate peroxidase and superoxide dismutase in plants increased with increasing water stress. Malondialdehyde increased under severe water stress, but application of FA significantly decreased lipid peroxidation. Production of reactive oxygen species (ROS is a common phenomenon in plants under stress. Under this condition, the balance between the production of ROS and the quenching activity of antioxidants is upset, often resulting in oxidative damage. In this study, application of FA significantly increased fluorescence of chlorophyll a, inhibiting ROS production and enhancing antioxidant enzymes activity that destroyed ROS. Thus, ROS in plant cells was reduced under water stress by application of FA and consequently lipid peroxidation was reduced.

Seleção e produção de sementes em hortaliças: com referência especial ao gênero Brassica

Directory of Open Access Journals (Sweden)

F. G. Brieger

1942-01-01

Full Text Available The preliminary work with vegetables was described and special reference was-made to the group Brassica oleracea. a Plants flowering easily in Piracicaba and probably in the whole State of São Paulo. To this group belongs the lettuce, endive, chichory, carrot, radish, kale, brocoli and cauliflower. b Plants where special treatment is necessary for flowering, as cabbage. c Plants that did not flower up to this moment, as Svisschard beet and beet. Three main factors contribute for the seedless condition in the group cabbage : lack of flowering, anormalities of the flowers and self-sterility. The preliminary experiments in controling these factors seem to indicate the possibility of seed production in this group. The systematics of the two species Brassica oleracea (Europe and Brassica juncea (Oriental Asia was discussed. The economical differences in the group Brassica oleracea are controled by Mendelian factors with complicate types of interaction. It is not necessary to look for special places in the State of São Paulo for vegetable experiments but the possibility of better results in the future, with appropriate conditions, is emphasized.

Chromium-induced physio-chemical and ultrastructural changes in four cultivars of Brassica napus L.

Science.gov (United States)

Gill, Rafaqat A; Zang, Lili; Ali, Basharat; Farooq, Muhammad A; Cui, Peng; Yang, Su; Ali, Shafaqat; Zhou, Weijun

2015-02-01

In nature, plants are continuously exposed to several biotic and abiotic stresses. Among these stresses, chromium (Cr) stress is one of the most adverse factors that affects the plant growth, and productivity, and imposes a severe threat for sustainable crop production. In the present study, toxic effects of Cr were studied in hydroponically grown seedlings of four different cultivars of Brassica napus L. viz. ZS 758, Zheda 619, ZY 50 and Zheda 622. The study revealed that elevated Cr concentrations reduced the plant growth rate and biomass as compared to respective controls in all the cultivars and this decline was more obvious in Zheda 622. It was observed that reduction of photosynthetic attributes was more pronounced in Zheda 622 as compared to other cultivars; while, cultivar ZS 758 performed better under Cr-toxicity. Results showed that Cr contents in different parts of seedlings were higher in Zheda 622 as compared to other cultivars and Cr contents were higher in roots than shoots in all the cultivars. Accumulation of reactive oxygen species (ROS) and malondialdehyde (MDA) were induced under different Cr concentrations. Results showed that some of anti-oxidant enzyme activities in leaves and roots were increased under the Cr-toxicity. The electron microscopic study showed that ultrastructural damages in leaf mesophyll and root tip cells were more prominent in Zheda 622 as compared to other cultivars under 400 μM Cr stress. Under 400 μM Cr concentration, changes like broken cell wall, immature nucleus, a number of mitochondria, ruptured thylakoid membranes and large size of vacuole and starch grains were observed in leaf ultrastructures. The damages in root cells were observed in the form of disruption of golgibodies and diffused cell wall under the higher concentration of Cr (400 μM). On the basis of these observations, it was concluded that Zheda 622 was found to be more sensitive as followed by ZY 50, Zheda 619 and ZS 758 under Cr-toxicity. Copyright �

Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome

Science.gov (United States)

2013-01-01

Background Miniature inverted-repeat transposable elements (MITEs) are expected to play important roles in evolution of genes and genome in plants, especially in the highly duplicated plant genomes. Various MITE families and their roles in plants have been characterized. However, there have been fewer studies of MITE families and their potential roles in evolution of the recently triplicated Brassica genome. Results We identified a new MITE family, BRAMI-1, belonging to the Stowaway super-family in the Brassica genome. In silico mapping revealed that 697 members are dispersed throughout the euchromatic regions of the B. rapa pseudo-chromosomes. Among them, 548 members (78.6%) are located in gene-rich regions, less than 3 kb from genes. In addition, we identified 516 and 15 members in the 470 Mb and 15 Mb genomic shotgun sequences currently available for B. oleracea and B. napus, respectively. The resulting estimated copy numbers for the entire genomes were 1440, 1464 and 2490 in B. rapa, B. oleracea and B. napus, respectively. Concurrently, only 70 members of the related Arabidopsis ATTIRTA-1 MITE family were identified in the Arabidopsis genome. Phylogenetic analysis revealed that BRAMI-1 elements proliferated in the Brassica genus after divergence from the Arabidopsis lineage. MITE insertion polymorphism (MIP) was inspected for 50 BRAMI-1 members, revealing high levels of insertion polymorphism between and within species of Brassica that clarify BRAMI-1 activation periods up to the present. Comparative analysis of the 71 genes harbouring the BRAMI-1 elements with their non-insertion paralogs (NIPs) showed that the BRAMI-1 insertions mainly reside in non-coding sequences and that the expression levels of genes with the elements differ from those of their NIPs. Conclusion A Stowaway family MITE, named as BRAMI-1, was gradually amplified and remained present in over than 1400 copies in each of three Brassica species. Overall, 78% of the members were identified in

Quantitative Trait Loci Mapping in Brassica rapa Revealed the Structural and Functional Conservation of Genetic Loci Governing Morphological and Yield Component Traits in the A, B, and C Subgenomes of Brassica Species

Science.gov (United States)

Li, Xiaonan; Ramchiary, Nirala; Dhandapani, Vignesh; Choi, Su Ryun; Hur, Yoonkang; Nou, Ill-Sup; Yoon, Moo Kyoung; Lim, Yong Pyo

2013-01-01

Brassica rapa is an important crop species that produces vegetables, oilseed, and fodder. Although many studies reported quantitative trait loci (QTL) mapping, the genes governing most of its economically important traits are still unknown. In this study, we report QTL mapping for morphological and yield component traits in B. rapa and comparative map alignment between B. rapa, B. napus, B. juncea, and Arabidopsis thaliana to identify candidate genes and conserved QTL blocks between them. A total of 95 QTL were identified in different crucifer blocks of the B. rapa genome. Through synteny analysis with A. thaliana, B. rapa candidate genes and intronic and exonic single nucleotide polymorphisms in the parental lines were detected from whole genome resequenced data, a few of which were validated by mapping them to the QTL regions. Semi-quantitative reverse transcriptase PCR analysis showed differences in the expression levels of a few genes in parental lines. Comparative mapping identified five key major evolutionarily conserved crucifer blocks (R, J, F, E, and W) harbouring QTL for morphological and yield components traits between the A, B, and C subgenomes of B. rapa, B. juncea, and B. napus. The information of the identified candidate genes could be used for breeding B. rapa and other related Brassica species. PMID:23223793

A comparison of screening methods to identify waterlogging tolerance in the field in Brassica napus L. during plant ontogeny.

Directory of Open Access Journals (Sweden)

Xiling Zou

Full Text Available Waterlogging tolerance is typically evaluated at a specific development stage, with an implicit assumption that differences in waterlogging tolerance expressed in these systems will result in improved yield performance in fields. It is necessary to examine these criteria in fields. In the present study, three experiments were conducted to screen waterlogging tolerance in 25 rapeseed (Brassica napus L. varieties at different developmental stages, such as seedling establishment stage and seedling stage at controlled environment, and maturity stage in the fields. The assessments for physiological parameters at three growth stages suggest that there were difference of waterlogging tolerance at all the development stages, providing an important basis for further development of breeding more tolerant materials. The results indicated that flash waterlogging restricts plant growth and growth is still restored after removal of the stress. Correlation analysis between waterlogging tolerance coefficient (WTC of yield and other traits revealed that there was consistency in waterlogging tolerance of the genotypes until maturity, and good tolerance at seedling establishment stage and seedling stage can guarantee tolerance in later stages. The waterlogging-tolerant plants could be selected using some specific traits at any stage, and selections would be more effective at the seedling establishment stage. Thus, our study provides a method for screening waterlogging tolerance, which would enable the suitable basis for initial selection of a large number of germplasm or breeding populations for waterlogging tolerance and help for verifying their potential utility in crop-improvement.

The bioaccumulation of heavy metals in Brassica napus L. in the area around Turów Power Station, Poland

Directory of Open Access Journals (Sweden)

Niedźwiecka Alicja

2017-01-01

Full Text Available Brassica napus L. is a known bioaccumulator of copper, zinc, cadmium, lead, chromium, nickel and arsenic from soils. The metal ions are accumulated in the roots, stems, leaves and seeds of the oilseed rape. The samples of soils and plants were collected in the area around the Turów power station (Bogatynia city, Lower Silesia. The soil samples were collected from the surface layer of 0-25 cm. Roots, stems and pods of the oilseed rape were used in the study. The environmental samples were digested in HNO3, 60%, using the Microwave Digestion System. Metal concentrations have been dermined through the FAAS method. Three heavy metals - zinc, copper and lead – have been analyzed. The content of zinc was higher than the content of copper in all samples (plants and soils. In the roots of the oilseed rape higher concentration of metals compared to other parts of the plant was observed. In the soil samples, there was no correlation between the concentration of pollution and the distance from the power plant. Permissible concentrations of heavy metals relative to the standard according to the Polish Ministry of Environment Regulation from September 1st, 2016, have not been exceeded. The permissible pollution indexes (Wn in soils were exceeded compared to the geochemical background in uncontaminated soils of Poland. The bioaccumulation coefficients of heavy metals indicate lower metal concentrations in plants than in soils

Combining Ability Analysis and Genetic-Effects Studies for Some Important Quality Characters in Brassica napus L.

Directory of Open Access Journals (Sweden)

Aamar Shehzad

2015-10-01

Full Text Available Combining ability analysis has an important position in rapeseed breeding. To evaluate genetic and combining ability effects, three Brassica napus L. testers “Punjab Sarson, Legend and Durre-NIFA” and five lines “Duncled, K-258, ZN-R-1, ZN-R-8, ZN-M-6” were crossed using line × tester design in Randomized Complete Block Design (RCBD with three replications. Mean sum of squares of the analysis of variances (ANOVA for genotypes was highly significant for all of the traits. Most of the lines and testers exhibited significant results of mean sum of squares for combining ability. Line ‘Duncled’ was proved good general combiner for oil (8.8, protein (3.7, erucic acid (33.0, oleic acid (13.0 and glucosinolate (-19.3 over other lines and tester ‘Durree-NIFA’ for protein (6.6, erucic acid (-23.4, and linolenic acid (-5.3 over other testers. Significant specific combining ability effects were also observed. The best hybrid combinations were Legend × ZN-R-1 for oil (9.6, Punjab Sarson × Duncled for minimum erucic acid (-14.0 and linolenic acid contents (-6.0, and Legend × ZN-M-6 for maximum protein (8.2 and minimum glucosinolate contents (-11.1. The maximum oil contents were observed in ‘Legend × ZN-R-1’ (52.4%. The cross ‘Punjab Sarson × Duncled’ expressed maximum values of protein (26.5% and oleic acid (62.5% while minimum for erucic acid (2.3%, linolenic acid (5.4% and glucosinolate contents (19.3µmol/g. This research discloses the significance of non-additive genetic effects for most of the studied traits except oil contents. These studies will also help to improve nutritional values of rapeseed crop by selecting noble crosses.

Sulphur Nutrition and its Effect on Yield and Oil Content of Oilseed Rape (Brassica Napus L.

Directory of Open Access Journals (Sweden)

Mária Varényiová

2017-01-01

Full Text Available The aim of the experiment was to study the importance of sulphur in oilseed rape (Brassica napus L. nutrition as well as the effect of rising doses of sulphur in combination with nitrogen on yield, oiliness, oil production, nutrients content in seed and nutrients uptake by rapeseed. The plot–scale experiment was established in years 2013/14 and 2014/15 within the agricultural cooperative in Mojmírovce. There were four fertilization treatments on 600 m2 experimental plots in three replications in this experiment. The first treatment was unfertilized control. Other three treatments were fertilized by the same nitrogen dose of 160 kg.ha−1 and by increasing doses of sulphur. The second treatment was fertilized by a dose of 15 kg.ha−1 S, the third by a dose of 40 kg.ha−1 and a dose of 65 kg.ha−1 S was applied at the fourth treatment. The highest average yield 3.96 t.ha-1 was found when a dose of 40 kg.ha−1 S was applied. The application of sulphur in a dose of 65 kg.ha−1 was accompanied by a yield decrease by 11.4 % as compared to the treatment where a sulphur dose of 40 kg.ha−1 was used. An average oil content of 45.1, 45.5, and 44.0 % was found in treatments in which the doses of sulphur of 15, 40 and 65 kg.ha−1 were applied. No significant difference among the treatments fertilized by sulphur was found. The average oil production reached 1809, 1802 and 1595 kg.ha−1 in cases of treatments fertilized by sulphur doses of 15, 40 and 65 kg.ha−1.

Effects of Glucosinolates and Flavonoids on Colonization of the Roots of Brassica napus by Azorhizobium caulinodans ORS571

Science.gov (United States)

O'Callaghan, Kenneth J.; Stone, Philip J.; Hu, Xiaojia; Griffiths, D. Wynne; Davey, Michael R.; Cocking, Edward C.

2000-01-01

Plants of Brassica napus were assessed quantitatively for their susceptibility to lateral root crack colonization by Azorhizobium caulinodans ORS571(pXLGD4) (a rhizobial strain carrying the lacZ reporter gene) and for the concentration of glucosinolates in their roots by high-pressure liquid chromatography (HPLC). High- and low-glucosinolate-seed (HGS and LGS) varieties exhibited a relatively low and high percentage of colonized lateral roots, respectively. HPLC showed that roots of HGS plants contained a higher concentration of glucosinolates than roots of LGS plants. One LGS variety showing fewer colonized lateral roots than other LGS varieties contained a higher concentration of glucosinolates than other LGS plants. Inoculated HGS plants treated with the flavonoid naringenin showed significantly more colonization than untreated HGS plants. This increase was not mediated by a naringenin-induced lowering of the glucosinolate content of HGS plant roots, nor did naringenin induce bacterial resistance to glucosinolates or increase the growth of bacteria. The erucic acid content of seed did not appear to influence colonization by azorhizobia. Frequently, leaf assays are used to study glucosinolates and plant defense; this study provides data on glucosinolates and bacterial colonization in roots and describes a bacterial reporter gene assay tailored easily to the study of ecologically important phytochemicals that influence bacterial colonization. These data also form a basis for future assessments of the benefits to oilseed rape plants of interaction with plant growth-promoting bacteria, especially diazotrophic bacteria potentially able to extend the benefits of nitrogen fixation to nonlegumes. PMID:10788398

Glyphosate drift promotes changes in fitness and transgene flow in canola (Brassica napus) and hybrids

Science.gov (United States)

1. With the advent of transgenic crops, genetically modified, herbicide resistant B. napus has become a model system for examining the risks of escape of transgenes from cultivation and for evaluating potential ecological consequences of novel genes in wild species. 2. We exam...

Tuning growth cycles of Brassica crops via natural antisense transcripts of BrFLC.

Science.gov (United States)

Li, Xiaorong; Zhang, Shaofeng; Bai, Jinjuan; He, Yuke

2016-03-01

Several oilseed and vegetable crops of Brassica are biennials that require a prolonged winter cold for flowering, a process called vernalization. FLOWERING LOCUS C (FLC) is a central repressor of flowering. Here, we report that the overexpression of natural antisense transcripts (NATs) of Brassica rapa FLC (BrFLC) greatly shortens plant growth cycles. In rapid-, medium- and slow-cycling crop types, there are four copies of the BrFLC genes, which show extensive variation in sequences and expression levels. In Bre, a biennial crop type that requires vernalization, five NATs derived from the BrFLC2 locus are rapidly induced under cold conditions, while all four BrFLC genes are gradually down-regulated. The transgenic Bre lines overexpressing a long NAT of BrFLC2 do not require vernalization, resulting in a gradient of shortened growth cycles. Among them, a subset of lines both flower and set seeds as early as Yellow sarson, an annual crop type in which all four BrFLC genes have non-sense mutations and are nonfunctional in flowering repression. Our results demonstrate that the growth cycles of biennial crops of Brassica can be altered by changing the expression levels of BrFLC2 NATs. Thus, BrFLC2 NATs and their transgenic lines are useful for the genetic manipulation of crop growth cycles. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

The effect of Ni on concentration of the most abundant essential cations in several Brassica species

Directory of Open Access Journals (Sweden)

Putnik-Delić Marina I.

2014-01-01

Full Text Available Some plants from the genus Brassica have the ability to tolerate excessive concentrations of heavy metals, including Ni. Considering the fact that Ni is a very toxic element for living beings we wanted to examine its influence on some species from genus Brassicaceae. The aim of this study was to investigate the effect of Ni on distribution and accumulation of essential macronutrients from the standpoint of food quality and phytoremediation potential. Experiments were performed using winter (W and spring (S varieties of rapeseed (Brassica napus, L., white mustard (Brassica alba, L., black mustard (Brassica nigra, L. and turnip (Brassica rapa, L.. The seeds were exposed to 10 μM Ni from the beginning of germination. Plants were grown in water cultures, in semi-controlled conditions of a greenhouse, on ½ strength Hoagland solution to which was added Ni in the same concentration as during germination. Concentrations and distribution of Ca, Mg, K in leaf and stem were altered in the presence of increased concentration of Ni. Significant differences were found between the control and Ni-treated plants as well as among the genotypes. [Projekat Ministarstva nauke Republike Srbije, br. TR 31036 i br. TR 31016

Ectopic expression of GA 2-oxidase 6 from rapeseed (Brassica napus L.) causes dwarfism, late flowering and enhanced chlorophyll accumulation in Arabidopsis thaliana.

Science.gov (United States)

Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying

2017-02-01

Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Colorless chlorophyll catabolites in senescent florets of broccoli (Brassica oleracea var. italica).

Science.gov (United States)

Roiser, Matthias H; Müller, Thomas; Kräutler, Bernhard

2015-02-11

Typical postharvest storage of broccoli (Brassica oleracea var. italica) causes degreening of this common vegetable with visible loss of chlorophyll (Chl). As shown here, colorless Chl-catabolites are generated. In fresh extracts of degreening florets of broccoli, three colorless tetrapyrrolic Chl-catabolites accumulated and were detected by high performance liquid chromatography (HPLC): two "nonfluorescent" Chl-catabolites (NCCs), provisionally named Bo-NCC-1 and Bo-NCC-2, and a colorless 1,19-dioxobilin-type "nonfluorescent" Chl-catabolite (DNCC), named Bo-DNCC. Analysis by nuclear magnetic resonance spectroscopy and mass spectrometry of these three linear tetrapyrroles revealed their structures. In combination with a comparison of their HPL-chromatographic properties, this allowed their identification with three known catabolites from two other brassicacea, namely two NCCs from oil seed rape (Brassica napus) and a DNCC from degreened leaves of Arabidopsis thaliana.

Brassica database (BRAD) version 2.0: integrating and mining Brassicaceae species genomic resources.

Science.gov (United States)

Wang, Xiaobo; Wu, Jian; Liang, Jianli; Cheng, Feng; Wang, Xiaowu

2015-01-01

The Brassica database (BRAD) was built initially to assist users apply Brassica rapa and Arabidopsis thaliana genomic data efficiently to their research. However, many Brassicaceae genomes have been sequenced and released after its construction. These genomes are rich resources for comparative genomics, gene annotation and functional evolutionary studies of Brassica crops. Therefore, we have updated BRAD to version 2.0 (V2.0). In BRAD V2.0, 11 more Brassicaceae genomes have been integrated into the database, namely those of Arabidopsis lyrata, Aethionema arabicum, Brassica oleracea, Brassica napus, Camelina sativa, Capsella rubella, Leavenworthia alabamica, Sisymbrium irio and three extremophiles Schrenkiella parvula, Thellungiella halophila and Thellungiella salsuginea. BRAD V2.0 provides plots of syntenic genomic fragments between pairs of Brassicaceae species, from the level of chromosomes to genomic blocks. The Generic Synteny Browser (GBrowse_syn), a module of the Genome Browser (GBrowse), is used to show syntenic relationships between multiple genomes. Search functions for retrieving syntenic and non-syntenic orthologs, as well as their annotation and sequences are also provided. Furthermore, genome and annotation information have been imported into GBrowse so that all functional elements can be visualized in one frame. We plan to continually update BRAD by integrating more Brassicaceae genomes into the database. Database URL: http://brassicadb.org/brad/. © The Author(s) 2015. Published by Oxford University Press.

Comparative mapping of Brassica juncea and Arabidopsis thaliana using Intron Polymorphism (IP markers: homoeologous relationships, diversification and evolution of the A, B and C Brassica genomes

Directory of Open Access Journals (Sweden)

Gupta Vibha

2008-03-01

Full Text Available Abstract Background Extensive mapping efforts are currently underway for the establishment of comparative genomics between the model plant, Arabidopsis thaliana and various Brassica species. Most of these studies have deployed RFLP markers, the use of which is a laborious and time-consuming process. We therefore tested the efficacy of PCR-based Intron Polymorphism (IP markers to analyze genome-wide synteny between the oilseed crop, Brassica juncea (AABB genome and A. thaliana and analyzed the arrangement of 24 (previously described genomic block segments in the A, B and C Brassica genomes to study the evolutionary events contributing to karyotype variations in the three diploid Brassica genomes. Results IP markers were highly efficient and generated easily discernable polymorphisms on agarose gels. Comparative analysis of the segmental organization of the A and B genomes of B. juncea (present study with the A and B genomes of B. napus and B. nigra respectively (described earlier, revealed a high degree of colinearity suggesting minimal macro-level changes after polyploidization. The ancestral block arrangements that remained unaltered during evolution and the karyotype rearrangements that originated in the Oleracea lineage after its divergence from Rapa lineage were identified. Genomic rearrangements leading to the gain or loss of one chromosome each between the A-B and A-C lineages were deciphered. Complete homoeology in terms of block organization was found between three linkage groups (LG each for the A-B and A-C genomes. Based on the homoeology shared between the A, B and C genomes, a new nomenclature for the B genome LGs was assigned to establish uniformity in the international Brassica LG nomenclature code. Conclusion IP markers were highly effective in generating comparative relationships between Arabidopsis and various Brassica species. Comparative genomics between the three Brassica lineages established the major rearrangements

Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae

OpenAIRE

Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling

2015-01-01

Background Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics ...

Effects of derived meals from juncea (Brassica juncea, yellow and black seeded canola (Brassica napus and multicarbohydrase enzymes supplementation on apparent metabolizable energy in broiler chickens

Directory of Open Access Journals (Sweden)

Balachandar Jayaraman

2016-09-01

Full Text Available Two experiments were conducted to determine the nitrogen-corrected apparent metabolizable energy (AMEn of differently processed meals from Juncea (Brassica juncea, yellow and black seeded canola (Brassica napus, with or without supplementation of multi-carbohydrase enzymes (Enz in diets for broiler chickens. The first experiment was a 3 × 2 × 2 factorial arrangement with the main factors being seed type (yellow [Yellow] or black [B1] canola seeds and Juncea seeds, processed at two temperatures (high temperature desolventized-toasted [HTDT] at 95°C or low temperature desolventized-toasted [LTDT] at 57°C, with or without Enz. In Exp. 1, a total of 384 one-day-old male broiler chicks were randomly assigned to 64 battery cages, with 6 birds/cage. The second experiment was a 2 × 2 × 2 factorial arrangement with the main factors being seed type (Yellow or black [B2], seed source (Scott, Saskatchewan or Truro, Nova Scotia and Enz (with or without supplementation. A total of 264 one-day-old male broiler chicks were randomly assigned to 44 battery cages, with 6 birds per cage. In Exp. 1 and 2, all birds were fed a common starter diet from 1 to 14 days of age. From d 15 to 21, the birds were fed one of the test treatments, a basal grower diet or the basal grower diet replaced with 30% test ingredient with celite (0.8% added as an inert marker. Excreta was collected on d 20 and 21. In Exp. 1, there were no interactions (P > 0.05 among seed type, processing temperature and Enz. Processing temperature and dietary Enz did not affect (P > 0.05 AMEn of different canola meals. The AMEn of prepress solvent extracted canola and juncea meals (PSEM from Yellow (11.2 MJ/kg was higher (P  0.05 among seed color, location and Enz. Supplementation of dietary Enz did not affect (P > 0.05 AMEn of different cold press canola meals. The AMEn of cold press canola meals (CPM from Yellow (14.7 MJ/kg was higher (P < 0.05 compared with B2 (12.2�

Dynamic Metabolic Profiles and Tissue-Specific Source Effects on the Metabolome of Developing Seeds of Brassica napus.

Directory of Open Access Journals (Sweden)

Helin Tan

Full Text Available Canola (Brassica napus is one of several important oil-producing crops, and the physiological processes, enzymes, and genes involved in oil synthesis in canola seeds have been well characterized. However, relatively little is known about the dynamic metabolic changes that occur during oil accumulation in seeds, as well as the mechanistic origins of metabolic changes. To explore the metabolic changes that occur during oil accumulation, we isolated metabolites from both seed and silique wall and identified and characterized them by using gas chromatography coupled with mass spectrometry (GC-MS. The results showed that a total of 443 metabolites were identified from four developmental stages. Dozens of these metabolites were differentially expressed during seed ripening, including 20 known to be involved in seed development. To investigate the contribution of tissue-specific carbon sources to the biosynthesis of these metabolites, we examined the metabolic changes of silique walls and seeds under three treatments: leaf-detachment (Ld, phloem-peeling (Pe, and selective silique darkening (Sd. Our study demonstrated that the oil content was independent of leaf photosynthesis and phloem transport during oil accumulation, but required the metabolic influx from the silique wall. Notably, Sd treatment resulted in seed senescence, which eventually led to a severe reduction of the oil content. Sd treatment also caused a significant accumulation of fatty acids (FA, organic acids and amino acids. Furthermore, an unexpected accumulation of sugar derivatives and organic acid was observed in the Pe- and Sd-treated seeds. Consistent with this, the expression of a subset of genes involved in FA metabolism, sugar and oil storage was significantly altered in Pe and Sd treated seeds. Taken together, our studies suggest the metabolite profiles of canola seeds dynamically varied during the course of oil accumulation, which may provide a new insight into the mechanisms

Exploring genotypic variations for improved oil content and healthy fatty acids composition in rapeseed (Brassica napus L.).

Science.gov (United States)

Ishaq, Muhammad; Razi, Raziuddin; Khan, Sabaz Ali

2017-04-01

Development of new genotypes having high oil content and desirable levels of fatty acid compositions is a major objective of rapeseed breeding programmes. In the current study combining ability was determined for oil, protein, glucosinolates and various fatty acids content using 8 × 8 full diallel in rapeseed (Brassica napus). Highly significant genotypic differences were observed for oil, protein, glucosinolates, oleic acid, linolenic acid and erucic acid content. Mean squares due to general combining ability (GCA), specific combining ability (SCA) and reciprocal combining ability (RCA) were highly significant (P ≤ 0.01) for biochemical traits. Parental line AUP-17 for high oil content and low glucosinolates, genotype AUP-2 for high protein and oleic acids, and AUP-18 for low lenolenic and erucic acid were best general combiners. Based on desirable SCA effects, F 1 hybrids AUP-17 × AUP-20; AUP-2 × AUP-8; AUP-7 × AUP-14; AUP-2 × AUP-9; AUP-7 × AUP-14 and AUP-2 × AUP-9 were found superior involving at least one best general combiner. F 1 hybrids AUP-17 × AUP-20 (for oil content); AUP-2 × AUP-8 (for protein content); AUP-7 × AUP-14 (for glucosinolates); AUP-2 × AUP-9 (for oleic acid); AUP-7 × AUP-14 (for linolenic acid) and AUP-2 × AUP-9 (for erucic acid) were found superior involving at least one best general combiner. As reciprocal crosses of AUP-14 with AUP-7 and AUP-8 were superior had low × low and low × high GCA effects for glucosinolates and oleic acid, respectively therefore, these could be exploited in future rapeseed breeding programmes to develop new lines with good quality. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Mitochondrial genome sequencing helps show the evolutionary mechanism of mitochondrial genome formation in Brassica

Science.gov (United States)

2011-01-01

Background Angiosperm mitochondrial genomes are more complex than those of other organisms. Analyses of the mitochondrial genome sequences of at least 11 angiosperm species have showed several common properties; these cannot easily explain, however, how the diverse mitotypes evolved within each genus or species. We analyzed the evolutionary relationships of Brassica mitotypes by sequencing. Results We sequenced the mitotypes of cam (Brassica rapa), ole (B. oleracea), jun (B. juncea), and car (B. carinata) and analyzed them together with two previously sequenced mitotypes of B. napus (pol and nap). The sizes of whole single circular genomes of cam, jun, ole, and car are 219,747 bp, 219,766 bp, 360,271 bp, and 232,241 bp, respectively. The mitochondrial genome of ole is largest as a resulting of the duplication of a 141.8 kb segment. The jun mitotype is the result of an inherited cam mitotype, and pol is also derived from the cam mitotype with evolutionary modifications. Genes with known functions are conserved in all mitotypes, but clear variation in open reading frames (ORFs) with unknown functions among the six mitotypes was observed. Sequence relationship analysis showed that there has been genome compaction and inheritance in the course of Brassica mitotype evolution. Conclusions We have sequenced four Brassica mitotypes, compared six Brassica mitotypes and suggested a mechanism for mitochondrial genome formation in Brassica, including evolutionary events such as inheritance, duplication, rearrangement, genome compaction, and mutation. PMID:21988783

Bee assemblage in habitats associated with Brassica napus L.

Directory of Open Access Journals (Sweden)

Rosana Halinski

2015-09-01

Full Text Available ABSTRACTAssessments in agricultural crops indicate that alterations in the landscape adjacent to the crops can result in reduced productivity due to loss or low abundance of pollinating agents. In the canola crop, production is partially dependent on insect pollination. Therefore, knowledge of the faunal diversity within and near crop fields is key for the management of these insects and consequently for the increase in productivity. This study aimed to determine and compare the diversity of bees in habitats associated with canola fields in southern Brazil. Bees were captured in four agricultural areas using pan traps in three habitat classes: (1 flowering canola crop, (2 forest remnant, and (3 grassland vegetation. The highest abundance of bees was observed in the grassland vegetation (50% and in the flowering canola field (47%. Eight species common to the three habitat classes were recorded, four of which are represented by native social bees. In addition, a single or a few individuals represented species that were exclusive to a specific habitat class; eight species were collected exclusively in the interior of the canola field, 51 in the grassland vegetation, and six in the forest remnant. The majority of the rare species recorded exhibits subsocial or solitary behaviour and inhabit open places. The composition of bee groups differed between the habitats showing the importance of maintaining habitat mosaics with friendly areas for pollinators, which promote the pollination service for canola flowers.

Comparative transcriptome analysis reveals carbohydrate and lipid metabolism blocks in Brassica napus L. male sterility induced by the chemical hybridization agent monosulfuron ester sodium.

Science.gov (United States)

Li, Zhanjie; Cheng, Yufeng; Cui, Jianmin; Zhang, Peipei; Zhao, Huixian; Hu, Shengwu

2015-03-17

Chemical hybridization agents (CHAs) are often used to induce male sterility for the production of hybrid seeds. We previously discovered that monosulfuron ester sodium (MES), an acetolactate synthase (ALS) inhibitor of the herbicide sulfonylurea family, can induce rapeseed (Brassica napus L.) male sterility at approximately 1% concentration required for its herbicidal activity. To find some clues to the mechanism of MES inducing male sterility, the ultrastructural cytology observations, comparative transcriptome analysis, and physiological analysis on carbohydrate content were carried out in leaves and anthers at different developmental stages between the MES-treated and mock-treated rapeseed plants. Cytological analysis revealed that the plastid ultrastructure was abnormal in pollen mother cells and tapetal cells in male sterility anthers induced by MES treatment, with less material accumulation in it. However, starch granules were observed in chloroplastids of the epidermis cells in male sterility anthers. Comparative transcriptome analysis identified 1501 differentially expressed transcripts (DETs) in leaves and anthers at different developmental stages, most of these DETs being localized in plastid and mitochondrion. Transcripts involved in metabolism, especially in carbohydrate and lipid metabolism, and cellular transport were differentially expressed. Pathway visualization showed that the tightly regulated gene network for metabolism was reprogrammed to respond to MES treatment. The results of cytological observation and transcriptome analysis in the MES-treated rapeseed plants were mirrored by carbohydrate content analysis. MES treatment led to decrease in soluble sugars content in leaves and early stage buds, but increase in soluble sugars content and decrease in starch content in middle stage buds. Our integrative results suggested that carbohydrate and lipid metabolism were influenced by CHA-MES treatment during rapeseed anther development, which might

Comparative field evaluation of some newer versus conventional insecticides for the control of aphids (homoptera: aphididae) on oilseed rape (brassica napus l.)

International Nuclear Information System (INIS)

Sarwar, M.; Ahmad, N.; Bux, M.; Nasrullah, A.; Tofique, M.

2011-01-01

This study was designed to evaluate the effects of new insecticides like, Imidacloprid (Confidor 200 EC), Thiomethoxam (Actara 25 WG) and Acetamiprid (Megamos 20 SL) belonging to Nitroguanidine group along with conventional insecticides such as, Chlorpyrifos (Lorsban 40 EC) and Dimethoate (Systoate 40 EC) belonging to Organophosphate group against aphids' population on oilseed rape (Brassica napus L.). A perusal of data, based on the overall performance of the test compounds, reflected that newer insecticides were superior in reducing the population of aphids and yield enhancement as compared to conventional insecticides. The best results were achieved with the application of Imidacloprid by recording the lowest number of aphids (2.2 per plant) than obtained with Thiomethoxam and Acetamiprid (3.22 and 4.66, respectively). Other insecticides, viz., Chlorpyrifos and Dimethoate were also found to be effective in maintaining the aphids' population at lower levels per plant (16.2 and 17.5, respectively) over untreated control (227.7). Imidacloprid was responsible for increasing the grain yield to 3722.85 Kg per Hectare, approached by Thiomethoxam, Acetamiprid, Chlorpyrifos and Dimethoate as against unsprayed control (2980.0, 2542.85, 1542.85, 540.0 and 604.85 Kg per Hectare, respectively). Study indicated that selective use of newer insecticides would seem a reasonable strategy in aphids controlling and integration of such chemicals in insects' management package could help to reduce pest densities. (author)

Effects of different roasting conditions on the nutritional value and oxidative stability of high-oleic and yellow-seeded Brassica napus oils

Directory of Open Access Journals (Sweden)

Rękas, A.

2015-09-01

Full Text Available This study was conducted to evaluate the possibility of enhancing the nutritional value and oxidative stability of rapeseed oil obtained from seeds subjected to thermal treatment prior to pressing. The yellowseeded and high-oleic B. napus lines, harvested in Poland, were roasted prior to pressing for 1 h at 100 and 150 °C. This study highlighted how rapeseed breeding lines affect the quality profile of the oils obtained both before and after the roasting process. In principle, the high-oleic B. napus was accompanied by a nearly 2-fold increase in oxidative stability compared to the yellow-seeded B. napus, most likely due to a higher content of oxidation-resistant oleic fatty acids (~74.24% vs. ~60.76% and a decreased concentration of oxidizable PUFAs (~16.32% vs. ~31.09%. Similar to the case of roasting black-seeded rapeseed, the thermal pre-treatment of yellow-seeded and high-oleic B. napus prior to pressing did not alter the composition of their fatty acids. Based on the results obtained in this study, it can be concluded that roasting seeds prior to pressing does not reduce the amount of tocopherols in the oil; moreover, a slight increase in γ-tocopherol content was observed.Este estudio se realizó para evaluar la posibilidad de aumentar el valor nutritivo y la estabilidad oxidativa del aceite de colza obtenido a partir de semillas sometidas a tratamiento térmico antes del prensado. Las líneas de B. napus sembrados amarillos y alto oleico, cosechadas en Polonia, fueron tostadas antes de ser prensadas durante 1 hora a 100 y 150 °C. Este estudio pone de relieve cómo las líneas de colza mejoradas ven afectado el perfil de calidad de los aceites obtenidos antes y después del proceso de tostado. En principio, el alto oleico B. napus aumenta casi 2 veces la estabilidad a la oxidación en comparación con semilla amarilla B. napus, muy probablemente debido a un mayor contenido de ácido graso oleico resistente a la oxidación (~74,24% vs

Effect of Sugarcane Filter Muds, Chemical and Biological Fertilizers on Absorption of Some Macro- and Micro-Elementsand Heavy Metals by Canola (Brassica napus L.

Directory of Open Access Journals (Sweden)

H. Monjezi

2015-12-01

Full Text Available In order to evaluate the effect of sugarcane (Sacharum officinarum L. filter muds and chemical and biological fertilizers application on macro- and micronutrient elements and some heavy metals (Pb and Cd absorption by canola (Brassica napus L. grains, a factorial experiment was conducted in 2012 in the Experimental Farm of Ramin (Mollasani Agriculture and Natural Resources University of Khouzestan, Iran. A complete blocks design was used for the experiment with three replications. Different integrated treatments of filter muds and chemical fertilizers (A1: 100% filter muds, A2: 75% filter muds + 25% chemical fertilizers, A3: 50% filter muds + 50% chemical fertilizers, A4: 25% filter muds + 75% chemical fertilizers and A5: 100% chemical fertilizers along with two levels of biological fertilizers application (with and without biological fertilizers were investigated. The biological fertilizers investigated in this study were Nitroxin and Barvar2. Application of filter muds led to decreases in nitrogen, phosphorus and Cd of canola seeds. On the other hand, increase of filter muds application led to increase of Zn, Cu, Fe and Pb content in canola seeds. Biological and chemical fertilizers application resulted in increases of nitrogen, phosphorus and cadmium contents in canola seeds. Biofertilizers also increased phosphorus and cadmium contents in canola seeds.

Analysis of yield and plant traits of oilseed rape (Brassica napus L. cultivated in temperate region in light of the possibilities of sowing in arid areas

Directory of Open Access Journals (Sweden)

Tadeusz Zając

2016-12-01

Full Text Available This work is a review of selected literature on the species of Brassica with the greatest economic significance. Oilseed rape (Brassica napus ssp. oleifera currently ranks third worldwide among oilseed crops used for oil production and is the most important in the temperate zone. The manifold uses of rape include not only human consumption of oil, but also the use of post-extraction meal to feed livestock as well as industrial applications as a source of bioenergy or cellulose. The improvement in the economic position of rape among crop plants is also due to the doubling of its yield between 1970 and 2009; the average annual increase in seed yield worldwide was 27 kg ha−1 yr−1. The yield level in Europe exceeds the average yields achieved in the world, particularly in Asia. Recently, the cultivation of oilseed rape was started on a relatively large acreage in Iran where the yield amounted 2.1 t ha−1, exceeding the yields of China and India. In Poland, the acreage of oilseed rape cultivation between 1965 and 2013 increased 3–4 times, and during this period the annual increase in seed yield was 29 kg ha−1 yr−1. Under the field conditions of the temperate climate zone, winter oilseed rape yield is mainly determined by agro-climatic conditions during the growing period, the level of nitrogen fertilization, and the production potential of varieties, which is currently highest in hybrids. There is a noticeable tendency of hybrids towards formation of more siliques by individual oilseed plants. Different production categories of plants appear in a rape crop. Semi-dwarf varieties of winter rapeseed are distinguished by greater silique density, particularly on the main shoot. Moreover, these hybrids are characterized by faster growth of the root system, which enables them to take up nitrogen from the soil more efficiently.

Growth and physiological responses of canola (Brassica napus) to three components of global climate change: temperature, carbon dioxide and drought

Energy Technology Data Exchange (ETDEWEB)

Qaderi, M.M.; Kurepin, L.V.; Reid, D.M. [Univ. of Calgary, Dept. of Biological Sciences, Calgary, Alberta (Canada)

2006-12-15

Elevated CO{sub 2} appears to be a significant factor in global warming, which will likely lead to drought conditions in many areas. Few studies have considered the interactive effects of higher CO{sub 2}, temperature and drought on plant growth and physiology. We grew canola (Brassica napus cv. 45H72) plants under lower (22/18 deg. C) and higher (28/24 deg. C) temperature regimes in controlled-environment chambers at ambient (370 {mu}mol mol-1) and elevated (740 {mu}mol mol-1) CO{sub 2} levels. One half of the plants were watered to field capacity and the other half at wilting point. In three separate experiments, we determined growth, various physiological parameters and content of abscisic acid (ABA), indole-3-acetic acid and ethylene. Drought-stressed plants grown under higher temperature at ambient CO{sub 2} had decreased stem height and diameter, leaf number and area, dry matter, leaf area ratio, shoot/root weight ratio, net CO{sub 2} assimilation and chlorophyll fluorescence. However, these plants had increased specific leaf weight, leaf weight ratio and chlorophyll concentration. Elevated CO{sub 2} generally had the opposite effect. and partially reversed the inhibitory effects of higher temperature and drought on leaf dry weight accumulation. This study showed that higher temperature and drought inhibit many processes but elevated CO{sub 2} partially mitigate some adverse effects. As expected, drought stress increased ABA but higher temperature inhibited the ability of plants to produce ABA in response to drought. (au)

Yield and seed oil content response of dwarf, rapid-cycling Brassica to nitrogen treatments, planting density, and carbon dioxide enrichment

Science.gov (United States)

Frick, J.; Nielsen, S. S.; Mitchell, C. A.

1994-01-01

Effects of N level (15 to 30 mM), time of N increase (14 to 28 days after planting), and planting density (1163 to 2093 plants/m2) were determined for crop yield responses of dwarf, rapid-cycling brassica (Brassica napus L., CrGC 5-2, Genome: ACaacc). Crops were grown in solid-matrix hydroponic systems and under controlled-environment conditions, including nonsupplemented (ambient) or elevated CO2 concentrations (998 +/- 12 micromoles mol-1). The highest seed yield rate obtained (4.4 g m-2 day-1) occurred with the lowest N level (15 mM) applied at the latest treatment time (day 28). In all trials, CO2 enrichment reduced seed yield rate and harvest index by delaying the onset of flowering and senescence and stimulating vegetative shoot growth. The highest shoot biomass accumulation rate (55.5 g m-2 day-1) occurred with the highest N level (30 mM) applied at the earliest time (day 14). Seed oil content was not significantly affected by CO2 enrichment. Maximum seed oil content (30% to 34%, dry weight basis) was obtained using the lowest N level (15 mM) initiated at the latest treatment time (day 28). In general, an increase in seed oil content was accompanied by a decrease in seed protein. Seed carbohydrate, moisture, and ash contents did not vary significantly in response to experimental treatments. Effects of N level and time of N increase were consistently significant for most crop responses. Planting density was significant only under elevated CO2 conditions.

Identification of seed-related QTL in Brassica rapa

NARCIS (Netherlands)

Bagheri, H.; Pino del Carpio, D.; Hanhart, C.J.; Bonnema, A.B.; Keurentjes, J.J.B.; Aarts, M.G.M.

2013-01-01

To reveal the genetic variation, and loci involved, for a range of seed-related traits, a new F2 mapping population was developed by crossing Brassica rapa ssp. parachinensis L58 (CaiXin) with B. rapa ssp. trilocularis R-o-18 (spring oil seed), both rapid flowering and self-compatible. A linkage map

Effects of abscisic acid and high osmoticum on storage protein gene expression in microspore embryos of Brassica napus

International Nuclear Information System (INIS)

Wilen, R.W.; Mandel, R.M.; Pharis, R.P.; Moloney, M.M.; Holbrook, L.A.

1990-01-01

Storage protein gene expression, characteristic of mid- to late embryogenesis, was investigated in microspore embryos of rapeseed (Brassica napus). These embryos, derived from the immature male gametophyte, accumulate little or no detectable napin or cruciferin mRNA when cultured on hormone-free medium containing 13% sucrose. The addition of abscisic acid (ABA) to the medium results in an increase in detectable transcripts encoding both these polypeptides. Storage protein mRNA is induced at 1 micromolar ABA with maximum stimulation occurring between 5 and 50 micromolar. This hormone induction results in a level of storage protein mRNA that is comparable to that observed in zygotic embryos of an equivalent morphological stage. Effects similar to that of ABA are noted when 12.5% sorbitol is added to the microspore embryo medium (osmotic potential = 25.5 bars). Time course experiments, to study the induction of napin and cruciferin gene expression demonstrated that the ABA effect occurred much more rapidly than the high osmoticum effect, although after 48 hours, the levels of napin or cruciferin mRNA detected were similar in both treatments. This difference in the rates of induction is consistent with the idea that the osmotic effect may be mediated by ABA which is synthesized in response to the reduced water potential. Measurements of ABA (by gas chromatography-mass spectrometry using [ 2 H 6 ]ABA as an internal standard) present in microspore embryos during sorbitol treatment and in embryos treated with 10 micromolar ABA were performed to investigate this possibility. Within 2 hours of culture on high osmoticum the level of ABA increased substantially and significantly above control and reached a maximum concentration within 24 hours. This elevated concentration was maintained for 48 hours after culturing and represents a sixfold increase over control embryos

Re-exploration of U's Triangle Brassica Species Based on Chloroplast Genomes and 45S nrDNA Sequences.

Science.gov (United States)

Kim, Chang-Kug; Seol, Young-Joo; Perumal, Sampath; Lee, Jonghoon; Waminal, Nomar Espinosa; Jayakodi, Murukarthick; Lee, Sang-Choon; Jin, Seungwoo; Choi, Beom-Soon; Yu, Yeisoo; Ko, Ho-Cheol; Choi, Ji-Weon; Ryu, Kyoung-Yul; Sohn, Seong-Han; Parkin, Isobel; Yang, Tae-Jin

2018-05-09

The concept of U's triangle, which revealed the importance of polyploidization in plant genome evolution, described natural allopolyploidization events in Brassica using three diploids [B. rapa (A genome), B. nigra (B), and B. oleracea (C)] and derived allotetraploids [B. juncea (AB genome), B. napus (AC), and B. carinata (BC)]. However, comprehensive understanding of Brassica genome evolution has not been fully achieved. Here, we performed low-coverage (2-6×) whole-genome sequencing of 28 accessions of Brassica as well as of Raphanus sativus [R genome] to explore the evolution of six Brassica species based on chloroplast genome and ribosomal DNA variations. Our phylogenomic analyses led to two main conclusions. (1) Intra-species-level chloroplast genome variations are low in the three allotetraploids (2~7 SNPs), but rich and variable in each diploid species (7~193 SNPs). (2) Three allotetraploids maintain two 45SnrDNA types derived from both ancestral species with maternal dominance. Furthermore, this study sheds light on the maternal origin of the AC chloroplast genome. Overall, this study clarifies the genetic relationships of U's triangle species based on a comprehensive genomics approach and provides important genomic resources for correlative and evolutionary studies.

Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L. in response to fungal pathogens and hormone treatments

Directory of Open Access Journals (Sweden)

Deyholos Michael K

2009-06-01

Full Text Available Abstract Background Members of plant WRKY transcription factor families are widely implicated in defense responses and various other physiological processes. For canola (Brassica napus L., no WRKY genes have been described in detail. Because of the economic importance of this crop, and its evolutionary relationship to Arabidopsis thaliana, we sought to characterize a subset of canola WRKY genes in the context of pathogen and hormone responses. Results In this study, we identified 46 WRKY genes from canola by mining the expressed sequence tag (EST database and cloned cDNA sequences of 38 BnWRKYs. A phylogenetic tree was constructed using the conserved WRKY domain amino acid sequences, which demonstrated that BnWRKYs can be divided into three major groups. We further compared BnWRKYs to the 72 WRKY genes from Arabidopsis and 91 WRKY from rice, and we identified 46 presumptive orthologs of AtWRKY genes. We examined the subcellular localization of four BnWRKY proteins using green fluorescent protein (GFP and we observed the fluorescent green signals in the nucleus only. The responses of 16 selected BnWRKY genes to two fungal pathogens, Sclerotinia sclerotiorum and Alternaria brassicae, were analyzed by quantitative real time-PCR (qRT-PCR. Transcript abundance of 13 BnWRKY genes changed significantly following pathogen challenge: transcripts of 10 WRKYs increased in abundance, two WRKY transcripts decreased after infection, and one decreased at 12 h post-infection but increased later on (72 h. We also observed that transcript abundance of 13/16 BnWRKY genes was responsive to one or more hormones, including abscisic acid (ABA, and cytokinin (6-benzylaminopurine, BAP and the defense signaling molecules jasmonic acid (JA, salicylic acid (SA, and ethylene (ET. We compared these transcript expression patterns to those previously described for presumptive orthologs of these genes in Arabidopsis and rice, and observed both similarities and differences in

Digital gene expression analysis of gene expression differences within Brassica diploids and allopolyploids.

Science.gov (United States)

Jiang, Jinjin; Wang, Yue; Zhu, Bao; Fang, Tingting; Fang, Yujie; Wang, Youping

2015-01-27

Brassica includes many successfully cultivated crop species of polyploid origin, either by ancestral genome triplication or by hybridization between two diploid progenitors, displaying complex repetitive sequences and transposons. The U's triangle, which consists of three diploids and three amphidiploids, is optimal for the analysis of complicated genomes after polyploidization. Next-generation sequencing enables the transcriptome profiling of polyploids on a global scale. We examined the gene expression patterns of three diploids (Brassica rapa, B. nigra, and B. oleracea) and three amphidiploids (B. napus, B. juncea, and B. carinata) via digital gene expression analysis. In total, the libraries generated between 5.7 and 6.1 million raw reads, and the clean tags of each library were mapped to 18547-21995 genes of B. rapa genome. The unambiguous tag-mapped genes in the libraries were compared. Moreover, the majority of differentially expressed genes (DEGs) were explored among diploids as well as between diploids and amphidiploids. Gene ontological analysis was performed to functionally categorize these DEGs into different classes. The Kyoto Encyclopedia of Genes and Genomes analysis was performed to assign these DEGs into approximately 120 pathways, among which the metabolic pathway, biosynthesis of secondary metabolites, and peroxisomal pathway were enriched. The non-additive genes in Brassica amphidiploids were analyzed, and the results indicated that orthologous genes in polyploids are frequently expressed in a non-additive pattern. Methyltransferase genes showed differential expression pattern in Brassica species. Our results provided an understanding of the transcriptome complexity of natural Brassica species. The gene expression changes in diploids and allopolyploids may help elucidate the morphological and physiological differences among Brassica species.

The effect of exposure to enhanced UV-B radiation on the penetration of monochromatic and polychromatic UV-B radiation in leaves of Brassica napus

International Nuclear Information System (INIS)

Cen, Y.-P.; Bornman, J.F.

1993-01-01

Using quartz optical fibres, penetration of both monochromatic (310 nm) and polychromatic UV-B (280–320 nm) radiation in leaves of Brassica napus L. (cv. Ceres) was measured. Plants were grown under either visible light (750 μmol m −2 s −1 photosynthetically active radiation) or with the addition of 8. 9 KJ m −2 day −1 biologically effective UV-B (UV-B BE ) radiation. Results showed that of the 310 nm radiation that penetreated the leaf, 90% was within the intial one third of the leaf with high attenuation in the leaf epidermis, especially in UV-treated plants. Polychromatic UV-B radiation, relative to incident radiation, showed a relatively uniform spectral distribution within the leaf, except for collimated radiation. Over 30% of the UV-screening pigments in the leaf, including flavonoids, were found in the adaxial epidermal layer, making this layer less transparent to UV-B radiation than the abaxial epidermis, which contained less than 12% of the UV-screening pigments. UV-screening pigments increased by 20% in UV-treated leaves relative to control leaves. Densely arranged epicuticular wax on the adaxial leaf surface of UV-treated plants may have further decreased penetration of UV-B radiation by reflectance. An increased leaf thickness, and decreases in leaf area and leaf dry weight were also found for UV-treated plants. (author)

Responses of the cabbage seedpod weevil, Ceutorhynchus obstrictus (Marsham) (Coleoptera: Curculionidae), to seed treatments of canola (Brassica napus L.) with the neonicotinoid compounds clothianidin and imidacloprid.

Science.gov (United States)

Dosdall, Lloyd M

2009-12-01

The cabbage seedpod weevil, Ceutorhynchus obstrictus (Marsham), is a major pest in the production of canola (Brassica napus L.) in North America and Europe, and effective population control is often essential for economical crop production. In North America, neonicotinoid insecticides have been used for several years in canola as seed treatments for reducing herbivory by flea beetles. The neonicotinoids clothianidin and imidacloprid were investigated to determine their effects on preimaginal development and on emergence of new-generation adults of C. obstrictus in comparison with effects of lindane, a chlorinated hydrocarbon seed treatment. Mean numbers of second- and third-instar larvae were significantly higher in plants seed-treated with lindane than in plants treated with the neonicotinoid compounds, even though weevil oviposition was similar for all treatments. Emergence of new-generation adults was reduced by 52 and 39% for plants seed-treated with clothianidin and imidacloprid, respectively, compared with emergence from plants treated with lindane. Seed treatment with both clothianidin and imidacloprid produced systemic insecticidal effects on larvae of C. obstrictus, with clothianidin slightly more effective than imidacloprid. Use of clothianidin or imidacloprid as seed treatments can comprise an important component in the integrated management of cabbage seedpod weevil in canola. (c) 2009 Society of Chemical Industry.

Brassica cover crops for nitrogen retention in the Mid-Atlantic coastal plain.

Science.gov (United States)

Dean, Jill E; Weil, Ray R

2009-01-01

Brassica cover crops are new to the mid-Atlantic region, and limited information is available on their N uptake capabilities for effective N conservation. Forage radish (Raphanus sativus L. cv. Daikon), oilseed radish (Raphanus sativus L. cv. Adagio), and rape (Brassica napus L. cv. Dwarf Essex) were compared with rye (Secale cereale L. cv. Wheeler), a popular cover crop in the region, with regard to N uptake ability and potential to decrease N leaching at two sites in Maryland. Plants were harvested in fall and spring for dry matter and N analysis. Soil samples from 0 cm to 105 to 180 cm depth were obtained in fall and spring for NH(4)-N and NO(3)-N analyses. Ceramic cup tension lysimeters were installed at depths of 75 to 120 cm to monitor NO(3)-N in soil pore water. Averaged across 3 site-years, forage radish and rape shoots had greater dry matter production and captured more N in fall than rye shoots. Compared with a weedy fallow control, rape and rye caused similar decreases in soil NO(3)-N in fall and spring throughout the sampled profile. Cover crops had no effect on soil NH(4)-N. During the spring on coarse textured soil, pore water NO(3)-N concentrations in freeze-killed Brassica (radish) plots were greater than in control and overwintering Brassica (rape) and rye plots. On fine textured soil, all cover crops provided a similar decrease in pore water NO(3)-N concentration compared with control. On coarse textured soils, freeze-killed Brassica cover crops should be followed by an early-planted spring main crop.

Cytokinins in shoot apices of Brassica napus plants during vernalization

Czech Academy of Sciences Publication Activity Database

Tarkowská, Danuše; Filek, M.; Biesaga-Koscielniak, J.; Marcinska, I.; Macháčková, Ivana; Krekule, Jan; Strnad, Miroslav

2012-01-01

Roč. 187, č. 1 (2012), s. 105-112 ISSN 0168-9452 R&D Projects: GA AV ČR KAN200380801; GA MŠk ED0007/01/01 Keywords : Cytokinins * Vernalization * Winter rape * Flowering Subject RIV: EF - Botanics Impact factor: 2.922, year: 2012

Impact of Brassica and Lucerne Finishing Feeds and Intramuscular Fat on Lamb Eating Quality and Flavor. A Cross-Cultural Study Using Chinese and Non-Chinese Australian Consumers.

Science.gov (United States)

Frank, Damian; Watkins, Peter; Ball, Alex; Krishnamurthy, Raju; Piyasiri, Udayasika; Sewell, James; Ortuño, Jordi; Stark, Janet; Warner, Robyn

2016-09-14

Use of forage brassicas (Brassica napus) and lucerne (alfalfa; Medicago sativa) as ruminant feeds has been linked to unacceptable flavors in sheepmeat. Lambs from low and high intramuscular fat sires were allocated to one of four finishing feeds-perennial ryegrass (Lolium perenne), lucerne, and two brassica forages-for a 6 week period. Grilled loins (Longissimus thoracis et lumborum) were subjected to chemical and sensory analysis by a trained panel and also evaluated by non-Chinese and Chinese background Australian consumers. Consumer liking was similar for both groups, and liking was highest for the brassica- and lucerne-finished lamb, especially from high intramuscular fat sires. No evidence of a distinctive lucerne- or brassica-induced flavor taint was measured by the trained panel or gas chromatography-mass spectrometry-olfactometry. The diets influenced the composition of lipids and branched-chain fatty acids in the subcutaneous fat, and the concentration of total branched-chain fatty acids was positively correlated with flavor and overall liking. Significantly higher levels of key aroma volatiles were measured in the higher fat samples.

Mineral, vitamin C and crude protein contents in kale ( Brassica ...

African Journals Online (AJOL)

This study compares mineral, vitamin C and crude protein contents at different harvesting stages in kale (Brassica oleraceae var. acephala). Three different harvest periods as first harvest stage (at the rosette stage), second harvest stage (at the budding stage) and third harvest stage (at the flowering/blooming stage) were ...

Enhancing freezing tolerance of Brassica napus L. by overexpression of a stearoyl-acyl carrier protein desaturase gene (SAD) from Sapium sebiferum (L.) Roxb.

Science.gov (United States)

Peng, Dan; Zhou, Bo; Jiang, Yueqiao; Tan, XiaoFeng; Yuan, DeYi; Zhang, Lin

2018-07-01

Sapium sebiferum (L.) Roxb. is an important woody oil tree and traditional herbal medicine in China. Stearoyl-acyl carrier protein desaturase (SAD) is a dehydrogenase enzyme that plays a key role in the transformation of saturated fatty acids into unsaturated fatty acids in oil; these fatty acids greatly influence the freezing tolerance of plants. However, it remains unclear whether freezing tolerance can be regulated by the expression level of SsSAD in S. sebiferum L. Our research indicated that SsSAD expression in S. sebiferum L. increased under freezing stress. To further confirm this result, we constructed a pEGAD-SsSAD vector and transformed it into B. napus L. W10 by Agrobacterium tumefaciens-mediated transformation. Transgenic plants that overexpressed the SsSAD gene exhibited significantly higher linoleic (18:2) and linolenic acid (18:3) content and advanced freezing tolerance. These results suggest that SsSAD overexpression in B. napus L. can increase the content of polyunsaturated fatty acids (PUFAs) such as linoleic (18:2) and linolenic acid (18:3), which are likely pivotal in improving freezing tolerance in B. napus L. plants. Thus, SsSAD overexpression could be useful in the production of freeze-tolerant varieties of B. napus L. Copyright © 2018 Elsevier B.V. All rights reserved.

Morphological and genetic characterization of a new cytoplasmic male sterility system (oxa CMS) in stem mustard (Brassica juncea).

Science.gov (United States)

Heng, Shuangping; Liu, Sansan; Xia, Chunxiu; Tang, HongYu; Xie, Fei; Fu, Tingdong; Wan, Zhengjie

2018-01-01

KEY MESSAGE: oxa CMS is a new cytoplasmic male sterility type in Brassica juncea. oxa CMS is a cytoplasmic male sterility (CMS) line that has been widely used in the production and cultivation of stem mustard in the southwestern China. In this study, different CMS-type specific mitochondrial markers were used to confirm that oxa CMS is distinct from the pol CMS, ogu CMS, nap CMS, hau CMS, tour CMS, Moricandia arvensis CMS, orf220-type CMS, etc., that have been previously reported in Brassica crops. Pollen grains of the oxa CMS line are sterile with a self-fertility rate of almost 0% and the sterility strain rate and sterility degree of oxa CMS is 100% due to a specific flower structure and flowering habit. Scanning electron microscopy revealed that most pollen grains in mature anthers of the oxa CMS line are empty, flat and deflated. Semi-thin section further showed that the abortive stage of anther development in oxa CMS is initiated at the late uninucleate stage. Abnormally vacuolated microspores caused male sterility in the oxa CMS line. This cytological study combined with marker-assisted selection showed that oxa CMS is a novel CMS type in stem mustard (Brassica juncea). Interestingly, the abortive stage of oxa CMS is later than those in other CMS types reported in Brassica crops, and there is no negative effect on the oxa CMS line growth period. This study demonstrated that this novel oxa CMS has a unique flower structure with sterile pollen grains at the late uninucleate stage. Our results may help to uncover the mechanism of oxa CMS in Brassica juncea.

Regulatory network of secondary metabolism in Brassica rapa: insight into the glucosinolate pathway.

Directory of Open Access Journals (Sweden)

Dunia Pino Del Carpio

Full Text Available Brassica rapa studies towards metabolic variation have largely been focused on the profiling of the diversity of metabolic compounds in specific crop types or regional varieties, but none aimed to identify genes with regulatory function in metabolite composition. Here we followed a genetical genomics approach to identify regulatory genes for six biosynthetic pathways of health-related phytochemicals, i.e carotenoids, tocopherols, folates, glucosinolates, flavonoids and phenylpropanoids. Leaves from six weeks-old plants of a Brassica rapa doubled haploid population, consisting of 92 genotypes, were profiled for their secondary metabolite composition, using both targeted and LC-MS-based untargeted metabolomics approaches. Furthermore, the same population was profiled for transcript variation using a microarray containing EST sequences mainly derived from three Brassica species: B. napus, B. rapa and B. oleracea. The biochemical pathway analysis was based on the network analyses of both metabolite QTLs (mQTLs and transcript QTLs (eQTLs. Co-localization of mQTLs and eQTLs lead to the identification of candidate regulatory genes involved in the biosynthesis of carotenoids, tocopherols and glucosinolates. We subsequently focused on the well-characterized glucosinolate pathway and revealed two hotspots of co-localization of eQTLs with mQTLs in linkage groups A03 and A09. Our results indicate that such a large-scale genetical genomics approach combining transcriptomics and metabolomics data can provide new insights into the genetic regulation of metabolite composition of Brassica vegetables.

Bioinformatics analysis of the ς-carotene desaturase gene in cabbage (Brassica oleracea var. capitata)

Science.gov (United States)

Sun, Bo; Zheng, Aihong; Jiang, Min; Xue, Shengling; Zhang, Fen; Tang, Haoru

2018-04-01

ς-carotene desaturase (ZDS) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata ZDS (BocZDS) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocZDS gene mapped to Scaffold000363, and contains an open reading frame of 1,686 bp that encodes a 561-amino acid protein with a calculated molecular mass of 62.00 kD and an isoelectric point (pI) of 8.2. Subcellular localization predicted the BocZDS gene was in the chloroplast. The conserved domain of the BocZDS protein is PLN02487, indicating that it belongs the member of zeta-carotene desaturase. Homology analysis indicates that the ZDS protein is apparently conserved during plant evolution and is most closely related to B. oleracea var. oleracea, B. napus, and B. rapa. The findings of the present study provide a molecular basis for the elucidation of ZDS gene function in cabbage.

Foraging behavior of honey bees (hymenoptera: Apidae) on Brassica nigra and B. rapa grown under simulated ambient and enhanced UV-B radiation

Energy Technology Data Exchange (ETDEWEB)

Collins, S.A.; Robinson, G.E. [Univ. of Illinois, Urbana, IL (United States); Conner, J.K. [Univ. of Illinois, Champaign, IL (United States)

1997-01-01

Two species of mustard, Brassica nigra and B. rapa, were grown under simulated ambient and enhanced ultraviolet-B (UV-B) radiation and exposed to pollinators, Apis mellifera L. Observations were made to determine whether UV-B-induced changes in these plants affected pollinator behavior. Total duration of the foraging trip, number of flowers visited, foraging time per flower, search time per flower, total amount of pollen collected, and pollen collected per flower were measured. There were no significant differences between UV-B treatments in any of the behaviors measured or in any of the pollen measurements. These results suggest that increases in the amount of solar UV-B reaching the earth`s surface may not have a negative effect on the relationship between these members of the genus Brassica and their honey bee pollinators. 28 refs., 2 figs., 1 tab.

Foraging behavior of honey bees (hymenoptera: Apidae) on Brassica nigra and B. rapa grown under simulated ambient and enhanced UV-B radiation

International Nuclear Information System (INIS)

Collins, S.A.; Robinson, G.E.; Conner, J.K.

1997-01-01

Two species of mustard, Brassica nigra and B. rapa, were grown under simulated ambient and enhanced ultraviolet-B (UV-B) radiation and exposed to pollinators, Apis mellifera L. Observations were made to determine whether UV-B-induced changes in these plants affected pollinator behavior. Total duration of the foraging trip, number of flowers visited, foraging time per flower, search time per flower, total amount of pollen collected, and pollen collected per flower were measured. There were no significant differences between UV-B treatments in any of the behaviors measured or in any of the pollen measurements. These results suggest that increases in the amount of solar UV-B reaching the earth's surface may not have a negative effect on the relationship between these members of the genus Brassica and their honey bee pollinators. 28 refs., 2 figs., 1 tab

Genetic diversity analysis of brassica napus/brassica campestris progenies using microsatellite markers

International Nuclear Information System (INIS)

Fayyaz, L.; Farhatullah, A.; Iqbal, S.; Kanwal, M.; Nawaz, I.

2014-01-01

Genetic diversity and relationship of F2 segregating progenies of interspecific crosses between B. napus N-501/B. campestris C-118 were studied. A set of 90 genotypes (2 parental lines and their 88 F2 progenies) was characterized separately using 24 microsatellite or SSR markers to cover the diversity as broadly as possibly present in them. In initial screening only 12 out of 24 SSR primers combination amplified DNA fragments, while the remaining 12 SSR primers did not amplify DNA fragment therefore those 12 SSR molecular markers were not used for further analysis. The 12 SSR primer combinations generated a total of 33 alleles, of that 32 were polymorphic loci, whereas only one was monomorphic locus. Primers BRMS-19 and BRMS-40 were highly polymorphic producing 4 bands each. Primer Ra2-D04 was less polymorphic and it produced only one band. The proportion of polymorphic loci was 95.83% which indicates high genetic diversity among the progenies. The average number of polymorphic alleles per locus was 2.66. The PIC values ranged from 0.395 for primer Ra2-E03 to 0.726 for primer BRMS-019 with an average genetic diversity (PIC value) of 0.584 per locus. Seven primers showed PIC values above 0.5 (50%) indicating high genetic diversity in the studied plant materials. Pair-wise similarity indices among 90 genotypes ranged from 0.3 to 0.95. Dendrogram obtained through UPGMA clustering of F2 progenies depicted eight main groups using similarity coefficient of 0.70. The progenies could be similar to their parents if they have the same banding patterns as that of the parents and could be distinguished from each other by the combination of fragments which are repeatedly present in one progeny and absent in the other. Considerable genetic diversity has been found among the F2 segregating progenies and their parents using SSR markers thus, SSR analysis proved to be a useful tool. (author)

Investigation of growth indices and yield of canola (Brassica napus L. in competition with wild mustard (Sinapis arvensis L. as influenced by different amount of nitrogen application

Directory of Open Access Journals (Sweden)

F. Soleymani

2016-04-01

Full Text Available To evaluate the effect of different levels of nitrogen fertilizer on growth indices and competitive ability of canola (Brassica napus L. against wild mustard (Sinapis arvensis L., a split plot trial based on a randomized complete block design with three replications, was carried out at Agricultural Faculty of Bu-Ali Sina University, during 2008-2009. Experimental factors were amounts of nitrogen fertilizer of urea at four levels (100, 150, 200 and 250 kgN.ha-1 and five wild mustard plant densities (0, 4, 8, 16 and 32 plants.m-2. The results showed that wild mustard interference led to reduction of leaf area index (LAI, dry matter accumulation, crop growth rate (CGR, leaf area index duration (LAID, dry matter duration (BMD and seed yield of canola, while these characteristics were increased with more nitrogen fertilizer application. The maximum indices were obtained at 250 kg N.ha-1 and weed-free condition, but generally, the least reduction in maximum LAI, CGR, LAID and BMD of canola affected by wild mustard competition occurred at 200 kg N.ha-1. In conclusion, the results showed that optimum level of fertilizer 200 kg N.ha-1, increased competitive ability of canola against wild mustard and improved yield and growth indices.

QTL for phytosterol and sinapate ester content in Brassica napus L. collocate with the two erucic acid genes

Science.gov (United States)

Amar, Samija; Ecke, Wolfgang; Becker, Heiko C.

2008-01-01

Improving oil and protein quality for food and feed purposes is an important goal in rapeseed (Brassica napus L.) breeding programs. Rapeseed contains phytosterols, used to enrich food products, and sinapate esters, which are limiting the utilization of rapeseed proteins in the feed industry. Increasing the phytosterol content of oil and lowering sinapate ester content of meal could increase the value of the oilseed rape crop. The objective of the present study was to identify quantitative trait loci (QTL) for phytosterol and sinapate ester content in a winter rapeseed population of 148 doubled haploid lines, previously found to have a large variation for these two traits. This population also segregated for the two erucic acid genes. A close negative correlation was found between erucic acid and phytosterol content (Spearman’s rank correlation, rs = −0.80**). For total phytosterol content, three QTL were detected, explaining 60% of the genetic variance. The two QTL with the strongest additive effects were mapped on linkage groups N8 and N13 within the confidence intervals of the two erucic acid genes. For sinapate ester content four QTL were detected, explaining 53% of the genetic variance. Again, a close negative correlation was found between erucic acid and sinapate ester content (rs = −0.66**) and the QTL with the strongest additive effects mapped on linkage groups N8 and N13 within the confidence intervals of the two erucic acid genes. The results suggests, that there is a pleiotropic effect of the two erucic acid genes on phytosterol and sinapate ester content; the effect of the alleles for low erucic acid content is to increase phytosterol and sinapate ester content. Possible reasons for this are discussed based on known biosynthetic pathways. Electronic supplementary material The online version of this article (doi:10.1007/s00122-008-0734-2) contains supplementary material, which is available to authorized users. PMID:18335203

Low level impurities in imported wheat are a likely source of feral transgenic oilseed rape (Brassica napus L.) in Switzerland.

Science.gov (United States)

Schulze, Juerg; Brodmann, Peter; Oehen, Bernadette; Bagutti, Claudia

2015-11-01

In Switzerland, the cultivation of genetically modified (GM) oilseed rape (Brassica napus L.) and the use of its seeds for food and feed are not permitted. Nevertheless, the GM oilseed rape events GT73, MS8×RF3, MS8 and RF3 have recently been found in the Rhine port of Basel, Switzerland. The sources of GM oilseed rape seeds have been unknown. The main agricultural good being imported at the Rhine port of Basel is wheat and from 2010 to 2013, 19% of all Swiss wheat imports originated from Canada. As over 90% of all oilseed rape grown in Canada is GM, we hypothesised that imports of Canadian wheat may contain low level impurities of GM oilseed rape. Therefore, waste fraction samples gathered during the mechanical cleaning of Canadian wheat from two Swiss grain mills were analysed by separating oilseed rape seeds from waste fraction samples and testing DNA of pooled seeds for the presence of transgenes by real-time PCR. Furthermore, oilseed rape seeds from each grain mill were sown in a germination experiment, and seedling DNA was tested for the presence of transgenes by real-time PCR. GT73, MS8×RF3, MS8 and RF3 oilseed rape was detected among seed samples and seedlings of both grain mills. Based on this data, we projected a mean proportion of 0.005% of oilseed rape in wheat imported from Canada. Besides Canadian wheat, the Rhine port of Basel does not import any other significant amounts of agricultural products from GM oilseed rape producing countries. We therefore conclude that Canadian wheat is the major source of unintended introduction of GM oilseed rape seeds into Switzerland.

Broadening the genetic base of Abyssinian mustard (Brassica carinata A. Braun through introgression of genes from related allotetraploid species

Directory of Open Access Journals (Sweden)

Farooq A. Sheikh

2014-07-01

Full Text Available Brassica carinata (BBCC, 2n=34 has still to emerge as a major oilseed crop owing to poor agronomic attributes like long stature, long maturity duration and low seed yield. The restricted amount of genetic variability available in natural B. carinata necessitates utilization of new sources of variability for broadening its genetic base. Interspecific hybridization followed by selection in selfed and back cross progenies was employed to generate useful variability into B. carinata cv ˈPC5ˈ from elite lines of Brassica napus (AACC, 2n=38 and Brassica juncea (AABB, 2n=36. The morphological evaluation of 24 stable introgressed progenies revealed wide range of variability for key economic traits. The progenies with mean maturity duration of 161 ± 2.1 days, short stature of 139.5 ± 6.5 cm and seed yield per plant of 18.6 ± 2.0 g in comparison to the corresponding figures of 168 ± 4.6 days, 230.6 ± 12.7 cm and 12.0 ± 2.4 g in ˈPC5ˈ (recurrent parent were recovered. Diversity analysis at morphological level revealed that 22 out of 24 stable introgressed progenies were grouped with B. carinata ˈPC5ˈ at average taxonomic distance of 1.19. The diversity at molecular level using 25 polymorphic and reproducible RAPD primers revealed that 19 out of 21 introgressed progenies grouped with B. carinata ˈPC5ˈ at a similarity coefficient of 0.68. The clusters in general represent a wide range of genetic diversity in the back cross lines of B. carinata as a result of introgression of genes from elite lines of B. napus and B. juncea parents.

A comparison of two stomatal conductance models for ozone flux modelling using data from two Brassica species

International Nuclear Information System (INIS)

Op de Beeck, M.; De Bock, M.; Vandermeiren, K.; Temmerman, L. de; Ceulemans, R.

2010-01-01

In this study we tested and compared a multiplicative stomatal model and a coupled semi-empirical stomatal-photosynthesis model in their ability to predict stomatal conductance to ozone (g st ) using leaf-level data from oilseed rape (Brassica napus L.) and broccoli (Brassica oleracea L. var. italica Plenck). For oilseed rape, the multiplicative model and the coupled model were able to explain 72% and 73% of the observed g st variance, respectively. For broccoli, the models were able to explain 53% and 51% of the observed g st variance, respectively. These results support the coupled semi-empirical stomatal-photosynthesis model as a valid alternative to the multiplicative stomatal model for O 3 flux modelling, in terms of predictive performance. - A multiplicative stomatal model and a coupled semi-empirical stomatal-photosynthesis model performed equally well when tested against leaf-level data for oilseed rape and broccoli.

The role of BoFLC2 in cauliflower (Brassica oleracea var. botrytis L.) reproductive development.

Science.gov (United States)

Ridge, Stephen; Brown, Philip H; Hecht, Valérie; Driessen, Ronald G; Weller, James L

2015-01-01

In agricultural species that are sexually propagated or whose marketable organ is a reproductive structure, management of the flowering process is critical. Inflorescence development in cauliflower is particularly complex, presenting unique challenges for those seeking to predict and manage flowering time. In this study, an integrated physiological and molecular approach was used to clarify the environmental control of cauliflower reproductive development at the molecular level. A functional allele of BoFLC2 was identified for the first time in an annual brassica, along with an allele disrupted by a frameshift mutation (boflc2). In a segregating F₂ population derived from a cross between late-flowering (BoFLC2) and early-flowering (boflc2) lines, this gene behaved in a dosage-dependent manner and accounted for up to 65% of flowering time variation. Transcription of BoFLC genes was reduced by vernalization, with the floral integrator BoFT responding inversely. Overall expression of BoFT was significantly higher in early-flowering boflc2 lines, supporting the idea that BoFLC2 plays a key role in maintaining the vegetative state. A homologue of Arabidopsis VIN3 was isolated for the first time in a brassica crop species and was up-regulated by two days of vernalization, in contrast to findings in Arabidopsis where prolonged exposure to cold was required to elicit up-regulation. The correlations observed between gene expression and flowering time in controlled-environment experiments were validated with gene expression analyses of cauliflowers grown outdoors under 'natural' vernalizing conditions, indicating potential for transcript levels of flowering genes to form the basis of predictive assays for curd initiation and flowering time. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

The fate of chromosomes and alleles in an allohexaploid Brassica population.

Science.gov (United States)

Mason, Annaliese S; Nelson, Matthew N; Takahira, Junko; Cowling, Wallace A; Alves, Gustavo Moreira; Chaudhuri, Arkaprava; Chen, Ning; Ragu, Mohana E; Dalton-Morgan, Jessica; Coriton, Olivier; Huteau, Virginie; Eber, Frédérique; Chèvre, Anne-Marie; Batley, Jacqueline

2014-05-01

Production of allohexaploid Brassica (2n = AABBCC) is a promising goal for plant breeders due to the potential for hybrid heterosis and useful allelic contributions from all three of the Brassica genomes present in the cultivated diploid (2n = AA, 2n = BB, 2n = CC) and allotetraploid (2n = AABB, 2n = AACC, and 2n = BBCC) crop species (canola, cabbages, mustards). We used high-throughput SNP molecular marker assays, flow cytometry, and fluorescent in situ hybridization (FISH) to characterize a population of putative allohexaploids derived from self-pollination of a hybrid from the novel cross (B. napus × B. carinata) × B. juncea to investigate whether fertile, stable allohexaploid Brassica can be produced. Allelic segregation in the A and C genomes generally followed Mendelian expectations for an F2 population, with minimal nonhomologous chromosome pairing. However, we detected no strong selection for complete 2n = AABBCC chromosome complements, with weak correlations between DNA content and fertility (r(2) = 0.11) and no correlation between missing chromosomes or chromosome segments and fertility. Investigation of next-generation progeny resulting from one highly fertile F2 plant using FISH revealed general maintenance of high chromosome numbers but severe distortions in karyotype, as evidenced by recombinant chromosomes and putative loss/duplication of A- and C-genome chromosome pairs. Our results show promise for the development of meiotically stable allohexaploid lines, but highlight the necessity of selection for 2n = AABBCC karyotypes.

Conjugated linoleic acid content in milk of Chilean Black Friesian cows under pasture conditions and supplemented with canola seed (Brassica napus concentrate

Directory of Open Access Journals (Sweden)

J. P. Avilez Ruiz

2012-12-01

Full Text Available At present, there is limited and contradictory information about the effects of the use of canola (Brassica napus seed as supplement on the contents of conjugated linoleic acid (CLA in milk of grazing cows. The objective of this study was to evaluate the effect of a dietary supplement with canola seed on the production and composition of milk, and CLA concentration in Chilean Black Friesian cows under pasture conditions. Three experiments were done. Experiment 1: control group was fed 5 kg d-1 of commercial concentrate without canola (0-TC1 and treatment group that was fed 3.75 kg of commercial concentrate plus 1.16 kg of whole canola seed (1.16-TC1. Experiment 2: Control group was fed 8 kg d-1 commercial concentrate without canola (0-TC2 and treatment group that was fed 6.2 kg of commercial concentrate plus 1.2 kg of ground canola seed (1.2-TC2. Experiment 3: control group was fed 6 kg d-1 commercial concentrate without canola (0-TC3 and treatment group was fed 6 kg of commercial concentrate with 20% of whole canola seed (1.2 kg d-1, 1.2-TC3. The duration of each experiment was 60 days. No differences in milk production and quality were observed among the experimental groups in every assay. The CLA isomers trans-10, cis-12 and cis-10, cis-12 were higher than those normally found in the scientific literature. There was no effect of the inclusion of canola seed on total CLA content or the content of cis-9, trans-11, trans-10, cis-12 and cis-10, cis-12 isomers.

Effects of salt stress on phosphorus uptake by european rape sheiaralle

International Nuclear Information System (INIS)

Li Guihua; Zhang Jianfeng; Wei Dongpu; Yang Juncheng; Mei Yong

2007-01-01

The effects of different salinity on phosphorus uptake by European rape Sheiaralle were studied under hydroponics and sand culture conditions. The results showed that above ground uptake of instant P increased with the salinity increased, the uptake of 32 P by roots firstly decreased and then increased with the increase salinity. Instant P uptake by Brassica napus was lower under different salinity treatment than in non-saline condition (P - , but the biomass yield decreased much faster than P uptake, so P relatively condensed, and uptake of P by Brassica napus increased as the salinity (including non-saline treatment) was increased (P<0.05). Fresh weight of Brassica napus decreased significantly with the salinity increased (P<0.05). (authors)

Genome-Wide Gene Expression Disturbance by Single A1/C1 Chromosome Substitution in Brassica rapa Restituted From Natural B. napus

Directory of Open Access Journals (Sweden)

Bin Zhu

2018-03-01

Full Text Available Alien chromosome substitution (CS lines are treated as vital germplasms for breeding and genetic mapping. Previously, a whole set of nine Brassica rapa-oleracea monosonic alien addition lines (MAALs, C1-C9 was established in the background of natural B. napus genotype “Oro,” after the restituted B. rapa (RBR for Oro was realized. Herein, a monosomic substitution line with one alien C1 chromosome (Cs1 in the RBR complement was selected in the progenies of MAAL C1 and RBR, by the PCR amplification of specific gene markers and fluorescence in situ hybridization. Cs1 exhibited the whole plant morphology similar to RBR except for the defective stamens without fertile pollen grains, but it produced some seeds and progeny plants carrying the C1 chromosome at high rate besides those without the alien chromosome after pollinated by RBR. The viability of the substitution and its progeny for the RBR diploid further elucidated the functional compensation between the chromosome pairs with high homoeology. To reveal the impact of such aneuploidy on genome-wide gene expression, the transcriptomes of MAAL C1, Cs1 and euploid RBR were analyzed. Compared to RBR, Cs1 had sharply reduced gene expression level across chromosome A1, demonstrating the loss of one copy of A1 chromosome. Both additional chromosome C1 in MAAL and substitutional chromosome C1 in Cs1 caused not only cis-effect but also prevalent trans-effect differentially expressed genes. A dominant gene dosage effects prevailed among low expressed genes across chromosome A1 in Cs1, and moreover, dosage effects for some genes potentially contributed to the phenotype deviations. Our results provided novel insights into the transcriptomic perturbation and gene dosage effects on phenotype in CS related to one naturally evolved allopolyploid.

Unexpected diversity of feral genetically modified oilseed rape (Brassica napus L. despite a cultivation and import ban in Switzerland.

Directory of Open Access Journals (Sweden)

Juerg Schulze

Full Text Available Despite cultivation and seed import bans of genetically modified (GM oilseed rape (Brassica napus L., feral GM plants were found growing along railway lines and in port areas at four sites in Switzerland in 2011 and 2012. All GM plants were identified as glyphosate-resistant GM event GT73 (Roundup Ready, Monsanto. The most affected sites were the Rhine port of Basel and the St. Johann freight railway station in Basel. To assess the distribution and intra- and interspecific outcrossing of GM oilseed rape in more detail, we monitored these two sites in 2013. Leaves and seed pods of feral oilseed rape plants, their possible hybridization partners and putative hybrid plants were sampled in monthly intervals and analysed for the presence of transgenes by real-time PCR. Using flow cytometry, we measured DNA contents of cell nuclei to confirm putative hybrids. In total, 2787 plants were sampled. The presence of GT73 oilseed rape could be confirmed at all previously documented sampling locations and was additionally detected at one new sampling location within the Rhine port. Furthermore, we found the glufosinate-resistant GM events MS8xRF3, MS8 and RF3 (all traded as InVigor, Bayer at five sampling locations in the Rhine port. To our knowledge, this is the first time that feral MS8xRF3, MS8 or RF3 plants were detected in Europe. Real-time PCR analyses of seeds showed outcrossing of GT73 into two non-GM oilseed rape plants, but no outcrossing of transgenes into related wild species was observed. We found no hybrids between oilseed rape and related species. GM plants most frequently occurred at unloading sites for ships, indicating that ship cargo traffic is the main entry pathway for GM oilseed rape. In the future, it will be of major interest to determine the source of GM oilseed rape seeds.

Unexpected diversity of feral genetically modified oilseed rape (Brassica napus L.) despite a cultivation and import ban in Switzerland.

Science.gov (United States)

Schulze, Juerg; Frauenknecht, Tina; Brodmann, Peter; Bagutti, Claudia

2014-01-01

Despite cultivation and seed import bans of genetically modified (GM) oilseed rape (Brassica napus L.), feral GM plants were found growing along railway lines and in port areas at four sites in Switzerland in 2011 and 2012. All GM plants were identified as glyphosate-resistant GM event GT73 (Roundup Ready, Monsanto). The most affected sites were the Rhine port of Basel and the St. Johann freight railway station in Basel. To assess the distribution and intra- and interspecific outcrossing of GM oilseed rape in more detail, we monitored these two sites in 2013. Leaves and seed pods of feral oilseed rape plants, their possible hybridization partners and putative hybrid plants were sampled in monthly intervals and analysed for the presence of transgenes by real-time PCR. Using flow cytometry, we measured DNA contents of cell nuclei to confirm putative hybrids. In total, 2787 plants were sampled. The presence of GT73 oilseed rape could be confirmed at all previously documented sampling locations and was additionally detected at one new sampling location within the Rhine port. Furthermore, we found the glufosinate-resistant GM events MS8xRF3, MS8 and RF3 (all traded as InVigor, Bayer) at five sampling locations in the Rhine port. To our knowledge, this is the first time that feral MS8xRF3, MS8 or RF3 plants were detected in Europe. Real-time PCR analyses of seeds showed outcrossing of GT73 into two non-GM oilseed rape plants, but no outcrossing of transgenes into related wild species was observed. We found no hybrids between oilseed rape and related species. GM plants most frequently occurred at unloading sites for ships, indicating that ship cargo traffic is the main entry pathway for GM oilseed rape. In the future, it will be of major interest to determine the source of GM oilseed rape seeds.

Ideotype population exploration: growth, photosynthesis, and yield components at different planting densities in winter oilseed rape (Brassica napus L.).

Science.gov (United States)

Ma, Ni; Yuan, Jinzhan; Li, Ming; Li, Jun; Zhang, Liyan; Liu, Lixin; Naeem, Muhammad Shahbaz; Zhang, Chunlei

2014-01-01

Rapeseed is one of the most important edible oil crops in the world and the seed yield has lagged behind the increasing demand driven by population growth. Winter oilseed rape (Brassica napus L.) is widely cultivated with relatively low yield in China, so it is necessary to find the strategies to improve the expression of yield potential. Planting density has great effects on seed yield of crops. Hence, field experiments were conducted in Wuhan in the Yangtze River basin with one conventional variety (Zhongshuang 11, ZS11) and one hybrid variety (Huayouza 9, HYZ9) at five planting densities (27.0×10(4), 37.5×10(4), 48.0×10(4), 58.5×10(4), 69.0×10(4) plants ha(-1)) during 2010-2012 to investigate the yield components. The physiological traits for high-yield and normal-yield populations were measured during 2011-2013. Our results indicated that planting densities of 58.5×10(4) plants ha(-1) in ZS11 and 48.0×10(4) plants ha(-1) in HYZ9 have significantly higher yield compared with the density of 27.0×10(4) plants ha(-1) for both varieties. The ideal silique numbers for ZS11 and HYZ9 were ∼0.9×10(4) (n m(-2)) and ∼1×10(4) (n m(-2)), respectively, and ideal primary branches for ZS11 and HYZ9 were ∼250 (n m(-2)) and ∼300 (n m(-2)), respectively. The highest leaf area index (LAI) and silique wall area index (SAI) was ∼5.0 and 7.0, respectively. Moreover, higher leaf net photosynthetic rate (Pn) and water use efficiency (WUE) were observed in the high-yield populations. A significantly higher level of silique wall photosynthesis and rapid dry matter accumulation were supposed to result in the maximum seed yield. Our results suggest that increasing the planting density within certain range is a feasible approach for higher seed yield in winter rapeseed in China.

Herbivore-Induced DNA Demethylation Changes Floral Signalling and Attractiveness to Pollinators in Brassica rapa.

Directory of Open Access Journals (Sweden)

Roman T Kellenberger

Full Text Available Plants have to fine-tune their signals to optimise the trade-off between herbivore deterrence and pollinator attraction. An important mechanism in mediating plant-insect interactions is the regulation of gene expression via DNA methylation. However, the effect of herbivore-induced DNA methylation changes on pollinator-relevant plant signalling has not been systematically investigated. Here, we assessed the impact of foliar herbivory on DNA methylation and floral traits in the model crop plant Brassica rapa. Methylation-sensitive amplified fragment length polymorphism (MSAP analysis showed that leaf damage by the caterpillar Pieris brassicae was associated with genome-wide methylation changes in both leaves and flowers of B. rapa as well as a downturn in flower number, morphology and scent. A comparison to plants with jasmonic acid-induced defence showed similar demethylation patterns in leaves, but both the floral methylome and phenotype differed significantly from P. brassicae infested plants. Standardised genome-wide demethylation with 5-azacytidine in five different B. rapa full-sib groups further resulted in a genotype-specific downturn of floral morphology and scent, which significantly reduced the attractiveness of the plants to the pollinator bee Bombus terrestris. These results suggest that DNA methylation plays an important role in adjusting plant signalling in response to changing insect communities.

Could nitrile derivatives of turnip (Brassica rapa) glucosinolates be hepato- or cholangiotoxic in cattle?

Science.gov (United States)

Collett, Mark G; Stegelmeier, Bryan L; Tapper, Brian A

2014-07-30

Turnip (Brassica rapa ssp. rapa) and rape (Brassica napus ssp. biennis) and other brassica forage crops are regarded as "safe" feed for cattle during late summer and fall in the North Island of New Zealand when high Pithomyces chartarum spore counts in pastures frequently lead to sporidesmin toxicity (facial eczema). Sporadic acute severe cases of turnip photosensitization in dairy cows characteristically exhibit high γ-glutamyl transferase and glutamate dehydrogenase serum enzyme activities that mimic those seen in facial eczema. The two diseases can, however, be distinguished by histopathology of the liver, where lesions, in particular those affecting small bile ducts, differ. To date, the hepato-/cholangiotoxic phytochemical causing liver damage in turnip photosensitization in cattle is unknown. Of the hydrolysis products of the various glucosinolate secondary compounds found in high concentrations in turnip and rape, work has shown that nitriles and epithionitriles can be hepatotoxic (and nephro- or pancreatotoxic) in rats. These derivatives include β-hydroxy-thiiranepropanenitrile and 3-hydroxy-4-pentenenitrile from progoitrin; thiiranepropanenitrile and 4-pentenenitrile from gluconapin; thiiranebutanenitrile and 5-hexenenitrile from glucobrassicanapin; phenyl-3-propanenitrile from gluconasturtiin; and indole-3-acetonitrile from glucobrassicin. This perspective explores the possibility of the preferential formation of such derivatives, especially the epithionitriles, in acidic conditions in the bovine rumen, followed by absorption, hepatotoxicity, and secondary photosensitization.

Impact of municipal waste water of Quetta city on biomass, physiology and yield of canola (brassica napus l.)

International Nuclear Information System (INIS)

Kakar, S.R.; Tareen, R.B.; Kayani, S.A.; Tariq, M.

2010-01-01

The present study was carried out in order to investigate the impact of municipal wastewater effluents of Quetta city on the biomass, physiology, and productivity of two canola (Brassica napus L.) cultivars viz., Oscar and Rainbow. Plants were grown in pots from seed to maturity during 2005-2006 growth season. Different concentrations of effluents (T1: 20% ,T2: 40%, T3: 60% T4: 80; T5: 100%) were supplied to plants as a soil drench compared to control plants (T0) receiving normal tap water. The wastewater effluents were highly alkaline in nature along with very high Electrical Conductivity, Biological Oxygen Demand; Chemical Oxygen Demand; Sodium Adsorption Ratio, Total Suspended Solids and minerals concentrations have found well above threshold limits set for the usage of municipal wastewater for irrigation purposes. Growth performance of both canola cultivars showed statistically significant effects on some physiological attributes. All treated plants showed reductions in growth and yield parameters, but T5 treated plants were most affected compared to control. There were significantly higher reductions in stomatal conductance (49% in Oscar; 53% in Rainbow), transpiration rate (62% Oscar; 67% in Rainbow), and photosynthetic rate (62% in Oscar; 69% in Rainbow) of T5 treatment plants compared with control. Both pigments of chlorophyll (a and b) responded efficiently to the applied stress of wastewater effluents showing reductions in chlorophyll a and b by 68-82% in cv. Oscar and 74-86% in cv. Rainbow. Similarly, fresh and dry biomass also showed reductions in different effluents treated plants (T1 to T5) ranging from 2-78% in both the cultivars of canola. Drastic reductions were recorded in the number of siliqua per plant (70-72%), seeds per plant (84-85%), seed weight per plant (87-90), and in the harvest index (72-74%) in cultivars Oscar and Rainbow, respectively than that of control. The overall result of the municipal wastewater impacts on canola cultivars are

VALOR NUTRICIO Y CONTENIDO DE SAPONINAS EN GERMINADOS DE HUAUZONTLE (Chenopodium nuttalliae Saff., CALABACITA (Cucurbita pepo L., CANOLA (Brassica napus L. Y AMARANTO (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.

Directory of Open Access Journals (Sweden)

M. R. Barrón-Yánez

2009-01-01

(Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.

Improvement of large quantity breeding method for making radiation breeding efficient and development of cell culture techniques, (3)

International Nuclear Information System (INIS)

Hogetsu, Daisuke; Koyama, Motoko; Minami, Harufumi

1990-01-01

In the creation of useful mutant plants using cell culture techniques, the examination on the effectiveness of selecting useful mutation at cell level and the possibility of raising the selection efficiency by irradiation was aimed at. The experimental method is described. The young plants which accumulate proline were obtained. The cells which showed the resistance to hydroxyproline also showed the resistance to salt. In the improvement of redifferentiation ability by irradiation, the method of fixing IAA in the tissues of azuki plants was examined. The possibility of examining the change of IAA due to irradiation by microautoradiography was obtained. It is intended to examine the distribution of IAA in the formation of adventitious roots from the epicotyl of azuki plants. In the introduction of cell engineering techniques in radiation breeding, it is the objective to introduce the genes which resist sour rot that Brassica campestris, Brassica napus, Brassica oleracea and so on have by utilizing cell fusion process. The fusion of the reproduction cells of Brassica napus pollens and the cell protoplasts of Brassica campestris was successfully carried out. The possibility of new asymmetric fusion in Brassica napus was shown. (K.I.)

ANALYSIS OF SLG GENE – THE MOLECULAR MARKER IN HYBRID BREEDING OF OIL SEED RAPE

Directory of Open Access Journals (Sweden)

L DOLANSKÁ

2004-07-01

Full Text Available Oil seed rape (Brassica napus L. cultivars, donors of quality (SC and self-incompatible (SI lines have been analysed using identification of S-locus. In several Brassica napus cultivars one S-locus SLG gene was detected as dominant and the second S-locus as recessive. Amplification class II SLG gene screened recessive gene in all analysed samples (SC and SI. The DNA fragment of recessive gene corresponded to SLG gene W found in cv. Westar. S-haplotypes were analysed by PCR-RFLP. Different Brassica napus cultivars had an identical electrophoretic profile conforming with nonfunctional A10 allele in B. campestris. In B. napus A10 allele is localised in genome A. The functional recessive SLG gene is probably localised in genome C. Model of their segregation was suggested. SC and SI plants segregated in F2 generation at the ratio of approximately 3:1. This indicates a recessive monogenic disposition of SI in the experimental population.

Evaluation of Effect of Gamma Rays Irradiation for Increasing of Variation in Germination and Agronomic Traits in Oilseed rape (Brassica napus L.

Directory of Open Access Journals (Sweden)

R. Momeni

2012-04-01

Full Text Available Increasing of genetic diversity is one of primary and basic goals of plant breeding programs. Induction of mutation is a method to increase genetic diversity that can be used in accommodate with selection, recombination and or combination of them in plant breeding. The aim of this study was to investigate the impact of different doses of gamma rays (500, 700, 900, 1100 and 1300 Gry on primary growth characters, such as: rate and percentage of germination, the length of rootlet and stemlet in M1 generation, and on agronomic characters such as: plant height, number of lateral branches, number of pods on main and lateral stem, length of pods and weigth of 1000-seed in M2 generation for two varieties of oilseed rape (Brassica napus, PF and Zarfam. Results of lab experiments showed that for both varieties, the germination percentage, the length of rootlet and the length of stemlet were significantly decreased by mutagen in compare with the control. While germination rate was only significantly affected by mutagen in PF. The estimation of "F" showed that there was significant difference between the variance of treatments for the germination rate and germination percentage in PF cultivar and for germination rate and stemlet length in Zarfam cultivar. In fact, increasing of gamma doses causes considerable enhancement in variance of treatment in compare with the control. The maximum relative coefficient of variation was related to 1300 Gry for germination rate of PF. In M2, all traits of study except number of pods on main stem was decreased by different doses of Gamma rays in PF cultivar. In opposition to other traits, Pods on main stem in PF cultivar was increased in different doses of gamma ray in compare with the control. But in Zarfam cultivar, only 1000-seed weight was significantly affected by Gamma rays.

Effect of elevated atmospheric CO/sub 2/on nitrogen distribution and N utilization efficiency in winter rape (brassica napus L.)

International Nuclear Information System (INIS)

Zhang, Z. H.; Lu, S.; Wang, W. M.; Song, H. X.; Lepo, J. E.

2017-01-01

We characterized the responses of plant dry biomass, nitrogen (N) distribution and N-utilization efficiency (NUtE) to changes in CO/sub 2/ concentration through exposure and culture of winter rape under normal-(380 mu mol.mol/sup -1/) and elevated-CO/sub 2/ (760 mu mo mol/sup -1/) conditions. Brassica napus (Xiangyou 15) was used as an agriculturally important model plant. Plants were cultivated in a greenhouse with sand culture under normal- (15 mmol.L/sup -1/) and limited-N (5 mmol.L/sup -1/) conditions. NUtE increased with elevated CO/sub 2/ regardless of whether N was limited. NUtE was higher under N limitation than under normal N conditions for both normal- and elevated-CO/sub 2/ conditions. 15N labeling was used to assess the distribution of N from vegetative- to reproductive-organs.N distribution within the plant and during different developmental stages was affected by CO/sub 2/ concentration and the level of N application. A higher proportion of N was found in siliques at the harvest stage for N-limited plants compared to normal-N plants. The proportion of N absorbed into siliques after the stem elongation stage under elevated-CO/sub 2/ conditions was significantly higher than under normal CO/sub 2/. The proportion of N transport, as well as the total amount of N, absorbed at the stem elongation stage from vegetative organs into siliques under elevated CO/sub 2/ was significantly lower than under normal-CO/sub 2/ conditions. However, the proportion of N absorbed at the stem elongation stage and thus lost from the silique under elevated CO/sub 2/ was significantly higher than under normal CO/sub 2/. In conclusion, limited N or elevated CO/sub 2/ generally benefitted plant NUtE. In addition, after the stem elongation stage, elevated CO/sub 2/ promoted the redistribution of N from plant vegetative tissues to reproductive organs; however, elevated CO/sub 2/ during or before stem elongation had the opposite effect. (author)

Do competitive conditions affect introgression of transgenes from oilseed rape (Brassica napus) to weedy Brassica rapa? AS case study with special reference to transplastomic oilseed rape

DEFF Research Database (Denmark)

Johannessen, Marina

In species where chloroplast inheritance is exclusively or predominantly maternal, pollen-mediated flow of transgenes is reduced if transgenes are inserted in chloroplast DNA instead of nuclear DNA. However, transmission of chloroplast-encoded transgeneswill still occur if transgenic individuals ...... affected the thousand-kernel weight significantly. It was concluded that further introgression of transgenes from transplastomic oilseed rape to B. rapa is mostlikely at current field densities of B. napus and when B. rapa is an abundant weed....

The role of jasmonates in floral nectar secretion.

Directory of Open Access Journals (Sweden)

Venkatesan Radhika

Full Text Available Plants produce nectar in their flowers as a reward for their pollinators and most of our crops depend on insect pollination, but little is known on the physiological control of nectar secretion. Jasmonates are well-known for their effects on senescence, the development and opening of flowers and on plant defences such as extrafloral nectar. Their role in floral nectar secretion has, however, not been explored so far. We investigated whether jasmonates have an influence on floral nectar secretion in oil-seed rape, Brassica napus. The floral tissues of this plant produced jasmonic acid (JA endogenously, and JA concentrations peaked shortly before nectar secretion was highest. Exogenous application of JA to flowers induced nectar secretion, which was suppressed by treatment with phenidone, an inhibitor of JA synthesis. This effect could be reversed by additional application of JA. Jasmonoyl-isoleucine and its structural mimic coronalon also increased nectar secretion. Herbivory or addition of JA to the leaves did not have an effect on floral nectar secretion, demonstrating a functional separation of systemic defence signalling from reproductive nectar secretion. Jasmonates, which have been intensively studied in the context of herbivore defences and flower development, have a profound effect on floral nectar secretion and, thus, pollination efficiency in B. napus. Our results link floral nectar secretion to jasmonate signalling and thereby integrate the floral nectar secretion into the complex network of oxylipid-mediated developmental processes of plants.

Concentrations of thiocyanate and goitrin in human plasma, their precursor concentrations in brassica vegetables, and associated potential risk for hypothyroidism.

Science.gov (United States)

Felker, Peter; Bunch, Ronald; Leung, Angela M

2016-04-01

Brassica vegetables are common components of the diet and have beneficial as well as potentially adverse health effects. Following enzymatic breakdown, some glucosinolates in brassica vegetables produce sulforaphane, phenethyl, and indolylic isothiocyanates that possess anticarcinogenic activity. In contrast, progoitrin and indolylic glucosinolates degrade to goitrin and thiocyanate, respectively, and may decrease thyroid hormone production. Radioiodine uptake to the thyroid is inhibited by 194 μmol of goitrin, but not by 77 μmol of goitrin. Collards, Brussels sprouts, and some Russian kale (Brassica napus) contain sufficient goitrin to potentially decrease iodine uptake by the thyroid. However, turnip tops, commercial broccoli, broccoli rabe, and kale belonging to Brassica oleracae contain less than 10 μmol of goitrin per 100-g serving and can be considered of minimal risk. Using sulforaphane plasma levels following glucoraphanin ingestion as a surrogate for thiocyanate plasma concentrations after indole glucosinolate ingestion, the maximum thiocyanate contribution from indole glucosinolate degradation is estimated to be 10 μM, which is significantly lower than background plasma thiocyanate concentrations (40-69 μM). Thiocyanate generated from consumption of indole glucosinolate can be assumed to have minimal adverse risks for thyroid health. © The Author(s) 2016. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The effect of plant growth-promoting rhizobacteria on the phytoextraction of Cd and Zn by Brassica napus L.

Science.gov (United States)

Dąbrowska, G; Hrynkiewicz, K; Trejgell, A; Baum, C

2017-07-03

The test strains Bacteroidetes bacterium (Ba), Pseudomonas fluorescens (Pf) and Variovorax sp. (Va) were selected in advance for their in vitro capability for growth promotion of rapeseed in the presence of increased concentrations of Cd, Cu, Pb and Zn in the medium. In the pot experiment, the strains were used for single Ba, Pf, Va or combined Ba + Pf, Ba + Va, Pf + Va, and Ba + Pf + Va inoculation of B. napus growing in contaminated soil from alluvial deposits. The positive effect of bacterial strains on plant growth was observed in vitro, but was not confirmed in situ in the contaminated soil, where the tested strains inhibited biomass production, rather than stimulating it. However, single inoculation with Ba significantly increased the chlorophyll content and K + concentration in the leaves. The inoculation of rapeseed with Ba and Va strains was indicated to be the most promising combination for phytoextraction of Cd and Zn from contaminated soil. Combined inoculation with Pf+Va and Pf + Ba+Va significantly decreased the concentration of heavy metals in the roots of rapeseed. We conclude that suitable combinations of PGPR can control the metal uptake of B. napus, selectively increasing either metal extraction or metal stabilization in the rhizosphere and offering promising applications in soil remediation.

Generation and characterization of tribenuron-methyl herbicide-resistant rapeseed (Brasscia napus) for hybrid seed production using chemically induced male sterility.

Science.gov (United States)

Li, Haitao; Li, Juanjuan; Zhao, Bo; Wang, Jing; Yi, Licong; Liu, Chao; Wu, Jiangsheng; King, Graham J; Liu, Kede

2015-01-01

Identification and molecular analysis of four tribenuron-methyl resistant mutants in Brassica napus , which would be very useful in hybrid production using a Chemically induced male sterility system. Chemically induced male sterility (CIMS) systems dependent on chemical hybridization agents (CHAs) like tribenuron-methyl (TBM) represent an important approach for practical utilization of heterosis in rapeseed. However, when spraying the female parents with TBM to induce male sterility the male parents must be protected with a shield to avoid injury to the stamens, which would otherwise complicate the seed production protocol and increase the cost of hybrid seed production. Here we report the first proposed application of a herbicide-resistant cultivar in hybrid production, using a CIMS system based on identifying four TBM-resistant mutants in Brassica napus. Genetic analysis indicated that the TBM resistance was controlled by a single dominant nuclear gene. An in vitro enzyme activity assay for acetohydroxyacid synthase (AHAS) suggested that the herbicide resistance is caused by a gain-of-function mutation in a copy of AHAS genes. Comparative sequencing of the mutants and wild type BnaA.AHAS.a coding sequences identified a C-to-T transition at either position 535 or 536 from the translation start site, which resulted in a substitution of proline with serine or leucine at position 197 according to the Arabidopsis thaliana protein sequence. An allele-specific dCAPS marker developed from the C536T variation co-segregated with the herbicide resistance. Transgenic A. thaliana plants expressing BnaA.ahas3.a conferred herbicide resistance, which confirmed that the P197 substitution in BnaA.AHAS.a was responsible for the herbicide resistance. Moreover, the TBM-resistant lines maintain normal male fertility under TBM treatment and can be of practical value in hybrid seed production using CIMS.

Genomic Prediction of Testcross Performance in Canola (Brassica napus)

Science.gov (United States)

Jan, Habib U.; Abbadi, Amine; Lücke, Sophie; Nichols, Richard A.; Snowdon, Rod J.

2016-01-01

Genomic selection (GS) is a modern breeding approach where genome-wide single-nucleotide polymorphism (SNP) marker profiles are simultaneously used to estimate performance of untested genotypes. In this study, the potential of genomic selection methods to predict testcross performance for hybrid canola breeding was applied for various agronomic traits based on genome-wide marker profiles. A total of 475 genetically diverse spring-type canola pollinator lines were genotyped at 24,403 single-copy, genome-wide SNP loci. In parallel, the 950 F1 testcross combinations between the pollinators and two representative testers were evaluated for a number of important agronomic traits including seedling emergence, days to flowering, lodging, oil yield and seed yield along with essential seed quality characters including seed oil content and seed glucosinolate content. A ridge-regression best linear unbiased prediction (RR-BLUP) model was applied in combination with 500 cross-validations for each trait to predict testcross performance, both across the whole population as well as within individual subpopulations or clusters, based solely on SNP profiles. Subpopulations were determined using multidimensional scaling and K-means clustering. Genomic prediction accuracy across the whole population was highest for seed oil content (0.81) followed by oil yield (0.75) and lowest for seedling emergence (0.29). For seed yieId, seed glucosinolate, lodging resistance and days to onset of flowering (DTF), prediction accuracies were 0.45, 0.61, 0.39 and 0.56, respectively. Prediction accuracies could be increased for some traits by treating subpopulations separately; a strategy which only led to moderate improvements for some traits with low heritability, like seedling emergence. No useful or consistent increase in accuracy was obtained by inclusion of a population substructure covariate in the model. Testcross performance prediction using genome-wide SNP markers shows considerable

Comparative analysis of vitamin C, crude protein, elemental nitrogen ...

African Journals Online (AJOL)

Yomi

2011-12-21

Dec 21, 2011 ... greens (Brassica napus L.) and kale (Brassica oleracea var. acephala) ... Nitrogen is essential for protein production, for proper growth of ... Brassica crops. ..... the effect of trace element-amended fertilizers on their Co, Se, and.

Infestation of Polish Agricultural Soils by Plasmodiophora Brassicae Along The Polish-Ukrainian Border

Directory of Open Access Journals (Sweden)

Jędryczka Małgorzata

2014-07-01

Full Text Available There has been a rapid, worldwide increase in oilseed rape production that has resulted in enormous intensification of oilseed rape cultivation, leading to tight rotations. This in turn, has caused an accumulation of pests as well as foliar and soil-borne diseases. Recently, clubroot has become one of the biggest concerns of oilseed rape growers. Clubroot is caused by the soil-borne protist Plasmodiophora brassicae Woronin. The pathogen may be present in groundwater, lakes, and irrigation water used in sprinkling systems. It can be easily transmitted from one field to another not only by water, but also by soil particles and dust transmitted by wind and on machinery. The aim of our overall study was to check for P. brassicae infestation of Polish agricultural soils. This paper presents the 2012 results of a study performed along the Polish-Ukrainian border in two provinces: Lublin (Lubelskie Voivodeship and the Carpathian Foothills (Podkarpackie Voivodeship, in south-east Poland. Monitoring was done in 11 counties, including nine rural and two municipal ones. In total, 40 samples were collected, out of which 36 were collected from fields located in rural areas and four from municipal areas, with two per municipal region. Each sample was collected at 8-10 sites per field, using a soil auger. The biotest to detect the presence of P. brassicae was done under greenhouse conditions using seedlings of the susceptible Brassicas: B. rapa ssp. pekinensis and the Polish variety of oilseed rape B. napus cv. Monolit. Susceptible plants grown in heavily infested soils produced galls on their roots. A county was regarded as free from the pathogen, if none of the bait plants became infected. The pathogen was found in three out of 40 fields monitored (7.5% in the Carpathian Foothill region. The fields were located in two rural counties. The pathogen was not found in Lublin province, and was also not detected in any of the municipal counties. The detection with

TRANSGENIC PLANTS OF RAPE (BRASSICA NAPUS L. WITH GENE OSMYB4 HAVE INCREASED RESISTANCE TO SALTS OF HEAVY METALS

Directory of Open Access Journals (Sweden)

Raldugina G.N.

2012-08-01

Full Text Available This work aims to study the response of the transgenic spring rape plants (Brassica napus L. var. ‘Westar’ with the rice transfactor-encoding gene Osmyb4 to treatment with salts of heavy metals (HM CuSO4 or ZnSO4 and accumulation in the leaves of biomass, metals, photosynthetic pigments, lipid peroxidation, and antioxidant compounds: total phenols, anthocyanins, and antioxidant enzyme activity superoxide dismutase (SOD and guaiacol peroxidase (POX were determined. Vegetatively propagated transgenic plants and wild-type plants were grown on Hoagland-Snyder medium at 24°C, then at the 5-6th leaves-stage, CuSO4 (in concentration 25-150 mM or ZnSO4 (500 - 5000 mM were added to the growth medium, and plants were exposed to the salts for 15 days. Under the action of small concentrations of salts, the results obtained for the transgenic and untransformed plants did not differ, but at high concentrations strong differences between transgenic and untransformed plants were observed. In transgenic plants, accumulation of biomass was greater. Carotene and xanthophyll were destroyed in transgenic plants less than in the untransformed plants. They have accumulated in their leaves more metal, especially Zn, reaching almost to the accumulation of 7 mg per g of dry biomass, bringing these plants to the hyperaccumulation of Zn. In the tissues of transgenic plants exposed to high concentrations of salts, the content of total phenols, anthocyanins, and low molecular weight compounds, that are responsible for protection against ROS, increased significantly. All these results indicate a greater stability of the transgenic plants to the action of heavy metals, as evidenced also by less activity of lipid peroxidases in their tissue: at high salt concentrations, malondialdehyde (MDA accumulated significantly less in transgenic plants than in non-transformed plant tissues. The greater stability of transgenic plants to stressful effect of HM is also evidenced by the

Transpiration flow controls Zn transport in Brassica napus and Lolium multiflorum under toxic levels as evidenced from isotopic fractionation

Science.gov (United States)

Couder, Eléonore; Mattielli, Nadine; Drouet, Thomas; Smolders, Erik; Delvaux, Bruno; Iserentant, Anne; Meeus, Coralie; Maerschalk, Claude; Opfergelt, Sophie; Houben, David

2015-11-01

Stable zinc (Zn) isotope fractionation between soil and plant has been used to suggest the mechanisms affecting Zn uptake under toxic conditions. Here, changes in Zn isotope composition in soil, soil solution, root and shoot were studied for ryegrass (Lolium multiflorum L.) and rape (Brassica napus L.) grown on three distinct metal-contaminated soils collected near Zn smelters (total Zn 0.7-7.5%, pH 4.8-7.3). The Zn concentrations in plants reflected a toxic Zn supply. The Zn isotopic fingerprint of total soil Zn varied from -0.05‰ to +0.26 ± 0.02‰ (δ66Zn values relative to the JMC 3-0749L standard) among soils, but the soil solution Zn was depleted in 66Zn, with a constant Zn isotope fractionation of about -0.1‰ δ66Zn unit compared to the bulk soil. Roots were enriched with 66Zn relative to soil solution (δ66Znroot - δ66Znsoil solution = Δ66Znroot-soil solution = +0.05 to +0.2 ‰) and shoots were strongly depleted in 66Zn relative to roots (Δ66Znshoot-root = -0.40 to -0.04 ‰). The overall δ66Zn values in shoots reflected that of the bulk soil, but were lowered by 0.1-0.3 ‰ units as compared to the latter. The isotope fractionation between root and shoot exhibited a markedly strong negative correlation (R2 = 0.83) with transpiration per unit of plant weight. Thus, the enrichment with light Zn isotopes in shoot progressed with increasing water flux per unit plant biomass dry weight, showing a passive mode of Zn transport by transpiration. Besides, the light isotope enrichment in shoots compared to roots was larger for rape than for rye grass, which may be related to the higher Zn retention in rape roots. This in turn may be related to the higher cation exchange capacity of rape roots. Our finding can be of use to trace the biogeochemical cycles of Zn and evidence the tolerance strategies developed by plants in Zn-excess conditions.

Epidermal transmittance and phenolic composition in leaves of atrazine-tolerant and atrazine-sensitive cultivars of Brassica napus grown under enhanced UV-B radiation

International Nuclear Information System (INIS)

Olsson, L.C.; Veit, M.; Bornman, J.F.

1999-01-01

Experiments were conducted on the atrazine-tolerant mutant Stallion and the atrazine-sensitive cv. Paroll of Brassica napus L., which were grown under either visible light or with the addition of UV-B radiation (280–320 nm) for 15 days. The mutant has been shown to be sensitive to high levels of visible light as compared to the atrazine-sensitive cultivar and therefore we wished to determine plant response to UV-B radiation with respect to potential pigment changes, certain anatomical features, radiation penetration and partial photosynthesis. With regard to pigment changes, we were particularly interested in whether the compositional shift in flavonol pigments under enhanced UV-B radiation, previously suggested to favour increased antioxidant activity, is confined to the adaxial epidermis, which generally receives most UV-B radiation or whether the pigment shift is also inducible in the abaxial epidermis.As was to be expected, the penetration of UV-B radiation (310 nm) was lower in the UV-B-exposed plants, which was correlated with an increased amount of UV-screening pigments in the adaxial and abaxial epidermal layers. The main flavonoid glycosides showed the largest shift from kaempferol to quercetin as aglycone moiety in the adaxial epidermal layer. However, in the abaxial epidermal layer the hydroxycinnamic acid (HCA) derivatives and kaempferol glycosides were predominant. Penetration of 430 nm light was higher after UV-B exposure, and probably contributed to the fact that photosynthetic efficiency of photosystem II was unchanged or higher after UV-B exposure. UV-B radiation decreased leaf area in the atrazine-tolerant mutant only. Both cultivars showed an increased leaf thickness after UV-B exposure due to cell elongation mainly of the palisade tissue. This was especially evident in the mutant

Heritability and genetic advance studies for biochemical traits in F2-3 introgressed families of Brassica

International Nuclear Information System (INIS)

Farhatullah, N.K.; Khalil, I.H.; Nahed, H.

2015-01-01

Higher heritability estimates along with high genetic advance values are effective in envisaging gain under selection in developing genotypes. The objective of the present study was to evaluate variability, heritability and genetic advance in 10 interspecific F2-3 families of Brassica species (B. napus * B. juncea, B. napus * B. rapa). These families were studied for heterospecific introgression of biochemical traits. Low to high heritability estimates were recorded for seed quality traits. Considerable variations within F2-3 families were observed for biochemical traits. Most of the F2-3 families for oil content and erucic showed moderate to high heritability indicating the slightest influence of environment thus modification of trait by selection would be more effective. Among F2-3 introgressed families Bn-510 x Bj-109 produced high oil i.e., 49.5% while Bn-532 x Br-118 (24.4%), Bn-533 x Bj-109 (24.1%) and high protein percentage in terms of mean performance. In the present research, individual segregating progenies of interspecific cross populations i.e., which possessed combination of desirable traits, were identified which could be incorporated in the future Breeding programs and it may facilitate varietal development. (author)

Influence of radiation damage repair inhibitor on superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) in different sensitive crops

International Nuclear Information System (INIS)

Song Daojun; Xu Dengyi; Wan Zhaoliang; He Shoulin

1997-01-01

The activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) were affected remarkably by 60 Co γ-ray irradiation and radiation damage repair inhibitor (Caf, EDTA). SOD, CAT and POD activities showed the similar change pattern in both soybean (sensitive to radiation) and Brassica napus L. (resistant to radiation) seedlings in all treatments. After reaching the maximum value, SOD activity decreased with the increase of doses. CAT activity had the same change pattern as that of SOD in soybean, while with Brassica napus L., CAT activity remained relatively steady from 300 Gy to 1000 Gy. And POD activity increased with the increase of doses. Compared with H 2 O-treatments, CaF, EDAT post-treatments obviously enhanced SOD, CAT and POD activities. With all the treatments, the three enzyme activities were higher in Brassica napus L. than those in soybean seedlings

Random amplified polymorphic DNA markers of the Brassica alboglabra chromosome of a B. campestris-alboglabra addition line

DEFF Research Database (Denmark)

Bagger Jørgensen, Rikke; Chen, B.Y.; Cheng, B.F.

1996-01-01

The alien C-genome chromosome in a Brassica campestris-alboglabra monosomic addition line was characterized by random amplified polymorphic DNA (RAPD) analysis. The alien chromosome carried three loci, E(c), W-c and Lap-1C, controlling synthesis of erucic acid, white flower colour and a fast...

Synthesis and Herbicidal Activity of 5-Heterocycloxy-3-substituted-1-(3-trifluoromethyl)phenyl-1H-pyrazole

Institute of Scientific and Technical Information of China (English)

XU Han; HU Xu-hong; ZOU Xiao-mao; ZHU You-quan; LIU Bin; HU Fang-zhong; YANG Hua-zheng

2012-01-01

The authors synthesized a series of novel 5-heterocycloxy-3-substituted-1-(3-trifluoromethyl)phenyl-1H- pyrazole derivatives.Herbicidal activities of the two intermediate compounds and thirteen target compounds were evaluated via Brassica napus and Echinochloa crusgalli(L.) Beauv tests.Bioassay results show that some of the compounds exhibit better inhibiting activities against Brassica napus and some of the compounds exhibit bleaching activities against Echinochloa crusgalli(L.) Beauv at 100 μg/mL.

Identification, duplication, evolution and expression analyses of caleosins in Brassica plants and Arabidopsis subspecies.

Science.gov (United States)

Shen, Yue; Liu, Mingzhe; Wang, Lili; Li, Zhuowei; Taylor, David C; Li, Zhixi; Zhang, Meng

2016-04-01

Caleosins are a class of Ca(2+) binding proteins that appear to be ubiquitous in plants. Some of the main proteins embedded in the lipid monolayer of lipid droplets, caleosins, play critical roles in the degradation of storage lipids during germination and in lipid trafficking. Some of them have been shown to have histidine-dependent peroxygenase activity, which is believed to participate in stress responses in Arabidopsis. In the model plant Arabidopsis thaliana, caleosins have been examined extensively. However, little is known on a genome-wide scale about these proteins in other members of the Brassicaceae. In this study, 51 caleosins in Brassica plants and Arabidopsis lyrata were investigated and analyzed in silico. Among them, 31 caleosins, including 7 in A. lyrata, 11 in Brassica oleracea and 13 in Brassica napus, are herein identified for the first time. Segmental duplication was the main form of gene expansion. Alignment, motif and phylogenetic analyses showed that Brassica caleosins belong to either the H-family or the L-family with different motif structures and physicochemical properties. Our findings strongly suggest that L-caleosins are evolved from H-caleosins. Predicted phosphorylation sites were differentially conserved in H-caleosin and L-caleosins, respectively. 'RY-repeat' elements and phytohormone-related cis-elements were identified in different caleosins, which suggest diverse physiological functions. Gene structure analysis indicated that most caleosins (38 out of 44) contained six exons and five introns and their intron phases were highly conserved. Structurally integrated caleosins, such as BrCLO3-3 and BrCLO4-2, showed high expression levels and may have important roles. Some caleosins, such as BrCLO2 and BoCLO8-2, lost motifs of the calcium binding domain, proline knot, potential phosphorylation sites and haem-binding sites. Combined with their low expression, it is suggested that these caleosins may have lost function.

Brassica napus

Indian Academy of Sciences (India)

2011-12-16

Dec 16, 2011 ... 2School of Agriculture and Food Science, Zhejiang A & F University, Lin'an, 311300, People's Republic of China ... was affected by the environmental conditions on 15, 22, 29 or 36 days after ... Journal of Genetics, Vol. 90, No ...

Tolerance of Brassica nigra to Pieris brassicae herbivory

NARCIS (Netherlands)

Blatt, S.E.; Smallegange, R.C.; Hess, L.; Harvey, J.A.; Dicke, M.; Loon, van J.J.A.

2008-01-01

Black mustard, Brassica nigra (L.) Koch, is a wild annual species found throughout Europe and fed on by larvae of the large cabbage-white butterfly, Pieris brassicae L. We examined the impact of herbivory from P. brassicae, a gregarious herbivore, on B. nigra grown from wild seed collected locally.

Induced accumulation of Au, Ag and Cu in Brassica napus grown in a mine tailings with the inoculation of Aspergillus niger and the application of two chemical compounds.

Science.gov (United States)

González-Valdez, Eduardo; Alarcón, Alejandro; Ferrera-Cerrato, Ronald; Vega-Carrillo, Héctor René; Maldonado-Vega, María; Salas-Luévano, Miguel Ángel; Argumedo-Delira, Rosalba

2018-06-15

This study evaluated the ability of Brassica napus for extracting gold (Au), silver (Ag) and copper (Cu) from a mine tailings, with the inoculation of two Aspergillus niger strains, and the application of ammonium thiocyanate (NH 4 SCN) or ammonium thiosulfate [(NH 4 ) 2 S 2 O 3 ]. After seven weeks of growth inoculated or non-inoculated plants were applied with 1 or 2 g kg -1 of either NH 4 SCN or (NH 4 ) 2 S 2 O 3 , respectively. Eight days after the application of the chemical compounds, plants were harvested for determining the total dry biomass, and the content of Au, Ag, and Cu in plant organs. Application of (NH 4 ) 2 S 2 O 3 or NH 4 SCN resulted in enhanced Au-accumulation in stems (447% and 507%, respectively), while either (NH 4 ) 2 S 2 O 3 +Aspergillus, or NH 4 SCN increased the Au-accumulation in roots (198.5% and 404%, respectively) when compared to the control. Treatments with (NH 4 ) 2 S 2 O 3 or (NH 4 ) 2 S 2 O 3 +Aspergillus significantly increased (P ≤ 0.001) the accumulation of Ag in leaves (677% and 1376%, respectively), while NH 4 SCN + Aspergillus, and (NH 4 ) 2 S 2 O 3 enhanced the accumulation in stems (7153% and 6717.5%). The Ag-accumulation in roots was stimulated by NH 4 SCN+ Aspergillus, and (NH 4 ) 2 S 2 O 3 + Aspergillus (132.5% and 178%, respectively), when compared to the control. The combination of NH 4 SCN+Aspergillus significantly enhanced the Cu-accumulation in leaves (228%); whereas NH 4 SCN+ Aspergillus, or (NH 4 ) 2 S 2 O 3 + Aspergillus resulted in greater accumulation of Cu in stems (1233.5% and 1580%, respectively) than the control. Results suggest that either NH 4 SCN or (NH 4 ) 2 S 2 O 3 (with or without Aspergillus) improved the accumulation of Au and Ag by B. napus. Accumulation of Au and Ag in plant organs overpassed the hyperaccumulation criterion (> 1 mg kg -1 of plant biomass); whereas Cu-accumulation in stems and roots also overpassed such criterion (> 1000 mg kg -1 ) by applying

Combining ability for maturity and plant height in brassica rapa (l.) ssp. dichotoma (roxb.) hanelt

International Nuclear Information System (INIS)

Nasim, A.; Farhatullah, A.; Khan, N.U.; Azam, S.M.; Nasim, Z.

2014-01-01

A 5 * 5 F1 diallel cross hybrids of Brassica rapa (L.) ssp. dichotoma (Roxb.) Hanelt along with parents were evaluated through combining ability for days to flowering (initiation and completion), days to maturity and plant height. Highly significant differences were recorded for all the traits. Mean squares due to general, specific and reciprocal combining ability were significant for all the traits except plant height for which the latter two components were non-significant. Prevalence of additive (plant height), non-additive (days to flowering completion; days to maturity) and reciprocal effects (days to flowering initiation) were detected. Parental line G-403 was best general combiner for all the traits. The F1 hybrids G-902 * G-265 (days to flowering initiation), G-902 * G-403 (days to flowering completion), G-265 * G-1500 (days to maturity) and G-909 * G-265 (plant height) were superior and may be exploited for future breeding programs. (author)

Dicty_cDB: Contig-U16187-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available CI 5 ALP Hydra magnipapill... 62 2e-14 2 ( AW719233 ) LjNEST1e12r Lotus japonicus nodule library, matur... 5... 17ACDHMS_UP_015_C09_27OCT2004_075 Brassica napus ... 50 2e-09 3 ( EX123282 ) BR107112 mature green leaf cDNA library...a rapa sub... 50 2e-09 3 ( EX125217 ) BR109047 mature green leaf cDNA library KHLM Bras... 50 2e-09 3 ( EV161608 ) 0085470 Brassic...ETGS6H_UP_013_E04_15NOV2004_024 Brassica napus 6... 50 3e-08 3 ( CV515629 ) 0048P0010Z_H11_T7 Mimulus guttatus library 1 Mimu...E543256 ) 9RDBNGA_UP_037_C07_03DEC2003_059 Brassica napus -... 50 3e-08 3 ( CV515401 ) 0048P0009Z_D01_T7 Mimulus guttatus library

Role of relative humidity in processing and storage of seeds and assessment of variability in storage behaviour in Brassica spp. and Eruca sativa.

Science.gov (United States)

Suma, A; Sreenivasan, Kalyani; Singh, A K; Radhamani, J

2013-01-01

The role of relative humidity (RH) while processing and storing seeds of Brassica spp. and Eruca sativa was investigated by creating different levels of relative humidity, namely, 75%, 50%, 32%, and 11% using different saturated salt solutions and 1% RH using concentrated sulphuric acid. The variability in seed storage behaviour of different species of Brassica was also evaluated. The samples were stored at 40 ± 2°C in sealed containers and various physiological parameters were assessed at different intervals up to three months. The seed viability and seedling vigour parameters were considerably reduced in all accessions at high relative humidity irrespective of the species. Storage at intermediate relative humidities caused minimal decline in viability. All the accessions performed better at relative humidity level of 32% maintaining seed moisture content of 3%. On analyzing the variability in storage behaviour, B. rapa and B. juncea were better performers than B. napus and Eruca sativa.

Efficiency of wheat brassica mixtures with different seed rates in rainfed areas of potohar-pakistan

International Nuclear Information System (INIS)

Khan, S.; Khan, M.A.; Akmal, M.; Jabeen, A.

2014-01-01

Mixed over sole cropping is advantageous under the rainfed conditions in Pakistan. This avoids risk of complete crop failure and may returns higher income. The study aimed to investigate appropriate seed-rates combination for wheat-Brassica as mixed- or intercropped in rainfed conditions. Experiments were conducted at National Agricultural Research Center (NARC), Islamabad Pakistan during winter 2004-05 and 2005-06 using 10 treatments for wheat and Brassica as sole and mixed- or intercropped with 100 and 5 kg ha/sup -1/ for sole crop and 100 kg ha/sup -1/ for wheat with 40, 50, 60, and 70% lower than the recommended for Brassica. Sowing was done in 3rd week of October each year, in lines spaced 30cm. Fertilizer was applied N 48, P/sub 2/O/sub 5/ 34 and K/sub 2/O 18 (kg ha/sup -1/). Brassica was manually removed for fodder at flowering. Seed rate (SR) significantly (p<0.05) affected wheat grain yield. Cropping system (CS) significantly (p<0.05) affected grain yield of Brassica. Interactions of CS and SR were also significant (p<0.05) for both species. Planned mean comparison for grain yield was found significant (p<0.05) for wheat and brassica. Grain yield for sole wheat was 4.28t ha/sup -1/ but reported higher in mixed than intercropped. Grain yield of wheat decreased with increase in seed rate of Brassica as intercropped. Higher grain yield (4.39 t ha/sup -1/) of wheat was recorded for seed rates combinations 100:50 (%) as wheat: Brassica intercropped. The land equivalent ratio (LER) for mixed or intercropped system was higher than the sole crop and it increased with increase in the seed rate of Brassica as mixed crop but decreased as intercropped. The high LER was associated to treatment 100:50 (%) seed rates combination for wheat:Brassica as intercropped. Intercropped resulted the greater LER (1.78) than the mixed crop (1.66) and was found most effective for sustainable production in the rainfed areas for a higher net return. (author)

High-throughput phenotyping (HTP) identifies seedling root traits linked to variation in seed yield and nutrient capture in field-grown oilseed rape (Brassica napus L.).

Science.gov (United States)

Thomas, C L; Graham, N S; Hayden, R; Meacham, M C; Neugebauer, K; Nightingale, M; Dupuy, L X; Hammond, J P; White, P J; Broadley, M R

2016-04-06

Root traits can be selected for crop improvement. Techniques such as soil excavations can be used to screen root traits in the field, but are limited to genotypes that are well-adapted to field conditions. The aim of this study was to compare a low-cost, high-throughput root phenotyping (HTP) technique in a controlled environment with field performance, using oilseed rape (OSR;Brassica napus) varieties. Primary root length (PRL), lateral root length and lateral root density (LRD) were measured on 14-d-old seedlings of elite OSR varieties (n = 32) using a 'pouch and wick' HTP system (∼40 replicates). Six field experiments were conducted using the same varieties at two UK sites each year for 3 years. Plants were excavated at the 6- to 8-leaf stage for general vigour assessments of roots and shoots in all six experiments, and final seed yield was determined. Leaves were sampled for mineral composition from one of the field experiments. Seedling PRL in the HTP system correlated with seed yield in four out of six (r = 0·50, 0·50, 0·33, 0·49;P emergence in three out of five (r = 0·59, 0·22, 0·49;P emergence, general early vigour or yield in the field. Associations between PRL and field performance are generally related to early vigour. These root traits might therefore be of limited additional selection value, given that vigour can be measured easily on shoots/canopies. In contrast, LRD cannot be assessed easily in the field and, if LRD can improve nutrient uptake, then it may be possible to use HTP systems to screen this trait in both elite and more genetically diverse, non-field-adapted OSR. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company.

Expression analysis of four flower-specific promoters of Brassica spp ...

African Journals Online (AJOL)

STORAGESEVER

2009-10-19

Oct 19, 2009 ... power of the promoter. Besides, several enhancer and suppressor regions were also identified in the ... of the target gene and decrement of the burden of plant growth and ..... Meyerowitz's ABC model of flower development.

Molecular Characterization of a Leaf Senescence-Related Transcription Factor BrWRKY75 of Chinese Flowering Cabbage

Directory of Open Access Journals (Sweden)

Xiaoli Tan

2016-09-01

Full Text Available WRKY is a plant-specific transcription factor (TF involved in the regulation of many biological processes; however, its role in leaf senescence of leafy vegetables remains unknown. In the present work, a WRKY TF, termed BrWRKY75 was isolated from Chinese flowering cabbage [Brassica rapa L. ssp. chinensis (L. Mokino var. utilis Tsen et Lee]. Analysis of deduced amino acid sequence and the phylogenetic tree showed that BrWRKY75 has high homology with WRKY75 from Brassica oleracea and Arabidopsis thaliana, and belongs to the II c sub-group. Sub-cellular localization and transcriptional activity analysis revealed that BrWRKY75 is a nuclear protein with transcriptional repression activity, and was up-regulated during leaf senescence. Electrophoretic mobility shift assay confirmed that BrWRKY75 directly bound to the W-box (TTGAC cis-element. Collectively, these results provide a basis for further investigation of the transcriptional regulation of Chinese flowering cabbage leaf senescence.

Characterization of the Mamestra configurata (Lepidoptera: Noctuidae) larval midgut protease complement and adaptation to feeding on artificial diet, Brassica species, and protease inhibitor.

Science.gov (United States)

Erlandson, Martin A; Hegedus, Dwayne D; Baldwin, Douglas; Noakes, Amy; Toprak, Umut

2010-10-01

The midgut protease profiles from 5th instar Mamestra configurata larvae fed various diets (standard artificial diet, low protein diet, low protein diet with soybean trypsin inhibitor [SBTI], or Brassica napus) were characterized by one-dimensional enzymography in gelatin gels. The gut protease profile of larvae fed B. napus possessed protease activities of molecular masses of approximately 33 and 55 kDa, which were not present in the guts of larvae fed artificial diet. Similarly, larvae fed artificial diet had protease activities of molecular masses of approximately 21, 30, and 100 kDa that were absent in larvae fed B. napus. Protease profiles changed within 12 to 24 h after switching larvae from artificial diet to plant diet and vice versa. The gut protease profiles from larvae fed various other brassicaceous species and lines having different secondary metabolite profiles did not differ despite significant differences in larval growth rates on the different host plants. Genes encoding putative digestive proteolytic enzymes, including four carboxypeptidases, five aminopeptidases, and 48 serine proteases, were identified in cDNA libraries from 4th instar M. configurata midgut tissue. Many of the protease-encoding genes were expressed at similar levels on all diets; however, three chymoptrypsin-like genes (McSP23, McSP27, and McSP37) were expressed at much higher levels on standard artificial diet and diet containing SBTI as was the trypsin-like gene McSP34. The expression of the trypsin-like gene McSP50 was highest on B. napus. The adaptation of M. configurata digestive biochemistry to different diets is discussed in the context of the flexibility of polyphagous insects to changing diet sources.

Depletion of cellular brassinolide decreases embryo production and disrupts the architecture of the apical meristems in Brassica napus microspore-derived embryos.

Science.gov (United States)

Belmonte, Mark; Elhiti, Mohamed; Waldner, Blaine; Stasolla, Claudio

2010-06-01

Exogenous applications of brassinolide (BL) increased the number and quality of microspore-derived embryos (MDEs) whereas treatments with brassinazole (BrZ), a BL biosynthetic inhibitor, had the opposite effect. At the optimal concentration (4x10(-6) M) BrZ decreased both embryo yield and conversion to less than half the value of control embryos. Metabolic studies revealed that BL levels had profound effects on glutathione and ascorbate metabolism by altering the amounts of their reduced forms (ASC and GSH) and oxidized forms [dehydroascorbate (DHA), ascorbate free radicals (AFRs), and GSSG]. Applications of BL switched the glutathione and ascorbate pools towards the oxidized forms, thereby lowering the ASC/ASC+DHA+AFR and GSH/GSH+GSSG ratios. These changes were ascribed to the ability of BL to increase the activity of ascorbate peroxidase (APX) and decrease that of glutathione reductase (GR). This trend was reversed in a BL-depleted environment, effected by BrZ applications. These metabolic alterations were associated with changes in embryo structure and performance. BL-treated MDEs developed zygotic-like shoot apical meristems (SAMs) whereas embryos treated with BrZ developed abnormal meristems. In the presence of BrZ, embryos either lacked a visible SAM, or formed SAMs in which the meristematic cells showed signs of differentiation, such as vacuolation and storage product accumulation. These abnormalities were accompanied by the lack or misexpression of three meristem marker genes isolated from Brassica napus (denoted as BnSTM, BnCLV1, and BnZLL-1) homologous to the Arabidopsis SHOOTMERISTEMLESS (STM), CLAVATA 1 (CLV1), and ZWILLE (ZLL). The expression of BnSTM and BnCLV1 increased after a few days in cultures in embryos treated with BL whereas an opposite tendency was observed with applications of BrZ. Compared with control embryos where these two genes exhibited abnormal localization patterns, BnSTM and BnCLV1 always localized throughout the subapical domains

Induced polyploidization in Brassica campestris L. (Brassicaceae).

Science.gov (United States)

Kumar, G; Dwivedi, K

2014-01-01

Present experimental design has been made up to obtain crop with higher ploidy level via synthetic polyploidization. Since ploidy manipulation is generally associated with the obtainment of some increased enviable traits of the crop and also provides them greater adaptability to unfavorable or harsh circumstances as compared to its diploids counterparts. Thus, herein present research autotetraploids of Brassica campestris L. have been lucratively achieved by the application of colchicine. Two methods of treatment were utilized i.e. seed treatment and seedling treatment. No polyploidy could be obtained through seed treatment while seedling treatment responded well towards polyploidy. However, the status of autotetraploidy has been confirmed by cytomorphological investigations of treated plants as against its diploids counterparts. For the purpose, morphological parameters such as increased stomata size, pollen diameter, flower size, reproductive organs whereas reduction in plant height, leaf length, leaf breadth, stomata frequency, number of flowers/inflorescence etc. were appraised. Further, cytological observations were made that had clearly revealed the doubling of genome in the autotetraploids as compared to diploids. Meanwhile, pollen fertility and size of pollen grains were evaluated as well.

Genetic analisys of a cross of gaillon (Brassica oleracea var. alboglabra with cauliflower (B.oleracea var. botrytis

Directory of Open Access Journals (Sweden)

Vanessa B.M.G. Spini

2000-03-01

Full Text Available The cauliflower (Brassica oleracea var. botrytis is an annual vegetable cultivated in Southern and Southwestern Brazil with limited production in the Northeast and Centralwest. A variety of Chinese kale, "kaai laan" or "gaillon" (Brassica oleracea var. alboglabra, produces seeds at high temperatures and therefore can do so in North and Northeastern Brazil. Gaillon and cauliflower were crossed 55 times using 10 gaillon plants as mothers and 4 cauliflower plants as pollen donors. From these crosses, in the F2 generation, 612 plants with inflorescence like gaillon and 48 plants with inflorescence like cauliflower were obtained, in a proportion similar to 15:1, implying that 2 pairs of genes entered into formation of the cauliflower inflorescence type. In order to study flower color, 339 plants were analyzed: 274 presented white flowers and 65, yellow flowers, denoting that this caracter is determined by 1 pair of genes, white being dominant over yellow; white flowers had a slighly higher adaptive value in our population. The characteristic waxy leaf showed a proportion of 3 waxy plants for 1 not waxy, indicating the action of one pair of genes.A couve-flor (Brassica oleracea var. botrytis é um vegetal anual e tem seu cultivo no Brasil limitado às regiões Sul e Sudeste, com pequena produção no Nordeste e Centro-Oeste. Uma variedade de couve da China, "kaai laan" ou "gaillon" (Brassica oleracea var. alboglabra, produz sementes em altas temperaturas e, portanto, é apta a produzir sementes no Norte e Nordeste do Brasil. Gaillon e couve-flor foram cruzados. Foram feitos 55 cruzamentos usando 10 plantas de gaillon como mãe e 4 plantas de couve-flor como doadores de pólen. Desses cruzamentos, na geração F2, 612 plantas com inflorescência tipo gaillon e 48 plantas com inflorescência tipo couve-flor foram obtidas, em proporção similar a 15:1, demonstrando que 2 pares de genes estão envolvidos na formação da inflorescência em couve

Characterization of cysteine-degrading and H2S-releasing enzymes of higher plants - From the field to the test tube and back

DEFF Research Database (Denmark)

Jutta, Papenbrock; Anja, Riemenschneider; Kamp, Anja

2007-01-01

focussed mainly on the release of H2S as defence strategy. In field experiments using different Brassica napus genotypes it was shown that the genetic differ- ences among Brassica genotypes lead to differences in sulfur content and L-cysteine desulfhydrase activity. Another field ex- periment demonstrated...... that sulfur supply and infection with Pyrenopeziza brassica influenced L-cysteine desulfhydrase activity in Brassica napus. Cysteine-degrading enzymes such as cysteine desulfhydrases are hypothesized to be involved in H2S release. Several L- and D-cysteine-specific desulfhydrase candidates have been isolated...... in plants which might be involved in SIR, such as high levels of thiols, glucosinolates, cysteine-rich proteins, phytoalexins, elemental sulfur, or H2S. Probably more than one strategy is used by plants. Species- or even variety-dependent differences in the development of SIR are probably used. Our research...

Genome-wide identification of QTL for seed yield and yield-related traits and construction of a high-density consensus map for QTL comparison in Brassica napus

Directory of Open Access Journals (Sweden)

Weiguo eZhao

2016-01-01

Full Text Available Seed yield (SY is the most important trait in rapeseed, which was determined by multiple seed yield-related traits (SYRTs and also easily subject to environmental influence. Lots of quantitative trait loci (QTL for SY and SYRTs were reported in Brassica napus. However, no studies have focused on SY and seven agronomic traits affecting SY simultaneous. Genome-wide QTL analysis for SY and seven SYRTs in eight environments was conducted in a doubled haploid population containing 348 lines. Totally, 18 and 208 QTLs for SY and SYRTs were observed, respectively, and then these QTLs were integrated into 144 consensus QTLs by a meta-analysis. Three major QTLs for SY were observed, including cqSY-C6-2 and cqSY-C6-3 that expressed stably in winter cultivation area for three years and cqSY-A2-2 only expressed in spring rapeseed area. Trait-by-trait meta-analysis revealed that the 144 consensus QTLs were integrated into 72 pleiotropic unique QTLs. Among them, all the unique QTLs affected SY, except for uq-A6-1, including uq.A2-3, uq.C1-2, uq.C1-3, uq.C6-1, uq.C6-5 and uq.C6-6 could also affect more than two SYRTs. According to high density consensus map construction and QTL comparison from literature, 36 QTLs from five populations were co-localized with QTLs identified in this study. In addition, 13 orthologs genes were observed, including five each genes for SY and SW, one each gene for BY, BH and PH, respectively. The genomic information of these QTLs would be valuable in hybrid cultivar breeding, and be helpful to analyze QTL expression in different environments.

Effect of different methods of soil fertility increasing via application of organic, chemical and biological fertilizers on grain yield and quality of canola (Brassica napus L.

Directory of Open Access Journals (Sweden)

K. Mohammadi

2016-05-01

Full Text Available Different resource of fertilizers had an effect on grain yield, oil and grain quality. Information regarding the effect of simultaneous application of organic, chemical and biological fertilizers on canola (Brassica napus L. traits is not available. In order to study the effect of different systems of soil fertility on grain yield and quality of canola (Talayeh cultivar, an experiment was conducted at experimental farm of Agricultural Research Center of Sanandaj, Iran, during two growing seasons of 2007-2008 and 2008-2009. The experimental units were arranged as split plots based on randomized complete blocks design with three replications. Main plots consisted of five methods for obtaining the basal fertilizers requirement including (N1: farm yard manure; (N2: compost; (N3: chemical fertilizers; (N4: farm yard manure + compost and (N5: farm yard manure + compost + chemical fertilizers; and control (N6. Sub plots consisted four levels of biofertilizers were (B1: Bacillus lentus and Pseudomonas putida; (B2: Trichoderma harzianum; (B3: Bacillus lentus and Pseudomonas putida and Trichoderma harzianum; and (B4: control, (without biofertilizers. Results showed that basal fertilizers and biofertilizers have a significant effect on grain yield. The highest grain yield was obtained from N5 treatment in which organic and chemical fertilizers were applied simultaneously applied. Basal fertilizers, biofertilizers have a significant effect on leaf chlorophyll. The highest nitrogen content (42.85 mg.g-1 and least amount of (N/S were obtained from N5 treatment. The highest oil percent was obtained from N1 and N2 treatments and highest oil yield was obtained from N5 treatment. Finally, application of organic manure and biofertilizers with chemical fertilizer led to an increase in yield and quality of canola grain.

Oviposition Preference for Young Plants by the Large Cabbage Butterfly (Pieris brassicae ) Does not Strongly Correlate with Caterpillar Performance.

Science.gov (United States)

Fei, Minghui; Harvey, Jeffrey A; Yin, Yi; Gols, Rieta

2017-06-01

The effects of temporal variation in the quality of short-lived annual plants on oviposition preference and larval performance of insect herbivores has thus far received little attention. This study examines the effects of plant age on female oviposition preference and offspring performance in the large cabbage white butterfly Pieris brassicae. Adult female butterflies lay variable clusters of eggs on the underside of short-lived annual species in the family Brassicaceae, including the short-lived annuals Brassica nigra and Sinapis arvensis, which are important food plants for P. brassicae in The Netherlands. Here, we compared oviposition preference and larval performance of P. brassicae on three age classes (young, mature, and pre-senescing) of B. nigra and S. arvensis plants. Oviposition preference of P. brassicae declined with plant age in both plant species. Whereas larvae performed similarly on all three age classes in B. nigra, preference and performance were weakly correlated in S. arvensis. Analysis of primary (sugars and amino acids) and secondary (glucosinolates) chemistry in the plant shoots revealed that differences in their quality and quantity were more pronounced with respect to tissue type (leaves vs. flowers) than among different developmental stages of both plant species. Butterflies of P. brassicae may prefer younger and smaller plants for oviposition anticipating that future plant growth and size is optimally synchronized with the final larval instar, which contributes >80% of larval growth before pupation.

Diversity Analysis of Ethiopian Mustard Breeding Lines Using RAPD ...

African Journals Online (AJOL)

Ethiopian mustard (Brassica carinata A. Braun) is an oilseed crop less known to the ... have also been used for cultivar identification in B. napus (Ren et al. ..... of Brassica oleracea L. group (2n=18) using random amplified polymorphic DNA.

High oleic acid content materials of rapeseed (Brassica napus) produced by radiation breeding

International Nuclear Information System (INIS)

Guan Chunyun; Liu Chunlin; Chen Sheyuan

2006-01-01

High oleic acid content rapeseed breeding has great significance, because high oleic acid oil is a healthy and nutritious oil, which is of a long shelflife and also propitious to producing biodiesel fuel. The high oleic acid content breeding materials of rapeseed (B. napus) were obtained by 80-100 kR ~(60)Co gamma ray ionizing radiation treatment of dry seeds and continuous selection. The results showed that the oleic acid contents of M (2), M (3) and M (4) progenies increased by different grades. Moreover, the oleic acid content of M (5) progeny increased greatly. The oleic acid contents were higher than 70% in the most of the plants and the highest one reached 93.5 %. The base G was transited by base A in fad (2) gene at the 270 site of high oleic acid mutation (M(6) 04-855). The location is at the beta folding area and conservative area of this protein. Base mutation at sites 1 044 and 1 062 also led to produce a stop condon. These changes in structure led to loss the function of fad (2). According to molecular mechanism of gene mutation, no matter what transvertion or transition happens, several replications are needed. That is to say several generations are needed. That was also the reason why high oleic acid content mutation occurred in later generations

Identification of metabolic QTLs and candidate genes for glucosinolate synthesis in Brassica oleracea leaves, seeds and flower buds.

Directory of Open Access Journals (Sweden)

Tamara Sotelo

Full Text Available Glucosinolates are major secondary metabolites found in the Brassicaceae family. These compounds play an essential role in plant defense against biotic and abiotic stresses, but more interestingly they have beneficial effects on human health. We performed a genetic analysis in order to identify the genome regions regulating glucosinolates biosynthesis in a DH mapping population of Brassica oleracea. In order to obtain a general overview of regulation in the whole plant, analyses were performed in the three major organs where glucosinolates are synthesized (leaves, seeds and flower buds. Eighty two significant QTLs were detected, which explained a broad range of variability in terms of individual and total glucosinolate (GSL content. A meta-analysis rendered eighteen consensus QTLs. Thirteen of them regulated more than one glucosinolate and its content. In spite of the considerable variability of glucosinolate content and profiles across the organ, some of these consensus QTLs were identified in more than one tissue. Consensus QTLs control the GSL content by interacting epistatically in complex networks. Based on in silico analysis within the B. oleracea genome along with synteny with Arabidopsis, we propose seven major candidate loci that regulate GSL biosynthesis in the Brassicaceae family. Three of these loci control the content of aliphatic GSL and four of them control the content of indolic glucosinolates. GSL-ALK plays a central role in determining aliphatic GSL variation directly and by interacting epistatically with other loci, thus suggesting its regulatory effect.

Brassica ASTRA: an integrated database for Brassica genomic research.

Science.gov (United States)

Love, Christopher G; Robinson, Andrew J; Lim, Geraldine A C; Hopkins, Clare J; Batley, Jacqueline; Barker, Gary; Spangenberg, German C; Edwards, David

2005-01-01

Brassica ASTRA is a public database for genomic information on Brassica species. The database incorporates expressed sequences with Swiss-Prot and GenBank comparative sequence annotation as well as secondary Gene Ontology (GO) annotation derived from the comparison with Arabidopsis TAIR GO annotations. Simple sequence repeat molecular markers are identified within resident sequences and mapped onto the closely related Arabidopsis genome sequence. Bacterial artificial chromosome (BAC) end sequences derived from the Multinational Brassica Genome Project are also mapped onto the Arabidopsis genome sequence enabling users to identify candidate Brassica BACs corresponding to syntenic regions of Arabidopsis. This information is maintained in a MySQL database with a web interface providing the primary means of interrogation. The database is accessible at http://hornbill.cspp.latrobe.edu.au.

Molecular Diversity Analysis and Genetic Mapping of Pod Shatter Resistance Loci in Brassica carinata L.

Directory of Open Access Journals (Sweden)

Rosy Raman

2017-11-01

Full Text Available Seed lost due to easy pod dehiscence at maturity (pod shatter is a major problem in several members of Brassicaceae family. We investigated the level of pod shatter resistance in Ethiopian mustard (Brassica carinata and identified quantitative trait loci (QTL for targeted introgression of this trait in Ethiopian mustard and its close relatives of the genus Brassica. A set of 83 accessions of B. carinata, collected from the Australian Grains Genebank, was evaluated for pod shatter resistance based on pod rupture energy (RE. In comparison to B. napus (RE = 2.16 mJ, B. carinata accessions had higher RE values (2.53 to 20.82 mJ. A genetic linkage map of an F2 population from two contrasting B. carinata selections, BC73526 (shatter resistant with high RE and BC73524 (shatter prone with low RE comprising 300 individuals, was constructed using a set of 6,464 high quality DArTseq markers and subsequently used for QTL analysis. Genetic analysis of the F2 and F2:3 derived lines revealed five statistically significant QTL (LOD ≥ 3 that are linked with pod shatter resistance on chromosomes B1, B3, B8, and C5. Herein, we report for the first time, identification of genetic loci associated with pod shatter resistance in B. carinata. These characterized accessions would be useful in Brassica breeding programs for introgression of pod shatter resistance alleles in to elite breeding lines. Molecular markers would assist marker-assisted selection for tracing the introgression of resistant alleles. Our results suggest that the value of the germplasm collections can be harnessed through genetic and genomics tools.

Heritability studies for seed quality traits in introgressed segregating populations of brassica

International Nuclear Information System (INIS)

Farhatullah, S.; Nasim, A.; Fayyaz, L.

2014-01-01

Estimation of genetic parameters in the context of trait characterization is an essential component of future targeted crop improvement programs. Collection of knowledge about genetic behavior such as genetic variability and heritability etc., of the germplasm is the basic step for initiation of any breeding program. Genetic variability and Broad sense heritability for various seed quality traits in 10 brassica genotypes and their 12 F2 progenies comprising of introgressed hybrids were studied. The genotypes had highly significant variation for oil content, protein, glucosinolates contents, oleic, linolenic and erucic acid contents. Glucosinolates content and erucic acid showed high heritability in all F2 populations, while rest of the traits showed variable trends. The cross combination 547 x 118 (B. napus x B. campestris) proved to be a good interspecific hybrid that had high proportion of introgression and has high heritability for beneficial traits. The individual plants having combination of desirable traits were also identified from the F2 populations. (author)

Landscape-scale distribution and persistence of genetically modified oilseed rape (Brassica napus) in Manitoba, Canada.

Science.gov (United States)

Knispel, Alexis L; McLachlan, Stéphane M

2010-01-01

Genetically modified herbicide-tolerant (GMHT) oilseed rape (OSR; Brassica napus L.) was approved for commercial cultivation in Canada in 1995 and currently represents over 95% of the OSR grown in western Canada. After a decade of widespread cultivation, GMHT volunteers represent an increasing management problem in cultivated fields and are ubiquitous in adjacent ruderal habitats, where they contribute to the spread of transgenes. However, few studies have considered escaped GMHT OSR populations in North America, and even fewer have been conducted at large spatial scales (i.e. landscape scales). In particular, the contribution of landscape structure and large-scale anthropogenic dispersal processes to the persistence and spread of escaped GMHT OSR remains poorly understood. We conducted a multi-year survey of the landscape-scale distribution of escaped OSR plants adjacent to roads and cultivated fields. Our objective was to examine the long-term dynamics of escaped OSR at large spatial scales and to assess the relative importance of landscape and localised factors to the persistence and spread of these plants outside of cultivation. From 2005 to 2007, we surveyed escaped OSR plants along roadsides and field edges at 12 locations in three agricultural landscapes in southern Manitoba where GMHT OSR is widely grown. Data were analysed to examine temporal changes at large spatial scales and to determine factors affecting the distribution of escaped OSR plants in roadside and field edge habitats within agricultural landscapes. Additionally, we assessed the potential for seed dispersal between escaped populations by comparing the relative spatial distribution of roadside and field edge OSR. Densities of escaped OSR fluctuated over space and time in both roadside and field edge habitats, though the proportion of GMHT plants was high (93-100%). Escaped OSR was positively affected by agricultural landscape (indicative of cropping intensity) and by the presence of an

Bt-transgenic oilseed rape hybridization with its weedy relative, Brassica rapa.

Science.gov (United States)

Halfhill, Matthew D; Millwood, Reginald J; Raymer, Paul L; Stewart, C Neal

2002-10-01

The movement of transgenes from crops to weeds and the resulting consequences are concerns of modern agriculture. The possible generation of "superweeds" from the escape of fitness-enhancing transgenes into wild populations is a risk that is often discussed, but rarely studied. Oilseed rape, Brassica napus (L.), is a crop with sexually compatible weedy relatives, such as birdseed rape (Brassica rapa (L.)). Hybridization of this crop with weedy relatives is an extant risk and an excellent interspecific gene flow model system. In laboratory crosses, T3 lines of seven independent transformation events of Bacillus thuringiensis (Bt) oilseed rape were hybridized with two weedy accessions of B. rapa. Transgenic hybrids were generated from six of these oilseed rape lines, and the hybrids exhibited an intermediate morphology between the parental species. The Bt transgene was present in the hybrids, and the protein was synthesized at similar levels to the corresponding independent oilseed rape lines. Insect bioassays were performed and confirmed that the hybrid material was insecticidal. The hybrids were backcrossed with the weedy parent, and only half the oilseed rape lines were able to produce transgenic backcrosses. After two backcrosses, the ploidy level and morphology of the resultant plants were indistinguishable from B. rapa. Hybridization was monitored under field conditions (Tifton, GA, USA) with four independent lines of Bt oilseed rape with a crop to wild relative ratio of 1200:1. When B. rapa was used as the female parent, hybridization frequency varied among oilseed rape lines and ranged from 16.9% to 0.7%.

Preferential exclusion of hybrids in mixed pollinations between oilseed rape (Brassica napus) and weedy B. campestris (Brassicaceae)

DEFF Research Database (Denmark)

Hauser, T.P.; Bagger Jørgensen, Rikke; Østergård, Hanne

1997-01-01

amplified polymorphic DNA analysis. Using data on the proportion of fully developed seeds and the proportion of these seeds that were hybrids, a statistical model was constructed to estimate the fitness of conspecific and heterospecific pollen and the survival of conspecific and heterospecific zygotes...... for competition between male gametophytes and/or seeds within pods. To test whether competition influences the success of hybridization, pollen from the two species was mixed in different proportions and applied to stigmas of both species. The resulting seeds were scored for paternity by isozyme and randomly...... to seeds. B. campestris pollen in B. napus styles had a significantly lower fitness than the conspecific pollen, whereas no difference between pollen types was found in B. campestris styles. Hybrid zygotes survived to significantly lower proportions than conspecific zygotes in both species, with the lowest...

BrassicaTED - a public database for utilization of miniature transposable elements in Brassica species.

Science.gov (United States)

Murukarthick, Jayakodi; Sampath, Perumal; Lee, Sang Choon; Choi, Beom-Soon; Senthil, Natesan; Liu, Shengyi; Yang, Tae-Jin

2014-06-20

MITE, TRIM and SINEs are miniature form transposable elements (mTEs) that are ubiquitous and dispersed throughout entire plant genomes. Tens of thousands of members cause insertion polymorphism at both the inter- and intra- species level. Therefore, mTEs are valuable targets and resources for development of markers that can be utilized for breeding, genetic diversity and genome evolution studies. Taking advantage of the completely sequenced genomes of Brassica rapa and B. oleracea, characterization of mTEs and building a curated database are prerequisite to extending their utilization for genomics and applied fields in Brassica crops. We have developed BrassicaTED as a unique web portal containing detailed characterization information for mTEs of Brassica species. At present, BrassicaTED has datasets for 41 mTE families, including 5894 and 6026 members from 20 MITE families, 1393 and 1639 members from 5 TRIM families, 1270 and 2364 members from 16 SINE families in B. rapa and B. oleracea, respectively. BrassicaTED offers different sections to browse structural and positional characteristics for every mTE family. In addition, we have added data on 289 MITE insertion polymorphisms from a survey of seven Brassica relatives. Genes with internal mTE insertions are shown with detailed gene annotation and microarray-based comparative gene expression data in comparison with their paralogs in the triplicated B. rapa genome. This database also includes a novel tool, K BLAST (Karyotype BLAST), for clear visualization of the locations for each member in the B. rapa and B. oleracea pseudo-genome sequences. BrassicaTED is a newly developed database of information regarding the characteristics and potential utility of mTEs including MITE, TRIM and SINEs in B. rapa and B. oleracea. The database will promote the development of desirable mTE-based markers, which can be utilized for genomics and breeding in Brassica species. BrassicaTED will be a valuable repository for scientists

Interspecific hybridization, polyploidization, and backcross of Brassica oleracea var. alboglabra with B. rapa var. purpurea morphologically recapitulate the evolution of Brassica vegetables.

Science.gov (United States)

Zhang, Xiaohui; Liu, Tongjin; Li, Xixiang; Duan, Mengmeng; Wang, Jinglei; Qiu, Yang; Wang, Haiping; Song, Jiangping; Shen, Di

2016-01-04

Brassica oleracea and B. rapa are two important vegetable crops. Both are composed of dozens of subspecies encompassing hundreds of varieties and cultivars. Synthetic B. napus with these two plants has been used extensively as a research model for the investigation of allopolyploid evolution. However, the mechanism underlying the explosive evolution of hundreds of varieties of B. oleracea and B. rapa within a short period is poorly understood. In the present study, interspecific hybridization between B. oleracea var. alboglabra and B. rapa var. purpurea was performed. The backcross progeny displayed extensive morphological variation, including some individuals that phenocopied subspecies other than their progenitors. Numerous interesting novel phenotypes and mutants were identified among the backcross progeny. The chromosomal recombination between the A and C genomes and the chromosomal asymmetric segregation were revealed using Simple Sequence Repeats (SSR) markers. These findings provide direct evidence in support of the hypothesis that interspecific hybridization and backcrossing have played roles in the evolution of the vast variety of vegetables among these species and suggest that combination of interspecific hybridization and backcrossing may facilitate the development of new mutants and novel phenotypes for both basic research and the breeding of new vegetable crops.

Use of Se-enriched mustard and canola seed meals as potential bioherbicides and green fertilizers in strawberry production

Science.gov (United States)

New plant-based products can be produced from seed harvested from Brassica species used for phytomanaging selenium (Se) in the westside of central California. We tested Se-enriched seed meals produced from canola (Brassica napus) and mustard (Sinapis alba) plants as potential bio-herbicides and as g...

Amplifying recombination genome-wide and reshaping crossover landscapes in Brassicas

Science.gov (United States)

Falque, Matthieu; Trotoux, Gwenn; Eber, Frédérique; Nègre, Sylvie; Gilet, Marie; Huteau, Virginie; Lodé, Maryse; Jousseaume, Thibaut; Dechaumet, Sylvain; Morice, Jérôme; Coriton, Olivier; Rousseau-Gueutin, Mathieu

2017-01-01

Meiotic recombination by crossovers (COs) is tightly regulated, limiting its key role in producing genetic diversity. However, while COs are usually restricted in number and not homogenously distributed along chromosomes, we show here how to disrupt these rules in Brassica species by using allotriploid hybrids (AAC, 2n = 3x = 29), resulting from the cross between the allotetraploid rapeseed (B. napus, AACC, 2n = 4x = 38) and one of its diploid progenitors (B. rapa, AA, 2n = 2x = 20). We produced mapping populations from different genotypes of both diploid AA and triploid AAC hybrids, used as female and/or as male. Each population revealed nearly 3,000 COs that we studied with SNP markers well distributed along the A genome (on average 1 SNP per 1.25 Mbp). Compared to the case of diploids, allotriploid hybrids showed 1.7 to 3.4 times more overall COs depending on the sex of meiosis and the genetic background. Most surprisingly, we found that such a rise was always associated with (i) dramatic changes in the shape of recombination landscapes and (ii) a strong decrease of CO interference. Hybrids carrying an additional C genome exhibited COs all along the A chromosomes, even in the vicinity of centromeres that are deprived of COs in diploids as well as in most studied species. Moreover, in male allotriploid hybrids we found that Class I COs are mostly responsible for the changes of CO rates, landscapes and interference. These results offer the opportunity for geneticists and plant breeders to dramatically enhance the generation of diversity in Brassica species by disrupting the linkage drag coming from limits on number and distribution of COs. PMID:28493942

Origination, expansion, evolutionary trajectory, and expression bias of AP2/ERF superfamily in Brassica napus

Directory of Open Access Journals (Sweden)

Xiaoming Song

2016-08-01

Full Text Available The AP2/ERF superfamily, one of the most important transcription factor families, plays crucial roles in response to biotic and abiotic stresses. So far, a comprehensive evolutionary inference of its origination and expansion has not been available. Here, we identified 515 AP2/ERF genes in B. napus, a neo-tetraploid forming ~7500 years ago, and found that 82.14% of them were duplicated in the tetraploidization. A prominent subgenome bias was revealed in gene expression, tissue-specific, and gene conversion. Moreover, a large-scale analysis across plants and alga suggested that this superfamily could have been originated from AP2 family, expanding to form other families (ERF, and RAV. This process was accompanied by duplicating and/or alternative deleting AP2 domain, intragenic domain sequence conversion, and/or by acquiring other domains, resulting in copy number variations, alternatively contributing to functional innovation. We found that significant positive selection occurred at certain critical nodes during the evolution of land plants, possibly responding to changing environment. In conclusion, the present research revealed origination, functional innovation, and evolutionary trajectory of the AP2/ERF superfamily, contributing to understanding their roles in plant stress tolerance.

Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.

Science.gov (United States)

Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling

2015-06-19

Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic

Lambs Fed Fresh Winter Forage Rape (Brassica napus L.) Emit Less Methane than Those Fed Perennial Ryegrass (Lolium perenne L.), and Possible Mechanisms behind the Difference

Science.gov (United States)

Sun, Xuezhao; Henderson, Gemma; Cox, Faith; Molano, German; Harrison, Scott J.; Luo, Dongwen; Janssen, Peter H.; Pacheco, David

2015-01-01

The objectives of this study were to examine long-term effects of feeding forage rape (Brassica napus L.) on methane yields (g methane per kg of feed dry matter intake), and to propose mechanisms that may be responsible for lower emissions from lambs fed forage rape compared to perennial ryegrass (Lolium perenne L.). The lambs were fed fresh winter forage rape or ryegrass as their sole diet for 15 weeks. Methane yields were measured using open circuit respiration chambers, and were 22-30% smaller from forage rape than from ryegrass (averages of 13.6 g versus 19.5 g after 7 weeks, and 17.8 g versus 22.9 g after 15 weeks). The difference therefore persisted consistently for at least 3 months. The smaller methane yields from forage rape were not related to nitrate or sulfate in the feed, which might act as alternative electron acceptors, or to the levels of the potential inhibitors glucosinolates and S-methyl L-cysteine sulfoxide. Ruminal microbial communities in forage rape-fed lambs were different from those in ryegrass-fed lambs, with greater proportions of potentially propionate-forming bacteria, and were consistent with less hydrogen and hence less methane being produced during fermentation. The molar proportions of ruminal acetate were smaller and those of propionate were greater in forage rape-fed lambs, consistent with the larger propionate-forming populations and less hydrogen production. Forage rape contained more readily fermentable carbohydrates and less structural carbohydrates than ryegrass, and was more rapidly degraded in the rumen, which might favour this fermentation profile. The ruminal pH was lower in forage rape-fed lambs, which might inhibit methanogenic activity, shifting the rumen fermentation to more propionate and less hydrogen and methane. The significance of these two mechanisms remains to be investigated. The results suggest that forage rape is a potential methane mitigation tool in pastoral-based sheep production systems. PMID:25803688

Phospholipase Dε enhances Braasca napus growth and seed production in response to nitrogen availability.

Science.gov (United States)

Lu, Shaoping; Yao, Shuaibing; Wang, Geliang; Guo, Liang; Zhou, Yongming; Hong, Yueyun; Wang, Xuemin

2016-03-01

Phospholipase D (PLD), which hydrolyses phospholipids to produce phosphatidic acid, has been implicated in plant response to macronutrient availability in Arabidopsis. This study investigated the effect of increased PLDε expression on nitrogen utilization in Brassica napus to explore the application of PLDε manipulation to crop improvement. In addition, changes in membrane lipid species in response to nitrogen availability were determined in the oil seed crop. Multiple PLDε over expression (PLDε-OE) lines displayed enhanced biomass accumulation under nitrogen-deficient and nitrogen-replete conditions. PLDε-OE plants in the field produced more seeds than wild-type plants but have no impact on seed oil content. Compared with wild-type plants, PLDε-OE plants were enhanced in nitrate transporter expression, uptake and reduction, whereas the activity of nitrite reductase was higher under nitrogen-depleted, but not at nitrogen-replete conditions. The level of nitrogen altered membrane glycerolipid metabolism, with greater impacts on young than mature leaves. The data indicate increased expression of PLDε has the potential to improve crop plant growth and production under nitrogen-depleted and nitrogen-replete conditions. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Effect of Different Salinity levels on some Photosynthetic Characters of Canola (Brassica napus L. Cultivars

Directory of Open Access Journals (Sweden)

F Tahmasbi

2016-07-01

Full Text Available Introduction Salinity is one of the most important factors limiting crop production in arid and semiarid regions of the world that affects crop yield. Salt tolerance of Brassica species are very complex due to genetic relationships. Because of low erucic acid (less than 2% of total fatty acids and glucosinolates contents (less than 3 µmol g-1, oil of Canola has many consumers around the world. Because Canola have tolerance potential against toxicity of salinity and its minerals, its growth can be successful in saline condition. According to the recent ongoing drought and the need to use low quality irrigation water for crops such as Canola, aim of this experiment was to evaluate the effect of salinity on changes in carbon fixation process and photosynthetic pigments of three Canola genotypes under salinity as well as determine most salt tolerant genotype for use in saline regions. Materials and Methods An experiment was conducted in the greenhouse of Shahid Chamran University during 2007-2008 growing season in factorial test based on a completely randomized design with four replications. The first factor (genotype included Hayola 401, RGS0003 and Shiraly and the second factor (salinity levels had four levels of salinity (50, 100 and 150 mM NaCl as well as distilled water as a control. Sources of salinity were NaCl and CaCl2 with equal ratio as most resembles to lower water quality resources in the region. Date and time of stress were considered four weeks after planting (four-leaf stage. A Stepped irrigation method using saline water was done every 12 days over three steps period. To perform this study 10 liters volume pots were used. Three pots per each treatment, and totally 144 pots were used. SAS (version 9.1, Excel and MSTAT-C software's was used for statistical analysis. The comparison of means was done by Duncan method. Results and Discussion The results showed that content of chlorophyll a, b and carotenoids in all three genotypes

Subgenome parallel selection is associated with morphotype diversification and convergent crop domestication in Brassica rapa and Brassica oleracea

NARCIS (Netherlands)

Cheng, Feng; Sun, Rifei; Hou, Xilin; Zheng, Hongkun; Zhang, Fenglan; Zhang, Yangyong; Liu, Bo; Liang, Jianli; Zhuang, Mu; Liu, Yunxia; Liu, Dongyuan; Wang, Xiaobo; Li, Pingxia; Liu, Yumei; Lin, Ke; Bucher, Johan; Zhang, Ningwen; Wang, Yan; Wang, Hui; Deng, Jie; Liao, Yongcui; Wei, Keyun; Zhang, Xueming; Fu, Lixia; Hu, Yunyan; Liu, Jisheng; Cai, Chengcheng; Zhang, Shujiang; Zhang, Shifan; Li, Fei; Zhang, Hui; Zhang, Jifang; Guo, Ning; Liu, Zhiyuan; Liu, Jin; Sun, Chao; Ma, Yuan; Zhang, Haijiao; Cui, Yang; Freeling, Micheal R.; Borm, Theo; Bonnema, Guusje; Wu, Jian; Wang, Xiaowu

2016-01-01

Brassica species, including crops such as cabbage, turnip and oilseed, display enormous phenotypic variation. Brassica genomes have all undergone a whole-genome triplication (WGT) event with unknown effects on phenotype diversification. We resequenced 199 Brassica rapa and 119 Brassica oleracea

Breeding response of transcript profiling in developing seeds of Brassica napus

Directory of Open Access Journals (Sweden)

Li Xiaodan

2009-05-01

Full Text Available Abstract Background The upgrading of rapeseed cultivars has resulted in a substantial improvement in yield and quality in China over the past 30 years. With the selective pressure against fatty acid composition and oil content, high erucic acid- and low oil-content cultivars have been replaced by low erucic acid- and high oil-content cultivars. The high erucic acid cultivar Zhongyou 821 and its descendent, low erucic acid cultivar Zhongshuang 9, are representatives of two generations of the most outstanding Chinese rapeseed cultivars (B. napus developed the past 2 decades. This paper compares the transcriptional profiles of Zhongshuang 9 and Zhongyou 821 for 32 genes that are principally involved in lipid biosynthesis during seed development in order to elucidate how the transcriptional profiles of these genes responded to quality improvement over the past 20 years. Results Comparison of the cultivar Zhongyou 821 with its descendent, Zhongshuang 9, shows that the transcriptional levels of seven of the 32 genes were upregulated by 30% to 109%, including FAD3, ACCase, FAE1, GKTP, Caleosin, GAPDH, and PEPC. Of the 32 genes, 10 (KAS3, β-CT, BcRK6, P450, FatA, Oleosin, FAD6, FatB, α-CT and SUC1 were downregulated by at least 20% and most by 50%. The Napin gene alone accounted for over 75% of total transcription from all 32 genes assessed in both cultivars. Most of the genes showed significant correlation with fatty acid accumulation, but the correlation in ZS9 was significantly different from that in ZY821. Higher KCR2 activity is associated with higher C16:0, C18:0, and C18:2 in both cultivars, lower C22:1 and total fatty acid content in ZY821, and lower 18:1 in ZS9. Conclusion This paper illustrates the response of the transcription levels of 32 genes to breeding in developing rapeseed seeds. Both cultivars showed similar transcription profiles, with the Napin gene predominantly transcribed. Selective pressure for zero erucic acid, low

Identification of seed-related QTL in Brassica rapa

Directory of Open Access Journals (Sweden)

H. Bagheri

2013-10-01

Full Text Available To reveal the genetic variation, and loci involved, for a range of seed-related traits, a new F2 mapping population was developed by crossing Brassica rapa ssp. parachinensis L58 (CaiXin with B. rapa ssp. trilocularis R-o-18 (spring oil seed, both rapid flowering and self-compatible. A linkage map was constructed using 97 AFLPs and 21 SSRs, covering a map distance of 757 cM with an average resolution of 6.4 cM, and 13 quantitative trait loci (QTL were detected for nine traits. A strong seed colour QTL (LOD 26 co-localized with QTL for seed size (LOD 7, seed weight (LOD 4.6, seed oil content (LOD 6.6, number of siliques (LOD 3 and number of seeds per silique (LOD 3. There was only a significant positive correlation between seed colour and seed oil content in the yellow coloured classes. Seed coat colour and seed size were controlled by the maternal plant genotype. Plants with more siliques tended to have more, but smaller, seeds and higher seed oil content. Seed colour and seed oil content appeared to be controlled by two closely linked loci in repulsion phase. Thus, it may not always be advantageous to select for yellow-seededness when breeding for high seed oil content in Brassicas.

Genic Microsatellite Markers in Brassica rapa: Development, Characterization, Mapping, and Their Utility in Other Cultivated and Wild Brassica Relatives

Science.gov (United States)

Ramchiary, Nirala; Nguyen, Van Dan; Li, Xiaonan; Hong, Chang Pyo; Dhandapani, Vignesh; Choi, Su Ryun; Yu, Ge; Piao, Zhong Yun; Lim, Yong Pyo

2011-01-01

Genic microsatellite markers, also known as functional markers, are preferred over anonymous markers as they reveal the variation in transcribed genes among individuals. In this study, we developed a total of 707 expressed sequence tag-derived simple sequence repeat markers (EST-SSRs) and used for development of a high-density integrated map using four individual mapping populations of B. rapa. This map contains a total of 1426 markers, consisting of 306 EST-SSRs, 153 intron polymorphic markers, 395 bacterial artificial chromosome-derived SSRs (BAC-SSRs), and 572 public SSRs and other markers covering a total distance of 1245.9 cM of the B. rapa genome. Analysis of allelic diversity in 24 B. rapa germplasm using 234 mapped EST-SSR markers showed amplification of 2 alleles by majority of EST-SSRs, although amplification of alleles ranging from 2 to 8 was found. Transferability analysis of 167 EST-SSRs in 35 species belonging to cultivated and wild brassica relatives showed 42.51% (Sysimprium leteum) to 100% (B. carinata, B. juncea, and B. napus) amplification. Our newly developed EST-SSRs and high-density linkage map based on highly transferable genic markers would facilitate the molecular mapping of quantitative trait loci and the positional cloning of specific genes, in addition to marker-assisted selection and comparative genomic studies of B. rapa with other related species. PMID:21768136

Production of viable male unreduced gametes in Brassica interspecific hybrids is genotype specific and stimulated by cold temperatures

Directory of Open Access Journals (Sweden)

Cowling Wallace A

2011-06-01

Full Text Available Abstract Background Unreduced gametes (gametes with the somatic chromosome number may provide a pathway for evolutionary speciation via allopolyploid formation. We evaluated the effect of genotype and temperature on male unreduced gamete formation in Brassica allotetraploids and their interspecific hybrids. The frequency of unreduced gametes post-meiosis was estimated in sporads from the frequency of dyads or giant tetrads, and in pollen from the frequency of viable giant pollen compared with viable normal pollen. Giant tetrads were twice the volume of normal tetrads, and presumably resulted from pre-meiotic doubling of chromosome number. Giant pollen was defined as pollen with more than 1.5 × normal diameter, under the assumption that the doubling of DNA content in unreduced gametes would approximately double the pollen cell volume. The effect of genotype was assessed in five B. napus, two B. carinata and one B. juncea parents and in 13 interspecific hybrid combinations. The effect of temperature was assessed in a subset of genotypes in hot (day/night 30°C/20°C, warm (25°C/15°C, cool (18°C/13°C and cold (10°C/5°C treatments. Results Based on estimates at the sporad stage, some interspecific hybrid genotypes produced unreduced gametes (range 0.06 to 3.29% at more than an order of magnitude higher frequency than in the parents (range 0.00% to 0.11%. In nine hybrids that produced viable mature pollen, the frequency of viable giant pollen (range 0.2% to 33.5% was much greater than in the parents (range 0.0% to 0.4%. Giant pollen, most likely formed from unreduced gametes, was more viable than normal pollen in hybrids. Two B. napus × B. carinata hybrids produced 9% and 23% unreduced gametes based on post-meiotic sporad observations in the cold temperature treatment, which was more than two orders of magnitude higher than in the parents. Conclusions These results demonstrate that sources of unreduced gametes, required for the triploid

Cytoplasmic and Genomic Effects on Meiotic Pairing in Brassica Hybrids and Allotetraploids from Pair Crosses of Three Cultivated Diploids

Science.gov (United States)

Cui, Cheng; Ge, Xianhong; Gautam, Mayank; Kang, Lei; Li, Zaiyun

2012-01-01

Interspecific hybridization and allopolyploidization contribute to the origin of many important crops. Synthetic Brassica is a widely used model for the study of genetic recombination and “fixed heterosis” in allopolyploids. To investigate the effects of the cytoplasm and genome combinations on meiotic recombination, we produced digenomic diploid and triploid hybrids and trigenomic triploid hybrids from the reciprocal crosses of three Brassica diploids (B. rapa, AA; B. nigra, BB; B. oleracea, CC). The chromosomes in the resultant hybrids were doubled to obtain three allotetraploids (B. juncea, AA.BB; B. napus, AA.CC; B. carinata, BB.CC). Intra- and intergenomic chromosome pairings in these hybrids were quantified using genomic in situ hybridization and BAC-FISH. The level of intra- and intergenomic pairings varied significantly, depending on the genome combinations and the cytoplasmic background and/or their interaction. The extent of intragenomic pairing was less than that of intergenomic pairing within each genome. The extent of pairing variations within the B genome was less than that within the A and C genomes, each of which had a similar extent of pairing. Synthetic allotetraploids exhibited nondiploidized meiotic behavior, and their chromosomal instabilities were correlated with the relationship of the genomes and cytoplasmic background. Our results highlight the specific roles of the cytoplasm and genome to the chromosomal behaviors of hybrids and allopolyploids. PMID:22505621

The Emerging British Verticillium longisporum Population Consists of Aggressive Brassica Pathogens.

Science.gov (United States)

Depotter, Jasper R L; Rodriguez-Moreno, Luis; Thomma, Bart P H J; Wood, Thomas A

2017-11-01

Verticillium longisporum is an economically important fungal pathogen of brassicaceous crops that originated from at least three hybridization events between different Verticillium spp., leading to the hybrid lineages A1/D1, A1/D2, and A1/D3. Isolates of lineage A1/D1 generally cause stem striping on oilseed rape (Brassica napus), which has recently been reported for the first time to occur in the United Kingdom. Intriguingly, the emerging U.K. population is distinct from the north-central European stem striping population. Little is known about the pathogenicity of the newly emerged U.K. population; hence, pathogenicity tests were executed to compare British isolates to previously characterized reference strains. In addition to the model plant Arabidopsis thaliana, the pathogenicity of four British isolates was assessed on four cultivars of three Brassica crop species: oilseed rape (Quartz and Incentive), cauliflower (Clapton), and Chinese cabbage (Hilton). To this end, vascular discoloration of the roots, plant biomass accumulations, and fungal stem colonization upon isolate infection were evaluated. The British isolates appeared to be remarkably aggressive, because plant biomass was significantly affected and severe vascular discoloration was observed. The British isolates were successful stem colonizers and the extent of fungal colonization negatively correlated with plant biomass of cauliflower and Quartz oilseed rape. However, in Quartz, the fungal colonization of A1/D1 isolates was significantly lower than that of the virulent reference isolate from lineage A1/D3, PD589. Moreover, despite levels of stem colonization similar to those of A1/D1 strains, PD589 did not cause significant disease on Incentive. Thus, A1/D1 isolates, including British isolates, are aggressive oilseed rape pathogens despite limited colonization levels in comparison with a virulent A1/D3 isolate.

Ozone affects growth and development of Pieris brassicae on the wild host plant Brassica nigra

International Nuclear Information System (INIS)

Khaling, Eliezer; Papazian, Stefano; Poelman, Erik H.; Holopainen, Jarmo K.; Albrectsen, Benedicte R.; Blande, James D.

2015-01-01

When plants are exposed to ozone they exhibit changes in both primary and secondary metabolism, which may affect their interactions with herbivorous insects. Here we investigated the performance and preferences of the specialist herbivore Pieris brassicae on the wild plant Brassica nigra under elevated ozone conditions. The direct and indirect effects of ozone on the plant-herbivore system were studied. In both cases ozone exposure had a negative effect on P. brassicae development. However, in dual-choice tests larvae preferentially consumed plant material previously fumigated with the highest concentration tested, showing a lack of correlation between larval preference and performance on ozone exposed plants. Metabolomic analysis of leaf material subjected to combinations of ozone and herbivore-feeding, and focussing on known defence metabolites, indicated that P. brassicae behaviour and performance were associated with ozone-induced alterations to glucosinolate and phenolic pools. - Highlights: • We examined the effects of ozone on Pieris brassicae performance and preference. • We studied ozone and herbivore induced changes in the metabolome of Brassica nigra. • The performance of P. brassicae did not correlate with preference of ozonated plants. • Ozone and herbivore-feeding stress changes the phytochemical pools of B. nigra. - Ozone indirectly reduces herbivore performance, which is associated with change in phytochemical pools, but does not correlate with host plant preference

Growth and ions (Na/sup +/, K/sup +/ and Cl/sup-1/-) accumulating pattern of some brassica genotypes under saline - sodic field condition

International Nuclear Information System (INIS)

Shirazi, M.U.; Ali, M.; Khan, M.A.; Mumtaz, S.; Rajpoot, M.A.; Ali, M.

2011-01-01

The growth and ionic uptake pattern of some Brassica genotypes i.e., Rainbow, Wester, Durr-e-NIFA, Abaseen 95 (Brassica napus) and NIFA raya (Brassica juncea) under saline-sodic field conditions was studied. Two sets of experiments on normal and saline-sodic site were conducted at NIA experimental farm, Tandojam, Pakistan during Rabi 2006-07. The salinity of the experimental site ranged between 11.0-22.9 dS/m and the pH was alkaline (8-8.6). The dominant cation was sodium (Na). The growth performance was recorded at the time of crop harvest in terms of plant height, grain weight / plant, grain yield and 100 grain weight. It was observed that the performance of Wester was better followed by NIFA- raya. The ionic uptake pattern, of leaves, stem and roots showed that the accumulation of Na was less in leaf as compared to stem and roots. However, the genotypes having better performance we re found to have accumulating type of behavior showing comparatively higher Na contents in all plant parts than other genotypes. This suggests that these genotypes might adjust their osmotic potential through the accumulation of sodium in vacuole. On the other hand trend in case of K accumulation was reverse i.e. high in leaves and stem as compared to roots. Higher accumulating pattern of K in leaves might be helpful for reducing the toxic effects of sodium. However, no correlation was observed between K-Na selectivity or K/Na ratio among the genotypes tested. It is therefore concluded that better selective mechanism for Na uptake and strict control of intercellular Na influx for cellular osmotic adjustment could be selected for saline environment. (author)

(Brassica napus L.) cultivars

African Journals Online (AJOL)

user

2011-03-07

Mar 7, 2011 ... African Journal of Biotechnology Vol. 10(10), pp. 1827-1832, 7 ... and even death (Zhu, 2001). ... as a nitrogen fertilizer equivalent to 150 kg N ha-1 and triple- super- ... negatively the plant fresh weight, but the effect ratio.

Genetic Variability in Glucosinolates in Seed of Brassica juncea: Interest in Mustard Condiment

Directory of Open Access Journals (Sweden)

Othmane Merah

2015-01-01

Full Text Available Brassica juncea is mostly used for oil production which implies selection of genotypes with low glucosinolates level and high oil content. In contrast, condiment production needs varieties with high level in some glucosinolates including sinigrin. The genetic variability was studied mostly by molecular tools. The objectives were almost the decrease of glucosinolates level in order to use the oilcake for animal feed. The aim of this work is to study the genetic variability for different glucosinolates and their relationships with agronomical traits within a large collection of Brassica juncea genotypes for condiment uses. A collection of 190 genotypes from different origins was studied in Dijon (France. Oil content and total glucosinolates, and sinigrin and gluconapin levels were measured. Flowering and maturation durations, seed yield, and yield components were also measured. Large variability was observed between genotypes for the measured traits within the studied collection. Total glucosinolates varied twofold between extreme genotypes. Values of sinigrin content varied from 0 to more than 134 µmol·g−1. Correlations between glucosinolates traits and both phenological and agronomical characters are presented and discussed for their potential for industrial condiment uses.

Early interspecific interference in the wheat/faba bean (Triticum aestivum/ Vicia faba ssp. minor and rapeseed/squarrosum clover (Brassica napus var. oleifera/Trifolium squarrosum intercrops

Directory of Open Access Journals (Sweden)

Paolo Benincasa

2012-04-01

Full Text Available Most of research on intercrops evaluate performances and interference between species on the basis of final yield, while little knowledge is available on the interference in early stages and at the root level, at least for cultivated intercrops. In fact, in the few studies on this subject species are often combined minding at experimental needs (e.g. common substrate, temperature and water requirements, easy root separation more than at their actual use in the farm. The present work evaluates interspecific interference during early developmental stages for two intercrops of agricultural interest: soft wheat-faba bean and rapeseed-squarrosum clover. Improving this knowledge would help intercrop growth modelling and rational cultivation. The experiments were carried out on soft wheat (Triticum aestivum, faba bean (Vicia faba var. minor, rapeseed (Brassica napus var. oleifera and squarrosum clover (Trifolium squarrosum, germinated and grown until 32 days after sowing (DAS as one-species stands or as wheat/faba bean and rapeseed/squarrosum clover intercrops, with different densities and proportions for the two species in each couple. Germination was studied in controlled-temperature chamber, plantlet growth was studied on pots in the greenhouse. During germination no interspecific interference was observed for both wheat/faba bean and rapeseed/squarrosum clover intercrops. During plantlet growth, interspecific interference occurred in both intercrops causing variations in whole plant and root dry matter accumulation. In the wheat/faba bean intercrop each species suffered from the competitive effect of the companion species and faba bean was the dominant species when present in lower proportion than wheat. The unexpectedly high aggressivity of faba bean may be explained either with the greater seed size that could have represented an initial advantage within the short duration of the experiment or with the competition towards wheat for substrate N

Cardinal Temperatures of Brassica sp. and How to Determine It

Directory of Open Access Journals (Sweden)

D. K. SUANDA SUANDA

2013-08-01

Full Text Available Cardinal temperatures consist of minimum, optimum and maximum of plant growth, and might beable to be determined by assessing effect of temperature on seed germination. An experiment ofseed germination was conducted in laboratory, using thermal gradient plate for ten days. To test hypothesisthat rapeseed genotypes vary in their response to temperatures. The design of this experiment was asplit plot with four replications. The main-treatments were 14 different temperatures: 0.4°C, 3.3°C,7.8°C, 11.6°C, 13.3°C, 15.0°C, 16.8°C, 18.3°C, 20.9°C, 21.1°C, 25.6°C, 29.0°C, 33.0°C and36.3°C. Sub-treatments were 6 brassica genotypes: Brassica napus genotypes (Tatyoon and Marnoo;B. campestris (Jumbuck and Chinoli B; B. juncea (No. 81797 and Zero Erusic Mustard (ZEM 2.Each treatment was using 50 seeds. Germinations were observed daily for ten days and data wereanalyzed with regression and correlation. Genotypes responded differently to temperatures with Jumbuckthe most sensitive to low temperature with minimum temperature (7.90°C, then respectively followedby Chinoli B (6.36°C, ZEM 2 (4.77°C, Tatyoon (4.63°C, No. 81797 (2.59°C, and Marnoo(1.00°C. For high temperature the most sensitive was No. 81797 with maximum temperature 38.61°C.and then respectively followed by Marnoo (39.76°C, Chinoli B (42.93°C, Tatyoon (43.79°C,Jumbuck (44.58°C and ZEM 2 (45.88°C. Optimum temperatures were for Jumbuck was 24.56°C,ZEM 2 (26.95°C, Tatyoon (27.12°C, No. 81797 (28.12°C, Chinoli B (29.74°C and Marnoo(30.48°C.

Comprehensive analysis of the flowering genes in Chinese cabbage and examination of evolutionary pattern of CO-like genes in plant kingdom

Science.gov (United States)

Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin

2015-09-01

In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.

User Guidelines for the Brassica Database: BRAD.

Science.gov (United States)

Wang, Xiaobo; Cheng, Feng; Wang, Xiaowu

2016-01-01

The genome sequence of Brassica rapa was first released in 2011. Since then, further Brassica genomes have been sequenced or are undergoing sequencing. It is therefore necessary to develop tools that help users to mine information from genomic data efficiently. This will greatly aid scientific exploration and breeding application, especially for those with low levels of bioinformatic training. Therefore, the Brassica database (BRAD) was built to collect, integrate, illustrate, and visualize Brassica genomic datasets. BRAD provides useful searching and data mining tools, and facilitates the search of gene annotation datasets, syntenic or non-syntenic orthologs, and flanking regions of functional genomic elements. It also includes genome-analysis tools such as BLAST and GBrowse. One of the important aims of BRAD is to build a bridge between Brassica crop genomes with the genome of the model species Arabidopsis thaliana, thus transferring the bulk of A. thaliana gene study information for use with newly sequenced Brassica crops.

Incorporation of [14C]-palmitate into lipids of Brassica cells during the induction of freezing tolerance

International Nuclear Information System (INIS)

Lynch, D.V.; Joseph, R.A.

1989-01-01

Changes in plasma membrane lipid composition have been causally related to increased freezing tolerance. Studies of lipid metabolism during ABA induction of freezing tolerance in Brassica napus suspension cultures were undertaken. Cells were labeled with [ 14 C]-palmitate four days after transfer to fresh medium (control) or medium containing ABA (which increases freezing tolerance). At times between one and 20 hrs after labeling, ABA-treated cells incorporated almost twice the amount of label as controls cells. Approximately 80% of the radioactivity was associated with neutral lipids in ABA-treated cells and controls. Incorporation of label into total cellular polar lipids was 4.9 x 10 5 dpm/mg protein for control cells and 1 x 10 6 dpm/mg protein for cells transferred to medium containing ABA. Analysis of lipids following alkaline hydrolysis indicated that incorporation of [ 14 C]-palmitate into glucosylceramide of ABA-treated cells was less than 60% of control values when expressed relative to that of the total polar lipids. Incorporation into ceramides was also depressed in ABA-treated cells

Effects of different combinations and concentrations of growth ...

African Journals Online (AJOL)

PRECIOUS

2009-11-16

Nov 16, 2009 ... artificial seed (Büyükalaca and Mavituna, 1995; Vicient and Martinez .... light stimulated somatic embryo formation and maturation in Brassica napus. .... Effects of Abscisic Acid on Somatic Embryogenesis and Induction of.

The effect of nitrogen and sulphur on the agronomical and water use ...

African Journals Online (AJOL)

The effect of nitrogen and sulphur on the agronomical and water use efficiencies of canola (Brassica napus L.) grown in selected localities of the Western Cape province, South Africa. Wonder Ngezimana, Gert A. Agenbag ...

Development of transgenic finger millet (Eleusine coracana (L ...

Indian Academy of Sciences (India)

2012-01-18

Jan 18, 2012 ... plants engineered with chitinase gene have been found to be effective in .... primers (forward: 5′ GCTTCTACACCTACGACGCCTT 3′; reverse: ..... and Toppan A 1996 Field tolerance to fungal pathogens of. Brassica napus ...

Vernalization and photoperiod-related changes in the DNA methylation state in winter and spring rapeseed

Czech Academy of Sciences Publication Activity Database

Guzy-Wrobelska, J.; Filek, M.; Kaliciak, A.; Szarejko, I.; Macháčková, Ivana; Krekule, Jan; Barciszewska, M.

2013-01-01

Roč. 35, č. 3 (2013), s. 817-827 ISSN 0137-5881 Institutional research plan: CEZ:AV0Z50380511 Keywords : Brassica napus * DNA methylation * MSAP Subject RIV: EF - Botanics Impact factor: 1.524, year: 2013

African Journal of Biotechnology - Vol 8, No 20 (2009)

African Journals Online (AJOL)

Identification of differentially expressed genes in seeds of two Brassica napus ... DNA in burial place remains of Turkey using real time polymerase chain reaction ... Varietal response of four cowpea cultivars (Vigna unguiculata L. Walp) to ...

Effect of different doses of urea on the uptake of cadmium from soil ...

African Journals Online (AJOL)

Yomi

2012-01-19

Jan 19, 2012 ... uptake by canola (Brassica napus L.) applied in full and split doses. Nine different ... production of ruminants being reared on the pasture. Key words: ... combined nitrogen fertilizer used in today's agricultural practices ...

Download this PDF file

African Journals Online (AJOL)

ajl yemi

2011-11-30

Nov 30, 2011 ... Morphological data included plant height (cm), number of days to emergence, number .... Option500 and Fusia; third group contained. Option501 ..... Summer Rapeseed (Brassica napus ssp. oleifera L.) cultivars for yield and ...

Transcriptome analysis of Brassica juncea var. tumida Tsen responses to Plasmodiophora brassicae primed by the biocontrol strain Zhihengliuella aestuarii.

Science.gov (United States)

Luo, Yuanli; Dong, Daiwen; Su, Yu; Wang, Xuyi; Peng, Yumei; Peng, Jiang; Zhou, Changyong

2018-05-01

Mustard clubroot, caused by Plasmodiophora brassicae, is a serious disease that affects Brassica juncea var. tumida Tsen, a mustard plant that is the raw material for a traditional fermented food manufactured in Chongqing, China. In our laboratory, we screened the antagonistic bacteria Zhihengliuella aestuarii against P. brassicae. To better understand the biocontrol mechanism, three transcriptome analyses of B. juncea var. tumida Tsen were conducted using Illumina HiSeq 4000, one from B. juncea only inoculated with P. brassicae (P), one inoculated with P. brassica and the biocontrol agent Z. aestuarii at the same time (P + B), and the other was the control (H), in which P. brassicae was replaced by sterile water. A total of 19.94 Gb was generated by Illumina HiSeq sequencing. The sequence data were de novo assembled, and 107,617 unigenes were obtained. In total, 5629 differentially expressed genes between biocontrol-treated (P + B) and infected (P) samples were assigned to 126 KEGG pathways. Using multiple testing corrections, 20 pathways were significantly enriched with Qvalue ≤ 0.05. The resistance-related genes, involved in the production of pathogenesis-related proteins, pathogen-associated molecular pattern-triggered immunity, and effector-triggered immunity signaling pathways, calcium influx, salicylic acid pathway, reactive oxygen intermediates, and mitogen-activated protein kinase cascades, and cell wall modification, were obtained. The various defense responses induced by the biocontrol strain combatted the P. brassicae infection. The genes and pathways involved in plant resistance were induced by a biocontrol strain. The transcriptome data explained the molecular mechanism of the potential biocontrol strain against P. brassicae. The data will also serve as an important public information platform to study B. juncea var. tumida Tsen and will be useful for breeding mustard plants resistant to P. brassicae.

Overexpression of NPR1 in Brassica juncea Confers Broad Spectrum Resistance to Fungal Pathogens

Directory of Open Access Journals (Sweden)

Sajad Ali

2017-10-01

Full Text Available Brassica juncea (Indian mustard is a commercially important oil seed crop, which is highly affected by many biotic stresses. Among them, Alternaria leaf blight and powdery mildew are the most devastating diseases leading to huge yield losses in B. juncea around the world. In this regard, genetic engineering is a promising tool that may possibly allow us to enhance the B. juncea disease resistance against these pathogens. NPR1 (non-expressor of pathogen-related gene 1 is a bonafide receptor of salicylic acid (SA which modulates multiple immune responses in plants especially activation of induced and systemic acquired resistance (SAR. Here, we report the isolation and characterization of new NPR1 homolog (BjNPR1 from B. juncea. The phylogenetic tree constructed based on the deduced sequence of BjNPR1 with homologs from other species revealed that BjNPR1 grouped together with other known NPR1 proteins of Cruciferae family, and was nearest to B. napus. Furthermore, expression analysis showed that BjNPR1 was upregulated after SA treatment and fungal infection but not by jasmonic acid or abscisic acid. To understand the defensive role of this gene, we generated B. juncea transgenic lines overexpressing BjNPR1, and further confirmed by PCR and Southern blotting. The transgenic lines showed no phenotypic abnormalities, and constitutive expression of BjNPR1 activates defense signaling pathways by priming the expression of antifungal PR genes. Moreover, BjNPR1 transgenic lines showed enhanced resistance to Alternaria brassicae and Erysiphe cruciferarum as there was delay in symptoms and reduced disease severity than non-transgenic plants. In addition, the rate of disease spreading to uninfected or distal parts was also delayed in transgenic plants thus suggesting the activation of SAR. Altogether, the present study suggests that BjNPR1 is involved in broad spectrum of disease resistance against fungal pathogens.

Subgenome parallel selection is associated with morphotype diversification and convergent crop domestication in Brassica rapa and Brassica oleracea.

Science.gov (United States)

Cheng, Feng; Sun, Rifei; Hou, Xilin; Zheng, Hongkun; Zhang, Fenglan; Zhang, Yangyong; Liu, Bo; Liang, Jianli; Zhuang, Mu; Liu, Yunxia; Liu, Dongyuan; Wang, Xiaobo; Li, Pingxia; Liu, Yumei; Lin, Ke; Bucher, Johan; Zhang, Ningwen; Wang, Yan; Wang, Hui; Deng, Jie; Liao, Yongcui; Wei, Keyun; Zhang, Xueming; Fu, Lixia; Hu, Yunyan; Liu, Jisheng; Cai, Chengcheng; Zhang, Shujiang; Zhang, Shifan; Li, Fei; Zhang, Hui; Zhang, Jifang; Guo, Ning; Liu, Zhiyuan; Liu, Jin; Sun, Chao; Ma, Yuan; Zhang, Haijiao; Cui, Yang; Freeling, Micheal R; Borm, Theo; Bonnema, Guusje; Wu, Jian; Wang, Xiaowu

2016-10-01

Brassica species, including crops such as cabbage, turnip and oilseed, display enormous phenotypic variation. Brassica genomes have all undergone a whole-genome triplication (WGT) event with unknown effects on phenotype diversification. We resequenced 199 Brassica rapa and 119 Brassica oleracea accessions representing various morphotypes and identified signals of selection at the mesohexaploid subgenome level. For cabbage morphotypes with their typical leaf-heading trait, we identified four subgenome loci that show signs of parallel selection among subgenomes within B. rapa, as well as four such loci within B. oleracea. Fifteen subgenome loci are under selection and are shared by these two species. We also detected strong subgenome parallel selection linked to the domestication of the tuberous morphotypes, turnip (B. rapa) and kohlrabi (B. oleracea). Overall, we demonstrated that the mesohexaploidization of the two Brassica genomes contributed to their diversification into heading and tuber-forming morphotypes through convergent subgenome parallel selection of paralogous genes.

Complete mitochondrial genome sequence of black mustard (Brassica nigra; BB) and comparison with Brassica oleracea (CC) and Brassica carinata (BBCC).

Science.gov (United States)

Yamagishi, Hiroshi; Tanaka, Yoshiyuki; Terachi, Toru

2014-11-01

Crop species of Brassica (Brassicaceae) consist of three monogenomic species and three amphidiploid species resulting from interspecific hybridizations among them. Until now, mitochondrial genome sequences were available for only five of these species. We sequenced the mitochondrial genome of the sixth species, Brassica nigra (nuclear genome constitution BB), and compared it with those of Brassica oleracea (CC) and Brassica carinata (BBCC). The genome was assembled into a 232 145 bp circular sequence that is slightly larger than that of B. oleracea (219 952 bp). The genome of B. nigra contained 33 protein-coding genes, 3 rRNA genes, and 17 tRNA genes. The cox2-2 gene present in B. oleracea was absent in B. nigra. Although the nucleotide sequences of 52 genes were identical between B. nigra and B. carinata, the second exon of rps3 showed differences including an insertion/deletion (indel) and nucleotide substitutions. A PCR test to detect the indel revealed intraspecific variation in rps3, and in one line of B. nigra it amplified a DNA fragment of the size expected for B. carinata. In addition, the B. carinata lines tested here produced DNA fragments of the size expected for B. nigra. The results indicate that at least two mitotypes of B. nigra were present in the maternal parents of B. carinata.

Effect of Nitrogen Foliar Application on Canola Yield (Brassica napus L. and Nitrogen Efficiency across Different Sowing Dates

Directory of Open Access Journals (Sweden)

S Doori

2016-12-01

Full Text Available Introduction Between oil seeds, from the quality, quantity and nutrition index point of view, canola has the top level . Because of the solubility of N fertilizers, the time of urea application, is very important and one of the main reasons of the reduction in N application efficiency is utilization of urea in an inappropriate time. By precisely foliar application of nitrogen, the efficiency of nitrogen transformation to the grain will be very high because in this method the leaf is considered the main organ of nitrogen uptake and a low amount of absorbed nitrogen was transferred to the root and entered the soil. The more division of N application in growth stages and in accordance with plant need and foliar application result in increasing nitrogen use efficiency. The delay in sowing will result in the reduction of yield and this is due to low LAI, and thus low radiation absorb in vegetable phase and shorter reproductive phase with high temperature in flowering and subsequent stages that result in low prolific silique and make disorder in transferring stored material to grain. In this experiment using N foliar application to decrease the adverse effect of delay in sowing is objective. Materials and Methods The experiment was conducted in 2013-2014 in Ramin Agriculture and Natural Resource University of Khuzestan. Experiment was conducted as split plots in a randomized complete blocks design with three replications. In this experiment sowing date]optimum sowing (27 November, 17 December and late sowing (30 December [were assigned to main plots and several time of N-foliar application with 5 percent density from urea (20 liter per ha, ]TO (control, T1 (foliar N application in rosette stage, T2 (foliar N application in budding stage, T3 (foliar N application in flowering stage[ were placed in sub-plots in randomized way. Fertilizing was based on the results of soil examination. Therefore, 162 kg ha-1 of pure nitrogen (from resource urea in the way

Comparative mapping reveals similar linkage of functional genes to ...

Indian Academy of Sciences (India)

related traits between Brassica napus and Oryza sativa. Fupeng Li, Chaozhi Ma, Qingfang Chen, Touming Liu, Jinxiong Shen, Jinxing Tu, Yongzhong Xing and Tingdong Fu. J. Genet. 91, 163–170. Length of. Position of. Position of. Expect.

Tolerence of Braccica nigra to Pieris brassicae herbivory

NARCIS (Netherlands)

Blatt, S.E.; Smallegange, R.C.; Hess, L.; Harvey, J.A.; Dicke, D.; van Loon, J.J.A.

2008-01-01

Black mustard, Brassica nigra (L.) Koch, is a wild annual species found throughout Europe and fed on by larvae of the large cabbage-white butterfly, Pieris brassicae L. We examined the impact of herbivory from P. brassicae, a gregarious herbivore, on B. nigra grown from wild seed collected locally.

Collinearity analysis of Brassica A and C genomes based on an updated inferred unigene order

Directory of Open Access Journals (Sweden)

Ian Bancroft

2015-06-01

Full Text Available This data article includes SNP scoring across lines of the Brassica napus TNDH population based on Illumina sequencing of mRNA, expanded to 75 lines. The 21, 323 mapped markers defined 887 recombination bins, representing an updated genetic linkage map for the species. Based on this new map, 5 genome sequence scaffolds were split and the order and orientation of scaffolds updated to establish a new pseudomolecule specification. The order of unigenes and SNP array probes within these pseudomolecules was determined. Unigenes were assessed for sequence similarity to the A and C genomes. The 57, 246 that mapped to both enabled the collinearity of the A and C genomes to be illustrated graphically. Although the great majority was in collinear positions, some were not. Analyses of 60 such instances are presented, suggesting that the breakdown in collinearity was largely due to either the absence of the homoeologue on one genome (resulting in sequence match to a paralogue or multiple similar sequences being present. The mRNAseq datasets for the TNDH lines are available from the SRA repository (ERA283648; the remaining datasets are supplied with this article.

Genetic and Epigenetic Alterations of Brassica nigra Introgression Lines from Somatic Hybridization: A Resource for Cauliflower Improvement.

Science.gov (United States)

Wang, Gui-Xiang; Lv, Jing; Zhang, Jie; Han, Shuo; Zong, Mei; Guo, Ning; Zeng, Xing-Ying; Zhang, Yue-Yun; Wang, You-Ping; Liu, Fan

2016-01-01

Broad phenotypic variations were obtained previously in derivatives from the asymmetric somatic hybridization of cauliflower "Korso" (Brassica oleracea var. botrytis, 2n = 18, CC genome) and black mustard "G1/1" (Brassica nigra, 2n = 16, BB genome). However, the mechanisms underlying these variations were unknown. In this study, 28 putative introgression lines (ILs) were pre-selected according to a series of morphological (leaf shape and color, plant height and branching, curd features, and flower traits) and physiological (black rot/club root resistance) characters. Multi-color fluorescence in situ hybridization revealed that these plants contained 18 chromosomes derived from "Korso." Molecular marker (65 simple sequence repeats and 77 amplified fragment length polymorphisms) analysis identified the presence of "G1/1" DNA segments (average 7.5%). Additionally, DNA profiling revealed many genetic and epigenetic differences among the ILs, including sequence alterations, deletions, and variation in patterns of cytosine methylation. The frequency of fragments lost (5.1%) was higher than presence of novel bands (1.4%), and the presence of fragments specific to Brassica carinata (BBCC 2n = 34) were common (average 15.5%). Methylation-sensitive amplified polymorphism analysis indicated that methylation changes were common and that hypermethylation (12.4%) was more frequent than hypomethylation (4.8%). Our results suggested that asymmetric somatic hybridization and alien DNA introgression induced genetic and epigenetic alterations. Thus, these ILs represent an important, novel germplasm resource for cauliflower improvement that can be mined for diverse traits of interest to breeders and researchers.

Cover crop-based ecological weed management: exploration and optimization

NARCIS (Netherlands)

Kruidhof, H.M.

2008-01-01

Keywords: organic farming, ecologically-based weed management, cover crops, green manure, allelopathy, Secale cereale, Brassica napus, Medicago sativa

Cover crop-based ecological weed management: exploration and optimization. In organic farming systems, weed control is recognized as one

Nutritive values of brassica campestris L. oil as affected by growth regulator treatments

International Nuclear Information System (INIS)

Bano, A.; Khan, N.

2009-01-01

The effects of plant growth regulators, viz. Indole acetic acid (IAA), Gibberellic acid (GA) and Abscisic acid (ABA) were studied on fatty acid compositions, glucosinolate content and protein content of Brassica campestris L subsp. Oleifera (common name yellow sarson). Growth regulators were applied in seed soaking solution as well as foliar spray during vegetative phase and at flowering stage. There were reductions in the amount of long chain fatty acids viz erucic acid, eicosenoic acid and increase in the amount of unsaturated fatty acid viz. linoleic acid by lAA applications. The stimulating effect of lAA which reduced amount of unsaturated fatty acid was more pronounced when applied as foliar spray at vegetative stage. But, foliar spray of ABA during flowering increased the concentration of linoleic acid and reduced the eicosenoic acid and erucic acid. The glucosinolate content was greater in seeds soaked in 10/sup -5/ M lAA than that of control but less in 10/sup -5/ M GA treated seeds than that of control. The ABA treatment (10/sup -5/M) increased the concentration of glucosinolates in the seeds IAA treatments (10/sup -5/M) increased the protein percentage in the seeds. Foliar application of GA (10/sup -5/M) during vegetative growth and ABA (10/sup -5/M) as seed soaking prior to sowing as well as foliar spry during flowering decreased the protein content of seeds. (author)

Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box.

Science.gov (United States)

Ezcurra, I; Wycliffe, P; Nehlin, L; Ellerström, M; Rask, L

2000-10-01

The transcriptional activator ABI3 is a key regulator of gene expression during embryo maturation in crucifers. In monocots, the related VP1 protein regulates the Em promoter synergistically with abscisic acid (ABA). We identified cis-elements in the Brassica napus napin napA promoter mediating regulation by ABI3 and ABA, by analyzing substitution mutation constructs of napA in transgenic tobacco plantlets ectopically expressing ABI3. In transient analysis using particle bombardment of tobacco leaf sections, a tetramer of the distB ABRE (abscisic acid-responsive element) mediated transactivation by ABI3 and ABI3-dependent response to ABA, whereas a tetramer of the composite RY/G complex, containing RY repeats and a G-box, mediated only ABA-independent transactivation by ABI3. Deletion of the conserved B2 and B3 domains of ABI3 abolished transactivation of napA by ABI3. The two domains of ABI3 interact with different cis-elements: B2 is necessary for ABA-independent and ABA-dependent activations through the distB ABRE, whereas B3 interacts with the RY/G complex. Thus B2 mediates the interaction of ABI3 with the protein complex at the ABRE. The regulation of napA by ABI3 differs from Em regulation by VP1, in that the B3 domain of ABI3 is essential for the ABA-dependent regulation of napA.

Comparative Transcriptome Analysis between Broccoli (Brassica oleracea var. italica) and Wild Cabbage (Brassica macrocarpa Guss.) in Response to Plasmodiophora brassicae during Different Infection Stages.

Science.gov (United States)

Zhang, Xiaoli; Liu, Yumei; Fang, Zhiyuan; Li, Zhansheng; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao

2016-01-01

Clubroot, one of the most devastating diseases to the Brassicaceae family, is caused by the obligate biotrophic pathogen Plasmodiophora brassicae . However, studies of the molecular basis of disease resistance are still poor especially in quantitative resistance. In the present paper, two previously identified genotypes, a clubroot-resistant genotype (wild cabbage, B2013) and a clubroot-susceptible genotype (broccoli, 90196) were inoculated by P. brassicae for 0 (T0), 7 (T7), and 14 (T14) day after inoculation (DAI). Gene expression pattern analysis suggested that response changes in transcript level of two genotypes under P. brassicae infection were mainly activated at the primary stage (T7). Based on the results of DEGs functional enrichments from two infection stages, genes associated with cell wall biosynthesis, glucosinolate biosynthesis, and plant hormone signal transduction showed down-regulated at T14 compared to T7, indicating that defense responses to P. brassicae were induced earlier, and related pathways were repressed at T14. In addition, the genes related to NBS-LRR proteins, SA signal transduction, cell wall and phytoalexins biosynthesis, chitinase, Ca 2+ signals and RBOH proteins were mainly up-regulated in B2013 by comparing those of 90196, indicating the pathways of response defense to clubroot were activated in the resistant genotype. This is the first report about comparative transcriptome analysis for broccoli and its wild relative during the different stages of P. brassicae infection and the results should be useful for molecular assisted screening and breeding of clubroot-resistant genotypes.

Genome-wide Investigation of microRNAs and Their Targets in Brassica rapa ssp. pekinensis Root with Plasmodiophora brassicae Infection

Directory of Open Access Journals (Sweden)

Xiaochun Wei

2016-07-01

Full Text Available Increasing evidence has revealed that microRNAs play a pivotal role in the post transcriptional regulation of gene expression in response to pathogens in plants. However, there is little information available about the expression patterns of miRNAs and their targets in Chinese cabbage (Brassica rapa ssp. pekinensis under Plasmodiophora brassicae stress. In the present study, using deep sequencing and degradome analysis, a genome-wide identification of miRNAs and their targets during P. brassicae stress was performed. A total of 221 known and 93 potentially novel miRNAs were successfully identified from two root libraries of one control (635-10CK and P. brassicae-treated Chinese cabbage samples (635-10T. Of these, 14 known and 10 potentially novel miRNAs were found to be differentially expressed after P. brassicae treatment. Degradome analysis revealed that the 223 target genes of the 75 miRNAs could be potentially cleaved. KEGG (Kyoto Encyclopedia of Genes and Genomes pathway analysis suggested that the putative target genes of the miRNAs were predominately involved in selenocompound metabolism and plant hormone signal transduction. Then the expression of 12 miRNAs was validated by quantitative real-time PCR (qRT-PCR. These results provide insights into the miRNA-mediated regulatory networks underlying the stress response to the plant pathogen P. brassicae.

Assessing the risk of Glyphosate to native plants and weedy Brassicaceae species of North Dakota

Science.gov (United States)

This study was conducted to determine the ecological risk to native plants and weedy Brassicaceae species which may be growing in areas affected by off target movement of glyphosate applied to glyphosate-resistant canola (Brassica napus). Ten native grass and forb species were ...

Effect of salinity stress on plant fresh weight and nutrient ...

African Journals Online (AJOL)

Effect of salinity stress on plant fresh weight and nutrient composition of some Canola ( Brassica napus L.) cultivars. ... K+, Ca2+ and K+/Na+ contents in plants decreased by salt stress, but Na+ and Cl- content in the roots, ... from 32 Countries:.

Adjuvants for single droplet application of glyphosate

DEFF Research Database (Denmark)

Mathiassen, Solvejg Kopp; Kudsk, Per; Lund, Ivar

2016-01-01

Retention and biological activity of droplets of glyphosate deposited onto plant leaves using a Drop on Demand inkjet printer application system, was examined on pot-grown Brassica napus, Solanum nigrum, Chenopodium album, Silene noctiflora and Echinocloa crus-galli plants. Retention was measured...

Rape embryogenesis I. The proembryo development

Directory of Open Access Journals (Sweden)

Teresa Tykarska

2015-01-01

Full Text Available The development of the proembryo of rape Brassica napus L. from the zygote to the young embryo proper is described. A number of regularities were found in the direction, succession, and distribution of segmental and differentiating divisions of the proembryo. The direction of the divisions seems to foe determined by the direction of growth and the shape of the cells. The termyoung embryo proper is proposed to denote the globular embryo which already possesses separate plerome and periblem mother-cells and mother-cells of the iec layer and of clumella. The body of the embryo proper is derived from the apical cell ca which arose from the first division of the zygote and from the hypophysis - the only suspensor cell which closes the spheroid of the embryo. The development of the Brassica napus L. proembryo follows the sub-archetype Capsella bursa-pastoris in the IV megarchetype of Soueges.

In vitro propagation of Ethiopian mustard ( Brassica carinata A ...

African Journals Online (AJOL)

Brassica carinata (A. Braun) is an amphi-diploid species that originated from interspecific hybridization between Brassica nigra and Brassica oleracea in the highlands of Ethiopia. The crop has many desirable agronomic traits but with oil quality constraints like high erucic acid and glucosinolate contents. In this study, two ...

Unleashing the genome of Brassica rapa

Directory of Open Access Journals (Sweden)

Haibao eTang

2012-07-01

Full Text Available The completion and release of the Brassica rapa genome is of great benefit to researchers of the Brassicas, Arabidopsis, and genome evolution. While its lineage is closely related to the model organism Arabidopsis thaliana, the Brassicas experienced a whole genome triplication subsequent to their divergence. This event contemporaneously created three copies of its ancestral genome, which had diploidized through the process of homeologous gene loss known as fractionation. By the fractionation of homeologous gene content and genetic regulatory binding sites, Brassica’s genome is well placed to use comparative genomic techniques to identify syntenic regions, homeologous gene duplications, and putative regulatory sequences. Here, we use the comparative genomics platform CoGe to perform several different genomic analyses with which to study structural changes of its genome and dynamics of various genetic elements. Starting with whole genome comparisons, the Brassica paleohexaploidy is characterized, syntenic regions with Arabidopsis thaliana are identified, and the TOC1 gene in the circadian rhythm pathway from Arabidopsis thaliana is used to find duplicated orthologs in Brassica rapa. These TOC1 genes are further analyzed to identify conserved noncoding sequences that contain cis-acting regulatory elements and promoter sequences previously implicated in circadian rhythmicity. Each 'cookbook style' analysis includes a step-by-step walkthrough with links to CoGe to quickly reproduce each step of the analytical process.

Genome-wide analysis of the SBP-box gene family in Chinese cabbage (Brassica rapa subsp. pekinensis).

Science.gov (United States)

Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin

2015-11-01

The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.

Changes in Growth and Oil Yield Indices of Rapeseed (Brassica napus L., cv. Hyola 401 in Different Concentrations andTimes of Application of Supplementary Nitrogen Fertilizer

Directory of Open Access Journals (Sweden)

P. Tousi Kehal

2013-03-01

Full Text Available In order to investigate the effect of concentration and time of supplementary nitrogen fertilizer spray on growth indices of rapeseed (cv. Hyola 401, a field experiment was conducted at Rice Research Institute of Iran as a randomized complete blocks design with 16 treatments and 3 replications in 2008-2009. The treatments included concentration of nitrogen fertilizer (urea at two levels (5 and 10 ppm in seven levels of application time:1 spraying at 6-8- leaf stage, 2 beginning of stem elongation, 3 prior to flowering, 4 at 6-8- leaf stage + beginning of stem elongation, 5 at 6-8- leaf + prior to flowering, 6 beginning of stem elongation+ prior to flowering, and 7 at 6-8- leaf + beginning of stem elongation+ prior to flowering, which were compared with two control treatments (no fertilizer nitrogen and conventional soil fertilization. Results showed that significant difference was observed between spray treatments including concentration and times of nitrogen application, between controls and between controls with spray treatments, of grain and oil yield, crop growth rate (CGR, leaf area index (LAI and leaf area duration (LAD. Application of nitrogen (10 ppm at the beginning of stem elongation+ prior to flowering stages produced maximum grain yield (4221.7 kg/ha and oil yield (1771.1 kg/ha. Spray treatments produced maximum oil yield index (15.3% compared to controls. Maximum LAI (6.9 and 5.6 respectively, CGR (15.2 and 14.3 g/m2.10 GDD, respectively and LAD (1204 and 1029 cm2/10 GDD, respectively were also obtained from spray application of nitrogen (10 ppm at the beginning of stem elongation+ prior to flowering stages and at 6-8-leaf stage + beginning of stem elongation + prior to flowering. According to the results of the present investigation, it seems that foliar application of supplementary nitrogen fertilizer at the end growth stages (beginning of stem elongation and prior to flowering of rapeseed plants may help to enhance growth indices

Standardized gene nomenclature for the Brassica genus

Directory of Open Access Journals (Sweden)

King Graham J

2008-05-01

Full Text Available Abstract The genus Brassica (Brassicaceae, Brassiceae is closely related to the model plant Arabidopsis, and includes several important crop plants. Against the background of ongoing genome sequencing, and in line with efforts to standardize and simplify description of genetic entities, we propose a standard systematic gene nomenclature system for the Brassica genus. This is based upon concatenating abbreviated categories, where these are listed in descending order of significance from left to right (i.e. genus – species – genome – gene name – locus – allele. Indicative examples are provided, and the considerations and recommendations for use are discussed, including outlining the relationship with functionally well-characterized Arabidopsis orthologues. A Brassica Gene Registry has been established under the auspices of the Multinational Brassica Genome Project that will enable management of gene names within the research community, and includes provisional allocation of standard names to genes previously described in the literature or in sequence repositories. The proposed standardization of Brassica gene nomenclature has been distributed to editors of plant and genetics journals and curators of sequence repositories, so that it can be adopted universally.

Canola versus Wheat Rotation Effects on Subsequent Wheat Yield

Science.gov (United States)

Winter canola (Brassica napus L.) (WC) is considered the most promising, domestically-produced oilseed feedstock for biodiesel production and for diversifying wheat (Triticum aestivum L.)-based cropping systems in the Inland Pacific Northwest, USA (PNW). A law passed in 2006 requires that at least t...

Browse Title Index

African Journals Online (AJOL)

Items 101 - 132 of 132 ... Effect of an organic plant fertiliser on the establishment of rooted cuttings of ... of Potato virus Y (PVY) infecting vegetable crops in KwaZulu-Natal, ... on the grain yield and quality of canola (Brassica napus L.) grown in the ...

Data from: Can above-ground ecosystem services compensate for reduced fertilizer input and soil organic matter in annual crops?

NARCIS (Netherlands)

Gils, van S.H.; Putten, van der W.H.; Kleijn, D.

2016-01-01

Above-ground and below-ground environmental conditions influence crop yield by pollination, pest pressure, and resource supply. However, little is known about how interactions between these factors contribute to yield. Here, we used oilseed rape Brassica napus to test their effects on crop yield. We

Can above-ground ecosystem services compensate for reduced fertilizer input and soil organic matter in annual crops?

NARCIS (Netherlands)

van Gils, Stijn; van der Putten, Wim H; Kleijn, David

2016-01-01

1.Above-ground and below-ground environmental conditions influence crop yield by pollination, pest pressure, and resource supply. However, little is known about how interactions between these factors contribute to yield. Here, we used oilseed rape Brassica napus to test their effects on crop

Can above-ground ecosystem services compensate for reduced fertilizer input and soil organic matter in annual crops?

NARCIS (Netherlands)

Gils, van S.H.; Putten, van der W.H.; Kleijn, D.

2016-01-01

1.Above-ground and below-ground environmental conditions influence crop yield by pollination, pest pressure and resource supply. However, little is known about how interactions between these factors contribute to yield. Here, we used oilseed rape Brassica napus to test their effects on crop

BRAD, the genetics and genomics database for Brassica plants

Directory of Open Access Journals (Sweden)

Li Pingxia

2011-10-01

Full Text Available Abstract Background Brassica species include both vegetable and oilseed crops, which are very important to the daily life of common human beings. Meanwhile, the Brassica species represent an excellent system for studying numerous aspects of plant biology, specifically for the analysis of genome evolution following polyploidy, so it is also very important for scientific research. Now, the genome of Brassica rapa has already been assembled, it is the time to do deep mining of the genome data. Description BRAD, the Brassica database, is a web-based resource focusing on genome scale genetic and genomic data for important Brassica crops. BRAD was built based on the first whole genome sequence and on further data analysis of the Brassica A genome species, Brassica rapa (Chiifu-401-42. It provides datasets, such as the complete genome sequence of B. rapa, which was de novo assembled from Illumina GA II short reads and from BAC clone sequences, predicted genes and associated annotations, non coding RNAs, transposable elements (TE, B. rapa genes' orthologous to those in A. thaliana, as well as genetic markers and linkage maps. BRAD offers useful searching and data mining tools, including search across annotation datasets, search for syntenic or non-syntenic orthologs, and to search the flanking regions of a certain target, as well as the tools of BLAST and Gbrowse. BRAD allows users to enter almost any kind of information, such as a B. rapa or A. thaliana gene ID, physical position or genetic marker. Conclusion BRAD, a new database which focuses on the genetics and genomics of the Brassica plants has been developed, it aims at helping scientists and breeders to fully and efficiently use the information of genome data of Brassica plants. BRAD will be continuously updated and can be accessed through http://brassicadb.org.

Diversity of Pollinator Insects in Relation to Seed Set of Mustard (Brassica rapa L.: Cruciferae

Directory of Open Access Journals (Sweden)

TRI ATMOWIDI

2007-12-01

Full Text Available Pollinators provide key services to both natural and agricultural ecosystems. Agricultural productivity depends, in part, on pollinator populations from adjacent seminatural habitats. Here we analysed the diversity of pollinator insects and its effect to seed set of mustard (Brassica rapa planted in agricultural ecosystem near the Gunung Halimun-Salak National Park, West Java. At least 19 species of insects pollinated the mustard, and three species, i.e. Apis cerana, Ceratina sp., and Apis dorsata showed a high abundance. The higher abundance and species richness of pollinators occurred at 08.30-10.30 am and the diversity was related to the number of flowering plants. Insect pollinations increased the number of pods, seeds per pod, seed weights per plant, and seed germination.

Isolation and Functional Characterization of a Floral Repressor, BcMAF1, From Pak-choi (Brassica rapa ssp. Chinensis).

Science.gov (United States)

Huang, Feiyi; Liu, Tongkun; Hou, Xilin

2018-01-01

MADS-box genes form a large gene family in plants and are involved in multiple biological processes, such as flowering. However, the regulation mechanism of MADS-box genes in flowering remains unresolved, especially under short-term cold conditions. In the present study, we isolated BcMAF1 , a Pak-choi ( Brassica rapa ssp. Chinensis ) MADS AFFECTING FLOWERING ( MAF ), as a floral repressor and functionally characterized BcMAF1 in Arabidopsis and Pak-choi. Subcellular localization and sequence analysis indicated that BcMAF1 was a nuclear protein and contained a conserved MADS-box domain. Expression analysis revealed that BcMAF1 had higher expression levels in leaves, stems, and petals, and could be induced by short-term cold conditions in Pak-choi. Overexpressing BcMAF1 in Arabidopsis showed that BcMAF1 had a negative function in regulating flowering, which was further confirmed by silencing endogenous BcMAF1 in Pak-choi. In addition, qPCR results showed that AtAP3 expression was reduced and AtMAF2 expression was induced in BcMAF1 -overexpressing Arabidopsis . Meanwhile, BcAP3 transcript was up-regulated and BcMAF2 transcript was down-regulated in BcMAF1 -silencing Pak-choi. Yeast one-hybrid and dual luciferase transient assays showed that BcMAF1 could bind to the promoters of BcAP3 and BcMAF2 . These results indicated that BcAP3 and BcMAF2 might be the targets of BcMAF1. Taken together, our results suggested that BcMAF1 could negatively regulate flowering by directly activating BcMAF2 and repressing BcAP3 .

Characterization and expression patterns of small RNAs in synthesized Brassica hexaploids.

Science.gov (United States)

Shen, Yanyue; Zhao, Qin; Zou, Jun; Wang, Wenliang; Gao, Yi; Meng, Jinling; Wang, Jianbo

2014-06-01

Polyploidy has played an important role in promoting plant evolution through genomic merging and doubling. We used high-throughput sequencing to compare miRNA expression profiles between Brassica hexaploid and its parents. A total of 613, 784 and 742 known miRNAs were identified in Brassica rapa, Brassica carinata, and Brassica hexaploid, respectively. We detected 618 miRNAs were differentially expressed (log(2)Ratio ≥ 1, P ≤ 0.05) between Brassica hexaploid and its parents, and 425 miRNAs were non-additively expressed in Brassica hexaploid, which suggest a trend of non-additive miRNA regulation following hybridization and polyploidization. Remarkably, majority of the non-additively expressed miRNAs in the Brassica hexaploid are repressed, and there was a bias toward repression of B. rapa miRNAs, which is consistent with the progenitor-biased gene repression in the synthetic allopolyploids. In addition, we identified 653 novel mature miRNAs in Brassica hexaploid and its parents. Finally, we found that almost all the non-additive accumulation of siRNA clusters exhibited a low-parent pattern in Brassica hexaploid. Non-additive small RNA regulation is involved in a range of biological pathways, probably providing a driving force for variation and adaptation in allopolyploids.

Phenolic Compounds in Brassica Vegetables

Directory of Open Access Journals (Sweden)

Pablo Velasco

2010-12-01

Full Text Available Phenolic compounds are a large group of phytochemicals widespread in the plant kingdom. Depending on their structure they can be classified into simple phenols, phenolic acids, hydroxycinnamic acid derivatives and flavonoids. Phenolic compounds have received considerable attention for being potentially protective factors against cancer and heart diseases, in part because of their potent antioxidative properties and their ubiquity in a wide range of commonly consumed foods of plant origin. The Brassicaceae family includes a wide range of horticultural crops, some of them with economic significance and extensively used in the diet throughout the world. The phenolic composition of Brassica vegetables has been recently investigated and, nowadays, the profile of different Brassica species is well established. Here, we review the significance of phenolic compounds as a source of beneficial compounds for human health and the influence of environmental conditions and processing mechanisms on the phenolic composition of Brassica vegetables.

Pengaruh Kombinasi Pupuk Kandang Sapi dan Abu Sabut Kelapa sebagai Pupuk Utama dalam Budidaya Tanaman Brokoli (Brassica oleracia L.

Directory of Open Access Journals (Sweden)

Eko Binti Lestari

2016-08-01

Full Text Available This research aims to study the effectiveness of coconut fibre ash as an additive nutrient for growth and yield of Broccoli (Brassica oleracia L., and to determine the best combination between manure and coconut fibre ash in organic farming of Broccoli. This research conducted using single factor experiment that arranged in Randomized Completely Block Design (RCBD. The treatments are (1 Manure 0,75 kg + Coconut fire ash 24,3 g (2 Manure 0,75 kg + Coconut fibre ash12,15 g, (3 Manure 0,75 kg + without Coconut fibre ash, (4 Manure 1 kg + Coconut fibre ash 24,3 g, (5 Manure 1 kg + Coconut fibre ash 12,15  g, (6 Manure 1 kg + without coconut fibre ash, (7 Manure 1,25 kg + Coconut fibre ash 24,3 g, (8 Manure 1,25 kg + Coconut fibre ash 12,15 g, (9 Manure 1,25 kg + without coconut fibre ash. The result showed that the combination between manure and coconut fibre ash have not significantly different in number of leaves, flowering time, fresh weight, flower size, fresh weight of flower. However, the combination between manure 1,25 kg and coconut fibre ash 24,3 g is considered to be the most efficient in organic farming of Broccoli.

Genome-wide identification of aquaporin encoding genes in Brassica oleracea and their phylogenetic sequence comparison to Brassica crops and Arabidopsis

Science.gov (United States)

Diehn, Till A.; Pommerrenig, Benjamin; Bernhardt, Nadine; Hartmann, Anja; Bienert, Gerd P.

2015-01-01

Aquaporins (AQPs) are essential channel proteins that regulate plant water homeostasis and the uptake and distribution of uncharged solutes such as metalloids, urea, ammonia, and carbon dioxide. Despite their importance as crop plants, little is known about AQP gene and protein function in cabbage (Brassica oleracea) and other Brassica species. The recent releases of the genome sequences of B. oleracea and Brassica rapa allow comparative genomic studies in these species to investigate the evolution and features of Brassica genes and proteins. In this study, we identified all AQP genes in B. oleracea by a genome-wide survey. In total, 67 genes of four plant AQP subfamilies were identified. Their full-length gene sequences and locations on chromosomes and scaffolds were manually curated. The identification of six additional full-length AQP sequences in the B. rapa genome added to the recently published AQP protein family of this species. A phylogenetic analysis of AQPs of Arabidopsis thaliana, B. oleracea, B. rapa allowed us to follow AQP evolution in closely related species and to systematically classify and (re-) name these isoforms. Thirty-three groups of AQP-orthologous genes were identified between B. oleracea and Arabidopsis and their expression was analyzed in different organs. The two selectivity filters, gene structure and coding sequences were highly conserved within each AQP subfamily while sequence variations in some introns and untranslated regions were frequent. These data suggest a similar substrate selectivity and function of Brassica AQPs compared to Arabidopsis orthologs. The comparative analyses of all AQP subfamilies in three Brassicaceae species give initial insights into AQP evolution in these taxa. Based on the genome-wide AQP identification in B. oleracea and the sequence analysis and reprocessing of Brassica AQP information, our dataset provides a sequence resource for further investigations of the physiological and molecular functions of

Importance of winter rape for small rodents

Czech Academy of Sciences Publication Activity Database

Heroldová, Marta; Zejda, J.; Zapletal, M.; Obdržálková, D.; Jánová, E.; Bryja, Josef; Tkadlec, E.

2004-01-01

Roč. 50, č. 4 (2004), s. 175-181 ISSN 0370-663X R&D Projects: GA AV ČR KSK6005114 Keywords : Microtus arvalis * Apodemus microps * Brassica napus Subject RIV: EG - Zoology Impact factor: 0.379, year: 2004 http://www.cazv.cz/attachments/6-heroldova.pdf

High-Performance Liquid Chromatography–Mass Spectrometry Analysis of Plant Metabolites in Brassicaceae

NARCIS (Netherlands)

Vos, de C.H.; Schipper, A.; Hall, R.D.

2012-01-01

The Brassicaceae family comprises a variety of plant species that are of high economic importance as -vegetables or industrial crops. This includes crops such as Brassica rapa (turnip, Bok Choi), B. oleracea (cabbages, broccoli, cauliflower, etc.), and B. napus (oil seed rape), and also includes the

Chitosan oligosaccharides-triggered innate immunity contributes to oilseed rape resistance against Sclerotinia sclerotiorum

DEFF Research Database (Denmark)

Yin, Heng; Yan, Li; HongYan, Zhang