WorldWideScience

Sample records for brainstem glioblastoma multiforme

  1. Difficult diagnosis of brainstem glioblastoma multiforme in a woman: a case report and review of the literature

    Directory of Open Access Journals (Sweden)

    Lakhan Shaheen E

    2009-10-01

    Full Text Available Abstract Introduction Brainstem gliomas are rare in adults. They most commonly occur in the pons and are most likely to be high-grade lesions. The diagnosis of a high-grade brainstem glioma is usually reached due to the presentation of rapidly progressing brainstem, cranial nerve and cerebellar symptoms. These symptoms do, however, overlap with a variety of other central nervous system disorders. Magnetic resonance imaging is the radiographic modality of choice, but can still be misleading. Case presentation A 48-year-old Caucasian woman presented with headache and vomiting followed by cerebellar signs and confusion. Magnetic resonance imaging findings were suggestive of a demyelinating process, but the patient failed to respond to therapy. Her condition rapidly progressed and she died. At autopsy, a high-grade invasive pontine tumor was identified. Histological evaluation revealed glioblastoma multiforme. Conclusion While pontine gliomas are rare in adults, those that do occur tend to be high-grade and rapidly progressive. Progression of symptoms from non-specific findings of headache and vomiting to rapid neurological deterioration, as occurred in our patient, is common in glioblastoma multiforme. While radiographic findings are often suggestive of the underlying pathology, this case represents the possibility of glioblastoma multiforme presenting as a deceptively benign appearing lesion.

  2. Primary cerebellar glioblastoma multiforme.

    Science.gov (United States)

    Demir, Mustafa Kemal; Hakan, Tayfun; Akinci, Okan; Berkman, Zafer

    2005-06-01

    Primary glioblastoma multiforme of cerebellar hemispheres in adults is a rare condition. Most of them result from dedifferentiation of astrocytoma to glioblastoma. We present two cases of unusual de novo cerebellar glioblastomas, one of which is the giant-cell variant. We review their clinical behaviour with conventional MR imaging features and discuss the key findings that can lead to the correct diagnosis in sight of new MR imaging technologies.

  3. TSPO Imaging in Glioblastoma Multiforme

    DEFF Research Database (Denmark)

    Jensen, Per; Feng, Ling; Law, Ian

    2015-01-01

    -CLINDE is superior to (18)F-FET in predicting progression of glioblastoma multiforme (GBM) at follow-up. METHODS: Three patients with World Health Organization grade IV GBM were scanned with (123)I-CLINDE SPECT, (18)F-FET PET, and gadolinium-enhanced MR imaging. Molecular imaging data were compared with follow...

  4. Rare clinical form of glioblastoma multiforme

    Directory of Open Access Journals (Sweden)

    Maria Ejma

    2014-03-01

    Full Text Available Glioblastoma multiforme (glioblastoma multiforme - GBM is the most malignant tumor classified by WHO. It is also the most common primary CNS tumor with a very aggressive course and unfavourable prognosis, usually develops in adults, and is typically located supratentorially in the fronto-temporal region. However, the literature describes an unusual position of GBM (e.g. spinal cord, pons, pineal region, familial gliomas unconnected with the family of gliomas predisposed to the occurrence of syndromes, unusual glioma and metastatic sites, gliomas transplanted with organs. In this paper, based on the available literature, the authors discuss an unusual and rare form of glioblastoma multiforme.

  5. Cotard's syndrome with glioblastoma multiforme.

    Science.gov (United States)

    Reich, Michel; Comet, Benedicte; Le Rhun, Emilie; Ramirez, Carole

    2012-06-01

    Brain tumors are classically associated with neurological and/or psychiatric symptomatology. Behavioral or cognitive disorders can underlie delirium, personality changes, psychotic reactions, and mood disorders. To illustrate this, we report the case of a 60-year-old male patient confronted with an inoperable glioblastoma multiforme on the splenium of the corpus callosum, of poor prognosis, treated by concomitant radiochemotherapy with temozolomide, who developed psychotic depression with Cotard's syndrome. Clinical manifestations of this syndrome with untoward consequences in terms of prognosis are classically characterized by intense moral suffering, indignity and pessimistic fixations, suicidal ideations, and a nihilistic delusion relating to one's own body. Nevertheless, this association between Cotard's syndrome and glioblastoma has been seldom described. To our knowledge, this is the first time that this has been described as a complication of this particular tumor location. Some neuropsychopathological hypotheses are proposed, which involve medical, iatrogenic, and psychogenesis issues. This case report points to the necessary collaboration between psychiatrists, neuro-oncologists and radiation oncologists in improving the patient's management and quality of life.

  6. Advances in the treatment of glioblastoma multiforme

    OpenAIRE

    Jaramillo, Sonia; Pontificia Universidad Javerian; Osorio, Walter; Pontificia Universidad Javeriana; Espitia, Juan Carlos; Pontificia Universidad Javeriana

    2010-01-01

    Glioblastoma multiforme is the most common central nervous system (CNS) primary tumor in men. Its incidence in Europe lies between 3 to 4 cases per 100,000 inhabitants and it represents 25% of all the CNS tumors and 50% of the primary tumors. Less than 3% of all patients diagnosed with glioblastoma multiforme survive more than 4 years and the average survival is of 6 months. Studies aiming to increase the survival rate, as well as to achieve longer asymptomatic periods are being carried out a...

  7. PICTORIAL REVIEW Glioblastoma multiforme has many faces

    African Journals Online (AJOL)

    in both its pathological and radiological appearance.3 We present a series of 5 patients with histologically proven glioblastoma multiforme with atypical MRI findings. Case 1: Gliosarcoma. A 64-year-old man was initially admitted for pneumonia. On further inquiry, relatives reported that he had suffered from mild confusion,.

  8. Irinotecan and bevacizumab in recurrent glioblastoma multiforme

    DEFF Research Database (Denmark)

    Jakobsen, Jan Nyrop; Hasselbalch, Benedikte; Stockhausen, Marie-Thérése

    2011-01-01

    INTRODUCTION: Glioblastoma multiforme (GBM) is the most common high grade primary brain tumor in adults. Despite significant advances in treatment, the prognosis remains poor. Bevacizumab (BVZ) and irinotecan (CPT-11) are currently being investigated in the treatment of GBM patients. Although...

  9. Orphan drugs in glioblastoma multiforme: a review

    Directory of Open Access Journals (Sweden)

    Lassen U

    2014-11-01

    Full Text Available Ulrik Lassen, Morten Mau-Sørensen, Hans Skovgaard Poulsen Department of Oncology, Rigshospitalet, Copenhagen, DenmarkAbstract: Glioblastoma multiforme (GBM is the most common and deadly brain tumor in adults. The incidence of GBM in the USA and Europe is 2–3 per 100,000. By definition, an orphan disease affects up to 200,000 persons in the USA (one in every 1,500. A search was made in the US Food and Drug Administration orphan drug listing. In addition, a PubMed search of orphan drugs designated for GBM or high-grade glioma was performed, followed by a search for clinical studies in GBM with orphan drugs designated for other indications. This included cytotoxic chemotherapy and targeted agents. Thirteen drugs with orphan designation for the treatment of glioblastoma, high-grade glioma, or primary malignant brain tumors were identified. In addition, 16 drugs with orphan designation for other indications were identified to have been evaluated in clinical studies of GBM. The efficacy data from the clinical studies is presented. A few agents have been approved by the US Food and Drug Administration for the treatment of high-grade gliomas following orphan drug designation, but most have failed to reach the market. However, a few patients may have benefited from receiving developmental agents within clinical trials. Biomarkers for selection of these patients may result in more success in the field of personalized medicine. Keywords: orphan drugs, glioblastoma multiforme, brain tumor, targeted therapy, cytotoxic therapy

  10. Statin use and survival following glioblastoma multiforme

    DEFF Research Database (Denmark)

    Gaist, David; Hallas, Jesper; Friis, Søren

    2014-01-01

    AIM: While some studies indicate a potential chemopreventive effect of statin use on the risk of glioma, the effect of statins on the prognosis of brain tumours has not yet been examined. We thus conducted a cohort study evaluating the influence of statin use on survival in patients...... with glioblastoma multiforme (GBM). METHODS: We identified 1562 patients diagnosed with GBM during 2000-2009 from the Danish Cancer Registry and linked this cohort to Danish nationwide demographic and health registries. Within the GBM cohort, each patient recorded as using statins prior to diagnosis (defined as ≥2...... redeemed prescriptions) was matched to two statin non-users (

  11. Glioblastoma Multiforme Presenting as Spontaneous Intracerebral Hemorrhage

    Directory of Open Access Journals (Sweden)

    Cagatay Ozdol

    2014-06-01

    Full Text Available Brain tumors with concomitant intracerebral hemorrhage are rarely encountered. Hemorrhage as the initial presentation of a brain tumour may pose some diagnostic problems, especially if the tumour is small or the hemorrhage is abundant. We present a 47-year-old man who admitted to the emergency department with sudden onset headache, right blurred vision and gait disturbance. A non-contrast cranial computerized tomography scan performed immediately after his admission revealed a well circumscribed right occipitoparietal haematoma with intense peripheral edema causing compression of the ipsilateral ventricles. On 6th hour of his admission the patient%u2019s neurological status deteriorated and he subsequently underwent emergent craniotomy and microsurgical evacuation of the haematoma. The histopathological examination of the mass was consistent with a glioblastoma multiforme. Neoplasms may be hidden behind each case of spontaneous intracerebral hemorrhage. Histological sampling and investigation is mandatory in the presence of preoperative radiological features suggesting a neoplasm.

  12. Glioblastoma multiforme in a child with tuberous sclerosis complex.

    Science.gov (United States)

    Vignoli, Aglaia; Lesma, Elena; Alfano, Rosa Maria; Peron, Angela; Scornavacca, Giulia Federica; Massimino, Maura; Schiavello, Elisabetta; Ancona, Silvia; Cerati, Michele; Bulfamante, Gaetano; Gorio, Alfredo; Canevini, Maria Paola

    2015-10-01

    Tuberous Sclerosis Complex (TSC) is characterized by the presence of benign tumors in the brain, kidneys, heart, eyes, lungs, and skin. The typical brain lesions are cortical tubers, subependimal nodules and subependymal giant-cell astrocytomas. The occurrence of malignant astrocytomas such as glioblastoma is rare. We report on a child with a clinical diagnosis of TSC and a rapidly evolving glioblastoma multiforme. Genetic analysis identified a de novo mutation in TSC2. Molecular characterization of the tumor was performed and discussed, as well as a review of the literature where cases of TSC and glioblastoma multiforme are described. Although the co-occurrence of TSC and glioblastoma multiforme seems to be rare, this possible association should be kept in mind, and proper clinical and radiological follow up should be recommended in these patients. © 2015 Wiley Periodicals, Inc.

  13. Cancer Stem Cells in Glioblastoma Multiforme

    Directory of Open Access Journals (Sweden)

    Amy Ruth Bradshaw

    2016-08-01

    Full Text Available Aim To identify and characterize cancer stem cells (CSC in glioblastoma multiforme (GBM.Methods 4μm-thick formalin-fixed paraffin-embedded GBM samples from six patients underwent 3,3-diaminobenzidine (DAB and immunofluorescent (IF immunohistochemical (IHC staining for the embryonic stem cell (ESC markers NANOG, OCT4, SALL4, SOX2 and pSTAT3. IF IHC staining was performed to demonstrate co-expression of these markers with GFAP. The protein expression and the transcriptional activities of the genes encoding NANOG, OCT4, SOX2, SALL4 and STAT3 were investigated using Western blotting (WB and NanoString gene expression analysis, respectively. Results DAB and IF IHC staining demonstrated the presence of a CSC population expressing NANOG, OCT4, SOX2, SALL4 and STAT3 with the almost ubiquitous presence of SOX2 and a relatively low abundance of OCT4, within GBM. The expression of NANOG, SOX2 and pSTAT3 but, not OCT and SALL4, was confirmed by WB. NanoString gene analysis demonstrated transcriptional activation of NANOG, OCT4, SALL4, STAT3 and SOX2 in GBM. Conclusion This study demonstrated a population of CSCs within GBM characterized by the expression of the CSC markers NANOG, SALL4, SOX2, pSTAT3 and OCT4 at the protein and mRNA levels. The almost ubiquitous presence of SOX2 and a relatively low abundance of OCT4 would support the putative existence of a stem cell hierarchy within GBM.

  14. Glioblastoma multiforme with long term survival.

    Science.gov (United States)

    Deb, Prabal; Sharma, Mehar Chand; Mahapatra, Ashok Kumar; Agarwal, Deepak; Sarkar, Chitra

    2005-09-01

    Glioblastoma multiforme (GBM) Patients generally have a dismal prognosis, with median survival of 10-12 months. GBM with long-term survival (LTS) of (3) > or = 5 years is rare, and no definite markers indicating better prognosis have been identified till date. The present study was undertaken to evaluate GBMs with LTS in order to identify additional correlates associated with favourable outcome. The cases were evaluated for relevant clinicopathological data, proliferation index and expression of tumortumour suppressor gene (p53 ), cyclin-dependant kinase-inhibitors (p27 and p16 ) and epidermal growth factor receptor (EGFR) proteins. Six cases of GBM with LTS with an average survival of 9 years (range 5-15 years) were identified. All were young patients with mean age of 27 years (range 8-45 years). Histology of three cases was consistent with conventional GBM, while two showed prominent oligodendroglial component admixed with GBM areas. One was a giant cell GBM, which progressed to gliosarcoma on recurrence. The mean MIB-1LI was 12% (range 6-20%). p53 was immunopositive in 4 out of 5 cases. EGFR and p27 were immunonegative in all, whereas p16 was immunonegative in 3 out of 5 cases. Currently, in the absence of specific molecular and genetic markers, GBM in young patients should be meticulously evaluated for foci of oligodendroglial component and/or giant cell elements, in addition to proliferative index and p53 expression, since these probably have prognostic connotations, as evident in this study. The role of p16 and p27 however needs better definition with study of more number of cases.

  15. Gemcitabine uptake in glioblastoma multiforme: potential as a radiosensitizer

    NARCIS (Netherlands)

    Sigmond, J.; Honeywell, R.J.; Postma, T.J.; Dirven, C.M.; Lange, de S.M.; Born, van der K.; Laan, A.; Baayen, J.C.; Groeningen, van C.J.; Bergman, A.M.; Giaccone, G.; Peters, G.J.

    2009-01-01

    Glioblastoma multiforme (GBM), the most frequent malignant brain tumor, has a poor prognosis, but is relatively sensitive to radiation. Both gemcitabine and its metabolite difluorodeoxyuridine (dFdU) are potent radiosensitizers. The aim of this phase 0 study was to investigate whether gemcitabine

  16. Restricted calorie ketogenic diet for the treatment of glioblastoma multiforme.

    Science.gov (United States)

    Maroon, Joseph; Bost, Jeffrey; Amos, Austin; Zuccoli, Giulio

    2013-08-01

    Glioblastoma multiforme is the most common malignant primary brain tumor in adults and generally considered to be universally fatal. Glioblastoma multiforme accounts for 12% to 15% of all intracranial neoplasms and affects 2 to 3 adults per every 100,000 in the United States annually. In children glioblastoma multiforme accounts for only approximately 7% to 9% of central nervous system tumors. The mean survival rate in adults after diagnosis ranges from 12 to 18 months with standard therapy and 3 to 6 months without therapy. The prognosis in children is better compared to adult tumor onset with a mean survival of approximately 4 years following gross total surgical resection and chemotherapy. There have been few advances in the treatment of glioblastoma multiforme in the past 40 years beyond surgery, radiotherapy, chemotherapy, and corticosteroids. For this reason a restrictive calorie ketogenic diet, similar to that used in children to control drug resistant seizure activity, has been advanced as an alternative adjunctive treatment to help prolonged survival. This article reviews the science of tumor metabolism and discusses the mechanism of calorie restriction, cellular energy metabolism, and how dietary induced ketosis can inhibit cancer cell's energy supply to slow tumor growth.

  17. Glioblastoma multiforme has many faces | van Rensburg | SA ...

    African Journals Online (AJOL)

    Glioblastoma multiforme (GBM) is a class of devastating, highly aggressive central nervous system tumours. While the classical appearance is easily recognisable, several variations occur. We present 6 cases of confirmed GBM that illustrate the unusual findings in histological subtypes, early presentation and spread on ...

  18. Nanoparticles of carbon allotropes inhibit glioblastoma multiforme angiogenesis in ovo

    DEFF Research Database (Denmark)

    Grodzik, Marta; Sawosz, Ewa; Wierzbicki, Mateusz

    2011-01-01

    The objective of the study was to determine the effect of carbon nanoparticles produced by different methods on the growth of brain tumor and the development of blood vessels. Glioblastoma multiforme cells were cultured on the chrioallantoic membrane of chicken embryo and after 7 days of incubation...

  19. Advanced case of glioblastoma multiforme and pregnancy. An ethical dilemma.

    Science.gov (United States)

    Al-Rasheedy, Intisar M; Al-Hameed, Fahad M

    2015-10-01

    Glioblastoma multiforme (GBM) is the most common and malignant form of the glial tumors. Advanced and treated GBM is rarely associated with pregnancy for many reasons. Glioblastoma multiforme presenting during pregnancy carries unique challenges to the patient, baby, family, and health care providers. We describe an unusual case of advanced GBM that was treated with maximum doses of chemotherapy and radiations, and she became pregnant and presented at eighteenth weeks of gestation. Her medical management was associated with a significant ethical dilemma. We managed to deliver the baby safely through cesarean section at week 28 despite the critical condition of the mother. Unfortunately, the mother died 2 weeks post delivery. We concluded that although recurrent and treated GBM is rarely associated with pregnancy and carries dismal prognosis, but if it occurs, it can still be carried, and a multidisciplinary team work is the key for successful outcome.

  20. Glioblastoma multiforme in children: report of 13 cases and review of the literature.

    Science.gov (United States)

    Mahvash, Mehran; Hugo, Heinz-Herrmann; Maslehaty, Homajoun; Mehdorn, Hubertus Maximilian; Stark, Andreas Martin

    2011-09-01

    We present clinical and histopathologic data from 13 children who underwent craniotomy for newly diagnosed glioblastoma multiforme. Clinical characteristics were compared to those in adult patients (n = 403). The mean age of the children was 10.4 years. The male/female ratio was 3.3:1. The localization was infratentorial in 6 cases (brainstem, n = 4; cerebellum, n = 2) and supratentorial in 7 cases (frontal, n = 2; parietal, n = 3; temporal, n = 2). Infratentorial localization was observed solely in children from 0-10 years, whereas supratentorial location was found in children between the age of 11 and 21 years. Surgical resection was followed by radiotherapy in 11 cases and additional chemotherapy in 8 cases. Giant cell glioblastoma multiforme was found in 2 cases (15%, vs 1-5% in adults). The mean Ki-67 proliferation index was 29.4% (vs 25.6% in adults). There were no significant differences in histologic morphology between children and adults. The total survival time was 90 weeks (vs 47 weeks in adults). One patient is still alive after 8 years. Predictive factors of prolonged survival were the extent of tumor resection and radio- and/or chemotherapy after resection. Multidisciplinary treatment of glioblastoma in childhood might lead to better median survival than in adults. Infratentorial tumor location was observed exclusively in children younger than 11 years old. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Cerebellar giant cell glioblastoma multiforme in an adult

    OpenAIRE

    Sudhansu Sekhar Mishra; Sanjay Kumar Behera; Manmath Kumar Dhir; Satya Bhusan Senapati

    2014-01-01

    Cerebellar glioblastoma multiforme (GBM) is a rare tumor that accounts for only 1% of all cases of GBM and its giant cell variant is even much rarely encountered in adults. A case of cerebellar giant cell GBM managed at our institution reporting its clinical presentation, radiological and histological findings, and treatment instituted is described. In conjunction, a literature review, including particular issues, clinical data, advances in imaging studies, pathological characteristics, treat...

  2. Flavopiridol's antiproliferative effects in glioblastoma multiforme

    Directory of Open Access Journals (Sweden)

    Gozde Cobanoglu

    2016-01-01

    Conclusion: The present study demonstrated that flavopiridol did not induce caspase-3/7 activation, BIM, and BAX pro-apoptotic proteins but it leads to the expression changes of various proteins that inhibit proliferation and eternity in glioblastoma cell lines which have different genetic alterations.

  3. Malignant melanoma mimicking giant cell variant of glioblastoma multiforme: A case report and review of literature

    OpenAIRE

    Arcega, R; Yong, WH; Xu, H

    2015-01-01

    We present a case of metastatic malignant melanoma in a patient initially diagnosed with glioblastoma multiforme, giant cell variant. A forty year old female presented to our institution for a re-resection of a recurrent right parietal lobe mass, presumed to be recurrent glioblastoma multiforme. PET scan during preoperative evaluation revealed a 3 cm left lower lobe lung mass. Metastatic glioblastoma to lung was considered in the differential diagnosis. Resection of the brain mass revealed a ...

  4. Glioblastoma multiforme of the pineal region: case report Glioblastoma multiforme de região pineal: relato de caso

    Directory of Open Access Journals (Sweden)

    Emerson Leandro Gasparetto

    2003-06-01

    Full Text Available PURPOSE: pineal region tumors are uncommon, and comprise more frequently three categories: germ cell, parenchymal cell and glial tumors. Most pineal gliomas are low-grade astrocytomas. Glioblastoma multiforme, the most aggressive and common brain tumor, is extremely rare at this location with only few cases reported. CASE DESCRIPTION: a 29-year-old woman with a two month history of headache, nuchal pain, fever, nausea and seizures and physical examination showing nuchal rigidity, generalized hypotony, hypotrophy and hyper-reflexia, Babinski sign and left VI cranial par palsy. CT scan examination revealed a ill-defined hypodense lesion at the pineal region with heterogeneous contrast enhancement. MRI showed a lesion at the pineal region infiltrating the right thalamic region. The patient underwent a right craniotomy with partial resection of the mass. The histological examination of paraffin-embedded material defined the diagnosis of glioblastoma multiforme. Post-operative radiotherapy was indicated but the patient refused the treatment and died two months afterwards. CONCLUSION: in spite of its rarity at this location, glioblastoma multiforme should be considered in the differential diagnosis of aggressive lesions at the pineal region.OBJETIVO: Os tumores da região pineal são incomuns e podem ser divididos em três categorias de acordo com a sua origem: células germinativas, células do parênquima e células gliais. Em sua maioria, os gliomas de pineal são astrocitomas de baixo grau, sendo que o seu correspondente maligno, glioblastoma multiforme, é o mais comum e agressivo tumor encefálico e é extremamente raro nesta localização, com apenas alguns casos relatados na literatura. CASO: Mulher com 29 anos apresentando há 2 meses cefaléia, nucalgia, febre, náuseas e crises convulsivas. O exame físico mostrou rigidez de nuca, hipotonia, hipotrofia e hiperreflexia generalizadas, sinal de Babinski e paralisia do VI nervo craniano. A

  5. Glioblastoma Multiforme in the Pineal Region with Leptomeningeal Dissemination and Lumbar Metastasis

    Science.gov (United States)

    Hironaka, Yasuo; Suigimoto, Tadashi; Nakase, Hiroyuki

    2015-01-01

    We report a case of a 31-year-old woman with glioblastoma multiforme (GBM) in the pineal region with associated leptomeningeal dissemination and lumbar metastasis. The patient presented with severe headache and vomiting. Magnetic resonance imaging (MRI) of the brain showed a heterogeneously enhanced tumor in the pineal region with obstructive hydrocephalus. After an urgent ventricular-peritoneal shunt, she was treated by subtotal resection and chemotherapy concomitant with radiotherapy. Two months after surgery, MRI showed no changes in the residual tumor but leptomeningeal dissemination surrounding the brainstem. One month later, she exhibited severe lumbago and bilateral leg pain. Thoracico-lumbar MRI showed drop like metastasis in the lumbar region. Finally she died five months after the initial diagnosis. Neurosurgeons should pay attention to GBM in the pineal region, not only as an important differential diagnosis among the pineal tumors, but due to the aggressive features of leptomeningeal dissemination and spinal metastasis. PMID:26713151

  6. Clinical outcome of patients with glioblastoma multiforme: Single center experience

    Directory of Open Access Journals (Sweden)

    Özlem Yersal

    2017-12-01

    Full Text Available Glioblastoma multiforme (GBM is the most common and fatal brain tumor in adults. Prognosis remains dismal and median overall survival rarely exceeds 12 months. In this study, we evaluated the demographic and clinical features of Turkish glioblastoma patients from single institute to identify the important prognostic factors which might be related with patient outcomes in this population, retrospectively. Demographic data, clinicopathological data and treatment parameters (i.e. extent of surgical resection, radiotherapy and use of chemotherapy were obtained from medical records. SPSS version 22 was used for all statistical analyses. The median progression-free survival and overall survival was 9,9 and 13,7 months; respectively. The group of patients with the highest mean overall survival had a tumor at the fronto-temporal region, followed by frontal localization. In univariate analysis, age, concurrent chemoradiotherapy and adjuvant temozolomide use were all predictors for both PFS and OS. However, in multivariate analysis, age and concurrent radiotherapy were significant predictors of survival. Patients receiving cyberknife after recurrence had longer OS. We retrospectively evaluated glioblastoma patients from single institute, the results supported previously reported factors that influence survival time in glioblastoma.

  7. A prospective PET study of patients with glioblastoma multiforme

    DEFF Research Database (Denmark)

    Andersen, Preben B.; Blinkenberg, M; Lassen, U

    2006-01-01

    OBJECTIVE: To study the post-surgical metabolic and structural cerebral changes in patients with glioblastoma multiforme (GBM). MATERIALS AND METHODS: We examined ten patients prospectively with newly diagnosed GBM. All patients were primarily treated with surgery, followed by chemotherapy (carmu...... compared with structural imaging in the prospective evaluation of GBM. We found a difference in metabolic increase and tumor growth between the two treatment regimens, although this finding has limited relevance due to the design of the study.......OBJECTIVE: To study the post-surgical metabolic and structural cerebral changes in patients with glioblastoma multiforme (GBM). MATERIALS AND METHODS: We examined ten patients prospectively with newly diagnosed GBM. All patients were primarily treated with surgery, followed by chemotherapy...... (carmustine, cisplatine and etoposide) and radiotherapy. Positron emission tomography (PET) was used to measure tumor- and cerebral metabolism. CT or MRI was used to estimate tumor volume by measurements of tumor area. RESULTS: Tumor metabolism was not increased during chemotherapy (P = 0.71), but increased...

  8. Concerns about anti-angiogenic treatment in patients with glioblastoma multiforme

    NARCIS (Netherlands)

    Verhoeff, J.J.C.; van Tellingen, O.; Claes, A.; Stalpers, L.J.A.; van Linde, M.E.; Richel, D.J.; Leenders, W.P.J.; van Furth, W.R.

    2009-01-01

    BACKGROUND: The relevance of angiogenesis inhibition in the treatment of glioblastoma multiforme (GBM) should be considered in the unique context of malignant brain tumours. Although patients benefit greatly from reduced cerebral oedema and intracranial pressure, this important clinical improvement

  9. Alternative lengthening of telomeres and survival in patients with glioblastoma multiforme.

    Science.gov (United States)

    Hakin-Smith, V; Jellinek, D A; Levy, D; Carroll, T; Teo, M; Timperley, W R; McKay, M J; Reddel, R R; Royds, J A

    2003-03-08

    Despite advances in the molecular pathogenesis of glioblastoma multiforme, no reliable prognostic markers have been identified. We analysed telomerase activity and telomere lengths in glioblastoma multiformes from 77 patients. 19 patients (25%) had tumours with the alternative-lengthening-of-telomere (ALT) phenotype. Median survival for patients with this phenotype was 542 days (95% CI 114-970) compared with 247 days (224-270) for glioblastoma multiformes with normal telomeres (p=0.0003). Cox's regression analysis showed that this association is independent of age. In patients with non-ALT tumours, telomerase activity did not affect survival (median 287 [199-375] vs 236 [230-242] days, p=0.275). We conclude that ALT is a prognostic indicator for patients with glioblastoma multiforme.

  10. Cerebellar giant cell glioblastoma multiforme in an adult.

    Science.gov (United States)

    Mishra, Sudhansu Sekhar; Behera, Sanjay Kumar; Dhir, Manmath Kumar; Senapati, Satya Bhusan

    2014-07-01

    Cerebellar glioblastoma multiforme (GBM) is a rare tumor that accounts for only 1% of all cases of GBM and its giant cell variant is even much rarely encountered in adults. A case of cerebellar giant cell GBM managed at our institution reporting its clinical presentation, radiological and histological findings, and treatment instituted is described. In conjunction, a literature review, including particular issues, clinical data, advances in imaging studies, pathological characteristics, treatment options, and the behavior of such malignant tumor is presented. It is very important for the neurosurgeon to make the differential diagnosis between the cerebellar GBM, and other diseases such as metastasis, anaplastic astrocytomas, and cerebellar infarct because their treatment modalities, prognosis, and outcome are different.

  11. Nanotechnology to augment immunotherapy for the treatment of glioblastoma multiforme.

    Science.gov (United States)

    Ung, Nolan; Yang, Isaac

    2015-07-01

    Glioblastoma multiforme (GBM) is characterized as one of the most common and most deadly malignant primary brain tumors. Current treatment modalities include the use of surgical resection and adjuvant chemotherapy and radiation therapy, though survival is still limited. Because of this, new treatment strategies are needed to improve overall survival. Immunotherapy has emerged as a potential treatment, but still possesses certain limitations to have a substantial clinical effect. In addition, nanotechnology has emerged as potent treatment effectors that have been shown to augment the effects of therapies including chemotherapy, gene therapy, and more. Nanoparticles possess a novel approach due to the myriad of functional groups that can create targeted treatments, though further optimization is still required. In this review, the authors will present the current uses and abilities of nanotechnology and its implication for use with immunotherapy in the treatment of GBM.

  12. Brain Cancer Stem Cells: Current Status on Glioblastoma Multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Facchino, Sabrina; Abdouh, Mohamed [Developmental Biology Laboratory, Hopital Maisonneuve-Rosemont, 5415 Boul. l' Assomption, Montreal, H1T 2M4 (Canada); Bernier, Gilbert, E-mail: gbernier.hmr@ssss.gouv.qc.ca [Developmental Biology Laboratory, Hopital Maisonneuve-Rosemont, 5415 Boul. l' Assomption, Montreal, H1T 2M4 (Canada); Faculté de Médecine, Université de Montréal, Montréal, H3T 1J4 (Canada)

    2011-03-30

    Glioblastoma multiforme (GBM), an aggressive brain tumor of astrocytic/neural stem cell origin, represents one of the most incurable cancers. GBM tumors are highly heterogeneous. However, most tumors contain a subpopulation of cells that display neural stem cell characteristics in vitro and that can generate a new brain tumor upon transplantation in mice. Hence, previously identified molecular pathways regulating neural stem cell biology were found to represent the cornerstone of GBM stem cell self-renewal mechanism. GBM tumors are also notorious for their resistance to radiation therapy. Notably, GBM “cancer stem cells” were also found to be responsible for this radioresistance. Herein, we will analyze the data supporting or not the cancer stem cell model in GBM, overview the current knowledge regarding GBM stem cell self-renewal and radioresistance molecular mechanisms, and discuss the potential therapeutic application of these findings.

  13. Protocols for BNCT of glioblastoma multiforme at Brookhaven: Practical considerations

    Energy Technology Data Exchange (ETDEWEB)

    Chanana, A.D.; Coderre, J.A.; Joel, D.D.; Slatkin, D.N.

    1996-12-31

    In this report we discuss some issues considered in selecting initial protocols for boron neutron capture therapy (BNCT) of human glioblastoma multiforme. First the tolerance of normal tissues, especially the brain, to the radiation field. Radiation doses limits were based on results with human and animal exposures. Estimates of tumor control doses were based on the results of single-fraction photon therapy and single fraction BNCT both in humans and experimental animals. Of the two boron compounds (BSH and BPA), BPA was chosen since a FDA-sanctioned protocol for distribution in humans was in effect at the time the first BNCT protocols were written and therapy studies in experimental animals had shown it to be more effective than BSH.

  14. Cerebellar giant cell glioblastoma multiforme in an adult

    Directory of Open Access Journals (Sweden)

    Sudhansu Sekhar Mishra

    2014-01-01

    Full Text Available Cerebellar glioblastoma multiforme (GBM is a rare tumor that accounts for only 1% of all cases of GBM and its giant cell variant is even much rarely encountered in adults. A case of cerebellar giant cell GBM managed at our institution reporting its clinical presentation, radiological and histological findings, and treatment instituted is described. In conjunction, a literature review, including particular issues, clinical data, advances in imaging studies, pathological characteristics, treatment options, and the behavior of such malignant tumor is presented. It is very important for the neurosurgeon to make the differential diagnosis between the cerebellar GBM, and other diseases such as metastasis, anaplastic astrocytomas, and cerebellar infarct because their treatment modalities, prognosis, and outcome are different.

  15. Epilepsy in glioblastoma multiforme: correlation with glutamine synthetase levels.

    Science.gov (United States)

    Rosati, Anna; Marconi, Silvia; Pollo, Bianca; Tomassini, Alessia; Lovato, Laura; Maderna, Emanuela; Maier, Klaus; Schwartz, Andreas; Rizzuto, Nicolò; Padovani, Alessandro; Bonetti, Bruno

    2009-07-01

    The hypothesis addressed by this study is that a glutamine synthetase (GS) deficiency in neoplastic astrocytes is a possible molecular basis associated with seizure generation in glioblastoma multiforme (GBM). Quantitative Western blot analysis of GS was performed in 20 individuals operated for malignant glioma. The levels of GS in patients with GBM and epilepsy were significantly lower (range 0.04-1.15; mean 0.35 +/- 0.36; median 0.25) than in non-epileptic GBM individuals (range 0.78-3.97; mean 1.64 +/- 0.99; median 1.25; P = 0.002). No relationship has been found between histological features (i.e. necrosis, gliosis, stroma, inflammatory cells, giant cells, and haemosiderine) and GS expression or epilepsy. Even though the epileptogenesis in glioma is multifactorial, it is conceivable that a down-regulation of GS may have an important pro-epileptogenic role in GBM, through the slowing of glutamate-glutamine cycle. This study suggests that seizures in GBM are coupled with a highly localized enzyme deficiency. The manipulation of GS activity might constitute a novel principle for inhibiting seizures in patients with glioma epilepsy.

  16. Magnetic Resonance Nano-Theranostics for Glioblastoma Multiforme.

    Science.gov (United States)

    Yao, Jingwen; Hsu, Chao-Hsiung; Li, Zhao; Kim, Tanya S; Hwang, Lian-Pin; Lin, Ying-Chih; Lin, Yung-Ya

    2015-01-01

    Glioblastoma multiforme (GBM) is one of the most challenging diseases to treat in clinical oncology due to its high mortality rates and inefficient conventional treatment methods. Difficulties with early detection, post-surgical recurrences, and resistance to chemotherapy and/or radiotherapy are important reasons for the poor prognosis of those with GBM. Over the past few decades, magnetic resonance (MR) theranostics using magnetic nanoparticles has shown unique advantages and great promises for the diagnosis and treatment of cancers. Magnetic nanoparticles not only serve as "molecular beacons" to enhance tumor contrast in magnetic resonance imaging (MRI), but also serve as "molecular bullets" for targeted drug delivery, controlled release, and induced hyperthermia. Moreover, multiple functions of magnetic nanoparticles can be synergistically engineered into a single nanoplatform, making it possible to simultaneously image, treat, target, and monitor the targeted lesions. The multi-functionality of nanoparticles, also called nano-theranostics, gives rises to effective new approaches for combating GBM. In this work, recent research and progress concerning the applications of MR nano-theranostics on GBM using magnetic nanoparticles will be highlighted, focusing on topics such as diagnosis, therapy, targeting, and hyperthermia, as well as outstanding challenges for MR nanotheranostics in treating GBM. The conclusions are generally applicable to other types of brain tumors.

  17. Immune phenotypes predict survival in patients with glioblastoma multiforme

    Directory of Open Access Journals (Sweden)

    Haouraa Mostafa

    2016-09-01

    Full Text Available Abstract Background Glioblastoma multiforme (GBM, a common primary malignant brain tumor, rarely disseminates beyond the central nervous system and has a very bad prognosis. The current study aimed at the analysis of immunological control in individual patients with GBM. Methods Immune phenotypes and plasma biomarkers of GBM patients were determined at the time of diagnosis using flow cytometry and ELISA, respectively. Results Using descriptive statistics, we found that immune anomalies were distinct in individual patients. Defined marker profiles proved highly relevant for survival. A remarkable relation between activated NK cells and improved survival in GBM patients was in contrast to increased CD39 and IL-10 in patients with a detrimental course and very short survival. Recursive partitioning analysis (RPA and Cox proportional hazards models substantiated the relevance of absolute numbers of CD8 cells and low numbers of CD39 cells for better survival. Conclusions Defined alterations of the immune system may guide the course of disease in patients with GBM and may be prognostically valuable for longitudinal studies or can be applied for immune intervention.

  18. Glioblastoma Multiforme: A Look Inside Its Heterogeneous Nature

    Energy Technology Data Exchange (ETDEWEB)

    Inda, Maria-del-Mar, E-mail: mminda@vhio.net; Bonavia, Rudy [Translational Research Program, Vall d’Hebron Institute of Oncology (VHIO), Vall d’Hebron University Hospital, 119-129 Passeig Vall d’Hebron, Barcelona 08035 (Spain); Seoane, Joan [Translational Research Program, Vall d’Hebron Institute of Oncology (VHIO), Vall d’Hebron University Hospital, 119-129 Passeig Vall d’Hebron, Barcelona 08035 (Spain); Catalan Institution of Research and Advanced Studies (ICREA), Barcelona 08035 (Spain)

    2014-01-27

    Heterogeneity is a hallmark of tumors and has a crucial role in the outcome of the malignancy, because it not only confounds diagnosis, but also challenges the design of effective therapies. There are two types of heterogeneity: inter-tumor and intra-tumor heterogeneity. While inter-tumor heterogeneity has been studied widely, intra-tumor heterogeneity has been neglected even though numerous studies support this aspect of tumor pathobiology. The main reason has been the technical difficulties, but with new advances in single-cell technology, intra-tumor heterogeneity is becoming a key area in the study of cancer. Several models try to explain the origin and maintenance of intra-tumor heterogeneity, however, one prominent model compares cancer with a tree where the ubiquitous mutations compose the trunk and mutations present in subpopulations of cells are represented by the branches. In this review we will focus on the intra-tumor heterogeneity of glioblastoma multiforme (GBM), the most common brain tumor in adults that is characterized by a marked heterogeneity at the cellular and molecular levels. Better understanding of this heterogeneity will be essential to design effective therapies against this devastating disease to avoid tumor escape.

  19. Recurrent Glioblastoma Multiforme: Implication of Nonenhancing Lesions on Bevacizumab Treatment

    Directory of Open Access Journals (Sweden)

    Daniela Alexandru

    2013-08-01

    Full Text Available Glioblastoma multiforme (GBM is the most common primary brain tumors, accounting for 15-20% of all intracranial tumors. It is one of the most lethal tumors of the central nervous system with a median survival from diagnosis on the order of 6 to 18 months. Despite aggressive resection and chemoradiation, the tumor always recurs. Magnetic Resonance (MR imaging is an essential component in the diagnosis, treatment planning, and following response. However, the imaging features of recurrent GBM may be challenging, particularly in patients undertaking novel antiangiogenic therapy. We present such a case treated with repeated surgeries, combined chemoradiation, and bevacizumab. The patient benefited from the regimen with a 6-month progression-free survival, evidenced on both stable clinical condition and MR imaging findings. However, despite chemotherapy, a fulminant progression developed with growth multiple tumors in different locations and variable imaging characteristics, ranging from typical enhancing nodules to nonenhancing signal changes. The lesions of different imaging features were biopsy-proved to be recurrent GBM. We discuss the use of MR imaging in the evaluation of GBM treated with bevacizumab and emphasize the implication of signal abnormality on fluid-attenuated inversion recovery (FLAIR images for early evidence of recurrence. [J Interdiscipl Histopathol 2013; 1(4.000: 217-222

  20. A comprehensive characterization of mitochondrial DNA mutations in glioblastoma multiforme.

    Science.gov (United States)

    Vidone, Michele; Clima, Rosanna; Santorsola, Mariangela; Calabrese, Claudia; Girolimetti, Giulia; Kurelac, Ivana; Amato, Laura Benedetta; Iommarini, Luisa; Trevisan, Elisa; Leone, Marco; Soffietti, Riccardo; Morra, Isabella; Faccani, Giuliano; Attimonelli, Marcella; Porcelli, Anna Maria; Gasparre, Giuseppe

    2015-06-01

    Glioblastoma multiforme (GBM) is the most malignant brain cancer in adults, with a poor prognosis, whose molecular stratification still represents a challenge in pathology and clinics. On the other hand, mitochondrial DNA (mtDNA) mutations have been found in most tumors as modifiers of the bioenergetics state, albeit in GBM a characterization of the mtDNA status is lacking to date. Here, a characterization of the burden of mtDNA mutations in GBM samples was performed. First, investigation of tumor-specific vs. non tumor-specific mutations was carried out with the MToolBox bioinformatics pipeline by analyzing 45 matched tumor/blood samples, from whole genome or whole exome sequencing datasets obtained from The Cancer Genome Atlas (TCGA) consortium. Additionally, the entire mtDNA sequence was obtained in a dataset of 104 fresh-frozen GBM samples. Mitochondrial mutations with potential pathogenic interest were prioritized based on heteroplasmic fraction, nucleotide variability, and in silico prediction of pathogenicity. A preliminary biochemical analysis of the activity of mitochondrial respiratory complexes was also performed on fresh-frozen GBM samples. Although a high number of mutations was detected, we report that the large majority of them does not pass the prioritization filters. Therefore, a relatively limited burden of pathogenic mutations is indeed carried by GBM, which did not appear to determine a general impairment of the respiratory chain. This article is part of a Directed Issue entitled: Energy Metabolism Disorders and Therapies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Altered expression of polycomb group genes in glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Gang Li

    Full Text Available The Polycomb group (PcG proteins play a critical role in histone mediated epigenetics which has been implicated in the malignant evolution of glioblastoma multiforme (GBM. By systematically interrogating The Cancer Genome Atlas (TCGA, we discovered widespread aberrant expression of the PcG members in GBM samples compared to normal brain. The most striking differences were upregulation of EZH2, PHF19, CBX8 and PHC2 and downregulation of CBX7, CBX6, EZH1 and RYBP. Interestingly, changes in EZH2, PHF19, CBX7, CBX6 and EZH1 occurred progressively as astrocytoma grade increased. We validated the aberrant expression of CBX6, CBX7, CBX8 and EZH2 in GBM cell lines by Western blotting and qRT-PCR, and further the aberrant expression of CBX6 in GBM tissue samples by immunohistochemical staining. To determine if there was functional significance to the diminished CBX6 levels in GBM, CBX6 was overexpressed in GBM cells resulting in decreased proliferative capacity. In conclusion, aberrant expression of PcG proteins in GBMs may play a role in the development or maintenance of the malignancy.

  2. Molecular Characteristics in MRI-classified Group 1 Glioblastoma Multiforme

    Directory of Open Access Journals (Sweden)

    William E Haskins

    2013-07-01

    Full Text Available Glioblastoma multiforme (GBM is a clinically and pathologically heterogeneous brain tumor. Previous study of MRI-classified GBM has revealed a spatial relationship between Group 1 GBM (GBM1 and the subventricular zone (SVZ. The SVZ is an adult neural stem cell niche and is also suspected to be the origin of a subtype of brain tumor. The intimate contact between GBM1 and the SVZ raises the possibility that tumor cells in GBM1 may be most related to SVZ cells. In support of this notion, we found that neural stem cell and neuroblast markers are highly expressed in GBM1. Additionally, we identified molecular characteristics in this type of GBM that include up-regulation of metabolic enzymes, ribosomal proteins, heat shock proteins, and c-Myc oncoprotein. As GBM1 often recurs at great distances from the initial lesion, the rewiring of metabolism and ribosomal biogenesis may facilitate cancer cells’ growth and survival during tumor migration. Taken together, combined our findings and MRI-based classification of GBM1 would offer better prediction and treatment for this multifocal GBM.

  3. Aplastic anemia as a cause of death in a patient with glioblastoma multiforme treated with temozolomide

    Energy Technology Data Exchange (ETDEWEB)

    Kopecky, Jindrich; Priester, Peter; Slovacek, Ladislav; Petera, Jiri; Macingova, Zuzana [Dept. of Clinical Oncology and Radiotherapy, Charles Univ. Hospital and Faculty of Medicine in Hradec Kralove (Czech Republic); Kopecky, Otakar [Clinical Oncology, Regional Hospital Nachod (Czech Republic)

    2010-08-15

    Background: Standard treatment of glioblastoma multiforme consists of postoperative radiochemotherapy with temozolomide, followed by a 6-month chemotherapy. Serious hematologic complications are rarely reported. Case Report and Results: The authors present the case of a 61-year-old female patient with glioblastoma multiforme treated with external-beam radiation therapy and concomitant temozolomide. After completion of treatment, the patient developed symptoms of serious aplastic anemia that eventually led to death due to prolonged neutro- and thrombocytopenia followed by infectious complications. Conclusion: Lethal complications following temozolomide are, per se, extremely rare, however, a total of four other cases of aplastic anemia have been reported in the literature so far. (orig.)

  4. Prognostic relevance of cytochrome C oxidase in primary glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Corinne E Griguer

    Full Text Available Patients with primary glioblastoma multiforme (GBM have one of the lowest overall survival rates among cancer patients, and reliable biomarkers are necessary to predict patient outcome. Cytochrome c oxidase (CcO promotes the switch from glycolytic to OXPHOS metabolism, and increased CcO activity in tumors has been associated with tumor progression after chemotherapy failure. Thus, we investigated the relationship between tumor CcO activity and the survival of patients diagnosed with primary GBM. A total of 84 patients with grade IV glioma were evaluated in this retrospective cohort study. Cumulative survival was calculated by the Kaplan-Meier method and analyzed by the log-rank test, and univariate and multivariate analyses were performed with the Cox regression model. Mitochondrial CcO activity was determined by spectrophotometrically measuring the oxidation of cytochrome c. High CcO activity was detected in a subset of glioma tumors (∼30%, and was an independent prognostic factor for shorter progression-free survival and overall survival [P = 0.0087 by the log-rank test, hazard ratio = 3.57 for progression-free survival; P<0.001 by the log-rank test, hazard ratio = 10.75 for overall survival]. The median survival time for patients with low tumor CcO activity was 14.3 months, compared with 6.3 months for patients with high tumor CcO activity. High CcO activity occurs in a significant subset of high-grade glioma patients and is an independent predictor of poor outcome. Thus, CcO activity may serve as a useful molecular marker for the categorization and targeted therapy of GBMs.

  5. Genome-wide methylation analyses in glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Rose K Lai

    Full Text Available Few studies had investigated genome-wide methylation in glioblastoma multiforme (GBM. Our goals were to study differential methylation across the genome in gene promoters using an array-based method, as well as repetitive elements using surrogate global methylation markers. The discovery sample set for this study consisted of 54 GBM from Columbia University and Case Western Reserve University, and 24 brain controls from the New York Brain Bank. We assembled a validation dataset using methylation data of 162 TCGA GBM and 140 brain controls from dbGAP. HumanMethylation27 Analysis Bead-Chips (Illumina were used to interrogate 26,486 informative CpG sites in both the discovery and validation datasets. Global methylation levels were assessed by analysis of L1 retrotransposon (LINE1, 5 methyl-deoxycytidine (5m-dC and 5 hydroxylmethyl-deoxycytidine (5hm-dC in the discovery dataset. We validated a total of 1548 CpG sites (1307 genes that were differentially methylated in GBM compared to controls. There were more than twice as many hypomethylated genes as hypermethylated ones. Both the discovery and validation datasets found 5 tumor methylation classes. Pathway analyses showed that the top ten pathways in hypomethylated genes were all related to functions of innate and acquired immunities. Among hypermethylated pathways, transcriptional regulatory network in embryonic stem cells was the most significant. In the study of global methylation markers, 5m-dC level was the best discriminant among methylation classes, whereas in survival analyses, high level of LINE1 methylation was an independent, favorable prognostic factor in the discovery dataset. Based on a pathway approach, hypermethylation in genes that control stem cell differentiation were significant, poor prognostic factors of overall survival in both the discovery and validation datasets. Approaches that targeted these methylated genes may be a future therapeutic goal.

  6. Genome-wide methylation analyses in glioblastoma multiforme.

    Science.gov (United States)

    Lai, Rose K; Chen, Yanwen; Guan, Xiaowei; Nousome, Darryl; Sharma, Charu; Canoll, Peter; Bruce, Jeffrey; Sloan, Andrew E; Cortes, Etty; Vonsattel, Jean-Paul; Su, Tao; Delgado-Cruzata, Lissette; Gurvich, Irina; Santella, Regina M; Ostrom, Quinn; Lee, Annette; Gregersen, Peter; Barnholtz-Sloan, Jill

    2014-01-01

    Few studies had investigated genome-wide methylation in glioblastoma multiforme (GBM). Our goals were to study differential methylation across the genome in gene promoters using an array-based method, as well as repetitive elements using surrogate global methylation markers. The discovery sample set for this study consisted of 54 GBM from Columbia University and Case Western Reserve University, and 24 brain controls from the New York Brain Bank. We assembled a validation dataset using methylation data of 162 TCGA GBM and 140 brain controls from dbGAP. HumanMethylation27 Analysis Bead-Chips (Illumina) were used to interrogate 26,486 informative CpG sites in both the discovery and validation datasets. Global methylation levels were assessed by analysis of L1 retrotransposon (LINE1), 5 methyl-deoxycytidine (5m-dC) and 5 hydroxylmethyl-deoxycytidine (5hm-dC) in the discovery dataset. We validated a total of 1548 CpG sites (1307 genes) that were differentially methylated in GBM compared to controls. There were more than twice as many hypomethylated genes as hypermethylated ones. Both the discovery and validation datasets found 5 tumor methylation classes. Pathway analyses showed that the top ten pathways in hypomethylated genes were all related to functions of innate and acquired immunities. Among hypermethylated pathways, transcriptional regulatory network in embryonic stem cells was the most significant. In the study of global methylation markers, 5m-dC level was the best discriminant among methylation classes, whereas in survival analyses, high level of LINE1 methylation was an independent, favorable prognostic factor in the discovery dataset. Based on a pathway approach, hypermethylation in genes that control stem cell differentiation were significant, poor prognostic factors of overall survival in both the discovery and validation datasets. Approaches that targeted these methylated genes may be a future therapeutic goal.

  7. Phase II study of bevacizumab and temsirolimus combination therapy for recurrent glioblastoma multiforme

    DEFF Research Database (Denmark)

    Lassen, Ulrik; Sorensen, Morten; Gaziel, Tine Bernhardtsen

    2013-01-01

    Bevacizumab combined with chemotherapy has recently shown promising efficacy in recurrent high-grade glioma. Phosphatase and tensin homolog (PTEN) mutation in glioblastoma multiforme (GBM) patients causes abnormally high activity of the pathways of Phosphatidylinositide 3-kinases (PI3K), Protein...

  8. Clinical variables serve as prognostic factors in a model for survival from glioblastoma multiforme

    DEFF Research Database (Denmark)

    Michaelsen, Signe Regner; Christensen, Ib Jarle; Grunnet, Kirsten

    2013-01-01

    Although implementation of temozolomide (TMZ) as a part of primary therapy for glioblastoma multiforme (GBM) has resulted in improved patient survival, the disease is still incurable. Previous studies have correlated various parameters to survival, although no single parameter has yet been...

  9. Glioblastoma multiforme in four siblings : a cytogenetic and molecular genetic study

    NARCIS (Netherlands)

    DIRVEN, CMF; TUERLINGS, J; MOLENAAR, W.M.; GO, KG; LOUIS, DN

    1995-01-01

    The familial occurrence of gliomas, in the absence of well-defined neurological tumor syndromes such as the neurofibromatoses, is uncommon, We present a family of ten children in which the four eldest suffered from gliomas. Three of these siblings had histologically verified glioblastoma multiforme,

  10. RNA expression patterns in serum microvesicles from patients with glioblastoma multiforme and controls

    Directory of Open Access Journals (Sweden)

    Noerholm Mikkel

    2012-01-01

    Full Text Available Abstract Background RNA from exosomes and other microvesicles contain transcripts of tumour origin. In this study we sought to identify biomarkers of glioblastoma multiforme in microvesicle RNA from serum of affected patients. Methods Microvesicle RNA from serum from patients with de-novo primary glioblastoma multiforme (N = 9 and normal controls (N = 7 were analyzed by microarray analysis. Samples were collected according to protocols approved by the Institutional Review Board. Differential expressions were validated by qRT-PCR in a separate set of samples (N = 10 in both groups. Results Expression profiles of microvesicle RNA correctly separated individuals in two groups by unsupervised clustering. The most significant differences pertained to down-regulated genes (121 genes > 2-fold down in the glioblastoma multiforme patient microvesicle RNA, validated by qRT-PCR on several genes. Overall, yields of microvesicle RNA from patients was higher than from normal controls, but the additional RNA was primarily of size Conclusions Serum microvesicle RNA from patients with glioblastoma multiforme has significantly down-regulated levels of RNAs coding for ribosome production, compared to normal healthy controls, but a large overabundance of RNA of unknown origin with size

  11. Treatment outcome of patients with recurrent glioblastoma multiforme : A retrospective multicenter analysis

    NARCIS (Netherlands)

    van Linde, Myra E.; Brahm, Cyrillo G.; Hamer, Philip C. de Witt; Reijneveld, Jaap C.; Bruynzeel, Anna M. E.; Vandertop, W. Peter; van de Ven, Peter M.; Wagemakers, Michiel; van der Weide, Hiske L.; Enting, Roelien H.; Walenkamp, Annemiek M. E.; Verheul, Henk M. W.

    2017-01-01

    Glioblastoma multiforme (GBM) universally recurs with dismal prognosis. We evaluated the efficacy of standard treatment strategies for patients with recurrent GBM (rGBM). From two centers in the Netherlands, 299 patients with rGBM after first-line treatment, diagnosed between 2005 and 2014, were

  12. Volumetric Spectroscopic Imaging of Glioblastoma Multiforme Radiation Treatment Volumes

    Energy Technology Data Exchange (ETDEWEB)

    Parra, N. Andres [Department of Radiation Oncology, University of Miami Miller School of Medicine, Miami, Florida (United States); Maudsley, Andrew A. [Department of Radiology, University of Miami Miller School of Medicine, Miami, Florida (United States); Gupta, Rakesh K. [Department of Radiology and Imaging, Fortis Memorial Research Institute, Gurgaon, Haryana (India); Ishkanian, Fazilat; Huang, Kris [Department of Radiation Oncology, University of Miami Miller School of Medicine, Miami, Florida (United States); Walker, Gail R. [Biostatistics and Bioinformatics Core Resource, Sylvester Cancer Center, University of Miami Miller School of Medicine, Miami, Florida (United States); Padgett, Kyle [Department of Radiation Oncology, University of Miami Miller School of Medicine, Miami, Florida (United States); Department of Radiology, University of Miami Miller School of Medicine, Miami, Florida (United States); Roy, Bhaswati [Department of Radiology and Imaging, Fortis Memorial Research Institute, Gurgaon, Haryana (India); Panoff, Joseph; Markoe, Arnold [Department of Radiation Oncology, University of Miami Miller School of Medicine, Miami, Florida (United States); Stoyanova, Radka, E-mail: RStoyanova@med.miami.edu [Department of Radiation Oncology, University of Miami Miller School of Medicine, Miami, Florida (United States)

    2014-10-01

    Purpose: Magnetic resonance (MR) imaging and computed tomography (CT) are used almost exclusively in radiation therapy planning of glioblastoma multiforme (GBM), despite their well-recognized limitations. MR spectroscopic imaging (MRSI) can identify biochemical patterns associated with normal brain and tumor, predominantly by observation of choline (Cho) and N-acetylaspartate (NAA) distributions. In this study, volumetric 3-dimensional MRSI was used to map these compounds over a wide region of the brain and to evaluate metabolite-defined treatment targets (metabolic tumor volumes [MTV]). Methods and Materials: Volumetric MRSI with effective voxel size of ∼1.0 mL and standard clinical MR images were obtained from 19 GBM patients. Gross tumor volumes and edema were manually outlined, and clinical target volumes (CTVs) receiving 46 and 60 Gy were defined (CTV{sub 46} and CTV{sub 60}, respectively). MTV{sub Cho} and MTV{sub NAA} were constructed based on volumes with high Cho and low NAA relative to values estimated from normal-appearing tissue. Results: The MRSI coverage of the brain was between 70% and 76%. The MTV{sub NAA} were almost entirely contained within the edema, and the correlation between the 2 volumes was significant (r=0.68, P=.001). In contrast, a considerable fraction of MTV{sub Cho} was outside of the edema (median, 33%) and for some patients it was also outside of the CTV{sub 46} and CTV{sub 60}. These untreated volumes were greater than 10% for 7 patients (37%) in the study, and on average more than one-third (34.3%) of the MTV{sub Cho} for these patients were outside of CTV{sub 60}. Conclusions: This study demonstrates the potential usefulness of whole-brain MRSI for radiation therapy planning of GBM and revealed that areas of metabolically active tumor are not covered by standard RT volumes. The described integration of MTV into the RT system will pave the way to future clinical trials investigating outcomes in patients treated based on

  13. Malignant melanoma mimicking giant cell variant of glioblastoma multiforme: a case report and review of literature.

    Science.gov (United States)

    Arcega, Ramir; Yong, William H; Xu, Haodong

    2015-01-01

    We present a case of metastatic malignant melanoma in a patient initially diagnosed with glioblastoma multiforme, giant cell variant. A forty year old female presented to our institution for a re-resection of a recurrent right parietal lobe mass, presumed to be recurrent glioblastoma multiforme. PET scan during preoperative evaluation revealed a 3 cm left lower lobe lung mass. Metastatic glioblastoma to lung was considered in the differential diagnosis. Resection of the brain mass revealed a highly pleomorphic giant and spindle cell lesion with an immunophenotype strongly supportive of melanoma. Immunostains for melanocytic markers were subsequently performed on the lung biopsy specimen, and demonstrated diffuse staining of the atypical cells, supporting the diagnosis of malignant melanoma in the lung. This case demonstrates the importance of considering melanoma in the differential in any tumor with high grade features.

  14. Radiologic findings in patients treated with boron neutron capture therapy for glioblastoma multiforme within EORTC trial 11961

    NARCIS (Netherlands)

    Vos, Maaike J.; Turowski, Bernd; Zanella, Friedhelm E.; Paquis, Philippe; Siefert, Axel; Hideghéty, Katalin; Haselsberger, Klaus; Grochulla, Frank; Postma, Tjeerd J.; Wittig, Andrea; Heimans, Jan J.; Slotman, Ben J.; Vandertop, W. Peter; Sauerwein, Wolfgang

    2005-01-01

    PURPOSE: To assess the occurrence and development of cerebral radiologic changes (cerebral atrophy and white matter lesions) in patients treated with boron neutron capture therapy (BNCT) for primary supratentorial glioblastoma multiforme within the European Organization for Research and Treatment of

  15. Established and emerging variants of glioblastoma multiforme: review of morphological and molecular features.

    Science.gov (United States)

    Karsy, Michael; Gelbman, Marshall; Shah, Paarth; Balumbu, Odessa; Moy, Fred; Arslan, Erol

    2012-01-01

    Since the recent publication of the World Health Organization brain tumour classification guidelines in 2007, a significant expansion in the molecular understanding of glioblastoma multiforme (GBM) and its pathological as well as genomic variants has been evident. The purpose of this review article is to evaluate the histopathological, molecular and clinical features surrounding emerging and currently established GBM variants. The tumours discussed include classic glioblastoma multiforme and its four genomic variants, proneural, neural, mesenchymal, classical, as well as gliosarcoma (GS), and giant cell GBM (gcGBM). Furthermore, the emerging variants include fibrillary/epithelial GBM, small cell astrocytoma (SCA), GBM with oligodendroglial component (GBMO), GBM with primitive neuroectodermal features (GBM-PNET), gemistocytic astrocytoma (GA), granular cell astrocytoma (GCA), and paediatric high-grade glioma (HGG) as well as diffuse intrinsic pontine glioma (DIPG). Better understanding of the heterogeneous nature of GBM may provide improved treatment paradigms, prognostic classification, and approaches towards molecularly targeted treatments.

  16. Phase II study of bevacizumab and temsirolimus combination therapy for recurrent glioblastoma multiforme

    DEFF Research Database (Denmark)

    Lassen, Ulrik; Sorensen, Morten; Gaziel, Tine Bernhardtsen

    2013-01-01

    BACKGROUND: Bevacizumab combined with chemotherapy has recently shown promising efficacy in recurrent high-grade glioma. Phosphatase and tensin homolog (PTEN) mutation in glioblastoma multiforme (GBM) patients causes abnormally high activity of the pathways of Phosphatidylinositide 3-kinases (PI3K....../10), infection (1/10), hypertension (1/10), and hyperglycemia (1/10). CONCLUSION: Temsirolimus can be safely administered in combination with bevacizumab. This study failed to detect activity of such a combination in patients with progressive GBM beyond bevacizumab therapy....

  17. Copper-64 Dichloride as Theranostic Agent for Glioblastoma Multiforme: A Preclinical Study

    OpenAIRE

    Cristina Ferrari; Artor Niccoli Asabella; Carlo Villano; Beatrice Giacobbi; Daniela Coccetti; Paola Panichelli; Giuseppe Rubini

    2015-01-01

    Glioblastoma multiforme (GBM) is the most common primary malignant brain tumor in adults with a median survival time less than one year. To date, there are only a limited number of effective agents available for GBM therapy and this does not seem to add much survival advantage over the conventional approach based on surgery and radiotherapy. Therefore, the development of novel therapeutic approaches to GBM is essential and those based on radionuclide therapy could be of significant clinical i...

  18. The importance of genomic copy number changes in the prognosis of glioblastoma multiforme.

    Science.gov (United States)

    Arslantas, Ali; Artan, Sevilhan; Oner, Ulkü; Müslümanoğlu, Hamza; Durmaz, Ramazan; Cosan, Erhan; Atasoy, Metin Ant; Başaran, Nurettin; Tel, Eşref

    2004-01-01

    Glial tumors are the most common tumors of the nervous system, affecting individuals at any age. Since understanding of the molecular pathologies underlying human gliomas is still very poor, the treatment and therefore prognosis of this malignancy could not yet be improved. In order to determine whether different glioblastoma-associated genomic aberrations may serve as prognostic markers in combination with histopathological findings, 20 primary glioblastoma multiforme tumors were screened by comparative genomic hybridization, and the results were compared with histopathological and clinical features. All tumors showed genomic copy aberrations detected by comparative genomic hybridization. Regional and numerical increases in chromosome 7 copy number were the most frequently seen abnormality (10/20 tumors), followed by loss of chromosome 10 (8/20). Both of these aberrations were associated with shorter surveillance time. Chromosome 12q amplification was detected in seven tumors. Loss of 17p, 1p, and 19q in combination was seen in three cases. One of them was a giant cell GBM, whereas the remaining two cases were still alive. Combination of chromosome 1p and 19q deletions was also seen in a case with long surveillance. According to the preliminary findings of this study, in addition to the EGFR gene, amplification of other genes on chromosome 7 and the deletion of PTEN gene and other cancer-related genes on chromosome 10 appeared important to the development of glioblastoma multiforme and were associated with poor prognosis, whereas the combination of chromosome 1p and 19q deletions seems to be an informative molecular marker for better prognosis. The clinical features and genetic alterations of primary and secondary glioblastoma multiforme should be compared in large series to clarify the effective prognostic markers; and further molecular analyses focused on chromosomes 7 and 10 will be very helpful for understanding the molecular mechanisms underlying the

  19. Metástases intrarraquidianas de glioblastoma multiforme supratentorial da infância: relato de caso Spinal cord metastatic glioblastoma multiforme of childhood: case report

    Directory of Open Access Journals (Sweden)

    Patricia Imperatriz Porto Rondinelli

    2002-09-01

    Full Text Available Relatamos o caso de uma menina de onze anos de idade com glioblastoma multiforme na região têmporo-parietal direita, completamente ressecado cirurgicamente, submetida a radioterapia craniana pós-operatória. Houve recaída três meses após, em topografia distante do sítio primário, na porção caudal do canal raquidiano. Após, ocorreu evolução rápida para o óbito. A propósito desse caso, discutimos nossa experiência quanto à conduta nesses tumores e a literatura sobre o assunto.We report the case of an eleven years-old girl with a right temporo-parietal glioblastoma multiforme. The tumor was totally resected on neurossurgery, and cranial radioteraphy was applied at next. The tumor recurred three months later, far from primary site, in the caudal portion of the spinal canal. Death occurred in less than one month later. Taking into account the data of this case, we discuss our experience in the management of such tumors and the literature on the subject.

  20. Dual integrated overprinting hypo fractionation (2xSIB) for glioblastoma multiform; Hipofraccionamiento de doble sobreimpresion integrada (2xSIB) para el flioblastoma multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Velazquez Miranda, S.; Munoz Carmona, D. M.

    2011-07-01

    Glioblastoma multiform e is characterized by being of a proliferative cell type and radiobiological behavior corresponding to an alpha / beta low. This tells us that we will have more success if we deal with fractions of higher doses than the standard treatment, and that shortening the total time is essential to reduce the effects of proliferation.

  1. Hemolytic anemia in two patients with glioblastoma multiforme: A possible interaction between vorinostat and dapsone.

    Science.gov (United States)

    Lewis, Jennifer A; Petty, William J; Harmon, Michele; Peacock, James E; Valente, Kari; Owen, John; Pirmohamed, Munir; Lesser, Glenn J

    2015-06-01

    Patients undergoing treatment for glioblastoma multiforme are routinely placed on prophylactic treatment for Pneumocystis jirovecii pneumonia because of significant therapy-induced lymphopenia. In patients with sulfa allergies, dapsone prophylaxis is often used due to its efficacy, long half-life, cost effectiveness, and general safety at low doses. However, dapsone may uncommonly induce a hemolytic anemia, particularly in patients deficient of glucose-6-phosphate dehydrogenase. This hemolysis is thought to be a result of oxidative stress on red blood cells induced by dapsone metabolites which produce reactive oxygen species that disrupt the red blood cell membrane and promote splenic sequestration. A single case report of dapsone-induced hemolytic anemia in a patient with glioblastoma multiforme has been reported. We present two patients with glioblastoma multiforme who developed severe hemolytic anemia shortly after initiating therapy with vorinostat, a pan-active histone deacetylase inhibitor, while on prophylactic dapsone. There are several potential mechanisms by which histone deacetylase inhibition may alter dapsone metabolism including changes in hepatic acetylation or N-glucuronidation leading to an increase in the bioavailability of dapsone's hematotoxic metabolites. In addition, vorinostat may lead to increased hemolysis through inhibition of heat shock protein-90, a chaperone protein that maintains the integrity of the red blood cell membrane cytoskeleton. The potential interaction between dapsone and vorinostat may have important clinical implications as more than 10 clinical trials evaluating drug combinations with vorinostat in patients with malignant glioma are either ongoing or planned in North America. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  2. Establecimiento y caracterización de una línea celular derivada de un glioblastoma multiforme

    OpenAIRE

    Verónica Rincón; Carmen Lucía Roa; Gloria Osorio; Gerardo Aristizábal; Jaime E. Castellanos

    2007-01-01

    Introducción: Las líneas celulares y los cultivos primarios son una excelente herramienta para el estudio de la biología, desarrollo y respuesta a la terapia en tumores cerebrales.Objetivo: Establecer y caracterizar una línea celular derivada de un glioblastoma multiforme como un modelo de estudio in vitro para la extrapolación y aplicación futura en terapia génica. Material y métodos: Se obtuvo una muestra de un paciente con diagnóstico clínico e histopatológico de glioblastoma multiforme, s...

  3. Rapid Neurological Recovery Following Partial Surgical Resection of Spinal Glioblastoma Multiforme in a Pediatric Patient Presenting With Complete Paraplegia.

    Science.gov (United States)

    Friedman, Gabriel N; Grannan, Benjamin L; Yanamadala, Vijay; Shankar, Ganesh M; Dewitt, John C; Puthenpura, Vidya; Koffie, Robert M; Macdonald, Shannon M; Ebb, David H; Frosch, Matthew P; Duhaime, Ann-Christine

    2016-11-01

    Pediatric spinal cord glioblastoma multiforme is a rare entity with a poor prognosis often presenting with lower extremity weakness or paralysis. Previous literature suggests that aggressive surgical resection may provide overall survival benefit; however, there is limited concurrent analysis demonstrating neurological recovery following surgical resection. We report the case of a 9-year-old boy who presented with complete paraplegia and regained the ability to ambulate independently following subtotal surgical resection, radiation, and chemotherapy. The case demonstrates the balance between meaningful neurological recovery and overall survival when deciding on the extent of resection in cases of pediatric spinal glioblastoma multiforme.

  4. [Glioblastoma multiforme with intra- and extramedullary dissemination to the spinal cord].

    Science.gov (United States)

    Hansson, Karin; Gutte, Henrik; Idris, Fadi

    2013-04-15

    Metastases to the spinal cord from glioblastoma multiforme (GBM) are uncommon, but important to have in mind when patients with a history of GBM present with symptoms that do not correlate with the primary disease pattern. We report a rare case, where a male with GBM, six months after tumour excision followed by concomitant radio- and chemotherapy, presented with gait disturbance and unspecific neurological symptoms of the lower right limb. Magnetic resonance imaging of columna totalis revealed both intra- and extramedullary metastases in the spinal cord. The patient died one month later.

  5. Analysis of Electronic Densities and Integrated Doses in Multiform Glioblastomas Stereotactic Radiotherapy

    Science.gov (United States)

    Barón-Aznar, C.; Moreno-Jiménez, S.; Celis, M. A.; Lárraga-Gutiérrez, J. M.; Ballesteros-Zebadúa, P.

    2008-08-01

    Integrated dose is the total energy delivered in a radiotherapy target. This physical parameter could be a predictor for complications such as brain edema and radionecrosis after stereotactic radiotherapy treatments for brain tumors. Integrated Dose depends on the tissue density and volume. Using CT patients images from the National Institute of Neurology and Neurosurgery and BrainScansoftware, this work presents the mean density of 21 multiform glioblastomas, comparative results for normal tissue and estimated integrated dose for each case. The relationship between integrated dose and the probability of complications is discussed.

  6. Magnetic Resonance-Guided Laser Induced Thermal Therapy for Glioblastoma Multiforme: A Review

    Directory of Open Access Journals (Sweden)

    Sarah E. Norred

    2014-01-01

    Full Text Available Magnetic resonance-guided laser induced thermotherapy (MRgLITT has become an increasingly relevant therapy for tumor ablation due to its minimally invasive approach and broad applicability across many tissue types. The current state of the art applies laser irradiation via cooled optical fiber applicators in order to generate ablative heat and necrosis in tumor tissue. Magnetic resonance temperature imaging (MRTI is used concurrently with this therapy to plan treatments and visualize tumor necrosis. Though application in neurosurgery remains in its infancy, MRgLITT has been found to be a promising therapy for many types of brain tumors. This review examines the current use of MRgLITT with regard to the special clinical challenge of glioblastoma multiforme and examines the potential applications of next-generation nanotherapy specific to the treatment of glioblastoma.

  7. Diffusion tensor imaging for target volume definition in glioblastoma multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Berberat, Jatta; Remonda, Luca [Cantonal Hospital, Department of Neuro-radiology, Aarau (Switzerland); McNamara, Jane; Rogers, Susanne [Cantonal Hospital, Department of Radiation Oncology, Aarau (Switzerland); Bodis, Stephan [Cantonal Hospital, Department of Radiation Oncology, Aarau (Switzerland); University Hospital, Department of Radiation Oncology, Zurich (Switzerland)

    2014-10-15

    Diffusion tensor imaging (DTI) is an MR-based technique that may better detect the peritumoural region than MRI. Our aim was to explore the feasibility of using DTI for target volume delineation in glioblastoma patients. MR tensor tracts and maps of the isotropic (p) and anisotropic (q) components of water diffusion were coregistered with CT in 13 glioblastoma patients. An in-house image processing program was used to analyse water diffusion in each voxel of interest in the region of the tumour. Tumour infiltration was mapped according to validated criteria and contralateral normal brain was used as an internal control. A clinical target volume (CTV) was generated based on the T{sub 1}-weighted image obtained using contrast agent (T{sub 1Gd}), tractography and the infiltration map. This was compared to a conventional T{sub 2}-weighted CTV (T{sub 2}-w CTV). Definition of a diffusion-based CTV that included the adjacent white matter tracts proved highly feasible. A statistically significant difference was detected between the DTI-CTV and T{sub 2}-w CTV volumes (p < 0.005, t = 3.480). As the DTI-CTVs were smaller than the T{sub 2}-w CTVs (tumour plus peritumoural oedema), the pq maps were not simply detecting oedema. Compared to the clinical planning target volume (PTV), the DTI-PTV showed a trend towards volume reduction. These diffusion-based volumes were smaller than conventional volumes, yet still included sites of tumour recurrence. Extending the CTV along the abnormal tensor tracts in order to preserve coverage of the likely routes of dissemination, whilst sparing uninvolved brain, is a rational approach to individualising radiotherapy planning for glioblastoma patients. (orig.) [German] Die Diffusions-Tensor-Bildgebung (DTI) ist eine MR-Technik, die dank der Erfassung des peritumoralen Bereichs eine Verbesserung bezueglich MRI bringt. Unser Ziel war die Pruefung der Machbarkeit der Verwendung der DTI fuer die Zielvolumenabgrenzung fuer Patienten mit

  8. Effects of Flavonoids from Food and Dietary Supplements on Glial and Glioblastoma Multiforme Cells.

    Science.gov (United States)

    Vidak, Marko; Rozman, Damjana; Komel, Radovan

    2015-10-23

    Quercetin, catechins and proanthocyanidins are flavonoids that are prominently featured in foodstuffs and dietary supplements, and may possess anti-carcinogenic activity. Glioblastoma multiforme is the most dangerous form of glioma, a malignancy of the brain connective tissue. This review assesses molecular structures of these flavonoids, their importance as components of diet and dietary supplements, their bioavailability and ability to cross the blood-brain barrier, their reported beneficial health effects, and their effects on non-malignant glial as well as glioblastoma tumor cells. The reviewed flavonoids appear to protect glial cells via reduction of oxidative stress, while some also attenuate glutamate-induced excitotoxicity and reduce neuroinflammation. Most of the reviewed flavonoids inhibit proliferation of glioblastoma cells and induce their death. Moreover, some of them inhibit pro-oncogene signaling pathways and intensify the effect of conventional anti-cancer therapies. However, most of these anti-glioblastoma effects have only been observed in vitro or in animal models. Due to limited ability of the reviewed flavonoids to access the brain, their normal dietary intake is likely insufficient to produce significant anti-cancer effects in this organ, and supplementation is needed.

  9. Secondary Glioblastoma Multiforme in a Child with Disseminated Juvenile Pilocytic Astrocytoma

    Directory of Open Access Journals (Sweden)

    C. S. Amene

    2012-01-01

    Full Text Available Secondary glioblastoma multiforme (sGBM can occur after a long latency period following radiation treatment of various diseases including brain tumors, leukemia, and more benign disorders like tinea capitis. Outcomes of radiation-induced sGBM remain poor in both children and adults. We report a case of a 16-year-old girl with a history of disseminated juvenile pilocytic astrocytoma treated with chemotherapy and craniospinal radiation 9 years prior who developed sGBM in the absence of a tumor predisposition syndrome. She presented with a several-week history of headaches and no acute findings on computed tomography compared to baseline neuroimaging 3 months prior. Repeat computed tomography performed just 3 weeks later for worsening headaches revealed a new large posterior fossa tumor where pathology confirmed the diagnosis of sGBM. In spite of maximal surgical resection, reirradiation, and adjuvant chemotherapy, she died 1 year postdiagnosis. Our case highlights the potential late effects of high-dose cranial radiation, how symptomatology may precede neuroimaging findings, and the rapid formation of sGBM that mirrors that of de novo Glioblastoma Multiforme.

  10. Level of Notch activation determines the effect on growth and stem cell-like features in glioblastoma multiforme neurosphere cultures

    DEFF Research Database (Denmark)

    Kristoffersen, Karina; Villingshøj, Mette; Poulsen, Hans Skovgaard

    2013-01-01

    Brain cancer stem-like cells (bCSC) are cancer cells with neural stem cell (NSC)-like properties found in glioblastoma multiforme (GBM) and they are assigned a central role in tumor initiation, progression and relapse. The Notch pathway is important for maintenance and cell fate decisions...

  11. Increased intracranial pressure in a case of spinal cervical glioblastoma multiforme: analysis of these two rare conditions

    Directory of Open Access Journals (Sweden)

    C.M. de Castro-Costa

    1994-03-01

    Full Text Available The authors describe a rare case of increased intracranial hypertension consequent to a spinal cervical glioblastoma multiforme in a young patient. They analyse the physiopathology of intracranial hypertension in spinal tumors and the rarity of such kind of tumor in this location, and its clinico-pathological aspects.

  12. TRAIL-receptor expression is an independent prognostic factor for survival in patients with a primary glioblastoma multiforme

    NARCIS (Netherlands)

    Kuijlen, Jos M. A.; Mooij, Jan Jakob A.; Platteel, Inge; Hoving, Eelco W.; van der Graaf, Winette T. A.; Span, Mark M.; Hollema, Harry; den Dunnen, Wilfred F. A.

    Purpose: In order to improve the survival of patients with a glioblastoma multiforme tumor (GBM), new therapeutic strategies must be developed. The use of a death inducing ligand such as TRAIL (TNF Related Apoptosis Inducing Ligand) seems a promising innovative therapy. The aim of this study was to

  13. Prospective evaluation of angiogenic, hypoxic and EGFR-related biomarkers in recurrent glioblastoma multiforme treated with cetuximab, bevacizumab and irinotecan

    DEFF Research Database (Denmark)

    Hasselbalch, Benedikte; Eriksen, Jesper Grau; Broholm, Helle

    2010-01-01

    , hypoxia and mediators of the epidermal growth factor receptor (EGFR) pathway were investigated. Tumor tissue was obtained from a previous phase II study, treating recurrent primary glioblastoma multiforme (GBM) patients with the EGFR inhibitor cetuximab in combination with bevacizumab and irinotecan...

  14. Complement activation in Glioblastoma Multiforme pathophysiology: Evidence from serum levels and presence of complement activation products in tumor tissue

    NARCIS (Netherlands)

    T.A.M. Bouwens; L.A. Trouw (L.); R. Veerhuis; C.M.F. Dirven (Clemens); M.L.M. Lamfers (Martine); H. Al-Khawaja

    2015-01-01

    textabstractInflammation plays a key role in the pathophysiology of Glioblastoma Multiforme (GBM). Here we focus on the contribution of the so far largely ignored complement system.ELISA and immunohistochemistry were combined to assess levels and localization of critical components of the

  15. What is the value of emission tomography studies in patients with a primary glioblastoma multiforme treated by Ir-192 brachytherapy?

    NARCIS (Netherlands)

    Koot, R. W.; Habraken, J. B. A.; Paans, A. M. J.; Bosch, D. A.; Pruim, J.; Hulshof, M.C.C.M.

    Background. We studied the use of (201)Thallium SPECT and L-[1-C-11]-tyrosine PET in patients with a primary glioblastoma multiforme treated with Ir-192 brachytherapy after surgery and external beam radiation therapy. We hypothesised that the patients most likely to benefit from further surgery

  16. Impact of therapy on quality of life, neurocognitive function and their correlates in glioblastoma multiforme: a review

    DEFF Research Database (Denmark)

    Henriksson, Roger; Asklund, Thomas; Poulsen, Hans Skovgaard

    2011-01-01

    The maintenance of quality of life (QoL) in patients with high-grade glioma is an important endpoint during treatment, particularly in those with glioblastoma multiforme (GBM) given its dismal prognosis despite limited advances in standard therapy. It has proven difficult to identify new therapies...

  17. Visual field changes as an early indicator of glioblastoma multiforme progression: two cases of functional vision changes before MRI detection

    Directory of Open Access Journals (Sweden)

    Xie K

    2015-06-01

    Full Text Available Kate Xie,1,* Catherine Y Liu,1,* Anton N Hasso,2 Robert Wade Crow1 1Department of Ophthalmology, Gavin Herbert Eye Institute, University of California, Irvine, Irvine, CA, USA, 2Department of Radiological Sciences, University of California Irvine Medical Center, Orange, CA, USA *These authors contributed equally to this work Abstract: Glioblastoma multiforme is an aggressive tumor associated with a high rate of recurrence even after maximal therapy. In a disease with poor prognosis and rapid deterioration, early detection of tumor progression is necessary to make timely treatment decisions or to initiate end of life care. We identify two cases where Humphrey visual field testing predated magnetic resonance imaging and positron emission tomography findings of tumor progression by months in glioblastoma multiforme. New or worsening visual field defects may indicate signs of tumor progression in glioblastoma multiforme and should prompt further investigation. Keywords: glioblastoma multiforme, optic pathway, visual field defects

  18. Glioblastoma multiforme in children: experience at Hospital Infantil de Mexico Federico Gomez.

    Science.gov (United States)

    Sánchez-Herrera, Federico; Castro-Sierra, Eduardo; Gordillo-Domínguez, Luis Felipe; Vaca-Ruiz, Miguel Angel; Santana-Montero, Blanca; Perezpeña-Diazconti, Mario; González-Carranza, Vicente; Torres-García, Samuel; Chico-Ponce de León, Fernando

    2009-05-01

    To evaluate clinical evolution of pediatric patients diagnosed with glioblastoma multiforme (GBM) at Hospital Infantil de México Federico Gómez. Cases of patients treated from January to May, 2007, were included in this study. Variables analyzed were: age, diagnosis, size of tumor, histopathological description, degree of resection, time of stay in hospital, complications and outcome using Pearson's chi-squared test and logistic regression. Sixteen patients were identified. Mean age of presentation was 8.8. An increased frequency of complications was observed in younger patients and longer survival rates in patients with greater resections; main mode of presentation was directly related to intracranial hypertension; size of tumor was not related to evolution or outcome. Modern histological classifications especially designed for children are deemed necessary to accurately diagnose GBM.

  19. Boron neutron capture therapy for newly diagnosed glioblastoma multiforme: An assessment of clinical potential

    Energy Technology Data Exchange (ETDEWEB)

    Hopewell, J.W., E-mail: john.hopewell@gtc.ox.ac.uk [Green Templeton College and Particle Therapy Cancer Research Institute, University of Oxford, Oxford (United Kingdom); Gorlia, T. [Data Center, EORTC, Brussels (Belgium); Pellettieri, L. [Hammercap Medical AB, Stockholm (Sweden)] [Department of Neurosurgery, Goeteborg University, Goeteborg (Sweden); Giusti, V. [Hammercap Medical AB, Stockholm (Sweden)] [Department of Mechanical, Nuclear and Production Engineering, University of Pisa, Pisa (Italy); H-Stenstam, B. [Nykoeping Hospital, County of Sormland (Sweden); Skoeld, K. [Hammercap Medical AB, Stockholm (Sweden)

    2011-12-15

    The purpose of this analysis was to assess the potential of BNCT, with L-boronophenylalanine (L-BPA), as first line radiotherapy for glioblastoma multiforme (GBM). The survival of patients with newly diagnosed GBM from a phase II BNCT study was compared with those from the two arms of a phase III study with conventional radiotherapy (RT) vs. RT plus concomitant and adjuvant medication with temozolomide (TMZ). A small subgroup, for which the methylation status of the O{sup 6}-methylguanine-DNA methyltransferase (MGMT) DNA-repair gene was known, was also considered. The results indicated that the use of BNCT with BPA should be explored in a stratified randomized phase II trial in which patients with the unmethylated MGMT DNA-repair gene are offered BNCT vs. RT plus TMZ.

  20. Phase II open-label study of nintedanib in patients with recurrent glioblastoma multiforme

    DEFF Research Database (Denmark)

    Muhic, Aida; Poulsen, Hans Skovgaard; Mau-Sørensen, Paul Morten

    2013-01-01

    Nintedanib (BIBF 1120) is a small, orally available, triple angiokinase inhibitor in phase III development (various indications) that targets VEGFR 1-3, FGFR 1-3, and PDGFR-α/β. This open-label, uncontrolled, phase II study assessed the efficacy and safety of nintedanib in patients with recurrent....... Nintedanib had an acceptable safety profile, with no CTCAE grade 3-4 adverse events. Common adverse events were CTCAE grade 1-2 fatigue, loss of appetite, diarrhea, and nausea. Single-agent nintedanib (200 mg bid) demonstrated limited, but clinically non-relevant antitumor activity in patients with recurrent...... glioblastoma multiforme (GBM) who had previously failed radiotherapy plus temozolomide as first-line therapy (STUPP), or the same regimen with subsequent bevacizumab-based therapy as second-line treatment (BEV). Patients with a performance status of 0-1, histologically proven GBM, and measurable disease (by...

  1. Significant anti-tumor effect of bevacizumab in treatment of pineal gland glioblastoma multiforme.

    Science.gov (United States)

    Mansour, Joshua; Fields, Braxton; Macomson, Samuel; Rixe, Olivier

    2014-12-01

    Glioblastoma multiforme (GBM) is the most aggressive subtype of malignant gliomas. Current standard treatment for GBM involves a combination of cytoreduction through surgical resection, followed by radiation with concomitant and adjuvant chemotherapy (temozolomide). The role of bevacizumab in the treatment of GBM continues to be a topic of ongoing research and debate. Despite aggressive treatment, these tumors remain undoubtedly fatal, especially in the elderly. Furthermore, tumors present in the pineal gland are extremely rare, accounting for only 0.1-0.4 % of all adult brain tumors, with this location adding to the complexity of treatment. We present a case of GBM, at the rare location of pineal gland, in an elderly patient who was refractory to initial standard of care treatment with radiation and concomitant and adjuvant temozolomide, but who developed a significant response to anti-angiogenic therapy using bevacizumab.

  2. Simulation of glioblastoma multiforme (GBM) tumor cells using ising model on the Creutz Cellular Automaton

    Science.gov (United States)

    Züleyha, Artuç; Ziya, Merdan; Selçuk, Yeşiltaş; Kemal, Öztürk M.; Mesut, Tez

    2017-11-01

    Computational models for tumors have difficulties due to complexity of tumor nature and capacities of computational tools, however, these models provide visions to understand interactions between tumor and its micro environment. Moreover computational models have potential to develop strategies for individualized treatments for cancer. To observe a solid brain tumor, glioblastoma multiforme (GBM), we present a two dimensional Ising Model applied on Creutz cellular automaton (CCA). The aim of this study is to analyze avascular spherical solid tumor growth, considering transitions between non tumor cells and cancer cells are like phase transitions in physical system. Ising model on CCA algorithm provides a deterministic approach with discrete time steps and local interactions in position space to view tumor growth as a function of time. Our simulation results are given for fixed tumor radius and they are compatible with theoretical and clinic data.

  3. Radiofrequency applicator concepts for simultaneous MR imaging and hyperthermia treatment of glioblastoma multiforme

    Directory of Open Access Journals (Sweden)

    Oberacker Eva

    2017-09-01

    Full Text Available Glioblastoma multiforme is the most frequent and most aggressive malignant brain tumor with de facto no long term curation by the use of current multimodal therapeutic approaches. The efficacy of brachytherapy and enhancing interstitial hyperthermia has been demonstrated. RF heating at ultrahigh fields (B0=7.0T, f=298MHz has the potential of delivering sufficiently large thermal dosage for hyperthermia of relatively large tumor areas. This work focuses on electromagnetic field (EMF simulations and provides realistic applicator designs tailored for simultaneous RF heating and MRI. Our simulations took advantage of target volumes derived from patient data, and our preliminary results suggest that RF power can be focused to both a small tumor area and a large clinical target volume.

  4. The emerging role of stereotactic radiosurgery in the treatment of glioblastoma multiforme.

    Science.gov (United States)

    Barbarisi, Manlio; Romanelli, Pantaleo

    2012-10-01

    Stereotactic radiosurgery is an emerging treatment option offered to patients with Glioblastoma multiforme (GBM). Radiosurgery is performed as an outpatient procedure and provides a safe and effective non invasive treatment for focal GBM. High energy beams originating from cobalt sources placed into an helmet (Gamma-Knife) or generated by a linear accelerator (LINAC) rotating on a gantry (X-Knife, Novalis) or maneuvered by a robotic arm (CyberKnife) are delivered with submillimetric accuracy to a selected intracranial target. Treatment accuracy is provided by image-guided volumetric CT and MR studies complemented with advanced metabolic neuroimaging techniques such as CT-PET. Radiosurgery is typically used as a salvage treatment in patients with recurrent GBM to avoid further surgical procedures or as a complement to conventional fractionated radiotherapy. This paper reviews the emerging role of stereotactic radiosurgery in the treatment of GBM.

  5. Boron Neutron Capture Therapy (BNCT) Dose Calculation using Geometrical Factors Spherical Interface for Glioblastoma Multiforme

    Science.gov (United States)

    Zasneda, Sabriani; Widita, Rena

    2010-06-01

    Boron Neutron Capture Therapy (BNCT) is a cancer therapy by utilizing thermal neutron to produce alpha particles and lithium nuclei. The superiority of BNCT is that the radiation effects could be limited only for the tumor cells. BNCT radiation dose depends on the distribution of boron in the tumor. Absorbed dose to the cells from the reaction 10B (n, α) 7Li was calculated near interface medium containing boron and boron-free region. The method considers the contribution of the alpha particle and recoiled lithium particle to the absorbed dose and the variation of Linear Energy Transfer (LET) charged particles energy. Geometrical factor data of boron distribution for the spherical surface is used to calculate the energy absorbed in the tumor cells, brain and scalp for case Glioblastoma Multiforme. The result shows that the optimal dose in tumor is obtained for boron concentrations of 22.1 mg 10B/g blood.

  6. Metabolic management of glioblastoma multiforme using standard therapy together with a restricted ketogenic diet: Case Report.

    Science.gov (United States)

    Zuccoli, Giulio; Marcello, Norina; Pisanello, Anna; Servadei, Franco; Vaccaro, Salvatore; Mukherjee, Purna; Seyfried, Thomas N

    2010-04-22

    Management of glioblastoma multiforme (GBM) has been difficult using standard therapy (radiation with temozolomide chemotherapy). The ketogenic diet is used commonly to treat refractory epilepsy in children and, when administered in restricted amounts, can also target energy metabolism in brain tumors. We report the case of a 65-year-old woman who presented with progressive memory loss, chronic headaches, nausea, and a right hemisphere multi-centric tumor seen with magnetic resonance imaging (MRI). Following incomplete surgical resection, the patient was diagnosed with glioblastoma multiforme expressing hypermethylation of the MGMT gene promoter. Prior to initiation of the standard therapy, the patient conducted water-only therapeutic fasting and a restricted 4:1 (fat: carbohydrate + protein) ketogenic diet that delivered about 600 kcal/day. The patient also received the restricted ketogenic diet concomitantly during the standard treatment period. The diet was supplemented with vitamins and minerals. Steroid medication (dexamethasone) was removed during the course of the treatment. The patient was followed using MRI and positron emission tomography with fluoro-deoxy-glucose (FDG-PET). After two months treatment, the patient's body weight was reduced by about 20% and no discernable brain tumor tissue was detected using either FDG-PET or MRI imaging. Biomarker changes showed reduced levels of blood glucose and elevated levels of urinary ketones. MRI evidence of tumor recurrence was found 10 weeks after suspension of strict diet therapy. This is the first report of confirmed GBM treated with standard therapy together with a restricted ketogenic diet. As rapid regression of GBM is rare in older patients following incomplete surgical resection and standard therapy alone, the response observed in this case could result in part from the action of the calorie restricted ketogenic diet. Further studies are needed to evaluate the efficacy of restricted ketogenic diets

  7. Metabolic management of glioblastoma multiforme using standard therapy together with a restricted ketogenic diet: Case Report

    Directory of Open Access Journals (Sweden)

    Servadei Franco

    2010-04-01

    Full Text Available Abstract Background Management of glioblastoma multiforme (GBM has been difficult using standard therapy (radiation with temozolomide chemotherapy. The ketogenic diet is used commonly to treat refractory epilepsy in children and, when administered in restricted amounts, can also target energy metabolism in brain tumors. We report the case of a 65-year-old woman who presented with progressive memory loss, chronic headaches, nausea, and a right hemisphere multi-centric tumor seen with magnetic resonance imaging (MRI. Following incomplete surgical resection, the patient was diagnosed with glioblastoma multiforme expressing hypermethylation of the MGMT gene promoter. Methods Prior to initiation of the standard therapy, the patient conducted water-only therapeutic fasting and a restricted 4:1 (fat: carbohydrate + protein ketogenic diet that delivered about 600 kcal/day. The patient also received the restricted ketogenic diet concomitantly during the standard treatment period. The diet was supplemented with vitamins and minerals. Steroid medication (dexamethasone was removed during the course of the treatment. The patient was followed using MRI and positron emission tomography with fluoro-deoxy-glucose (FDG-PET. Results After two months treatment, the patient's body weight was reduced by about 20% and no discernable brain tumor tissue was detected using either FDG-PET or MRI imaging. Biomarker changes showed reduced levels of blood glucose and elevated levels of urinary ketones. MRI evidence of tumor recurrence was found 10 weeks after suspension of strict diet therapy. Conclusion This is the first report of confirmed GBM treated with standard therapy together with a restricted ketogenic diet. As rapid regression of GBM is rare in older patients following incomplete surgical resection and standard therapy alone, the response observed in this case could result in part from the action of the calorie restricted ketogenic diet. Further studies are needed

  8. Giant cell glioblastoma multiforme: report of a case with prolonged survival and transformation to gliosarcoma.

    Science.gov (United States)

    Deb, Prabal; Sharma, Mehar Chand; Chander, Bal; Mahapatra, Ashok Kumar; Sarkar, Chitra

    2006-03-01

    Giant cell glioblastomas (GCGs) and gliosarcomas are rare histological variants of glioblastoma multiforme (GBMs). The mean age of occurrence in GCG is 42 years, but occasional cases have been documented in children under 10 years of age. Clinically, they are associated with a better prognosis than conventional GBMs, with few reports documenting prolonged survival up to 17 years after diagnosis. In contrast, gliosarcomas have age distribution and survival characteristics similar to conventional GBMs. They either arise de novo (primary) or secondary to irradiation to GBM. We report a rare case of childhood GCG in an 8-year-old boy surviving for more than 10 years since initial diagnosis. He has had two recurrences at the ages of 16 and 17 years, respectively, with histopathology at second recurrence showing evidence of gliosarcoma. No such case of gliosarcoma following treatment for GCG has been reported in the literature. Hence, the origin of the gliosarcoma whether radiation induced or only a phenotypic change in the GBM remains conjectural.

  9. Genomic aberrations in 80 cases of primary glioblastoma multiforme: Pathogenetic heterogeneity and putative cytogenetic pathways.

    Science.gov (United States)

    Dahlback, Hanne-Sofie S; Brandal, Petter; Meling, Torstein R; Gorunova, Ludmila; Scheie, David; Heim, Sverre

    2009-10-01

    Screening the whole glioblastoma multiforme (GBM) genome for aberrations is a good starting point when looking for molecular markers that could potentially stratify patients according to prognosis and optimal treatment. We investigated 80 primary untreated GBM using both G-banding analysis and high-resolution comparative genomic hybridization (HR-CGH). Abnormal karyotypes were found in 83% of the tumors. The most common numerical chromosome aberrations were +7, -10, -13, -14, -15, +20, and -22. Structural abnormalities most commonly involved chromosomes 1 and 3, and the short arm of chromosome 9. HR-CGH verified these findings and revealed additional frequent losses at 1p34-36, 6q22-27, and 19q12-13 and gains of 3q26 and 12q13-15. Although most karyotypes and gain/loss patterns were complex, there was also a distinct subset of tumors displaying simple karyotypic changes only. There was a statistically significant association between trisomy 7 and monosomy 10, and also between +7/-10 as putative primary aberrations and secondary losses of 1p, 9p, 13q, and 22q. The low number of tumors in the rarer histological tumor subgroups precludes definite conclusions, but there did not seem to be any clear-cut cytogenetic-pathological correlations, perhaps with the exception of ring chromosomes in giant cell glioblastomas. Our findings demonstrate that although GBM is a pathogenetically very heterogeneous group of diseases, distinct genomic aberration patterns exist. (c) 2009 Wiley-Liss, Inc.

  10. Glioblastoma multiforme and papillary thyroid carcinoma - A rare combination of multiple primary malignancies

    Directory of Open Access Journals (Sweden)

    Swaroopa Pulivarthi

    2015-01-01

    Full Text Available We are describing a 19-year-old white woman who presented with two synchronous primary cancers, namely glioblastoma multiforme and papillary thyroid cancer. The patient was admitted with dizziness, headache, and vomiting. CT head revealed acute intraparenchymal hematoma in the right cingulate gyrus and the splenium of the corpus callosum. Carotid and cerebral angiogram were unremarkable. MRI of the brain demonstrated a non-enhancing and non-hemorrhagic component of the lesion along the lateral margin of the hemorrhage just medial to the atrium of the right lateral ventricle that was suspicious for a tumor or metastasis. Brain biopsy confirmed it as glioblastoma mutiforme. CT chest was done to rule out primary cancer that revealed a 11 mm hypodense lesion in the left lobe of the thyroid and ultrasound-guided fine-needle aspiration biopsy confirmed it as papillary thyroid carcinoma. We should evaluate for multiple primary malignancies in young patients who are found to have primary index cancer.

  11. Primary Spinal Glioblastoma Multiforme with Secondary Manifestation as a Cerebral “Angioglioma.” Literature Review and Case Report

    Science.gov (United States)

    Linsenmann, Thomas; Westermaier, Thomas; Vince, Giles Hamilton; Monoranu, Camelia Maria; Löhr, Mario; Ernestus, Ralf-Ingo; Stetter, Christian

    2015-01-01

    Primary intramedullary spinal glioblastoma multiforme (sGBM) with a secondary cerebral manifestation is a very rare entity with a poor outcome. Case studies show a mean average of survival of 10 months after diagnosis. These tumors tend to develop at a young age. A combination with an arteriovenous malformation in the same location has never been published before. Vascular malformations in association with cerebral glioblastomas have only been reported in five cases so far. Proangiogenic factors are assumed to be involved in the appearance of both entities. We present a case study and a review of the literature. PMID:26251789

  12. Nanocarriers for the treatment of glioblastoma multiforme: Current state-of-the-art.

    Science.gov (United States)

    Karim, Reatul; Palazzo, Claudio; Evrard, Brigitte; Piel, Geraldine

    2016-04-10

    Glioblastoma multiforme, a grade IV glioma, is the most frequently occurring and invasive primary tumor of the central nervous system, which causes about 4% of cancer-associated-deaths, making it one of the most fatal cancers. With present treatments, using state-of-the-art technologies, the median survival is about 14 months and 2 year survival rate is merely 3-5%. Hence, novel therapeutic approaches are urgently necessary. However, most drug molecules are not able to cross the blood-brain barrier, which is one of the major difficulties in glioblastoma treatment. This review describes the features of blood-brain barrier, and its anatomical changes with different stages of tumor growth. Moreover, various strategies to improve brain drug delivery i.e. tight junction opening, chemical modification of the drug, efflux transporter inhibition, convection-enhanced delivery, craniotomy-based drug delivery and drug delivery nanosystems are discussed. Nanocarriers are one of the highly potential drug transport systems that have gained huge research focus over the last few decades for site specific drug delivery, including drug delivery to the brain. Properly designed nanocolloids are capable to cross the blood-brain barrier and specifically deliver the drug in the brain tumor tissue. They can carry both hydrophilic and hydrophobic drugs, protect them from degradation, release the drug for sustained period, significantly improve the plasma circulation half-life and reduce toxic effects. Among various nanocarriers, liposomes, polymeric nanoparticles and lipid nanocapsules are the most widely studied, and are discussed in this review. For each type of nanocarrier, a general discussion describing their composition, characteristics, types and various uses is followed by their specific application to glioblastoma treatment. Moreover, some of the main challenges regarding toxicity and standardized evaluation techniques are narrated in brief. Copyright © 2016 Elsevier B.V. All

  13. Activity of irofulven (6-hydroxymethylacylfulvene) in the treatment of glioblastoma multiforme-derived xenografts in athymic mice.

    Science.gov (United States)

    Friedman, H S; Keir, S T; Houghton, P J; Lawless, A A; Bigner, D D; Waters, S J

    2001-11-01

    This study was conducted to define the activity of irofulven in the treatment of a series of xenografts derived from human glioblastoma multiforme growing subcutaneously and intracranially in athymic nude mice. Athymic mice bearing subcutaneous or intracranial tumors were treated with irofulven at a 10% lethal dose with responses compared to tumor-bearing mice treated with drug vehicle. Irofulven was active against all tumor lines tested with growth delays ranging from 5.6 to 81.6 days (all values statistically significant, P Irofulven also produced a statistically significant (P Irofulven is active in a spectrum of human glioblastoma multiforme-derived xenografts and evaluation in patients with this neoplasm is warranted.

  14. MR-guided laser-induced interstitial thermotherapy of recurrent glioblastoma multiforme: Preliminary results in 16 patients

    Energy Technology Data Exchange (ETDEWEB)

    Schwarzmaier, Hans-Joachim [Center for Medical Research, Klinikum Krefeld, University of Duesseldorf Medical School at Krefeld (Germany)]. E-mail: schwarzmaier@klinikum-krefeld.de; Eickmeyer, Frank [Department of Radiology, Coordination Center for Clinical Studies, Klinikum Krefeld, University of Duesseldorf Medical School at Krefeld (Germany); Tempelhoff, Wernholt von [Department of Neurosurgery, Klinikum Krefeld, University of Duesseldorf Medical School at Krefeld (Germany); Fiedler, Volkhard Ulrich [Department of Radiology, Coordination Center for Clinical Studies, Klinikum Krefeld, University of Duesseldorf Medical School at Krefeld (Germany); Niehoff, Hendrik [Department of Neurosurgery, Klinikum Krefeld, University of Duesseldorf Medical School at Krefeld (Germany); Ulrich, Slif Dagobert [Department of Radiology, Coordination Center for Clinical Studies, Klinikum Krefeld, University of Duesseldorf Medical School at Krefeld (Germany); Yang Qin [University of Duesseldorf (Germany); Ulrich, Frank [Department of Neurosurgery, Klinikum Krefeld, University of Duesseldorf Medical School at Krefeld (Germany)

    2006-08-15

    We investigated the survival after laser-induced interstitial thermotherapy in 16 patients suffering from recurrent glioblastoma multiforme. The concept underlying the intervention is the cytoreduction of the tumor tissue by local thermocoagulation. All patients received standard chemotherapy (temozolomide). The median overall survival time after the first relapse was 9.4 months, corresponding to a median overall survival time after laser irradiation of 6.9 months. During the study, however, the median survival after laser coagulation increased to 11.2 months. This survival time is substantially longer than those reported for the natural history (<5 months) or after chemotherapy (temozolomide: 5.4-7.1 months). We conclude that cytoreduction by laser irradiation might be a promising option for patients suffering from recurrent glioblastoma multiforme. In addition, the data indicate the presence of a substantial learning curve. Future work should optimize the therapeutic regimen and evaluate this treatment approach in controlled clinical trials.

  15. Identification of novel candidate target genes in amplicons of Glioblastoma multiforme tumors detected by expression and CGH microarray profiling

    OpenAIRE

    Hernández-Moneo Jose-Luis; de Lope Angel; Gómez Elena; Camacho Francisca I; Fiaño Concepción; Ribalta Teresa; Mollejo Manuela; Ruano Yolanda; Martínez Pedro; Meléndez Bárbara

    2006-01-01

    Abstract Background Conventional cytogenetic and comparative genomic hybridization (CGH) studies in brain malignancies have shown that glioblastoma multiforme (GBM) is characterized by complex structural and numerical alterations. However, the limited resolution of these techniques has precluded the precise identification of detailed specific gene copy number alterations. Results We performed a genome-wide survey of gene copy number changes in 20 primary GBMs by CGH on cDNA microarrays. A nov...

  16. Deciphering the Finger Prints of Brain Cancer Glioblastoma Multiforme from Four Different Patients by Using Near Infrared Raman Spectroscopy.

    Science.gov (United States)

    Banerjee, Hirendra Nath; Banerji, Arnold; Banerjee, Arunendra Nath; Riddick, Eilena; Petis, Jenae; Evans, Shavonda; Patel, Megha; Parson, Carl; Smith, Valerie; Gwebu, E; Voisin, Sarah

    2015-02-03

    To explore the effectiveness of Raman spectra to diagnose brain cancer glioblastoma multiforme (GBM), we investigated the Raman spectra of single cell from four different GBM cell lines developed from four different patients and analyzed the spectra. The Raman spectra of brain cancer (GBM) cells were similar in all these cell lines. The results indicate that Raman spectra can offer the experimental basis for the cancer diagnosis and treatment.

  17. Deciphering the Finger Prints of Brain Cancer Glioblastoma Multiforme from Four Different Patients by Using Near Infrared Raman Spectroscopy

    OpenAIRE

    Banerjee, Hirendra Nath; Banerji, Arnold; Banerjee, Arunendra Nath; Riddick, Eilena; Petis, Jenae; Evans, Shavonda; Patel, Megha; Parson, Carl; Smith, Valerie; Gwebu, E; Voisin, Sarah

    2015-01-01

    To explore the effectiveness of Raman spectra to diagnose brain cancer glioblastoma multiforme (GBM), we investigated the Raman spectra of single cell from four different GBM cell lines developed from four different patients and analyzed the spectra. The Raman spectra of brain cancer (GBM) cells were similar in all these cell lines. The results indicate that Raman spectra can offer the experimental basis for the cancer diagnosis and treatment.

  18. Strong adverse prognostic impact of hyperglycemic episodes during adjuvant chemoradiotherapy of glioblastoma multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Mayer, Arnulf; Vaupel, Peter; Stockinger, Marcus; Schmidberger, Heinz [University Medical Center, Department of Radiooncology and Radiotherapy, Mainz (Germany); Struss, Hans-Garlich [University Medical Center, Department of Laboratory Medicine, Mainz (Germany); Giese, Alf [University Medical Center, Department of Neurosurgery, Mainz (Germany)

    2014-10-15

    In comparison to normal brain tissue, glioblastomas exhibit significantly increased glucose uptake. Brain edema is a common complication during adjuvant chemoradiotherapy, leading to a requirement for glucocorticoid treatment. Glucocorticoid treatment frequently causes considerable deregulation of blood glucose levels. Therefore, episodes of hyperglycemia may contribute to radio- and/or chemoresistance. This study comprises a retrospective analysis of the influence of hyperglycemic episodes (HEs) during adjuvant therapy on the overall survival of 106 glioblastoma multiforme patients. The occurrence of one or more deregulated blood glucose value(s) > 10 mM is associated with a reduction in median overall survival from 16.7 to 8.8 months. A significantly poorer overall survival of patients with hyperglycemia could also be detected in subgroup analyses of patients with complete tumor resection and complete treatment according to the EORTC 22891/26891 trial protocol, as well as in a multivariate Cox proportional hazards analysis. A history of diabetes mellitus had no influence on prognosis. Our data suggest that the observed negative impact of elevated blood glucose levels on overall survival may not solely be explained by the patients' poorer general condition; the elevated blood glucose concentration itself may play a pathogenetic role. This could be due to increased activity of antioxidant systems, elevated expression of DNA damage response proteins and protection of hypoxic tumor cells against apoptosis combined with hypoxia-mediated radioresistance. A possible prognostic impact of elevated blood glucose levels during the period of adjuvant (chemo-) radiotherapy of glioblastoma should be evaluated in a prospective clinical trial. (orig.) [German] Glioblastome zeigen im Vergleich mit normalem Gehirngewebe eine deutlich vermehrte Glukoseaufnahme. Im Rahmen der adjuvanten Radio(chemo)therapie von Glioblastomen treten vielfach Hirnoedeme auf, die eine

  19. Overcoming Temozolomide Resistance in Glioblastoma Multiforme with MGMT-Targeting Spherical Nucleic Acids

    Science.gov (United States)

    Sita, Timothy L.

    Glioblastoma multiforme (GBM) is the most prevalent primary central nervous system malignancy. Due to the aggressive nature of these tumors and our inability to adequately treat them, only 3-5% of patients survive longer than 3 years post-diagnosis. The standard of care for newly diagnosed GBM is surgical resection followed by concomitant and adjuvant radiotherapy and temozolomide (TMZ) chemotherapy. TMZ cytotoxicity is mediated primarily through methylation of the O 6 -position of guanine. In the majority of patients, this methyl group is rapidly removed by the enzyme O6 -methylguanine-DNA methyltransferase (MGMT), conferring resistance to the chemotherapy. However, in a small subset of GBM patients, the promoter region for MGMT is methylated over the course of tumor development. This epigenetic silencing of MGMT activity allows TMZ to induce apoptosis in glioblastoma cells and drastically increases survival in GBM patients. The following work seeks to recapitulate this improved survival phenotype by combining TMZ with a novel nanoconstruct capable of silencing MGMT expression. The nanoconstruct consists of gold nanoparticles densely conjugated with either an MGMT-targeting ribozyme (ribozyme-Spherical Nucleic Acids (SNAs)), or small interfering RNA (siRNA) duplexes designed against MGMT (siMGMT-SNAs), and has been found to have unique characteristics, including (1) the rapid internalization by all glioma cell types studied including glioma initiating cells (GICs), (2) the capacity to potently silence MGMT expression, (3) increased apoptotic response in GBM cells, (4) the ability to cross the blood-brain barrier (BBB), blood-tumor barrier (BTB), and accumulate in GBM xenografts, and (5) no observable acute toxicity at high doses in animal models. In summary, preliminary data suggest ribozyme-SNA and siMGMT-SNAs sensitize GBM cells in vitro and in vivo, enhancing the therapeutic response to TMZ.

  20. Copper-64 Dichloride as Theranostic Agent for Glioblastoma Multiforme: A Preclinical Study

    Directory of Open Access Journals (Sweden)

    Cristina Ferrari

    2015-01-01

    Full Text Available Glioblastoma multiforme (GBM is the most common primary malignant brain tumor in adults with a median survival time less than one year. To date, there are only a limited number of effective agents available for GBM therapy and this does not seem to add much survival advantage over the conventional approach based on surgery and radiotherapy. Therefore, the development of novel therapeutic approaches to GBM is essential and those based on radionuclide therapy could be of significant clinical impact. Experimental evidence has clearly demonstrated that cancer cells have a particularly high fractional content of copper inside the nucleus compared to normal cells. This behavior can be conveniently exploited both for diagnosis and for delivering therapeutic payloads (theranostic of the radionuclide copper-64 into the nucleus of cancerous cells by intravenous administration of its simplest chemical form as dichloride salt [64Cu]CuCl2. To evaluate the potential theranostic role of [64Cu]CuCl2 in GBM, the present work reports results from a preclinical study carried out in a xenografted GBM tumor mouse model. Biodistribution data of this new agent were collected using a small-animal PET tomograph. Subsequently, groups of tumor implanted nude mice were treated with [64Cu]CuCl2 to simulate single- and multiple-dose therapy protocols, and results were analyzed to estimate therapeutic efficacy.

  1. Gene Expression Profile of Glioblastoma Multiforme Invasive Phenotype Points to New Therapeutic Targets

    Directory of Open Access Journals (Sweden)

    Dominique B. Hoelzinger

    2005-01-01

    Full Text Available The invasive phenotype of glioblastoma multiforme (GBM is a hallmark of malignant process, yet molecular mechanisms that dictate this locally invasive behavior remain poorly understood. Gene expression profiles of human glioma cells were assessed from laser capture-microdissected GBM cells collected from paired patient tumor cores and white matterinvading cell populations. Changes in gene expression in invading GBM cells were validated by quantitative reverse transcription polymerase chain reaction (QRTPCR and immunohistochemistry in an independent sample set. QRT-PCR confirmed the differential expression in 19 of 21 genes tested. Immunohistochemical analyses of autotaxin (ATX, ephrin 133, B-cell lymphoma-w (BCLW, and protein tyrosine kinase 2 beta showed them to be expressed in invasive glioma cells. The known GBM markers, insulin-like growth factor binding protein 2 and vimentin, were robustly expressed in the tumor core. A glioma invasion tissue microarray confirmed the expression of ATX and BCLW in invasive cells of tumors of various grades. GBM phenotypic and genotypic heterogeneity is well documented. In this study, we show an additional layer of complexity: transcriptional differences between cells of tumor core and invasive cells located in the brain parenchyma. Gene products supporting invasion may be novel targets for manipulation of brain tumor behavior with consequences on treatment outcome.

  2. A combination of tyrosine kinase inhibitors, crizotinib and dasatinib for the treatment of glioblastoma multiforme.

    Science.gov (United States)

    Nehoff, Hayley; Parayath, Neha N; McConnell, Melanie J; Taurin, Sebastien; Greish, Khaled

    2015-11-10

    Glioblastoma multiforme (GBM) is the most common and aggressive primary brain tumor. Despite the advances in surgery, radiotherapy and chemotherapy, patient survival averages only 14.6 months. In most GBM tumors, tyrosine kinases show increased activity and/or expression and actively contribute to the development, recurrence and onset of treatment resistance; making their inhibition an appealing therapeutic strategy. We compared the cytotoxicity of 12 tyrosine kinase inhibitors in vitro. A combination of crizotinib and dasatinib emerged as the most cytotoxic across established and primary human GBM cell lines. The combination treatment induced apoptotic cell death and polyploidy. Furthermore, the combination treatment led to the altered expression and localization of several tyrosine kinase receptors such as Met and EGFR and downstream effectors as such as SRC. Furthermore, the combination treatment reduced the migration and invasion of GBM cells and prevented endothelial cell tube formation in vitro. Overall, our study demonstrated the broad specificity of a combination of crizotinib and dasatinib across multiple GBM cell lines. These findings provide insight into the development of alternative therapy for the treatment of GBM.

  3. Prolonged survival when temozolomide is added to accelerated radiotherapy for glioblastoma multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Guckenberger, Matthias; Mayer, Mario; Sweeney, Reinhart A.; Flentje, Michael [University Hospital Wuerzburg (Germany). Dept. of Radiation Oncology; Buttmann, Mathias [University Hospital Wuerzburg (Germany). Dept. of Neurology; Vince, Giles H. [University Hospital Wuerzburg (Germany). Dept. of Neurosurgery

    2011-09-15

    The goal of this study was to evaluate accelerated radiotherapy with and without temozolomide (TMZ) for glioblastoma multiforme (GBM). This retrospective analysis evaluated 86 patients with histologically proven GBM who were treated with accelerated radiotherapy of 1.8 Gy twice daily to a total dose of 54 Gy within 3 weeks. Median age was 62 years and median Karnofsky index was 90. A total of 41 patients received radiotherapy only from 2002-2005 and 45 patients were treated with TMZ concomitantly and after radiotherapy from 2005-2007. Median overall survival (OS) was 12.5 months and 2-year OS was 15.4%. Patient characteristics were well balanced between the two groups except for better performance status (p = 0.05) and higher frequency of retreatment for the first recurrence (p = 0.02) in the TMZ group. Age at diagnosis (HR 2.83) and treatment with TMZ (HR 0.60) were correlated with OS in the multivariate analysis: treatment with and without TMZ resulted in median OS of 16 months and 11.3 months, respectively. Hematological toxicity grade > II was observed in 2/45 patients and 5/37 patients during simultaneous radiochemotherapy and adjuvant TMZ. TMZ added to accelerated radiotherapy for GBM resulted in prolonged overall survival with low rates of severe hematological toxicity. (orig.)

  4. Glioblastoma multiforme versus solitary supratentorial brain metastasis. Differentiation based on morphology and magnetic resonance signal characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Maurer, Martin H.; Wuestefeld, J.; Schaefer, M.L.; Wiener, E. [Charite - Universitaetsmedizin Berlin, Campus Virchow-Klinikum (Germany). Klinik fuer Diagnostische und Interventionelle Radiologie; Synowitz, M.; Lohkamp, L.N. [Charite - Universitaetsmedizin Berlin, Campus Virchow-Klinikum (Germany). Klinik fuer Neurochirurgie; Badakshi, H. [Charite - Universitaetsmedizin Berlin, Campus Virchow-Klinikum (Germany). Klinik fuer Strahlentherapie

    2013-03-15

    Purpose: To evaluate the diagnostic potential of a multi-factor analysis of morphometric parameters and magnetic resonance (MR) signal characteristics of a mass and peritumoral area to distinguish solitary supratentorial metastasis from glioblastoma multiforme (GBM). Materials and Methods: MR examinations of 51 patients with histologically proven GBM and 44 with a single supratentorial metastasis were evaluated. A large variety of morphologic criteria and MR signal characteristics in different sequences were analyzed. The data were subjected to logistic regression to investigate their ability to discriminate between GBM and cerebral metastasis. Receiver-operating characteristic (ROC) analysis was used to select an optimal cut-off point for prediction and to assess the predictive value in terms of sensitivity, specificity, and accuracy of the final model. Results: The logistic regression analysis revealed that the ratio of the maximum diameter of the peritumoral area measured on T2-weighted images (d T2) to the maximum diameter of the enhancing mass area (d T1, post-contrast) is the only useful criterion to distinguish single supratentorial brain metastasis from GBM with a lower ratio favoring GBM (accuracy 68 %, sensitivity 84 % and specificity 45 %). The cut-off point for the ratio d T2/d T1 post-contrast was calculated as 2.35. Conclusion: Measurement of maximum diameters of the peritumoral area in relation to the enhancing mass can be evaluated easily in the clinical routine to discriminate GBM from solitary supratentorial metastasis with an accuracy comparable to that of advanced MRI techniques. (orig.)

  5. Copper-64 Dichloride as Theranostic Agent for Glioblastoma Multiforme: A Preclinical Study.

    Science.gov (United States)

    Ferrari, Cristina; Asabella, Artor Niccoli; Villano, Carlo; Giacobbi, Beatrice; Coccetti, Daniela; Panichelli, Paola; Rubini, Giuseppe

    2015-01-01

    Glioblastoma multiforme (GBM) is the most common primary malignant brain tumor in adults with a median survival time less than one year. To date, there are only a limited number of effective agents available for GBM therapy and this does not seem to add much survival advantage over the conventional approach based on surgery and radiotherapy. Therefore, the development of novel therapeutic approaches to GBM is essential and those based on radionuclide therapy could be of significant clinical impact. Experimental evidence has clearly demonstrated that cancer cells have a particularly high fractional content of copper inside the nucleus compared to normal cells. This behavior can be conveniently exploited both for diagnosis and for delivering therapeutic payloads (theranostic) of the radionuclide copper-64 into the nucleus of cancerous cells by intravenous administration of its simplest chemical form as dichloride salt [(64)Cu]CuCl2. To evaluate the potential theranostic role of [(64)Cu]CuCl2 in GBM, the present work reports results from a preclinical study carried out in a xenografted GBM tumor mouse model. Biodistribution data of this new agent were collected using a small-animal PET tomograph. Subsequently, groups of tumor implanted nude mice were treated with [(64)Cu]CuCl2 to simulate single- and multiple-dose therapy protocols, and results were analyzed to estimate therapeutic efficacy.

  6. Association of Glioblastoma Multiforme Stem Cell Characteristics, Differentiation, and Microglia Marker Genes with Patient Survival

    Directory of Open Access Journals (Sweden)

    Sandra Bien-Möller

    2018-01-01

    Full Text Available Patients with glioblastoma multiforme (GBM are at high risk to develop a relapse despite multimodal therapy. Assumedly, glioma stem cells (GSCs are responsible for treatment resistance of GBM. Identification of specific GSC markers may help to develop targeted therapies. Here, we performed expression analyses of stem cell (ABCG2, CD44, CD95, CD133, ELF4, Nanog, and Nestin as well as differentiation and microglia markers (GFAP, Iba1, and Sparc in GBM compared to nonmalignant brain. Furthermore, the role of these proteins for patient survival and their expression in LN18 stem-like neurospheres was analyzed. At mRNA level, ABCG2 and CD95 were reduced, GFAP was unchanged; all other investigated markers were increased in GBM. At protein level, CD44, ELF4, Nanog, Nestin, and Sparc were elevated in GBM, but only CD133 and Nestin were strongly associated with survival time. In addition, ABCG2 and GFAP expression was decreased in LN18 neurospheres whereas CD44, CD95, CD133, ELF4, Nanog, Nestin, and Sparc were upregulated. Altogether only CD133 and Nestin were associated with survival rates. This raises concerns regarding the suitability of the other target structures as prognostic markers, but makes both CD133 and Nestin candidates for GBM therapy. Nevertheless, a search for more specific marker proteins is urgently needed.

  7. Newcastle Disease Virus Interaction in Targeted Therapy against Proliferation and Invasion Pathways of Glioblastoma Multiforme

    Directory of Open Access Journals (Sweden)

    Jafri Malin Abdullah

    2014-01-01

    Full Text Available Glioblastoma multiforme (GBM, or grade IV glioma, is one of the most lethal forms of human brain cancer. Current bioscience has begun to depict more clearly the signalling pathways that are responsible for high-grade glioma initiation, migration, and invasion, opening the door for molecular-based targeted therapy. As such, the application of viruses such as Newcastle disease virus (NDV as a novel biological bullet to specifically target aberrant signalling in GBM has brought new hope. The abnormal proliferation and aggressive invasion behaviour of GBM is reported to be associated with aberrant Rac1 protein signalling. NDV interacts with Rac1 upon viral entry, syncytium induction, and actin reorganization of the infected cell as part of the replication process. Ultimately, intracellular stress leads the infected glioma cell to undergo cell death. In this review, we describe the characteristics of malignant glioma and the aberrant genetics that drive its aggressive phenotype, and we focus on the use of oncolytic NDV in GBM-targeted therapy and the interaction of NDV in GBM signalling that leads to inhibition of GBM proliferation and invasion, and subsequently, cell death.

  8. MULTIFOCAL GLIOBLASTOMA MULTIFORME PRECEDED BY A GEMISTOCYTIC ASTROCYTOMA AND DYSREGULATED IMMUNE RESPONSE.

    Directory of Open Access Journals (Sweden)

    Ilian Koev

    2014-06-01

    Full Text Available Glioblastoma multiforme (GBM is known to be the most common malignant form of astroglial brain tumors. The etiology, cellular and molecular pathogenic mechanisms remain unclear to a great extent. Recent research indicates the role of the immune system in malignant glioma and especially in triggering the mechanisms of local resistance and systemic immune suppression. There is accumulating evidence that the concept of the CNS as an immune-privileged organ is no longer valid. Recent advances demonstrate that it is an immunologically active site, with complex immune responses mostly based on innate immune processes. Multifocal gliomas with varying histopathological appearance are extremely rare. We report the only case of GBM preceded by a gemistocytic astrocytoma with a very short survival time of just 3 months after the onset of complaints. Interestingly, a normal CD4/CD8 ratio but prominent change in the regulatory T cell lineage was recorded. The elevation of the suppressor CD8+CD11b+ cells and the reduction of cytotoxic CD8+CD11b- cells indicate the prevalence of a suppressor phenotype which provides an explanation for the occurrence of the second malignant tumor, the rapid tumor progression and fatal outcome.

  9. Quality of Radiomic Features in Glioblastoma Multiforme: Impact of Semi-Automated Tumor Segmentation Software.

    Science.gov (United States)

    Lee, Myungeun; Woo, Boyeong; Kuo, Michael D; Jamshidi, Neema; Kim, Jong Hyo

    2017-01-01

    The purpose of this study was to evaluate the reliability and quality of radiomic features in glioblastoma multiforme (GBM) derived from tumor volumes obtained with semi-automated tumor segmentation software. MR images of 45 GBM patients (29 males, 16 females) were downloaded from The Cancer Imaging Archive, in which post-contrast T1-weighted imaging and fluid-attenuated inversion recovery MR sequences were used. Two raters independently segmented the tumors using two semi-automated segmentation tools (TumorPrism3D and 3D Slicer). Regions of interest corresponding to contrast-enhancing lesion, necrotic portions, and non-enhancing T2 high signal intensity component were segmented for each tumor. A total of 180 imaging features were extracted, and their quality was evaluated in terms of stability, normalized dynamic range (NDR), and redundancy, using intra-class correlation coefficients, cluster consensus, and Rand Statistic. Our study results showed that most of the radiomic features in GBM were highly stable. Over 90% of 180 features showed good stability (intra-class correlation coefficient [ICC] ≥ 0.8), whereas only 7 features were of poor stability (ICC NDR ≥1), while above 35% of the texture features showed poor NDR (software tools provided sufficiently reliable tumor segmentation and feature stability; thus helping to overcome the inherent inter-rater and intra-rater variability of user intervention. However, certain aspects of feature quality, including NDR and redundancy, need to be assessed for determination of representative signature features before further development of radiomics.

  10. Dendritic cell vaccination for glioblastoma multiforme: review with focus on predictive factors for treatment response

    Directory of Open Access Journals (Sweden)

    Dejaegher J

    2014-03-01

    Full Text Available Joost Dejaegher,1 Stefaan Van Gool,2 Steven De Vleeschouwer1 1Department of Neurosciences, 2Department of Microbiology and Immunology, KU Leuven, Leuven, Belgium Abstract: Glioblastoma multiforme (GBM is the most common and most aggressive type of primary brain cancer. Since median overall survival with multimodal standard therapy is only 15 months, there is a clear need for additional effective and long-lasting treatments. Dendritic cell (DC vaccination is an experimental immunotherapy being tested in several Phase I and Phase II clinical trials. In these trials, safety and feasibility have been proven, and promising clinical results have been reported. On the other hand, it is becoming clear that not every GBM patient will benefit from this highly personalized treatment. Defining the subgroup of patients likely to respond to DC vaccination will position this option correctly amongst other new GBM treatment modalities, and pave the way to incorporation in standard therapy. This review provides an overview of GBM treatment options and focuses on the currently known prognostic and predictive factors for response to DC vaccination. In this way, it will provide the clinician with the theoretical background to refer patients who might benefit from this treatment. Keywords: immunotherapy, personalized medicine, brain tumor, stratification

  11. Dendritic cell vaccination for glioblastoma multiforme: review with focus on predictive factors for treatment response

    Science.gov (United States)

    Dejaegher, Joost; Van Gool, Stefaan; De Vleeschouwer, Steven

    2014-01-01

    Glioblastoma multiforme (GBM) is the most common and most aggressive type of primary brain cancer. Since median overall survival with multimodal standard therapy is only 15 months, there is a clear need for additional effective and long-lasting treatments. Dendritic cell (DC) vaccination is an experimental immunotherapy being tested in several Phase I and Phase II clinical trials. In these trials, safety and feasibility have been proven, and promising clinical results have been reported. On the other hand, it is becoming clear that not every GBM patient will benefit from this highly personalized treatment. Defining the subgroup of patients likely to respond to DC vaccination will position this option correctly amongst other new GBM treatment modalities, and pave the way to incorporation in standard therapy. This review provides an overview of GBM treatment options and focuses on the currently known prognostic and predictive factors for response to DC vaccination. In this way, it will provide the clinician with the theoretical background to refer patients who might benefit from this treatment. PMID:27471700

  12. Effect of bexarotene on differentiation of glioblastoma multiforme compared with ATRA.

    Science.gov (United States)

    Heo, Jin-Chul; Jung, Tae-Hoon; Lee, Sungjin; Kim, Hyun Young; Choi, Gildon; Jung, Myungeun; Jung, Daeyoung; Lee, Heung Kyoung; Lee, Jung-Ok; Park, Ji-Hwan; Hwang, Daehee; Seol, Ho Jun; Cho, Heeyeong

    2016-06-01

    Glioblastoma multiforme (GBM) is the most aggressive malignant brain tumor. Since differentiation can attenuate or halt the growth of tumor cells, an image-based phenotypic screening was performed to find out drugs inducing morphological differentiation of GBMs. Bexarotene, a selective retinoid X receptor agonist, showed strong inhibition of neurospheroidal colony formation and migration of cultured primary GBM cells. Bexarotene treatment reduced nestin expression, while significantly increasing glial fibrillary acidic protein (GFAP) expression. The effect of bexarotene on gene expression profile was compared with the activity of all-trans retinoic acid (ATRA), a well-known differentiation inducer. Both drugs largely altered the gene expression pattern into a tumor-ameliorating direction. These drugs increased the gene expression levels of Krüppel-like factor 9 (KLF9), regulator of G-protein signaling 4 (RGS4), growth differentiation factor 15 (GDF15), angiopoietin-like protein 4 (ANGPTL4), and lowered the level of chemokine receptor type 4 (CXCR4). However, transglutaminase 2 (TG2) induction, an adverse effect of ATRA, was much weaker in bexarotene treated primary GBM cells. Consistently, the TG2 enzymatic activity was negligibly affected by bexarotene treatment. It is important to control TG2 overexpression since its upregulation is correlated with tumor transformation and drug resistance. Bexarotene also showed in vivo tumoricidal effects in a GBM xenograft mouse model. Therefore, we suggest bexarotene as a more beneficial differentiation agent than ATRA for GBM.

  13. 5-ALA Fluorescence Image Guided Resection of Glioblastoma Multiforme: A Meta-Analysis of the Literature

    Directory of Open Access Journals (Sweden)

    Samy Eljamel

    2015-05-01

    Full Text Available Background: Glioblastoma multiforme (GBM is one of the most deadly cancers in humans. Despite recent advances in anti-cancer therapies, most patients with GBM die from local disease progression. Fluorescence image guided surgical resection (FIGR was recently advocated to enhance local control of GBM. This is meta-analyses of 5-aminolevulinic (5-ALA induced FIGR. Materials: Review of the literature produced 503 potential publications; only 20 of these fulfilled the inclusion criteria of this analysis, including a total of 565 patients treated with 5-ALA-FIGR reporting on its outcomes and 800 histological samples reporting 5-ALA-FIGR sensitivity and specificity. Results: The mean gross total resection (GTR rate was 75.4% (95% CI: 67.4–83.5, p < 0.001. The mean time to tumor progression (TTP was 8.1 months (95% CI: 4.7–12, p < 0.001. The mean overall survival gain reported was 6.2 months (95% CI: −1–13, p < 0.001. The specificity was 88.9% (95% CI: 83.9–93.9, p < 0.001 and the sensitivity was 82.6% (95% CI: 73.9–91.9, p < 0.001. Conclusion: 5-ALA-FIGR in GBM is highly sensitive and specific, and imparts significant benefits to patients in terms of improved GTR and TTP.

  14. Infrared Thermography in Surgery of Newly Diagnosed Glioblastoma Multiforme: A Technical Case Report

    Directory of Open Access Journals (Sweden)

    Emanuil Naydenov

    2017-04-01

    Full Text Available Infrared thermography (IRT is a real-time non-contact diagnostic tool with a broad potential for neurosurgical applications. Here we describe the intraoperative use of this technique in a single patient with newly diagnosed glioblastoma multiforme (GBM. An 86-year-old female was admitted in the clinic with a 2-month history of slowly progressing left-sided paresis. Neuroimaging studies demonstrated an irregular space-occupying process consistent with a malignant glioma in the right fronto-temporo-insular region. An elective surgical intervention was performed by using 5-aminolevulinic acid fluorescence (BLUE 400, OPMI and intraoperative IRT brain mapping (LWIR, 1.25 mRad IFOV, 0.05°C NETD. After dura opening, the cerebral surface appeared inconspicuous. However, IRT revealed a significantly colder area (Δt° 1.01°C, well corresponding to the cortical epicenter of the lesion. The underlying tumor was partially excised and the histological result was GBM. Intraoperative IRT seems to be a useful technique for subcortical convexity brain tumor localization. Further studies with a large number of patients are needed to prove the reliability of this method in GBM surgery.

  15. Infrared Thermography in Surgery of Newly Diagnosed Glioblastoma Multiforme: A Technical Case Report.

    Science.gov (United States)

    Naydenov, Emanuil; Minkin, Krasimir; Penkov, Marin; Nachev, Sevdalin; Stummer, Walter

    2017-01-01

    Infrared thermography (IRT) is a real-time non-contact diagnostic tool with a broad potential for neurosurgical applications. Here we describe the intraoperative use of this technique in a single patient with newly diagnosed glioblastoma multiforme (GBM). An 86-year-old female was admitted in the clinic with a 2-month history of slowly progressing left-sided paresis. Neuroimaging studies demonstrated an irregular space-occupying process consistent with a malignant glioma in the right fronto-temporo-insular region. An elective surgical intervention was performed by using 5-aminolevulinic acid fluorescence (BLUE 400, OPMI) and intraoperative IRT brain mapping (LWIR, 1.25 mRad IFOV, 0.05°C NETD). After dura opening, the cerebral surface appeared inconspicuous. However, IRT revealed a significantly colder area (Δt° 1.01°C), well corresponding to the cortical epicenter of the lesion. The underlying tumor was partially excised and the histological result was GBM. Intraoperative IRT seems to be a useful technique for subcortical convexity brain tumor localization. Further studies with a large number of patients are needed to prove the reliability of this method in GBM surgery.

  16. Differentiation between progression and pseudoprogresion by arterial spin labeling MRI in patients with glioblastoma multiforme.

    Science.gov (United States)

    Jovanovic, Marija; Radenkovic, Sandra; Stosic-Opincal, Tatjana; Lavrnic, Slobodan; Gavrilovic, Svetlana; Lazovic-Popovic, Biljana; Soldatovic, Ivan; Maksimovic, Ruzica

    2017-01-01

    To compare arterial spin labeling (ASL) perfusion technique with the clinically established dynamic susceptibility contrast-enhanced (DSC) perfusion weighted-imaging (PWI), and to determine its value in routine MRI evaluation of disease progression in patients with glioblastoma multiforme (GBM). A prospective intraindividual study was performed in 31 patients with histologically proven GBM who had clinical and/or radiological deterioration after treatment, including surgery, radiotherapy and therapy with temozolomide. Conventional brain protocol with ASL and DSC techniques was performed on 3T MRI unit. Cerebral blood flow (CBF) and cerebral blood volume (CBV) maps were analyzed by means of regions of interest (ROI). Each ROI average value was normalized to the contralateral normal brain parenchyma ROI value. Neuroradiologists analyzed CBF and CBV maps separately, and classified patients into progression or pseudoprogression group. Radiological diagnosis was confirmed by clinical-radiological follow-up for at least three months after patient deterioration. High linear correlation existed between DSC-PWI and ASL in the tumor ROI (r=0.733; p<0.001). 92% of ASL CBF maps were informative. ASL detected all lesions as well as DSC MRI. Both techniques provided perfusion values closely correlated. ASL allows distinction between GBM progression and pseudoprogression, and it can be used as reliable alternative to DSC-PWI.

  17. Connection between cell phone use, p53 gene expression in different zones of glioblastoma multiforme and survival prognoses

    Directory of Open Access Journals (Sweden)

    Reza Akhavan-Sigari

    2014-08-01

    Full Text Available The aim of this paper is to investigate p53 gene expression in the central and peripheral zones of glioblastoma multiforme using a real-time reverse transcription polymerase chain reaction (RT-PCR technique in patients who use cell phones ≥3 hours a day and determine its relationship to clinicopathological findings and overall survival. Sixty-three patients (38 males and 25 females, diagnosed with glioblastoma multiforme (GBM, underwent tumor resection between 2008 and 2011. Patient ages ranged from 25 to 88 years, with a mean age of 55. The levels of expression of p53 in the central and peripheral zone of the GBM were quantified by RT-PCR. Data on p53 gene expression from the central and peripheral zone, the related malignancy and the clinicopatholagical findings (age, gender, tumor location and size, as well as overall survival, were analyzed. Forty-one out of 63 patients (65% with the highest level of cell phone use (≥3 hours/day had higher mutant type p53 expression in the peripheral zone of the glioblastoma; the difference was statistically significant (P=0.034. Results from the present study on the use of mobile phones for ≥3 hours a day show a consistent pattern of increased risk for the mutant type of p53 gene expression in the peripheral zone of the glioblastoma, and that this increase was significantly correlated with shorter overall survival time. The risk was not higher for ipsilateral exposure. We found that the mutant type of p53 gene expression in the peripheral zone of the glioblastoma was increased in 65% of patients using cell phones ≥3 hours a day.

  18. Results of the phase I dose-escalating study of motexafin gadolinium with standard radiotherapy in patients with glioblastoma multiforme.

    Science.gov (United States)

    Ford, Judith M; Seiferheld, Wendy; Alger, Jeffrey R; Wu, Genevieve; Endicott, Thyra J; Mehta, Minesh; Curran, Walter; Phan, See-Chun

    2007-11-01

    Motexafin gadolinium (MGd) is a putative radiation enhancer initially evaluated in patients with brain metastases. This Phase I trial studied the safety and tolerability of a 2-6-week course (10-22 doses) of MGd with radiotherapy for glioblastoma multiforme. A total of 33 glioblastoma multiforme patients received one of seven MGd regimens starting at 10 doses of 4 mg/kg/d MGd and escalating to 22 doses of 5.3 mg/kg/d MGd (5 or 10 daily doses then three times per week). The National Cancer Institute Cancer Therapy Evaluation Program toxicity and stopping rules were applied. The maximal tolerated dose was 5.0 mg/kg/d MGd (5 d/wk for 2 weeks, then three times per week) for 22 doses. The dose-limiting toxicity was reversible transaminase elevation. Adverse reactions included rash/pruritus (45%), chills/fever (30%), and self-limiting vesiculobullous rash of the thumb and fingers (42%). The median survival of 17.6 months prompted a case-matched analysis. In the case-matched analysis, the MGd patients had a median survival of 16.1 months (n = 31) compared with the matched Radiation Therapy Oncology Group database patients with a median survival of 11.8 months (hazard ratio, 0.43; 95% confidence interval, 0.20-0.94). The maximal tolerated dose of MGd with radiotherapy for glioblastoma multiforme in this study was 5 mg/kg/d for 22 doses (daily for 2 weeks, then three times weekly). The baseline survival calculations suggest progression to Phase II trials is appropriate, with the addition of MGd to radiotherapy with concurrent and adjuvant temozolomide.

  19. The suppression of manganese superoxide dismutase decreased the survival of human glioblastoma multiforme T98G cells

    Directory of Open Access Journals (Sweden)

    Novi S. Hardiany

    2017-05-01

    Full Text Available Background: Glioblastoma multiforme (GBM is a primary malignant brain tumor which has poor prognosis. High incidence of oxidative stress-based therapy resistance could be related to the high antioxidant status of GBM cells. Our previous study has reported that manganese superoxide dismutase (MnSOD antioxidant expression was significantly higher in high grade glioma than in low grade. The aim of this study was to analyze the impact of MnSOD suppression toward GBM cell survival.Methods: This study is an experimental study using human glioblastoma multiforme T98G cell line. Suppression of MnSOD expression was performed using in vitro transfection MnSOD-siRNA. The MnSOD expression was analyzed by measuring the mRNA using real time RT-PCR, protein using ELISA technique, and specific activity of enzyme using inhibition of xantine oxidase. Concentration of reactive oxygen species (ROS intracellular was determined by measuring superoxide radical and hydrogen peroxide. Cell survival was analyzed by measuring viability, proliferation, and cell apoptosis.Results: In vitro transfection of MnSOD-siRNA suppressed the mRNA, protein, and specific activity of MnSOD. This treatment significantly increased the concentration of superoxide radical; however, it did not influence the concentration of hydrogen peroxide. Moreover, viability MnSOD-suppressing cell significantly decreased, accompanied by increase of cell apoptosis without affecting cell proliferation.Conclusion: The suppression of MnSOD expression leads to decrease glioblastoma multiforme cell survival, which was associated to the increase of cell apoptotic.

  20. Boron neutron capture therapy (BNCT) for glioblastoma multiforme using the epithermal neutron beam at the Brookhaven Medical Research Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Capala, J. [Brookhaven National Lab., Upton, NY (United States); Diaz, A.Z.; Chadha, M. [Univ. Hospital, State Univ. of New York, NY (United States)] [and others

    1997-12-31

    The abstract describes evaluation of boron neutron capture therapy (BNCT) for two groups of glioblastoma multiforme patients. From September 1994 to February 1996 15 patients have been treated. In September 1997 another 34 patients were examined. Authors determined a safe starting dose for BNCT using epithermal neutrons and BPA-F. They have also evaluated adverse effects of BNCT at this starting dose. Therapeutic effectiveness of this starting dose has been evaluated. No significant side effects from BPA-F infusion or BNCT treatment were observed in normal brains.

  1. Myelin structure is a key difference in the x-ray scattering signature between meningioma, schwannoma and glioblastoma multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Falzon, G [Physics and Electronics, School of Biological, Biomedical and Molecular Sciences, University of New England, Armidale, NSW 2351 (Australia); Pearson, S [Physics and Electronics, School of Biological, Biomedical and Molecular Sciences, University of New England, Armidale, NSW 2351 (Australia); Murison, R [School of Mathematics, Statistics and Computer Science, University of New England, Armidale, NSW 2351 (Australia); Hall, C [School of Physics, Monash University, Victoria 3800 (Australia); Siu, K [School of Physics, Monash University, Victoria 3800 (Australia); Round, A [European Molecular Biology Laboratory, Hamburg Outstation, Notkestrasse 85, 22603 Hamburg (Germany); Schueltke, E [Division of Neurosurgery, University of Sakatchewan, Saskatoon S7N 5E5 (Canada); Kaye, A H [Department of Surgery, University of Melbourne, Parkville, 3050 (Australia); Lewis, R [Monash Centre for Synchrotron Science, Monash University, Victoria 3800 (Australia)

    2007-11-07

    Small angle x-ray scattering (SAXS) patterns of benign and malignant brain tumour tissue were examined. Independent component analysis was used to find a feature set representing the images collected. A set of coefficients was then used to describe each image, which allowed the use of the statistical technique of flexible discriminant analysis to discover a hidden order in the data set. The key difference was found to be in the intensity and spectral content of the second and fourth order myelin scattering peaks. This has clearly demonstrated that significant differences in the structure of myelin exist in the highly malignant glioblastoma multiforme as opposed to the benign: meningioma and schwannoma.

  2. The Na, K-ATPase β-Subunit Isoforms Expression in Glioblastoma Multiforme: Moonlighting Roles

    Science.gov (United States)

    Rotoli, Deborah; Cejas, Mariana-Mayela; Maeso, María-del-Carmen; Pérez-Rodríguez, Natalia-Dolores; Morales, Manuel; Ávila, Julio

    2017-01-01

    Glioblastoma multiforme (GBM) is the most common form of malignant glioma. Recent studies point out that gliomas exploit ion channels and transporters, including Na, K-ATPase, to sustain their singular growth and invasion as they invade the brain parenchyma. Moreover, the different isoforms of the β-subunit of Na, K-ATPase have been implicated in regulating cellular dynamics, particularly during cancer progression. The aim of this study was to determine the Na, K-ATPase β subunit isoform subcellular expression patterns in all cell types responsible for microenvironment heterogeneity of GBM using immunohistochemical analysis. All three isoforms, β1, β2/AMOG (Adhesion Molecule On Glia) and β3, were found to be expressed in GBM samples. Generally, β1 isoform was not expressed by astrocytes, in both primary and secondary GBM, although other cell types (endothelial cells, pericytes, telocytes, macrophages) did express this isoform. β2/AMOG and β3 positive expression was observed in the cytoplasm, membrane and nuclear envelope of astrocytes and GFAP (Glial Fibrillary Acidic Protein) negative cells. Interestingly, differences in isoforms expression have been observed between primary and secondary GBM: in secondary GBM, β2 isoform expression in astrocytes was lower than that observed in primary GBM, while the expression of the β3 subunit was more intense. These changes in β subunit isoforms expression in GBM could be related to a different ionic handling, to a different relationship between astrocyte and neuron (β2/AMOG) and to changes in the moonlighting roles of Na, K-ATPase β subunits as adaptor proteins and transcription factors. PMID:29117147

  3. Glioblastoma Multiforme Cancer Stem Cells Express Components of the Renin-Angiotensin System

    Directory of Open Access Journals (Sweden)

    Amy Ruth Bradshaw

    2016-09-01

    Full Text Available Aim To investigate the expression of the renin-angiotensin system (RAS in cancer stem cells (CSCs we have previously characterized in glioblastoma multiforme (GBM.Methods 3,3-Diaminobenzidine (DAB immunohistochemical (IHC staining for the stem cell marker, SOX2 and components of the RAS: angiotensin converting enzyme (ACE, (prorenin receptor (PRR, angiotensin II receptor 1 (ATIIR1 and receptor 2 (ATIIR2 on 4μm-thick formalin-fixed paraffin-embedded sections of previously characterized GBM samples in six patients was undertaken. Immunofluorescent (IF IHC staining was performed to demonstrate expression of GFAP, SOX2, PRR, ACE, ATIIR1 and ATIIR2. The protein expression and the transcriptional activities of the genes encoding for ACE, PRR, ATIIR1 and ATIIR2 were studied using Western blotting (WB and NanoString gene expression analysis, respectively. Results DAB and IF IHC staining demonstrated the expression SOX2 on the GFAP+ GBM CSCs. Cytoplasmic expression of PRR by the GFAP+ CSCs and the endothelium of the microvessels was observed. ACE was expressed on the endothelium of the microvessels only, while nuclear and cytoplasmic expression of ATIIR1 and ATIIR2 was observed on the endothelium of the microvessels and the CSCs. ATIIR1 was expressed on the GFAP+ CSCs cells and ATIIR2 was expressed by the SOX2+ CSCs. The expression of ACE, PRR and ATIIR1, but not ATIIR2 was confirmed by WB. NanoString gene analysis demonstrated transcriptional activation of ACE, PRR and ATIIR1, but not ATIIR2. Conclusion This study demonstrated the expression of PRR, ATIIR1 and ATIIR2 by the SOX2 CSC population, and ACE on the endothelium of the microvessels, within GBM. ACE, PRR and ATIIR1 were expressed at the protein and mRNA levels, with ATIIR2 detectable only by IHC staining. This novel finding suggests the CSCs may be a novel therapeutic target for GBM by modulation of the RAS.

  4. [Clinical, histopathological and cytogenetical findings in six cases with primary glioblastoma multiforme].

    Science.gov (United States)

    Naydenov, E; Tzekov, Chr; Minkin, K; Hadjidekova, S; Dimova, I; Nachev, S; Bussarsky, V; Romansky, K; Toncheva, D

    2009-01-01

    Glioblastoma multiforme (GBM) is the most common malignant primary brain tumor. There is an increasing amount of data demonstrating that the routine histological examination has limited value to predict the tumor biological behaviour. To compare the clinical, histological and cytogenetical findings in a group of six patients with primary GBM surgically treated in the Department of Neurosurgery at University Hospital "St. Ivan Rilski"- Sofia, Bulgaria. The studied group consisted of three women and three men with average age of 51 years and 6 months. In all patients the diagnosis was histologically confirmed. A microarray comparative genomic hybridization (CGH) analysis of fresh-frozen tumor tissue samples was also made. In two of the patients the tumor was localized in frontotemporal region, in another two- in frontoparietal, and in the other two- in parietal and occipital respectively. The onset was with headache in three of the cases. The median time between the onset and admission in the clinic was 70 days. Gross-total tumor removal was performed in one patient. In the other five subtotal excision was made. Three of the patients improved after the intervention. One patient deteriorated after the surgery. All patients demonstrated typical histological findings except one who had giant cell subtype of GBM. The microarray CGH analysis determined chromosome 10 monosomy in five patients, trisomy 7 - in four, trisomy 20 - in three, 3q23 deletion - in three, and Yp11.2 deletion - in three. GBMs are genetically heterogeneous tumors with different clinical response to standard multimodal treatment regimens. The microarray CGH analysis is a powerful method which can demonstrate the presence of a number of molecular markers with possible predictive value.

  5. Integrative analysis of micro-RNA, gene expression, and survival of glioblastoma multiforme.

    Science.gov (United States)

    Huang, Yen-Tsung; Hsu, Thomas; Kelsey, Karl T; Lin, Chien-Ling

    2015-02-01

    Glioblastoma multiforme (GBM), the most common type of malignant brain tumor, is highly fatal. Limited understanding of its rapid progression necessitates additional approaches that integrate what is known about the genomics of this cancer. Using a discovery set (n = 348) and a validation set (n = 174) of GBM patients, we performed genome-wide analyses that integrated mRNA and micro-RNA expression data from GBM as well as associated survival information, assessing coordinated variability in each as this reflects their known mechanistic functions. Cox proportional hazards models were used for the survival analyses, and nonparametric permutation tests were performed for the micro-RNAs to investigate the association between the number of associated genes and its prognostication. We also utilized mediation analyses for micro-RNA-gene pairs to identify their mediation effects. Genome-wide analyses revealed a novel pattern: micro-RNAs related to more gene expressions are more likely to be associated with GBM survival (P = 4.8 × 10(-5)). Genome-wide mediation analyses for the 32,660 micro-RNA-gene pairs with strong association (false discovery rate [FDR] micro-RNAs and mediated their prognostic effects as well. We further constructed a gene signature using the 16 genes, which was highly associated with GBM survival in both the discovery and validation sets (P = 9.8 × 10(-6)). This comprehensive study discovered mediation effects of micro-RNA to gene expression and GBM survival and provided a new analytic framework for integrative genomics. © 2014 WILEY PERIODICALS, INC.

  6. Involvement of miRNAs in the differentiation of human glioblastoma multiforme stem-like cells.

    Directory of Open Access Journals (Sweden)

    Beatriz Aldaz

    Full Text Available Glioblastoma multiforme (GBM-initiating cells (GICs represent a tumor subpopulation with neural stem cell-like properties that is responsible for the development, progression and therapeutic resistance of human GBM. We have recently shown that blockade of NFκB pathway promotes terminal differentiation and senescence of GICs both in vitro and in vivo, indicating that induction of differentiation may be a potential therapeutic strategy for GBM. MicroRNAs have been implicated in the pathogenesis of GBM, but a high-throughput analysis of their role in GIC differentiation has not been reported. We have established human GIC cell lines that can be efficiently differentiated into cells expressing astrocytic and neuronal lineage markers. Using this in vitro system, a microarray-based high-throughput analysis to determine global expression changes of microRNAs during differentiation of GICs was performed. A number of changes in the levels of microRNAs were detected in differentiating GICs, including over-expression of hsa-miR-21, hsa-miR-29a, hsa-miR-29b, hsa-miR-221 and hsa-miR-222, and down-regulation of hsa-miR-93 and hsa-miR-106a. Functional studies showed that miR-21 over-expression in GICs induced comparable cell differentiation features and targeted SPRY1 mRNA, which encodes for a negative regulator of neural stem-cell differentiation. In addition, miR-221 and miR-222 inhibition in differentiated cells restored the expression of stem cell markers while reducing differentiation markers. Finally, miR-29a and miR-29b targeted MCL1 mRNA in GICs and increased apoptosis. Our study uncovers the microRNA dynamic expression changes occurring during differentiation of GICs, and identifies miR-21 and miR-221/222 as key regulators of this process.

  7. Radiation Therapy Dose Escalation for Glioblastoma Multiforme in the Era of Temozolomide

    Energy Technology Data Exchange (ETDEWEB)

    Badiyan, Shahed N.; Markovina, Stephanie; Simpson, Joseph R.; Robinson, Clifford G.; DeWees, Todd [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Tran, David D.; Linette, Gerry [Division of Medical Oncology, Department of Medicine, Washington University School of Medicine, St. Louis, Missouri (United States); Jalalizadeh, Rohan [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Dacey, Ralph; Rich, Keith M.; Chicoine, Michael R.; Dowling, Joshua L.; Leuthardt, Eric C.; Zipfel, Gregory J.; Kim, Albert H. [Department of Neurosurgery, Washington University School of Medicine, St. Louis, Missouri (United States); Huang, Jiayi, E-mail: jhuang@radonc.wustl.edu [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States)

    2014-11-15

    Purpose: To review clinical outcomes of moderate dose escalation using high-dose radiation therapy (HDRT) in the setting of concurrent temozolomide (TMZ) in patients with newly diagnosed glioblastoma multiforme (GBM), compared with standard-dose radiation therapy (SDRT). Methods and Materials: Adult patients aged <70 years with biopsy-proven GBM were treated with SDRT (60 Gy at 2 Gy per fraction) or with HDRT (>60 Gy) and TMZ from 2000 to 2012. Biological equivalent dose at 2-Gy fractions was calculated for the HDRT assuming an α/β ratio of 5.6 for GBM. Results: Eighty-one patients received SDRT, and 128 patients received HDRT with a median (range) biological equivalent dose at 2-Gy fractions of 64 Gy (61-76 Gy). Overall median follow-up time was 1.10 years, and for living patients it was 2.97 years. Actuarial 5-year overall survival (OS) and progression-free survival (PFS) rates for patients that received HDRT versus SDRT were 12.4% versus 13.2% (P=.71), and 5.6% versus 4.1% (P=.54), respectively. Age (P=.001) and gross total/near-total resection (GTR/NTR) (P=.001) were significantly associated with PFS on multivariate analysis. Younger age (P<.0001), GTR/NTR (P<.0001), and Karnofsky performance status ≥80 (P=.001) were associated with improved OS. On subset analyses, HDRT failed to improve PFS or OS for those aged <50 years or those who had GTR/NTR. Conclusion: Moderate radiation therapy dose escalation above 60 Gy with concurrent TMZ does not seem to improve clinical outcomes for patients with GBM.

  8. New insights into the genetics of glioblastoma multiforme by familial exome sequencing.

    Science.gov (United States)

    Backes, Christina; Harz, Christian; Fischer, Ulrike; Schmitt, Jana; Ludwig, Nicole; Petersen, Britt-Sabina; Mueller, Sabine C; Kim, Yoo-Jin; Wolf, Nadine M; Katus, Hugo A; Meder, Benjamin; Furtwängler, Rhoikos; Franke, Andre; Bohle, Rainer; Henn, Wolfram; Graf, Norbert; Keller, Andreas; Meese, Eckart

    2015-03-20

    Glioblastoma multiforme (GBM) is the most aggressive and malignant subtype of human brain tumors. While a family clustering of GBM has long been acknowledged, relevant hereditary factors still remained elusive. Exome sequencing of families offers the option to discover respective genetic factors.We sequenced blood samples of one of the rare affected families: while both parents were healthy, both children were diagnosed with GBM. We report 85 homozygous non-synonymous single nucleotide variations (SNVs) in both siblings that were heterozygous in the parents. Beyond known key players for GBM such as ERBB2, PMS2, or CHI3L1, we identified over 50 genes that have not been associated to GBM so far. We also discovered three accumulative effects potentially adding to the tumorigenesis in the siblings: a clustering of multiple variants in single genes (e.g., PTPRB, CROCC), the aggregation of affected genes on specific molecular pathways (e.g., Focal adhesion or ECM receptor interaction) and genomic proximity (e.g., chr22.q12.2, chr1.p36.33). We found a striking accumulation of SNVs in specific genes for the daughter, who developed not only a GBM at the age of 12 years but was subsequently diagnosed with a pilocytic astrocytoma, a common acute lymphatic leukemia and a diffuse pontine glioma.The reported variants underline the relevance of genetic predisposition and cancer development in this family and demonstrate that GBM has a complex and heterogeneous genetic background. Sequencing of other affected families will help to further narrow down the driving genetic causes for this disease.

  9. Partial correlation analyses of global diffusion tensor imaging-derived metrics in glioblastoma multiforme: Pilot study

    Science.gov (United States)

    Cortez-Conradis, David; Rios, Camilo; Moreno-Jimenez, Sergio; Roldan-Valadez, Ernesto

    2015-01-01

    AIM: To determine existing correlates among diffusion tensor imaging (DTI)-derived metrics in healthy brains and brains with glioblastoma multiforme (GBM). METHODS: Case-control study using DTI data from brain magnetic resonance imaging of 34 controls (mean, 41.47; SD, ± 21.94 years; range, 21-80 years) and 27 patients with GBM (mean, SD; 48.41 ± 15.18 years; range, 18-78 years). Image postprocessing using FSL software calculated eleven tensor metrics: fractional (FA) and relative anisotropy; pure isotropic (p) and anisotropic diffusions (q), total magnitude of diffusion (L); linear (Cl), planar (Cp) and spherical tensors (Cs); mean (MD), axial (AD) and radial diffusivities (RD). Partial correlation analyses (controlling the effect of age and gender) and multivariate Mancova were performed. RESULTS: There was a normal distribution for all metrics. Comparing healthy brains vs brains with GBM, there were significant very strong bivariate correlations only depicted in GBM: [FA↔Cl (+)], [FA↔q (+)], [p↔AD (+)], [AD↔MD (+)], and [MD↔RD (+)]. Among 56 pairs of bivariate correlations, only seven were significantly different. The diagnosis variable depicted a main effect [F-value (11, 23) = 11.842, P ≤ 0.001], with partial eta squared = 0.850, meaning a large effect size; age showed a similar result. The age also had a significant influence as a covariate [F (11, 23) = 10.523, P < 0.001], with a large effect size (partial eta squared = 0.834). CONCLUSION: DTI-derived metrics depict significant differences between healthy brains and brains with GBM, with specific magnitudes and correlations. This study provides reference data and makes a contribution to decrease the underlying empiricism in the use of DTI parameters in brain imaging. PMID:26644826

  10. Quality of radiomic features in glioblastoma multiforme: Impact of semi-automated tumor segmentation software

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Myung Eun; Kim, Jong Hyo [Center for Medical-IT Convergence Technology Research, Advanced Institutes of Convergence Technology, Seoul National University, Suwon (Korea, Republic of); Woo, Bo Yeong [Dept. of Transdisciplinary Studies, Graduate School of Convergence Science and Technology, Seoul National University, Suwon (Korea, Republic of); Ko, Micheal D.; Jamshidi, Neema [Dept. of Radiological Sciences, University of California, Los Angeles, Los Angeles (United States)

    2017-06-15

    The purpose of this study was to evaluate the reliability and quality of radiomic features in glioblastoma multiforme (GBM) derived from tumor volumes obtained with semi-automated tumor segmentation software. MR images of 45 GBM patients (29 males, 16 females) were downloaded from The Cancer Imaging Archive, in which post-contrast T1-weighted imaging and fluid-attenuated inversion recovery MR sequences were used. Two raters independently segmented the tumors using two semi-automated segmentation tools (TumorPrism3D and 3D Slicer). Regions of interest corresponding to contrast-enhancing lesion, necrotic portions, and non-enhancing T2 high signal intensity component were segmented for each tumor. A total of 180 imaging features were extracted, and their quality was evaluated in terms of stability, normalized dynamic range (NDR), and redundancy, using intra-class correlation coefficients, cluster consensus, and Rand Statistic. Our study results showed that most of the radiomic features in GBM were highly stable. Over 90% of 180 features showed good stability (intra-class correlation coefficient [ICC] ≥ 0.8), whereas only 7 features were of poor stability (ICC < 0.5). Most first order statistics and morphometric features showed moderate-to-high NDR (4 > NDR ≥1), while above 35% of the texture features showed poor NDR (< 1). Features were shown to cluster into only 5 groups, indicating that they were highly redundant. The use of semi-automated software tools provided sufficiently reliable tumor segmentation and feature stability; thus helping to overcome the inherent inter-rater and intra-rater variability of user intervention. However, certain aspects of feature quality, including NDR and redundancy, need to be assessed for determination of representative signature features before further development of radiomics.

  11. Magnetic resonance imaging in 67 cases of glioblastoma multiform and occurrence of metastases; Estudo atraves da ressonancia magnetica de 67 casos de glioblastoma multiforme e a ocorrencia de metastases

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Nelson Fortes; Barbosa, Marcelo; Amaral, Lazaro L. Faria do; Mendonca, Renato Adam; Lima, Sergio Santos [Hospital Beneficencia Portuguesa de Sao Paulo, SP (Brazil). Med Imagem]. E-mail: neldiz@hotmail.com

    2004-09-01

    The purpose of this paper is to demonstrate the main MRI characteristics of glioblastoma multiform (GBM), the most common CNS primary tumor, emphasizing its location and the occurrence of metastases. The MR imaging of 67 pathologically proven cases of glioblastoma multiform were retrospectively reviewed. The exams were realized in the period between 1995 and 2003, in one of three 1.5 Signa GE units (Milwaukee, WI). The ages of the patients ranged from 4 years to 86 years, mean 60 years, and the occurrence of the tumor was preponderant among men, with 39 cases (58%). The most common location was in the frontal lobes (47%) followed by the temporal lobes (18%) and the parietal lobes (16%). In 19% of the cases there were involvement of more than one site and long distance metastases were seen in 22% of the patients. According to the literature, the most common location of GBM was in the frontal lobe of older than 50 years old men. Metastases occurred in 22% of our cases. (author)

  12. Columbia University: Computational Human High-grade Glioblastoma Multiforme Interactome - miRNA (Post-transcriptional) Layer | Office of Cancer Genomics

    Science.gov (United States)

    The Human High-Grade Glioma Interactome (HGi) contains a genome-wide complement of molecular interactions that are Glioblastoma Multiforme (GBM)-specific. HGi v3 contains the post-transcriptional layer of the HGi, which includes the miRNA-target (RNA-RNA) layer of the interactome. Read the Abstract

  13. Microscopic thrombi in glioblastoma multiforme do not predict the development of deep venous thrombosis.

    Science.gov (United States)

    Prayson, Nicholas F; Angelov, Lilyana; Prayson, Richard A

    2009-10-01

    Patients with glioblastoma multiforme (GBM) are known to be at risk for hypercoagulable events. Tumoral intravascular thrombi likely contribute to the development of hypoxia and necrosis. The purpose of this study was to assess whether there is a relationship between the number of thrombi identified microscopically at the time of tumor resection and the subsequent development of extremity deep venous thrombosis (DVT). A retrospective review of 96 patients (53 men and 43 women; age range, 21-92 years; mean age, 60.2 years) with GBM (World Health Organization grade IV) was carried out. Thrombi were counted (number of thrombi/blood vessels evaluated/10 high-power fields) in nonnecrotic areas of the resected tumor and correlated with a variety of clinical and pathological parameters, including the development of postoperative DVT, as detected by extremity ultrasound. Thrombi were identified in the resected GBM in 66 (69%) patients. Of the tumors with thrombi, the percentage of blood vessels with thrombi ranged from 1.1% to 42.9% (mean, 10.7%). Deep venous thrombosis was discovered in 30 (31.3%) patients. There was no correlation between the number of microscopic thrombi and the development of DVT. Eighty-one patients died of tumor (survival, 1-66 months; mean, 11.0 months), 12 patients were alive at last known follow-up (mean, 23 months), and 3 patients were lost to follow-up. Of patients with DVT, 27 patients died of tumor (survival, 1-47 months; mean, 11.0 months), 3 patients were alive (18, 20, and 21 months), and 1 patient was lost to follow-up. There was no correlation between the number of microscopic thrombi and the percentage of resected tumor that was necrotic (range, thrombi vs 11.5 months in patients with thrombi). Microscopic thrombi were identified in about two thirds (69%) of patients with GBM, and DVT developed in about one third (31.3%) of patients with GBM. There was no correlation between the number of microscopic thrombi and the subsequent

  14. Phase II Trial of Hypofractionated IMRT With Temozolomide for Patients With Newly Diagnosed Glioblastoma Multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, Krishna [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado (United States); Damek, Denise [Department of Neurology, University of Colorado School of Medicine, Aurora, Colorado (United States); Gaspar, Laurie E. [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado (United States); Ney, Douglas [Department of Neurology, University of Colorado School of Medicine, Aurora, Colorado (United States); Waziri, Allen; Lillehei, Kevin [Department of Neurosurgery, University of Colorado School of Medicine, Aurora, Colorado (United States); Stuhr, Kelly; Kavanagh, Brian D. [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado (United States); Chen Changhu, E-mail: changhu.chen@ucdenver.edu [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado (United States)

    2012-11-01

    Purpose: To report toxicity and overall survival (OS) in patients with newly diagnosed glioblastoma multiforme (GBM) treated with hypofractionated intensity-modulated radiotherapy (hypo-IMRT) with concurrent and adjuvant temozolomide (TMZ). Methods and Materials: Patients with newly diagnosed GBM after biopsy or resection and with adequate performance status and organ or bone marrow function were eligible for this study. Patients received postoperative hypo-IMRT to the surgical cavity and residual tumor seen on T1-weighted brain MRI with a 5-mm margin to a total dose of 60 Gy in 10 fractions (6 Gy/fraction) and to the T2 abnormality on T2-weighted MRI with 5-mm margin to 30 Gy in 10 fractions (3 Gy/fraction). Concurrent TMZ was given at 75 mg/m{sup 2}/day for 28 consecutive days. Adjuvant TMZ was given at 150 to 200 mg/m{sup 2}/day for 5 days every 28 days. Toxicities were defined using Common Terminology Criteria for Adverse Events version 3.0. Results: Twenty-four patients were treated, consisting of 14 men, 10 women; a median age of 60.5 years old (range, 27-77 years); and a median Karnofsky performance score of 80 (range, 60-90). All patients received hypo-IMRT and concurrent TMZ according to protocol, except for 2 patients who received only 14 days of concurrent TMZ. The median number of adjuvant TMZ cycles was 6.5 (range, 0-14).With a median follow-up of 14.8 months (range, 2.7-34.2 months) for all patients and a minimum follow-up of 20.6 months for living patients, no instances of grade 3 or higher nonhematologic toxicity were observed. The median OS was 16.6 months (range, 4.1-35.9 months). Six patients underwent repeated surgery for suspected tumor recurrence; necrosis was found in 50% to 100% of the resected specimens. Conclusion: In selected GBM patients, 60 Gy hypo-IMRT delivered in 6-Gy fractions over 2 weeks with concurrent and adjuvant TMZ is safe. OS in this small cohort of patients was comparable to that treated with current standard of care

  15. {sup 23}Na-MRI of recurrent glioblastoma multiforme after intraoperative radiotherapy: technical note

    Energy Technology Data Exchange (ETDEWEB)

    Haneder, Stefan; Buesing, Karen A.; Schoenberg, Stefan O.; Ong, Melissa M. [Heidelberg University, Institute of Clinical Radiology and Nuclear Medicine, University Medical Center Mannheim, Medical Faculty Mannheim, Mannheim (Germany); Giordano, Frank A.; Wenz, Frederik [University of Heidelberg, Department of Radiation Oncology, University Medical Center Mannheim, Mannheim (Germany); Konstandin, Simon; Schad, Lothar R. [Heidelberg University, Computer Assisted Clinical Medicine, Mannheim (Germany); Brehmer, Stefanie; Schmiedek, Peter [Heidelberg University, Department of Neurosurgery, University Medical Center Mannheim, Mannheim (Germany)

    2015-03-01

    We report the first case of an intraoperative radiotherapy (IORT) in a patient with recurrent glioblastoma multiforme (GBM) who was followed up with a novel magnetic resonance imaging (MRI) method - {sup 23}Na-MRI - in comparison to a standard contrast-enhanced {sup 1}H-MRI and {sup 18}F-FET-PET. A 56-year-old female patient with diagnosed GBM in July 2012 underwent tumor resection, radiochemotherapy, and three cycles of chemotherapy. After a relapse, 6 months after the initial diagnosis, an IORT was recommended which was performed in March 2013 using the INTRABEAM system (Carl Zeiss Meditec AG, Germany) with a 3-cm applicator and a surface dose of 20 Gy. Early post-operative contrast-enhanced and 1-month follow-up {sup 1}H-MRI and a {sup 18}F-FET-PET were performed. In addition, an IRB-approved {sup 23}Na-MRI was performed on a 3.0-T MR scanner (MAGNETOM TimTrio, Siemens Healthcare, Germany). After re-surgery and IORT in March 2013, only a faint contrast enhancement but considerable surrounding edema was visible at the medio-posterior resection margins. In April 2013, new and progressive contrast enhancement, edema, {sup 23}Na content, and increased uptake in the {sup 18}F-FET-PET were visible, indicating tumor recurrence. Increased sodium content within the area of contrast enhancement was found in the {sup 23}Na-MRI, but also exceeding this area, very similar to the increased uptake depicted in the {sup 18}F-FET-PET. The clearly delineable zone of edema in both examinations exhibits a lower {sup 23}Na content compared to areas with suspected proliferating tumor tissue. {sup 23}Na-MRI provided similar information in the suspicious area compared to {sup 18}F-FET-PET, exceeding conventional {sup 1}H-MRI. Still, {sup 23}Na-MRI remains an investigational technique, which is worth to be further evaluated. (orig.)

  16. Classifying Glioblastoma Multiforme Follow-Up Progressive vs. Responsive Forms Using Multi-Parametric MRI Features.

    Science.gov (United States)

    Ion-Mărgineanu, Adrian; Van Cauter, Sofie; Sima, Diana M; Maes, Frederik; Sunaert, Stefan; Himmelreich, Uwe; Van Huffel, Sabine

    2016-01-01

    Purpose: The purpose of this paper is discriminating between tumor progression and response to treatment based on follow-up multi-parametric magnetic resonance imaging (MRI) data retrieved from glioblastoma multiforme (GBM) patients. Materials and Methods: Multi-parametric MRI data consisting of conventional MRI (cMRI) and advanced MRI [i.e., perfusion weighted MRI (PWI) and diffusion kurtosis MRI (DKI)] were acquired from 29 GBM patients treated with adjuvant therapy after surgery. We propose an automatic pipeline for processing advanced MRI data and extracting intensity-based histogram features and 3-D texture features using manually and semi-manually delineated regions of interest (ROIs). Classifiers are trained using a leave-one-patient-out cross validation scheme on complete MRI data. Balanced accuracy rate (BAR)-values are computed and compared between different ROIs, MR modalities, and classifiers, using non-parametric multiple comparison tests. Results: Maximum BAR-values using manual delineations are 0.956, 0.85, 0.879, and 0.932, for cMRI, PWI, DKI, and all three MRI modalities combined, respectively. Maximum BAR-values using semi-manual delineations are 0.932, 0.894, 0.885, and 0.947, for cMRI, PWI, DKI, and all three MR modalities combined, respectively. After statistical testing using Kruskal-Wallis and post-hoc Dunn-Šidák analysis we conclude that training a RUSBoost classifier on features extracted using semi-manual delineations on cMRI or on all MRI modalities combined performs best. Conclusions: We present two main conclusions: (1) using T1 post-contrast (T1pc) features extracted from manual total delineations, AdaBoost achieves the highest BAR-value, 0.956; (2) using T1pc-average, T1pc-90th percentile, and Cerebral Blood Volume (CBV) 90th percentile extracted from semi-manually delineated contrast enhancing ROIs, SVM-rbf, and RUSBoost achieve BAR-values of 0.947 and 0.932, respectively. Our findings show that AdaBoost, SVM-rbf, and RUSBoost

  17. The future role of personalized medicine in the treatment of glioblastoma multiforme

    Directory of Open Access Journals (Sweden)

    Jing Li

    2010-08-01

    Full Text Available Jing Li1,2, Chunhui Di1,2, Austin K Mattox1,2, Linda Wu1,2, D Cory Adamson1,2,3,41Preston Robert Tisch Brain Tumor Center, Duke Medical Center, Durham, North Carolina, USA; 2Department of Surgery (Neurosurgery, Duke Medical Center, Durham, North Carolina, USA; 3Department of Neurobiology, Duke Medical Center, Durham, North Carolina, USA; 4Neurosurgery Section, Durham VA Medical Center, Durham, North Carolina, USAAbstract: Glioblastoma multiforme (GBM remains one of the most malignant primary central nervous system tumors. Personalized therapeutic approaches have not become standard of care for GBM, but science is fast approaching this goal. GBM’s heterogeneous genomic landscape and resistance to radiotherapy and chemotherapy make this tumor one of the most challenging to treat. Recent advances in genome-wide studies and genetic profiling show that there is unlikely to be a single genetic or cellular event that can be effectively targeted in all patients. Instead, future therapies will likely require personalization for each patient’s tumor genotype or proteomic profile. Over the past year, many investigations specifically focused simultaneously on strategies to target oncogenic pathways, angiogenesis, tumor immunology, epigenomic events, glioma stem cells (GSCs, and the highly migratory glioma cell population. Combination therapy targeting multiple pathways is becoming a fast growing area of research, and many studies put special attention on small molecule inhibitors. Because GBM is a highly vascular tumor, therapy that directs monoclonal antibodies or small molecule tyrosine kinase inhibitors toward angiogenic factors is also an area of focus for the development of new therapies. Passive, active, and adoptive immunotherapies have been explored by many studies recently, and epigenetic regulation of gene expression with microRNAs is also becoming an important area of study. GSCs can be useful targets to stop tumor recurrence and

  18. Podocalyxin promotes glioblastoma multiforme cell invasion and proliferation by inhibiting angiotensin-(1-7)/Mas signaling.

    Science.gov (United States)

    Liu, Bo; Liu, Yu; Jiang, Yugang

    2015-05-01

    Podocalyxin (PODX) reportedly enhances invasion in many human cancers including glioblastoma multiforme (GBM). Recent studies have shown that the local renin-angiotensin system (RAS) in tumor environment contributes significantly to tumor progression. As a counter-regulatory axis in RAS, angiotensin (Ang)-(1-7)/Mas signaling has been shown to inhibit the growth and invasiveness of several human cancers including GBM. In the present study, we examined the crosstalk between PODX and Ang-(1-7)/Mas signaling in GBM cells, and assessed its impact on GBM cell invasion and proliferation. A strong negative correlation between the expression of PODX and Mas in GBM tumor tissues from 10 consecutive patients (r=-0.768, pMas at the mRNA and protein levels, which led to decreased density of Ang-(1-7)-binding Mas on the cell membrane. This effect was completely abolished by selective phosphatidylinositol 3-kinase (PI3K) inhibitor BKM120. By contrast, the stable knockdown of PODX in LN-229 and U-118 MG cells increased the expression of Mas and the density of Ang-(1-7)-binding Mas on the cell membrane. Overexpression and knockdown of PODX respectively reversed and enhanced the inhibitory effects of Ang-(1-7) on the expression/activity of matrix metalloproteinase-9 and cell invasion and proliferation in GBM cells. Although the overexpression of Mas showed no significant effect on the promoting effect of PODX on GBM cell invasion and proliferation in the absence of Ang-(1-7), it completely eliminated the effect of PODX in the presence of Ang-(1-7). In conclusion, to the best of our knowledge, the present study provided the first evidence that PODX inhibits Ang-(1-7)/Mas signaling by downregulating the expression of Mas through a PI3K-dependent mechanism in GBM cells. This effect led to enhanced GBM cell invasion and proliferation. The results of this study add new insight into the biological functions of PODX and the molecular mechanisms underlying GBM progression.

  19. XL-184, a MET, VEGFR-2 and RET kinase inhibitor for the treatment of thyroid cancer, glioblastoma multiforme and NSCLC.

    Science.gov (United States)

    Zhang, Ying; Guessous, Fadila; Kofman, Alex; Schiff, David; Abounader, Roger

    2010-02-01

    XL-184 (BMS-907351), under development by Exelixis Inc and Bristol-Myers Squibb Co, is a pan-tyrosine kinase inhibitor for the potential oral treatment of medullary thyroid cancer, glioblastoma multiforme and NSCLC. The prinicipal targets of XL-184 are MET, VEGFR-2 and RET, but the drug is also reported to display inhibitory activity against KIT, FLT3 and TEK. Preclinical studies demonstrated that XL-184 potently inhibited multiple receptor tyrosine kinases in various cancer cell lines and animal xenograft models, and that the drug exhibited significant oral bioavailability and blood-brain barrier penetration. A phase I clinical trial in patients with advanced solid malignancies indicated that XL-184 accumulated dose-dependently in the plasma and had a long terminal half-life. A phase II trial in patients with progressive or recurrent glioblastoma revealed modest but promising median progression-free survival. Toxicity and side effects for the drug have generally been of low-to-moderate severity. At the time of publication, three additional trials of XL-184 were recruiting patients, including a phase I trial in combination with standard of care in patients with glioblastoma, a phase I/II trial in combination with erlotinib in patients with NSCLC, and a phase III trial in patients with medullary thyroid cancer.

  20. Development of an exercise intervention as part of rehabilitation in a glioblastoma multiforme survivor during irradiation treatment

    DEFF Research Database (Denmark)

    Hansen, Anders; Søgaard, Karen; Minet, Lisbeth Rosenbek

    2018-01-01

    completed a supervised six-week exercise intervention during irradiation treatment beginning 42 d after resection. Exercise modalities of cardiorespiratory, resistance, and balance training were designed on generic recommendations of various cancer populations and literature review. RESULTS: Our case......INTRODUCTION: This case report describes the rationale and development of an exercise intervention in a patient with glioblastoma multiforme (GBM ) and discusses potential relations of observed effects in functional performance and quality of life (QOL). METHODS: A 54-year-old GBM survivor...... attended all possible sessions without experiencing adverse effects, and improved in aerobe power (24%), muscle strength (0-38%), standing balance (71%), walking ability (9%), and QOL domains of "Global Health Status/QoL" and "Physical functioning." CONCLUSIONS: Based on this single case, exercise...

  1. Boron neutron capture therapy of glioblastoma multiforme using the p- boronophenylalanine-fructose complex and epithermal neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Coderre, J.A.; Chanana, A.D.; Joel, D.D.; Liu, H.B.; Slatkin, D.N.; Wielopolski, L. [Brookhaven National Lab., Upton, NY (United States); Bergland, R.; Elowitz, E. [Beth Israel Medical Center, New York, NY (United States). Dept. of Neurosurgery; Chadha, M. [Beth Israel Medical Center, New York, NY (United States). Dept. of Radiation Oncology

    1994-12-31

    The amino acid analogue p-boronophenylalanine (BPA) is under investigation as a neutron capture agent for BNCT of glioblastoma multiforme. A series of patients undergoing surgical removal of tumor received BPA orally as the free amino acid. Favorable tumor/blood boron concentration ratios were obtained but the absolute amount of boron in the tumor would have been insufficient for BNCT. BPA can be solubilized at neutral pH by complexation with fructose (BPA-F). Studies with rats suggest that intraperitoneal injection of BPA-F complex produces a much higher tumor boron concentration to rat intracerebral 9L gliosarcoma that were possible with oral BPA. Higher boron concentrations have allowed higher tumor radiation doses to be delivered while maintaining the dose to the normal brain vascular endothelium below the threshold of tolerance. The experience to date of the administration of BPA-F to one patient is provided in this report.

  2. Treatment of glioblastoma multiforme cells with temozolomide-BioShuttle ligated by the inverse Diels-Alder ligation chemistry

    Directory of Open Access Journals (Sweden)

    Klaus Braun

    2009-01-01

    Full Text Available Klaus Braun1, Manfred Wiessler1, Volker Ehemann2, Ruediger Pipkorn3, Herbert Spring4, Juergen Debus5, Bernd Didinger5, Mario Koch3, Gabriele Muller6, Waldemar Waldeck61German Cancer Research Center, Dept of Imaging and Radiooncology, Heidelberg, Germany; 2University of Heidelberg, Institute of Pathology, Heidelberg, Germany; 3German Cancer Research Center, Central Peptide Synthesis Unit, Heidelberg, Germany; 4German Cancer Research Center, Dept of Structural Analysis of Gene Structure and Function, Heidelberg, Germany; 5University of Heidelberg, Dept of Radiation Oncology, Heidelberg, Germany; 6German Cancer Research Center,Division of Biophysics of Macromolecules, Heidelberg, GermanyAbstract: Recurrent glioblastoma multiforme (GBM, insensitive against most therapeutic interventions, has low response and survival rates. Temozolomide (TMZ was approved for second-line therapy of recurrent anaplastic astrocytoma. However, TMZ therapy in GBM patients reveals properties such as reduced tolerability and inauspicious hemogram. The solution addressed here concerning GBM therapy consolidates and uses the potential of organic and peptide chemistry with molecular medicine. We enhanced the pharmacologic potency with simultaneous reduction of unwanted adverse reactions of the highly efficient chemotherapeutic TMZ. The TMZ connection to transporter molecules (TMZ-BioShuttle was investigated, resulting in a much higher pharmacological effect in glioma cell lines and also with reduced dose rate. From this result we can conclude that a suitable chemistry could realize the ligation of pharmacologically active, but sensitive and highly unstable pharmaceutical ingredients without functional deprivation. The TMZ-BioShuttle dramatically enhanced the potential of TMZ for the treatment of brain tumors and is an attractive drug for combination chemotherapy.Keywords: drug delivery, carrier molecules, facilitated transport, glioblastoma multiforme, temozolomide

  3. {sup 18}F-Fluoromisonidazole positron emission tomography may differentiate glioblastoma multiforme from less malignant gliomas

    Energy Technology Data Exchange (ETDEWEB)

    Hirata, Kenji; Shiga, Tohru; Tamaki, Nagara [Hokkaido University, Department of Nuclear Medicine, Graduate School of Medicine, Sapporo, Hokkaido (Japan); Terasaka, Shunsuke; Kobayashi, Hiroyuki; Yamaguchi, Shigeru; Houkin, Kiyohiro [Graduate School of Medicine, Hokkaido University, Department of Neurosurgery, Sapporo (Japan); Hattori, Naoya [Graduate School of Medicine, Hokkaido University, Department of Molecular Imaging, Sapporo (Japan); Magota, Keiichi [Hokkaido University Hospital, Department of Radiology, Sapporo (Japan); Tanaka, Shinya [Graduate School of Medicine, Hokkaido University, Department of Cancer Pathology, Sapporo (Japan); Kuge, Yuji [Hokkaido University, Central Institute of Isotope Science, Sapporo (Japan)

    2012-05-15

    Glioblastoma multiforme (GBM) is the most aggressive primary brain tumor and its prognosis is significantly poorer than those of less malignant gliomas. Pathologically, necrosis is one of the most important characteristics that differentiate GBM from lower grade gliomas; therefore, we hypothesized that {sup 18}F fluoromisonidazole (FMISO), a radiotracer for hypoxia imaging, accumulates in GBM but not in lower grade gliomas. We aimed to evaluate the diagnostic value of FMISO positron emission tomography (PET) for the differential diagnosis of GBM from lower grade gliomas. This prospective study included 23 patients with pathologically confirmed gliomas. All of the patients underwent FMISO PET and {sup 18}F-fluorodeoxyglucose (FDG) PET within a week. FMISO images were acquired 4 h after intravenous administration of 400 MBq of FMISO. Tracer uptake in the tumor was visually assessed. Lesion to normal tissue ratios and FMISO uptake volume were calculated. Of the 23 glioma patients, 14 were diagnosed as having GBM (grade IV glioma in the 2007 WHO classification), and the others were diagnosed as having non-GBM (5 grade III and 4 grade II). In visual assessment, all GBM patients showed FMISO uptake in the tumor greater than that in the surrounding brain tissues, whereas all the non-GBM patients showed FMISO uptake in the tumor equal to that in the surrounding brain tissues (p {<=} 0.001). One GBM patient was excluded from FDG PET study because of hyperglycemia. All GBM patients and three of the nine (33%) non-GBM patients showed FDG uptake greater than or equal to that in the gray matter. The sensitivity and specificity for diagnosing GBM were 100 and 100% for FMISO, and 100 and 66% for FDG, respectively. The lesion to cerebellum ratio of FMISO uptake was higher in GBM patients (2.74 {+-} 0.60, range 1.71-3.81) than in non-GBM patients (1.22 {+-} 0.06, range 1.09-1.29, p {<=} 0.001) with no overlap between the groups. The lesion to gray matter ratio of FDG was also

  4. Trans sodium crocetinate with temozolomide and radiation therapy for glioblastoma multiforme.

    Science.gov (United States)

    Gainer, John L; Sheehan, Jason P; Larner, James M; Jones, David R

    2017-02-01

    OBJECTIVE A new drug, trans sodium crocetinate (TSC), has been developed to enhance the delivery of oxygen to hypoxic tissues. Cancerous tumors, such as glioblastoma multiforme (GBM), are very hypoxic, and it has been suggested that radiation therapy (RT) is more beneficial if tumors are better oxygenated. A Phase I/II clinical trial was conducted to determine the effect of adding TSC to RT sessions. METHODS An open, single-arm clinical trial incorporating the standard of care (SOC) for GBM was conducted at 18 clinical sites. There were 6 weeks of RT consisting of 2 Gy/day for 5 days/week, beginning after an initial resection or stereotactic biopsy to confirm GBM. Temozolomide (TMZ), 75 mg/m2, was given before each RT session. The TSC, 0.25 mg/kg, was intravenously administered around 45 minutes before an RT session 3 days/week, usually on Monday, Wednesday, and Friday. A Phase I run-in period included 2 cohorts. The first cohort contained 3 patients who were given a half dose of the intravenous TSC (that is, 0.25 mg/kg, 3 times per week for only the first 3 weeks of RT). After a Safety Monitoring Committee (SMC) had verified that no dose-limiting toxicity (DLT) had occurred, a second cohort of 6 patients was given the same dosage of TSC but for the full 6 weeks of RT. After the SMC verified that no DLTs had occurred, Phase II began, with the administration of the full 18 doses of TSC. Fifty additional patients were enrolled during Phase II. Following the completion of RT, the patients rested for a month. After that, SOC TMZ chemotherapy (150-200 mg/m2) was administered for 5 days of the 1st week of 6 monthly cycles. No TSC was administered during this chemotherapy phase or later in the trial. Any other follow-up therapies were administered at the discretion of the individual investigators. RESULTS Kaplan-Meier analysis showed that 36% of the full-dose TSC patients were alive at 2 years, compared with historical survival values ranging from 27% to 30% for the SOC

  5. Optimizing cancer radiotheraphy with 2-deoxy-D-glucose. Dose escalation studies in patients with glioblastoma multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Singh, D.; Gupta, J.P. [Dharmshila Cancer Hospital, New Delhi (India); Banerji, A.K. [Vidyasagar Inst. of Mental Health and Neurosciences, New Delhi (India); Dwarakanath, B.S.; Tripathi, R.P.; Mathew, T.L.; Ravindranath, T. [Institute of Nuclear Medicine and Allied Sciences, Delhi (India); Jain, V. [Wright State University, Dayton, OH (United States). Kettering Medical Center

    2005-08-01

    Background and purpose: Higher rates of glucose utilization and glycolysis generally correlate with poor prognosis in several types of malignant tumors. Own earlier studies on model systems demonstrated that the nonmetabolizable glucose analog 2-deoxy-D-glucose (2-DG) could enhance the efficacy of radiotherapy in a dose-dependent manner by selectively sensitizing cancer cells while protecting normal cells. Phase I/II clinical trials indicated that the combination of 2-DG, at an oral dose of 200 mg/kg body weight (BW), with large fractions of {gamma}-radiation was well tolerated in cerebral glioma patients. Since higher 2-DG doses are expected to improve the therapeutic gain, present studies were undertaken to examine the tolerance and safety of escalating 2-DG dose during combined treatment (2-DG + radiotherapy) in glioblastoma multiforme patients. Patients and methods: Untreated patients with histologically proven glioblastoma multiforme (WHO criteria) were included in the study. Seven weekly fractions of {sup 60}C {gamma}-rays (5 Gy/fraction) were delivered to the tumor volume (presurgical CT/MRI evaluation) plus 3 cm margin. Escalating 2-DG doses (200-250-300 mg/kg BW) were administered orally 30 min before irradiation after overnight fasting. Acute toxicity and tolerance were studied by monitoring the vital parameters and side effects. Late radiation damage and treatment responses were studied radiologically and clinically in surviving patients. Results: Transient side effects similar to hypoglycemia were observed in most of the patients. Tolerance and patient compliance to the combined treatment were very good up to a 2-DG dose of 250 mg/kg BW. However, at the higher dose of 300 mg/kg BW, two out of six patients were very restless and could not complete treatment, though significant changes in the vital parameters were not observed even at this dose. No significant damage to the normal brain tissue was observed during follow-up in seven out of ten patients who

  6. Folate Functionalized Boron Nitride Nanotubes and their Selective Uptake by Glioblastoma Multiforme Cells: Implications for their Use as Boron Carriers in Clinical Boron Neutron Capture Therapy

    Science.gov (United States)

    Ciofani, Gianni; Raffa, Vittoria; Menciassi, Arianna; Cuschieri, Alfred

    2009-02-01

    Boron neutron capture therapy (BNCT) is increasingly being used in the treatment of several aggressive cancers, including cerebral glioblastoma multiforme. The main requirement for this therapy is selective targeting of tumor cells by sufficient quantities of 10B atoms required for their capture/irradiation with low-energy thermal neutrons. The low content of boron targeting species in glioblastoma multiforme accounts for the difficulty in selective targeting of this very malignant cerebral tumor by this radiation modality. In the present study, we have used for the first time boron nitride nanotubes as carriers of boron atoms to overcome this problem and enhance the selective targeting and ablative efficacy of BNCT for these tumors. Following their dispersion in aqueous solution by noncovalent coating with biocompatible poly- l-lysine solutions, boron nitride nanotubes were functionalized with a fluorescent probe (quantum dots) to enable their tracking and with folic acid as selective tumor targeting ligand. Initial in vitro studies have confirmed substantive and selective uptake of these nanovectors by glioblastoma multiforme cells, an observation which confirms their potential clinical application for BNCT therapy for these malignant cerebral tumors.

  7. Folate Functionalized Boron Nitride Nanotubes and their Selective Uptake by Glioblastoma Multiforme Cells: Implications for their Use as Boron Carriers in Clinical Boron Neutron Capture Therapy

    Directory of Open Access Journals (Sweden)

    Ciofani Gianni

    2008-01-01

    Full Text Available Abstract Boron neutron capture therapy (BNCT is increasingly being used in the treatment of several aggressive cancers, including cerebral glioblastoma multiforme. The main requirement for this therapy is selective targeting of tumor cells by sufficient quantities of10B atoms required for their capture/irradiation with low-energy thermal neutrons. The low content of boron targeting species in glioblastoma multiforme accounts for the difficulty in selective targeting of this very malignant cerebral tumor by this radiation modality. In the present study, we have used for the first time boron nitride nanotubes as carriers of boron atoms to overcome this problem and enhance the selective targeting and ablative efficacy of BNCT for these tumors. Following their dispersion in aqueous solution by noncovalent coating with biocompatible poly-l-lysine solutions, boron nitride nanotubes were functionalized with a fluorescent probe (quantum dots to enable their tracking and with folic acid as selective tumor targeting ligand. Initial in vitro studies have confirmed substantive and selective uptake of these nanovectors by glioblastoma multiforme cells, an observation which confirms their potential clinical application for BNCT therapy for these malignant cerebral tumors.

  8. Correlação clínico-topográfica em glioblastomas multiformes nas síndromes motoras: significados fisiopatológicos Clinical topographic findings in glioblastoma multiforme and the relation with motor impairment

    Directory of Open Access Journals (Sweden)

    Rita de Cássia G. Lucena

    2006-06-01

    Full Text Available O glioblastoma multiforme (GBM é o tumor glial com maior grau de malignidade. Acomete principalmente os hemisférios cerebrais apresentando sintomas e sinais focais ou gerais, relacionados ao tamanho, localização e taxa de crescimento tumoral. OBJETIVO: Analisar a relação do déficit motor com a topografia do GBM. MÉTODO: Foram estudados 43 casos de GBM, referidos quanto à idade, sexo, localização e a síndrome motora. RESULTADOS: O tumor predominou em adultos (média de 55 anos, sexo masculino (55,82%, localização frontal (aproximadamente 40%. A hemiparesia prevaleceu como distúrbio motor, somente não ocorrendo em 2 casos de lesão frontal, 2 temporais, 1 parietal, 1 occipital e 1 fronto-temporal. CONCLUSÃO: Os achados clínico-topográficos favorecem os efeitos infiltrativos (lesões extensas como responsáveis pela síndrome motora em detrimento aos efeitos compressivos (lesões localizadas.Glioblastoma multiforme (GBM is the glial tumor with the highest grade of malignity. It mainly affects the cerebral hemispheres, presenting general or focal signs and symptoms, which depend on the size, the location of the lesion and rate of growth of the tumor. OBJECTIVE: To analyze the relationship between motor impairment and GBM topography. METHOD: We studied 43 cases of GBM, related to the age, gender, localization and motor impairment. RESULTS: The occurrence of the tumor was preponderant in adults (mean age 55 years old, men (55.82%, and frontal lobe (approximately 40%. The principal motor impairment was hemiparesis, with the exception of 2 cases in the frontal lobe, 2 temporal, 1 parietal, 1 occipital and 1 frontotemporal. CONCLUSION: The clinical-topographic findings lead to consider the infiltrative effects (broad lesions are responsible for the motor impairment rather than compressive effects (located lesions.

  9. Combination of measles virus virotherapy and radiation therapy has synergistic activity in the treatment of glioblastoma multiforme.

    Science.gov (United States)

    Liu, Chunsheng; Sarkaria, Jann N; Petell, Cory A; Paraskevakou, Georgia; Zollman, Paula J; Schroeder, Mark; Carlson, Brett; Decker, Paul A; Wu, Wenting; James, C David; Russell, Stephen J; Galanis, Evanthia

    2007-12-01

    Glioblastoma multiforme is the most frequent primary brain tumor in adults and represents one of the most lethal malignancies with a median survival of 12-16 months. We have previously shown that an oncolytic measles virus derivative expressing soluble human carcinoembryonic antigen (MV-CEA) has significant antitumor activity against glioblastoma multiforme cell lines and xenografts. Radiation therapy (RT) represents one of the mainstays of glioma treatment. Here we tested the hypothesis that the combination of RT with MV-CEA would have synergistic activity against gliomas. 3-(4,5-Dimethyl-thiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) and clonogenic assays were used to test cytoxicity of the combination treatment in vivo. To examine the mechanism of synergy, one-step viral growth curves, terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assays, and Western blot analyses were performed. In vivo assessment of synergistic antitumor activity was conducted in a U87 glioma model. MTS and clonogenic assays showed a strong synergistic interaction between MV-CEA and RT in glioblastoma multiforme cells including both primary and established glioma lines. Furthermore, significant antitumor efficacy was observed in vivo in a subcuteneous U87 xenograph model. There was significant prolongation of survival (P = 0.001) in the combination treatment group as compared with single modality- or control-treated animals. One-step viral growth curves showed increased viral burst size by up to 2 log in MV/RT combination-treated cells, as compared with single agent MV-CEA-treated glioma cells. Changes in CEA levels and expression of viral N and H protein were also consistent with increased viral production. Furthermore, TUNEL assays and Western blot analysis showed increase in apoptosis in MV/RT combination-treated cells. The pan-caspase inhibitor Z-VAD-FMK and the caspase-8 inhibitor Z-IETD-FMK, but not the caspase-9

  10. Global diffusion tensor imaging derived metrics differentiate glioblastoma multiforme vs. normal brains by using discriminant analysis: introduction of a novel whole-brain approach

    Science.gov (United States)

    Roldan-Valadez, Ernesto; Rios, Camilo; Cortez-Conradis, David; Favila, Rafael; Moreno-Jimenez, Sergio

    2014-01-01

    Background Histological behavior of glioblastoma multiforme suggests it would benefit more from a global rather than regional evaluation. A global (whole-brain) calculation of diffusion tensor imaging (DTI) derived tensor metrics offers a valid method to detect the integrity of white matter structures without missing infiltrated brain areas not seen in conventional sequences. In this study we calculated a predictive model of brain infiltration in patients with glioblastoma using global tensor metrics. Methods Retrospective, case and control study; 11 global DTI-derived tensor metrics were calculated in 27 patients with glioblastoma multiforme and 34 controls: mean diffusivity, fractional anisotropy, pure isotropic diffusion, pure anisotropic diffusion, the total magnitude of the diffusion tensor, linear tensor, planar tensor, spherical tensor, relative anisotropy, axial diffusivity and radial diffusivity. The multivariate discriminant analysis of these variables (including age) with a diagnostic test evaluation was performed. Results The simultaneous analysis of 732 measures from 12 continuous variables in 61 subjects revealed one discriminant model that significantly differentiated normal brains and brains with glioblastoma: Wilks’ λ = 0.324, χ2 (3) = 38.907, p < .001. The overall predictive accuracy was 92.7%. Conclusions We present a phase II study introducing a novel global approach using DTI-derived biomarkers of brain impairment. The final predictive model selected only three metrics: axial diffusivity, spherical tensor and linear tensor. These metrics might be clinically applied for diagnosis, follow-up, and the study of other neurological diseases. PMID:24991202

  11. Phase I Trial of Hypofractionated Intensity-Modulated Radiotherapy With Temozolomide Chemotherapy for Patients With Newly Diagnosed Glioblastoma Multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Chen Changhu, E-mail: changhu.chen@ucdenver.edu [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, CO (United States); Damek, Denise [Department of Neurology, University of Colorado School of Medicine, Aurora, CO (United States); Gaspar, Laurie E. [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, CO (United States); Waziri, Allen; Lillehei, Kevin [Department of Neurosurgery, University of Colorado School of Medicine, Aurora, CO (United States); Kleinschmidt-DeMasters, B.K. [Department of Pathology, University of Colorado School of Medicine, Aurora, CO (United States); Robischon, Monica; Stuhr, Kelly; Rusthoven, Kyle E.; Kavanagh, Brian D. [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, CO (United States)

    2011-11-15

    Purpose: To determine the maximal tolerated biologic dose intensification of radiotherapy using fractional dose escalation with temozolomide (TMZ) chemotherapy in patients with newly diagnosed glioblastoma multiforme. Methods and Materials: Patients with newly diagnosed glioblastoma multiforme after biopsy or resection and with adequate performance status, bone marrow, and organ function were eligible. The patients underwent postoperative intensity-modulated radiotherapy (IMRT) with concurrent and adjuvant TMZ. All patients received a total dose of 60 Gy to the surgical cavity and residual tumor, with a 5-mm margin. IMRT biologic dose intensification was achieved by escalating from 3 Gy/fraction (Level 1) to 6 Gy/fraction (Level 4) in 1-Gy increments. Concurrent TMZ was given at 75 mg/m{sup 2}/d for 28 consecutive days. Adjuvant TMZ was given at 150-200 mg/m{sup 2}/d for 5 days every 28 days. Dose-limiting toxicity was defined as any Common Terminology Criteria for Adverse Events, version 3, Grade 3-4 nonhematologic toxicity, excluding Grade 3 fatigue, nausea, and vomiting. A standard 3+3 Phase I design was used. Results: A total of 16 patients were accrued (12 men and 4 women, median age, 69 years; range, 34-84. The median Karnofsky performance status was 80 (range, 60-90). Of the 16 patients, 3 each were treated at Levels 1 and 2, 4 at Level 3, and 6 at Level 4. All patients received IMRT and concurrent TMZ according to the protocol, except for 1 patient, who received 14 days of concurrent TMZ. The median number of adjuvant TMZ cycles was 7.5 (range, 0-12). The median survival was 16.2 months (range, 3-33). One patient experienced vision loss in the left eye 7 months after IMRT. Four patients underwent repeat surgery for suspected tumor recurrence 6-12 months after IMRT; 3 had radionecrosis. Conclusions: The maximal tolerated IMRT fraction size was not reached in our study. Our results have shown that 60 Gy IMRT delivered in 6-Gy fractions within 2 weeks with

  12. Primary pontine gliobastoma multiforme: A case report and review of the literature

    Energy Technology Data Exchange (ETDEWEB)

    Baik, Ji Yeon; Baek, Hye Jin [Dept. of Radiology, Inje University College of Medicine, Haeundae Paik Hospital, Busan (Korea, Republic of); Moon, Jin Il; Cho, Soo Buem; Choi, Bo Hwa; Bae, Kyung Soo; Jeon, Kyung Nyeo [Dept. of Radiology, Gyeongsang National University School of Medicine, Gyeongsang National University Changwon Hospital, Changwon (Korea, Republic of); Choi, Dae Seob; Shin, Hwa Seon [Dept. of Radiology, Gyeongsang National University School of Medicine, Gyeongsang National University Hospital, Jinju (Korea, Republic of)

    2016-08-15

    Glioblastoma multiforme (GBM) most commonly occurs in the pons while it is rare in the brainstem. However, diagnosis of brainstem GBM can be difficult due to its rarity and nonspecific clinical manifestations. Herein, we presented a case of a 47-year-old female patient confirmed as primary pontine GBM by histopathological examination. This case highlights that GBM should be considered in the differential diagnosis of patients with a space-occupying lesion in the brainstem as well as the importance of a meticulous radiological review with clinical suspicion.

  13. Spatial Habitat Features Derived from Multiparametric Magnetic Resonance Imaging Data Are Associated with Molecular Subtype and 12-Month Survival Status in Glioblastoma Multiforme.

    Directory of Open Access Journals (Sweden)

    Joonsang Lee

    Full Text Available One of the most common and aggressive malignant brain tumors is Glioblastoma multiforme. Despite the multimodality treatment such as radiation therapy and chemotherapy (temozolomide: TMZ, the median survival rate of glioblastoma patient is less than 15 months. In this study, we investigated the association between measures of spatial diversity derived from spatial point pattern analysis of multiparametric magnetic resonance imaging (MRI data with molecular status as well as 12-month survival in glioblastoma. We obtained 27 measures of spatial proximity (diversity via spatial point pattern analysis of multiparametric T1 post-contrast and T2 fluid-attenuated inversion recovery MRI data. These measures were used to predict 12-month survival status (≤12 or >12 months in 74 glioblastoma patients. Kaplan-Meier with receiver operating characteristic analyses was used to assess the relationship between derived spatial features and 12-month survival status as well as molecular subtype status in patients with glioblastoma. Kaplan-Meier survival analysis revealed that 14 spatial features were capable of stratifying overall survival in a statistically significant manner. For prediction of 12-month survival status based on these diversity indices, sensitivity and specificity were 0.86 and 0.64, respectively. The area under the receiver operating characteristic curve and the accuracy were 0.76 and 0.75, respectively. For prediction of molecular subtype status, proneural subtype shows highest accuracy of 0.93 among all molecular subtypes based on receiver operating characteristic analysis. We find that measures of spatial diversity from point pattern analysis of intensity habitats from T1 post-contrast and T2 fluid-attenuated inversion recovery images are associated with both tumor subtype status and 12-month survival status and may therefore be useful indicators of patient prognosis, in addition to providing potential guidance for molecularly

  14. The role of factor inhibiting HIF (FIH-1 in inhibiting HIF-1 transcriptional activity in glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Enfeng Wang

    Full Text Available Glioblastoma multiforme (GBM accounts for about 38% of primary brain tumors in the United States. GBM is characterized by extensive angiogenesis induced by vascular growth factors and cytokines. The transcription of these growth factors and cytokines is regulated by the Hypoxia-Inducible-Factor-1(HIF-1, which is a key regulator mediating the cellular response to hypoxia. It is known that Factor Inhibiting HIF-1, or FIH-1, is also involved in the cellular response to hypoxia and has the capability to physically interact with HIF-1 and block its transcriptional activity under normoxic conditions. Delineation of the regulatory role of FIH-1 will help us to better understand the molecular mechanism responsible for tumor growth and progression and may lead to the design of new therapies targeting cellular pathways in response to hypoxia. Previous studies have shown that the chromosomal region of 10q24 containing the FIH-1 gene is often deleted in GBM, suggesting a role for the FIH-1 in GBM tumorigenesis and progression. In the current study, we found that FIH-1 is able to inhibit HIF-mediated transcription of GLUT1 and VEGF-A, even under hypoxic conditions in human glioblastoma cells. FIH-1 has been found to be more potent in inhibiting HIF function than PTEN. This observation points to the possibility that deletion of 10q23-24 and loss or decreased expression of FIH-1 gene may lead to a constitutive activation of HIF-1 activity, an alteration of HIF-1 targets such as GLUT-1 and VEGF-A, and may contribute to the survival of cancer cells in hypoxia and the development of hypervascularization observed in GBM. Therefore FIH-1 can be potential therapeutic target for the treatment of GBM patients with poor prognosis.

  15. Liver graft-transmitted glioblastoma multiforme. A case report and experience with 13 multiorgan donors suffering from primary cerebral neoplasia.

    Science.gov (United States)

    Jonas, S; Bechstein, W O; Lemmens, H P; Neuhaus, R; Thalmann, U; Neuhaus, P

    1996-01-01

    The transmission of donor-related malignancies by organ transplantation is a rather rare event. There has only been one report on the development of a brain tumor metastasis in liver transplantation. From September 1988 to January 1993, 342 donor hepatectomies with subsequent transplantation were performed at our center. The main donor diagnoses included subarachnoidal bleeding (n = 128; 37.4%), isolated head injury (n = 114; 33.3%), multiple injuries (n = 55; 16.1%), primary cerebral neoplasia (n = 13; 3.8%), and other (n = 32; 9.4%). Primary cerebral neoplasia included glioblastoma (n = 4), meningioma (n = 3), astrocytoma (n = 2), angioma (n = 2), neurocytoma (n = 1), and ependymoma (n = 1). In the group of donors suffering from primary cerebral neoplasia, procured organs other than the liver included kidneys (n = 20), combined kidneys and pancreata (n = 1), pancreata (n = 2), hearts (n = 8), combined hearts and lungs (n = 1), and single lungs (n = 1). Follow-up of the respective graft recipients ranged from 28 to 68 months (median 43 months). Recurrent malignancy was observed once, in a liver graft recipient. The donor, a 48-year-old female, had undergone surgical resection of an intracerebral multiform glioblastoma and died 4 months later of a relapse in the brain stem. The 28-year-old female recipient had undergone transplantation for an autoimmune-hepatitic cirrhosis. Four months later, histopathological examination of an intraperitoneal and intrahepatic mass revealed a poorly differentiated, small-cell pleomorphic cancer, identified as a glioma metastasis by S100- and glial fibrillary acidic protein immunohistochemical staining. The patient died 6 months post-transplantation. On autopsy, no further neoplastic lesions were detected. Our review adds a second reported case of a liver graft-transmitted brain tumor to the literature and the fourth donor-related malignancy after hepatic transplantation in general.

  16. Investigating Ceria Nanocrystals Uptake by Glioblastoma Multiforme Cells and its Related Effects: An Electron Microscopy Study

    KAUST Repository

    Aloufi, Bader

    2017-01-22

    Cerium oxide nanoparticles have been utilized widely nowadays in cancer research. It has been suggested by many studies that these nanoparticles are capable of having dual antioxidant behavior in healthy and cancer microenvironment; where in physiological condition, they act as antioxidant and do not affect the healthy cells, while in tumor-like condition; they act as an oxidase, and result in a selective killing for the cancer cells. In this experiment, the interaction of nanoceria with glioblastoma and healthy astrocyte cells was examined, and further correlated with the in vitro cytotoxic effects of various nanoceria concentrations (100 and 300 µg/ml) and exposure times (12, 24, and 48 hours). Electron microscopes were used to investigate the cellular-NPs interactions, and to examine the related cytotoxic effects in combination with trypan blue and propidium iodide viability assays. Our data suggest the following results. First, the two cell lines demonstrated capability of taken up the ceria through endocytosis pathway, where the NPs were recognized engulfed by double membrane vesicles at various regions over the cellular cytoplasm. Secondly, cerium oxide nanoparticles were found to affect the glioblastoma cells, but not so severely the corresponding healthy astrocytes at the various concentrations and incubation times, as revealed by the viability assays and the electron microscopy analysis. Thirdly, the viability of the glioblastoma cells after the treatment displayed a declined trend when increasing the ceria concentrations, but did not show such dependency with regard to the different time points. In all cases, the healthy astrocyte cells showed slight alterations in mitochondrial shape which did not influence their viability. Among the various nanoceria concentrations and exposure times, the most efficient dose of treatment was found to be with a concentration of 300 µg/ml at a time point of 24-hour, where higher reduction on the viability of

  17. Vascular Endothelial Growth Factor, Irradiation, and Axitinib Have Diverse Effects on Motility and Proliferation of Glioblastoma Multiforme Cells

    Directory of Open Access Journals (Sweden)

    Reinhardt Krcek

    2017-08-01

    Full Text Available Glioblastoma multiforme (GBM is the most common primary brain tumor. It is highly aggressive with an unfavorable prognosis for the patients despite therapies including surgery, irradiation, and chemotherapy. One important characteristic of highly vascularized GBM is the strong expression of vascular endothelial growth factor (VEGF. VEGF has become a new target in the treatment of GBM, and targeted therapies such as the VEGF-receptor blocker axitinib are in clinical trials. Most studies focus on VEGF-induced angiogenesis, but only very few investigations analyze autocrine or paracrine effects of VEGF on the tumor cells. In this study, we examined the impact of VEGF, irradiation, and axitinib on cell proliferation and cell motility in human GBM cell lines U-251 and U-373. VEGF receptor 2 was shown to be expressed within both cell lines by using PCR and immunochemistry. Moreover, we performed 24-h videography to analyze motility, and a viability assay for cell proliferation. We observed increasing effects of VEGF and irradiation on cell motility in both cell lines, as well as strong inhibiting effects on cellular motility by VEGF-receptor blockade using axitinib. Moreover, axitinib diminished irradiation induced accelerating effects. While VEGF stimulation or irradiation did not affect cell proliferation, axitinib significantly decreased cell proliferation in both cell lines. Therefore, the impairment of VEGF signaling might have a crucial role in the treatment of GBM.

  18. IQGAP1 in Podosomes/Invadosomes Is Involved in the Progression of Glioblastoma Multiforme Depending on the Tumor Status

    Science.gov (United States)

    Rotoli, Deborah; Pérez-Rodríguez, Natalia Dolores; Morales, Manuel; Maeso, María del Carmen; Ávila, Julio; Mobasheri, Ali; Martín-Vasallo, Pablo

    2017-01-01

    Glioblastoma multiforme (GBM) is the most frequent and aggressive primary brain tumor. GBM is formed by a very heterogeneous astrocyte population, neurons, neovascularization and infiltrating myeloid cells (microglia and monocyte derived macrophages). The IQGAP1 scaffold protein interacts with components of the cytoskeleton, cell adhesion molecules, and several signaling molecules to regulate cell morphology and motility, cell cycle and other cellular functions. IQGAP1 overexpression and delocalization has been observed in several tumors, suggesting a role for this protein in cell proliferation, transformation and invasion. IQGAP1 has been identified as a marker of amplifying cancer cells in GBMs. To determine the involvement of IQGAP1 in the onco-biology of GBM, we performed immunohistochemical confocal microscopic analysis of the IQGAP1 protein in human GBM tissue samples using cell type-specific markers. IQGAP1 immunostaining and subcellular localization was heterogeneous; the protein was located in the plasma membrane and, at variable levels, in nucleus and/or cytosol. Moreover, IQGAP1 positive staining was found in podosome/invadopodia-like structures. IQGAP1+ staining was observed in neurons (Map2+ cells), in cancer stem cells (CSC; nestin+) and in several macrophages (CD31+ or Iba1+). Our results indicate that the IQGAP1 protein is involved in normal cell physiology as well as oncologic processes. PMID:28098764

  19. Recent advances in the use of PI3K inhibitors for glioblastoma multiforme: current preclinical and clinical development.

    Science.gov (United States)

    Zhao, Hua-Fu; Wang, Jing; Shao, Wei; Wu, Chang-Peng; Chen, Zhong-Ping; To, Shing-Shun Tony; Li, Wei-Ping

    2017-06-07

    Glioblastoma multiforme (GBM) is the most common and aggressive malignant primary tumor in the central nervous system. One of the most widely used chemotherapeutic drugs for GBM is temozolomide, which is a DNA-alkylating agent and its efficacy is dependent on MGMT methylation status. Little progress in improving the prognosis of GBM patients has been made in the past ten years, urging the development of more effective molecular targeted therapies. Hyper-activation of the phosphatidylinositol 3-kinase (PI3K)/Akt pathway is frequently found in a variety of cancers including GBM, and it plays a central role in the regulation of tumor cell survival, growth, motility, angiogenesis and metabolism. Numerous PI3K inhibitors including pan-PI3K, isoform-selective and dual PI3K/mammalian target of rapamycin (mTOR) inhibitors have exhibited favorable preclinical results and entered clinical trials in a range of hematologic malignancies and solid tumors. Furthermore, combination of inhibitors targeting PI3K and other related pathways may exert synergism on suppressing tumor growth and improving patients' prognosis. Currently, only a handful of PI3K inhibitors are in phase I/II clinical trials for GBM treatment. In this review, we focus on the importance of PI3K/Akt pathway in GBM, and summarize the current development of PI3K inhibitors alone or in combination with other inhibitors for GBM treatment from preclinical to clinical studies.

  20. FNAB cytology of extra-cranial metastasis of glioblastoma multiforme may resemble a lung primary: A diagnostic pitfall

    Directory of Open Access Journals (Sweden)

    Dincer HE

    2005-01-01

    Full Text Available Abstract Background As extra-cranial metastasis of glioblastoma multiforme (GBM is rare, it may create a diagnostic dilemma especially during interpretation of fine needle aspiration biopsy (FNAB cytology. Case presentation We present transbronchial FNAB findings in a 62-year-old smoker with lung mass clinically suspicious for a lung primary. The smears of transbronchial FNAB showed groups of cells with ill-defined cell margins and cytological features overlapping with poorly differentiated non-small cell carcinoma. The tumor cells demonstrated lack of immunoreactivity for cytokeratin, thyroid transcription factor-1, and usual neuroendocrine markers, synaptophysin and chromogranin in formalin-fixed cellblock sections. However, they were immunoreactive for the other neuroendocrine immunomarker, CD56, suggesting neural nature of the cells. Further scrutiny of clinical details revealed a history of GBM, 13 months status-post surgical excision with radiation therapy and systemic chemotherapy. The tumor recurred 7 months earlier and was debulked surgically and with intra-cranial chemotherapy. Additional evaluation of tumor cells for glial fibrillary acidic protein (GFAP immunoreactivity with clinical details resulted in final interpretation of metastatic GBM. Conclusion Lack of clinical history and immunophenotyping may lead to a diagnostic pitfall with possible misinterpretation of metastatic GBM as poorly differentiated non-small cell carcinoma of lung in a smoker.

  1. MiR-26a enhances the radiosensitivity of glioblastoma multiforme cells through targeting of ataxia–telangiectasia mutated

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Pin; Lan, Jin; Ge, Jianwei; Nie, Quanmin; Guo, Liemei [Department of Neurosurgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200127 (China); Qiu, Yongming, E-mail: qiuzhoub@hotmail.com [Department of Neurosurgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200127 (China); Shanghai Institute of Head Trauma, Shanghai 200127 (China); Mao, Qing, E-mail: maoq@netease.com [Department of Neurosurgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200127 (China); Shanghai Institute of Head Trauma, Shanghai 200127 (China)

    2014-01-15

    Glioblastoma multiforme (GBM) is notoriously resistant to radiation, and consequently, new radiosensitizers are urgently needed. MicroRNAs are a class of endogenous gene modulators with emerging roles in DNA repair. We found that overexpression of miR-26a can enhance radiosensitivity and reduce the DNA repair ability of U87 cells. However, knockdown miR-26a in U87 cells could act the converse manner. Mechanistically, this effect is mediated by direct targeting of miR-26a to the 3′UTR of ATM, which leads to reduced ATM levels and consequent inhibition of the homologous recombination repair pathway. These results suggest that miR-26a may act as a new radiosensitizer of GBM. - Highlights: ●miR-26a directly target ATM in GBM cells. ●miR-26a enhances the radiosensitivity of GBM cells. ●miR-26a could reduce the DNA repair capacity of GBM cells.

  2. 18F-Fluorothymidine-Pet Imaging of Glioblastoma Multiforme: Effects of Radiation Therapy on Radiotracer Uptake and Molecular Biomarker Patterns

    Directory of Open Access Journals (Sweden)

    Sanjay Chandrasekaran

    2013-01-01

    Full Text Available Introduction. PET imaging is a useful clinical tool for studying tumor progression and treatment effects. Conventional 18F-FDG-PET imaging is of limited usefulness for imaging Glioblastoma Multiforme (GBM due to high levels of glucose uptake by normal brain and the resultant signal-to-noise intensity. 18F-Fluorothymidine (FLT in contrast has shown promise for imaging GBM, as thymidine is taken up preferentially by proliferating cells. These studies were undertaken to investigate the effectiveness of 18F-FLT-PET in a GBM mouse model, especially after radiation therapy (RT, and its correlation with useful biomarkers, including proliferation and DNA damage. Methods. Nude/athymic mice with human GBM orthografts were assessed by microPET imaging with 18F-FDG and 18F-FLT. Patterns of tumor PET imaging were then compared to immunohistochemistry and immunofluorescence for markers of proliferation (Ki-67, DNA damage and repair (γH2AX, hypoxia (HIF-1α, and angiogenesis (VEGF. Results. We confirmed that 18F-FLT-PET uptake is limited in healthy mice but enhanced in the intracranial tumors. Our data further demonstrate that 18F-FLT-PET imaging usefully reflects the inhibition of tumor by RT and correlates with changes in biomarker expression. Conclusions. 18F-FLT-PET imaging is a promising tumor imaging modality for GBM, including assessing RT effects and biologically relevant biomarkers.

  3. C-Myc negatively controls the tumor suppressor PTEN by upregulating miR-26a in glioblastoma multiforme cells

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Pin; Nie, Quanmin; Lan, Jin; Ge, Jianwei [Department of Neurosurgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200127 (China); Qiu, Yongming, E-mail: qiuzhoub@hotmail.com [Department of Neurosurgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200127 (China); Shanghai Institute of Head Trauma, Shanghai 200127 (China); Mao, Qing, E-mail: maoq@netease.com [Department of Neurosurgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200127 (China); Shanghai Institute of Head Trauma, Shanghai 200127 (China)

    2013-11-08

    Highlights: •The c-Myc oncogene directly upregulates miR-26a expression in GBM cells. •ChIP assays demonstrate that c-Myc interacts with the miR-26a promoter. •Luciferase reporter assays show that PTEN is a specific target of miR-26a. •C-Myc–miR-26a suppression of PTEN may regulate the PTEN/AKT pathway. •Overexpression of c-Myc enhances the proliferative capacity of GBM cells. -- Abstract: The c-Myc oncogene is amplified in many tumor types. It is an important regulator of cell proliferation and has been linked to altered miRNA expression, suggesting that c-Myc-regulated miRNAs might contribute to tumor progression. Although miR-26a has been reported to be upregulated in glioblastoma multiforme (GBM), the mechanism has not been established. We have shown that ectopic expression of miR-26a influenced cell proliferation by targeting PTEN, a tumor suppressor gene that is inactivated in many common malignancies, including GBM. Our findings suggest that c-Myc modulates genes associated with oncogenesis in GBM through deregulation of miRNAs via the c-Myc–miR-26a–PTEN signaling pathway. This may be of clinical relevance.

  4. Graphene Functionalized with Arginine Decreases the Development of Glioblastoma Multiforme Tumor in a Gene-Dependent Manner

    Science.gov (United States)

    Sawosz, Ewa; Jaworski, Sławomir; Kutwin, Marta; Vadalasetty, Krishna Prasad; Grodzik, Marta; Wierzbicki, Mateusz; Kurantowicz, Natalia; Strojny, Barbara; Hotowy, Anna; Lipińska, Ludwika; Jagiełło, Joanna; Chwalibog, André

    2015-01-01

    Our previous studies revealed that graphene had anticancer properties in experiments in vitro with glioblastoma multiforme (GBM) cells and in tumors cultured in vivo. We hypothesized that the addition of arginine or proline to graphene solutions might counteract graphene agglomeration and increase the activity of graphene. Experiments were performed in vitro with GBM U87 cells and in vivo with GBM tumors cultured on chicken embryo chorioallantoic membranes. The measurements included cell morphology, mortality, viability, tumor morphology, histology, and gene expression. The cells and tumors were treated with reduced graphene oxide (rGO) and rGO functionalized with arginine (rGO + Arg) or proline (rGO + Pro). The results confirmed the anticancer effect of graphene on GBM cells and tumor tissue. After functionalization with amino acids, nanoparticles were distributed more specifically, and the flakes of graphene were less agglomerated. The molecule of rGO + Arg did not increase the expression of TP53 in comparison to rGO, but did not increase the expression of MDM2 or the MDM2/TP53 ratio in the tumor, suggesting that arginine may block MDM2 expression. The expression of NQO1, known to be a strong protector of p53 protein in tumor tissue, was greatly increased. The results indicate that the complex of rGO + Arg has potential in GBM therapy. PMID:26512645

  5. Graphene Functionalized with Arginine Decreases the Development of Glioblastoma Multiforme Tumor in a Gene-Dependent Manner

    Directory of Open Access Journals (Sweden)

    Ewa Sawosz

    2015-10-01

    Full Text Available Our previous studies revealed that graphene had anticancer properties in experiments in vitro with glioblastoma multiforme (GBM cells and in tumors cultured in vivo. We hypothesized that the addition of arginine or proline to graphene solutions might counteract graphene agglomeration and increase the activity of graphene. Experiments were performed in vitro with GBM U87 cells and in vivo with GBM tumors cultured on chicken embryo chorioallantoic membranes. The measurements included cell morphology, mortality, viability, tumor morphology, histology, and gene expression. The cells and tumors were treated with reduced graphene oxide (rGO and rGO functionalized with arginine (rGO + Arg or proline (rGO + Pro. The results confirmed the anticancer effect of graphene on GBM cells and tumor tissue. After functionalization with amino acids, nanoparticles were distributed more specifically, and the flakes of graphene were less agglomerated. The molecule of rGO + Arg did not increase the expression of TP53 in comparison to rGO, but did not increase the expression of MDM2 or the MDM2/TP53 ratio in the tumor, suggesting that arginine may block MDM2 expression. The expression of NQO1, known to be a strong protector of p53 protein in tumor tissue, was greatly increased. The results indicate that the complex of rGO + Arg has potential in GBM therapy.

  6. Graphene Functionalized with Arginine Decreases the Development of Glioblastoma Multiforme Tumor in a Gene-Dependent Manner.

    Science.gov (United States)

    Sawosz, Ewa; Jaworski, Sławomir; Kutwin, Marta; Vadalasetty, Krishna Prasad; Grodzik, Marta; Wierzbicki, Mateusz; Kurantowicz, Natalia; Strojny, Barbara; Hotowy, Anna; Lipińska, Ludwika; Jagiełło, Joanna; Chwalibog, André

    2015-10-23

    Our previous studies revealed that graphene had anticancer properties in experiments in vitro with glioblastoma multiforme (GBM) cells and in tumors cultured in vivo. We hypothesized that the addition of arginine or proline to graphene solutions might counteract graphene agglomeration and increase the activity of graphene. Experiments were performed in vitro with GBM U87 cells and in vivo with GBM tumors cultured on chicken embryo chorioallantoic membranes. The measurements included cell morphology, mortality, viability, tumor morphology, histology, and gene expression. The cells and tumors were treated with reduced graphene oxide (rGO) and rGO functionalized with arginine (rGO + Arg) or proline (rGO + Pro). The results confirmed the anticancer effect of graphene on GBM cells and tumor tissue. After functionalization with amino acids, nanoparticles were distributed more specifically, and the flakes of graphene were less agglomerated. The molecule of rGO + Arg did not increase the expression of TP53 in comparison to rGO, but did not increase the expression of MDM2 or the MDM2/TP53 ratio in the tumor, suggesting that arginine may block MDM2 expression. The expression of NQO1, known to be a strong protector of p53 protein in tumor tissue, was greatly increased. The results indicate that the complex of rGO + Arg has potential in GBM therapy.

  7. An update in the use of antibodies to treat glioblastoma multiforme.

    Science.gov (United States)

    Hernández-Pedro, Norma Y; Rangel-López, Edgar; Vargas Félix, Gustavo; Pineda, Benjamín; Sotelo, Julio

    2013-01-01

    Glioblastoma is a deadly brain disease and modest improvement in survival has been made. At initial diagnosis, treatment consists of maximum safe surgical resection, followed by temozolomide and chemoirradiation or adjuvant temozolomide alone. However, these treatments do not improve the prognosis and survival of patients. New treatment strategies are being sought according to the biology of tumors. The epidermal growth factor receptor has been considered as the hallmark in glioma tumors; thereby, some antibodies have been designed to bind to this receptor and block the downstream signaling pathways. Also, it is known that vascularization plays an important role in supplying new vessels to the tumor; therefore, new therapy has been guided to inhibit angiogenic growth factors in order to limit tumor growth. An innovative strategy in the treatment of glial tumors is the use of toxins produced by bacteria, which may be coupled to specific carrier-ligands and used for tumoral targeting. These carrier-ligands provide tumor-selective properties by the recognition of a cell-surface receptor on the tumor cells and promote their binding of the toxin-carrier complex prior to entry into the cell. Here, we reviewed some strategies to improve the management and treatment of glioblastoma and focused on the use of antibodies.

  8. Reassessing the Role of Intra-Arterial Drug Delivery for Glioblastoma Multiforme Treatment

    Directory of Open Access Journals (Sweden)

    Jason A. Ellis

    2015-01-01

    Full Text Available Effective treatment for glioblastoma (GBM will likely require targeted delivery of several specific pharmacological agents simultaneously. Intra-arterial (IA delivery is one technique for targeting the tumor site with multiple agents. Although IA chemotherapy for glioblastoma (GBM has been attempted since the 1950s, the predicted benefits remain unproven in clinical practice. This review focuses on innovative approaches to IA drug delivery in treating GBM. Guided by novel in vitro and in vivo optical measurements, newer pharmacokinetic models promise to better define the complex relationship between background cerebral blood flow and drug injection parameters. Advanced optical technologies and tracers, unique nanoparticles designs, new cellular targets, and rational drug formulations are continuously modifying the therapeutic landscape for GBM. Personalized treatment approaches are emerging; however, such tailored approaches will largely depend on effective drug delivery techniques and on the ability to simultaneously deliver multidrug regimens. These new paradigms for tumor-selective drug delivery herald dramatic improvements in the effectiveness of IA chemotherapy for GBM. Therefore, within this context of so-called “precision medicine,” the role of IA delivery for GBM is thoroughly reassessed.

  9. TSPO imaging in glioblastoma multiforme: A direct comparison between 123ICLINDE-SPECT, 18F-FET PET and gadolinium-enhanced MRI.

    OpenAIRE

    Jensen, Per; Feng, Li; Law, Ian; Svarer, Claus; Knudsen, Gitte M.; Mikkelsen, Jens D.; de Nijs, Robin; Larsen, Vibeke A; Dyssegaard, Agnete; Thomsen, Gerda; Fischer, Walter; Guilloteau, Denis; Pinborg, Lars H.

    2015-01-01

    Here we compare TSPO imaging using 123 I-CLINDE and amino acid transport imaging using 18 F-FET and investigate if 123 I-CLINDE is superior to 18 F-FET in predictingprogression of glioblastoma multiforme (GBM) at follow up. Methods  Three patients with WHO grade IV GBM were scanned with 123 I-CLINDE SPECT, 18 F-FET PET and Gadolinium enhanced magnetic resonance imaging (gadolinium-MRI). Molecular imaging data were compared to follow-up gadolinium-MRI or contrast enhanc...

  10. [First Mexican consensus on recommendations of the multidisciplinary care of patients with glioblastoma multiforme (GBM): Mexican Interdisciplinary Group on Neuro-Oncology Research (GIMINO)].

    Science.gov (United States)

    Celis, Miguel Ángel; Alegría-Loyola, Marco Antonio; González-Aguilar, Alberto; Martínez-Tlahuel, Jorge; Green-Renner, Dan; Reyes-Soto, Gervith; Arellano-Reynoso, Alfonso; Flores-Castro, Jesús Manuel; Moreno-Jiménez, Sergio; Poitevin-Chacón, María Adela; Cacho-Díaz, Bernardo; Olvera-Manzanilla, Eduardo; Díaz-Victoria, Ana Ruth; Aguilar-Castañeda, Erika; Granados-García, Martín; Rodríguez-Orozco, Josana; Herrera-Goepfert, Roberto; Álvarez-Avitia, Miguel Ángel

    2015-01-01

    Glioblastoma multiforme is one of the most aggressive central nervous system tumors and with worse prognosis. Until now,treatments have managed to significantly increase the survival of these patients, depending on age, cognitive status, and autonomy of the individuals themselves. Based on these parameters, both initial or recurrence treatments are performed, as well as monitoring of disease by imaging studies. When the patient enters the terminal phase and curative treatments are suspended, respect for the previous wishes of the patient and development and implementation of palliative therapies must be guaranteed.

  11. Analysis of the expression of Kv10.1 potassium channel in patients with brain metastases and glioblastoma multiforme: impact on survival

    OpenAIRE

    Martínez, Ramón; Stühmer, Walter; Martin, Sabine; Schell, Julian; Reichmann, Andrea; Rohde, Veit; Pardo, Luis

    2015-01-01

    Background Kv10.1, a voltage-gated potassium channel only detected in the healthy brain, was found to be aberrantly expressed in extracerebral cancers. Investigations of Kv10.1 in brain metastasis and glioblastoma multiforme (GBM) are lacking. Methods We analyzed the expression of Kv10.1 by immunohistochemistry in these brain tumors (75 metastasis from different primary tumors, 71 GBM patients) and the influence of a therapy with tricyclic antidepressants (which are Kv10.1 blockers) on surviv...

  12. Expression of lncRNAs in Low-Grade Gliomas and Glioblastoma Multiforme: An In Silico Analysis.

    Directory of Open Access Journals (Sweden)

    Brian J Reon

    2016-12-01

    Full Text Available Each year, over 16,000 patients die from malignant brain cancer in the US. Long noncoding RNAs (lncRNAs have recently been shown to play critical roles in regulating neurogenesis and brain tumor progression. To better understand the role of lncRNAs in brain cancer, we performed a global analysis to identify and characterize all annotated and novel lncRNAs in both grade II and III gliomas as well as grade IV glioblastomas (glioblastoma multiforme [GBM].We determined the expression of all lncRNAs in over 650 brain cancer and 70 normal brain tissue RNA sequencing datasets from The Cancer Genome Atlas (TCGA and other publicly available datasets. We identified 611 induced and 677 repressed lncRNAs in glial tumors relative to normal brains. Hundreds of lncRNAs were specifically expressed in each of the three lower grade glioma (LGG subtypes (IDH1/2 wt, IDH1/2 mut, and IDH1/2 mut 1p19q codeletion and the four subtypes of GBMs (classical, mesenchymal, neural, and proneural. Overlap between the subtype-specific lncRNAs in GBMs and LGGs demonstrated similarities between mesenchymal GBMs and IDH1/2 wt LGGs, with 2-fold higher overlap than would be expected by random chance. Using a multivariate Cox regression survival model, we identified 584 and 282 lncRNAs that were associated with a poor and good prognosis, respectively, in GBM patients. We developed a survival algorithm for LGGs based on the expression of 64 lncRNAs that was associated with patient prognosis in a test set (hazard ratio [HR] = 2.168, 95% CI = 1.765-2.807, p < 0.001 and validation set (HR = 1.921, 95% CI = 1.333-2.767, p < 0.001 of patients from TCGA. The main limitations of this study are that further work is needed to investigate the clinical relevance of our findings, and that validation in an independent dataset is needed to determine the robustness of our survival algorithm.This work identifies a panel of lncRNAs that appear to be prognostic in gliomas and provides a critical

  13. Patterns of relapse in glioblastoma multiforme following concomitant chemoradiotherapy with temozolomide

    Science.gov (United States)

    Tamangani, J; Senthil, L; Cruickshank, G; Spooner, D; Jones, B; Brookes, C; Sanghera, P

    2013-01-01

    Objective: Different methods for contouring target volumes are currently in use in the UK when irradiating glioblastomas post operatively. Both one- and two-phase techniques are offered at different centres. 90% of relapses are recognised to occur locally when using radiotherapy alone. The objective of this evaluation was to determine the pattern of relapse following concomitant radiotherapy with temozolomide (RT-TMZ). Methods: A retrospective analysis of patients receiving RT-TMZ between 2006 and 2010 was performed. Outcome data including survival were calculated from the start of radiotherapy. Analysis of available serial cross-sectional imaging was performed from diagnosis to first relapse. The site of first relapse was defined by the relationship to primary disease. Central relapse was defined as progression of the primary enhancing mass or the appearance of a new enhancing nodule within 2 cm. Results: 105 patients were identified as receiving RT-TMZ. 34 patients were not eligible for relapse analysis owing to either lack of progression or unsuitable imaging. Patterns of first relapse were as follows: 55 (77%) patients relapsed centrally within 2 cm of the original gadolinium-enhanced mass on MRI, 13 (18%) patients relapsed >4 cm from the original enhancement and 3 (4%) relapsed within the contralateral hemisphere. Conclusion: Central relapse remains the predominant pattern of failure following RT-TMZ. Single-phase conformal radiotherapy using a 2-cm margin from the original contrast-enhanced mass is appropriate for the majority of these patients. Advances in knowledge: Central relapse remains the predominant pattern of failure following chemoradiotherapy for glioblastomas. PMID:23385995

  14. Genetic epidemiology of glioblastoma multiforme: confirmatory and new findings from analyses of human leukocyte antigen alleles and motifs.

    Directory of Open Access Journals (Sweden)

    Wei Song

    2009-09-01

    Full Text Available Human leukocyte antigen (HLA class I genes mediate cytotoxic T-lymphocyte responses and natural killer cell function. In a previous study, several HLA-B and HLA-C alleles and haplotypes were positively or negatively associated with the occurrence and prognosis of glioblastoma multiforme (GBM.As an extension of the Upper Midwest Health Study, we have performed HLA genotyping for 149 GBM patients and 149 healthy control subjects from a non-metropolitan population consisting almost exclusively of European Americans. Conditional logistic regression models did not reproduce the association of HLA-B*07 or the B*07-Cw*07 haplotype with GBM. Nonetheless, HLA-A*32, which has previously been shown to predispose GBM patients to a favorable prognosis, was negatively associated with occurrence of GBM (odds ratio=0.41, p=0.04 by univariate analysis. Other alleles (A*29, A*30, A*31 and A*33 within the A19 serology group to which A*32 belongs showed inconsistent trends. Sequencing-based HLA-A genotyping established that A*3201 was the single A*32 allele underlying the observed association. Additional evaluation of HLA-A promoter and exon 1 sequences did not detect any unexpected single nucleotide polymorphisms that could suggest differential allelic expression. Further analyses restricted to female GBM cases and controls revealed a second association with a specific HLA-B sequence motif corresponding to Bw4-80Ile (odds ratio=2.71, p=0.02.HLA-A allelic product encoded by A*3201 is likely to be functionally important to GBM. The novel, sex-specific association will require further confirmation in other representative study populations.

  15. A Metabolic Inhibitory Cocktail for Grave Cancers: Metformin, Pioglitazone and Lithium Combination in Treatment of Pancreatic Cancer and Glioblastoma Multiforme.

    Science.gov (United States)

    Elmaci, İlhan; Altinoz, Meric A

    2016-10-01

    Pancreatic cancer (PC) and glioblastoma multiforme (GBM) are among the human cancers with worst prognosis which require an urgent need for efficient therapies. Here, we propose to apply to treat both malignancies with a triple combination of drugs, which are already in use for different indications. Recent studies demonstrated a considerable link between risk of PC and diabetes. In experimental models, anti-diabetogenic agents suppress growth of PC, including metformin (M), pioglitazone (P) and lithium (L). L is used in psychiatric practice, yet also bears anti-diabetic potential and selectively inhibits glycogen synthase kinase-3 beta (GSK-3β). M, a biguanide class anti-diabetic agent shows anticancer activity via activating AMP-activated protein kinase (AMPK). Glitazones bind to PPAR-γ and inhibit NF-κB, triggering cell proliferation, apoptosis resistance and synthesis of inflammatory cytokines in cancer cells. Inhibition of inflammatory cytokines could simultaneously decrease tumor growth and alleviate cancer cachexia, having a major role in PC mortality. Furthermore, mutual synergistic interactions exist between PPAR-γ and GSK-3β, between AMPK and GSK-3β and between AMPK and PPAR-γ. In GBM, M blocks angiogenesis and migration in experimental models. Very noteworthy, among GBM patients with type 2 diabetes, usage of M significantly correlates with better survival while reverse is true for sulfonylureas. In experimental models, P synergies with ligands of RAR, RXR and statins in reducing growth of GBM. Further, usage of P was found to be lesser in anaplastic astrocytoma and GBM patients, indicating a protective effect of P against high-grade gliomas. L is accumulated in GBM cells faster and higher than in neuroblastoma cells, and its levels further increase with chronic exposure. Recent studies revealed anti-invasive potential of L in GBM cell lines. Here, we propose that a triple-agent regime including drugs already in clinical usage may provide a

  16. Phase 2 study of BCNU and temozolomide for recurrent glioblastoma multiforme: North American Brain Tumor Consortium study1

    Science.gov (United States)

    Prados, Michael D.; Yung, W.K. Alfred; Fine, Howard A.; Greenberg, Harry S.; Junck, Larry; Chang, Susan M.; Nicholas, M. Kelly; Robins, H. Ian; Mehta, Minesh P.; Fink, Karen L.; Jaeckle, Kurt A.; Kuhn, John; Hess, Kenneth R.; Schold, S. Clifford

    2004-01-01

    The purpose of this study was to evaluate the activity, measured in terms of progression-free survival (PFS) and response rates, of 1,3-bis(chloroethyl)-1-nitrosourea (BCNU) plus temozolomide in adult patients with recurrent glioblastoma multiforme. The phase 2 dose and schedule for this trial was BCNU 150 mg/m2 i.v. followed in 2 h by temozolomide 550 mg/m2 as a single oral dose. Treatment was repeated every 6 weeks for up to 8 cycles unless tumor progression was documented. The primary end point was PFS at 6 months (PFS-6). Response was a secondary end point, measured by MR imaging, neurological status, and steroid requirements prior to each 6-week cycle. The median age of eligible patients was 53, and 89.5% had no prior chemotherapy. All patients were evaluable for toxicity and time to progression. The PFS-6 was 21%. Overall survival was 68% at 6 months and 26% at 1 year. The MRI response for 36 patients was 2 partial responses, 2 minor responses, 19 cases of stable disease, and 13 immediate progressions. Median survival was 34 weeks, and median PFS was 11 weeks. Toxicity was primarily myelosuppression; no toxic deaths occurred. Historical phase 2 study data in this patient population show a PFS-6 of 15%. Recent data for use of temozolomide alone have shown a PFS-6 of 21%. We conclude that BCNU plus temozolomide when used in these doses and schedule has only modest activity, with significant toxicity, and appears to be no more effective than single-agent temozolomide. PMID:14769138

  17. Tumor-associated macrophages in glioblastoma multiforme-a suitable target for somatostatin receptor-based imaging and therapy?

    Directory of Open Access Journals (Sweden)

    Constantin Lapa

    Full Text Available Glioblastoma multiforme (GBM is the most common primary brain tumor in adults. Tumor-associated macrophages (TAM have been shown to promote malignant growth and to correlate with poor prognosis. [1,4,7,10-tetraazacyclododecane-NN',N″,N'″-tetraacetic acid]-d-Phe1,Tyr3-octreotate (DOTATATE labeled with Gallium-68 selectively binds to somatostatin receptor 2A (SSTR2A which is specifically expressed and up-regulated in activated macrophages. On the other hand, the role of SSTR2A expression on the cell surface of glioma cells has not been fully elucidated yet. The aim of this study was to non-invasively assess SSTR2A expression of both glioma cells as well as macrophages in GBM.15 samples of patient-derived GBM were stained immunohistochemically for macrophage infiltration (CD68, proliferative activity (Ki67 as well as expression of SSTR2A. Anti-CD45 staining was performed to distinguish between resident microglia and tumor-infiltrating macrophages. In a subcohort, positron emission tomography (PET imaging using 68Ga-DOTATATE was performed and the semiquantitatively evaluated tracer uptake was compared to the results of immunohistochemistry.The amount of microglia/macrophages ranged from 50% in the tumor samples with the vast majority being resident microglial cells. A strong SSTR2A immunostaining was observed in endothelial cells of proliferating vessels, in neurons and neuropile. Only faint immunostaining was identified on isolated microglial and tumor cells. Somatostatin receptor imaging revealed areas of increased tracer accumulation in every patient. However, retention of the tracer did not correlate with immunohistochemical staining patterns.SSTR2A seems not to be overexpressed in GBM samples tested, neither on the cell surface of resident microglia or infiltrating macrophages, nor on the surface of tumor cells. These data suggest that somatostatin receptor directed imaging and treatment strategies are less promising in GBM.

  18. Pulsed Versus Conventional Radiation Therapy in Combination With Temozolomide in a Murine Orthotopic Model of Glioblastoma Multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Lee, David Y.; Chunta, John L.; Park, Sean S.; Huang, Jiayi; Martinez, Alvaro A.; Grills, Inga S.; Krueger, Sarah A.; Wilson, George D. [Department of Radiation Oncology, William Beaumont Hospital, Royal Oak, Michigan (United States); Marples, Brian, E-mail: brian.marples@beaumont.edu [Department of Radiation Oncology, William Beaumont Hospital, Royal Oak, Michigan (United States)

    2013-08-01

    Purpose: To evaluate the efficacy of pulsed low-dose radiation therapy (PLRT) combined with temozolomide (TMZ) as a novel treatment approach for radioresistant glioblastoma multiforme (GBM) in a murine model. Methods and Materials: Orthotopic U87MG hGBM tumors were established in Nu-Foxn1{sup nu} mice and imaged weekly using a small-animal micropositron emission tomography (PET)/computed tomography (CT) system. Tumor volume was determined from contrast-enhanced microCT images and tumor metabolic activity (SUVmax) from the F18-FDG microPET scan. Tumors were irradiated 7 to 10 days after implantation with a total dose of 14 Gy in 7 consecutive days. The daily treatment was given as a single continuous 2-Gy dose (RT) or 10 pulses of 0.2 Gy using an interpulse interval of 3 minutes (PLRT). TMZ (10 mg/kg) was given daily by oral gavage 1 hour before RT. Tumor vascularity and normal brain damage were assessed by immunohistochemistry. Results: Radiation therapy with TMZ resulted in a significant 3- to 4-week tumor growth delay compared with controls, with PLRT+TMZ the most effective. PLRT+TMZ resulted in a larger decline in SUVmax than RT+TMZ. Significant differences in survival were evident. Treatment after PLRT+TMZ was associated with increased vascularization compared with RT+TMZ. Significantly fewer degenerating neurons were seen in normal brain after PLRT+TMZ compared with RT+TMZ. Conclusions: PLRT+TMZ produced superior tumor growth delay and less normal brain damage when compared with RT+TMZ. The differential effect of PLRT on vascularization may confirm new treatment avenues for GBM.

  19. A Phase I Dose Escalation Study of Hypofractionated IMRT Field-in-Field Boost for Newly Diagnosed Glioblastoma Multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Monjazeb, Arta M., E-mail: arta.monjazeb@ucdmc.ucdavis.edu [U.C. Davis School of Medicine, Department of Radiation Oncology, Sacramento, CA (United States); Ayala, Deandra; Jensen, Courtney [Radiation Oncology, Wake Forest University Health Sciences, Winston-Salem, NC (United States); Case, L. Douglas [Biostatistical Sciences, Wake Forest University Health Sciences, Winston-Salem, NC (United States); Bourland, J. Daniel; Ellis, Thomas L. [Neurosurgery, Wake Forest University Health Sciences, Winston-Salem, NC (United States); McMullen, Kevin P.; Chan, Michael D. [Radiation Oncology, Wake Forest University Health Sciences, Winston-Salem, NC (United States); Tatter, Stephen B. [Neurosurgery, Wake Forest University Health Sciences, Winston-Salem, NC (United States); Lesser, Glen J. [Hematology Oncology, Wake Forest University Health Sciences, Winston-Salem, NC (United States); Shaw, Edward G. [Radiation Oncology, Wake Forest University Health Sciences, Winston-Salem, NC (United States)

    2012-02-01

    Objectives: To describe the results of a Phase I dose escalation trial for newly diagnosed glioblastoma multiforme (GBM) using a hypofractionated concurrent intensity-modulated radiotherapy (IMRT) boost. Methods: Twenty-one patients were enrolled between April 1999 and August 2003. Radiotherapy consisted of daily fractions of 1.8 Gy with a concurrent boost of 0.7 Gy (total 2.5 Gy daily) to a total dose of 70, 75, or 80 Gy. Concurrent chemotherapy was not permitted. Seven patients were enrolled at each dose and dose limiting toxicities were defined as irreversible Grade 3 or any Grade 4-5 acute neurotoxicity attributable to radiotherapy. Results: All patients experienced Grade 1 or 2 acute toxicities. Acutely, 8 patients experienced Grade 3 and 1 patient experienced Grade 3 and 4 toxicities. Of these, only two reversible cases of otitis media were attributable to radiotherapy. No dose-limiting toxicities were encountered. Only 2 patients experienced Grade 3 delayed toxicity and there was no delayed Grade 4 toxicity. Eleven patients requiring repeat resection or biopsy were found to have viable tumor and radiation changes with no cases of radionecrosis alone. Median overall and progression-free survival for this cohort were 13.6 and 6.5 months, respectively. One- and 2-year survival rates were 57% and 19%. At recurrence, 15 patients received chemotherapy, 9 underwent resection, and 5 received radiotherapy. Conclusions: Using a hypofractionated concurrent IMRT boost, we were able to safely treat patients to 80 Gy without any dose-limiting toxicity. Given that local failure still remains the predominant pattern for GBM patients, a trial of dose escalation with IMRT and temozolomide is warranted.

  20. Addition of Bevacizumab to Standard Radiation Therapy and Daily Temozolomide Is Associated With Minimal Toxicity in Newly Diagnosed Glioblastoma Multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Vredenburgh, James J., E-mail: vrede001@mc.duke.edu [Department of Medicine, Duke University Medical Center, Durham, NC (United States); Desjardins, Annick [Department of Neurology, Duke University Medical Center, Durham, NC (United States); Kirkpatrick, John P. [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Reardon, David A. [Department of Surgery, Duke University Medical Center, Durham, NC (United States); Department of Pediatrics, Duke University Medical Center, Durham, NC (United States); Peters, Katherine B. [Department of Neurology, Duke University Medical Center, Durham, NC (United States); Herndon, James E.; Marcello, Jennifer [Department of Cancer Center Biostatistics, Duke University Medical Center, Durham, NC (United States); Bailey, Leighann; Threatt, Stevie; Sampson, John; Friedman, Allan [Department of Surgery, Duke University Medical Center, Durham, NC (United States); Friedman, Henry S. [Department of Surgery, Duke University Medical Center, Durham, NC (United States); Department of Pediatrics, Duke University Medical Center, Durham, NC (United States)

    2012-01-01

    Purpose: To determine the safety of the addition of bevacizumab to standard radiation therapy and daily temozolomide for newly diagnosed glioblastoma multiforme (GBM). Methods and Materials: A total of 125 patients with newly diagnosed GBM were enrolled in the study, and received standard radiation therapy and daily temozolomide. All patients underwent a craniotomy and were at least 2 weeks postoperative. Radiation therapy was administered in 1.8-Gy fractions, with the clinical target volume for the primary course treated to a dose of 45 to 50.4 Gy, followed by a boost of 9 to 14.4 Gy, to a total dose of 59.4 Gy. Patients received temozolomide at 75 mg/m{sup 2} daily throughout the course of radiation therapy. Bevacizumab was given at 10 mg/kg intravenously every 14 days, beginning a minimum of 4 weeks postoperatively. Results: Of the 125 patients, 120 (96%) completed the protocol-specified radiation therapy. Five patients had to stop the protocol therapy, 2 patients with pulmonary emboli, and 1 patient each with a Grade 2 central nervous system hemorrhage, Grade 4 pancytopenia, and wound dehiscence requiring surgical intervention. All 5 patients ultimately finished the radiation therapy. After radiation therapy, 3 patients had progressive disease, 2 had severe fatigue and decreased performance status, 1 patient had a colonic perforation, and 1 had a rectal fissure; these 7 patients therefore did not proceed with the protocol-specified adjuvant temozolomide, bevacizumab, and irinotecan. However, 113 patients (90%) were able to continue on study. Conclusions: The addition of bevacizumab to standard radiation therapy and daily temozolomide was found to be associated with minimal toxicity in patients newly diagnosed with GBM.

  1. Differentiation of solitary brain metastasis from glioblastoma multiforme: a predictive multiparametric approach using combined MR diffusion and perfusion

    Energy Technology Data Exchange (ETDEWEB)

    Bauer, Adam Herman; Moser, Franklin G.; Maya, Marcel [Cedars-Sinai Medical Center, Department of Medical Imaging, Los Angeles, CA (United States); Erly, William; Nael, Kambiz [University of Arizona Medical Center, Department of Medical Imaging, Tucson, AZ (United States)

    2015-07-15

    Solitary brain metastasis (MET) and glioblastoma multiforme (GBM) can appear similar on conventional MRI. The purpose of this study was to identify magnetic resonance (MR) perfusion and diffusion-weighted biomarkers that can differentiate MET from GBM. In this retrospective study, patients were included if they met the following criteria: underwent resection of a solitary enhancing brain tumor and had preoperative 3.0 T MRI encompassing diffusion tensor imaging (DTI), dynamic contrast-enhanced (DCE), and dynamic susceptibility contrast (DSC) perfusion. Using co-registered images, voxel-based fractional anisotropy (FA), mean diffusivity (MD), K{sup trans}, and relative cerebral blood volume (rCBV) values were obtained in the enhancing tumor and non-enhancing peritumoral T2 hyperintense region (NET2). Data were analyzed by logistic regression and analysis of variance. Receiver operating characteristic (ROC) analysis was performed to determine the optimal parameter/s and threshold for predicting of GBM vs. MET. Twenty-three patients (14 M, age 32-78 years old) met our inclusion criteria. Pathology revealed 13 GBMs and 10 METs. In the enhancing tumor, rCBV, K{sup trans}, and FA were higher in GBM, whereas MD was lower, neither without statistical significance. In the NET2, rCBV was significantly higher (p = 0.05) in GBM, but MD was significantly lower (p < 0.01) in GBM. FA and K{sup trans} were higher in GBM, though not reaching significance. The best discriminative power was obtained in NET2 from a combination of rCBV, FA, and MD, resulting in an area under the curve (AUC) of 0.98. The combination of MR diffusion and perfusion matrices in NET2 can help differentiate GBM over solitary MET with diagnostic accuracy of 98 %. (orig.)

  2. Extracted magnetic resonance texture features discriminate between phenotypes and are associated with overall survival in glioblastoma multiforme patients.

    Science.gov (United States)

    Chaddad, Ahmad; Tanougast, Camel

    2016-11-01

    GBM is a markedly heterogeneous brain tumor consisting of three main volumetric phenotypes identifiable on magnetic resonance imaging: necrosis (vN), active tumor (vAT), and edema/invasion (vE). The goal of this study is to identify the three glioblastoma multiforme (GBM) phenotypes using a texture-based gray-level co-occurrence matrix (GLCM) approach and determine whether the texture features of phenotypes are related to patient survival. MR imaging data in 40 GBM patients were analyzed. Phenotypes vN, vAT, and vE were segmented in a preprocessing step using 3D Slicer for rigid registration by T1-weighted imaging and corresponding fluid attenuation inversion recovery images. The GBM phenotypes were segmented using 3D Slicer tools. Texture features were extracted from GLCM of GBM phenotypes. Thereafter, Kruskal-Wallis test was employed to select the significant features. Robust predictive GBM features were identified and underwent numerous classifier analyses to distinguish phenotypes. Kaplan-Meier analysis was also performed to determine the relationship, if any, between phenotype texture features and survival rate. The simulation results showed that the 22 texture features were significant with p value <0.05. GBM phenotype discrimination based on texture features showed the best accuracy, sensitivity, and specificity of 79.31, 91.67, and 98.75 %, respectively. Three texture features derived from active tumor parts: difference entropy, information measure of correlation, and inverse difference were statistically significant in the prediction of survival, with log-rank p values of 0.001, 0.001, and 0.008, respectively. Among 22 features examined, three texture features have the ability to predict overall survival for GBM patients demonstrating the utility of GLCM analyses in both the diagnosis and prognosis of this patient population.

  3. What’s the clinical significance of adding diffusion and perfusion MRI in the differentiation of glioblastoma multiforme and solitary brain metastasis?

    Directory of Open Access Journals (Sweden)

    Amr F. Mourad

    2017-09-01

    Full Text Available Objective: To evaluate the additional diagnostic value of diffusion and perfusion MRI in the differentiation of glioblastoma multiforme (GBM and solitary brain metastasis. Patients and methods: This retrospective study included 24 patients with histologically proven brain tumors who underwent conventional MRI with analysis of diffusion (DWI and perfusion (PWI MRI findings of each tumor. The Apparent Diffusion Coefficient (ADC values were calculated in the minimum (ADC-MIN, mean (ADC-MEAN, and maximum (ADC-MAX in all the tumors and the peritumoral regions. The PWI data was expressed as maximum regional cerebral blood volume (rCBV of the tumors and peritumoral regions. Results: After adding diffusion and perfusion to conventional MRI findings, we found that the accuracy of differentiation between glioblastoma multiforme (GBM and solitary metastasis increased from 70% to 90%.There is a significant difference in DWI signal intensity between GBM and metastatic tumors (P < 0.05. The ADC values of GBM were lower than that of metastatic tumors. On perfusion MRI, the maximum rCBV of the peritumoral region (rCBVP of GBM was higher than that of brain metastases (P < 0.001. Conclusion: The addition of diffusion and perfusion to the MRI protocol increases the accuracy of differentiation between GBM and solitary brain metastasis and should be considered routinely. Keywords: Diffusion MRI, Perfusion MRI, GBM, Solitary brain metastases

  4. 336 Small RNA Sequencing of Glioblastoma Multiforme Extracellular Vesicles.

    Science.gov (United States)

    de Mooij, Tristan; McCutcheon, Brandon A; Leontovich, Alexey A; Parney, Ian F

    2016-08-01

    Glioblastoma (GBM) subverts the immune system toward immunosuppression through transfer of oncogenic components, including noncoding RNAs, via extracellular vesicles (EVs). GBM-derived EVs are detectable in blood and cerebrospinal fluid (CSF) and may 1 day serve as liquid biopsies. EVs of 5 adult GBM cell lines generated at our institution from primary GBMs were harvested after serum-free culture and purified via sequential centrifugation. RNA was collected using the miRNAeasy kit (Qiagen) and sequenced with Illumina HiSeq 2000. Data were analyzed using the OASIS-2.0 platform using HG38. MirTarBase and MirDB interrogated validated and predicted microRNA-gene interactions. MDS and hierarchical clustering demonstrated dBT165 as an outlier. Seven hundred twelve of 28 623 interrogated noncoding RNAs were found to be expressed, most of which were not yet associated with GBM EVs. Samples contained miRNAs, piRNAs, snoRNAs, snRNAs, and rRNAs. Hsa-miR-21-5p, hsa-let-7b-5p, hsa-miR-3182, hsa-miR-4448, hsa-let-7i-5p constituted highest overall expression. Hsa-miR-21-5p demonstrated a distinct pathophysiological role, even in hsa-miR-21-5p-low samples, through its unique target signature. Top genes targeted by all miRNAs per sample were highly conserved and specific for cell cycle, PI3K/Akt signaling, p53 and Glioma-curated KEGG pathways. MirDeep2 predicted 4 robustly expressed novel microRNAs with mature sequences aguggggccacgagcugaga, uagugguuaguacccugccuug, acagauugagagcucuuuu, and auuucuguccaacuucug. Predicted gene targets of novel miRNAs closely overlapped those of validated miRNAs. Hsa-miR-5585-3p (P = .04, fold-change: 2.8), hsa_piR_020365 (P = .016, fold-change: 7, 17th highest overall expression) and hsa_piR_008624 (P = .017, fold-change: 3.6) were predictive of <2 years survival. To our knowledge, this is the first report detailing small RNA sequencing of GBM EVs. We demonstrated the expression of a multitude of previously unassociated noncoding RNAs, including 4

  5. The effect of field strength on glioblastoma multiforme response in patients treated with the NovoTTF™-100A system.

    Science.gov (United States)

    Turner, Scott G; Gergel, Thomas; Wu, Hueizhi; Lacroix, Michel; Toms, Steven A

    2014-05-22

    The NovoTTF™-100A system is a portable device that delivers intermediate frequency alternating electric fields (TTFields, tumor treating fields) through transducer arrays arranged on the scalp. An ongoing trial is assessing its efficacy for newly diagnosed glioblastoma multiforme (GBM) and it has been FDA-approved for recurrent GBM.The fields are believed to interfere with formation of the mitotic spindle as well as to affect polar molecules at telophase, thus preventing cell division. The position of the four arrays is unique to each patient and optimized based on the patient's imaging. We present three patients with GBM in whom the fields were adjusted at recurrence and the effects of each adjustment. We believe there may be a higher risk of treatment failure on the edges of the field where the field strength may be lower. The first patient underwent subtotal resection, radiotherapy with temozolomide (TMZ), and then began NovoTTF Therapy with metronomic TMZ. She had good control for nine months; however, new bifrontal lesions developed, and her fields were adjusted with a subsequent radiographic response. Over the next five months, her tumor burden increased and death was preceded by a right insular recurrence. A second patient underwent two resections followed by radiotherapy/TMZ and NovoTTF Therapy/TMZ. Six months later, two new distal lesions were noted, and he underwent further resection with adjustment of his fields. He remained stable over the subsequent year on NovoTTF Therapy and bevacizumab. A third patient on NovoTTF Therapy/TMZ remained stable for two years but developed a small, slow growing enhancing lesion, which was resected, and his fields were adjusted accordingly. Interestingly, the pathology showed giant cell GBM with multiple syncitial-type cells. Based on these observations, we believe that field strength may play a role in 'out of field' recurrences and that either the presence of a certain field strength may select for cells that are of a

  6. Impact of [{sup 11}C]Methionine Positron Emission Tomography for Target Definition of Glioblastoma Multiforme in Radiation Therapy Planning

    Energy Technology Data Exchange (ETDEWEB)

    Matsuo, Masayuki, E-mail: matsuo@kizawa-memorial-hospital.jp [Department of Radiation Oncology, Kizawa Memorial Hospital, Minokamo (Japan); Miwa, Kazuhiro [Chubu Medical Center for Prolonged Traumatic Brain Dysfunction and Department of Clinical Brain Sciences, Gifu University Graduate School of Medicine, Minokamo (Japan); Tanaka, Osamu [Department of Radiation Oncology, Kizawa Memorial Hospital, Minokamo (Japan); Shinoda, Jun [Chubu Medical Center for Prolonged Traumatic Brain Dysfunction and Department of Clinical Brain Sciences, Gifu University Graduate School of Medicine, Minokamo (Japan); Nishibori, Hironori; Tsuge, Yusuke [Department of Radiology, Kizawa Memorial Hospital, Minokamo (Japan); Yano, Hirohito; Iwama, Toru [Department of Neurosurgery, Gifu University School of Medicine, Gifu (Japan); Hayashi, Shinya; Hoshi, Hiroaki [Department of Radiology, Gifu University School of Medicine, Gifu (Japan); Yamada, Jitsuhiro [Chubu Medical Center for Prolonged Traumatic Brain Dysfunction and Department of Clinical Brain Sciences, Gifu University Graduate School of Medicine, Minokamo (Japan); Kanematsu, Masayuki [Department of Radiology, Gifu University School of Medicine, Gifu (Japan); Aoyama, Hidefumi [Department of Radiology, Niigata University School of Medicine, Niigata (Japan)

    2012-01-01

    Purpose: The purpose of this work was to define the optimal margins for gadolinium-enhanced T{sub 1}-weighted magnetic resonance imaging (Gd-MRI) and T{sub 2}-weighted MRI (T{sub 2}-MRI) for delineating target volumes in planning radiation therapy for postoperative patients with newly diagnosed glioblastoma multiforme (GBM) by comparison to carbon-11-labeled methionine positron emission tomography ([{sup 11}C]MET-PET) findings. Methods and Materials: Computed tomography (CT), MRI, and [{sup 11}C]MET-PET were separately performed for radiation therapy planning for 32 patients newly diagnosed with GBM within 2 weeks after undergoing surgery. The extent of Gd-MRI (Gd-enhanced clinical target volume [CTV-Gd]) uptake and that of T{sub 2}-MRI of the CTV (CTV-T{sub 2}) were compared with the extent of [{sup 11}C]MET-PET (CTV--[{sup 11}C]MET-PET) uptake by using CT--MRI or CT--[{sup 11}C]MET-PET fusion imaging. We defined CTV-Gd (x mm) and CTV-T{sub 2} (x mm) as the x-mm margins (where x = 0, 2, 5, 10, and 20 mm) outside the CTV-Gd and the CTV-T{sub 2}, respectively. We evaluated the relationship between CTV-Gd (x mm) and CTV-- [{sup 11}C]MET-PET and the relationship between CTV-T{sub 2} (x mm) and CTV-- [{sup 11}C]MET-PET. Results: The sensitivity of CTV-Gd (20 mm) (86.4%) was significantly higher than that of the other CTV-Gd. The sensitivity of CTV-T{sub 2} (20 mm) (96.4%) was significantly higher than that of the other CTV-T{sub 2} (x = 0, 2, 5, 10 mm). The highest sensitivity and lowest specificity was found with CTV-T{sub 2} (x = 20 mm). Conclusions: It is necessary to use a margin of at least 2 cm for CTV-T{sub 2} for the initial target planning of radiation therapy. However, there is a limit to this setting in defining the optimal margin for Gd-MRI and T{sub 2}-MRI for the precise delineation of target volumes in radiation therapy planning for postoperative patients with GBM.

  7. SU-F-R-17: Advancing Glioblastoma Multiforme (GBM) Recurrence Detection with MRI Image Texture Feature Extraction and Machine Learning

    Energy Technology Data Exchange (ETDEWEB)

    Yu, V; Ruan, D; Nguyen, D; Kaprealian, T; Chin, R; Sheng, K [UCLA School of Medicine, Los Angeles, CA (United States)

    2016-06-15

    Purpose: To test the potential of early Glioblastoma Multiforme (GBM) recurrence detection utilizing image texture pattern analysis in serial MR images post primary treatment intervention. Methods: MR image-sets of six time points prior to the confirmed recurrence diagnosis of a GBM patient were included in this study, with each time point containing T1 pre-contrast, T1 post-contrast, T2-Flair, and T2-TSE images. Eight Gray-level co-occurrence matrix (GLCM) texture features including Contrast, Correlation, Dissimilarity, Energy, Entropy, Homogeneity, Sum-Average, and Variance were calculated from all images, resulting in a total of 32 features at each time point. A confirmed recurrent volume was contoured, along with an adjacent non-recurrent region-of-interest (ROI) and both volumes were propagated to all prior time points via deformable image registration. A support vector machine (SVM) with radial-basis-function kernels was trained on the latest time point prior to the confirmed recurrence to construct a model for recurrence classification. The SVM model was then applied to all prior time points and the volumes classified as recurrence were obtained. Results: An increase in classified volume was observed over time as expected. The size of classified recurrence maintained at a stable level of approximately 0.1 cm{sup 3} up to 272 days prior to confirmation. Noticeable volume increase to 0.44 cm{sup 3} was demonstrated at 96 days prior, followed by significant increase to 1.57 cm{sup 3} at 42 days prior. Visualization of the classified volume shows the merging of recurrence-susceptible region as the volume change became noticeable. Conclusion: Image texture pattern analysis in serial MR images appears to be sensitive to detecting the recurrent GBM a long time before the recurrence is confirmed by a radiologist. The early detection may improve the efficacy of targeted intervention including radiosurgery. More patient cases will be included to create a generalizable

  8. SU-F-R-42: Association of Radiomic and Metabolic Tumor Volumes in Radiation Treatment of Glioblastoma Multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, C; Nagornaya, N; Parra, N; Kwon, D; Ishkanian, F; Markoe, A; Maudsley, A; Stoyanova, R [University of Miami, Miami, Florida (United States)

    2016-06-15

    Purpose: High-throughput extraction of imaging and metabolomic quantitative features from MRI and MR Spectroscopy Imaging (MRSI) of Glioblastoma Multiforme (GBM) results in tens of variables per patient. In radiotherapy (RT) of GBM, the relevant metabolic tumor volumes (MTVs) are related to aberrant levels of N-acetyl Aspartate (NAA) and Choline (Cho). Corresponding Clinical Target Volumes (CTVs) for RT planning are based on Contrast Enhancing T1-weighted MRI (CE-T1w) and T2-weighted/Fluid Attenuated Inversion Recovery (FLAIR) MRI. The objective is to build a framework for investigation of associations between imaging, CTV, and MTV features better understanding of the underlying information in the CTVs and dependencies between these volumes. Methods: Necrotic portions, enhancing lesion and edema were manually contoured on T1w/T2w images for 17 GBM patients. CTVs and MTVs for NAA (MTV{sub NAA}) and Cho (MTV{sub Cho}) were constructed. Tumors were scored categorically for ten semantic imaging traits by neuroradiologist. All features were investigated for redundancy. Two-way correlations between imaging and RT/MTV features were visualized as heat maps. Associations between MTV{sub NAA}, MTV{sub Cho} and imaging features were studied using Spearman correlation. Results: 39 imaging features were computed per patient. Half of the imaging traits were replaced with automatically extracted continuous variables. 21 features were extracted from MTVs/CTVs. There were a high number (43) of significant correlations of imaging with CTVs/MTV{sub NAA} while very few (10) significant correlations were with CTVs/MTV{sub Cho}. MTV{sub NAA} was found to be closely associated with MRI volumes, MTV{sub Cho} remains elusive for characterization with imaging. Conclusion: A framework for investigation of co-dependency between MRI and RT/metabolic features is established. A series of semantic imaging traits were replaced with automatically extracted continuous variables. The approach will

  9. Identification of novel candidate target genes in amplicons of Glioblastoma multiforme tumors detected by expression and CGH microarray profiling.

    Science.gov (United States)

    Ruano, Yolanda; Mollejo, Manuela; Ribalta, Teresa; Fiaño, Concepción; Camacho, Francisca I; Gómez, Elena; de Lope, Angel Rodríguez; Hernández-Moneo, Jose-Luis; Martínez, Pedro; Meléndez, Bárbara

    2006-09-26

    Conventional cytogenetic and comparative genomic hybridization (CGH) studies in brain malignancies have shown that glioblastoma multiforme (GBM) is characterized by complex structural and numerical alterations. However, the limited resolution of these techniques has precluded the precise identification of detailed specific gene copy number alterations. We performed a genome-wide survey of gene copy number changes in 20 primary GBMs by CGH on cDNA microarrays. A novel amplicon at 4p15, and previously uncharacterized amplicons at 13q32-34 and 1q32 were detected and are analyzed here. These amplicons contained amplified genes not previously reported. Other amplified regions containing well-known oncogenes in GBMs were also detected at 7p12 (EGFR), 7q21 (CDK6), 4q12 (PDGFRA), and 12q13-15 (MDM2 and CDK4). In order to identify the putative target genes of the amplifications, and to determine the changes in gene expression levels associated with copy number change events, we carried out parallel gene expression profiling analyses using the same cDNA microarrays. We detected overexpression of the novel amplified genes SLA/LP and STIM2 (4p15), and TNFSF13B and COL4A2 (13q32-34). Some of the candidate target genes of amplification (EGFR, CDK6, MDM2, CDK4, and TNFSF13B) were tested in an independent set of 111 primary GBMs by using FISH and immunohistological assays. The novel candidate 13q-amplification target TNFSF13B was amplified in 8% of the tumors, and showed protein expression in 20% of the GBMs. This high-resolution analysis allowed us to propose novel candidate target genes such as STIM2 at 4p15, and TNFSF13B or COL4A2 at 13q32-34 that could potentially contribute to the pathogenesis of these tumors and which would require futher investigations. We showed that overexpression of the amplified genes could be attributable to gene dosage and speculate that deregulation of those genes could be important in the development and progression of GBM. Our findings highlight

  10. Identification of novel candidate target genes in amplicons of Glioblastoma multiforme tumors detected by expression and CGH microarray profiling

    Directory of Open Access Journals (Sweden)

    Hernández-Moneo Jose-Luis

    2006-09-01

    Full Text Available Abstract Background Conventional cytogenetic and comparative genomic hybridization (CGH studies in brain malignancies have shown that glioblastoma multiforme (GBM is characterized by complex structural and numerical alterations. However, the limited resolution of these techniques has precluded the precise identification of detailed specific gene copy number alterations. Results We performed a genome-wide survey of gene copy number changes in 20 primary GBMs by CGH on cDNA microarrays. A novel amplicon at 4p15, and previously uncharacterized amplicons at 13q32-34 and 1q32 were detected and are analyzed here. These amplicons contained amplified genes not previously reported. Other amplified regions containg well-known oncogenes in GBMs were also detected at 7p12 (EGFR, 7q21 (CDK6, 4q12 (PDGFRA, and 12q13-15 (MDM2 and CDK4. In order to identify the putative target genes of the amplifications, and to determine the changes in gene expression levels associated with copy number change events, we carried out parallel gene expression profiling analyses using the same cDNA microarrays. We detected overexpression of the novel amplified genes SLA/LP and STIM2 (4p15, and TNFSF13B and COL4A2 (13q32-34. Some of the candidate target genes of amplification (EGFR, CDK6, MDM2, CDK4, and TNFSF13B were tested in an independent set of 111 primary GBMs by using FISH and immunohistological assays. The novel candidate 13q-amplification target TNFSF13B was amplified in 8% of the tumors, and showed protein expression in 20% of the GBMs. Conclusion This high-resolution analysis allowed us to propose novel candidate target genes such as STIM2 at 4p15, and TNFSF13B or COL4A2 at 13q32-34 that could potentially contribute to the pathogenesis of these tumors and which would require futher investigations. We showed that overexpression of the amplified genes could be attributable to gene dosage and speculate that deregulation of those genes could be important in the development

  11. Incorporating Cancer Stem Cells in Radiation Therapy Treatment Response Modeling and the Implication in Glioblastoma Multiforme Treatment Resistance

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Victoria Y.; Nguyen, Dan; Pajonk, Frank; Kupelian, Patrick; Kaprealian, Tania; Selch, Michael; Low, Daniel A.; Sheng, Ke, E-mail: ksheng@mednet.ucla.edu

    2015-03-15

    Purpose: To perform a preliminary exploration with a simplistic mathematical cancer stem cell (CSC) interaction model to determine whether the tumor-intrinsic heterogeneity and dynamic equilibrium between CSCs and differentiated cancer cells (DCCs) can better explain radiation therapy treatment response with a dual-compartment linear-quadratic (DLQ) model. Methods and Materials: The radiosensitivity parameters of CSCs and DCCs for cancer cell lines including glioblastoma multiforme (GBM), non–small cell lung cancer, melanoma, osteosarcoma, and prostate, cervical, and breast cancer were determined by performing robust least-square fitting using the DLQ model on published clonogenic survival data. Fitting performance was compared with the single-compartment LQ (SLQ) and universal survival curve models. The fitting results were then used in an ordinary differential equation describing the kinetics of DCCs and CSCs in response to 2- to 14.3-Gy fractionated treatments. The total dose to achieve tumor control and the fraction size that achieved the least normal biological equivalent dose were calculated. Results: Smaller cell survival fitting errors were observed using DLQ, with the exception of melanoma, which had a low α/β = 0.16 in SLQ. Ordinary differential equation simulation indicated lower normal tissue biological equivalent dose to achieve the same tumor control with a hypofractionated approach for 4 cell lines for the DLQ model, in contrast to SLQ, which favored 2 Gy per fraction for all cells except melanoma. The DLQ model indicated greater tumor radioresistance than SLQ, but the radioresistance was overcome by hypofractionation, other than the GBM cells, which responded poorly to all fractionations. Conclusion: The distinct radiosensitivity and dynamics between CSCs and DCCs in radiation therapy response could perhaps be one possible explanation for the heterogeneous intertumor response to hypofractionation and in some cases superior outcome from

  12. Clinical radiobiology of glioblastoma multiforme. Estimation of tumor control probability from various radiotherapy fractionation schemes

    Energy Technology Data Exchange (ETDEWEB)

    Pedicini, Piernicola [I.R.C.C.S.-Regional-Cancer-Hospital-C.R.O.B, Unit of Nuclear Medicine, Department of Radiation and Metabolic Therapies, Rionero-in-Vulture (Italy); Department of Radiation and Metabolic Therapies, I.R.C.C.S.-Regional-Cancer-Hospital-C.R.O.B, Unit of Radiotherapy, Rionero-in-Vulture (Italy); Fiorentino, Alba [Sacro Cuore - Don Calabria Hospital, Radiation Oncology Department, Negrar, Verona (Italy); Simeon, Vittorio [I.R.C.C.S.-Regional-Cancer-Hospital-C.R.O.B, Laboratory of Preclinical and Translational Research, Rionero-in-Vulture (Italy); Tini, Paolo; Pirtoli, Luigi [University of Siena and Tuscany Tumor Institute, Unit of Radiation Oncology, Department of Medicine Surgery and Neurological Sciences, Siena (Italy); Chiumento, Costanza [Department of Radiation and Metabolic Therapies, I.R.C.C.S.-Regional-Cancer-Hospital-C.R.O.B, Unit of Radiotherapy, Rionero-in-Vulture (Italy); Salvatore, Marco [I.R.C.C.S. SDN Foundation, Unit of Nuclear Medicine, Napoli (Italy); Storto, Giovanni [I.R.C.C.S.-Regional-Cancer-Hospital-C.R.O.B, Unit of Nuclear Medicine, Department of Radiation and Metabolic Therapies, Rionero-in-Vulture (Italy)

    2014-10-15

    The aim of this study was to estimate a radiobiological set of parameters from the available clinical data on glioblastoma (GB). A number of clinical trial outcomes from patients affected by GB and treated with surgery and adjuvant radiochemotherapy were analyzed to estimate a set of radiobiological parameters for a tumor control probability (TCP) model. The analytical/graphical method employed to fit the clinical data allowed us to estimate the intrinsic tumor radiosensitivity (α), repair capability (b), and repopulation doubling time (T{sub d}) in a first phase, and subsequently the number of clonogens (N) and kick-off time for accelerated proliferation (T{sub k}). The results were used to formulate a hypothesis for a scheduleexpected to significantly improve local control. The 95 % confidence intervals (CI{sub 95} {sub %}) of all parameters are also discussed. The pooled analysis employed to estimate the parameters summarizes the data of 559 patients, while the studies selected to verify the results summarize data of 104 patients. The best estimates and the CI{sub 95} {sub %} are α = 0.12 Gy{sup -1} (0.10-0.14), b = 0.015 Gy{sup -2} (0.013-0.020), α/b = 8 Gy (5.0-10.8), T{sub d} = 15.4 days (13.2-19.5), N = 1 . 10{sup 4} (1.2 . 10{sup 3} - 1 . 10{sup 5}), and T{sub k} = 37 days (29-46). The dose required to offset the repopulation occurring after 1 day (D{sub prolif}) and starting after T{sub k} was estimated as 0.30 Gy/day (0.22-0.39). The analysis confirms a high value for the α/b ratio. Moreover, a high intrinsic radiosensitivity together with a long kick-off time for accelerated repopulation and moderate repopulation kinetics were found. The results indicate a substantial independence of the duration of the overall treatment and an improvement in the treatment effectiveness by increasing the total dose without increasing the dose fraction. (orig.) [German] Schaetzung eines strahlenbiologischen Parametersatzes auf der Grundlage klinischer Daten bei

  13. Osthole Suppresses the Migratory Ability of Human Glioblastoma Multiforme Cells via Inhibition of Focal Adhesion Kinase-Mediated Matrix Metalloproteinase-13 Expression

    Directory of Open Access Journals (Sweden)

    Cheng-Fang Tsai

    2014-03-01

    Full Text Available Glioblastoma multiforme (GBM is the most common type of primary and malignant tumor occurring in the adult central nervous system. GBM often invades surrounding regions of the brain during its early stages, making successful treatment difficult. Osthole, an active constituent isolated from the dried C. monnieri fruit, has been shown to suppress tumor migration and invasion. However, the effects of osthole in human GBM are largely unknown. Focal adhesion kinase (FAK is important for the metastasis of cancer cells. Results from this study show that osthole can not only induce cell death but also inhibit phosphorylation of FAK in human GBM cells. Results from this study show that incubating GBM cells with osthole reduces matrix metalloproteinase (MMP-13 expression and cell motility, as assessed by cell transwell and wound healing assays. This study also provides evidence supporting the potential of osthole in reducing FAK activation, MMP-13 expression, and cell motility in human GBM cells.

  14. Hepatotoxicity by combination treatment of temozolomide, artesunate and Chinese herbs in a glioblastoma multiforme patient: case report review of the literature.

    Science.gov (United States)

    Efferth, Thomas; Schöttler, Ursula; Krishna, Sanjeev; Schmiedek, Peter; Wenz, Frederik; Giordano, Frank A

    2017-04-01

    Glioblastoma multiforme (GBM) represents an aggressive tumor type with poor prognosis. The majority of GBM patients cannot be cured. There is high willingness among patients for the compassionate use of non-approved medications, which might occasionally lead to profound toxicity. A 65-year-old patient with glioblastoma multiforme (GBM) has been treated with radiochemotherapy including temozolomide (TMZ) after surgery. The treatment outcome was evaluated as stable disease with a tendency to slow tumor progression. In addition to standard medication (ondansetron, valproic acid, levetiracetam, lorazepam, clobazam), the patient took the antimalarial drug artesunate (ART) and a decoction of Chinese herbs (Coptis chinensis, Siegesbeckia orientalis, Artemisia scoparia, Dictamnus dasycarpus). In consequence, the clinical status deteriorated. Elevated liver enzymes were noted with peak values of 238 U/L (GPT/ALAT), 226 U/L (GOT/ASAT), and 347 U/L (γ-GT), respectively. After cessation of ART and Chinese herbs, the values returned back to normal and the patient felt well again. In the literature, hepatotoxicity is well documented for TMZ, but is very rare for ART. Among the Chinese herbs used, Dictamnus dasycarpus has been reported to induce liver injury. Additional medication included valproic acid and levetiracetam, which are also reported to exert hepatotoxicity. While all drugs alone may bear a minor risk for hepatotoxicity, the combination treatment might have caused increased liver enzyme activities. It can be speculated that the combination of these drugs caused liver injury. We conclude that the compassionate use of ART and Chinese herbs is not recommended during standard radiochemotherapy with TMZ for GBM.

  15. The use of hypofractionated intensity-modulated irradiation in the treatment of glioblastoma multiforme: preliminary results of a prospective trial.

    Science.gov (United States)

    Sultanem, Khalil; Patrocinio, Horacio; Lambert, Christine; Corns, Robert; Leblanc, Richard; Parker, William; Shenouda, George; Souhami, Luis

    2004-01-01

    Despite major advances in treatment modalities, the prognosis of patients with glioblastoma multiforme (GBM) remains poor. Exploring hypofractionated regimens to replace the standard 6-week radiotherapy schedule is an attractive strategy as an attempt to prevent accelerated tumor cell repopulation. There is equally interest in dose escalation to the gross tumor volume where the majority of failures occur. We report our preliminary results using hypofractionated intensity-modulated accelerated radiotherapy regimen in the treatment of patients with GBM. Between July 1998 and December 2001, 25 patients with histologically proven diagnosis of GBM, Karnofsky performance status > or =60, and a postoperative tumor volume < or =110 cm3 were treated with a hypofractionated accelerated course of radiotherapy. The gross tumor volume (GTV) was defined as the contrast-enhancing lesion on the postoperative MRI T1-weighted images with the latter fused with computed tomography images for treatment planning. The planning target volume was defined as GTV + 1.5-cm margin. Using forward-planning intensity modulation (step-and-shoot technique), 60 Gy in 20 daily fractions of 3 Gy each were given to the GTV, whereas the planning target volume received a minimum of 40 Gy in 20 fractions of 2 Gy each at its periphery. Treatments were delivered over a 4-week period using 5 daily fractions per week. Dose was prescribed at the isocenter (ICRU point). Three beam angles were used in all of the cases. Treatments were well tolerated. Acute toxicity was limited to increased brain edema during radiotherapy in 2 patients who were on tapering doses of corticosteroids. This was corrected by increasing the steroid dose. At a median follow-up of 8.8 months, no late toxicity was observed. One patient experienced visual loss at 9 months after completion of treatment. MRI suggested nonspecific changes to the optic chiasm. On review of the treatment plan, the total dose to the optic chiasm was confirmed to

  16. Home palliative care and end of life issues in glioblastoma multiforme: results and comments from a homogeneous cohort of patients.

    Science.gov (United States)

    Pompili, Alfredo; Telera, Stefano; Villani, Veronica; Pace, Andrea

    2014-12-01

    Glioblastoma multiforme (GBM) is a rare tumor whose prognosis has remained poor over the years despite innovative radio- and chemotherapies, and important technical advances in neurosurgery such as intraoperative imaging, fluorescence, Cavitron ultrasonic surgical aspirator, and neuronavigation. Particular attention has been dedicated in the last years to the end of life (EOL) period in cancer patients for both ethical and socioeconomic issues. Good palliative care at home avoids improper and expensive hospitalizations, and helps and trains families, caregivers, and patients in facing a difficult situation. In 2012-2013 the authors' group cared for 197 patients with brain tumors. Of these there were 122 with GBMs: 64 died and 58 are still receiving assistance. The clinical conditions are periodically evaluated with the following scales: Barthel Index, Karnofsky Performance Scale, and Mini-Mental State Examination. Home care staff includes 2 neurologists, 5 nurses, 2 psychologists, 3 rehabilitation therapists, and 1 social worker. The intensity of care changes at the different stages of disease, ranging from low to medium levels of intensity at the progression stage (more than 1 access weekly) to high levels of intensity at the EOL stage (at least 3 accesses weekly). Control MRI studies are obtained every 3 months before terminal progression. Overall in this sample of patients there were 2838 home visits and 11,714 days of assistance. Thirty-four patients (14 female and 20 male) died at home (53.1%); 22 (13 female and 9 male) at the hospice (34.4%); and 8 (4 female and 4 male) at the hospital (12.5%). A positive impact on caregivers for home assistance was recorded in 97% of cases, for nursing in 95%, communication in 90%, rehabilitation at home in 92%, and social work help in 85%. Also, 72% had an improvement in their quality of life scores due to rehabilitation. End of life palliative sedation with midazolam was necessary in 11% of cases to obtain good control of

  17. Risk of subsequent cancer among pediatric, adult and elderly patients following a primary diagnosis of glioblastoma multiforme: a population-based study of the SEER database.

    Science.gov (United States)

    Li, Xuezhen; Li, Yanbin; Cao, Yang; Li, Peiliang; Liang, Bo; Sun, Jidian; Feng, Enshan

    2017-11-01

    Purpose/aim of the study: Our objective was to determine the risk of a subsequent malignancy in patients with glioblastoma multiforme (GBM). Data of patients with a primary diagnosis of GBM were extracted from the Surveillance, Epidemiology, and End Results database. Patients were divided into three age groups: pediatric, ≤19 years of age; adult, 20-59 years; elderly, ≥60 years. Outcomes were overall survival and incidence of second cancer. A total of 24 348 patients with primary GBM were identified during the period from 2004 to 2013: 349 pediatric, 9841 adults and 14 518 elderly. There were significant differences in terms of sex, race, registry site, tumor histological type, tumor size and extension among the groups. The median survival time for pediatric, adult and elderly patients was 15, 15 and 5 months, respectively. Of the study population, 1.8% developed a second malignancy and the rates of the three groups were statistically different. Secondary tumors of the cranial nerves and other nervous system were the most common occurrence in the adults and elderly. Female, registry site, giant cell glioblastoma, undergoing surgery or radiation therapy were associated with developing a second malignancy. The risk of a second malignancy in GBM patients is 1.8%, and associated with certain patient and treatment factors.

  18. MicroRNA-139-5p acts as a tumor suppressor by targeting ELTD1 and regulating cell cycle in glioblastoma multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Shouping [Department of Diagnostic Imaging, Linyi People' s Hospital, Linyi, Shandong 276000 (China); Wang, Xianjun [Department of Neurology, Linyi People' s Hospital, Linyi, Shandong 276000 (China); Li, Xiao [Department of Pathology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Cao, Yuandong, E-mail: yuandongcao@sina.com [Department of Radiotherapy, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu Province (China)

    2015-11-13

    MicroRNA-139-5p was identified to be significantly down-regulated in glioblastoma multiform (GBM) by miRNA array. In this report we aimed to clarify its biological function, molecular mechanisms and direct target gene in GBM. Twelve patients with GBM were analyzed for the expression of miR-139-5p by quantitative RT-PCR. miR-139-5p overexpression was established by transfecting miR-139-5p-mimic into U87MG and T98G cells, and its effects on cell proliferation were studied using MTT assay and colony formation assays. We concluded that ectopic expression of miR-139-5p in GBM cell lines significantly suppressed cell proliferation and inducing apoptosis. Bioinformatics coupled with luciferase and western blot assays also revealed that miR-139-5p suppresses glioma cell proliferation by targeting ELTD1 and regulating cell cycle. - Highlights: • miR-139-5p is downregulated in GBM. • miR-139-5p regulates cell proliferation through inducing apoptosis. • miR-139-5p regulates glioblastoma tumorigenesis by targeting 3′UTR of ELTD1. • miR-139-5p is involved in cell cycle regulation.

  19. Inhibition of Notch signaling alters the phenotype of orthotopic tumors formed from glioblastoma multiforme neurosphere cells but does not hamper intracranial tumor growth regardless of endogene Notch pathway signature

    DEFF Research Database (Denmark)

    Kristoffersen, Karina; Nedergaard, Mette Kjølhede; Villingshøj, Mette

    2014-01-01

    BACKGROUND: Brain cancer stem-like cells (bCSC) are cancer cells with neural stem cell (NSC)-like properties found in the devastating brain tumor glioblastoma multiforme (GBM). bCSC are proposed a central role in tumor initiation, progression, treatment resistance and relapse and as such present...... that more strongly induces angiogenesis if the treatment is not sustained. However, this more differentiated cell type might prove to be more sensitive to conventional therapies....

  20. Long-Term Survival and Improved Quality of Life following Multiple Repeat Gamma Knife Radiosurgeries for Recurrent Glioblastoma Multiforme: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Erik W. Larson

    2013-01-01

    Full Text Available The management of glioblastoma multiforme (GBM is in most cases complex and must be specifically tailored to the needs of the patient with the goals of extended survival and improved quality of life. Despite advancements in therapy, treatment outcomes remain almost universally poor. Salvage treatment options for the recurrence of the disease is an area of intense study. The following case highlights the utility of Gamma Knife Radiosurgery (GKRS as a salvage treatment. In this clinical situation, three sequential GKRS treatments led to prolonged survival (beyond four years after diagnosis and improved quality of life in a patient who was unable to receive further chemotherapy regimens and was unwilling to undergo further aggressive resection. To date, there have been few reports of three or more sequential GKRS treatment sessions utilized as salvage therapy for recurrent GBM in patients who can no longer tolerate chemotherapy. This report provides evidence that aggressive local treatment with GKRS at the time of recurrence may be appropriate, depending on a patient’s individual clinical situation, and can lead to prolonged survival and improved quality of life.

  1. Cytogenetic and molecular genetic analyses of giant cell glioblastoma multiforme reveal distinct profiles in giant cell and non-giant cell subpopulations.

    Science.gov (United States)

    Martinez, Ramon; Roggendorf, Wolfgang; Baretton, Gustavo; Klein, Rüdiger; Toedt, Grisha; Lichter, Peter; Schackert, Gabriele; Joos, Stefan

    2007-05-01

    We have comparatively analyzed mechanisms associated with chromosomal and microsatellite instability in giant cell glioblastoma multiforme (gcGBM) and classic GBM. This included microsatellite instability (MSI), loss of expression of four major mismatch repair (MMR) proteins, aberrations of five chromosomes, EGFR copy number, and TP53 mutations. MSI was more frequent among gcGBM (30 vs. 7.8%, P = 0.054). TP53 mutations were more commonly observed in gcGBM (83.3%), whereas EGFR was amplified in just one gcGBM (8.3%). By tumor cell phenotype-specific cytogenetic analysis of gcGBM, increased chromosome copy numbers were identified in 72-84% of giant cells but in only 4-14% of nongiant cells; in classic GBM, intermediate frequencies were noted (11-49%). Chromosome 10 deletions were found in nongiant cells of all gcGBM cases but in only approximately 45% of the cell population in classic GBM. The present study shows a distinct pattern of cytogenetic alterations in nongiant and giant cell phenotypes in gcGBM and suggests that multinuclear giant cells evolve from nongiant tumor cells at an early tumor stage. Furthermore, the data point to differences in the profile of chromosomal and microsatellite instability in gcGBM and classic GBM that might underscore the distinct pathological features of both tumor subtypes.

  2. Decreased survival of glioma patients with astrocytoma grade IV (glioblastoma multiforme) associated with long-term use of mobile and cordless phones.

    Science.gov (United States)

    Carlberg, Michael; Hardell, Lennart

    2014-10-16

    On 31 May 2011 the WHO International Agency for Research on Cancer (IARC) categorised radiofrequency electromagnetic fields (RF-EMFs) from mobile phones, and from other devices that emit similar non-ionising electromagnetic fields, as a Group 2B, i.e., a "possible", human carcinogen. A causal association would be strengthened if it could be shown that the use of wireless phones has an impact on the survival of glioma patients. We analysed survival of 1678 glioma patients in our 1997-2003 and 2007-2009 case-control studies. Use of wireless phones in the >20 years latency group (time since first use) yielded an increased hazard ratio (HR) = 1.7, 95% confidence interval (CI) = 1.2-2.3 for glioma. For astrocytoma grade IV (glioblastoma multiforme; n = 926) mobile phone use yielded HR = 2.0, 95% CI = 1.4-2.9 and cordless phone use HR = 3.4, 95% CI = 1.04-11 in the same latency category. The hazard ratio for astrocytoma grade IV increased statistically significant per year of latency for wireless phones, HR = 1.020, 95% CI = 1.007-1.033, but not per 100 h cumulative use, HR = 1.002, 95% CI = 0.999-1.005. HR was not statistically significant increased for other types of glioma. Due to the relationship with survival the classification of IARC is strengthened and RF-EMF should be regarded as human carcinogen requiring urgent revision of current exposure guidelines.

  3. Computerized assessment of vessel morphological changes during treatment of glioblastoma multiforme: report of a case imaged serially by MRA over four years.

    Science.gov (United States)

    Bullitt, Elizabeth; Ewend, Matthew; Vredenburgh, James; Friedman, Allan; Lin, Weili; Wilber, Kathy; Zeng, Donglin; Aylward, Stephen R; Reardon, David

    2009-08-01

    A patient with glioblastoma multiforme underwent serial computerized analysis of tumor-associated vasculature defined from magnetic resonance angiographic (MRA) scans obtained over almost a four year period. The clinical course included tumor resection with subsequent radiation therapy, a long symptom-free interval, emergence of a new malignant focus, resection of that focus, a stroke, and treatment with chemotherapy and anti-angiogenic therapy. Image analysis methods included segmentation of vessels from each MRA and statistical comparison of vessel morphology over 4 regions of interest (the initial tumor site, the second tumor site, a distant control region, and the entire brain) to the same 4 regions of interest in 50 healthy volunteers (26 females and 24 males; mean age 39 years). Results suggested that following completion of focal radiation therapy (RT) vessel shape abnormalities, if elevated at the time of RT completion, may progressively normalize for months in focal regions, that progressively severe vessel shape abnormalities can precede the emergence of a gadolinium enhancing lesion by months, that lesion resection can produce a dramatic but highly transient drop in abnormal vessel tortuosity both focally and globally, and that treatment with anti-angiogenic agents does not necessarily normalize vessel shape. Quantitative measurements of vessel morphology as defined from MRA may provide useful insights into tumor development and response to therapy.

  4. Dual Inhibition of PDK1 and Aurora Kinase A: An Effective Strategy to Induce Differentiation and Apoptosis of Human Glioblastoma Multiforme Stem Cells.

    Science.gov (United States)

    Daniele, Simona; Sestito, Simona; Pietrobono, Deborah; Giacomelli, Chiara; Chiellini, Grazia; Di Maio, Danilo; Marinelli, Luciana; Novellino, Ettore; Martini, Claudia; Rapposelli, Simona

    2017-01-18

    The poor prognosis of glioblastoma multiforme (GBM) is mainly attributed to drug resistance mechanisms and to the existence of a subpopulation of glioma stem cells (GSCs). Multitarget compounds able to both affect different deregulated pathways and the GSC subpopulation could escape tumor resistance and, most importantly, eradicate the stem cell reservoir. In this respect, the simultaneous inhibition of phosphoinositide-dependent kinase-1 (PDK1) and aurora kinase A (AurA), each one playing a pivotal role in cellular survival/migration/differentiation, could represent an innovative strategy to overcome GBM resistance and recurrence. Herein, the cross-talk between these pathways was investigated, using the single-target reference compounds MP7 (PDK1 inhibitor) and Alisertib (AurA inhibitor). Furthermore, a new ligand, SA16, was identified for its ability to inhibit the PDK1 and the AurA pathways at once, thus proving to be a useful tool for the simultaneous inhibition of the two kinases. SA16 blocked GBM cell proliferation, reduced tumor invasiveness, and triggered cellular apoptosis. Most importantly, the AurA/PDK1 blocker showed an increased efficacy against GSCs, inducing their differentiation and apoptosis. To the best of our knowledge, this is the first report on combined targeting of PDK1 and AurA. This drug represents an attractive multitarget lead scaffold for the development of new potential treatments for GBM and GSCs.

  5. Anti-proliferative and anti-migration effects of Polish propolis combined with Hypericum perforatum L. on glioblastoma multiforme cell line U87MG.

    Science.gov (United States)

    Borawska, Maria H; Naliwajko, Sylwia K; Moskwa, Justyna; Markiewicz-Żukowska, Renata; Puścion-Jakubik, Anna; Soroczyńska, Jolanta

    2016-09-20

    Propolis and Hypericum perforatum L. are natural products which contain many active compounds and have numerous beneficial effects, including an antitumor effect. Gliobmastoma multiforme (GBM) is a common primary brain tumor with poor prognosis and limited treatment options. In this study, the effect of propolis (EEP) combined with H. perforatum L. (HPE) on glioblastoma cell line U87MG was investigated for the first time. Anti-proliferative activity of EEP, HPE and their combination (EEP + HPE) was determined by a cytotoxicity test, DNA binding by [(3)H]-thymidine incorporation and cell migration assay. Anti-metastatic properties in U87MG treated with EEP, HPE and EEP + HPE were estimated on cells migration test (scratch assay) and metalloproteinases (MMP2 and MMP9) secretion (gelatin zymography). Combination of HPE and EEP extracts was found to have a time- and dose-dependent inhibitory effect on the viability of U87MG cells. This effect was significantly higher (p propolis and ethanolic extract of fresh-cut H. perforatum L. was proved the ability to reduce invasiveness of glioma cells through the inhibition of MMP2 and MMP9 secretion and suppression of cell migration. It has a more potent anti-proliferative effect on U87MG glioma cell line compared to using propolis and H. perforatum L. separately. Further studies are required to verify whether the examined extracts can activate apoptotic pathways.

  6. Multi-parametric (ADC/PWI/T2-w) image fusion approach for accurate semi-automatic segmentation of tumorous regions in glioblastoma multiforme.

    Science.gov (United States)

    Fathi Kazerooni, Anahita; Mohseni, Meysam; Rezaei, Sahar; Bakhshandehpour, Gholamreza; Saligheh Rad, Hamidreza

    2015-02-01

    Glioblastoma multiforme (GBM) brain tumor is heterogeneous in nature, so its quantification depends on how to accurately segment different parts of the tumor, i.e. viable tumor, edema and necrosis. This procedure becomes more effective when metabolic and functional information, provided by physiological magnetic resonance (MR) imaging modalities, like diffusion-weighted-imaging (DWI) and perfusion-weighted-imaging (PWI), is incorporated with the anatomical magnetic resonance imaging (MRI). In this preliminary tumor quantification work, the idea is to characterize different regions of GBM tumors in an MRI-based semi-automatic multi-parametric approach to achieve more accurate characterization of pathogenic regions. For this purpose, three MR sequences, namely T2-weighted imaging (anatomical MR imaging), PWI and DWI of thirteen GBM patients, were acquired. To enhance the delineation of the boundaries of each pathogenic region (peri-tumoral edema, viable tumor and necrosis), the spatial fuzzy C-means algorithm is combined with the region growing method. The results show that exploiting the multi-parametric approach along with the proposed semi-automatic segmentation method can differentiate various tumorous regions with over 80 % sensitivity, specificity and dice score. The proposed MRI-based multi-parametric segmentation approach has the potential to accurately segment tumorous regions, leading to an efficient design of the pre-surgical treatment planning.

  7. Analysis of the expression of Kv10.1 potassium channel in patients with brain metastases and glioblastoma multiforme: impact on survival.

    Science.gov (United States)

    Martínez, Ramón; Stühmer, Walter; Martin, Sabine; Schell, Julian; Reichmann, Andrea; Rohde, Veit; Pardo, Luis

    2015-11-03

    Kv10.1, a voltage-gated potassium channel only detected in the healthy brain, was found to be aberrantly expressed in extracerebral cancers. Investigations of Kv10.1 in brain metastasis and glioblastoma multiforme (GBM) are lacking. We analyzed the expression of Kv10.1 by immunohistochemistry in these brain tumors (75 metastasis from different primary tumors, 71 GBM patients) and the influence of a therapy with tricyclic antidepressants (which are Kv10.1 blockers) on survival. We also investigated Kv10.1 expression in the corresponding primary carcinomas of metastases patients. We observed positive Kv10.1 expression in 85.3 % of the brain metastases and in 77.5 % of GBMs. Patients with brain metastases, showing low Kv10.1 expression, had a significantly longer overall survival compared to those patients with high Kv10.1 expression. Metastases patients displaying low Kv10.1 expression and also receiving tricyclic antidepressants showed a significantly longer median overall survival as compared to untreated patients. Our data show that Kv10.1 is not only highly expressed in malignant tumors outside CNS, but also in the most frequent cerebral cancer entities, metastasis and GBM, which remain incurable in spite of aggressive multimodal therapies. Our results extend the correlation between dismal prognosis and Kv10.1 expression to patients with brain metastases or GBMs and, moreover, they strongly suggest a role of tricyclic antidepressants for personalized therapy of brain malignancies.

  8. Giant cell glioblastoma in the pediatric age group: Report of two cases

    OpenAIRE

    Sachin Anil Borkar; Lakshmiprasad, G.; Kiran Chikkanahalli Subbarao; Mehar Chand Sharma; Ashok K Mahapatra

    2013-01-01

    Giant cell glioblastoma multiforme is a rare subgroup of glioblastoma multiforme. It constitutes about 5% of all glioblastoma cases. Pediatric giant cell glioblastoma is extremely rare. We report two such cases of giant cell glioblastoma in pediatric age group (≤18 years). The pertinent literature is reviewed regarding this uncommon entity.

  9. Giant cell glioblastoma in the pediatric age group: Report of two cases.

    Science.gov (United States)

    Borkar, Sachin Anil; Lakshmiprasad, G; Subbarao, Kiran Chikkanahalli; Sharma, Mehar Chand; Mahapatra, Ashok K

    2013-01-01

    Giant cell glioblastoma multiforme is a rare subgroup of glioblastoma multiforme. It constitutes about 5% of all glioblastoma cases. Pediatric giant cell glioblastoma is extremely rare. We report two such cases of giant cell glioblastoma in pediatric age group (≤18 years). The pertinent literature is reviewed regarding this uncommon entity.

  10. Dose-escalated intensity-modulated radiotherapy and irradiation of subventricular zones in relation to tumor control outcomes of patients with glioblastoma multiforme

    Directory of Open Access Journals (Sweden)

    Kusumawidjaja G

    2016-03-01

    Full Text Available Grace Kusumawidjaja,1 Patricia Zhun Hong Gan,1 Whee Sze Ong,2 Achiraya Teyateeti,3 Pittaya Dankulchai,3 Daniel Yat Harn Tan,1 Eu Tiong Chua,1 Kevin Lee Min Chua,1 Chee Kian Tham,4 Fuh Yong Wong,1 Melvin Lee Kiang Chua1,5 1Division of Radiation Oncology, National Cancer Centre, Singapore; 2Division of Clinical Trials and Epidemiological Sciences, National Cancer Centre, Singapore; 3Department of Radiology, Division of Radiation Oncology, Faculty of Medicine Siriraj Hospital, Mahidol University, Thailand; 4Division of Medical Oncology, National Cancer Centre, Singapore; 5Duke-NUS Graduate Medical School, Singapore Background: Glioblastoma multiforme (GBM is the most aggressive primary brain tumor with high relapse rate. In this study, we aimed to determine if dose-escalated (DE radiotherapy improved tumor control and survival in GBM patients. Methods: We conducted a retrospective analysis of 49 and 23 newly-diagnosed histology-proven GBM patients, treated with DE radiotherapy delivered in 70 Gy (2.33 Gy per fraction and conventional doses (60 Gy, respectively, between 2007 and 2013. Clinical target volumes for 70 and 60 Gy were defined by 0.5 and 2.0 cm expansion of magnetic resonance imaging T1-gadolinium-enhanced tumor/surgical cavity, respectively. Bilateral subventricular zones (SVZ were contoured on a co-registered pre-treatment magnetic resonance imaging and planning computed tomography dataset as a 5 mm wide structure along the lateral margins of the lateral ventricles. Survival outcomes of both cohorts were compared using log-rank test. Radiation dose to SVZ in the DE cohort was evaluated. Results: Median follow-up was 13.6 and 15.1 months for the DE- and conventionally-treated cohorts, respectively. Median overall survival (OS of patients who received DE radiotherapy was 15.2 months (95% confidence interval [CI] =11.0–18.6, while median OS of the latter cohort was 18.4 months (95% CI =12.5–31.4, P=0.253. Univariate analyses of

  11. MALAT1 is a prognostic factor in glioblastoma multiforme and induces chemoresistance to temozolomide through suppressing miR-203 and promoting thymidylate synthase expression.

    Science.gov (United States)

    Chen, Wei; Xu, Xin-Ke; Li, Jun-Liang; Kong, Kuan-Kei; Li, Hui; Chen, Cheng; He, Jing; Wang, Fangyu; Li, Ping; Ge, Xiao-Song; Li, Fang-Cheng

    2017-04-04

    Glioblastoma multiforme (GBM) is the most malignant brain tumor with limited therapeutic options. Temozolomide (TMZ) is a novel cytotoxic agent used as first-line chemotherapy for GBM, however, some individual cells can't be isolated for surgical resection and show treatment-resistance, thus inducing poor prognosis. By using the HiSeq sequencing and bioinformatics methods, we identified lncRNAs showing different expression levels in TMZ-resistant and non-resistant patients. RT-qPCR was then performed in tissues and serum samples, and lncRNA MALAT1 was finally identified to show considerable discriminating potential to identify responding patients from non-responding patients. Moreover, high serum MALAT1 expression was associated with poor chemoresponse and survival in GBM patients receiving TMZ treatment. Subsequently, the TMZ resistant cell lines were established, and the CCK8 assay showed that lncRNA MALAT1 knockdown significantly reversed TMZ resistance in GBM cells. The gain and loss-function experiments revealed that miR-203 was down-regulated by MALAT1 and this interaction has reciprocal effects. Besides, thymidylate synthase (TS) mRNA was identified as a direct target of miR-203. LncRNA MALAT1 inhibition re-sensitized TMZ resistant cells through up-regulating miR-203 and down-regulating TS expression. On the other hand, MALAT1 overexpression promoted resistance by suppressing miR-203 and promoting TS expression. In conclusion, our integrated approach demonstrates that enhanced expression of lncRNA MALAT1 confers a potent poor therapeutic efficacy and inhibition of MALAT1 levels could be a future direction to develop a novel therapeutic strategy to overcome TMZ resistance in GBM patients.

  12. Successful inhibition of intracranial human glioblastoma multiforme xenograft growth via systemic adenoviral delivery of soluble endostatin and soluble vascular endothelial growth factor receptor-2: laboratory investigation.

    Science.gov (United States)

    Szentirmai, Oszkar; Baker, Cheryl H; Bullain, Szofia S; Lin, Ning; Takahashi, Masaya; Folkman, Judah; Mulligan, Richard C; Carter, Bob S

    2008-05-01

    Glioblastoma multiforme (GBM) is characterized by neovascularization, raising the question of whether angiogenic blockade may be a useful therapeutic strategy for this disease. It has been suggested, however, that, to be useful, angiogenic blockade must be persistent and at levels sufficient to overcome proangiogenic signals from tumor cells. In this report, the authors tested the hypothesis that sustained high concentrations of 2 different antiangiogenic proteins, delivered using a systemic gene therapy strategy, could inhibit the growth of established intracranial U87 human GBM xenografts in nude mice. Mice harboring established U87 intracranial tumors received intravenous injections of adenoviral vectors encoding either the extracellular domain of vascular endothelial growth factor receptor-2-Fc fusion protein (Ad-VEGFR2-Fc) alone, soluble endostatin (Ad-ES) alone, a combination of Ad-VEGFR2-Fc and Ad-ES, or immunoglobulin 1-Fc (Ad-Fc) as a control. Three weeks after treatment, magnetic resonance imaging-based determination of tumor volume showed that treatment with Ad-VEGFR2-Fc, Ad-ES, or Ad-VEGFR2-Fc in combination with Ad-ES, produced 69, 59, and 74% growth inhibition, respectively. Bioluminescent monitoring of tumor growth revealed growth inhibition in the same treatment groups to be 62, 74, and 72%, respectively. Staining with proliferating cell nuclear antigen and with terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling showed reduced tumor cell proliferation and increased apoptosis in all antiangiogenic treatment groups. These results suggest that systemic delivery and sustained production of endostatin and soluble VEGFR2 can slow intracranial glial tumor growth by both reducing cell proliferation and increasing tumor apoptosis. This work adds further support to the concept of using antiangiogenesis therapy for intracranial GBM.

  13. Successful inhibition of intracranial human glioblastoma multiforme xenograft growth via systemic adenoviral delivery of soluble endostatin and soluble vascular endothelial growth factor receptor-2

    Science.gov (United States)

    Szentirmai, Oszkar; Baker, Cheryl H.; Bullain, Szofia S.; Lin, Ning; Takahashi, Masaya; Folkman, Judah; Mulligan, Richard C.; Carter, Bob S.

    2015-01-01

    Object Glioblastoma multiforme (GBM) is characterized by neovascularization, raising the question of whether angiogenic blockade may be a useful therapeutic strategy for this disease. It has been suggested, however, that, to be useful, angiogenic blockade must be persistent and at levels sufficient to overcome proangiogenic signals from tumor cells. In this report, the authors tested the hypothesis that sustained high concentrations of 2 different antiangiogenic proteins, delivered using a systemic gene therapy strategy, could inhibit the growth of established intracranial U87 human GBM xenografts in nude mice. Methods Mice harboring established U87 intracranial tumors received intravenous injections of adenoviral vectors encoding either the extracellular domain of vascular endothelial growth factor receptor-2-Fc fusion protein (Ad-VEGFR2-Fc) alone, soluble endostatin (Ad-ES) alone, a combination of Ad-VEGFR2-Fc and Ad-ES, or immunoglobulin 1-Fc (Ad-Fc) as a control. Results Three weeks after treatment, magnetic resonance imaging-based determination of tumor volume showed that treatment with Ad-VEGFR2-Fc, Ad-ES, or Ad-VEGFR2-Fc in combination with Ad-ES, produced 69, 59, and 74% growth inhibition, respectively. Bioluminescent monitoring of tumor growth revealed growth inhibition in the same treatment groups to be 62, 74, and 72%, respectively. Staining with proliferating cell nuclear antigen and with terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick-end labeling showed reduced tumor cell proliferation and increased apoptosis in all antiangiogenic treatment groups. Conclusions These results suggest that systemic delivery and sustained production of endostatin and soluble VEGFR2 can slow intracranial glial tumor growth by both reducing cell proliferation and increasing tumor apoptosis. This work adds further support to the concept of using antiangiogenesis therapy for intracranial GBM. PMID:18447716

  14. The influence of sex and the presence of giant cells on postoperative long-term survival in adult patients with supratentorial glioblastoma multiforme.

    Science.gov (United States)

    Shinojima, Naoki; Kochi, Masato; Hamada, Jun-ichiro; Nakamura, Hideo; Yano, Shigetoshi; Makino, Keishi; Tsuiki, Hiromasa; Tada, Kenji; Kuratsu, Jun-ichi; Ishimaru, Yasuji; Ushio, Yukitaka

    2004-08-01

    Glioblastoma multiforme (GBM) remains incurable by conventional treatments, although some patients experience long-term survival. A younger age, a higher Karnofsky Performance Scale (KPS) score, more aggressive treatment, and long progression-free intervals have been reported to be positively associated with long-term postoperative patient survival. The aim of this retrospective study was the identification of additional favorable prognostic factors affecting long-term survival in surgically treated adult patients with supratentorial GBM. Of 113 adult patients newly diagnosed with histologically verified supratentorial GBM who were enrolled in Phase III trials during the period between 1987 and 1998, six (5.3%) who survived for longer than 5 years were defined as long-term survivors, whereas the remaining 107 patients served as controls. All six were women and were compared with the controls; they were younger (mean age 44.2 years, range 31-60 years), and their preoperative KPS scores were higher (mean 85, range 60-100). Four of the six patients underwent gross-total resection. In five patients (83.3%) the progression-free interval was longer than 5 years and in three a histopathological diagnosis of giant cell GBM was made. This diagnosis was not made in the other 107 patients. Among adult patients with supratentorial GBM, female sex and histopathological characteristics consistent with giant cell GBM may be predictive of a better survival rate, as may traditional factors (that is, younger age, good KPS score, more aggressive resection, and a long progression-free interval).

  15. Decreased Survival of Glioma Patients with Astrocytoma Grade IV (Glioblastoma Multiforme Associated with Long-Term Use of Mobile and Cordless Phones

    Directory of Open Access Journals (Sweden)

    Michael Carlberg

    2014-10-01

    Full Text Available On 31 May 2011 the WHO International Agency for Research on Cancer (IARC categorised radiofrequency electromagnetic fields (RF-EMFs from mobile phones, and from other devices that emit similar non-ionising electromagnetic fields, as a Group 2B, i.e., a “possible”, human carcinogen. A causal association would be strengthened if it could be shown that the use of wireless phones has an impact on the survival of glioma patients. We analysed survival of 1678 glioma patients in our 1997–2003 and 2007–2009 case-control studies. Use of wireless phones in the >20 years latency group (time since first use yielded an increased hazard ratio (HR = 1.7, 95% confidence interval (CI = 1.2–2.3 for glioma. For astrocytoma grade IV (glioblastoma multiforme; n = 926 mobile phone use yielded HR = 2.0, 95% CI = 1.4–2.9 and cordless phone use HR = 3.4, 95% CI = 1.04–11 in the same latency category. The hazard ratio for astrocytoma grade IV increased statistically significant per year of latency for wireless phones, HR = 1.020, 95% CI = 1.007–1.033, but not per 100 h cumulative use, HR = 1.002, 95% CI = 0.999–1.005. HR was not statistically significant increased for other types of glioma. Due to the relationship with survival the classification of IARC is strengthened and RF-EMF should be regarded as human carcinogen requiring urgent revision of current exposure guidelines.

  16. TSPO Imaging in Glioblastoma Multiforme: A Direct Comparison Between 123I-CLINDE SPECT, 18F-FET PET, and Gadolinium-Enhanced MR Imaging.

    Science.gov (United States)

    Jensen, Per; Feng, Ling; Law, Ian; Svarer, Claus; Knudsen, Gitte M; Mikkelsen, Jens D; de Nijs, Robin; Larsen, Vibeke A; Dyssegaard, Agnete; Thomsen, Gerda; Fischer, Walter; Guilloteau, Denis; Pinborg, Lars H

    2015-09-01

    Here we compare translocator protein (TSPO) imaging using 6-chloro-2-(4'-(123)I-iodophenyl)-3-(N,N-diethyl)-imidazo[1,2-a]pyridine-3-acetamide SPECT ((123)I-CLINDE) and amino acid transport imaging using O-(2-(18)F-fluoroethyl)-l-tyrosine PET ((18)F-FET) and investigate whether (123)I-CLINDE is superior to (18)F-FET in predicting progression of glioblastoma multiforme (GBM) at follow-up. Three patients with World Health Organization grade IV GBM were scanned with (123)I-CLINDE SPECT, (18)F-FET PET, and gadolinium-enhanced MR imaging. Molecular imaging data were compared with follow-up gadolinium-enhanced MR images or contrast-enhanced CT scans. The percentage overlap between volumes of interest (VOIs) of increased (18)F-FET uptake and (123)I-CLINDE binding was variable (12%-42%). The percentage overlap of MR imaging baseline VOIs was greater for (18)F-FET (79%-93%) than (123)I-CLINDE (15%-30%). In contrast, VOIs of increased contrast enhancement at follow-up compared with baseline overlapped to a greater extent with baseline (123)I-CLINDE VOIs than (18)F-FET VOIs (21% vs. 8% and 72% vs. 55%). Our preliminary results suggest that TSPO brain imaging in GBM may be a useful tool for predicting tumor progression at follow-up and may be less susceptible to changes in blood-brain barrier permeability than (18)F-FET. Larger studies are warranted to test the clinical potential of TSPO imaging in GBM, including presurgical planning and radiotherapy. © 2015 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  17. IDH mutation and MGMT promoter methylation are associated with the pseudoprogression and improved prognosis of glioblastoma multiforme patients who have undergone concurrent and adjuvant temozolomide-based chemoradiotherapy.

    Science.gov (United States)

    Li, Hailong; Li, Jiye; Cheng, Gang; Zhang, Jianning; Li, Xuezhen

    2016-12-01

    This study aimed to investigate the potential association between IDH mutation and O 6 -methyl-guanine methyl transferase (MGMT) gene promoter methylation and pseudoprogression disease (psPD) in glioblastoma multiforme (GBM) patients after concurrent temozolomide (TMZ)-based chemoradiotherapy. A total of 157 GBM patients who received concurrent TMZ-based chemoradiotherapy were included in this retrospective study. The association between psPD and a number of demographic and genetic factors, including IDH mutation and MGMT promoter methylation, were analyzed based on logistic regression, Cox regression, and multivariate analysis. Of the 157 GBM patients, 145 (92.36%) patients, including 38 patients with psPD, 38 patients with early progression (ePD), and 69 patients with non-progression (non-PD), were followed up for six to 56 months. We identified a higher rate of MGMT promoter methylation and IDH1 mutation in psPD patients compared with ePD patients (P=0.002). In addition, MGMT promoter methylation and IDH1 mutation predicted a high probability of psPD development in GBM patients (P=0.001 and PIDH1 mutation, Karnofsky performance score (KPS) ≥70, and psPD were associated with a significantly longer overall survival of GBM patients (P=0.001, 0.001, 0.002, and PIDH mutation had a cumulative effect on the OS of GBM patients. GBM patients with psPD (39.2±2.1months, PIDH1 mutation were associated with PsPD and predicted a longer median survival in GBM patients after TMZ-based chemoradiotherapy. Genetic analyses of the MGMT promoter and IDH1 may allow us to effectively treat GBM patients. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Type 2 Diabetes Mellitus and Glioblastoma Multiforme-Assessing Risk and Survival: Results of a Large Retrospective Study and Systematic Review of the Literature.

    Science.gov (United States)

    Barami, Kaveh; Lyon, Liisa; Conell, Carol

    2017-10-01

    Despite studies showing a positive correlation between type 2 diabetes mellitus (DM2), a modifiable risk factor, and various cancer types, the link remains controversial in the setting of glioblastoma multiforme (GBM). In this study, we assessed whether DM2 and DM2-associated factors were associated with a higher risk of developing GBM and also determined if DM2 affected the survival of patients with GBM. A cross-sectional case-control study of 1144 GBM cases diagnosed between 2000 and 2013 of which 969 patients matched for age and sex was performed to assess the association between DM2, hyperlipidemia, and obesity with the incidence of GBM. A longitudinal study of the patients with GBM was also performed to assess the association between the effect of DM2 and GBM survival. No association was seen between DM2, hyperlipidemia, obesity, and GBM. DM2 was associated with poorer survival in univariate testing yet not in multivariate testing. Diabetic patients with GBM had good glycemic control. Older patients had poorer survival and overall survival improved over years of study. DM2, hyperlipidemia, and obesity were not associated with increased risk of developing GBM, and DM2 itself does not seem to influence survival among these patients. This finding might be related to good glycemic control in this cohort. Survey of the literature consistently shows that hyperglycemia is associated with poorer survival. Our findings suggest that rather than the presence or absence of DM2, glycemic control seems to be more important in the survival of patients with GBM, which warrants future investigation. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. The SGK1 Kinase Inhibitor SI113 Sensitizes Theranostic Effects of the 64CuCl2 in Human Glioblastoma Multiforme Cells

    Directory of Open Access Journals (Sweden)

    Giada Catalogna

    2017-08-01

    Full Text Available Background/Aims: The importance of copper in the metabolism of cancer cells has been widely studied in the last 20 years and a clear-cut association between copper levels and cancer deregulation has been established. Copper-64, emitting positrons and β-radiations, is indicated for the labeling of a large number of molecules suitable for radionuclide imaging as well as radionuclide therapy. Glioblastoma multiforme (GBM is the CNS tumor with the worse prognosis, characterized by high number of recurrences and strong resistance to chemo-radio therapy, strongly affecting patients survival. We have recently discovered and studied the small molecule SI113, as inhibitor of SGK1, a serine/threonine protein kinase, that affects several neoplastic phenotypes and signaling cascades. The SI113-dependent SGK1 inhibition induces cell death, blocks proliferation, perturbs cell cycle progression and restores chemo-radio sensibility by modulating SGK1-related substrates. In the present paper we aim to characterize the combined effects of 64CuCl2 and SI113 on human GBM cell lines with variable p53 expression. Methods: Cell viability, cell death and stress/authopagic related pathways were then analyzed by FACS and WB-based assays, after exposure to SI113 and/or 64CuCl2. Results: We demonstrate here, that i 64CuCl2 is able to induce a time and dose dependent modulation of cell viability (with different IC50 values in highly malignant gliomas and that the co-treatment with SI113 leads to ii additive/synergistic effects in terms of cell death; iii enhancement of the effects of ionizing radiations, probably by a TRC1 modulation; iv modulation of the autophagic response. Conclusions: Evidence reported here underlines the therapeutic potential of the combined treatment with SI113 and 64CuCl2 in GBM cells.

  20. Polish natural bee honeys are anti-proliferative and anti-metastatic agents in human glioblastoma multiforme U87MG cell line.

    Directory of Open Access Journals (Sweden)

    Justyna Moskwa

    Full Text Available Honey has been used as food and a traditional medicament since ancient times. However, recently many scientists have been concentrating on the anti-oxidant, anti-proliferative, anti-inflammatory and other properties of honey. In this study, we investigated for the first time an anticancer effect of different honeys from Poland on tumor cell line - glioblastoma multiforme U87MG. Anti-proliferative activity of honeys and its interferences with temozolomide were determined by a cytotoxicity test and DNA binding by [H3]-thymidine incorporation. A gelatin zymography was used to conduct an evaluation of metalloproteinases (MMP-2 and MMP-9 expression in U87MG treatment with honey samples. The honeys were previously tested qualitatively (diastase activity, total phenolic content, lead and cadmium content. The data demonstrated that the examined honeys have a potent anti-proliferative effect on U87MG cell line in a time- and dose-dependent manner, being effective at concentrations as low as 0.5% (multifloral light honey - viability 53% after 72 h of incubation. We observed that after 48 h, combining honey with temozolomide showed a significantly higher inhibitory effect than the samples of honey alone. We observed a strong inhibition of MMP-2 and MMP-9 for the tested honeys (from 20 to 56% and from 5 to 58% compared to control, respectively. Our results suggest that Polish honeys have an anti-proliferative and anti-metastatic effect on U87MG cell line. Therefore, natural bee honey can be considered as a promising adjuvant treatment for brain tumors.

  1. Boron neutron capture therapy (BNCT) for glioblastoma multiforme: a phase II study evaluating a prolonged high-dose of boronophenylalanine (BPA).

    Science.gov (United States)

    Henriksson, Roger; Capala, Jacek; Michanek, Annika; Lindahl, Sten-Ake; Salford, Leif G; Franzén, Lars; Blomquist, Erik; Westlin, Jan-Erik; Bergenheim, A Tommy

    2008-08-01

    To evaluate the efficacy and safety of boron neutron capture therapy (BNCT) for glioblastoma multiforme (GBM) using a novel protocol for the boronophenylalanine-fructose (BPA-F) infusion. This phase II study included 30 patients, 26-69 years old, with a good performance status of which 27 have undergone debulking surgery. BPA-F (900 mg BPA/kg body weight) was given i.v. over 6h. Neutron irradiation started 2h after the completion of the infusion. Follow-up reports were monitored by an independent clinical research institute. The boron-blood concentration during irradiation was 15.2-33.7 microg/g. The average weighted absorbed dose to normal brain was 3.2-6.1 Gy (W). The minimum dose to the tumour volume ranged from 15.4 to 54.3 Gy (W). Seven patients suffered from seizures, 8 from skin/mucous problem, 5 patients were stricken by thromboembolism and 4 from abdominal disturbances in close relation to BNCT. Four patients displayed 9 episodes of grade 3-4 events (WHO). At the time for follow-up, minimum ten months, 23 out of the 29 evaluable patients were dead. The median time from BNCT treatment to tumour progression was 5.8 months and the median survival time after BNCT was 14.2 months. Following progression, 13 patients were given temozolomide, two patients were re-irradiated, and two were re-operated. Patients treated with temozolomide lived considerably longer (17.7 vs. 11.6 months). The quality of life analysis demonstrated a progressive deterioration after BNCT. Although, the efficacy of BNCT in the present protocol seems to be comparable with conventional radiotherapy and the treatment time is shorter, the observed side effects and the requirement of complex infrastructure and higher resources emphasize the need of further phase I and II studies, especially directed to improve the accumulation of (10)B in tumour cells.

  2. Development and in vitro testing of liposomal gadolinium-formulations for neutron capture therapy of glioblastoma multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Peters, Tanja

    2013-10-29

    For the improvement of current neutron capture therapy, several liposomal formulations of neutron capture agent gadolinium were developed and tested in a glioma cell model. Formulations were analyzed regarding physicochemical and biological parameters, such as size, zeta potential, uptake into cancer cells and performance under neutron irradiation. The neutron and photon dose derived from intracellular as well as extracellular Gd was calculated via Monte Carlo simulations and set in correlation with the reduction of cell survival after irradiation. To investigate the suitability of Gd as a radiosensitizer for photon radiation, cells were also irradiated with synchrotron radiation in addition to clinically used photons generated by linear accelerator. Irradiation with neutrons led to significantly lower survival for Gd-liposome-treated F98 and LN229 cells, compared to irradiated control cells and cells treated with non-liposomal Gd-DTPA. Correlation between Gd-content and -dose and respective cell survival displayed proportional relationship for most of the applied formulations. Photon irradiation experiments showed the proof-of-principle for the radiosensitizer approach, although the photon spectra currently used have to be optimized for higher efficiency of the radiosensitizer. In conclusion, the newly developed Gd-liposomes show great potential for the improvement of radiation treatment options for highly malignant glioblastoma.

  3. SU-E-T-183: Feasibility of Extreme Dose Escalation for Glioblastoma Multiforme Using 4π Radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, D; Rwigema, J; Yu, V; Kaprealian, T; Kupelian, P; Selch, M; Low, D; Sheng, K [Department of Radiation Oncology, UCLA, Los Angeles, CA (United States)

    2014-06-01

    Purpose: GBM recurrence primarily occurs inside or near the high-dose radiation field of original tumor site requiring greater than 100 Gy to significantly improve local control. We utilize 4π non-coplanar radiotherapy to test the feasibility of planning target volume (PTV) margin expansions or extreme dose escalations without incurring additional radiation toxicities. Methods: 11 GBM patients treated with VMAT to a prescription dose of 59.4 Gy or 60 Gy were replanned with 4π. Original VMAT plans were created with 2 to 4 coplanar or non-coplanar arcs using 3 mm hi-res MLC. The 4π optimization, using 5 mm MLC, selected and inverse optimized 30 beams from a candidate pool of 1162 beams evenly distributed through 4π steradians. 4π plans were first compared to clinical plans using the same prescription dose. Two more studies were then performed to respectively escalate the GTV and PTV doses to 100 Gy, followed by a fourth plan expanding the PTV by 5 mm and maintaining the prescription dose. Results: The standard 4π plan significantly reduced (p<0.01) max and mean doses to critical structures by a range of 47.0–98.4% and 61.0–99.2%, respectively. The high dose PTV/high dose GTV/expanded PTV studies showed a reduction (p<0.05) or unchanged* (p>0.05) maximum dose of 72.1%/86.7%/77.1% (chiasm), 7.2%*/27.7%*/30.7% (brainstem), 39.8%*/84.2%/51.9%* (spinal cord), 69.0%/87.0%/66.9% (L eye), 76.2%/88.1%/84.1% (R eye), 95.0%/98.6%/97.5% (L lens), 93.9%/98.8%/97.6% (R lens), 74.3%/88.5%/72.4% (L optical nerve), 80.4%/91.3%/75.7% (R optical nerve), 64.8%/84.2%/44.9%* (L cochlea), and 85.2%/93.0%/78.0% (R cochlea), respectively. V30 and V36 for both brain and (brain - PTV) were reduced for all cases except the high dose PTV plan. PTV dose coverage increased for all 4π plans. Conclusion: Extreme dose escalation or further margin expansion is achievable using 4π, maintaining or reducing OAR doses. This study indicates that clinical trials employing 4π delivery using

  4. Association of WT1 IgG antibody against WT1 peptide with prolonged survival in glioblastoma multiforme patients vaccinated with WT1 peptide.

    Science.gov (United States)

    Oji, Yusuke; Hashimoto, Naoya; Tsuboi, Akihiro; Murakami, Yui; Iwai, Miki; Kagawa, Naoki; Chiba, Yasuyoshi; Izumoto, Shuichi; Elisseeva, Olga; Ichinohasama, Ryo; Sakamoto, Junichi; Morita, Satoshi; Nakajima, Hiroko; Takashima, Satoshi; Nakae, Yoshiki; Nakata, Jun; Kawakami, Manabu; Nishida, Sumiyuki; Hosen, Naoki; Fujiki, Fumihiro; Morimoto, Soyoko; Adachi, Mayuko; Iwamoto, Masahiro; Oka, Yoshihiro; Yoshimine, Toshiki; Sugiyama, Haruo

    2016-09-15

    We previously evaluated Wilms' tumor gene 1 (WT1) peptide vaccination in a large number of patients with leukemia or solid tumors and have reported that HLA-A*24:02 restricted, 9-mer WT1-235 peptide (CYTWNQMNL) vaccine induces cellular immune responses and elicits WT1-235-specific cytotoxic T lymphocytes (CTLs). However, whether this vaccine induces humoral immune responses to produce WT1 antibody remains unknown. Thus, we measured IgG antibody levels against the WT1-235 peptide (WT1-235 IgG antibody) in patients with glioblastoma multiforme (GBM) receiving the WT1 peptide vaccine. The WT1-235 IgG antibody, which was undetectable before vaccination, became detectable in 30 (50.8%) of a total of 59 patients during 3 months of WT1 peptide vaccination. The dominant WT1-235 IgG antibody subclass was Th1-type, IgG1 and IgG3 . WT1-235 IgG antibody production was significantly and positively correlated with both progression-free survival (PFS) and overall survival (OS). Importantly, the combination of WT1-235 IgG antibody production and positive delayed type-hypersensitivity (DTH) to the WT1-235 peptide was a better prognostic marker for long-term OS than either parameter alone. These results suggested that WT1-235 peptide vaccination induces not only WT1-235-specific CTLs as previously described but also WT1-235-specific humoral immune responses associated with antitumor cellular immune response. Our results indicate that the WT1 IgG antibody against the WT1 peptide may be a useful predictive marker, with better predictive performance in combination with DTH to WT1 peptide, and provide a new insight into the antitumor immune response induction in WT1 peptide vaccine-treated patients. © 2016 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  5. Differentiating primary CNS lymphoma from glioblastoma multiforme: assessment using arterial spin labeling, diffusion-weighted imaging, and {sup 18}F-fluorodeoxyglucose positron emission tomography

    Energy Technology Data Exchange (ETDEWEB)

    Yamashita, Koji; Yoshiura, Takashi; Hiwatashi, Akio; Togao, Osamu; Abe, Koichiro; Kikuchi, Kazufumi; Maruoka, Yasuhiro; Honda, Hiroshi [Kyushu University, Department of Clinical Radiology, Graduate School of Medical Sciences, Fukuoka (Japan); Yoshimoto, Koji; Mizoguchi, Masahiro [Kyushu University, Department of Neurosurgery, Graduate School of Medical Sciences, Fukuoka (Japan); Suzuki, Satoshi O.; Iwaki, Toru [Kyushu University, Department of Neuropathology, Graduate School of Medical Sciences, Fukuoka (Japan)

    2013-02-15

    Our purpose was to evaluate the diagnostic performance of arterial spin labeling (ASL) perfusion imaging, diffusion-weighted imaging (DWI), and {sup 18}F-fluorodeoxyglucose positron emission tomography (FDG-PET) in differentiating primary central nervous system lymphomas (PCNSLs) from glioblastoma multiformes (GBMs). Fifty-six patients including 19 with PCNSL and 37 with GBM were retrospectively studied. From the ASL data, an absolute tumor blood flow (aTBF) and a relative tumor blood flow (rTBF) were obtained within the enhancing portion of each tumor. In addition, the minimum apparent diffusion coefficient (ADCmin) and the maximum standard uptake value (SUVmax) were obtained from DWI and FDG-PET data, respectively. Each of the four parameters was compared between PCNSLs and GBMs using Kruskal-Wallis test. The performance in discriminating between PCNSLs and GBMs was evaluated using the receiver-operating characteristics analysis. Area-under-the-curve (AUC) values were compared among the four parameters using a nonparametric method. The aTBF, rTBF, and ADCmin were significantly higher in GBMs (mean aTBF {+-} SD = 91.6 {+-} 56.0 mL/100 g/min, mean rTBF {+-} SD = 2.61 {+-} 1.61, mean ADCmin {+-} SD = 0.78 {+-} 0.19 x 10{sup -3} mm{sup 2}/s) than in PCNSLs (mean aTBF {+-} SD = 37.3 {+-} 10.5 mL/100 g/min, mean rTBF {+-} SD = 1.24 {+-} 0.37, mean ADCmin {+-} SD = 0.61 {+-} 0.13 x 10{sup -3} mm{sup 2}/s) (p < 0.005, respectively). In addition, SUVmax was significantly lower in GBMs (mean {+-} SD = 13.1 {+-} 6.34) than in PCNSLs (mean {+-} SD = 22.5 {+-} 7.83) (p < 0.005). The AUC for aTBF (0.888) was higher than those for rTBF (0.810), ADCmin (0.768), and SUVmax (0.848), although their difference was not statistically significant. ASL perfusion imaging is useful for differentiating PCNSLs from GBMs as well as DWI and FDG-PET. (orig.)

  6. Phase 1/2 Trials of Temozolomide, Motexafin Gadolinium, and 60-Gy Fractionated Radiation for Newly Diagnosed Supratentorial Glioblastoma Multiforme: Final Results of RTOG 0513

    Energy Technology Data Exchange (ETDEWEB)

    Brachman, David G., E-mail: david.brachman@dignityhealth.org [Arizona Oncology Services Foundation, Scottsdale, Arizona (United States); Barrow Neurological Institute, St. Joseph' s Hospital and Medical Center, Phoenix, Arizona (United States); Pugh, Stephanie L. [Radiation Therapy Oncology Group Statistical Center, Philadelphia, Pennsylvania (United States); Ashby, Lynn S. [Barrow Neurological Institute, St. Joseph' s Hospital and Medical Center, Phoenix, Arizona (United States); Thomas, Theresa A. [Arizona Oncology Services Foundation, Scottsdale, Arizona (United States); Dunbar, Erin M. [University of Florida College of Medicine, Gainesville, Florida (United States); Narayan, Samir [St. Joseph Mercy Hospital, Ann Arbor, Michigan (United States); Robins, H. Ian [University of Wisconsin Hospital, Madison, Wisconsin (United States); Bovi, Joseph A. [Medical College of Wisconsin, Milwaukee, Wisconsin (United States); Rockhill, Jason K. [University of Washington Medical Center, Seattle, Washington (United States); Won, Minhee [Barrow Neurological Institute, St. Joseph' s Hospital and Medical Center, Phoenix, Arizona (United States); Curran, Walter P. [Emory University, Atlanta, Georgia (United States)

    2015-04-01

    Purpose: The purpose of phase 1 was to determine the maximum tolerated dose (MTD) of motexafin gadolinium (MGd) given concurrently with temozolomide (TMZ) and radiation therapy (RT) in patients with newly diagnosed supratentorial glioblastoma multiforme (GBM). Phase 2 determined whether this combination improved overall survival (OS) and progression-free survival (PFS) in GBM recursive partitioning analysis class III to V patients compared to therapies for recently published historical controls. Methods and Materials: Dose escalation in phase 1 progressed through 3 cohorts until 2 of 6 patients experienced dose-limiting toxicity or a dose of 5 mg/kg was reached. Once MTD was established, a 1-sided 1-sample log-rank test at significance level of .1 had 85% power to detect a median survival difference (13.69 vs 18.48 months) with 60 deaths over a 12-month accrual period and an additional 18 months of follow-up. OS and PFS were estimated using the Kaplan-Meier method. Results: In phase 1, 24 patients were enrolled. The MTD established was 5 mg/kg, given intravenously 5 days a week for the first 10 RT fractions, then 3 times a week for the duration of RT. The 7 patients enrolled in the third dose level and the 94 enrolled in phase 2 received this dose. Of these 101 patients, 87 were eligible and evaluable. Median survival time was 15.6 months (95% confidence interval [CI]: 12.9-17.6 months), not significantly different from that of the historical control (P=.36). Median PFS was 7.6 months (95% CI: 5.7-9.6 months). One patient (1%) experienced a grade 5 adverse event possibly related to therapy during the concurrent phase, and none experience toxicity during adjuvant TMZ therapy. Conclusions: Treatment was well tolerated, but median OS did not reach improvement specified by protocol compared to historical control, indicating that the combination of standard RT with TMZ and MGd did not achieve a significant survival advantage.

  7. DCE-MRI prediction of survival time for patients with glioblastoma multiforme: using an adaptive neuro-fuzzy-based model and nested model selection technique.

    Science.gov (United States)

    Dehkordi, Azimeh N V; Kamali-Asl, Alireza; Wen, Ning; Mikkelsen, Tom; Chetty, Indrin J; Bagher-Ebadian, Hassan

    2017-09-01

    This pilot study investigates the construction of an Adaptive Neuro-Fuzzy Inference System (ANFIS) for the prediction of the survival time of patients with glioblastoma multiforme (GBM). ANFIS is trained by the pharmacokinetic (PK) parameters estimated by the model selection (MS) technique in dynamic contrast enhanced-magnetic resonance imaging (DCE-MRI) data analysis, and patient age. DCE-MRI investigations of 33 treatment-naïve patients with GBM were studied. Using the modified Tofts model and MS technique, the following physiologically nested models were constructed: Model 1, no vascular leakage (normal tissue); Model 2, leakage without efflux; Model 3, leakage with bidirectional exchange (influx and efflux). For each patient, the PK parameters of the three models were estimated as follows: blood plasma volume (vp ) for Model 1; vp and volume transfer constant (K(trans) ) for Model 2; vp , K(trans) and rate constant (kep ) for Model 3. Using Cox regression analysis, the best combination of the estimated PK parameters, together with patient age, was identified for the design and training of ANFIS. A K-fold cross-validation (K = 33) technique was employed for training, testing and optimization of ANFIS. Given the survival time distribution, three classes of survival were determined and a confusion matrix for the correct classification fraction (CCF) of the trained ANFIS was estimated as an accuracy index of ANFIS's performance. Patient age, kep and ve (K(trans) /kep ) of Model 3, and K(trans) of Model 2, were found to be the most effective parameters for training ANFIS. The CCF of the trained ANFIS was 84.8%. High diagonal elements of the confusion matrix (81.8%, 90.1% and 81.8% for Class 1, Class 2 and Class 3, respectively), with low off-diagonal elements, strongly confirmed the robustness and high performance of the trained ANFIS for predicting the three survival classes. This study confirms that DCE-MRI PK analysis, combined with the MS technique and ANFIS

  8. MiR-196a exerts its oncogenic effect in glioblastoma multiforme by inhibition of IκBα both in vitro and in vivo

    KAUST Repository

    Yang, Guang

    2014-01-23

    BackgroundRecent studies have revealed that miR-196a is upregulated in glioblastoma multiforme (GBM) and that it correlates with the clinical outcome of patients with GBM. However, its potential regulatory mechanisms in GBM have never been reported.MethodsWe used quantitative real-time PCR to assess miR-196a expression levels in 132 GBM specimens in a single institution. Oncogenic capability of miR-196a was detected by apoptosis and proliferation assays in U87MG and T98G cells. Immunohistochemistry was used to determine the expression of IκBα in GBM tissues, and a luciferase reporter assay was carried out to confirm whether IκBα is a direct target of miR-196a. In vivo, xenograft tumors were examined for an antiglioma effect of miR-196a inhibitors.ResultsWe present for the first time evidence that miR-196a could directly interact with IκBα 3′-UTR to suppress IκBα expression and subsequently promote activation of NF-κB, consequently promoting proliferation of and suppressing apoptosis in GBM cells both in vitro and in vivo. Our study confirmed that miR-196a was upregulated in GBM specimens and that high levels of miR-196a were significantly correlated with poor outcome in a large cohort of GBM patients. Our data from human tumor xenografts in nude mice treated with miR-196 inhibitors demonstrated that inhibition of miR-196a could ameliorate tumor growth in vivo.ConclusionsMiR-196a exerts its oncogenic effect in GBM by inhibiting IκBα both in vitro and in vivo. Our findings provide new insights into the pathogenesis of GBM and indicate that miR-196a may predict clinical outcome of GBM patients and serve as a new therapeutic target for GBM. © 2014 © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Exophytic giant cell glioblastoma of the medulla oblongata.

    Science.gov (United States)

    Luetjens, Goetz; Mirzayan, M Javad; Brandis, Almuth; Krauss, Joachim K

    2009-03-01

    Giant cell glioblastoma is a rare variant within the spectrum of glioblastoma multiforme (GBM) tumors. A giant cell glioblastoma may be associated with a better prognosis than the common type of GBM after combined treatment involving tumor resection and radiochemotherapy. A giant cell glioblastoma may occur at various sites in the brain and spinal cord. To the authors' knowledge, this type of tumor has not been previously reported as arising as an exophytic tumor from the medulla oblongata. The authors report on a 40-year-old man who presented with a large tumor located in the caudal fourth ventricle. The tumor was removed completely and the patient underwent percutaneous radiotherapy with 60 Gy and concomitant chemotherapy with temozolomide. Histopathological examination of the tumor revealed the typical features of a giant cell glioblastoma. At the 2-year follow-up the patient was doing well and showed no signs of tumor recurrence. It is important to identify variants of GBM because they may predict favorable long-term outcome, even when they arise from the caudal brainstem.

  10. Robust texture features for response monitoring of glioblastoma multiforme on T1-weighted and T2-FLAIR MR images: a preliminary investigation in terms of identification and segmentation.

    Science.gov (United States)

    Assefa, Dawit; Keller, Harald; Ménard, Cynthia; Laperriere, Normand; Ferrari, Ricardo J; Yeung, Ivan

    2010-04-01

    Image texture has recently attracted much attention in providing quantitative features that are unique to various different tissue types, in particular, in MR images of the brain. Such image features may be useful for tumor response quantification. As a first step, one needs to establish if these features are sensitive to different tissues of clinical relevance. Here, a novel method of texture analysis based on the Hartley transform has been investigated and applied to MR images of glioblastoma multiforme (GBM). Contrast-enhanced T1-weighted gradient-echo and T2-FLAIR spin-echo MR images of 27 GBM patients acquired prior to radiation therapy were available for analysis. Before computing texture features on these images, a novel image transformation was employed in the form of a power map computed from the localized Hartley transform of the image. Haralick statistical texture features were then computed based on the power map. This method was compared to the standard approach of obtaining texture features directly from the image. Twelve different features were computed on different resolution levels. On a regional resolution level, image texture features were identified that are able to correctly classify entire regions within T1-weighted and T2-FLAIR brain MR images of GBM patients into abnormal (containing contrast-enhancing GBM tumor) and brain tissue. Various metrics [area under the ROC curve (AUC), maximum accuracy, and Canberra distance] have been computed to quantify the usefulness of these features. On a local resolution level, it was investigated which of these features are able to provide a voxel-by-voxel enhancement that could be used for assisting the segmentation of the gross tumor volume on T1 images. The "gold standard" for this analysis was a gross tumor volume corresponding to the contrast-enhancing lesion visualized on T1-weighted images as segmented by a radiation oncologist. The Sum-mean and Variance features demonstrated the best performance

  11. CD133/CD15 defines distinct cell subpopulations with differential in vitro clonogenic activity and stem cell-related gene expression profile in in vitro propagated glioblastoma multiforme-derived cell line with a PNET-like component.

    Science.gov (United States)

    Kahlert, Ulf D; Bender, Noemi O; Maciaczyk, Donata; Bogiel, Tomasz; Bar, Eli E; Eberhart, Charles G; Nikkhah, Guido; Maciaczyk, Jarosław

    2012-01-01

    Glioblastoma multiforme (GBM), as many other solid tumours, contains a subpopulation of cells termed cancer stem-like cells responsible for the initiation and propagation of tumour growth. However, a unique immunophenotype/surface antigen composition for the clear identification of brain tumour stem cells (BTSC) has not yet been found. Here we report a novel code of cell surface markers for the identification of different cell subpopulations in neurospheres derived from a GBM with a primitive neuroectodermal tumour (PNET)-like component (GBM-PNET). These subgroups differ in their CD133/CD15 expression pattern and resemble cells with different stem-like genotype and developmental pathway activation levels. Strikingly, clonogenic analysis of cultures differentially expressing the investigated markers enabled the identification of distinct subpopulations of cells endowed with stem cell characteristics. High clonogenicity could be found in CD133(-)/CD15(-) and CD133(+)/CD15(+) but not in CD133(-)/CD15(+) cells. Moreover, cell subpopulations with pronounced clonogenic growth were characterized by high expression of stem cell-related genes. Interestingly, these observations were unique for GBM-PNET and differed from ordinary GBM cultures derived from tumours lacking a PNET component. This work elucidates the complex molecular heterogeneity of in vitro propagated glioblastoma-derived cells and potentially contributes to the development of novel diagnostic modalities aiming at the identification of the brain tumour stem-like cell population in a subgroup of GBMs.

  12. Urticaria Multiforme

    Science.gov (United States)

    Bernardo, Sebastian G.; Kovalerchik, Olga; Ahmad, Moneeb

    2013-01-01

    Urticaria multiforme is a benign cutaneous hypersensitivity reaction seen in pediatric patients that is characterized by the acute and transient onset of blanchable, annular, polycyclic, erythematous wheals with dusky, ecchymotic centers in association with acral edema. It is most commonly misdiagnosed as erythema multiforme, a serum-sickness-like reaction, or urticarial vasculitis. Since these three diagnoses represent distinct clinical entities with unique prognoses and management strategies, it is important that physicians distinguish urticaria multiforme from its clinical mimics in order to optimize patient care. By performing a thorough history and physical examination, the astute clinician can make the correct diagnosis and develop an appropriate, effective treatment plan while avoiding unnecessary biopsies and laboratory evaluations. The authors report a case of urticaria multiforme in a four-year-old girl in order to emphasize the distinctive morphological manifestations of this rare, albeit unique, disease seen in the pediatric population. PMID:23556035

  13. Erythema multiforme

    Science.gov (United States)

    French LE, Prins C. Erythema multiforme, Stevens-Johnson syndrome and toxic epidermal necrolysis. In: Bolognia JL, Jorizzo JL, Schaffer JV, eds. Dermatology . 3rd ed. Philadelphia, PA: Elsevier Saunders; 2012:chap 20. ...

  14. A very rare case report of long-term survival: A patient operated on in 1994 of glioblastoma multiforme and currently in perfect health

    Directory of Open Access Journals (Sweden)

    Riccardo Caruso

    2017-01-01

    Conclusion: The fact that there are extremely rare cases of long-term survival and even zero recurrence of the glioblastoma should serve as a stimulus to continue the research effort and not give up the fight against this tumor on a day-to-day basis.

  15. A clinical review of treatment outcomes in glioblastoma multiforme - the validation in a non-trial population of the results of a randomised Phase III clinical trial: has a more radical approach improved survival?

    LENUS (Irish Health Repository)

    Rock, K

    2012-01-03

    Objective: Glioblastoma multiforme (GBM) accounts for up to 60% of all malignant primary brain tumours in adults, occurring in 2-3 cases per 100 000 in Europe and North America. In 2005, a Phase III clinical trial demonstrated a significant improvement in survival over 2, and subsequently, 5 years with the addition of concurrent and adjuvant temozolomide (TMZ) to radical radiotherapy (RT) (Stupp R, Hegi M, van den Bent M, et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol 2009:10:459-66). The aim of this study was to investigate if the demonstrated improved survival in the literature translated to clinical practice.Methods: This was a retrospective study including all patients with histologically proven GBM diagnosed from 1999 to 2008 and treated with adjuvant RT at our institution. A total of 273 patients were identified. Statistical analysis was carried out using SPSS v18.Results: The median survival for the whole group (n = 273) over the 10-year period was 7.6 months (95% confidence interval 6.7-8.4 months). Overall, the cumulative probability of survival at 1 and 2 years was 31.5 and 9.4%, respectively. In total, 146 patients received radical RT. 103 patients were treated with radical RT and TMZ and 43 patients received radical RT alone. The median survival for patients receiving radical RT with TMZ was 13.4 months (95% CI 10.9-15.8 months) vs 8.8 months for radical RT alone (95% CI 6.9 - 10.7 months, p = 0.006). 2-year survival figures were 21.2 vs 4.7%, respectively. On multivariate analysis, independent predictors of survival included KPS, RT dose, TMZ and extent of surgery. The strongest predictors of poorer outcome based on the hazard ratio were palliative RT, followed by not receiving TMZ chemotherapy, then KPS <90 and a biopsy only surgical approach.Conclusion: This paper demonstrates

  16. A clinical review of treatment outcomes in glioblastoma multiforme - the validation in a non-trial population of the results of a randomised Phase III clinical trial: has a more radical approach improved survival?

    LENUS (Irish Health Repository)

    2012-02-01

    Objective: Glioblastoma multiforme (GBM) accounts for up to 60% of all malignant primary brain tumours in adults, occurring in 2-3 cases per 100 000 in Europe and North America. In 2005, a Phase III clinical trial demonstrated a significant improvement in survival over 2, and subsequently, 5 years with the addition of concurrent and adjuvant temozolomide (TMZ) to radical radiotherapy (RT) (Stupp R, Hegi M, van den Bent M, et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol 2009:10:459-66). The aim of this study was to investigate if the demonstrated improved survival in the literature translated to clinical practice.Methods: This was a retrospective study including all patients with histologically proven GBM diagnosed from 1999 to 2008 and treated with adjuvant RT at our institution. A total of 273 patients were identified. Statistical analysis was carried out using SPSS v18.Results: The median survival for the whole group (n = 273) over the 10-year period was 7.6 months (95% confidence interval 6.7-8.4 months). Overall, the cumulative probability of survival at 1 and 2 years was 31.5 and 9.4%, respectively. In total, 146 patients received radical RT. 103 patients were treated with radical RT and TMZ and 43 patients received radical RT alone. The median survival for patients receiving radical RT with TMZ was 13.4 months (95% CI 10.9-15.8 months) vs 8.8 months for radical RT alone (95% CI 6.9 - 10.7 months, p = 0.006). 2-year survival figures were 21.2 vs 4.7%, respectively. On multivariate analysis, independent predictors of survival included KPS, RT dose, TMZ and extent of surgery. The strongest predictors of poorer outcome based on the hazard ratio were palliative RT, followed by not receiving TMZ chemotherapy, then KPS <90 and a biopsy only surgical approach.Conclusion: This paper demonstrates improved

  17. Diagnostic examination performance by using microvascular leakage, cerebral blood volume, and blood flow derived from 3-T dynamic susceptibility-weighted contrast-enhanced perfusion MR imaging in the differentiation of glioblastoma multiforme and brain metastasis

    Energy Technology Data Exchange (ETDEWEB)

    Server, Andres; Nakstad, Per H. [Oslo University Hospital-Ullevaal, Section of Neuroradiology, Department of Radiology and Nuclear Medicine, Oslo (Norway); University of Oslo, Oslo (Norway); Orheim, Tone E.D. [Oslo University Hospital, Interventional Centre, Oslo (Norway); Graff, Bjoern A. [Oslo University Hospital-Ullevaal, Department of Radiology and Nuclear Medicine, Oslo (Norway); Josefsen, Roger [Oslo University Hospital-Ullevaal, Department of Neurosurgery, Oslo (Norway); Kumar, Theresa [Oslo University Hospital-Ullevaal, Department of Pathology, Oslo (Norway)

    2011-05-15

    Conventional magnetic resonance (MR) imaging has limited capacity to differentiate between glioblastoma multiforme (GBM) and metastasis. The purposes of this study were: (1) to compare microvascular leakage (MVL), cerebral blood volume (CBV), and blood flow (CBF) in the distinction of metastasis from GBM using dynamic susceptibility-weighted contrast-enhanced perfusion MR imaging (DSC-MRI), and (2) to estimate the diagnostic accuracy of perfusion and permeability MR imaging. A prospective study of 61 patients (40 GBMs and 21 metastases) was performed at 3 T using DSC-MRI. Normalized rCBV and rCBF from tumoral (rCBVt, rCBFt), peri-enhancing region (rCBVe, rCBFe), and by dividing the value in the tumor by the value in the peri-enhancing region (rCBVt/e, rCBFt/e), as well as MVL were calculated. Hemodynamic and histopathologic variables were analyzed statistically and Spearman/Pearson correlations. Receiver operating characteristic curve analysis was performed for each of the variables. The rCBVe, rCBFe, and MVL were significantly greater in GBMs compared with those of metastases. The optimal cutoff value for differentiating GBM from metastasis was 0.80 which implies a sensitivity of 95%, a specificity of 92%, a positive predictive value of 86%, and a negative predictive value of 97% for rCBVe ratio. We found a modest correlation between rCBVt and rCBFt ratios. MVL measurements in GBMs are significantly higher than those in metastases. Statistically, both rCBVe, rCBVt/e and rCBFe, rCBFt/e were useful in differentiating between GBMs and metastases, supporting the hypothesis that perfusion MR imaging can detect infiltration of tumor cells in the peri-enhancing region. (orig.)

  18. Widespread dispersion of adeno-associated virus serotype 1 and adeno-associated virus serotype 6 vectors in the rat central nervous system and in human glioblastoma multiforme xenografts.

    Science.gov (United States)

    Huszthy, Peter C; Svendsen, Agnete; Wilson, James M; Kotin, Robert M; Lønning, Per Eystein; Bjerkvig, Rolf; Hoover, Frank

    2005-03-01

    The transduction patterns of recombinant adeno-associated virus serotype 1 (AAV1) and serotype 6 (AAV6) vectors were assessed in human glioblastoma multiforme (GBM) cell lines, in human GBM biopsy spheroids, and in tumor xenografts growing in nude rat brains. All the cell lines tested (A172, D37, GaMg, HF66, and U373Mg) were found to be permissive to both AAV1 and AAV6 vectors, and thus displayed a transduction pattern similar to AAV2 vectors. For every cell line tested, the transduction efficiency displayed by AAV2 vectors was better than by isogenic and isopromoter AAV1 vectors. Transduction efficiency was dependent on the viral particle number used, suggesting that the receptors for these vectors are widely distributed in GBM tissues. Interestingly, AAV1, AAV2, and AAV6 vectors were able to infect and transduce the same cells when added simultaneously to monolayer cultures. Infection of human GBM biopsy spheroids with AAV1 and AAV6 vectors resulted in transgene expression both at the surface layers and in the core of the spheroids. Following injection of AAV1 and AAV6 vectors into human GBM biopsy xenografts growing in nude rat brains, reporter gene expression was seen both in the periphery as well as in the central regions of the tumors. When injected into the normal rat brain, both AAV1 and AAV6 vectors were found to transduce several central nervous system (CNS) regions. The presented results suggest a potential therapeutic role for AAV1 and AAV6 vectors in gene therapy for GBM and also for other CNS malignancies.

  19. Radiomic features from the peritumoral brain parenchyma on treatment-naive multi-parametric MR imaging predict long versus short-term survival in glioblastoma multiforme: Preliminary findings

    Energy Technology Data Exchange (ETDEWEB)

    Prasanna, Prateek; Patel, Jay; Madabhushi, Anant; Tiwari, Pallavi [Case Western Reserve University, Department of Biomedical Engineering, Cleveland, OH (United States); Partovi, Sasan [University Hospitals Case Medical Center, Case Western Reserve School of Medicine, Cleveland, OH (United States)

    2017-10-15

    Despite 90 % of glioblastoma (GBM) recurrences occurring in the peritumoral brain zone (PBZ), its contribution in patient survival is poorly understood. The current study leverages computerized texture (i.e. radiomic) analysis to evaluate the efficacy of PBZ features from pre-operative MRI in predicting long- (>18 months) versus short-term (<7 months) survival in GBM. Sixty-five patient examinations (29 short-term, 36 long-term) with gadolinium-contrast T{sub 1w}, FLAIR and T{sub 2w} sequences from the Cancer Imaging Archive were employed. An expert manually segmented each study as: enhancing lesion, PBZ and tumour necrosis. 402 radiomic features (capturing co-occurrence, grey-level dependence and directional gradients) were obtained for each region. Evaluation was performed using threefold cross-validation, such that a subset of studies was used to select the most predictive features, and the remaining subset was used to evaluate their efficacy in predicting survival. A subset of ten radiomic 'peritumoral' MRI features, suggestive of intensity heterogeneity and textural patterns, was found to be predictive of survival (p = 1.47 x 10{sup -5}) as compared to features from enhancing tumour, necrotic regions and known clinical factors. Our preliminary analysis suggests that radiomic features from the PBZ on routine pre-operative MRI may be predictive of long- versus short-term survival in GBM. (orig.)

  20. Giant cell glioblastoma in a child: A rare case report.

    Science.gov (United States)

    Jain, S K; Sundar, I Vijay; Sinha, V D; Sharma, Vinod; Bhasme, Vishal; Goel, Ravishankar S

    2012-07-01

    Giant cell glioblastoma (GCG) is a subtype of Glioblastoma multiforme that is rare in incidence and distinct in features and histopathological examination. It is reported to have better prognosis than common glioblastomas. The incidence of GCG in children is even more rare. We report a case of GCG in a 10-year-old boy along with a review of the relevant literature focusing on the differentiating points from common glioblastoma.

  1. Giant cell glioblastoma in a child: A rare case report

    OpenAIRE

    Jain, S.K; Sundar, I. Vijay; V D Sinha; Sharma, Vinod; Bhasme, Vishal; Ravishankar S Goel

    2012-01-01

    Giant cell glioblastoma (GCG) is a subtype of Glioblastoma multiforme that is rare in incidence and distinct in features and histopathological examination. It is reported to have better prognosis than common glioblastomas. The incidence of GCG in children is even more rare. We report a case of GCG in a 10-year-old boy along with a review of the relevant literature focusing on the differentiating points from common glioblastoma.

  2. Evo-Devo and the evolution of cancer: a hypothesis for metamorphic therapies for the cancers of prolactin-influenced tumourigenesis: with special reference to glioblastoma multiforme (GBM).

    Science.gov (United States)

    Pearson, Roy Douglas

    2009-06-01

    Recalling the remarkable developmental similarities between cancer cells and embryonic tissues, this paper argues that, by the process of retrodifferentiation and heterochronization, stem cells that have become neoplastic could be said to have undergone "cellular heterochrony." It theorizes, therefore, that hormones are the major factor in the non-random regulation of cellular heterochrony in tumourigenesis. Two recent articles confirm that there is low thyroxine and high prolactin in glioblastomas. Thyroxine metamorphoses vertebrates' tissues so as to mature the tissues, e.g., in amphibian metamorphosis. In 1896, thyroxine (horse thyroid extract) was the first successful hormonal product to be used against a fulminating breast cancer. Recent work confirms the important role of prolactin in the induction and progression of mammary, prostate and colorectal tumours. Although the pituitary is the main source of prolactin in vertebrates, there is also placental production of prolactin, and paracrine production of prolactin by tumours themselves. Since tumours produce their own prolactin, shutting down the pituitary source has not proven wholly successful. Research to find prolactin receptor antagonists is ongoing. Therefore, prolactin inhibitors (dopamine agonists), prolactin receptor antagonists, plus thyroxine comprise a plausible metamorphic therapy for shrinking solid tumour mass. By contrast with "differentiation" therapies currently sought by stem cell oncologists, this paper advocates "metamorphic" therapies, to introduce hormonal oncological knowledge of how to modulate signalling pathways that are aberrant in the stem cells that give rise to tumours. Despite subtle differences in these signalling translation pathways and cascades, strategies exist that will allow these evolved populations, going back to their stem precursors, to "metamorphose" or perhaps apoptotically cease proliferation.

  3. Nanoparticles for hyperthermic therapy: synthesis strategies and applications in glioblastoma

    NARCIS (Netherlands)

    Verma, Jyoti; Lal, Sumit; van Noorden, Cornelis J. F.

    2014-01-01

    Glioblastoma multiforme (GBM) is the most common and most aggressive malignant primary brain tumor in humans. Current GBM treatment includes surgery, radiation therapy, and chemotherapy, sometimes supplemented with novel therapies. Despite recent advances, survival of GBM patients remains poor.

  4. Phase II Trial of Radiosurgery to Magnetic Resonance Spectroscopy-Defined High-Risk Tumor Volumes in Patients With Glioblastoma Multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Einstein, Douglas B., E-mail: douglas.einstein@khnetwork.org [Department of Radiation Oncology, Case Comprehensive Cancer Center, Case Western Reserve University Kettering, Ohio (United States); Wessels, Barry [Department of Radiation Oncology, Case Comprehensive Cancer Center, Case Western Reserve University Kettering, Ohio (United States); Bangert, Barbara [Department of Radiology, Case Comprehensive Cancer Center, Case Western Reserve University Kettering, Ohio (United States); Fu, Pingfu [Department of Biostatistics, Case Comprehensive Cancer Center, Case Western Reserve University Kettering, Ohio (United States); Nelson, A. Dennis [Department of Radiology, Case Comprehensive Cancer Center, Case Western Reserve University Kettering, Ohio (United States); Cohen, Mark [Department of Pathology, Case Comprehensive Cancer Center, Case Western Reserve University Kettering, Ohio (United States); Sagar, Stephen [Department of Neurology, Case Comprehensive Cancer Center, Case Western Reserve University Kettering, Ohio (United States); Lewin, Jonathan [Department of Radiology, Case Comprehensive Cancer Center, Case Western Reserve University Kettering, Ohio (United States); Sloan, Andrew [Department of Neurosurgery, Case Comprehensive Cancer Center, Case Western Reserve University Kettering, Ohio (United States); Zheng Yiran; Williams, Jordonna; Colussi, Valdir; Vinkler, Robert [Department of Radiation Oncology, Case Comprehensive Cancer Center, Case Western Reserve University Kettering, Ohio (United States); Maciunas, Robert [Department of Neurosurgery, Case Comprehensive Cancer Center, Case Western Reserve University Kettering, Ohio (United States)

    2012-11-01

    Purpose: To determine the efficacy of a Gamma Knife stereotactic radiosurgery (SRS) boost to areas of high risk determined by magnetic resonance spectroscopy (MRS) functional imaging in addition to standard radiotherapy for patients with glioblastoma (GBM). Methods and Materials: Thirty-five patients in this prospective Phase II trial underwent surgical resection or biopsy for a GBM followed by SRS directed toward areas of MRS-determined high biological activity within 2 cm of the postoperative enhancing surgical bed. The MRS regions were determined by identifying those voxels within the postoperative T2 magnetic resonance imaging volume that contained an elevated choline/N-acetylaspartate ratio in excess of 2:1. These voxels were marked, digitally fused with the SRS planning magnetic resonance image, targeted with an 8-mm isocenter per voxel, and treated using Radiation Therapy Oncology Group SRS dose guidelines. All patients then received conformal radiotherapy to a total dose of 60 Gy in 2-Gy daily fractions. The primary endpoint was overall survival. Results: The median survival for the entire cohort was 15.8 months. With 75% of recursive partitioning analysis (RPA) Class 3 patients still alive 18 months after treatment, the median survival for RPA Class 3 has not yet been reached. The median survivals for RPA Class 4, 5, and 6 patients were 18.7, 12.5, and 3.9 months, respectively, compared with Radiation Therapy Oncology Group radiotherapy-alone historical control survivals of 11.1, 8.9, and 4.6 months. For the 16 of 35 patients who received concurrent temozolomide in addition to protocol radiotherapeutic treatment, the median survival was 20.8 months, compared with European Organization for Research and Treatment of Cancer historical controls of 14.6 months using radiotherapy and temozolomide. Grade 3/4 toxicities possibly attributable to treatment were 11%. Conclusions: This represents the first prospective trial using selective MRS-targeted functional SRS

  5. Novel Therapy for Glioblastoma Multiforme by Restoring LRRC4 in Tumor Cells: LRRC4 Inhibits Tumor-Infitrating Regulatory T Cells by Cytokine and Programmed Cell Death 1-Containing Exosomes

    Directory of Open Access Journals (Sweden)

    Peiyao Li

    2017-12-01

    Full Text Available Glioblastoma multiforme (GBM is a heterogeneous malignant brain tumor, the pathological incidence of which induces the accumulation of tumor-infiltrating lymphocytes (TILs. As a tumor suppressor gene, LRRC4 is absent in GBM cells. Here, we report that the recovery of LRRC4 in GBM cells inhibited the infiltration of tumor-infiltrating regulatory T cells (Ti-Treg, promoted the expansion of tumor-infiltrating effector T (Ti-Teff cells and CD4+CCR4+ T cells, and enhanced the chemotaxis of CD4+CCR4+ T cells in the GBM immune microenvironment. LRRC4 was not transferred into TILs from GBM cells through exosomes but mainly exerted its inhibiting function on Ti-Treg cell expansion by directly promoting cytokine secretion. GBM cell-derived exosomes (cytokine-free and programmed cell death 1 containing also contributed to the modulation of LRRC4 on Ti-Treg, Ti-Teff, and CD4+CCR4+ T cells. In GBM cells, LRRC4 directly bound to phosphoinositide-dependent protein kinase 1 (PDPK1, phosphorylated IKKβser181, facilitated NF-κB activation, and promoted the secretion of interleukin-6 (IL-6, CCL2, and interferon gamma. In addition, HSP90 was required to maintain the interaction between LRRC4 and PDPK1. However, the inhibition of Ti-Treg cell expansion and promotion of CD4+CCR4+ T cell chemotaxis by LRRC4 could be blocked by anti-IL-6 antibody or anti-CCL2 antibody, respectively. miR-101 is a suppressor gene in GBM. Our previous studies have shown that EZH2, EED, and DNMT3A are direct targets of miR-101. Here, we showed that miR-101 reversed the hypermethylation of the LRRC4 promoter and induced the re-expression of LRRC4 in GBM cells by directly targeting EZH2, EED, and DNMT3A. Our results reveal a novel mechanism underlying GBM microenvironment and provide a new therapeutic strategy using re-expression of LRRC4 in GBM cells to create a permissive intratumoral environment.

  6. Phase III Randomized Study of Postradiotherapy Chemotherapy with α-Difluoromethylornithine-Procarbazine, N-(2-Chloroethyl)-N′-cyclohexyl-N-nitrosurea, Vincristine (DFMO-PCV) Versus PCV for Glioblastoma Multiforme

    National Research Council Canada - National Science Library

    Victor A. Levin; Joon H. Uhm; Kurt A. Jaeckle; Ali Choucair; Patrick J. Flynn; W. K. Alfred Yung; Michael D. Prados; Janet M. Bruner; Susan M. Chang; Athanassios P. Kyritsis; Mary Jo Gleason; Kenneth R. Hess

    2000-01-01

    ... ′-cyclohexyl- N -nitrosurea, and vincristine (PCV) has been previously demonstrated in the setting of anaplastic/intermediate-grade gliomas, the benefit for glioblastoma patients remains unproven...

  7. Infratentorial glioblastoma multiforme: Case report | Magoha | East ...

    African Journals Online (AJOL)

    Browse By Category · Browse Alphabetically · Browse By Country · List All Titles · Free To Read Titles This Journal is Open Access. Featuring journals from 32 Countries: Algeria (5); Benin (2); Botswana (3); Burkina Faso (3); Cameroon (8); Congo, Republic (1); Côte d'Ivoire (4); Egypt, Arab Rep. (14); Eritrea (1); Ethiopia (30) ...

  8. PICTORIAL REVIEW Glioblastoma multiforme has many faces

    African Journals Online (AJOL)

    in the left superior temporal gyrus on the T2 images, confirmed on the coronal ... 4a) showed 2 adjacent areas in the left frontal lobe with high signal on T2WI and ... A chest radiograph showed nodules in the base of the right lung. During his admission, he had episodes of confusion and experienced nausea and vomiting.

  9. Small cell glioblastoma or small cell carcinoma

    DEFF Research Database (Denmark)

    Hilbrandt, Christine; Sathyadas, Sathya; Dahlrot, Rikke H

    2013-01-01

    was admitted to the hospital with left-sided loss of motor function. A MRI revealed a 6 cm tumor in the right temporoparietal area. The histology was consistent with both glioblastoma multiforme (GBM) and small cell lung carcinoma (SCLC) but IHC was suggestive of a SCLC metastasis. PET-CT revealed...

  10. Herpes associated erythema multiforme

    OpenAIRE

    K A Kamala; L Ashok; Rajeshwari G Annigeri

    2011-01-01

    Erythema multiforme is an acute and a self-limiting mucocutaneous hypersensitivity reaction triggered by certain infections and medications. One of the most common predisposing factors for erythema multiforme is infection with herpes simplex virus. Herpes associated erythema multiforme (HAEM) is an acute exudative dermatic and mucosal disease caused by the infecting herpes simplex virus. It has recurrence and idiorestriction, characterized by increasing of CD4+T leukomonocyte. This article re...

  11. Herpes associated erythema multiforme.

    Science.gov (United States)

    Kamala, K A; Ashok, L; Annigeri, Rajeshwari G

    2011-10-01

    Erythema multiforme is an acute and a self-limiting mucocutaneous hypersensitivity reaction triggered by certain infections and medications. One of the most common predisposing factors for erythema multiforme is infection with herpes simplex virus. Herpes associated erythema multiforme (HAEM) is an acute exudative dermatic and mucosal disease caused by the infecting herpes simplex virus. It has recurrence and idiorestriction, characterized by increasing of CD4+T leukomonocyte. This article reports a case of HAEM in a 9-year-old girl, with a review of relevant literature, and discusses the pathophysiology and treatment of erythema multiforme triggered by herpes simplex virus.

  12. Herpes associated erythema multiforme

    Directory of Open Access Journals (Sweden)

    K A Kamala

    2011-01-01

    Full Text Available Erythema multiforme is an acute and a self-limiting mucocutaneous hypersensitivity reaction triggered by certain infections and medications. One of the most common predisposing factors for erythema multiforme is infection with herpes simplex virus. Herpes associated erythema multiforme (HAEM is an acute exudative dermatic and mucosal disease caused by the infecting herpes simplex virus. It has recurrence and idiorestriction, characterized by increasing of CD4+T leukomonocyte. This article reports a case of HAEM in a 9-year-old girl, with a review of relevant literature, and discusses the pathophysiology and treatment of erythema multiforme triggered by herpes simplex virus

  13. The impact of bevacizumab treatment on survival and quality of life in newly diagnosed glioblastoma patients

    DEFF Research Database (Denmark)

    Poulsen, Hans Skovgaard; Urup, Thomas; Michaelsen, Signe Regner

    2014-01-01

    Glioblastoma multiforme (GBM) remains one of the most devastating tumors, and patients have a median survival of 15 months despite aggressive local and systemic therapy, including maximal surgical resection, radiation therapy, and concomitant and adjuvant temozolomide. The purpose of antineoplastic...

  14. Phase II clinical study of boron neutron capture therapy combined with X-ray radiotherapy/temozolomide in patients with newly diagnosed glioblastoma multiforme-Study design and current status report

    Energy Technology Data Exchange (ETDEWEB)

    Kawabata, Shinji, E-mail: neu046@poh.osaka-med.ac.jp [Department of Neurosurgery, Osaka Medical College, 2-7 Daigaku-Machi, Takatsuki, Osaka 569-8686 (Japan); Miyatake, Shin-Ichi; Hiramatsu, Ryo; Hirota, Yuki; Miyata, Shiro; Takekita, Yoko; Kuroiwa, Toshihiko [Department of Neurosurgery, Osaka Medical College, 2-7 Daigaku-Machi, Takatsuki, Osaka 569-8686 (Japan); Kirihata, Mitsunori [Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai, Osaka 599-8931 (Japan); Sakurai, Yoshinori; Maruhashi, Akira; Ono, Koji [Kyoto University Research Reactor Institute, 2 Asashiro-Nishi, Kumatori-cho, Sennan-gun, Osaka 590-0494 (Japan)

    2011-12-15

    Recently, we reported our clinical experiences of boron neutron capture therapy (BNCT) for the newly diagnosed glioblastoma. The major differences of our protocol from the other past studies were simultaneous use of both sodium borocapate and boronophenylalanine, and combination with fractionated X-ray irradiation. These results showed the efficacy of combination therapy with external beam X-ray irradiation and BNCT. For our future study, we planned the multi-centric phase II clinical study for newly diagnosed glioblastoma patients in Japan (OSAKA-TRIBRAIN0902, NCT00974987).

  15. Giant cell glioblastoma with unique bilateral cerebellopontine angle localization considered as extraaxial tumor growth in a patient with neurofibromatosis Type 1.

    Science.gov (United States)

    Taraszewska, Anna; Bogucki, Jacek; Powała, Agnieszka; Matyja, Ewa

    2013-01-01

    Giant cell glioblastoma multiforme (GCGBM) is a rare variant of glioblastoma, occurring predominantly in the cerebral hemispheres. Its infratentorial localization has been documented occasionally, while GCGBM in the cerebellopontine angle (CPA) region has not been described so far. We report a case of GCGBM presenting primarily as an extraaxial bilateral CPA tumor in a 29-year-old woman with neurofibromatosis Type 1 (NF1). The patient died shortly after surgery of the right CPA tumor. Postmortem study of the brain revealed large tumor masses, located in the CPA bilaterally, encasing the brainstem base and cisternal portions of the cranial nerves. Tumor masses were demarcated from the brainstem and cerebellum and covered by leptomeninges. Microscopically, a slight subpial tumor seeding from the leptomeninges into the brain parenchyma was observed in the right CPA region. The tumor showed highly pleomorphic, giant and multinucleated cells, densely cellular sheets of poorly differentiated cells and pseudopalisading necroses. Tumor cells were positive for GFAP, S-100 protein, and p53 and negative for neuronal antigens. The MIB-1 labeling index was very high in densely cellular areas. To our knowledge this is the second report of GCGBM in an NF1 patient and the first reported case of GCGBM presenting as an extraaxial leptomeningeal lesion with bilateral CPA localization, which might be considered as primary leptomeningeal gliomatosis.

  16. Favorable outcome of giant cell glioblastoma in a child. Report of an 11-year survival period.

    Science.gov (United States)

    Klein, R; Mölenkamp, G; Sörensen, N; Roggendorf, W

    1998-06-01

    Giant cell glioblastomas are defined as glioblastomas with a marked predominance of bizarre, multinucleated giant cells. They represent about 5% of all glioblastomas and can occur at any site of the central nervous system, but the temporal and frontal lobes are the sites of predilection. Overall, giant cell glioblastomas show a prolonged survival period compared with common glioblastoma multiforme, and survival periods of 7 and 9 years have been reported in adults. Here we report on a child aged 11 years at diagnosis, who has so far survived for 11 years since operation and adjunctive radio- and chemotherapy.

  17. PKC signaling in glioblastoma

    Science.gov (United States)

    do Carmo, Anália; Balça-Silva, Joana; Matias, Diana; Lopes, Maria Celeste

    2013-01-01

    Glioblastoma Multiforme (GBM) is the most aggressive brain tumor characterized by intratumoral heterogeneity at cytopathological, genomic and transcriptional levels. Despite the efforts to develop new therapeutic strategies the median survival of GBM patients is 12−14 months. Results from large-scale gene expression profile studies confirmed that the genetic alterations in GBM affect pathways controlling cell cycle progression, cellular proliferation and survival and invasion ability, which may explain the difficulty to treat GBM patients. One of the signaling pathways that contribute to the aggressive behavior of glioma cells is the protein kinase C (PKC) pathway. PKC is a family of serine/threonine-specific protein kinases organized into three groups according the activating domains. Due to the variability of actions controlled by PKC isoforms, its contribution to the development of GBM is poorly understood. This review intends to highlight the contribution of PKC isoforms to proliferation, survival and invasive ability of glioma cells. PMID:23358475

  18. RARβ gene methylation is a candidate for primary glioblastoma ...

    African Journals Online (AJOL)

    Background: We screened RARβ methylation in primary glioblastoma multiforme (GBM) and the results were evaluated based on the clinical data and treatment type. Objective: The objective of this study was to find new areas for the usage of MS HRM applications in the determination of methylation levels in primary GBM ...

  19. Tectal glioblastoma Glioblastoma tetal

    Directory of Open Access Journals (Sweden)

    Feres Chaddad Neto

    2007-12-01

    Full Text Available Brain stem gliomas are a heterogeneous group of neoplasms arising mostly in paediatric patients. Tectal plate gliomas represent a particular type of brain stem tumours usually with a benign, indolent clinical course, presenting with signs of raised intracranial hipertension due to supra-tentorialhydrocephalous caused by aqueductal stenosis. Seldom high-grade lesions arise in this location with tremendous therapeutic implications. When a malignant tumour is clinically and radiographically suspected a biopsy should be performed to obtain histhological confirmation. Treatment is then planned in a case-by-case basis. We present the case of a glioblastoma of the tectal plate in a 22 years-old woman operated upon by a supracerebellar-infratentorial approach.Os gliomas do tronco cerebral são um grupo heterogêneo de neoplasias que acometem habitualmente crianças. Os gliomas da placa quadrigeminal representam um tipo particular de tumores do tronco cerebral, habitualmente com um curso benigno e indolente, surgindo com sinais de hipertensão intracraniana devido a hidrocefalia supra-tentorial provocada por compressão do aqueduto cerebral. Raramente surgem lesões de alto grau nesta região, mas as implicações terapêuticas são tremendas. Quando existe suspeita clínica e imagiológica de que se trata de lesão maligna, esta deve ser biopsada para se obter confirmação histológica. O tratamento deve então ser planejado caso a caso. Apresentamos o caso de glioblastoma da placa quadrigeminal em uma paciente de 22 anos intervencionado por via supracerebelar-infratentorial.

  20. Herpes zoster - associated erythema multiforme.

    Science.gov (United States)

    Wollina, Uwe; Gemmeke, Astrid

    2009-04-05

    Erythema multiforme is a cutaneous reaction that has only rarely been described in varicella zoster virus infection. We describe a 76-year old immunocompetent male patient with thoracic herpes zoster. While treated with oral brivudin he developed a widespread cutaneous erythema multiforme. The lesions completely cleared with two weeks with systemic corticosteroids. Varicella zoster infections are possible triggers of erythema multiforme and this is the oldest patient reported with such an association. Brivudin itself has not been reported to induce erythema multiforme and is an unlikely cause of disease in our patient.

  1. A Phase I Study of Mebendazole for the Treatment of Pediatric Gliomas

    Science.gov (United States)

    2017-01-30

    Pilomyxoid Astrocytoma; Pilocytic Astrocytoma; Glioma, Astrocytic; Optic Nerve Glioma; Pleomorphic Xanthoastrocytoma; Glioblastoma Multiforme; Anaplastic Astrocytoma; Gliosarcoma; Diffuse Intrinsic Pontine Glioma; DIPG; Low-grade Glioma; Brainstem Glioma

  2. Evaluation of the Lactate-to-N-Acetyl-aspartate Ratio Defined With Magnetic Resonance Spectroscopic Imaging Before Radiation Therapy as a New Predictive Marker of the Site of Relapse in Patients With Glioblastoma Multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Deviers, Alexandra [Département de Radiothérapie, Institut Claudius Regaud, Toulouse (France); UMR (Unité Mixte de Recherche) 825, Institut National de la Santé et de la Recherche Médicale, Toulouse (France); INP (Institut National Polytechnique), ENVT (Ecole Nationale Vétérinaire de Toulouse), Unité d' Anatomie-Imagerie-Embryologie, Université de Toulouse, Toulouse (France); Ken, Soléakhéna [Département de Radiothérapie, Institut Claudius Regaud, Toulouse (France); UMR (Unité Mixte de Recherche) 825, Institut National de la Santé et de la Recherche Médicale, Toulouse (France); Filleron, Thomas [Bureau des Etudes Cliniques, Institut Claudius Regaud, Toulouse (France); Rowland, Benjamin; Laruelo, Andrea [Département de Radiothérapie, Institut Claudius Regaud, Toulouse (France); Catalaa, Isabelle; Lubrano, Vincent [UMR (Unité Mixte de Recherche) 825, Institut National de la Santé et de la Recherche Médicale, Toulouse (France); Hôpital de Rangueil, CHU (Centre Hospitalier Universitaire) de Toulouse, Toulouse (France); Celsis, Pierre [UMR (Unité Mixte de Recherche) 825, Institut National de la Santé et de la Recherche Médicale, Toulouse (France); and others

    2014-10-01

    Purpose: Because lactate accumulation is considered a surrogate for hypoxia and tumor radiation resistance, we studied the spatial distribution of the lactate-to-N-acetyl-aspartate ratio (LNR) before radiation therapy (RT) with 3D proton magnetic resonance spectroscopic imaging (3D-{sup 1}H-MRSI) and assessed its impact on local tumor control in glioblastoma (GBM). Methods and Materials: Fourteen patients with newly diagnosed GBM included in a phase 2 chemoradiation therapy trial constituted our database. Magnetic resonance imaging (MRI) and MRSI data before RT were evaluated and correlated to MRI data at relapse. The optimal threshold for tumor-associated LNR was determined with receiver-operating-characteristic (ROC) curve analysis of the pre-RT LNR values and MRI characteristics of the tumor. This threshold was used to segment pre-RT normalized LNR maps. Two spatial analyses were performed: (1) a pre-RT volumetric comparison of abnormal LNR areas with regions of MRI-defined lesions and a choline (Cho)-to- N-acetyl-aspartate (NAA) ratio ≥2 (CNR2); and (2) a voxel-by-voxel spatial analysis of 4,186,185 voxels with the intention of evaluating whether pre-RT abnormal LNR areas were predictive of the site of local recurrence. Results: A LNR of ≥0.4 (LNR-0.4) discriminated between tumor-associated and normal LNR values with 88.8% sensitivity and 97.6% specificity. LNR-0.4 voxels were spatially different from those of MRI-defined lesions, representing 44% of contrast enhancement, 64% of central necrosis, and 26% of fluid-attenuated inversion recovery (FLAIR) abnormality volumes before RT. They extended beyond the overlap with CNR2 for most patients (median: 20 cm{sup 3}; range: 6-49 cm{sup 3}). LNR-0.4 voxels were significantly predictive of local recurrence, regarded as contrast enhancement at relapse: 71% of voxels with a LNR-0.4 before RT were contrast enhanced at relapse versus 10% of voxels with a normal LNR (P<.01). Conclusions: Pre-RT LNR-0.4 in GBM

  3. Apoptosis in oral erythema multiforme.

    Science.gov (United States)

    Chrysomali, E; Lozada-Nur, F; Dekker, N P; Papanicolaou, S I; Regezi, J A

    1997-02-01

    Cell death was evaluated in oral erythema multiforme to test the hypothesis that apoptosis may be a mechanism by which keratinocytes die in this condition. Ten erythema multiforme and five control oral mucosa biopsy specimens were evaluated in immunohistochemically stained sections for apoptosis-regulating proteins Bcl-2, Bcl-x, Bax, p53, Fas, and Fas-ligand. Apoptotic keratinocytes, determined by a detection method for DNA fragmentation (TUNEL) and by conventional morphologic criteria were counted per high power field. Keratinocyte staining for Bcl-2 protein was comparable in erythema multiforme and controls. Bcl-x expression was reduced in five erythema multiforme cases. Staining for Bax protein differed in six erythema multiforme cases and showed variable intensity in layers under the parakeratin. Only slight differences in staining patterns of Fas and Fas-ligand proteins were noted between erythema multiforme and controls. The number of apoptotic keratinocytes evaluated by morphologic examination was significantly higher in erythema multiforme (mean per high power field, 0.90 +/- 0.2; controls, 0.06 +/- 0.04; p erythema multiforme, 0.43 +/- 0.1; controls, 0.02 +/- 0.02). Overexpression of p53 protein was seen in basal keratinocytes in five erythema multiforme specimens (mean, 17.5 +/- 4.03 per high power field; controls 1.2 +/- 0.3). There is evidence that cell death in erythema multiforme is at least in part due to apoptosis. The apoptotic mechanism may be related to an altered expression of apoptosis-regulating proteins. Although measurable alterations in the phenotypic expression of Fas and Fas-ligand proteins were not apparent, activation of Fas/Fas-ligand system could still be involved in the induction of apoptosis in erythema multiforme.

  4. Asbestos as a possible major cause of malignant lung tumors (including small cell carcinoma, adenocarcinoma & mesothelioma), brain tumors (i.e. astrocytoma & glioblastoma multiforme), many other malignant tumors, intractable pain including fibromyalgia, & some cardio-vascular pathology: Safe & effective methods of reducing asbestos from normal & pathological areas.

    Science.gov (United States)

    Omura, Yoshiaki

    2006-01-01

    High incidences of Small Cell Carcinoma & Adenocarcinoma of the lung, Astrocytoma & Glioblastoma Multiforme of the brain and Mesothelioma of the lung were found in those who had a high accumulation of Asbestos in the eyes and upper respiratory system (nose, larynx, trachea, etc.). When measured non-invasively using the Bi-Digital O-Ring Test (BDORT), brain tumors had the highest concentration of Asbestos (0.2 approximately 2.1 mg BDORT units). Relatively high levels of Asbestos (0.2 approximately 0.6 mg BDORT units) were found in: Squamous Cell Carcinoma of the lungs & esophagus, Adenocarcinoma of the larynx & breast, myelogenic leukemia, arteries of these cancers, left ventricle of failing heart, myocardial infarction, some of the narrowed arteries, varicose veins, cataracts, balding heads, hot flashes, Alzheimer's Disease and Autism. A small, round or ellipsoidal area, with diameter of 5 mm or less, was found near the center of every cancer tissue with a higher level of Asbestos (1 approximately 3 mg), As, Zn, Cr and Se, than in the rest of the tumor; this small area may be where the cancer initiated. Among areas of intractable pain with frequent recurrence and gradual worsening, about 0.2 approximately 0.5 mg BDORT units (or higher) of Asbestos were found. The author found that in the Astrocytoma and many other cancer patients, the optimal dose of DHEA produced very significant reductions of cancer cell telomere from over 1400 ng in the brain tumors (and over 900 ng in other cancers) to close to or less than 1 yg (=10(-24) g), with circulatory improvement by reduction of TXB2. Unlike the standard, widely used treatment with DHEA 25 approximately 50 mg daily, which is an overdose; we only gave one optimal dose (1.5 approximately 12.5 mg) and the beneficial effects usually lasted anywhere between 3-6 months, unless inhibiting factors were introduced. In addition, once one optimal dose of DHEA was given, the amount of Asbestos from these tumors decreased very

  5. Glioblastoma-Initiating Cells: Relationship with Neural Stem Cells and the Micro-Environment

    OpenAIRE

    Goffart, Nicolas; KROONEN, Jérôme

    2013-01-01

    Glioblastoma multiforme (GBM, WHO grade IV) is the most common and lethal subtype of primary brain tumor with a median overall survival of 15 months from the time of diagnosis. The presence in GBM of a cancer population displaying neural stem cell (NSC) properties as well as tumor-initiating abilities and resistance to current therapies suggests that these glioblastoma-initiating cells (GICs) play a central role in tumor development and are closely related to NSCs. However, it is nowadays sti...

  6. Focal brainstem gliomas

    Science.gov (United States)

    Sabbagh, Abdulrahman J.; Alaqeel, Ahmed M.

    2015-01-01

    Improved neuronavigation guidance as well as intraoperative imaging and neurophysiologic monitoring technologies have enhanced the ability of neurosurgeons to resect focal brainstem gliomas. In contrast, diffuse brainstem gliomas are considered to be inoperable lesions. This article is a continuation of an article that discussed brainstem glioma diagnostics, imaging, and classification. Here, we address open surgical treatment of and approaches to focal, dorsally exophytic, and cervicomedullary brainstem gliomas. Intraoperative neuronavigation, intraoperative neurophysiologic monitoring, as well as intraoperative imaging are discussed as adjunctive measures to help render these procedures safer, more acute, and closer to achieving surgical goals. PMID:25864061

  7. Cytomorphology of giant cell glioblastoma: Report of a case and brief review of literature.

    Science.gov (United States)

    Jaiswal, Sushila; Vij, Mukul; Jaiswal, Awadhesh Kumar; Srivastava, Arun Kumar; Behari, Sanjay; Pandey, Rakesh

    2012-05-01

    Giant cell glioblastoma is a histological variant of glioblastoma that accounts for less than 1% of intracranial tumors and to 5% of glioblastoma. They occur at any age and are likely to affect the younger as well the older age group unlike the conventional glioblastoma multiforme (GBM). They are often located subcortically in the temporal and parietal lobes. Cytological descriptions of giant cell glioblastoma are extremely rare. We describe squash cytomorphology of giant cell glioblastoma of left posterior frontal region in 35-year-old male. The squash smears were moderately cellular displaying malignant astrocytic tumor cells disposed in cohesive clusters and dispersed population on a necrotic background. Most striking feature was numerous multinucleated giant cells. We also discuss the differential diagnosis in light of relevant literature. Copyright © 2011 Wiley-Liss, Inc.

  8. Eosinophils in glioblastoma biology

    Directory of Open Access Journals (Sweden)

    Curran Colleen S

    2012-01-01

    Full Text Available Abstract Glioblastoma multiforme (GBM is the most common primary brain tumor in adults. The development of this malignant glial lesion involves a multi-faceted process that results in a loss of genetic or epigenetic gene control, un-regulated cell growth, and immune tolerance. Of interest, atopic diseases are characterized by a lack of immune tolerance and are inversely associated with glioma risk. One cell type that is an established effector cell in the pathobiology of atopic disease is the eosinophil. In response to various stimuli, the eosinophil is able to produce cytotoxic granules, neuromediators, and pro-inflammatory cytokines as well as pro-fibrotic and angiogenic factors involved in pathogen clearance and tissue remodeling and repair. These various biological properties reveal that the eosinophil is a key immunoregulatory cell capable of influencing the activity of both innate and adaptive immune responses. Of central importance to this report is the observation that eosinophil migration to the brain occurs in response to traumatic brain injury and following certain immunotherapeutic treatments for GBM. Although eosinophils have been identified in various central nervous system pathologies, and are known to operate in wound/repair and tumorstatic models, the potential roles of eosinophils in GBM development and the tumor immunological response are only beginning to be recognized and are therefore the subject of the present review.

  9. Glioblastoma with spinal seeding

    Energy Technology Data Exchange (ETDEWEB)

    Fakhrai, N.; Fazeny-Doerner, B.; Marosi, C. [Clinical Div. of Oncology, Dept. of Medicine I, Univ. of Vienna (Austria); Czech, T. [Dept. of Neurosurgery, Univ. of Vienna (Austria); Diekmann, K. [Dept. of Radiooncology, Univ. of Vienna (Austria); Birner, P.; Hainfellner, J.A. [Clinical Inst. for Neurology, Univ. of Vienna (Austria); Prayer, D. [Dept. of Neuroradiology, Univ. of Vienna (Austria)

    2004-07-01

    Background: extracranial seeding of glioblastoma multiforme (GBM) is very rare and its development depends on several factors. This case report describes two patients suffering from GBM with spinal seeding. In both cases, the anatomic localization of the primary tumor close to the cerebrospinal fluid (CSF) was the main factor for spinal seeding. Case reports: two patients with GBM and spinal seeding are presented. After diagnosis of spinal seeding, both patients were highly symptomatic from their spinal lesions. Case 1 experienced severe pain requiring opiates, and case 2 had paresis of lower limbs as well as urinary retention/incontinence. Both patients were treated with spinal radiation therapy. Nevertheless, they died 3 months after diagnosis of spinal seeding. Results: in both patients the diagnosis of spinal seeding was made at the time of cranial recurrence. Both tumors showed close contact to the CSF initially. Even though the patients underwent intensive treatment, it was not possible to keep them in a symptom-free state. Conclusion: because of short survival periods, patients deserve optimal pain management and dedicated palliative care. (orig.)

  10. Herpetic Recurrent Oral Erythema Multiforme

    OpenAIRE

    Shantala Arunkumar; Savitha S.Shettar; Mamata G.P; Rajeshwari G. Annigeri; Shakuntala G. K

    2016-01-01

    Erythema multiforme is considered as an immunologic disease possibly occurring because of predisposition to certain microorganisms, radiotherapy, systemic diseases, malignancy, and food or drug allergy. Here we report a case of herpes-induced recurrent erythema multiforme primarily manifesting in oral mucosa during first two episodes and third episode was characterized by oral lesions followed by skin lesions and the severity was increased with the subsequent episod...

  11. Herpetic Recurrent Oral Erythema Multiforme

    Directory of Open Access Journals (Sweden)

    Shantala Arunkumar

    2016-04-01

    Full Text Available Erythema multiforme is considered as an immunologic disease possibly occurring because of predisposition to certain microorganisms, radiotherapy, systemic diseases, malignancy, and food or drug allergy. Here we report a case of herpes-induced recurrent erythema multiforme primarily manifesting in oral mucosa during first two episodes and third episode was characterized by oral lesions followed by skin lesions and the severity was increased with the subsequent episodes, during each incident we have successfully managed the case.

  12. Genetic Characteristics of Glioblastoma: Clinical Implications of Heterogeneity

    Directory of Open Access Journals (Sweden)

    Qian Li

    2015-01-01

    Full Text Available Glioblastoma multiforme (GBM is a heterogeneous group of tumors, each with its own distinct molecular and genetic signatures. This heterogeneity is a major clinical hurdle for classifying tumors and for devising effective personalized therapies targeting the disease pathways. Herein, the primary genetic and epigenetic alterations in GBM that have been used as therapeutic targets in clinical settings nowadays, with or without clinical benefits for patients, as well as the future directions for developing novel strategies were discussed.

  13. The ER stress inducer DMC enhances TRAIL-induced apoptosis in glioblastoma

    NARCIS (Netherlands)

    van Roosmalen, Ingrid A. M.; Dos Reis, Carlos R; Setroikromo, Rita; Yuvaraj, Saravanan; Joseph, Justin V.; Tepper, Pieter G.; Kruyt, Frank A. E.; Quax, Wim J.

    2014-01-01

    Glioblastoma multiforme (GBM) is the most aggressive malignant brain tumour in humans and is highly resistant to current treatment modalities. We have explored the combined treatment of the endoplasmic reticulum (ER) stress-inducing agent 2,5-dimethyl-celecoxib (DMC) and TNF-related

  14. Herpes Simplex Virus (HSV-1 Encephalitis Mimicking Glioblastoma: Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Burke A. Cunha

    2014-12-01

    Full Text Available Glioblastoma multiforme (GBM often presents as a brain mass with encephalitis. In a patient with GBM, subsequent presentation with new onset encephalitis may be due to another GBM or Herpes simplex virus 1 (HSV-1 encephalitis. We present a case of HSV-1 encephalitis mimicking GBM in a patient with previous GBM.

  15. Apoptosis activation by TRAIL receptor selective variants in glioblastoma (stem) cells

    NARCIS (Netherlands)

    van Roosmalen, Ingrid A. M.; Joseph, Justin Vareecal; Balasubramaniyan, V.; Yuvaraj, Saravanan; Quax, Wim J.; Kruyt, Frank A. E.

    2011-01-01

    Glioblastoma multiforme (GBM) is the most common and malignant type of primary brain tumour in humans. The 5-year survival rate of patients is <10%. GBM has a very high rate of recurrence after treatment, which is thought to involve a subpopulation of cells in the tumour, called cancer stem cells

  16. A tree shrew glioblastoma model recapitulates features of human glioblastoma.

    Science.gov (United States)

    Tong, Yaohui; Hao, Junjun; Tu, Qiu; Yu, Hualin; Yan, Lanzhen; Li, Yuan; Lv, Longbao; Wang, Fei; Iavarone, Antonio; Zhao, Xudong

    2017-03-14

    Tupaia belangeri (tree shrew), an animal species whose genome has significantly higher similarity to primates than rodents, has been used in biomedical research. To generate animal models that reproduce the human tumors more faithfully than rodents, we present the first report of a cancer model mimicking human tumor genetics in tree shrew. By engineering a lentiviral system for the transduction of mutant H-Ras and a shRNA against tree shrew p53, we successfully generated malignant glioma in tree shrew. The tree shrew glioma exhibited aggressive behavior and a relatively short latency, and markedly reduced animal survival. Remarkably, the biological features of human high-grade glioma (necrosis, microvascular proliferation, pseudopalisading) were all present in tree shrew glioma. Furthermore, genetic analysis of tree shrew glioma revealed that the tumors were clustered within the mesenchymal subgroup of human glioblastoma multiforme. Compared with the corresponding mouse glioma, tree shrew gliomas were markedly more similar to human glioblastoma at gene expression profile. The tree shrew glioma model provides colleagues working in the field of gliomas and cancer in general with a more accurate animal model.

  17. [Survival pronostic factors in Mexican patients with multiforme glioblastoma].

    Science.gov (United States)

    Hernández-Reyna, Ricardo; Medellín-Sánchez, Roberto; Cerda-Flores, Ricardo M; Calderón-Garcidueñas, Ana Laura

    2010-01-01

    To study the pre- and transoperative factors that influence patients' survival with GM. Clinical and pathological records of all confirmed cases of GM diagnosed between 2000 and 2006 were included. Postoperative survival was divided in less or more than 8 months. χ2 test was used. One hundred and twenty patients (45 women and 75 men) were studied. Age range was from 7 to 85 years, 3.3% were 16 years old or younger and 12.5% were 70 years old or older. Headache was the most frequent complain, 40 patients developed hemiparesia and 6 had parestesias. Predominance of white matter hemispheric lesions was observed: right hemispheric tumors 65 (54%), left lesions 30 (25%) and bilateral tumors 7%. Histologically, 1.6% of GM had a sarcomatous component; 35% of patients survived less than 8 months. A difference between patients survival was the preoperative Karnofsky Performance Scale Score and the degree of cerebral edema during the surgical procedure. Pre-operative Karnofsky evaluation and edema during the surgical procedure were significant prognostic factors for survival.

  18. Glioblastoma multiforme has many faces | van Rensburg | SA ...

    African Journals Online (AJOL)

    The PDF file you selected should load here if your Web browser has a PDF reader plug-in installed (for example, a recent version of Adobe Acrobat Reader). If you would like more information about how to print, save, and work with PDFs, Highwire Press provides a helpful Frequently Asked Questions about PDFs.

  19. Infratentorial glioblastoma multiforme: case report and review of ...

    African Journals Online (AJOL)

    ... old female child who presented with a one month history of right sided headache, progressive right sided hemiparesis, and tremor with no history of infection or trauma. Investigations which included computerized tomography scanning, Magnetic Resonance Imaging, Magnetic Resonance Spectroscopy and Tractography.

  20. Investigation of platinum nanoparticle properties against U87 glioblastoma multiforme

    DEFF Research Database (Denmark)

    Kutwin, Marta; Sawosz, Ewa; Jaworski, Slawomir

    2017-01-01

    of platinum nanoparticles and cisplatin and their anticancer properties in examination with a U87 glioma cell line and tumor. Material and methods: Nanoparticles of platinum (NP-Pt) and cisplatin were incubated with U87 glioma cells or injected directly into tumor tissue. The biological properties of NP...

  1. Brainstem Cavernous Angioma

    Science.gov (United States)

    ... in obliteration of the angioma. [9] At a minimum, radiosurgery treatment for brainstem cavernous angioma is controversial. Given the advancement in minimally invasive surgical techniques, more and more neurosurgeons are becoming ...

  2. Urticaria multiforme er en variant af urticaria, som imiterer erythema multiforme

    DEFF Research Database (Denmark)

    Authried, Georg; Bracher, Linda; Bygum, Anette

    2013-01-01

    A 21-month-old boy developed urticaria multiforme during the course of a presumed pneumonia, which was treated with imacillin. At admission to hospital he was initially considered to have erythema multiforme, but the correct diagnosis was soon established as urticaria multiforme. He had a good re...... response to antihistamines. The diagnostic differences between urticaria multiforme and erythema multiforme are presented in this case report....

  3. Strategies of temozolomide in future glioblastoma treatment

    Directory of Open Access Journals (Sweden)

    Lee CY

    2017-01-01

    Full Text Available Chooi Yeng Lee School of Pharmacy, Monash University Malaysia, Selangor, Malaysia Abstract: Glioblastoma multiforme (GBM may be one of the most challenging brain tumors to treat, as patients generally do not live more than 2 years. This review aimed to give a timely review of potential future treatments for GBM by looking at the latest strategies, involving mainly the use of temozolomide (TMZ. Although these studies were carried out either in vitro or in rodents, the findings collectively suggested that we are moving toward developing a more efficacious therapy for GBM patients. Nanoparticles preparation was, by far, the most extensively studied strategy for targeted brain delivery. Therefore, the first section of this review presents a treatment strategy using TMZ-loaded nanocarriers, which encompassed nanoparticles, nanoliposomes, and nanosponges. Besides nanocarriers, new complexes that were formed between TMZ and another chemical agent or molecule have shown increased cytotoxicity and antitumor activity. Another approach was by reducing GBM cell resistance to TMZ, and this was achieved either through the suppression of metabolic change occurring in the cells, inhibition of the DNA repair protein, or up-regulation of the protein that mediates autophagy. Finally, the review collates a list of substances that have demonstrated the ability to suppress tumor cell growth. Keywords: cellular resistance, glioblastoma multiforme, nanoparticles, targeted delivery, temozolomide

  4. A role for the transcription factor HEY1 in glioblastoma

    DEFF Research Database (Denmark)

    Hulleman, Esther; Quarto, Micaela; Vernell, Richard

    2009-01-01

    Glioblastoma multiforme (GBM), the highest-grade glioma, is the most frequent tumour of the brain with a very poor prognosis and limited therapeutic options. Although little is known about the molecular mechanisms that underlie glioblastoma formation, a number of signal transduction routes...... and that expression of HEY1 in GBM correlates with tumour-grade and survival. In addition, we show by chromatin immunoprecipitations, luciferase assays and Northern blot experiments that HEY1 is a bona fide target of the E2F family of transcription factors, connecting the Ras and Notch signalling pathways. Finally......, we show that ectopic expression of HEY1 induces cell proliferation in neural stem cells, while depletion of HEY1 by RNA interference reduces proliferation of glioblastoma cells in tissue culture. Together, these data imply a role for HEY1 in the progression of GBM, and therefore we propose that HEY1...

  5. BAER - brainstem auditory evoked response

    Science.gov (United States)

    ... auditory potentials; Brainstem auditory evoked potentials; Evoked response audiometry; Auditory brainstem response; ABR; BAEP ... Normal results vary. Results will depend on the person and the instruments used to perform the test.

  6. The allosteric AKT inhibitor MK2206 shows a synergistic interaction with chemotherapy and radiotherapy in glioblastoma spheroid cultures

    NARCIS (Netherlands)

    Narayan, Ravi S.; Fedrigo, Carlos A.; Brands, Eelke; Dik, Rogier; Stalpers, Lukas J. A.; Baumert, Brigitta G.; Slotman, Ben J.; Westerman, Bart A.; Peters, Godefridus J.; Sminia, Peter

    2017-01-01

    Background: Glioblastoma multiforme (GBM) is the most common, invasive and deadly primary type of malignant brain tumor. The Phosphatidylinositol-3-Kinase/AKT (PI3K/AKT) pathway is highly active in GBM and has been associated with increased survival and resistance to therapy. The aim of this study

  7. A brainstem anosognosia of hemiparesis

    Directory of Open Access Journals (Sweden)

    Kazuo Abe

    2009-10-01

    Full Text Available A woman had anosognosia for hemiplegia as a manifestation of brainstem infarction. She had no mental or neuropsychological disturbances, and had involvement of the brainstem in the frontal/parietal-subcortical circuits to the right cerebral hemisphere. Brainstem lesions that disrupt frontal/parietal-subcortical areas may affect anosognosia for hemiplegia.

  8. Harnessing nanomedicine for therapeutic intervention in glioblastoma.

    Science.gov (United States)

    Gutkin, Anna; Cohen, Zvi R; Peer, Dan

    2016-11-01

    Glioblastoma is a type of brain cancer arises from glial cells. Glioblastoma multiforme (GBM), a subtype of glioblastoma, is the most common and most aggressive primary brain tumor. Currently, GBM therapy includes surgery and post-operative high-doses of radiation and chemotherapy. This therapeutic strategy has a limited contribution in extending the survival rate of GBM patients. Areas covered: Herein, we focus on harnessing nanoscale drug delivery strategies to treat brain malignancies. Specifically, we briefly discuss the challenges facing GBM therapy such as restricted passage across the blood-brain barrier (BBB) and low enhanced permeability and retention effect. Next, we describe different pathways to address these challenges. Finally, we discuss the field of nanomedicine, which emerged as a promising platform for drug delivery to brain malignancies. Expert opinion: Countless strategies have been applied in preclinical and clinical settings to treat GBM. Among them is the use of different types of nanoparticles (NPs) and viruses with different approaches to cross or bypass the BBB. We suggest here a paradigm shift in thinking about crossing the BBB and tumor penetration as fundamental issues that need to be address in order to improve the therapeutic outcome in GBM.

  9. Immunopathological aspects of oral erythema multiforme

    Directory of Open Access Journals (Sweden)

    Maharani Laillyza Apriasari

    2009-12-01

    Full Text Available Background: Erythema multiforme is an acute disease on the skin and mucous membrane. This lesion can erupt in mucous membranes of the oral cavity. Improper and late treatment may cause Stevens Johnson syndrome which may cause patient mortality, therefore proper and accurate diagnosis are needed. Purpose: The immunopathological aspect of oral erythema multiforme through literature study can help us to find the definite diagnosis and to know the differential diagnosis. review: In immunopathology, minor type of erythema multiforme is vasculitis caused by the immune complex hypersensitivity reaction among antigen antibodies. The mayor type of erythema multiforme may appeared from autoimmune reaction and from untreated minor type of erythema multiforme. Conclusion: Immunopathological approach of erythema multiforme is important beside the clinical manifestation, histology, and the differential diagnosis to find the definitive diagnosis.

  10. Apremilast for treatment of recurrent erythema multiforme

    OpenAIRE

    Chen, Tinley; Levitt, Jacob; Geller, Lauren

    2017-01-01

    Recurrent erythema multiforme with oralinvolvement is therapeutically challenging.Apremilast has been used with success in resolvingthe oral aphthae of Behçet disease, prompting theuse of the drug in patients with oral erosions fromerythema multiforme. Three patients with oralerythema multiforme were given apremilast at dosesof 30-60mg daily. Complete clearance of the lesionswere observed in all three patients, including thoserefractory to other standard therapies. Apremilast maypresent an ef...

  11. Erythema multiforme--oral manifestations.

    Science.gov (United States)

    Dryankova, M M; Popova, C L

    2001-01-01

    Modern scientific achievements in the etiology, pathogenesis, diagnosis and treatment of the vesiculobullous lesions of the oral mucosa are of basic significance for the students, who study the diagnosis and the treatment of these diseases, as well as for the clinical practitioners in their everyday practice. The presented new information about the drug-induced or herpes-associated erythema multiforme, the more severe forms - the Stevens-Johnson syndrome and the toxic epidermal necrolysis, is necessary for each practising dentist especially in the diagnosis and treatment of medically compromised patients. Modern investigations confirm the susceptibility of these patients to infections due to primary or secondary immune deficiency. The clinical oral manifestations of erythema multiforme and their treatment are presented.

  12. Herbal toothpowder induced erythema multiforme.

    Science.gov (United States)

    Satpute, Pranali; Yadav, Lalita; Ahmed, Riyaz; Kashid, Avinash; Peter, Kalpak

    2014-03-01

    Herbal toothpowders are available in market in a wide varieties, which consist of various ingredients. In rural areas of the developing countries, they are still used for cleansing teeth. Erythema multiforme (EM) is an acute mucocutaneous disorder that is believed to be a sequel of a cytotoxic immunologic attack on keratinocytes which express non-self-antigens. A 31-year-old male who used herbal toothpowder for oral-hygiene maintenance presented with ulcers in mouth, encrustation on lips and target lesions on both hands, suggesting Erythema multiforme. An oral biopsy confirmed the diagnosis. To the best of our knowledge, there is no report of an association of herbal extracts and EM in the English literature. With this report, we present a rare new triggering factor of Erythema mutiforme, thus adding it to the endless list of aetiologies.

  13. Herbal Toothpowder Induced Erythema Multiforme

    OpenAIRE

    Satpute, Pranali; Yadav, Lalita; Ahmed, Riyaz; Kashid, Avinash; Peter, Kalpak

    2014-01-01

    Herbal toothpowders are available in market in a wide varieties, which consist of various ingredients. In rural areas of the developing countries, they are still used for cleansing teeth. Erythema multiforme (EM) is an acute mucocutaneous disorder that is believed to be a sequel of a cytotoxic immunologic attack on keratinocytes which express non-self-antigens. A 31-year-old male who used herbal toothpowder for oral-hygiene maintenance presented with ulcers in mouth, encrustation on lips and ...

  14. Erythema multiforme: A case report

    Directory of Open Access Journals (Sweden)

    Arutla Rashmitha

    2017-01-01

    Full Text Available Erythema multiforme (EM is a life threatening mucocutaneous disorder where early diagnosis and management is of utmost important. Among various etiological agents, viral etiology is the most common and is characterized by ulcerations, erosions, and bleeding within the mucosa associated with encrustations and tissue tags. Dermal counterparts present with target iris lesion. Here, we report a case of viral-induced EM major where there are classical oral and dermal lesions in a 28-year-old male patient.

  15. Live attenuated measles virus vaccine therapy for locally established malignant glioblastoma tumor cells

    Directory of Open Access Journals (Sweden)

    Al-Shammari AM

    2014-05-01

    Full Text Available Ahmed M Al-Shammari,1 Farah E Ismaeel,2 Shahlaa M Salih,2 Nahi Y Yaseen11Experimental Therapy Department, Iraqi Center for Cancer and Medical Genetic Researches, Mustansiriya University, 2Departments of Biotechnology, College of Science, Al-Nahrain University, Baghdad, IraqAbstract: Glioblastoma multiforme is the most aggressive malignant primary brain tumor in humans, with poor prognosis. A new glioblastoma cell line (ANGM5 was established from a cerebral glioblastoma multiforme in a 72-year-old Iraqi man who underwent surgery for an intracranial tumor. This study was carried out to evaluate the antitumor effect of live attenuated measles virus (MV Schwarz vaccine strain on glioblastoma multiforme tumor cell lines in vitro. Live attenuated MV Schwarz strain was propagated on Vero, human rhabdomyosarcoma, and human glioblastoma-multiform (ANGM5 cell lines. The infected confluent monolayer appeared to be covered with syncytia with granulation and vacuolation, as well as cell rounding, shrinkage, and large empty space with cell debris as a result of cell lysis and death. Cell lines infected with virus have the ability for hemadsorption to human red blood cells after 72 hours of infection, whereas no hemadsorption of uninfected cells is seen. Detection of MV hemagglutinin protein by monoclonal antibodies in infected cells of all cell lines by immunocytochemistry assay gave positive results (brown color in the cytoplasm of infected cells. Cell viability was measured after 72 hours of infection by 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay. Results showed a significant cytotoxic effect for MV (P≤0.05 on growth of ANGM5 and rhabdomyosarcoma cell lines after 72 hours of infection. Induction of apoptosis by MV was assessed by measuring mitochondrial membrane potentials in tumor cells after 48, 72, and 120 hours of infection. Apoptotic cells were counted, and the mean percentage of dead cells was significantly higher after 48, 72

  16. [Herpes associated erythema multiforme: a case report].

    Science.gov (United States)

    Li, Qing-fu; Li, Duo; Zhou, Hong-mei; Lin, Mei

    2008-08-01

    Herpes associated erythema multiforme (HAEM) is an acute exudative dermatic and mucosal disease caused by infecting herpes simplex virus. It has recurrence and idiorestriction, characterized by increasing of CD4+T leukomonocyte. This article reports a case of herpes associated erythema multiforme, and by way of reviewing relevant literature, discusses the possible mechanism, diagnosis, treatment and prognosis of HAEM.

  17. Glioblastoma Stem-Like Cells—Biology and Therapeutic Implications

    Energy Technology Data Exchange (ETDEWEB)

    Gürsel, Demirkan B., E-mail: jab2029@nyp.org; Shin, Benjamin J.; Burkhardt, Jan-Karl; Kesavabhotla, Kartik; Schlaff, Cody D.; Boockvar, John A., E-mail: jab2029@nyp.org [Laboratory for Translational Brain Tumor and Stem Cell Research, Department of Neurological Surgery, Weill Cornell Brain Tumor Center, Weill Cornell Medical College, New York, NY 10021 (United States)

    2011-06-10

    The cancer stem-cell hypothesis proposes that malignant tumors are likely to encompass a cellular hierarchy that parallels normal tissue and may be responsible for the maintenance and recurrence of glioblastoma multiforme (GBM) in patients. The purpose of this manuscript is to review methods for optimizing the derivation and culturing of stem-like cells also known as tumor stem cells (TSCs) from patient-derived GBM tissue samples. The hallmarks of TSCs are that they must be able to self-renew and retain tumorigenicity. The isolation, optimization and derivation of TSCs as outlined in this review, will be important in understanding biology and therapeutic applications related to these cells.

  18. Toxicity and tropism of oncolytic VSV vectors in glioblastoma gene therapy

    OpenAIRE

    Zehtab Jahedi, Roza

    2012-01-01

    Glioblastoma multiforme is the most common and most fatal primary brain tumor in adults. Despite using advanced conventional therapeutic approaches like surgical resection, radiotherapy and chemotherapy only marginal improvement with a median survival of about 14 months is observed. Thus, finding urgent novel therapeutic strategies to target and kill GBM cells are desperately needed. In this respect, gene therapy provides new perspectives for treating cancer, although the safet...

  19. Congenital brainstem disconnection associated with a syrinx of the brainstem

    NARCIS (Netherlands)

    Barth, P. G.; de Vries, L. S.; Nikkels, P. G. J.; Troost, D.

    We report a case of congenital brainstem disconnection including the second detailed autopsy. A full-term newborn presented with irreversible apnoea and died on the fifth day. MRI revealed disconnection of the brainstem. The autopsy included a series of transverse sections of the mesencephalon,

  20. Imatinib in combination with hydroxyurea versus hydroxyurea alone as oral therapy in patients with progressive pretreated glioblastoma resistant to standard dose temozolomide

    DEFF Research Database (Denmark)

    Dresemann, G.; Weller, M.; Ostenfeld-Rosenthal, Ann Maria

    2010-01-01

    A randomized, multicenter, open-label, phase 3 study of patients with progressive, recurrent glioblastoma multiforme (GBM) for whom front-line therapy had failed was conducted. This study was designed to determine whether combination therapy with imatinib and hydroxyurea (HU) has superior antitumor...

  1. Tropical-wood-induced bullous erythema multiforme.

    Science.gov (United States)

    Shimizu, S; Chen, K R; Pratchyapruit, W O; Shimizu, H

    2000-01-01

    We report a case of bullous erythema multiforme caused by an exotic wood, pao ferro (Machaerium scleroxylon). A 25-year-old female, a luthier (guitar maker) who often handles a variety of woods, developed bullous erythema multiforme. A patch test confirmed a positive reaction to one of the exotic woods, pao ferro. A subsequent accidental short contact with pao ferro 5 months following the first incidence induced a similar exudative erythema. Exotic woods such as pao ferro should be added to the list of contact allergens that can induce bullous erythema multiforme. Copyright (R) 2000 S. Karger AG, Basel.

  2. Apremilast for treatment of recurrent erythema multiforme.

    Science.gov (United States)

    Chen, Tinley; Levitt, Jacob; Geller, Lauren

    2017-01-15

    Recurrent erythema multiforme with oralinvolvement is therapeutically challenging.Apremilast has been used with success in resolvingthe oral aphthae of Behçet disease, prompting theuse of the drug in patients with oral erosions fromerythema multiforme. Three patients with oralerythema multiforme were given apremilast at dosesof 30-60mg daily. Complete clearance of the lesionswere observed in all three patients, including thoserefractory to other standard therapies. Apremilast maypresent an effective option for recurrent erythemamultiforme for patients who have failed trials antiviraland immunosuppressive therapies.

  3. Glioblastoma Circulating Cells: Reality, Trap or Illusion?

    Directory of Open Access Journals (Sweden)

    A. Lombard

    2015-01-01

    Full Text Available Metastases are the hallmark of cancer. This event is in direct relationship with the ability of cancer cells to leave the tumor mass and travel long distances within the bloodstream and/or lymphatic vessels. Glioblastoma multiforme (GBM, the most frequent primary brain neoplasm, is mainly characterized by a dismal prognosis. The usual fatal issue for GBM patients is a consequence of local recurrence that is observed most of the time without any distant metastases. However, it has recently been documented that GBM cells could be isolated from the bloodstream in several studies. This observation raises the question of the possible involvement of glioblastoma-circulating cells in GBM deadly recurrence by a “homing metastasis” process. Therefore, we think it is important to review the already known molecular mechanisms underlying circulating tumor cells (CTC specific properties, emphasizing their epithelial to mesenchymal transition (EMT abilities and their possible involvement in tumor initiation. The idea is here to review these mechanisms and speculate on how relevant they could be applied in the forthcoming battles against GBM.

  4. Lipidized giant-cell glioblastoma of cerebellum.

    Science.gov (United States)

    Queiroz, L S; Faria, A V; Zanardi, V A; Netto, J R Menezes

    2005-01-01

    Glioblastoma multiforme is recognized rarely in the cerebellum. We describe a peculiar case with lipid accumulation in giant tumor cells, possibly the second example so far reported in this unusual location. A 46-year-old man with a 5-month history of headache, vomiting, dizziness and instability of gait, was found to have on magnetic resonance imaging an expanding mass situated deep in the left cerebellar hemisphere. The lesion was hypointense in T 1- and hyperintense in T2-weighted images, had poorly defined borders, peripheral edema and annular foci of contrast enhancement. Eight months after subtotal removal and radiotherapy, control MRI showed tumor recurrence with aggressive features. The patient was alive 15 months after operation but follow-up was eventually lost. Histologically, the tumor showed marked pleomorphism, with many giant cells characterized by finely vacuolated cytoplasm strongly suggestive of lipid accumulation. There were few, sometimes atypical mitotic figures and foci of endothelial proliferation. The tumor cells were strongly positive for GFAP, vimentin and S100 protein, all of which stressed the foamy appearance of the giant cells. About 15% of nuclei were positive for Ki-67. We considered the case to be a so-called lipidized glioblastoma, first recognized as a subtype by Kepes and Rubinstein [1981]. Differential diagnosis with anaplastic pleomorphic xanthoastrocytoma is discussed.

  5. Nuclear SMAD2 Restrains Proliferation of Glioblastoma

    Directory of Open Access Journals (Sweden)

    Yunhu Yu

    2015-03-01

    Full Text Available Aims: Although TGFβ receptor signaling has been shown to play a role in regulation of the growth and metastasis of glioblastoma multiforme (GBM, the downstream pathway through either SMAD2 or SMAD3 has not been elucidated. In this study, we investigate whether nuclear SMAD2 can restrain the proliferation of glioblastoma. Methods: A total of 23 resected specimens from GBM patients were collected for SMAD2 detection. Human GBM cell line A172, U87mg, D341m and Hs683 were maintained in Dulbecco's modified Eagle's medium and transfected with SMAD2 and SMAD3 shRNA plasmids. Gene expression was detected by RT-qPCR and Western and cell growth were detected by MTT assay. Results: Our results showed that the phosphorylated SMAD2 (pSMAD2, the nuclear and functional form of SMAD2 levels in GBM were significantly lower than the paired normal brain tissue in patients. Depletion of SMAD2, but not SMAD3, significantly abolished the inhibitory effects of TGFβ1 on the growth of GBM cells, possibly through pSMAD2-mediated increases in cell-cycle inhibitor, p27. Conclusion: Our data suggest that TGFβ/SMAD2 signaling cascades restrains growth of GBM.

  6. Nuclear receptor TLX inhibits TGF-β signaling in glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Johansson, Erik; Zhai, Qiwei [Sahlgrenska Cancer Center at the Sahlgrenska Academy, University of Gothenburg, Box 425, SE 405 30 Gothenburg (Sweden); Zeng, Zhao-jun [Sahlgrenska Cancer Center at the Sahlgrenska Academy, University of Gothenburg, Box 425, SE 405 30 Gothenburg (Sweden); Molecular Biology Research Center, School of Life Sciences, Central South University, 110, Xiangya Road, Changsha, Hunan 410078 (China); Yoshida, Takeshi [Sahlgrenska Cancer Center at the Sahlgrenska Academy, University of Gothenburg, Box 425, SE 405 30 Gothenburg (Sweden); Funa, Keiko, E-mail: keiko.funa@gu.se [Sahlgrenska Cancer Center at the Sahlgrenska Academy, University of Gothenburg, Box 425, SE 405 30 Gothenburg (Sweden)

    2016-05-01

    TLX (also called NR2E1) is an orphan nuclear receptor that maintains stemness of neuronal stem cells. TLX is highly expressed in the most malignant form of glioma, glioblastoma multiforme (GBM), and is important for the proliferation and maintenance of the stem/progenitor cells of the tumor. Transforming Growth Factor-β (TGF-β) is a cytokine regulating many different cellular processes such as differentiation, migration, adhesion, cell death and proliferation. TGF-β has an important function in cancer where it can work as either a tumor suppressor or oncogene, depending on the cancer type and stage of tumor development. Since glioblastoma often have dysfunctional TGF-β signaling we wanted to find out if there is any interaction between TLX and TGF-β in glioblastoma cells. We demonstrate that knockdown of TLX enhances the canonical TGF-β signaling response in glioblastoma cell lines. TLX physically interacts with and stabilizes Smurf1, which can ubiquitinate and target TGF-β receptor II for degradation, whereas knockdown of TLX leads to stabilization of TGF-β receptor II, increased nuclear translocation of Smad2/3 and enhanced expression of TGF-β target genes. The interaction between TLX and TGF-β may play an important role in the regulation of proliferation and tumor-initiating properties of glioblastoma cells. - Highlights: • TLX knockdown enhances TGF-β dependent Smad signaling in glioblastoma cells • TLX knockdown increases the protein level of TGF-β receptor II. • TLX stabilizes and retains Smurf1 in the cytoplasm. • TLX enhances Smurf1-dependent ubiquitination and degradation of TGF-β receptor II.

  7. Multidrug-induced erythema multiforme.

    Science.gov (United States)

    Isik, S R; Karakaya, G; Erkin, G; Kalyoncu, A F

    2007-01-01

    Adverse skin reactions to drugs are frequent, with rates of reaction to many commonly used drugs exceeding 1%. We describe a 29-year-old woman admitted with a history of itching, rash, vesicles on her hands and soles, and edema on her tongue and oropharynx after trimethoprim-sulfamethoxazole, ciprofloxacin, methenamine anhydromethylene citrate, piroxicam, azithromycin, and ceftriaxone intake. Erythema multiforme (EM) was diagnosed by skin biopsy after oral challenge with piroxicam. EM lesions reappeared after oral challenge with levofloxacin. Although EM is quite common with trimethoprim-sulfamethoxazole and there are some reports of EM appearing after intake of ciprofloxacin, it has rarely been attributed to piroxicam and no reports have identified levofloxacin as a cause.

  8. Erythema multiforme and related disorders.

    Science.gov (United States)

    Al-Johani, Khalid A; Fedele, Stefano; Porter, Stephen R

    2007-05-01

    Erythema multiforme (EM) and related disorders comprise a group of mucocutaneous disorders characterized by variable degrees of mucosal and cutaneous blistering and ulceration that occasionally can give rise to systemic upset and possibly compromise life. The clinical classification of these disorders has often been variable, thus making definitive diagnosis sometimes difficult. Despite being often caused by, or at least associated with, infection or drug therapy, the pathogenic mechanisms of these disorders remain unclear, and as a consequence, there are no evidence-based, reliably effective therapies. The present article reviews aspects of EM and related disorders of relevance to oral medicine clinical practice and highlights the associated potential etiologic agents, pathogenic mechanisms and therapies.

  9. Case Report: Pregnancy in a patient with recurrent glioblastoma [v1; ref status: indexed, http://f1000r.es/27s

    Directory of Open Access Journals (Sweden)

    Birgit Flechl

    2013-11-01

    Full Text Available We report the case of a woman with relapsed glioblastoma multiforme (GBM who recently gave birth. She announced her pregnancy shortly after the sixth cycle of a dense regimen of temozolomide, prescribed for treating the first recurrence of glioblastoma. Three years ago, in April 2008, she had undergone gross total resection of a glioblastoma multiforme in the postcentral region of the right hemisphere and had subsequently received treatment according to the actual standard therapy consisting of radiotherapy up to 60 Gy with concomitant and adjuvant temozolomide. The complete amount of temozolomide given before this pregnancy was 20.9 mg/m2. Nevertheless, she delivered a 1890 g child by caesarean section in the 32/6 week of pregnancy. The child showed no anomalies and is developing normally under close surveillance by paediatricians.

  10. Gingerol sensitizes TRAIL-induced apoptotic cell death of glioblastoma cells.

    Science.gov (United States)

    Lee, Dae-Hee; Kim, Dong-Wook; Jung, Chang-Hwa; Lee, Yong J; Park, Daeho

    2014-09-15

    Glioblastoma multiforme (GBM) is the most lethal and aggressive astrocytoma of primary brain tumors in adults. Although there are many clinical trials to induce the cell death of glioblastoma cells, most glioblastoma cells have been reported to be resistant to TRAIL-induced apoptosis. Here, we showed that gingerol as a major component of ginger can induce TRAIL-mediated apoptosis of glioblastoma. Gingerol increased death receptor (DR) 5 levels in a p53-dependent manner. Furthermore, gingerol decreased the expression level of anti-apoptotic proteins (survivin, c-FLIP, Bcl-2, and XIAP) and increased pro-apoptotic protein, Bax and truncate Bid, by generating reactive oxygen species (ROS). We also found that the sensitizing effects of gingerol in TRAIL-induced cell death were blocked by scavenging ROS or overexpressing anti-apoptotic protein (Bcl-2). Therefore, we showed the functions of gingerol as a sensitizing agent to induce cell death of TRAIL-resistant glioblastoma cells. This study gives rise to the possibility of applying gingerol as an anti-tumor agent that can be used for the purpose of combination treatment with TRAIL in TRAIL-resistant glioblastoma tumor therapy. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Gingerol sensitizes TRAIL-induced apoptotic cell death of glioblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dae-Hee, E-mail: leedneo@gmail.com [Departments of Surgery and Pharmacology and Cell Biology, School of Medicine, University of Pittsburgh, Pittsburgh, PA (United States); Kim, Dong-Wook [Department of Microbiology, Immunology, and Cancer Biology, University of VA (United States); Jung, Chang-Hwa [Division of Metabolism and Functionality Research, Korea Food Research Institute (Korea, Republic of); Lee, Yong J. [Departments of Surgery and Pharmacology and Cell Biology, School of Medicine, University of Pittsburgh, Pittsburgh, PA (United States); Park, Daeho, E-mail: daehopark@gist.ac.kr [School of Life Sciences, Gwangju Institute of Science and Technology, Gwangju 500-712 (Korea, Republic of)

    2014-09-15

    Glioblastoma multiforme (GBM) is the most lethal and aggressive astrocytoma of primary brain tumors in adults. Although there are many clinical trials to induce the cell death of glioblastoma cells, most glioblastoma cells have been reported to be resistant to TRAIL-induced apoptosis. Here, we showed that gingerol as a major component of ginger can induce TRAIL-mediated apoptosis of glioblastoma. Gingerol increased death receptor (DR) 5 levels in a p53-dependent manner. Furthermore, gingerol decreased the expression level of anti-apoptotic proteins (survivin, c-FLIP, Bcl-2, and XIAP) and increased pro-apoptotic protein, Bax and truncate Bid, by generating reactive oxygen species (ROS). We also found that the sensitizing effects of gingerol in TRAIL-induced cell death were blocked by scavenging ROS or overexpressing anti-apoptotic protein (Bcl-2). Therefore, we showed the functions of gingerol as a sensitizing agent to induce cell death of TRAIL-resistant glioblastoma cells. This study gives rise to the possibility of applying gingerol as an anti-tumor agent that can be used for the purpose of combination treatment with TRAIL in TRAIL-resistant glioblastoma tumor therapy. - Highlights: • Most GBM cells have been reported to be resistant to TRAIL-induced apoptosis. • Gingerol enhances the expression level of anti-apoptotic proteins by ROS. • Gingerol enhances TRAIL-induced apoptosis through actions on the ROS–Bcl2 pathway.

  12. Isolated third ventricle glioblastoma.

    Science.gov (United States)

    Yılmaz, Baran; Ekşi, Murat Şakir; Demir, Mustafa Kemal; Akakın, Akın; Toktaş, Zafer Orkun; Yapıcıer, Özlem; Kılıç, Türker

    2016-01-01

    Glioblastoma is the most common and the most malignant type of gliomas. Cerebral hemispheres are usual locations for gliomas. Isolated third ventricular presentation is very rare for glioblastomas. A new case of isolated third ventricular glioblastoma has been presented in this report. A 36-year-old woman was admitted to outpatient clinic with headache, blurred vision and confusion. A head CT scan and MRI had showed third ventricular mass lesion with obstructive hydrocephalus. Previous to her admission to our clinic, a ventriculo-peritoneal shunt had been inserted and her hydrocephalus had been relieved to some extent in acute settings. In our clinic, stereotactic biopsy was performed and a second ventriculoperitoneal shunt was inserted from the opposite site. Histopathological diagnosis was glioblastoma. Radiotherapy and chemotherapy were started immediately after the surgery. Patient's hydrocephalus has resolved and she was well at post-operative 6th month. In differential diagnosis list of the tumors presenting in the third ventricle, there are plenty of tumors such as colloid cyst, meningioma, germinoma, craniopharyngioma, lymphoma, choroid plexus papilloma, subependymal giant cell astrocytoma, chiasmatic and hypothalamic benign astrocytoma. Ring enhancement of this region pathology is a peculiar sign for glioblastoma, yet not pathognomonic. Tumor histology is crucial to yield the final diagnosis. Management of obstructive hydrocephalus, making histopathological diagnosis, starting adjuvant radiotherapy and chemotherapy in isolated third ventricular glioblastomas is a safe and effective approach when we consider malignant nature and intractable progress of glioblastomas.

  13. [Morphological classification of glioblastomas].

    Science.gov (United States)

    Figarella-Branger, D; Bouvier, C; Moroch, J; Michalak, S; F Burel-Vandenbos

    2010-12-01

    In the 2007 WHO classification, glioblastomas are classified among the group of astrocytic tumors. They are highly malignant (grade IV). This group of tumors is morphologically heterogeneous. The WHO distinguishes between clinico-pathological entities, variants of entities and histological pattern. Variants are defined as being reliably indentified histologically and having some relevance for clinical outcome but as still being part of a previously defined overarching entity. Patterns of differentiation are identifiable by histological appearances but without clinical or pathological significance. The description of the histological and immunohistochemical features is based on the 2007 WHO classification. In addition to the classic form of glioblastoma, two variants exist: the giant cell GBM and the gliosarcoma. The first but not the second would have a better outcome than the classic glioblastoma. The WHO classification also distinguishes several patterns of differentiation: small cells glioblastoma; glioblastoma with lipidized cells; glioblastoma with oligodendroglioma component; glioblastoma with heterologous differentiation. These patterns have to be recognized because they represent sometimes a diagnostic challenge. GFAP, Olig2 and Mib1/Ki67 are the most relevant immunohistochemical markers. Diagnostic value of neuronal markers is still controversial. EGFR or p53 expression can be detected and their prognosis value is discussed in this chapter. A systematic analysis of some markers in routine, for example IDH1 or internexin-a, could help to define more homogeneous groups of patients. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  14. Nanotechnology applications for glioblastoma.

    Science.gov (United States)

    Nduom, Edjah K; Bouras, Alexandros; Kaluzova, Milota; Hadjipanayis, Costas G

    2012-07-01

    Glioblastoma remains one of the most difficult cancers to treat and represents the most common primary malignancy of the brain. Although conventional treatments have found modest success in reducing the initial tumor burden, infiltrating cancer cells beyond the main mass are responsible for tumor recurrence and ultimate patient demise. Targeting residual infiltrating cancer cells requires the development of new treatment strategies. The emerging field of cancer nanotechnology holds promise in the use of multifunctional nanoparticles for imaging and targeted therapy of glioblastoma. This article examines the current state of nanotechnology in the treatment of glioblastoma and directions of further study. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Oral mucosal diseases: erythema multiforme.

    Science.gov (United States)

    Scully, Crispian; Bagan, Jose

    2008-03-01

    Erythema multiforme (EM) is a rare acute mucocutaneous condition caused by a hypersensitivity reaction with the appearance of cytotoxic T lymphocytes in the epithelium that induce apoptosis in keratinocytes, which leads to satellite cell necrosis. EM can be triggered by a range of factors, but the best documented association is with preceding infection with herpes simplex virus (HSV). Most other cases are initiated by drugs. EM has been classified into a number of variants, mainly minor and major forms, as it may involve the mouth alone, or present as a skin eruption with or without oral or other lesions of the mucous membrane. EM minor typically affects only one mucosa, and may be associated with symmetrical target skin lesions on the extremities. EM major typically involves two or more mucous membranes with more variable skin involvement. A severe variant of EM major is Stevens-Johnson syndrome, which typically extensively involves the skin. Both EM major and Stevens-Johnson syndrome can involve internal organs and produce systemic symptoms. Treatment of EM is controversial, as there is no reliable evidence. Precipitants should be avoided or treated and, in severe cases, corticosteroids may be needed. Toxic epidermal necrolysis may be similar to Stevens-Johnson syndrome, but many experts regard it as a discrete disease, and therefore it is not discussed here.

  16. Temozolomide Resistance in Glioblastoma Cell Lines: Implication of MGMT, MMR, P-Glycoprotein and CD133 Expression.

    Science.gov (United States)

    Perazzoli, Gloria; Prados, Jose; Ortiz, Raul; Caba, Octavio; Cabeza, Laura; Berdasco, Maria; Gónzalez, Beatriz; Melguizo, Consolación

    2015-01-01

    The use of temozolomide (TMZ) has improved the prognosis for glioblastoma multiforme patients. However, TMZ resistance may be one of the main reasons why treatment fails. Although this resistance has frequently been linked to the expression of O6-methylguanine-DNA methyltransferase (MGMT) it seems that this enzyme is not the only molecular mechanism that may account for the appearance of drug resistance in glioblastoma multiforme patients as the mismatch repair (MMR) complex, P-glycoprotein, and/or the presence of cancer stem cells may also be implicated. Four nervous system tumor cell lines were used to analyze the modulation of MGMT expression and MGMT promoter methylation by TMZ treatment. Furthermore, 5-aza-2'-deoxycytidine was used to demethylate the MGMT promoter and O(6)-benzylguanine to block GMT activity. In addition, MMR complex and P-glycoprotein expression were studied before and after TMZ exposure and correlated with MGMT expression. Finally, the effect of TMZ exposure on CD133 expression was analyzed. Our results showed two clearly differentiated groups of tumor cells characterized by low (A172 and LN229) and high (SF268 and SK-N-SH) basal MGMT expression. Interestingly, cell lines with no MGMT expression and low TMZ IC50 showed a high MMR complex expression, whereas cell lines with high MGMT expression and high TMZ IC50 did not express the MMR complex. In addition, modulation of MGMT expression in A172 and LN229 cell lines was accompanied by a significant increase in the TMZ IC50, whereas no differences were observed in SF268 and SK-N-SH cell lines. In contrast, P-glycoprotein and CD133 was found to be unrelated to TMZ resistance in these cell lines. These results may be relevant in understanding the phenomenon of TMZ resistance, especially in glioblastoma multiforme patients laking MGMT expression, and may also aid in the design of new therapeutic strategies to improve the efficacy of TMZ in glioblastoma multiforme patients.

  17. [Lip synechiae after erythema multiforme].

    Science.gov (United States)

    Brajon, D; Bursztejn, A-C; Goffinet, L; Schmutz, J-L; Barbaud, A

    2013-04-01

    Mucosal erosions in bullous diseases and leading to mucosal sequelae are widely described in toxic epidermal necrolysis (TEN). These complications cause disfigurement and functional impairment. They are more rarely reported in erythema multiforme (EM). We report a case of lip adhesion following EM induced by Mycoplasma pneumoniae. A 12-year-old boy was hospitalized in a paediatric intensive care unit. He had a prominent target skin rash on the palms and soles. Mucosal injury was associated with conjunctivitis, balanitis without dysuria and hyperalgesic stomatitis. M. pneumoniae serology was positive with immunoglobulin M. We made a diagnosis of EM secondary to M. pneumoniae infection. Two months later, the skin lesions had completely disappeared but the patient's mouth opening was limited to 25 mm and he presented bilateral adhesions between the upper and lower lips of 5mm on the right and 8mm on the left resulting in aesthetic and functional damage. Mucosal damage and its sequelae have been widely described in TEN. Ophthalmic sequelae are more frequent. A case of labial synechiae secondary to TEN has been reported. In EM, mucosal lesions occur in 100% of cases with a further mucosal problem being present in 50% of patients. Mucosal damage has been reported during EM flares but there are no studies of side-effects after the acute episode. Oral mucosal adhesions can cause cosmetic sequelae, but above all they hinder functional prognosis. These complications must be prevented by making gutters of vestibular deepening and lip movements with maximum mouth opening several times a day, starting as soon as possible. Appropriate pain management should be undertaken to ensure patient comfort and avoid the need for analgesics and restriction of movement. Mucosal sequelae exist in EM. Whatever their cause, complications involving the mucosa must be prevented through early, tailored and multidisciplinary treatment. Adequate pain management must not be overlooked. Copyright

  18. Oral manifestations of erythema multiforme.

    Science.gov (United States)

    Ayangco, Lilibeth; Rogers, Roy S

    2003-01-01

    Erythema multiforme is a reactive mucocutaneous disorder in a disease spectrum that comprises a self-limited, mild, exanthematic, cutaneous variant with minimal oral involvement (EM minor) to a progressive, fulminating, severe variant with extensive mucocutaneous epithelial necrosis (SJS and TEN). Significant differences exist among EM minor, EM major, SJS, and TEN with regards to severity and clinical expression; however, all variants share two common features: typical or less typical cutaneous target lesions and satellite-cell or more widespread necrosis of the epithelium. These features are considered to be sequelae of a cytotoxic immunologic attack on keratinocytes expressing non-self-antigens. These antigens are primarily microbial (viruses) or drugs and in rare instances histocompatibility antigens [5]. Although the precise pathogenesis is unknown, there is a tendency to consider EM both minor and major as part of one spectrum that is most often triggered by viral infections, and SJS and TEN as a separate one most often elicited by drugs with EM major and SJS representing a bridge in the continuum of EM. The oral manifestations of the spectrum of EM range from tender superficial erythematous and hyperkeratotic plaques to painful deep hemorrhagic bullae and erosions. Other mucosal surfaces including ocular, nasal, pharyngeal, laryngeal, upper respiratory, and anogenital may be involved. Scarring sequelae from ocular and pharyngeal involvement cause morbidity. The oral EM variant is an underrecognized form of EM. Most patients have chronic or recurrent oral lesions only, but one third have oral and lip lesions and one quarter have oral, lip, and skin lesions. This variant is a reaction pattern similar to EM minor, EM major, SJS, and TEN. The diagnosis of oral EM is one of exclusion. Careful clinical evaluation for other chronic mucocutaneous diseases, such as pemphigus, paraneoplastic pemphigus, mucous membrane pemphigoid, and lichen planus, is a necessary

  19. Microglial stimulation of glioblastoma invasion involves epidermal growth factor receptor (EGFR) and colony stimulating factor 1 receptor (CSF-1R) signaling.

    Science.gov (United States)

    Coniglio, Salvatore J; Eugenin, Eliseo; Dobrenis, Kostantin; Stanley, E Richard; West, Brian L; Symons, Marc H; Segall, Jeffrey E

    2012-05-09

    Glioblastoma multiforme is a deadly cancer for which current treatment options are limited. The ability of glioblastoma tumor cells to infiltrate the surrounding brain parenchyma critically limits the effectiveness of current treatments. We investigated how microglia, the resident macrophages of the brain, stimulate glioblastoma cell invasion. We first examined the ability of normal microglia from C57Bl/6J mice to stimulate GL261 glioblastoma cell invasion in vitro. We found that microglia stimulate the invasion of GL261 glioblastoma cells by approximately eightfold in an in vitro invasion assay. Pharmacological inhibition of epidermal growth factor receptor (EGFR) strongly inhibited microglia-stimulated invasion. Furthermore, blockade of colony stimulating factor 1 receptor (CSF-1R) signaling using ribonucleic acid (RNA) interference or pharmacological inhibitors completely inhibited microglial enhancement of glioblastoma invasion. GL261 cells were found to constitutively secrete CSF-1, the levels of which were unaffected by epidermal growth factor (EGF) stimulation, EGFR inhibition or coculture with microglia. CSF-1 only stimulated microglia invasion, whereas EGF only stimulated glioblastoma cell migration, demonstrating a synergistic interaction between these two cell types. Finally, using PLX3397 (a CSF-1R inhibitor that can cross the blood-brain barrier) in live animals, we discovered that blockade of CSF-1R signaling in vivo reduced the number of tumor-associated microglia and glioblastoma invasion. These data indicate that glioblastoma and microglia interactions mediated by EGF and CSF-1 can enhance glioblastoma invasion and demonstrate the possibility of inhibiting glioblastoma invasion by targeting glioblastoma-associated microglia via inhibition of the CSF-1R.

  20. [Giant cell glioblastoma. Case report].

    Science.gov (United States)

    Alvarez-Betancourt, Leonardo; López-Ortega, Salvador; Caldera-Duarte, Agustín

    2004-01-01

    Glioblastomas (World Health Organization, (WHO), grade IV) are the most frequent and malignant neoplasms of the human nervous system. Giant cells glioblastomas, a subtype of these, account for less than 1% of all brain toumors and up to 5% of glioblastomas. We present the case of a female who was diagnosed and treated for a right intra and paraventricular giant cell glioblastoma. We enfatize the importance of histological features of this toumor related to its prognosis.

  1. The role of IDH1 mutated tumour cells in secondary glioblastomas: an evolutionary game theoretical view

    Science.gov (United States)

    Basanta, David; Scott, Jacob G.; Rockne, Russ; Swanson, Kristin R.; Anderson, Alexander R. A.

    2011-02-01

    Recent advances in clinical medicine have elucidated two significantly different subtypes of glioblastoma which carry very different prognoses, both defined by mutations in isocitrate dehydrogenase-1 (IDH-1). The mechanistic consequences of this mutation have not yet been fully clarified, with conflicting opinions existing in the literature; however, IDH-1 mutation may be used as a surrogate marker to distinguish between primary and secondary glioblastoma multiforme (sGBM) from malignant progression of a lower grade glioma. We develop a mathematical model of IDH-1 mutated secondary glioblastoma using evolutionary game theory to investigate the interactions between four different phenotypic populations within the tumor: autonomous growth, invasive, glycolytic, and the hybrid invasive/glycolytic cells. Our model recapitulates glioblastoma behavior well and is able to reproduce two recent experimental findings, as well as make novel predictions concerning the rate of invasive growth as a function of vascularity, and fluctuations in the proportions of phenotypic populations that a glioblastoma will experience under different microenvironmental constraints.

  2. Ion channel expression patterns in glioblastoma stem cells with functional and therapeutic implications for malignancy.

    Science.gov (United States)

    Pollak, Julia; Rai, Karan G; Funk, Cory C; Arora, Sonali; Lee, Eunjee; Zhu, Jun; Price, Nathan D; Paddison, Patrick J; Ramirez, Jan-Marino; Rostomily, Robert C

    2017-01-01

    Ion channels and transporters have increasingly recognized roles in cancer progression through the regulation of cell proliferation, migration, and death. Glioblastoma stem-like cells (GSCs) are a source of tumor formation and recurrence in glioblastoma multiforme, a highly aggressive brain cancer, suggesting that ion channel expression may be perturbed in this population. However, little is known about the expression and functional relevance of ion channels that may contribute to GSC malignancy. Using RNA sequencing, we assessed the enrichment of ion channels in GSC isolates and non-tumor neural cell types. We identified a unique set of GSC-enriched ion channels using differential expression analysis that is also associated with distinct gene mutation signatures. In support of potential clinical relevance, expression of selected GSC-enriched ion channels evaluated in human glioblastoma databases of The Cancer Genome Atlas and Ivy Glioblastoma Atlas Project correlated with patient survival times. Finally, genetic knockdown as well as pharmacological inhibition of individual or classes of GSC-enriched ion channels constrained growth of GSCs compared to normal neural stem cells. This first-in-kind global examination characterizes ion channels enriched in GSCs and explores their potential clinical relevance to glioblastoma molecular subtypes, gene mutations, survival outcomes, regional tumor expression, and experimental responses to loss-of-function. Together, the data support the potential biological and therapeutic impact of ion channels on GSC malignancy and provide strong rationale for further examination of their mechanistic and therapeutic importance.

  3. Ion channel expression patterns in glioblastoma stem cells with functional and therapeutic implications for malignancy.

    Directory of Open Access Journals (Sweden)

    Julia Pollak

    Full Text Available Ion channels and transporters have increasingly recognized roles in cancer progression through the regulation of cell proliferation, migration, and death. Glioblastoma stem-like cells (GSCs are a source of tumor formation and recurrence in glioblastoma multiforme, a highly aggressive brain cancer, suggesting that ion channel expression may be perturbed in this population. However, little is known about the expression and functional relevance of ion channels that may contribute to GSC malignancy. Using RNA sequencing, we assessed the enrichment of ion channels in GSC isolates and non-tumor neural cell types. We identified a unique set of GSC-enriched ion channels using differential expression analysis that is also associated with distinct gene mutation signatures. In support of potential clinical relevance, expression of selected GSC-enriched ion channels evaluated in human glioblastoma databases of The Cancer Genome Atlas and Ivy Glioblastoma Atlas Project correlated with patient survival times. Finally, genetic knockdown as well as pharmacological inhibition of individual or classes of GSC-enriched ion channels constrained growth of GSCs compared to normal neural stem cells. This first-in-kind global examination characterizes ion channels enriched in GSCs and explores their potential clinical relevance to glioblastoma molecular subtypes, gene mutations, survival outcomes, regional tumor expression, and experimental responses to loss-of-function. Together, the data support the potential biological and therapeutic impact of ion channels on GSC malignancy and provide strong rationale for further examination of their mechanistic and therapeutic importance.

  4. [Erythema multiforme majus and Chlamydia pneumoniae infection].

    Science.gov (United States)

    Saada, D; Velasco, S; Vabres, P; Guillet, G

    2006-12-01

    Erythema multiforme majus of infectious origin is an acute eruptive syndrome seen more commonly in young subjects and characterised by an appearance of round target lesions. In most cases, it is associated with infection involving Herpes simplex virus or Mycoplasma pneumoniae. We report an original case of erythema multiforme majus subsequent to infection with Chlamydia pneumoniae. An 18 year-old man was hospitalised for management of generalised skin rash comprising lesions in rings, associated with bullous and post-bullous lesions, chiefly in the oral (preventing eating) and genital areas in a setting of febrile cough. Various bacterial agents (Mycoplasma pneumoniae, Chlamydia pneumoniae) and viral agents were suspected, but serological testing for Chlamydia pneumoniae alone was positive with IgM of 128 IU and IgG of 64 IU. The outcome was favourable within several days following administration of symptomatic treatment (rehydration, mouthwashes, etc.) and aetiological treatment (acyclovir: 30 mg/kg/d, ofloxacine: 400 mg/d). At D15, serologic tests for Mycoplasma pneumoniae continued to be negative. Anti-Chlamydia pneumoniae IgM and IgG were 256 IU. At D30, IgM was 128 IU while IgG remained at 256 IU. The existence of a systematic skin rash comprising typical target lesions and mucosal lesions in the oral and genital areas suggested to us a diagnosis of erythema multiforme majus. Screening for the agents generally responsible was negative and drug-induced rash was ruled out. Serological tests for Chlamydia pneumoniae were positive at various times, resulting in diagnosis of erythema multiforme majus secondary to infection with Chlamydia pneumoniae. Following demonstration of the presence of Chlamydia pneumoniae using reliable methods and the elimination of other causes of erythema multiforme majus, dermatologists should opt for this aetiology in order to optimise treatment.

  5. The Role of Hypoxia in Glioblastoma Invasion

    Directory of Open Access Journals (Sweden)

    Ana Rita Monteiro

    2017-11-01

    Full Text Available Glioblastoma multiforme (GBM, a grade IV astrocytoma, is the most common and deadly type of primary malignant brain tumor, with a patient’s median survival rate ranging from 15 to 17 months. The current treatment for GBM involves tumor resection surgery based on MRI image analysis, followed by radiotherapy and treatment with temozolomide. However, the gradual development of tumor resistance to temozolomide is frequent in GBM patients leading to subsequent tumor regrowth/relapse. For this reason, the development of more effective therapeutic approaches for GBM is of critical importance. Low tumor oxygenation, also known as hypoxia, constitutes a major concern for GBM patients, since it promotes cancer cell spreading (invasion into the healthy brain tissue in order to evade this adverse microenvironment. Tumor invasion not only constitutes a major obstacle to surgery, radiotherapy, and chemotherapy, but it is also the main cause of death in GBM patients. Understanding how hypoxia triggers the GBM cells to become invasive is paramount to developing novel and more effective therapies against this devastating disease. In this review, we will present a comprehensive examination of the available literature focused on investigating how GBM hypoxia triggers an invasive cancer cell phenotype and the role of these invasive proteins in GBM progression.

  6. CD34 expression in glioblastoma and giant cell glioblastoma.

    Science.gov (United States)

    Galloway, M

    2010-01-01

    This study aimed to determine whether CD34 is expressed in glioblastomas and giant cell glioblastomas, as this information may be of value when attempting to differentiate between giant cell glioblastomas and other relevant differential diagnoses such as pleomorphic xanthoastrocytomas with anaplastic features and anaplastic gangliogliomas. 11 giant cell glioblastomas and 16 non-giant cell glioblastomas were assessed with immunocytochemical staining for CD34. Standard immunocytochemical techniques were used, to reflect the staining patterns likely to be seen in routine diagnostic practice. Positive staining refers to staining of neoplastic cells. 73% of giant cell glioblastomas showed some degree of staining for CD34, and 55% showed strong widespread staining. 56% of non-giant cell glioblastomas showed some degree of CD34 staining, and 25% showed strong widespread staining. Both giant cell and non-giant cell glioblastomas frequently show CD34 expression by neoplastic cells, which may in some cases be strong and diffuse. Strong widespread staining of neoplastic cells for CD34 was more frequent in giant cell than non-giant cell glioblastomas, however this difference was not statistically significant. CD34 staining in isolation is unlikely to be of assistance in differentiating between giant cell glioblastoma and pleomorphic xanthoastrocytomas with anaplastic features or anaplastic gangliogliomas.

  7. Pro-apoptotic and anti-angiogenic properties of the α /β-thujone fraction from Thuja occidentalis on glioblastoma cells.

    Science.gov (United States)

    Torres, Angelo; Vargas, Yosselyn; Uribe, Daniel; Carrasco, Cristian; Torres, Cristian; Rocha, René; Oyarzún, Carlos; San Martín, Rody; Quezada, Claudia

    2016-05-01

    The most aggressive type of brain tumor is glioblastoma multiforme, which to date remains incurable. Thuja occidentalis is used in homeopathy for the treatment of cancer, however, its mechanism of action remains unknown. We set out to study the effects of thujone fractions of Thuja on glioblastoma using in vitro and in vivo models. We found that the α/ β-thujone fraction decrease the cell viability and exhibit a potent anti-proliferative, pro-apoptotic and anti-angiogenic effects in vitro. In vivo assays showed that α /β-thujone promotes the regression of neoplasia and inhibits the angiogenic markers VEGF, Ang-4 and CD31 into the tumor.

  8. Radiation induced sarcoma after treatment of glioblastoma: case report; Sarcoma radioinduzido pós-tratamento de glioblastoma: relato de caso

    Energy Technology Data Exchange (ETDEWEB)

    Rosa, Victor Domingos Lisita; Anjos, Caroline Souza dos; Candido, Priscila Barile Marchi; Dias Junior, Antonio Soares; Santos, Evandro Airton Sordi dos; Godoy, Antonio Carlos Cavalcante; Saggioro, Fabiano P.; Carlotti Junior, Carlos Gilberto; Oliveira, Harley Francisco de; Peria, Fernanda Maris, E-mail: fernandaperia@fmrp.usp.br, E-mail: victor_lisita@yahoo.com.br, E-mail: carolinesanjos@gmail.com, E-mail: priscilabarile@yahoo.com.br [Universidade de Sao Paulo (USP), Ribeirão Preto, SP (Brazil). Hospital das Clinicas

    2016-07-01

    Introduction: Glioblastoma multiform is the most lethal central nervous system neoplasm, with a median survival of around 13 months and the worst prognosis among all gliomas. The therapeutic approach of glioblastoma consists in neurosurgery with maximum possible resection of tumor volume, followed by radiotherapy and chemotherapy. Radiotherapy reduces the risk of tumor recurrence through direct and indirect damage to tumor deoxyribonucleic acid. The long-term effects of radiation therapy include tissue necrosis, vasculopathy, and radiation-induced neoplasia. The most reported secondary intracranial malignant tumors include meningiomas, gliomas, and sarcomas. The latency period between skull radiotherapy and the appearance of radioinduced lesions varies in the literature from six months to 47 years, with an average of 18.7 years. Case report: The present report describes the appearance of high-grade spindle cell sarcoma after ten months in a patient who received glioblastoma treatment at Hospital das Clínicas of Ribeirão Preto of the University of São Paulo. Conclusion: The rarity of this association is probably due to the poor survival of patients with glioblastoma, thus limiting the time to development of secondary neoplasia.

  9. Reciprocal Supportive Interplay between Glioblastoma and Tumor-Associated Macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Wenchao; Bao, Shideng, E-mail: baos@ccf.org [Department of Stem Cell Biology and Regenerative Medicine, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44195 (United States)

    2014-03-26

    Glioblastoma multiforme (GBM) is the most lethal and aggressive type of primary brain malignancy. Failures of the traditional therapies in treating GBMs raise the urgent requirement to develop new approaches with more responsive targets. The phenomenon of the high infiltration of tumor-associated macrophages (TAMs) into GBMs has been observed for a long time. Regardless of the limited knowledge about TAMs, the high percentage of supportive TAM in GBM tumor mass makes it possible to be a good target for GBM treatment. In this review, we discussed the unique features of TAMs in GBMs, including their origin, the tumor-supportive properties, the secreted cytokines, and the relevant mechanisms. In addition, we tried to interpret the current understandings about the interplay between GBM cancer cells and TAMs. Finally, the translational studies of targeting TAMs were also described.

  10. Human cytomegalovirus-mediated immunomodulation: Effects on glioblastoma progression.

    Science.gov (United States)

    Foster, Haidn; Ulasov, Ilya V; Cobbs, Charles S

    2017-08-01

    The presence of human cytomegalovirus (HCMV) and glioblastoma multiforme (GBM), first established in 2002, has developed into an area of considerable interest and controversy. Numerous studies have found evidence of possible HCMV infection of GBM tumor cells as well as myriad onco- and immunomodulatory properties exhibited by HCMV antigens and transcripts, while recent reports have failed to detect HCMV particles in GBM and question the virus' role in tumor progression. This review highlights the known immunomodulatory properties of HCMV, independent of GBM infection status, that help drive the virus from peripheral blood into the vital tissues and subsequently dampen local immune response, assisting GBM tumors in evading immune surveillance and contributing to the disease's poor prognosis. Emerging antiviral approaches to treating GBM, including antiviral drugs and immunotherapies directed against HCMV, are also examined. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. NHERF-1: Modulator of Glioblastoma Cell Migration and Invasion

    Directory of Open Access Journals (Sweden)

    Kerri L. Kislin

    2009-04-01

    Full Text Available The invasive nature of malignant gliomas is a clinical problem rendering tumors incurable by conventional treatment modalities such as surgery, ionizing radiation, and temozolomide. Na+/H+ exchanger regulatory factor 1 (NHERF-1 is a multifunctional adaptor protein, recruiting cytoplasmic signaling proteins and membrane receptors/transporters into functional complexes. This study revealed that NHERF-1 expression is increased in highly invasive cells that reside in the rim of glioblastoma multiforme (GBM tumors and that NHERF-1 sustains glioma migration and invasion. Gene expression profiles were evaluated from laser capture-microdissected human GBM cells isolated from patient tumor cores and corresponding invaded white matter regions. The role of NHERF-1 in the migration and dispersion of GBM cell lines was examined by reducing its expression with small-interfering RNA followed by radial migration, three-dimensional collagen dispersion, immunofluorescence, and survival assays. The in situ expression of NHERF-1 protein was restricted to glioma cells and the vascular endothelium, with minimal to no detection in adjacent normal brain tissue. Depletion of NHERF-1 arrested migration and dispersion of glioma cell lines and caused an increase in cell-cell cohesiveness. Glioblastoma multiforme cells with depleted NHERF-1 evidenced a marked decrease in stress fibers, a larger cell size, and a more rounded shape with fewer cellular processes. When NHERF-1 expression was reduced, glioma cells became sensitized to temozolomide treatment resulting in increased apoptosis. Taken together, these results provide the first evidence for NHERF-1 as a participant in the highly invasive phenotype of malignant gliomas and implicate NHERF-1 as a possible therapeutic target for treatment of GBM.

  12. High levels of c-Met is associated with poor prognosis in glioblastoma

    DEFF Research Database (Denmark)

    Petterson, Stine Asferg; Dahlrot, Rikke Hedegaard; Hermansen, Simon Kjær

    2015-01-01

    . Measurements of high c-Met intensity correlated with high WHO grade (p = 0.006) but no association with survival was observed in patients with WHO grade II (p = 0.09) or III (p = 0.17) tumors. High expression of c-Met was associated with shorter overall survival in patients with glioblastoma multiforme (p = 0...... and the clinical variables age (HR 1.01, 95 % CI 0.99-1.03, p = 0.30), performance status (HR 1.34, 95 % CI 1.17-1.53, p

  13. Modeling invasion of brain tissue by glioblastoma cells: ECM alignment and motility

    Science.gov (United States)

    Sander, L. M.

    2013-03-01

    A key stage in the development of highly malignant brain tumors (Glioblastoma Multiforme) is invasion of normal brain tissue by motile cells moving through a crowded, complex environment. Evidence from in vitro experiments suggests the cell motion is accompanied by considerable deformation and alignment of the extra-cellular matrix (ECM) of the brain. In the case of breast cancer, alignment effects of this sort have been seen in vivo. We have modeled features of this system including stress confinement in the non-linear elasticity of the ECM and contact guidance of the cell motion.

  14. Lyme disease of the brainstem

    Energy Technology Data Exchange (ETDEWEB)

    Kalina, Peter [Mayo Clinic, Department of Radiology, Rochester, MN (United States); Decker, Andrew [Northern Westchester Hospital Center, Department of Neurology, Mt. Kisco, NY (United States); Kornel, Ezriel [Northern Westchester Hospital Center, Division of Neurosurgery, Mt. Kisco, NY (United States); Halperin, John J. [North Shore University Hospital, Department of Neurology, Manhasset, NY (United States)

    2005-12-01

    Lyme disease is a multisystem infectious disease caused by the tick-borne spirochete, Borrelia burgdorferi. Central nervous system (CNS) involvement typically causes local inflammation, most commonly meningitis, but rarely parenchymal brain involvement. We describe a patient who presented with clinical findings suggesting a brainstem process. Magnetic resonance imaging (MRI) and positron emission tomography (PET) suggested a brainstem neoplasm. Prior to biopsy, laboratory evaluation led to the diagnosis of Lyme disease. Clinical and imaging abnormalities improved markedly following antimicrobial therapy. We describe Lyme disease involvement of the cerebellar peduncles with hypermetabolism on PET. Although MRI is the primary imaging modality for most suspected CNS pathology, the practical applications of PET continue to expand. (orig.)

  15. Pilomyxoid astrocytoma of the brainstem

    Directory of Open Access Journals (Sweden)

    Marco Antonio Zanini

    2013-04-01

    Full Text Available A pilomyxoid astrocytoma is a recently described tumor that occurs predominantly in the hypothalamic-chiasmatic region and is rarely found elsewhere. It has similar features as pilocytic astrocytomas, but has distinct histological characteristics and a poorer prognosis. A pilomyxoid astrocytoma is an aggressive tumor, and increased awareness is necessary with a suspect case. We present the first case of a pilomyxoid astrocytoma of the brainstem described after the newest World Health Organization classification of central nervous system tumors.

  16. Auditory brainstem implant program development.

    Science.gov (United States)

    Schwartz, Marc S; Wilkinson, Eric P

    2017-08-01

    Auditory brainstem implants (ABIs), which have previously been used to restore auditory perception to deaf patients with neurofibromatosis type 2 (NF2), are now being utilized in other situations, including treatment of congenitally deaf children with cochlear malformations or cochlear nerve deficiencies. Concurrent with this expansion of indications, the number of centers placing and expressing interest in placing ABIs has proliferated. Because ABI placement involves posterior fossa craniotomy in order to access the site of implantation on the cochlear nucleus complex of the brainstem and is not without significant risk, we aim to highlight issues important in developing and maintaining successful ABI programs that would be in the best interests of patients. Especially with pediatric patients, the ultimate benefits of implantation will be known only after years of growth and development. These benefits have yet to be fully elucidated and continue to be an area of controversy. The limited number of publications in this area were reviewed. Review of the current literature was performed. Disease processes, risk/benefit analyses, degrees of evidence, and U.S. Food and Drug Administration approvals differ among various categories of patients in whom auditory brainstem implantation could be considered for use. We suggest sets of criteria necessary for the development of successful and sustaining ABI programs, including programs for NF2 patients, postlingually deafened adult nonneurofibromatosis type 2 patients, and congenitally deaf pediatric patients. Laryngoscope, 127:1909-1915, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

  17. Herpes associated erythema multiforme annularis concentricum

    Directory of Open Access Journals (Sweden)

    Kuldeep C

    1995-01-01

    Full Text Available A young man had large, concentric plaques over the back and extensors of forearms for eight weeks. Past history suggested recurrent herpes labialis. Serum anti HSV-1 IgG titre was raised to 32 micrograms/l and histopathology of an active lesion suggested erythema multiforme. Symptomatic treatment and oral zinc therapy subsided EM lesions but concentric depigmentation developed after healing

  18. Pediatric giant cell glioblastoma: a case report and review of the literature.

    Science.gov (United States)

    De Prada, I; Cordobés, F; Azorín, D; Contra, T; Colmenero, I; Glez-Mediero, I

    2006-03-01

    Giant cell glioblastoma is a subtype of glioblastoma multiforme (GM) whose most characteristic histology is the presence of plentiful multinucleated giant cells. These tumours are very rare and account for only 5% of GM. They do not have specific localization, although normally they are supratentorial and affect mostly the temporal lobe. They may occur at any age, but mostly they occur in younger people than GM. They are infrequent in childhood, but they have longer survival in paediatric age. We present an 11-year-old girl that was operated but whose tumour recurred in a month after apparent total removal. We review in the literature the clinical, histological, immuno-histochemical and genetic characteristics, as well the prognosis of this tumour.

  19. Giant cell glioblastoma: a glioblastoma subtype with distinct epidemiology and superior prognosis.

    Science.gov (United States)

    Kozak, Kevin R; Moody, John S

    2009-12-01

    Giant cell glioblastoma (GC) is an uncommon subtype of glioblastoma multiforme (GBM). Consequently, the epidemiology, natural history, and factors associated with outcome are not well defined. Patients diagnosed with GC from 1988 through 2004 were identified in the Surveillance, Epidemiology, and End Results (SEER) database. Outcomes were examined with Kaplan-Meier survival analysis and Cox models. For comparison, similar analyses were conducted for patients diagnosed with GBM. GC was identified in 1% of 16,430 patients diagnosed with either GC or GBM. Compared with GBM, GC showed similar gender and racial distributions. Likewise, tumor size and location were not significantly different between the two histologies. GC tended to occur in younger patients with a median age at diagnosis of 51 years, compared with 62 years for GBM. Additionally, patients with GC were more likely to undergo complete resection compared with patients with GBM. For both histologies, young age, tumor size, extent of resection, and the use of adjuvant radiation therapy (RT) were associated with improved survival. Cox modeling suggests the prognosis for GC is significantly superior to that for GBM (hazard ratio = 0.76; 95% confidence interval, 0.59-0.97) even after adjustment for factors affecting survival. GC is an uncommon GBM subtype that tends to occur in younger patients. Prospective data defining optimal treatment for GC are unavailable; however, these retrospective findings suggest that resection, as opposed to biopsy only, and adjuvant RT may improve survival. The prognosis of GC is superior to that of GBM, and long-term survival is possible, suggesting aggressive therapy is warranted.

  20. Hyperekplexia and trismus due to brainstem encephalopathy

    Science.gov (United States)

    Kellett, M.; Humphrey, P.; Tedman, B.; Steiger, M.

    1998-01-01

    The brainstem is said to be the generator of pathological startle responses due to reticular reflex myoclonus or hyperekplexia. A patient with facial weakness, nystagmus, and pyramidal tract signs had generalised reflex spasms in response to auditory, visual and tactile stimuli which clinically and neurophysiologically resembled hyperekplexia. The case is unusual because as well as hyperekplexia, the patient's initial presentation was with an equally rare manifestation of brainstem pathology—brainstem mediated trismus. The causes of brainstem trismus and exaggerated startle responses are discussed with respect to their underlying mechanisms. 

 PMID:9667574

  1. Hypertensive Encephalopathy with Reversible Brainstem Edema

    National Research Council Canada - National Science Library

    Lee, Sungjoon; Cho, Byung-Kyu; Kim, Hoon

    2013-01-01

    .... The patient's condition was thus interpreted as hypertensive brainstem encephalopathy. While many consider this a vasogenic phenomenon, induced by sudden, severe hypertension, the precise mechanism remains unclear...

  2. Immunological Evasion in Glioblastoma

    Directory of Open Access Journals (Sweden)

    Roxana Magaña-Maldonado

    2016-01-01

    Full Text Available Glioblastoma is the most aggressive tumor in Central Nervous System in adults. Among its features, modulation of immune system stands out. Although immune system is capable of detecting and eliminating tumor cells mainly by cytotoxic T and NK cells, tumor microenvironment suppresses an effective response through recruitment of modulator cells such as regulatory T cells, monocyte-derived suppressor cells, M2 macrophages, and microglia as well as secretion of immunomodulators including IL-6, IL-10, CSF-1, TGF-β, and CCL2. Other mechanisms that induce immunosuppression include enzymes as indolamine 2,3-dioxygenase. For this reason it is important to develop new therapies that avoid this immune evasion to promote an effective response against glioblastoma.

  3. Nanotechnology Applications for Glioblastoma

    Science.gov (United States)

    Nduom, Edjah; Bouras, Alexandros; Kaluzova, Milota; Hadjipanayis, Costas G.

    2012-01-01

    Synopsis Glioblastoma remains one of the most difficult cancers to treat and represents the most common primary malignancy of the brain. While conventional treatments have found modest success in reducing the initial tumor burden, infiltrating cancer cells beyond the main mass are responsible for tumor recurrence and ultimate patient demise. Targeting the residual infiltrating cancer cells requires the development of new treatment strategies. The emerging field of cancer nanotechnology holds much promise in the use of multifunctional nanoparticles for the imaging and targeted therapy of GBM.. Nanoparticles have emerged as potential “theranostic” agents that can permit the diagnosis and therapeutic treatment of GBM tumors. A recent human clinical trial with magnetic nanoparticles has provided feasibility and efficacy data for potential treatment of GBM patients with thermotherapy. Here we examine the current state of nanotechnology in the treatment of glioblastoma and interesting directions of further study. PMID:22748656

  4. Biological Rationale for the Use of PPARγ Agonists in Glioblastoma

    Directory of Open Access Journals (Sweden)

    Hayley Patricia Ellis

    2014-03-01

    Full Text Available Glioblastoma Multiforme (GBM is the most common primary intrinsic CNS tumour and has an extremely poor overall survival, despite advances in neurosurgery, chemotherapy and radiation therapy. There has been interesting preliminary evidence suggesting that patients receiving the group of anti-diabetic drugs known as PPARγ (Peroxisome proliferator-activated receptor gamma agonists have a lower incidence of glioma. The nuclear hormone receptor PPARγ has been found to be expressed in high grade gliomas, and its activation has been shown to have several antineoplastic effects on human and rat glioma cell lines, and in some instances an additional protective increase in antioxidant enzymes has been observed in normal astrocytes. At present, no clinical trials are underway with regards to treating glioma patients using PPARγ agonists, as Pioglitazone and Rosiglitazone are only FDA-approved for use in treatment of type-2 diabetes. This review presents the case for evaluating the potential of PPARγ agonists as novel adjuvants in the treatment of high grade glioma. We introduce the PPARγ pathway, PPARγ gene and its products and examine recent research in glioblastoma.

  5. Identification of novel SNPs in glioblastoma using targeted resequencing.

    Science.gov (United States)

    Keller, Andreas; Harz, Christian; Matzas, Mark; Meder, Benjamin; Katus, Hugo A; Ludwig, Nicole; Fischer, Ulrike; Meese, Eckart

    2011-01-01

    High-throughput sequencing opens avenues to find genetic variations that may be indicative of an increased risk for certain diseases. Linking these genomic data to other "omics" approaches bears the potential to deepen our understanding of pathogenic processes at the molecular level. To detect novel single nucleotide polymorphisms (SNPs) for glioblastoma multiforme (GBM), we used a combination of specific target selection and next generation sequencing (NGS). We generated a microarray covering the exonic regions of 132 GBM associated genes to enrich target sequences in two GBM tissues and corresponding leukocytes of the patients. Enriched target genes were sequenced with Illumina and the resulting reads were mapped to the human genome. With this approach we identified over 6000 SNPs, including over 1300 SNPs located in the targeted genes. Integrating the genome-wide association study (GWAS) catalog and known disease associated SNPs, we found that several of the detected SNPs were previously associated with smoking behavior, body mass index, breast cancer and high-grade glioma. Particularly, the breast cancer associated allele of rs660118 SNP in the gene SART1 showed a near doubled frequency in glioblastoma patients, as verified in an independent control cohort by Sanger sequencing. In addition, we identified SNPs in 20 of 21 GBM associated antigens providing further evidence that genetic variations are significantly associated with the immunogenicity of antigens.

  6. Identification of novel SNPs in glioblastoma using targeted resequencing.

    Directory of Open Access Journals (Sweden)

    Andreas Keller

    Full Text Available High-throughput sequencing opens avenues to find genetic variations that may be indicative of an increased risk for certain diseases. Linking these genomic data to other "omics" approaches bears the potential to deepen our understanding of pathogenic processes at the molecular level. To detect novel single nucleotide polymorphisms (SNPs for glioblastoma multiforme (GBM, we used a combination of specific target selection and next generation sequencing (NGS. We generated a microarray covering the exonic regions of 132 GBM associated genes to enrich target sequences in two GBM tissues and corresponding leukocytes of the patients. Enriched target genes were sequenced with Illumina and the resulting reads were mapped to the human genome. With this approach we identified over 6000 SNPs, including over 1300 SNPs located in the targeted genes. Integrating the genome-wide association study (GWAS catalog and known disease associated SNPs, we found that several of the detected SNPs were previously associated with smoking behavior, body mass index, breast cancer and high-grade glioma. Particularly, the breast cancer associated allele of rs660118 SNP in the gene SART1 showed a near doubled frequency in glioblastoma patients, as verified in an independent control cohort by Sanger sequencing. In addition, we identified SNPs in 20 of 21 GBM associated antigens providing further evidence that genetic variations are significantly associated with the immunogenicity of antigens.

  7. [Frontal giant cell glioblastoma: radio-induced tumor? Case report and literature review].

    Science.gov (United States)

    Lrhezzioui, J; Emery, E; Chapon, F

    2007-12-01

    The current WHO classification recognizes two distinct variants of glioblastoma multiforme (GBMs): giant cell glioblastoma (GCG) and gliosarcoma, based on histological heterogeneity. Unlike conventional GBMs, GCGs preferentially occur in younger individuals and are associated with a better prognosis, a few reports documenting prolonged survival up to 17 years after diagnosis. However, transformation to gliosarcoma is possible and has been already reported. Radio-induced glioblastoma, which meets Cahan's criteria for radio-induced tumor, is very rare; the first case was published by Kleriga et al. We report a rare case observed in a 46-year-old man with a past history of right nose leiomyosarcoma treated 40 years earlier by surgery and interstitial and external beam radiation. At admission, the patient presented left hemiparesis revealing a right frontal GCG confirmed by pathology after cranial surgery. We describe this case firstly because of its rare histological variety and discuss its clinical, radiological, histopathological, therapeutic and prognostic characteristics with literature data. Secondly, because of its occurrence 40 years after external radiotherapy, which could suggest the hypothesis of radio-induced glioblastoma.

  8. Imatinib mesylate radiosensitizes human glioblastoma cells through inhibition of platelet-derived growth factor receptor.

    Science.gov (United States)

    Holdhoff, Matthias; Kreuzer, Karl-Anton; Appelt, Christine; Scholz, Regina; Na, Il-Kang; Hildebrandt, Bert; Riess, Hanno; Jordan, Andreas; Schmidt, Christian A; Van Etten, Richard A; Dörken, Bernd; le Coutre, Philipp

    2005-01-01

    Imatinib mesylate is a small molecule inhibitor of the c-Abl, platelet-derived growth factor (PDGF) receptor and c-Kit tyrosine kinases that is approved for the treatment of Philadelphia chromosome-positive chronic myeloid leukemia (CML) and gastrointestinal stromal tumors. Glioblastoma multiforme is a highly malignant primary brain tumor that is usually treated with surgery and/or radiotherapy. Previous studies implicate an autocrine loop caused by high expression of PDGF and its receptor, PDGFR, in the proliferation of some glioblastomas. Here, we demonstrate that pretreatment of a human glioblastoma cell line, RuSi RS1, with imatinib significantly enhanced the cytotoxic effect of ionizing radiation. This effect was not seen in human breast cancer (BT20) and colon cancer (WiDr) cell lines. Whereas c-Abl and c-Kit were expressed about equally in the three cell lines, RuSi RS1 cells showed significantly higher expression of PDGFR-beta protein in comparison to BT20 and WiDr. Imatinib treatment of RuSi RS1 cells decreased overall levels of cellular tyrosine phosphorylation and specifically inhibited phosphorylation of PDGFR-beta, while c-Abl was not prominently activated in these cells. These results suggest that imatinib may have clinical utility as a radiosensitizer in the treatment of human glioblastoma, possibly through disruption of an autocrine PDGF/PDGFR loop.

  9. Overexpression of miR-100 inhibits cell proliferation, migration, and chemosensitivity in human glioblastoma through FGFR3

    Directory of Open Access Journals (Sweden)

    Luan YX

    2015-11-01

    Full Text Available Yongxin Luan,1 Shuyan Zhang,1 Ling Zuo,2 Lixiang Zhou1 1Department of Neurosurgery, First Bethune Hospital of Jilin University, 2Department of Ophthalmology, Second Bethune Hospital of Jilin University, Changchun, People’s Republic of China Background: Glioblastoma multiforme is one of the most deadly forms of brain cancer. We investigated the regulatory effects of microRNA-100 (miR-100 on cell proliferation, migration, and chemosensitivity in human glioblastoma. Methods: miR-100 expression was assessed by quantitative real-time polymerase chain reaction in both glioblastoma cells and human tumors. Lentiviruses of miR-100 mimics and inhibitors were transfected into U251 and T98G cells. The regulatory effects of either overexpressing or downregulating miR-100 on glioblastoma were evaluated by a viability assay, growth assay, migration assay, chemosensitivity assay, and an in vivo tumor transplantation assay. Expression of fibroblast growth factor receptor 3 (FGFR3, the bioinformatically predicted target of miR-100, was examined by Western blot in glioblastoma. FGFR3 was then ectopically overexpressed in U251 and T98G cells, and its effects on miR-100-mediated cancer regulation were evaluated by growth, migration, and chemosensitivity assays. Results: MiR-100 was markedly downregulated in both glioblastoma cell lines and human tumors. Overexpressing miR-100 through lentiviral transfection in U251 and T98G cells significantly inhibited cancer growth (both in vitro and in vivo and migration and increased chemosensitivity to cisplatin and 1, 3-bis (2-chloroethyl-l-nitrosourea, whereas downregulation of miR-100 had no effects on development of cancer. FGFR3 was directly regulated by miR-100 in glioblastoma. Ectopically overexpressing FGFR3 was able to ameliorate the anticancer effects of upregulation of miR-100 on glioblastoma growth, migration, and chemosensitivity. Conclusion: MiR-100 was generally downregulated in glioblastoma. Overexpressing mi

  10. Suppression of the Eag1 potassium channel sensitizes glioblastoma cells to injury caused by temozolomide.

    Science.gov (United States)

    Sales, Thais Torquato; Resende, Fernando Francisco Borges; Chaves, Natália Lemos; Titze-De-Almeida, Simoneide Souza; Báo, Sônia Nair; Brettas, Marcella Lemos; Titze-De-Almeida, Ricardo

    2016-10-01

    Glioblastoma multiforme (GBM) is the most aggressive type of human primary brain tumor. The standard treatment protocol includes radiotherapy in combination with temozolomide (TMZ). Despite advances in GBM treatment, the survival time of patients diagnosed with glioma is 14.5 months. Regarding tumor biology, various types of cancer cell overexpress the ether à go-go 1 (Eag1) potassium channel. Therefore, the present study examined the role of Eag1 in the cell damage caused by TMZ on the U87MG glioblastoma cell line. Eag1 was inhibited using a channel blocker (astemizole) or silenced by a short-hairpin RNA expression vector (pKv10.1-3). pKv10.1-3 (0.2 µg) improved the Eag1 silencing caused by 250 µM TMZ, as determined by reverse transcription-quantitative polymerase chain reaction and immunocytochemistry. Additionally, inhibiting Eag1 with the vector or astemizole (5 µM) reduced glioblastoma cell viability and sensitized cells to TMZ. Cell viability decreased by 63% for pKv10.1-3 + TMZ compared with 34% for TMZ alone, and by 77% for astemizole + TMZ compared with 46% for TMZ alone, as determined by MTT assay. In addition, both the vector and astemizole increased the apoptosis rate of glioblastoma cells triggered by TMZ, as determined by an Annexin V apoptosis assay. Collectively, the current data reveal that Eag1 has a role in the damage caused to glioblastoma by TMZ. Furthermore, suppression of this channel can improve the action of TMZ on U87MG glioblastoma cells. Thus, silencing Eag1 is a promising strategy to improve GBM treatment and merits additional studies in animal models of glioma.

  11. Arthritis associated with recurrent erythema multiforme responding to oral acyclovir.

    Science.gov (United States)

    Molnar, I; Matulis, M

    2002-09-01

    Erythema multiforme is a skin condition frequently associated with herpes simplex virus and has a tendency to recur. Oral acyclovir has been successful in suppression of the disease. Here we report a patient who had recurrent erythema multiforme associated with recurrent polyarthritis that responded to oral acyclovir suppression therapy.

  12. Brainstem epidermoid cyst: An update

    Science.gov (United States)

    Patibandla, M. R.; Yerramneni, Vamsi Krishna; Mudumba, Vijaya S.; Manisha, Nukavarapu; Addagada, Gokul Chowdary

    2016-01-01

    The incidence of epidermoid tumors is between 1% and 2% of all intracranial tumors. The usual locations of epidermoid tumor are the parasellar region and cerebellopontine angle, and it is less commonly located in sylvian fissure, suprasellar region, cerebral and cerebellar hemispheres, and lateral and fourth ventricles. Epidermoid cysts located in the posterior fossa usually arise in the lateral subarachnoid cisterns, and those located in the brain stem are rare. These epidermoids contain cheesy and flaky white soft putty like contents. Epidermoid cysts are very slow growing tumors having a similar growth pattern of the epidermal cells of the skin and develop from remnants of epidermal elements during closure of the neural groove and disjunction of the surface ectoderm with neural ectoderm between the third and fifth weeks of embryonic life. We are presenting an interesting case of intrinsic brainstem epidermoid cyst containing milky white liquefied material with flakes in a 5-year-old girl. Diffusion-weighted imaging is definitive for the diagnosis. Ideal treatment of choice is removal of cystic components with complete resection of capsule. Although radical resection will prevent recurrence, in view of very thin firmly adherent capsule to brainstem, it is not always possible to do complete resection of capsule without any neurological deficits. PMID:27366244

  13. Eritema multiforme mayor desencadenado por antimicrobianos

    Directory of Open Access Journals (Sweden)

    Ronaldo de Carvalho Raimundo

    2010-03-01

    Full Text Available El eritema multiforme, aparece como una enfermedad sistémica con la participación de la piel y las membranas mucosas en relación con varios factores como las infecciones bacterianas o virales, y en particular la administración de drogas, analgésicos y antibióticos en general. Se presenta un paciente masculino de 29 años de edad con eritema multiforme mayor desencadenado por antimicrobianos con la aparición de lesiones vesiculares-bulloso-ulcerosas en las regiones de los labios, encías, la lengua y la mucosa genital en tratamiento de una infección del tracto urinario con norfloxacino 400 mg por una semana. Fue realizado un tratamiento de soporte con el uso de colutorios para la higienización bucal y pomada a base de corticoide para protección de las úlceras, antihistamínicos y orientación nutricional de dieta líquida hipercalórica e hiperproteica. Este síndrome está caracterizado como un proceso eruptivo buloso agudo que compromete la calidad de vida del paciente y no hay pruebas de laboratorio específicas por lo que su diagnóstico debe estar basado en la revisión minuciosa de la anamnesis y en los hallazgos clínicos.

  14. Brainstem and cerebellar cavernous malformations.

    Science.gov (United States)

    Atwal, Gursant S; Sarris, Christina E; Spetzler, Robert F

    2017-01-01

    Cavernous malformations are vascular lesions that occur throughout the central nervous system, most commonly in the supratentorial location, with brainstem and cerebellar cavernous malformations occurring more rarely. Cavernous malformations are associated with developmental venous anomalies that occur sporadically or in familial form. Patients with a cavernous malformation can present with headaches, seizures, sensorimotor disturbances, or focal neurologic deficits based on the anatomic location of the lesion. Patients with infratentorial lesions present more commonly with a focal neurologic deficit. Cavernous malformations are increasingly discovered incidentally due to the increasing use of magnetic resonance imaging. Understanding the natural history of these lesions is essential to their management. Observation and surgical resection are both reasonable options in the treatment of patients with these lesions. The clinical presentation of the patient, the location of the lesion, and the surgical risk assessment all play critical roles in management decision-making. © 2017 Elsevier B.V. All rights reserved.

  15. Di-Ethylhexylphthalate (DEHP Modulates Cell Invasion, Migration and Anchorage Independent Growth through Targeting S100P in LN-229 Glioblastoma Cells

    Directory of Open Access Journals (Sweden)

    Jennifer Nicole Sims

    2014-05-01

    Full Text Available Glioblastoma multiforme (GBM is the most aggressive brain cancer with a median survival of 1–2 years. The treatment of GBM includes surgical resection, radiation and chemotherapy, which minimally extends survival. This poor prognosis necessitates the identification of novel molecular targets associated with glioblastoma. S100P is associated with drug resistance, metastasis, and poor clinical outcomes in many malignancies. The functional role of S100P in glioblastoma has not been fully investigated. In this study, we examined the role of S100P mediating the effects of the environmental contaminant, DEHP, in glioblastoma cells (LN-229 by assessing cell proliferation, apoptosis, anchorage independent growth, cell migration and invasion following DEHP exposure. Silencing S100P and DEHP treatment inhibited LN-229 glioblastoma cell proliferation and induced apoptosis. Anchorage independent growth study revealed significantly decreased colony formation in shS100P cells. We also observed reduced cell migration in cells treated with DEHP following S100P knockdown. Similar results were observed in spheroid formation and expansion. This study is the first to demonstrate the effects of DEHP on glioblastoma cells, and implicates S100P as a potential therapeutic target that may be useful as a drug response biomarker.

  16. Imaging of adult brainstem gliomas

    Energy Technology Data Exchange (ETDEWEB)

    Purohit, Bela, E-mail: purohitbela@yahoo.co.in; Kamli, Ali A.; Kollias, Spyros S.

    2015-04-15

    Highlights: •BSG are classified on MRI into diffuse low-grade, malignant, focal tectal and exophytic subtypes. •Their prognosis and treatment is variable and is almost similar to adult supratentorial gliomas. •This article illustrates the imaging of adult BSGs on MRI and FET-PET. •We also describe prognostic factors and the treatment options of these tumours. -- Abstract: Brainstem gliomas (BSGs) are uncommon in adults accounting for about 2% of all intracranial neoplasms. They are often phenotypically low-grade as compared to their more common paediatric counterparts. Since brainstem biopsies are rarely performed, these tumours are commonly classified according to their MR imaging characteristics into 4 subgroups: (a) diffuse intrinsic low-grade gliomas, (b) enhancing malignant gliomas, (c) focal tectal gliomas and (d) exophytic gliomas/other subtypes. The prognosis and treatment is variable for the different types and is almost similar to adult supratentorial gliomas. Radiotherapy (RT) with adjuvant chemotherapy is the standard treatment of diffuse low-grade and malignant BSGs, whereas, surgical resection is limited to the exophytic subtypes. Review of previous literature shows that the detailed imaging of adult BSGs has not received significant attention. This review illustrates in detail the imaging features of adult BSGs using conventional and advanced MR techniques like diffusion weighted imaging (DWI), diffusion tensor imaging (DTI), MR perfusion weighted imaging (PWI), MR spectroscopy (MRS), as well as {sup 18}F-fluoro-ethyl-tyrosine positron emission tomography ({sup 18}F-FET/PET). We have discussed the pertinent differences between childhood and adult BSGs, imaging mimics, prognostic factors and briefly reviewed the treatment options of these tumours.

  17. Delayed neuronal cell death in brainstem after transient brainstem ischemia in gerbils

    Directory of Open Access Journals (Sweden)

    Hakuba Nobuhiro

    2010-09-01

    Full Text Available Abstract Background Because of the lack of reproducible brainstem ischemia models in rodents, the temporal profile of ischemic lesions in the brainstem after transient brainstem ischemia has not been evaluated intensively. Previously, we produced a reproducible brainstem ischemia model of Mongolian gerbils. Here, we showed the temporal profile of ischemic lesions after transient brainstem ischemia. Results Brainstem ischemia was produced by occlusion of the bilateral vertebral arteries just before their entry into the transverse foramina of the cervical vertebrae of Mongolian gerbils. Animals were subjected to brainstem ischemia for 15 min, and then reperfused for 0 d (just after ischemia, 1 d, 3 d and 7 d (n = 4 in each group. Sham-operated animals (n = 4 were used as control. After deep anesthesia, the gerbils were perfused with fixative for immunohistochemical investigation. Ischemic lesions were detected by immunostaining for microtubule-associated protein 2 (MAP2. Just after 15-min brainstem ischemia, ischemic lesions were detected in the lateral vestibular nucleus and the ventral part of the spinal trigeminal nucleus, and these ischemic lesions disappeared one day after reperfusion in all animals examined. However, 3 days and 7 days after reperfusion, ischemic lesions appeared again and clusters of ionized calcium-binding adapter molecule-1(IBA-1-positive cells were detected in the same areas in all animals. Conclusion These results suggest that delayed neuronal cell death took place in the brainstem after transient brainstem ischemia in gerbils.

  18. Influence of general anaesthesia on the brainstem.

    Science.gov (United States)

    Bosch, L; Fernández-Candil, J; León, A; Gambús, P L

    2017-03-01

    The exact role of the brainstem in the control of body functions is not yet well known and the same applies to the influence of general anaesthesia on brainstem functions. Nevertheless in all general anaesthesia the anaesthesiologist should be aware of the interaction of anaesthetic drugs and brainstem function in relation to whole body homeostasis. As a result of this interaction there will be changes in consciousness, protective reflexes, breathing pattern, heart rate, temperature or arterial blood pressure to name a few. Brainstem function can be explored using three different approaches: clinically, analyzing changes in brain electric activity or using neuroimaging techniques. With the aim of providing the clinician anaesthesiologist with a global view of the interaction between the anaesthetic state and homeostatic changes related to brainstem function, the present review article addresses the influence of anaesthetic drug effects on brainstem function through clinical exploration of cranial nerves and reflexes, analysis of electric signals such as electroencephalographic changes and what it is known about brainstem through the use of imaging techniques, more specifically functional magnetic resonance imaging. Copyright © 2016 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  19. Nanoparticles containing allotropes of carbon have genotoxic effects on glioblastoma multiforme cells

    DEFF Research Database (Denmark)

    Hinzmann, Mateusz; Jaworski, Sławomir; Kutwin, Marta

    2014-01-01

    The carbon-based nanomaterial family consists of nanoparticles containing allotropes of carbon, which may have a number of interactions with biological systems. The objective of this study was to evaluate the toxicity of nanoparticles comprised evaluation of cell morphology, and assessment of cell...... viability by Trypan blue assay and level of DNA fragmentation of U87 cells after 24 hours of incubation with 50 μg/mL carbon nanoparticles. DNA fragmentation was studied using single-cell gel electrophoresis. Incubation with nanoparticles containing the allotropes of carbon did not alter the morphology...... of the U87 cancer cells. However, incubation with pristine graphene and reduced graphene oxide led to a significant decrease in cell viability, whereas incubation with graphene oxide, graphite, and ultradispersed detonation diamond led to a smaller decrease in cell viability. The results of a comet assay...

  20. Intracerebral neurocysticercosis mimicking glioblastoma multiforme: a rare differential diagnosis in Central Europe

    Energy Technology Data Exchange (ETDEWEB)

    Sabel, M.; Weber, F. [Dept. of Neurosurgery, Heinrich-Heine Univ. Duesseldorf (Germany); Neuen-Jacob, E. [Dept. of Neuropathology, Heinrich-Heine Univ. Duesseldorf (Germany); Vogt, C. [Dept. of Internal Medicine, Heinrich-Heine Univ. Duesseldorf (Germany)

    2001-03-01

    A 47-year-old Greek man presented with a 4-week history of speech difficulties. CT and MRI revealed a low-density multilobulated cystic frontal mass with peripheral ring contrast enhancement adjacent to the sylvian fissure. Examination was normal. Blood tests revealed leucocytosis (16,000 cells/{mu}l) and an elevated erythrocyte sedimentation rate (30/52). A malignant brain tumour was suspected and surgically removed. Histological examination disclosed intracerebral neurocysticercosis. (orig.)

  1. VEGF-dependent mechanism of anti-angiogenic action of diamond nanoparticles in Glioblastoma Multiforme tumor

    DEFF Research Database (Denmark)

    Grodzik, M.; Sawosz, E.; Wierzbicki, M.

    2012-01-01

    Malignant gliomas are highly lethal cancers dependent on angiogenesis. The concept of treating tumors by inhibiting tumor angiogenesis was first articulated almost 30 years ago. Inhibition of tumor angiogenesis suppresses both tumor growth and metastasis. We determined the inhibition effect...

  2. Astrocitoma anaplásico y glioblastoma multiforme: Factores que influyen en la supervivencia

    Directory of Open Access Journals (Sweden)

    Letier Pérez Ortiz

    2001-06-01

    Full Text Available Se realizó un estudio retrospectivo de 67 pacientes con neoplasias astrogliales malignas operados en el Instituto de Neurología y Neurocirugía (INN entre los años 1983 y 1992. Se analizaron los factores epidemiológicos, clínicos, imagenológicos y del tratamiento que influyeron en la evolución de estos casos. La media del tiempo de supervivencia fue de 17,8 meses. El defecto motor, los trastornos de la esfera psíquica, el desplazamiento de las estructuras de la línea media, el edema peritumoral y la irregularidad de los bordes de la lesión fueron los elementos clínicos y tomográficos más frecuentes. Su presencia tuvo una relación negativa con la sobrevida. La edad menor de 40 años, la alta graduación de Karnofsky inicial, y el empleo de radioterapia y quimioterapia estuvieron relacionados con un incremento de la supervivencia. No se encontró significación entre el tipo de tratamiento quirúrgico realizado, la clasificación histopatológica del tumor y el tiempo de sobrevidaA retrospective study was conducted in 67 patients with malignant astroglial neoplasia who were operated on at the Neurology and Neurosurgery Institute (NNI between 1983 and 1992. We analyzed the epidemiological, clinical, imaging and of treatment factors influencing on the evolution of these cases. Survival mean time was 17.8 months. Motor defect, psychic sphere disorders, displacement of median line structures, peritumor edema, and the irregularity of the borders of the lesion were the most frequent tomographic and clinical elements. Their presence had a negative relation to survival. Age under 40, initial Karnofsky scale high graduation, and the use of radiotherapy and chemotherapy were related to survival increase. There was no significance among the type of surgical treatment carried out, the histopathological classification of the tumor and the time of survival

  3. In vitro evaluation of the effects of graphene platelets on glioblastoma multiforme cells

    DEFF Research Database (Denmark)

    Jaworski, Slawomir; Sawosz, Ewa; Grodzik, Marta

    2013-01-01

    Graphene is a single atom-thick material with exciting potential. It can be used in many fields, from electronics to biomedicine. However, little is known about its toxicity and biocompatibility. Herein, we report a study on the toxicity of graphene platelets (GPs) by examining the influence of G...

  4. SU-C-BRE-03: Dual Compartment Mathematical Modeling of Glioblastoma Multiforme (GBM)

    Energy Technology Data Exchange (ETDEWEB)

    Yu, V; Nguyen, D; Kupelian, P; Kaprealian, T; Selch, M; Low, D; Pajonk, F; Sheng, K [UCLA, Los Angeles, CA (United States)

    2014-06-15

    Purpose: To explore the aggressive recurrence and radioresistence of GBM with a dual compartment tumor survival mathematical model based on intrinsic tumor heterogeneity, cancer stem cells (CSC) and differentiated cancer cells (DCC). Methods: The repopulation and differentiation responses to radiotherapy of a solid tumor were simulated using an Ordinary Differential Equation (ODE). To obtain the tumor radiobiological parameters, we assumed that a tumor consists of two subpopulations, each with its distinctive linear quadratic parameters. The dual compartment cell survival model was constructed as SF(D)=F × exp(-α{sub 1} D-β{sub 1}D{sup 2}) + (1-F) × exp(-α{sub 2}D-β{sub 2}D{sup 2}) for a single fraction of treatment, with F as the fraction of CSC, and α and β describing the radiological properties of each population. Robust least square fitting was performed on clonogenic survival data from one GBM (U373MG) and one NSCLC (H460) cell line. The fit parameters were then used in the ODE model to predict treatment outcome of various treatment schemes. Results: The fit parameters from GBM cell survival data were (F, α{sub 1}, β{sub 1}, α{sub 2}, β{sub 2})=(0.0396, 0.0801, 0.0006, 0.1363, 0.0279), exhibiting two populations with distinctive radiological properties, CSC more radioresistant than DCC. The GBM cell line exhibited significantly poorer tumor control than its single compartment model prediction and NSCLC, which responded well to hypofrationation. The increased radioresistance was due to rapid regrowth of the DCC compartment triggered by its depletion while maintaining a viable CSC population. The rapid regrowth can be reduced by treating dose fractions ≤ 2 Gy with a prolonged treatment period. Conclusion: The interaction between a radioresistant CSC compartment and DCC compartment can explain the poor clinical outcome of GBM after radiotherapy despite dose escalation and hypofractionation attempts. Lower dose fractions result in better treatment outcome but still eventually recurs. Dose escalation beyond 100 Gy and/or differentiation therapy will be vital in achieving GBM tumor control.

  5. Predicting the growth of glioblastoma multiforme spheroids using a multiphase porous media model.

    Science.gov (United States)

    Mascheroni, Pietro; Stigliano, Cinzia; Carfagna, Melania; Boso, Daniela P; Preziosi, Luigi; Decuzzi, Paolo; Schrefler, Bernhard A

    2016-10-01

    Tumor spheroids constitute an effective in vitro tool to investigate the avascular stage of tumor growth. These three-dimensional cell aggregates reproduce the nutrient and proliferation gradients found in the early stages of cancer and can be grown with a strict control of their environmental conditions. In the last years, new experimental techniques have been developed to determine the effect of mechanical stress on the growth of tumor spheroids. These studies report a reduction in cell proliferation as a function of increasingly applied stress on the surface of the spheroids. This work presents a specialization for tumor spheroid growth of a previous more general multiphase model. The equations of the model are derived in the framework of porous media theory, and constitutive relations for the mass transfer terms and the stress are formulated on the basis of experimental observations. A set of experiments is performed, investigating the growth of U-87MG spheroids both freely growing in the culture medium and subjected to an external mechanical pressure induced by a Dextran solution. The growth curves of the model are compared to the experimental data, with good agreement for both the experimental settings. A new mathematical law regulating the inhibitory effect of mechanical compression on cancer cell proliferation is presented at the end of the paper. This new law is validated against experimental data and provides better results compared to other expressions in the literature.

  6. Discrimination between metastasis and glioblastoma multiforme based on morphometric analysis of MR images

    NARCIS (Netherlands)

    Blanchet, L.M.; Krooshof, P.W.; Postma, G.J.; Idema, A.J.S.; Goraj, B.M.; Heerschap, A.; Buydens, L.

    2011-01-01

    BACKGROUND AND PURPOSE: Solitary MET and GBM are difficult to distinguish by using MR imaging. Differentiation is useful before any metastatic work-up or biopsy. Our hypothesis was that MET and GBM tumors differ in morphology. Shape analysis was proposed as an indicator for discriminating these 2

  7. In Vitro Radiosensitizing Effects of Temozolomide on U87MG Cell Lines of Human Glioblastoma Multiforme

    Directory of Open Access Journals (Sweden)

    Samira Borhani

    2017-05-01

    Full Text Available Background: Glioma is the most common primary brain tumor with poor prognosis. Temozolomide (TMZ has been used with irradiation (IR to treat gliomas. The aim of the present study was to evaluate the cytotoxic and radiosensitizing effect of TMZ when combined with high-dose and high-dose rate of gamma irradiation in vitro. Methods: Two ‘U87MG’ cell lines and skin fibroblast were cultured and assigned to five groups for 24, 48, and 72 hours. The groups were namely, TMZ group (2000 μM/L, IR group (5 Gy, TMZ plus IR group, control group, and control solvent group. MTT assay was applied to evaluate cell viability. Data were analyzed with SPSS 21.0 software using one-way ANOVA and Kruskal-Wallis test. P<0.05 were considered statistically significant. Results: The slope of growth curve U87MG cells in semi-logarithmic scale was equal to 27.36±0.89 hours. The viability of cells was determined for different TMZ and IR treatment groups. In terms of cell viability, there were no significant differences between the control and control solvent groups (P=0.35 and between treated group by IR (5 Gy alone and TMZ (2000 µM/ml alone (P=0.15. Data obtained for the cell viability of combined TMZ plus IR in both cell lines compared to TMZ or IR treated group alone showed a significant difference (P=0.002. Conclusion: The evaluation of cells viability showed that TMZ in combination with IR on glioma cells led to a significant radiosensitivity compared to IR alone.

  8. Synthetic Nano-Low Density Lipoprotein as Targeted Drug DeliveryVehicle for Glioblastoma Multiforme

    Energy Technology Data Exchange (ETDEWEB)

    Nikanjam, Mina; Blakely, Eleanor A.; Bjornstad, Kathleen A.; Shu,Xiao; Budinger, Thomas F.; Forte, Trudy M.

    2006-06-14

    This paper discribes a synthetic low density lipoprotein(LDL) made by complexing a 29 amino acid that consists of a lipid bindingdomain and the LDL receptor binding domain with a lipid microemulsion.The nano-LDL particles were intermdiate in size between LDL and HDL andbound to LDL receptors on GBM brain tumor cells. Synthetic nano-LDLuptake by GBM cells was LDL receptor specific and dependent on cellreceptor number. It is suggested that these synthetic particles can serveas a delivery vehicle for hydophobic anti-tumor drugs by targeting theLDL receptor.

  9. Multireference Level Set for the Characterization of Nuclear Morphology in Glioblastoma Multiforme

    OpenAIRE

    Chang, Hang; Han, Ju; Spellman, Paul T.; Parvin, Bahram

    2012-01-01

    Histological tissue sections provide rich information and continue to be the gold standard for the assessment of tissue neoplasm. However, there are a significant amount of technical and biological variations that impede analysis of large histological datasets. In this paper, we have proposed a novel approach for nuclear segmentation in tumor histology sections, which addresses the problem of technical and biological variations by incorporating information from both manually annotated referen...

  10. Temozolomide Resistance in Glioblastoma Cell Lines: Implication of MGMT, MMR, P-Glycoprotein and CD133 Expression.

    Directory of Open Access Journals (Sweden)

    Gloria Perazzoli

    Full Text Available The use of temozolomide (TMZ has improved the prognosis for glioblastoma multiforme patients. However, TMZ resistance may be one of the main reasons why treatment fails. Although this resistance has frequently been linked to the expression of O6-methylguanine-DNA methyltransferase (MGMT it seems that this enzyme is not the only molecular mechanism that may account for the appearance of drug resistance in glioblastoma multiforme patients as the mismatch repair (MMR complex, P-glycoprotein, and/or the presence of cancer stem cells may also be implicated.Four nervous system tumor cell lines were used to analyze the modulation of MGMT expression and MGMT promoter methylation by TMZ treatment. Furthermore, 5-aza-2'-deoxycytidine was used to demethylate the MGMT promoter and O(6-benzylguanine to block GMT activity. In addition, MMR complex and P-glycoprotein expression were studied before and after TMZ exposure and correlated with MGMT expression. Finally, the effect of TMZ exposure on CD133 expression was analyzed.Our results showed two clearly differentiated groups of tumor cells characterized by low (A172 and LN229 and high (SF268 and SK-N-SH basal MGMT expression. Interestingly, cell lines with no MGMT expression and low TMZ IC50 showed a high MMR complex expression, whereas cell lines with high MGMT expression and high TMZ IC50 did not express the MMR complex. In addition, modulation of MGMT expression in A172 and LN229 cell lines was accompanied by a significant increase in the TMZ IC50, whereas no differences were observed in SF268 and SK-N-SH cell lines. In contrast, P-glycoprotein and CD133 was found to be unrelated to TMZ resistance in these cell lines.These results may be relevant in understanding the phenomenon of TMZ resistance, especially in glioblastoma multiforme patients laking MGMT expression, and may also aid in the design of new therapeutic strategies to improve the efficacy of TMZ in glioblastoma multiforme patients.

  11. Bayesian segmentation of brainstem structures in MRI

    DEFF Research Database (Denmark)

    Iglesias, Juan Eugenio; Van Leemput, Koen; Bhatt, Priyanka

    2015-01-01

    In this paper we present a method to segment four brainstem structures (midbrain, pons, medulla oblongata and superior cerebellar peduncle) from 3D brain MRI scans. The segmentation method relies on a probabilistic atlas of the brainstem and its neighboring brain structures. To build the atlas, we...... the brainstem structures in novel scans. Thanks to the generative nature of the scheme, the segmentation method is robust to changes in MRI contrast or acquisition hardware. Using cross validation, we show that the algorithm can segment the structures in previously unseen T1 and FLAIR scans with great accuracy...

  12. Current clinical management of brainstem cavernomas.

    Science.gov (United States)

    Bozinov, Oliver; Hatano, Taketo; Sarnthein, Johannes; Burkhardt, Jan-Karl; Bertalanffy, Helmut

    2010-11-26

    Over the last two decades a favourable course for treated or nontreated brainstem cavernomas has become possible with enhanced diagnostic tools and clinical experience, as well as minimally invasive microsurgical improvements. Currently, brainstem cavernoma can be treated microsurgically with excellent results and an acceptable morbidity rate. The preferred surgical route has progressively shifted from a dorsal to a lateral approach, but this remains dependent on the location of the lesion in the brainstem. Surgical evaluation and management of all cases of this rare disease should be performed by experienced teams from the outset.

  13. Drug induced oral erythema multiforme: A rare and less recognized variant of erythema multiforme

    OpenAIRE

    Joseph, T Isaac; Vargheese, Geetha; George, Deepu; Sathyan, Pradeesh

    2012-01-01

    Oral erythema multiforme (EM) is considered as a third category of EM other than EM minor and major. Patients present with oral and lip ulcerations typical of EM but without any skin target lesions. It has been reported that primary attacks of oral EM is confined to the oral mucosa but the subsequent attacks can produce more severe forms of EM involving the skin. Hence, it is important to identify and distinguish them from other ulcerative disorders involving oral cavity for early management....

  14. Bacoside A Induces Tumor Cell Death in Human Glioblastoma Cell Lines through Catastrophic Macropinocytosis

    Directory of Open Access Journals (Sweden)

    Sebastian John

    2017-06-01

    Full Text Available Glioblastoma multiforme (GBM is a highly aggressive type of brain tumor with an extremely poor prognosis. Recent evidences have shown that the “biomechanical imbalances” induced in GBM patient-derived glioblastoma cells (GC and in vivo via the administration of synthetic small molecules, may effectively inhibit disease progression and prolong survival of GBM animal models. This novel concept associated with de novo anti-GBM drug development has however suffered obstacles in adequate clinical utility due to the appearance of unrelated toxicity in the prolonged therapeutic windows. Here, we took a “drug repurposing approach” to trigger similar physico-chemical disturbances in the GBM tumor cells, wherein, the candidate therapeutic agent has been previously well established for its neuro-protective roles, safety, efficacy, prolonged tolerance and excellent brain bioavailability in human subjects and mouse models. In this study, we show that the extracts of an Indian traditional medicinal plant Bacopa monnieri (BM and its bioactive component Bacoside A can generate dosage associated tumor specific disturbances in the hydrostatic pressure balance of the cell via a mechanism involving excessive phosphorylation of calcium/calmodulin-dependent protein kinase IIA (CaMKIIA/CaMK2A enzyme that is further involved in the release of calcium from the smooth endoplasmic reticular networks. High intracellular calcium stimulated massive macropinocytotic extracellular fluid intake causing cell hypertrophy in the initial stages, excessive macropinosome enlargement and fluid accumulation associated organellar congestion, cell swelling, cell rounding and membrane rupture of glioblastoma cells; with all these events culminating into a non-apoptotic, physical non-homeostasis associated glioblastoma tumor cell death. These results identify glioblastoma tumor cells to be a specific target of the tested herbal medicine and therefore can be exploited as a safe anti

  15. Bacoside A Induces Tumor Cell Death in Human Glioblastoma Cell Lines through Catastrophic Macropinocytosis.

    Science.gov (United States)

    John, Sebastian; Sivakumar, K C; Mishra, Rashmi

    2017-01-01

    Glioblastoma multiforme (GBM) is a highly aggressive type of brain tumor with an extremely poor prognosis. Recent evidences have shown that the "biomechanical imbalances" induced in GBM patient-derived glioblastoma cells (GC) and in vivo via the administration of synthetic small molecules, may effectively inhibit disease progression and prolong survival of GBM animal models. This novel concept associated with de novo anti-GBM drug development has however suffered obstacles in adequate clinical utility due to the appearance of unrelated toxicity in the prolonged therapeutic windows. Here, we took a "drug repurposing approach" to trigger similar physico-chemical disturbances in the GBM tumor cells, wherein, the candidate therapeutic agent has been previously well established for its neuro-protective roles, safety, efficacy, prolonged tolerance and excellent brain bioavailability in human subjects and mouse models. In this study, we show that the extracts of an Indian traditional medicinal plant Bacopa monnieri (BM) and its bioactive component Bacoside A can generate dosage associated tumor specific disturbances in the hydrostatic pressure balance of the cell via a mechanism involving excessive phosphorylation of calcium/calmodulin-dependent protein kinase IIA (CaMKIIA/CaMK2A) enzyme that is further involved in the release of calcium from the smooth endoplasmic reticular networks. High intracellular calcium stimulated massive macropinocytotic extracellular fluid intake causing cell hypertrophy in the initial stages, excessive macropinosome enlargement and fluid accumulation associated organellar congestion, cell swelling, cell rounding and membrane rupture of glioblastoma cells; with all these events culminating into a non-apoptotic, physical non-homeostasis associated glioblastoma tumor cell death. These results identify glioblastoma tumor cells to be a specific target of the tested herbal medicine and therefore can be exploited as a safe anti-GBM therapeutic.

  16. Erythema multiforme major following treatment with infliximab.

    Science.gov (United States)

    Edwards, Dean; Boritz, Eli; Cowen, Edward W; Brown, Ronald S

    2013-02-01

    The growth in the use of anti-tumor necrosis factor α (TNF-α) agents for treatment of inflammatory conditions has led to increased recognition of the side effects associated with this class of drugs. We report a case of a patient who developed erythema multiforme (EM) major with characteristic oral and cutaneous lesions following treatment with the anti-TNF-α medication infliximab therapy for Crohn's disease (CD). To our knowledge, this is the first reported case of infliximab-induced EM secondary to the treatment of CD. It is important for dental clinicians evaluating patients using anti-TNF-α agents to be aware of this possible complication. Published by Mosby, Inc.

  17. Does Orthodontic Treatment induce Erythema Multiforme?

    Directory of Open Access Journals (Sweden)

    Anand Sharad Ambekar

    2014-01-01

    Full Text Available Oral erythema multiforme (EM is considered as a third category of EM other than EM minor and major. Patients present with oral and lip ulcerations typical of EM but without any skin target lesions. It has been reported that primary attacks of oral EM is confined to the oral mucosa but the subsequent attacks can produce more severe forms of EM involving the skin. Hence, it is important to identify and distinguish them from other ulcerative disorders involving oral cavity for early management. This article reports a case of oral EM that presented with oral and lip ulcerations typical of EM without any skin lesions during first phase of orthodontic treatment and highlights the importance of early diagnosis and proper management.

  18. Chlamydia pneumoniae infection-associated erythema multiforme

    Directory of Open Access Journals (Sweden)

    Shinsaku Imashuku

    2013-06-01

    Full Text Available There is a well-known correlation between Herpes simplex (HSV infection and erythema multiforme (EM. More recently, in Japan, it was found that Chlamydia pneumoniae (Cp may promote the development of EM. All cases of Cp infection-associated EM that had been diagnosed in our clinic over the past two years (from 2011 to 2012 were analyzed. Cp infection was diagnosed on the basis of a significant increase (>2.00 in anti-Cp IgM titers, as measured by the HITAZYME-ELISA test. There were 7 cases of Cp-EM, one male and 6 females. Median age was 13 years (range 3-29 years. It is recommended that the possible involvement of Cp infection, besides HSV or Mycoplasma pneumoniae infections, should be considered in all cases of EM.

  19. Brainstem involvement in subacute sclerosing panencephalitis.

    Science.gov (United States)

    Sharma, Pawan; Singh, Dileep; Singh, Maneesh Kumar; Garg, Ravindra Kumar; Kohli, Neera

    2011-01-01

    The parieto-occipital region of the brain is most frequently and severely affected in subacute sclerosing panencephalitis (SSPE). The basal ganglia, cerebellum and corpus callosum are less commonly involved. Brainstem involvement is rarely described in SSPE, and usually there is involvement of other regions of the brain. We describe a patient with subacute sclerosing panencephalitis with brain magnetic resonance imaging showing extensive brainstem involvement without significant involvement of other cortical structures. Though rarely described in SSPE, one should be aware of such brainstem and cerebellum involvement, and SSPE should be kept in mind when brainstem signal changes are seen in brain MRI with or without involvement of other regions of brain to avoid erroneous reporting.

  20. Under-reported Finding in Acral Erythema Multiforme.

    Science.gov (United States)

    Peña-Romero, Adriana G; Domínguez-Cherit, Judith; Guzmán-Abrego, Amanda C

    2015-01-01

    Erythema multiforme is an acute muco-cutaneous hypersensitivity reaction with a variety of etiologies. It is characterized by a skin eruption, with or without oral or other mucous membrane lesions. General characteristics and treatmet have been described, but nail findings are rarely reported Here we present a 26-year-old patient with acral erythema multiforme and erythronychia adjacent to skin lesions on the back of the hands. To our knowledge this association had not been reported before.

  1. Under-reported finding in acral erythema multiforme

    Directory of Open Access Journals (Sweden)

    Adriana G Pena Romero

    2015-01-01

    Full Text Available Erythema multiforme is an acute muco-cutaneous hypersensitivity reaction with a variety of etiologies. It is characterized by a skin eruption, with or without oral or other mucous membrane lesions. General characteristics and treatmet have been described , but nail findings are rarely reported  Here we present a 26-year-old patient with acral erythema multiforme and erythronychia adjacent to skin lesions on the back of the hands. To our knowledge this association had not been reported before.

  2. Under-reported finding in acral erythema multiforme

    OpenAIRE

    Adriana G Pena Romero; Judith Dominguez Cherit; Amanda C Guzman Abrego

    2015-01-01

    Erythema multiforme is an acute muco-cutaneous hypersensitivity reaction with a variety of etiologies. It is characterized by a skin eruption, with or without oral or other mucous membrane lesions. General characteristics and treatmet have been described , but nail findings are rarely reported  Here we present a 26-year-old patient with acral erythema multiforme and erythronychia adjacent to skin lesions on the back of the hands. To our knowledge this association had not been reported before....

  3. An unusual presentation of erythema multiforme in a paediatric patient

    OpenAIRE

    Bani Hani, A; Nazzal, H; Webb, L; Toumba, KJ; Fabbroni, G

    2015-01-01

    Background: Erythema multiforme (EM) is an acute, vesiculobullous disease of skin and mucous membranes with symptoms ranging from mild to severe. A complex interaction of different factors has been implicated the condition; the majority with a preceding herpes simplex infection. This report describes an unusual presentation of erythema multiforme affecting the lips and oral mucosa of a healthy 7-year-old boy in the form of lip adherence. Case report: Two weeks following eruption of oral ulcer...

  4. Glial cell contributions to auditory brainstem development

    Directory of Open Access Journals (Sweden)

    Karina S Cramer

    2016-10-01

    Full Text Available Glial cells, previously thought to have generally supporting roles in the central nervous system, are emerging as essential contributors to multiple aspects of neuronal circuit function and development. This review focuses on the contributions of glial cells to the development of specialized auditory pathways in the brainstem. These pathways display specialized synapses and an unusually high degree of precision in circuitry that enables sound source localization. The development of these pathways thus requires highly coordinated molecular and cellular mechanisms. Several classes of glial cells, including astrocytes, oligodendrocytes, and microglia, have now been explored in these circuits in both avian and mammalian brainstems. Distinct populations of astrocytes are found over the course of auditory brainstem maturation. Early appearing astrocytes are associated with spatial compartments in the avian auditory brainstem. Factors from late appearing astrocytes promote synaptogenesis and dendritic maturation, and astrocytes remain integral parts of specialized auditory synapses. Oligodendrocytes play a unique role in both birds and mammals in highly regulated myelination essential for proper timing to decipher interaural cues. Microglia arise early in brainstem development and may contribute to maturation of auditory pathways. Together these studies demonstrate the importance of non-neuronal cells in the assembly of specialized auditory brainstem circuits.

  5. A Novel Molecular Diagnostic of Glioblastomas: Detection of an Extracellular Fragment of Protein Tyrosine Phosphatase μ

    Directory of Open Access Journals (Sweden)

    Susan M. Burden-Gulley

    2010-04-01

    Full Text Available We recently found that normal human brain and low-grade astrocytomas express the receptor protein tyrosine phosphatase mu (PTPμ and that the more invasive astrocytomas, glioblastoma multiforme (GBM, downregulate full-length PTPμ expression. Loss of PTPμ expression in GBMs is due to proteolytic cleavage that generates an intracellular and potentially a cleaved and released extracellular fragment of PTPμ. Here, we identify that a cleaved extracellular fragment containing the domains required for PTPμ-mediated adhesion remains associated with GBM tumor tissue. We hypothesized that detection of this fragment would make an excellent diagnostic tool for the localization of tumor tissue within the brain. To this end, we generated a series of fluorescently tagged peptide probes that bind the PTPμ fragment. The peptide probes specifically recognize GBM cells in tissue sections of surgically resected human tumors. To test whether the peptide probes are able to detect GBM tumors in vivo, the PTPμ peptide probes were tested in both mouse flank and intracranial xenograft human glioblastoma tumor model systems. The glial tumors were molecularly labeled with the PTPμ peptide probes within minutes of tail vein injection using the Maestro FLEX In Vivo Imaging System. The label was stable for at least 3 hours. Together, these results indicate that peptide recognition of the PTPμ extracellular fragment provides a novel molecular diagnostic tool for detection of human glioblastomas. Such a tool has clear translational applications and may lead to improved surgical resections and prognosis for patients with this devastating disease.

  6. Pulsed Electromagnetic Field with Temozolomide Can Elicit an Epigenetic Pro-apoptotic Effect on Glioblastoma T98G Cells.

    Science.gov (United States)

    Pasi, Francesca; Fassina, Lorenzo; Mognaschi, Maria Evelina; Lupo, Giuseppe; Corbella, Franco; Nano, Rosanna; Capelli, Enrica

    2016-11-01

    Treatment with pulsed electromagnetic fields (PEMFs) is emerging as an interesting therapeutic option for patients with cancer. The literature has demonstrated that low-frequency/low-energy electromagnetic fields do not cause predictable effects on DNA; however, they can epigenetically act on gene expression. The aim of the present work was to study a possible epigenetic effect of a PEMF, mediated by miRNAs, on a human glioblastoma cell line (T98G). We tested a PEMF (maximum magnetic induction, 2 mT; frequency, 75 Hz) that has been demonstrated to induce autophagy in glioblastoma cells. In particular, we studied the effect of PEMF on the expression of genes involved in cancer progression and a promising synergistic effect with temozolomide, a frequently used drug to treat glioblastoma multiforme. We found that electromagnetic stimulation in combination with temozolomide can elicit an epigenetic pro-apoptotic effect in the chemo- and radioresistant T98G glioblastoma cell line. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  7. Dendritic cell vaccination in glioblastoma after fluorescence-guided resection

    Science.gov (United States)

    Valle, Ricardo Diez; de Cerio, Ascension Lopez-Diaz; Inoges, Susana; Tejada, Sonia; Pastor, Fernando; Villanueva, Helena; Gallego, Jaime; Espinos, Jaime; Aristu, Javier; Idoate, Miguel Angel; Andreu, Enrique; Bendandi, Maurizio

    2012-01-01

    AIM: To assess whether the addition of a customized, active immunotherapy to standard of care including fluorescence-guided surgery, may provide hints of an improved survival for patients with poor-prognosis, incurable glioblastoma multiform. METHODS: Preliminary to our ongoing, phase-II clinical trial, we conducted a small pilot study enrolling five consecutive patients with resectable glioblastoma. In terms of Recursive Partitioning Analysis, four patients were class V and one was class IV. In all five cases, fluorescence-guided surgery was employed, followed by rapid steroid discontinuation. Patients were then treated with a combination of standard radio-chemotherapy with temozolomide and tumor lysate-pulsed, mature dendritic cell-based vaccinations. RESULTS: Though all five patients ultimately progressed, with any further treatment left to the sole decision of the treating oncologist, active immunotherapy was very well tolerated and induced specific immune responses in all three patients for whom enough material was available for such an assessment. Median progression-free survival was 16.1 mo. Even more important, median and mean overall survival were 27 mo and 26 mo, respectively. Three patients have died with an overall survival of 9 mo, 27 mo and 27.4 mo, while the other two are still alive at 32 mo and 36 mo, the former receiving treatment with bevacizumab, while the latter has now been off therapy for 12 mo. Four of five patients were alive at two years. CONCLUSION: Active immunotherapy with tumor lysate-pulsed, autologous dendritic cells is feasible, safe, well tolerated and biologically efficacious. A phase-II study is ongoing to possibly improve further on our very encouraging clinical results. PMID:23293753

  8. Eritema multiforme mayor desencadenado por antimicrobianos Big multiform erythema triggered by antimicrobials

    Directory of Open Access Journals (Sweden)

    Ronaldo de Carvalho Raimundo

    2010-03-01

    Full Text Available El eritema multiforme, aparece como una enfermedad sistémica con la participación de la piel y las membranas mucosas en relación con varios factores como las infecciones bacterianas o virales, y en particular la administración de drogas, analgésicos y antibióticos en general. Se presenta un paciente masculino de 29 años de edad con eritema multiforme mayor desencadenado por antimicrobianos con la aparición de lesiones vesiculares-bulloso-ulcerosas en las regiones de los labios, encías, la lengua y la mucosa genital en tratamiento de una infección del tracto urinario con norfloxacino 400 mg por una semana. Fue realizado un tratamiento de soporte con el uso de colutorios para la higienización bucal y pomada a base de corticoide para protección de las úlceras, antihistamínicos y orientación nutricional de dieta líquida hipercalórica e hiperproteica. Este síndrome está caracterizado como un proceso eruptivo buloso agudo que compromete la calidad de vida del paciente y no hay pruebas de laboratorio específicas por lo que su diagnóstico debe estar basado en la revisión minuciosa de la anamnesis y en los hallazgos clínicos.The multiform erythema appears as a systemic disease where skin and the mucous membranes have participation in relation to some factors such as bacterial or viral infections and in particular the drugs administration, analgesics and antibiotics in general. The aim of present paper was the presentation of case of big multiform erythema triggering by antimicrobials. Authors present the case of a male patient aged 29 with appearance of ulcerous bullous-vesicular lesions in lips, gums, tongue and genital mucosa under treatment with 400 mg norfloxacin due to urinary tract infection for a week. We made support treatment using mouthwashes for oral hygiene and corticoids ointment for ulcer protection, antihistaminics and nutritional guiding of a hypercaloric and hyperprotein liquid diet. This syndrome is characterized

  9. Brainstem reflexes in patients with familial dysautonomia.

    Science.gov (United States)

    Gutiérrez, Joel V; Norcliffe-Kaufmann, Lucy; Kaufmann, Horacio

    2015-03-01

    Several distinctive clinical features of patients with familial dysautonomia (FD) including dysarthria and dysphagia suggest a developmental defect in brainstem reflexes. Our aim was to characterize the neurophysiological profile of brainstem reflexes in these patients. We studied the function of sensory and motor trigeminal tracts in 28 patients with FD. All were homozygous for the common mutation in the IKAP gene. Each underwent a battery of electrophysiological tests including; blink reflexes, jaw jerk reflex, masseter silent periods and direct stimulation of the facial nerve. Responses were compared with 25 age-matched healthy controls. All patients had significantly prolonged latencies and decreased amplitudes of all examined brainstem reflexes. Similar abnormalities were seen in the early and late components. In contrast, direct stimulation of the facial nerve revealed relative preservation of motor responses. The brainstem reflex abnormalities in FD are best explained by impairment of the afferent and central pathways. A reduction in the number and/or excitability of trigeminal sensory axons is likely the main problem. These findings add further evidence to the concept that congenital mutations of the elongator-1 protein (or IKAP) affect the development of afferent neurons including those carrying information for the brainstem reflex pathways. Copyright © 2014 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  10. Gamma Knife Treatment of Brainstem Metastases

    Directory of Open Access Journals (Sweden)

    Halloran E. Peterson

    2014-05-01

    Full Text Available The management of brainstem metastases is challenging. Surgical treatment is usually not an option, and chemotherapy is of limited utility. Stereotactic radiosurgery has emerged as a promising palliative treatment modality in these cases. The goal of this study is to assess our single institution experience treating brainstem metastases with Gamma Knife radiosurgery (GKRS. This retrospective chart review studied 41 patients with brainstem metastases treated with GKRS. The most common primary tumors were lung, breast, renal cell carcinoma, and melanoma. Median age at initial treatment was 59 years. Nineteen (46% of the patients received whole brain radiation therapy (WBRT prior to or concurrent with GKRS treatment. Thirty (73% of the patients had a single brainstem metastasis. The average GKRS dose was 17 Gy. Post-GKRS overall survival at six months was 42%, at 12 months was 22%, and at 24 months was 13%. Local tumor control was achieved in 91% of patients, and there was one patient who had a fatal brain hemorrhage after treatment. Karnofsky performance score (KPS >80 and the absence of prior WBRT were predictors for improved survival on multivariate analysis (HR 0.60 (p = 0.02, and HR 0.28 (p = 0.02, respectively. GKRS was an effective treatment for brainstem metastases, with excellent local tumor control.

  11. Emerging Biomarkers in Glioblastoma

    Directory of Open Access Journals (Sweden)

    Warren P. Mason

    2013-08-01

    Full Text Available Glioblastoma, the most common primary brain tumor, has few available therapies providing significant improvement in survival. Molecular signatures associated with tumor aggressiveness as well as with disease progression and their relation to differences in signaling pathways implicated in gliomagenesis have recently been described. A number of biomarkers which have potential in diagnosis, prognosis and prediction of response to therapy have been identified and along with imaging modalities could contribute to the clinical management of GBM. Molecular biomarkers including O(6-methlyguanine-DNA-methyltransferase (MGMT promoter and deoxyribonucleic acid (DNA methylation, loss of heterozygosity (LOH of chromosomes 1p and 19q, loss of heterozygosity 10q, isocitrate dehydrogenase (IDH mutations, epidermal growth factor receptor (EGFR, epidermal growth factor, latrophilin, and 7 transmembrane domain-containing protein 1 on chromosome 1 (ELTD1, vascular endothelial growth factor (VEGF, tumor suppressor protein p53, phosphatase and tensin homolog (PTEN, p16INK4a gene, cytochrome c oxidase (CcO, phospholipid metabolites, telomerase messenger expression (hTERT messenger ribonucleic acid [mRNA], microRNAs (miRNAs, cancer stem cell markers and imaging modalities as potential biomarkers are discussed. Inclusion of emerging biomarkers in prospective clinical trials is warranted in an effort for more effective personalized therapy in the future.

  12. Emerging Biomarkers in Glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    McNamara, Mairéad G.; Sahebjam, Solmaz; Mason, Warren P., E-mail: warren.mason@uhn.ca [Pencer Brain Tumor Centre, Princess Margaret Cancer Centre, 610 University Avenue, Toronto, Ontario M5G 2M9 (Canada)

    2013-08-22

    Glioblastoma, the most common primary brain tumor, has few available therapies providing significant improvement in survival. Molecular signatures associated with tumor aggressiveness as well as with disease progression and their relation to differences in signaling pathways implicated in gliomagenesis have recently been described. A number of biomarkers which have potential in diagnosis, prognosis and prediction of response to therapy have been identified and along with imaging modalities could contribute to the clinical management of GBM. Molecular biomarkers including O(6)-methlyguanine-DNA-methyltransferase (MGMT) promoter and deoxyribonucleic acid (DNA) methylation, loss of heterozygosity (LOH) of chromosomes 1p and 19q, loss of heterozygosity 10q, isocitrate dehydrogenase (IDH) mutations, epidermal growth factor receptor (EGFR), epidermal growth factor, latrophilin, and 7 transmembrane domain-containing protein 1 on chromosome 1 (ELTD1), vascular endothelial growth factor (VEGF), tumor suppressor protein p53, phosphatase and tensin homolog (PTEN), p16INK4a gene, cytochrome c oxidase (CcO), phospholipid metabolites, telomerase messenger expression (hTERT messenger ribonucleic acid [mRNA]), microRNAs (miRNAs), cancer stem cell markers and imaging modalities as potential biomarkers are discussed. Inclusion of emerging biomarkers in prospective clinical trials is warranted in an effort for more effective personalized therapy in the future.

  13. Glioblastoma extracellular vesicles: reservoirs of potential biomarkers

    Directory of Open Access Journals (Sweden)

    Redzic JS

    2014-02-01

    Full Text Available Jasmina S Redzic,1 Timothy H Ung,2 Michael W Graner2 1Skaggs School of Pharmacy and Pharmaceutical Sciences, 2Department of Neurosurgery, School of Medicine, University of Colorado Denver, Aurora, CO, USA Abstract: Glioblastoma multiforme (GBM is the most frequent and most devastating of the primary central nervous system tumors, with few patients living beyond 2 years postdiagnosis. The damage caused by the disease and our treatments for the patients often leave them physically and cognitively debilitated. Generally, GBMs appear after very short clinical histories and are discovered by imaging (using magnetic resonance imaging [MRI], and the diagnosis is validated by pathology, following surgical resection. The treatment response and diagnosis of tumor recurrence are also tracked by MRI, but there are numerous problems encountered with these monitoring modalities, such as ambiguous interpretation and forms of pseudoprogression. Diagnostic, prognostic, and predictive biomarkers would be an immense boon in following treatment schemes and in determining recurrence, which often requires an invasive intracranial biopsy to verify imaging data. Extracellular vesicles (EVs are stable, membrane-enclosed, virus-sized particles released from either the cell surface or from endosomal pathways that lead to the systemic release of EVs into accessible biofluids, such as serum/plasma, urine, cerebrospinal fluid, and saliva. EVs carry a wide variety of proteins, nucleic acids, lipids, and other metabolites, with many common features but with enough individuality to be able to identify the cell of origin of the vesicles. These components, if properly interrogated, could allow for the identification of tumor-derived EVs in biofluids, indicating tumor progression, relapse, or treatment failure. That knowledge would allow clinicians to continue with treatment regimens that were actually effective or to change course if the therapies were failing. Here, we review

  14. Erythema multiforme following vaccination for human papillomavirus.

    Science.gov (United States)

    Katoulis, A C; Liakou, A; Bozi, E; Theodorakis, M; Alevizou, A; Zafeiraki, A; Mistidou, M; Stavrianeas, N G

    2010-01-01

    Erythema multiforme (EM) is an acute self-limited immune-mediated reaction manifested by target skin lesions with mucous membrane involvement. The most common causes are infections and drugs. Vaccinations have been reported as a triggering factor, and they may be a frequent cause of EM in childhood. A 19-year-old female developed several target lesions of the hands and feet 10 days after the second dose of human papillomavirus (HPV) vaccine. Clinico-histologically, a diagnosis of EM minor was made. Treatment with topical corticosteroids and oral antihistamines resulted in complete clearance of the rash. Four months later, she received the last booster dose of the vaccine. A few subtle lesions appeared and disappeared spontaneously after a few days. Gardasil is a non-infectious vaccine, developed for the prevention of cervical cancer, precancerous genital lesions and genital warts. It delivers the major capsid (L1) protein of HPV types 6, 11, 16 and 18. Mild local reactions are the main adverse events. The only serious events are very rare cases of anaphylaxis. In our patient, the temporal relationship between the development of EM and the vaccination suggests that the HPV vaccine probably was the causal agent. This is the first published case of EM following HPV vaccination. Copyright 2009 S. Karger AG, Basel.

  15. Mucosal disease series. Number IV. Erythema multiforme.

    Science.gov (United States)

    Farthing, P; Bagan, J-V; Scully, C

    2005-09-01

    Erythema multiforme (EM) is an acute mucocutaneous hypersensitivity reaction characterised by a skin eruption, with or without oral or other mucous membrane lesions. Occasionally EM may involve the mouth alone. EM has been classified into a number of different variants based on the degree of mucosal involvement and the nature and distribution of the skin lesions. EM minor typically affects no more than one mucosa, is the most common form and may be associated with symmetrical target lesions on the extremities. EM major is more severe, typically involving two or more mucous membranes with more variable skin involvement - which is used to distinguish it from Stevens-Johnson syndrome (SJS), where there is extensive skin involvement and significant morbidity and a mortality rate of 5-15%. Both EM major and SJS can involve internal organs and typically are associated with systemic symptoms. Toxic epidermal necrolysis (TEN) may be a severe manifestation of EM, but some experts regard it as a discrete disease. EM can be triggered by a number of factors, but the best documented is preceding infection with herpes simplex virus (HSV), the lesions resulting from a cell mediated immune reaction triggered by HSV-DNA. SJS and TEN are usually initiated by drugs, and the tissue damage is mediated by soluble factors including Fas and FasL.

  16. Bullous Lupus Erythematosus Manifesting As Erythema Multiforme

    Directory of Open Access Journals (Sweden)

    Dhurat Rachita

    2004-01-01

    Full Text Available Bullous SLE has a distinctive clinical, histopathologic and immunopathologic features that together constitute a unique bullous disease phenotype. We report a 33 year old female presenting with multiple tense vesicles and bullae on normal and erythematous skin over the body and oral erosions. Palms and extremities showed typical target lesions. She had consumed NSAIDs intermittently for joint pains. She was diagnosed as bullous erythema multiforme and started on oral prednisolone but lesions failed to heal. Patient recollected a history of low grade fever and a photosensitive rash in the past. Investigations revealed positive ANA with a peripheral pattern. A skin biopsy of a vesicle showed a subepidemal blisher. Perilesional direct immunofluorescence studies showed a linear deposition of IgG, IgA and fibrin along the basement membrane zone and perivascular deposition of IgG. Lapus band test showed a linear deposition of IgG, C3, IgM and fibrin at BMZ clinching the diagnosis of bullous lupus erythematosus.

  17. Is enhanced MRI helpful in brainstem infarction?

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Y. M.; Shin, G. H.; Choi, W. S. [Kyung Hee University Hospital, Seoul (Korea, Republic of)

    1994-12-15

    To determine the role of MR contrast enhancement in evaluating time course of brainstem infarction. MR imaging with IV administration of gadopentetate dimeglumine was retrospectively reviewed in 43 patients with clinically and radiologically documented brainstem infarctions. The pattern of infarction was classified into spotty and patchy. Presence of parenchymal enhancement in infarction was evaluated. By location, there were 34 pontine, 3 midbrain, 6 medullary infarctions. The age of the infarctions ranged from 1 day to 9 months, with 5 patients scanned within 3 days and 10 scanned within 2 weeks of clinical ictus. Abnormalities on T2-weighted images were encountered in every case, with spotty pattern in 14 cases and patchy pattern in 29 cases. Parenchymal contrast enhancement was seen in 9 cases(20%), primarily occurring between days 8 and 20. MR contrast enhancement in brainstem infarction was infrequent that it may not be useful in the estimation of the age of infarction.

  18. Auditory brain-stem responses in adrenomyeloneuropathy.

    Science.gov (United States)

    Grimes, A M; Elks, M L; Grunberger, G; Pikus, A M

    1983-09-01

    We studied three patients with adrenomyeloneuropathy. Complete audiologic assessment was obtained: two patients showed unimpaired peripheral hearing and one showed a mild high-frequency hearing loss. Auditory brain-stem responses were abnormal in both ears of all subjects, with one subject showing no response above wave I, and the other two having significant wave I to III and wave III to V interval prolongations. We concluded that auditory brain-stem response testing provides a simple, valid, reliable method for demonstrating neurologic abnormality in adrenomyeloneuropathy even prior to evidence of clinical signs.

  19. Characterizing mutational heterogeneity in a glioblastoma patient with double recurrence.

    Directory of Open Access Journals (Sweden)

    Gabrielle C Nickel

    Full Text Available Human cancers are driven by the acquisition of somatic mutations. Separating the driving mutations from those that are random consequences of general genomic instability remains a challenge. New sequencing technology makes it possible to detect mutations that are present in only a minority of cells in a heterogeneous tumor population. We sought to leverage the power of ultra-deep sequencing to study various levels of tumor heterogeneity in the serial recurrences of a single glioblastoma multiforme patient. Our goal was to gain insight into the temporal succession of DNA base-level lesions by querying intra- and inter-tumoral cell populations in the same patient over time. We performed targeted "next-generation" sequencing on seven samples from the same patient: two foci within the primary tumor, two foci within an initial recurrence, two foci within a second recurrence, and normal blood. Our study reveals multiple levels of mutational heterogeneity. We found variable frequencies of specific EGFR, PIK3CA, PTEN, and TP53 base substitutions within individual tumor regions and across distinct regions within the same tumor. In addition, specific mutations emerge and disappear along the temporal spectrum from tumor at the time of diagnosis to second recurrence, demonstrating evolution during tumor progression. Our results shed light on the spatial and temporal complexity of brain tumors. As sequencing costs continue to decline and deep sequencing technology eventually moves into the clinic, this approach may provide guidance for treatment choices as we embark on the path to personalized cancer medicine.

  20. Methionine Uptake and Required Radiation Dose to Control Glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Iuchi, Toshihiko, E-mail: tiuchi@chiba-cc.jp [Division of Neurological Surgery, Chiba Cancer Center, Chiba (Japan); Hatano, Kazuo [Division of Radiation Oncology, Tokyo Bay Advanced Imaging and Radiation Oncology Clinic, Makuhari, Chiba (Japan); Uchino, Yoshio [Division of Nuclear Medicine, Chiba Ryogo Center, Chiba (Japan); Itami, Makiko [Division of Surgical Pathology, Chiba Cancer Center, Chiba (Japan); Hasegawa, Yuzo; Kawasaki, Koichiro; Sakaida, Tsukasa [Division of Neurological Surgery, Chiba Cancer Center, Chiba (Japan); Hara, Ryusuke [Division of Radiation Oncology, Chiba Cancer Center, Chiba (Japan)

    2015-09-01

    Purpose: The purpose of this study was to retrospectively assess the feasibility of radiation therapy planning for glioblastoma multiforme (GBM) based on the use of methionine (MET) positron emission tomography (PET), and the correlation among MET uptake, radiation dose, and tumor control. Methods and Materials: Twenty-two patients with GBM who underwent MET-PET prior to radiation therapy were enrolled. MET uptake in 30 regions of interest (ROIs) from 22 GBMs, biologically effective doses (BEDs) for the ROIs and their ratios (MET uptake:BED) were compared in terms of whether the ROIs were controlled for >12 months. Results: MET uptake was significantly correlated with tumor control (odds ratio [OR], 10.0; P=.005); however, there was a higher level of correlation between MET uptake:BED ratio and tumor control (OR, 40.0; P<.0001). These data indicated that the required BEDs for controlling the ROIs could be predicted in terms of MET uptake; BED could be calculated as [34.0 × MET uptake] Gy from the optimal threshold of the MET uptake:BED ratio for tumor control. Conclusions: Target delineation based on MET-PET was demonstrated to be feasible for radiation therapy treatment planning. MET-PET could not only provide precise visualization of infiltrating tumor cells but also predict the required radiation doses to control target regions.

  1. Significance of Epidermal Growth Factor Receptor in the Radiation Resistance of Glioblastoma Tumors

    Science.gov (United States)

    Petrás, Miklós; Lajtos, Tamás; Pintye, Éva; Feuerstein, Burt G.; Szöllősi, János; Vereb, György

    2008-12-01

    In the United States, a dramatically increased incidence and mortality of brain tumors have been observed over the past decades. Of the ˜44 thousand new cases of primary malignant and benign brain tumors diagnosed per year, high grade astrocytomas or multiform glioblastomas show particularly bad prognosis in spite of therapeutic developments. Current management of multiform glioblastoma includes the most extensive surgical resection possible, followed by adjuvant radio- and chemotherapy. However, treatment is frequently hampered by decreased radiosensitivity of the tumor. Recent studies revealed that subpopulations of glioblastoma cells show amplified checkpoint activation of the cell cycle upon ionizing radiation, which induces overactivation of DNA repair processes and leads to maintained proliferation rate as well as clinically observed radioresistance and recurrence of the tumor over time. In addition, overexpression of some transmembrane receptors has also been implicated in radioresistance. However, the role of the overexpressed proteins can only be interpreted reliably if their multi-faceted molecular interactions are properly characterized. Thus, based on recent evidence for the functional crosstalk between certain cell adhesion molecules and receptor tyrosine kinases, we have examined the molecular interactions of the receptor tyrosine kinase EGFR and the cell adhesion molecule β1-integrin using flow cytometric and microscopic fluorescence resosnance energy transfer (FRET) measurements on two cellular model systems showing similar expression patterns to low and high grade astrocytomas. On the one hand, U251 glioblastoma clones established by introducing varying amounts of extra chromosome 7 into the cells, and on the other hand stable, high and low EGFR expressing transfenctant U251 NCI sublines were investigated. The results revealed that increased EGFR and β1-integrin expression levels correlate with stronger EGFR—β1-integrin heteroassociation

  2. Acute disseminated encephalomyelitis presenting as a solitary brainstem mass.

    Science.gov (United States)

    Miller, D H; Scaravilli, F; Thomas, D C; Harvey, P; Hirsch, N P

    1993-01-01

    A 36 year old woman presented with a subacute brainstem syndrome. MRI showed a solitary, gadolinium enhancing brainstem mass, which on biopsy showed perivenous inflammation and demyelination compatible with acute disseminated encephalomyelitis. Images PMID:8350113

  3. Novel multiform morphologies of hydroxyapatite: Synthesis and growth mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Mary, I. Reeta [Department of Nanoscience and Technology, Bharathiar University, Coimbatore 641046 (India); Department of Physics, Government Arts College, Coimbatore 641018 (India); Sonia, S.; Viji, S.; Mangalaraj, D.; Viswanathan, C. [Department of Nanoscience and Technology, Bharathiar University, Coimbatore 641046 (India); Ponpandian, N., E-mail: ponpandian@buc.edu.in [Department of Nanoscience and Technology, Bharathiar University, Coimbatore 641046 (India)

    2016-01-15

    Graphical abstract: - Highlights: • Novel multiform morphologies of hydroxyapatite from nanoscale building blocks. • Facile hydro/solvothermal method under mild reaction conditions without the necessity of post-annealing treatment. • Growth mechanism by Ostwald ripening and self-assembly processes. - Abstract: Morphological evolution of materials becomes a prodigious challenge due to their key role in defining their functional properties and desired applications. Herein, we report the synthesis of hydroxyapatite (HAp) microstructures with multiform morphologies, such as spheres, cubes, hexagonal rods and nested bundles constructed from their respective nanoscale building blocks via a simple cost effective hydro/solvothermal method. A possible formation mechanism of diverse morphologies of HAp has been presented. Structural analysis based on X-ray diffraction (XRD) and Fourier transform infrared (FTIR) spectroscopy confirms the purity of the HAp microstructures. The multiform morphologies of HAp were corroborated by using Field emission scanning electron microscope (FESEM).

  4. Misdiagnosis of erythema multiforme: a literature review and case report.

    Science.gov (United States)

    Kempton, John; Wright, John M; Kerins, Carolyn; Hale, David

    2012-01-01

    Erythema multiforme is primarily considered a disease of the skin. Diagnosis tends to be centered on dermatologic lesions of the extremities, with mouth ulcers regarded as a secondary finding. The purpose of this paper was to report a case of an 8-year-old male diagnosed with erythema multiforme limited to the oral cavity. The patient was referred to Texas A&M Health Science Center's Baylor College of Dentistry for biopsy of recurrent mouth ulcers following an outbreak of a fever blister. Previous hospitalization occurred twice due to severe mouth ulcers causing dehydration and loss of nutrition. He was treated with 10 mg of prednisone twice daily and was able to eat and drink without pain within 48 hours. Nearly all lesions healed within 5 days of therapy. Although rare, erythema multiforme should always be considered in the differential diagnosis in the event of acute onset stomatitis.

  5. Acute tetraplegia and cardiac arrest following high cervical leptomeningeal metastasis of giant cell glioblastoma.

    Science.gov (United States)

    Ammerman, Joshua M; Kerr, P Benjamin; Roberti, Fabio

    2011-08-01

    Giant cell glioblastoma multiforme (gcGBM) is an unusual subtype of high-grade glioma (grade IV, World Health Organization classification). We report a patient with a rare acute tetraplegia, followed by lethal cardiac arrest, who had undergone a prior resection of a supratentorial gcGBM. Neuroradiological workup revealed a large, high cervical compressive leptomeningeal mass consistent with a drop metastasis. Due to the possibility of a rapid clinical deterioration in patients with high cervical cord compression, the diagnosis of drop metastasis to the spine should be considered in patients with a previous history of supratentorial GBM who present with acute diffuse motor weakness. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Giant cells glioblastoma: case report and pathological analysis from this uncommon subtype of glioma.

    Science.gov (United States)

    Belsuzarri, Telmo A B; Araujo, João F M; Catanoce, Aguinaldo P; Neves, Maick W F; Sola, Rodrigo A S; Navarro, Juliano N; Brito, Leandro G; Silva, Nilton R; Pontelli, Luis Otavio C; Mattos, Luiz Gustavo A; Gonçales, Tiago F; Zeviani, Wolnei M; Marques, Renata M B

    2015-02-11

    Glioblastoma multiforme (GBM) is the most common glial tumor of the brain system; nevertheless, the giant cell (GC) subtype is uncommon. Recent reviews report for an incidence of 1% in adults and 3% in children. The GCs usually have a better prognosis than GBM and also an increasing long-term survival rate. It is known that the diagnosis of this tumor is due to its histological findings and patterns, such as the unusual increased number of giant cells. Unfortunately, due to its rarity, the immunohistochemical and cytogenetical analysis of this tumor is not well known. Some authors also suggest that there are few subtypes of GCs and their patterns of aggressiveness could be due to cytogenetical markers. It is recognized that maximum safe resection treatment and adjuvant radiotherapy can improve survival rate (5-13 months) similar to GBM patients.

  7. Giant cells glioblastoma: case report and pathological analysis from this uncommon subtype of glioma

    Directory of Open Access Journals (Sweden)

    Telmo A.B. Belsuzarri

    2015-03-01

    Full Text Available Glioblastoma multiforme (GBM is the most common glial tumor of the brain system; nevertheless, the giant cell (GC subtype is uncommon. Recent reviews report for an incidence of 1% in adults and 3% in children. The GCs usually have a better prognosis than GBM and also an increasing long-term survival rate. It is known that the diagnosis of this tumor is due to its histological findings and patterns, such as the unusual increased number of giant cells. Unfortunately, due to its rarity, the immunohistochemical and cytogenetical analysis of this tumor is not well known. Some authors also suggest that there are few subtypes of GCs and their patterns of aggressiveness could be due to cytogenetical markers. It is recognized that maximum safe resection treatment and adjuvant radiotherapy can improve survival rate (5-13 months similar to GBM patients.

  8. Post-translational modifications of FDA-approved plasma biomarkers in glioblastoma samples.

    Directory of Open Access Journals (Sweden)

    Natalia A Petushkova

    Full Text Available Liquid chromatography-tandem mass spectrometry was used to analyze plasma proteins of volunteers (control and patients with glioblastoma multiform (GBM. A database search was pre-set with a variable post-translational modification (PTM: phosphorylation, acetylation or ubiquitination. There were no significant differences between the control and the GBM groups regarding the number of protein identifications, sequence coverage or number of PTMs. However, in GBM plasma, we unambiguously observed a decreased fraction in post-translationally modified peptides identified with high quality. The disease-specific PTM patterns were extracted and mapped to the set of FDA-approved plasma protein markers. Decreases of 46% and 24% in the number of acetylated and ubiquitinated peptides, respectively, were observed in the GBM samples. Significance of capturing disease-associated patterns of protein modifications was envisaged.

  9. Suppression of peroxiredoxin 4 in glioblastoma cells increases apoptosis and reduces tumor growth.

    Directory of Open Access Journals (Sweden)

    Tae Hyong Kim

    Full Text Available Glioblastoma multiforme (GBM, the most common and aggressive primary brain malignancy, is incurable despite the best combination of current cancer therapies. For the development of more effective therapies, discovery of novel candidate tumor drivers is urgently needed. Here, we report that peroxiredoxin 4 (PRDX4 is a putative tumor driver. PRDX4 levels were highly increased in a majority of human GBMs as well as in a mouse model of GBM. Reducing PRDX4 expression significantly decreased GBM cell growth and radiation resistance in vitro with increased levels of ROS, DNA damage, and apoptosis. In a syngenic orthotopic transplantation model, Prdx4 knockdown limited GBM infiltration and significantly prolonged mouse survival. These data suggest that PRDX4 can be a novel target for GBM therapies in the future.

  10. Post-translational modifications of FDA-approved plasma biomarkers in glioblastoma samples

    Science.gov (United States)

    Zgoda, Victor G.; Pyatnitskiy, Mikhail A.; Larina, Olesya V.; Teryaeva, Nadezhda B.; Potapov, Alexander A.; Lisitsa, Andrey V.

    2017-01-01

    Liquid chromatography-tandem mass spectrometry was used to analyze plasma proteins of volunteers (control) and patients with glioblastoma multiform (GBM). A database search was pre-set with a variable post-translational modification (PTM): phosphorylation, acetylation or ubiquitination. There were no significant differences between the control and the GBM groups regarding the number of protein identifications, sequence coverage or number of PTMs. However, in GBM plasma, we unambiguously observed a decreased fraction in post-translationally modified peptides identified with high quality. The disease-specific PTM patterns were extracted and mapped to the set of FDA-approved plasma protein markers. Decreases of 46% and 24% in the number of acetylated and ubiquitinated peptides, respectively, were observed in the GBM samples. Significance of capturing disease-associated patterns of protein modifications was envisaged. PMID:28493947

  11. PD-L1 expression by neurons nearby tumors indicates better prognosis in glioblastoma patients

    DEFF Research Database (Denmark)

    Liu, Yawei; Carlsson, Robert; Ambjørn, Malene

    2013-01-01

    Glioblastoma multiforme (GBM) is the most aggressive form of brain tumor. In general, tumor growth requires disruption of the tissue microenvironment, yet how this affects glioma progression is unknown. We studied program death-ligand (PD-L)1 in neurons and gliomas in tumors from GBM patients...... and associated the findings with clinical outcome. Remarkably, we found that upregulation of PD-L1 by neurons in tumor-adjacent brain tissue (TABT) associated positively with GBM patient survival, whereas lack of neuronal PD-L1 expression was associated with high PD-L1 in tumors and unfavorable prognosis...... in GBM patients, better survival in wild-type mice was associated with high neuronal PD-L1 in TABT and downregulation of PD-L1 in tumors, which was defective in Ifnb-/- mice. Our data indicated that neuronal PD-L1 signaling in brain cells was important for GBM patient survival. Reciprocal PD-L1...

  12. The Effect of Z-Ligustilide on the Mobility of Human Glioblastoma T98G Cells.

    Directory of Open Access Journals (Sweden)

    Jun Yin

    Full Text Available Z-ligustilide (LIG, an essential oil extract from Radix Angelica sinensis, has broad pharmaceutical applications in treating cardio-vascular diseases and ischemic brain injury. Recently, LIG has been connected to Glioblastoma multiforme (GBM because of its structural similarity to 3-n-alkyphthalide (NBP, which is specifically cytotoxic to GBM cells. Hence, we investigated LIG's effect on GBM T98G cells. The study shows that LIG can significantly reduce T98G cells' migration in a dose-dependent manner. Furthermore, the attenuation of cellular mobility can be linked to the activity of the Rho GTPases (RhoA, Rac1 and Cdc42, the three critical molecular switches governing cytoskeleton remodeling; thus, regulating cell migration. LIG significantly reduces the expression of RhoA and affects in a milder manner the expression of Cdc42 and Rac1.

  13. [Herpangina and erythema multiforme in a three-year boy].

    Science.gov (United States)

    Brzeziński, Piotr

    2013-01-01

    The dentist can be confronted with a vesiculobullous lesion of the oral mucosa are a symptoms of herpes infection (herpangina) of throat. Human enteroviruses (HEVs) are a major cause of herpangina. Herpangina is an acute viral infection caused by certain viruses Coxsackie, is spread by respiratory droplets. The infection is mainly encountered in young children. Oral lesions rarely more than 7 days; treatment is symptomatic. Viral throat infections may accompany various skin rashes, such as erythema multiforme (which can also occur without any connection with a viral infection). At work was presented a case of 3-year-old boy with herpes symptoms of sore throat and mild forms of erythema multiforme.

  14. Key concepts in glioblastoma therapy

    DEFF Research Database (Denmark)

    Bartek, Jiri; Ng, Kimberly; Bartek, Jiri

    2012-01-01

    Glioblastoma is the most common form of primary brain cancer and remains one of the most aggressive forms of human cancer. Current standard of care involves maximal surgical resection followed by concurrent therapy with radiation and the DNA alkylating agent temozolomide. Despite this aggressive...

  15. Bevacizumab for Patients with Recurrent Multifocal Glioblastomas

    Science.gov (United States)

    Breuer, Stella; Cieplik, Hans C.; Harter, Patrick N.; Franz, Kea; Bähr, Oliver; Steinbach, Joachim P.

    2017-01-01

    In patients with glioblastoma, antiangiogenic therapy with bevacizumab (BEV) has been shown to improve progression-free survival (PFS), but not overall survival (OS). Especially in patients with an unusual infiltrative phenotype as seen in multifocal glioblastoma, the use of BEV therapy is still more controversial. Therefore, we prepared a retrospective case series with 16 patients suffering from a multifocal glioblastoma treated with BEV. We compared these patients to a matched control cohort of 16 patients suffering from glioblastoma with a single lesion treated with BEV. The objective of this study was to evaluate whether the course of disease differs in glioblastoma patients with a multifocal disease pattern compared to those with a single lesion only. Patients were treated with BEV monotherapy or BEV in combination with irinotecan or lomustine (CCNU). Response rates and PFS were similar in both groups. There was a trend for an unfavorable OS in the patient group with multifocal glioblastoma, which was expected due to the generally worse prognosis of multifocal glioblastoma. We investigated whether BEV therapy affects the invasive growth pattern as measured by the appearance of new lesions on magnetic resonance imaging (MRI). Under BEV therapy, there was a trend for a lower frequency of new lesions both in multifocal and solitary glioblastoma. Based on these results, BEV therapy at relapse appears to be justified to no lesser extent in multifocal glioblastoma than in solitary glioblastoma. PMID:29156610

  16. Bevacizumab for Patients with Recurrent Multifocal Glioblastomas

    Directory of Open Access Journals (Sweden)

    Michael C. Burger

    2017-11-01

    Full Text Available In patients with glioblastoma, antiangiogenic therapy with bevacizumab (BEV has been shown to improve progression-free survival (PFS, but not overall survival (OS. Especially in patients with an unusual infiltrative phenotype as seen in multifocal glioblastoma, the use of BEV therapy is still more controversial. Therefore, we prepared a retrospective case series with 16 patients suffering from a multifocal glioblastoma treated with BEV. We compared these patients to a matched control cohort of 16 patients suffering from glioblastoma with a single lesion treated with BEV. The objective of this study was to evaluate whether the course of disease differs in glioblastoma patients with a multifocal disease pattern compared to those with a single lesion only. Patients were treated with BEV monotherapy or BEV in combination with irinotecan or lomustine (CCNU. Response rates and PFS were similar in both groups. There was a trend for an unfavorable OS in the patient group with multifocal glioblastoma, which was expected due to the generally worse prognosis of multifocal glioblastoma. We investigated whether BEV therapy affects the invasive growth pattern as measured by the appearance of new lesions on magnetic resonance imaging (MRI. Under BEV therapy, there was a trend for a lower frequency of new lesions both in multifocal and solitary glioblastoma. Based on these results, BEV therapy at relapse appears to be justified to no lesser extent in multifocal glioblastoma than in solitary glioblastoma.

  17. Protein kinase D2 regulates migration and invasion of U87MG glioblastoma cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Bernhart, Eva; Damm, Sabine; Wintersperger, Andrea [Institute of Molecular Biology and Biochemistry, Medical University of Graz, Graz (Austria); DeVaney, Trevor [Institute of Biophysics, Medical University of Graz (Austria); Zimmer, Andreas [Institute of Pharmaceutical Sciences, Department of Pharmaceutical Technology, Karl-Franzens University, Graz (Austria); Raynham, Tony; Ireson, Christopher [Cancer Research Technology Ltd, London (United Kingdom); Sattler, Wolfgang, E-mail: wolfgang.sattler@medunigraz.at [Institute of Molecular Biology and Biochemistry, Medical University of Graz, Graz (Austria)

    2013-08-01

    Glioblastoma multiforme (GBM) is the most common malignant brain tumor, which, despite combined modality treatment, reoccurs and is invariably fatal for affected patients. Recently, a member of the serine/threonine protein kinase D (PRKD) family, PRKD2, was shown to be a potent mediator of glioblastoma growth. Here we studied the role of PRKD2 in U87MG glioblastoma cell migration and invasion in response to sphingosine-1-phosphate (S1P), an activator of PRKD2 and a GBM mitogen. Time-lapse microscopy demonstrated that random cell migration was significantly diminished in response to PRKD2 silencing. The pharmacological PRKD family inhibitor CRT0066101 decreased chemotactic migration and invasion across uncoated or matrigel-coated Transwell inserts. Silencing of PRKD2 attenuated migration and invasion of U87MG cells even more effectively. In terms of downstream signaling, CRT0066101 prevented PRKD2 autophosphorylation and inhibited p44/42 MAPK and to a smaller extent p54/46 JNK and p38 MAPK activation. PRKD2 silencing impaired activation of p44/42 MAPK and p54/46 JNK, downregulated nuclear c-Jun protein levels and decreased c-Jun{sup S73} phosphorylation without affecting the NFκB pathway. Finally, qPCR array analyses revealed that silencing of PRKD2 downregulates mRNA levels of integrin alpha-2 and -4 (ITGA2 and -4), plasminogen activator urokinase (PLAU), plasminogen activator urokinase receptor (PLAUR), and matrix metallopeptidase 1 (MMP1). Findings of the present study identify PRKD2 as a potential target to interfere with glioblastoma cell migration and invasion, two major determinants contributing to recurrence of glioblastoma after multimodality treatment. Highlights: • Sphingosine-1-phosphate induces glioma cell migration and invasion. • Part of the effects is mediated by protein kinase D2 (PRKD2) activation. • Inactivation of PRKD2 attenuates glioblastoma cell migration and invasion. • Both, RNAi and pharmacological inhibition of PRKD2 inhibits MAPK

  18. Brainstem Encephalitis and ADEM Following Mumps

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2004-03-01

    Full Text Available Clinical manifestations of brainstem encephalitis (BSE with fever, decreased level of consciousness, and left facial and abducens paralysis developed 1 week after bilateral parotitis and mumps in a 4 year-old female child and were followed by symptoms of acute disseminated encephalomyelitis (ADEM within 20 days of recovery from BSE.

  19. Targeting the epithelial to mesenchymal transition in glioblastoma: the emerging role of MET signaling

    Directory of Open Access Journals (Sweden)

    Lee JK

    2014-10-01

    Full Text Available Jin-Ku Lee,1,2,* Kyeung Min Joo,3 Jeongwu Lee,4 Yeup Yoon,5,* Do-Hyun Nam2,5 1Samsung Biomedical Research Institute, Sungkyunkwan University School of Medicine, Seoul, Korea; 2Department of Neurosurgery, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea; 3Department of Anatomy and Cell Biology, Sungkyunkwan University School of Medicine, Seoul, Korea; 4Department of Stem Cell Biology and Regenerative Medicine, Lerner Research Institute, Cleveland Clinic, Cleveland, OH, USA; 5Samsung Advanced Institute for Health Sciences and Technology, Sungkyunkwan University School of Medicine, Seoul, Korea  *These authors contributed equally to this work Abstract: Glioblastoma multiforme (GBM is the most common human primary brain malignancy and has a dismal prognosis. Aggressive treatments using maximal surgical resection, radiotherapy, and temozolomide result in median survival of only 14.6 months in patients with GBM. Numerous clinical approaches using small molecule inhibitors have shown disappointing results because of the genetic heterogeneity of GBM. The epithelial to mesenchymal transition (EMT is a crucial biological process occurring in the early development stages of many species. However, cancer cells often obtain the ability to invade and metastasize through the EMT, which triggers the scattering of cells. The hepatocyte growth factor (HGF/MET signaling pathway is indicative of the EMT during both embryogenesis and the invasive growth of tumors, because HGF potently induces mesenchymal transition in epithelial-driven cells. Activation of MET signaling or co-overexpression of HGF and MET frequently represents aggressive growth and poor prognosis of various cancers, including GBM. Thus, efforts to treat cancers by inhibiting MET signaling using neutralizing antibodies or small molecule inhibitors have progressed during the last decade. In this review, we discuss HGF/MET signaling in the development of diseases

  20. Proteome and Secretome Characterization of Glioblastoma-Derived Neural Stem Cells.

    Science.gov (United States)

    Okawa, Satoshi; Gagrica, Sladjana; Blin, Carla; Ender, Christine; Pollard, Steven M; Krijgsveld, Jeroen

    2017-04-01

    Glioblastoma multiforme (GBM) (grade IV astrocytoma) is the most common and aggressive primary brain tumor. GBM consists of heterogeneous cell types including a subset of stem cell-like cells thought to sustain tumor growth. These tumor-initiating glioblastoma multiforme-derived neural stem (GNS) cells as well as their genetically normal neural stem (NS) counterparts can be propagated in culture as relatively pure populations. Here, we perform quantitative proteomics to globally characterize and compare total proteome plus the secreted proteome (secretome) between GNS cells and NS cells. Proteins and pathways that distinguish malignant cancer (GNS) stem cells from their genetically normal counterparts (NS cells) might have value as new biomarkers or therapeutic targets. Our analysis identified and quantified ∼7,500 proteins in the proteome and ∼2,000 in the secretome, 447 and 138 of which were differentially expressed, respectively. Notable tumor-associated processes identified using gene set enrichment analysis included: extracellular matrix interactions, focal adhesion, cell motility, and cell signaling. We focused on differentially expressed surface proteins, and identified 26 that participate in ligand-receptor pairs that play a prominent role in tumorigenesis. Immunocytochemistry and immunoblotting confirmed that CD9, a recently identified marker of adult subventricular zone NS cells, was consistently enriched across a larger set of primary GNS cell lines. CD9 may, therefore, have value as a GNS-specific surface marker and a candidate therapeutic target. Altogether, these findings support the notion that increased cell-matrix and cell-cell adhesion molecules play a crucial role in promoting the tumor initiating and infiltrative properties of GNS cells. Stem Cells 2017;35:967-980. © 2016 AlphaMed Press.

  1. Cisplatin-tethered gold nanospheres for multimodal chemo-radiotherapy of glioblastoma

    Science.gov (United States)

    Setua, Sonali; Ouberai, Myriam; Piccirillo, Sara G.; Watts, Colin; Welland, Mark

    2014-08-01

    Glioblastoma multiforme (GBM) remains the most aggressive and challenging brain tumour to treat. We report the first successful chemo-radiotherapy on patient derived treatment resistant GBM cells using a cisplatin-tethered gold nanosphere. After intracellular uptake, the nanosphere effects DNA damage which initiates caspase-mediated apoptosis in those cells. In the presence of radiation, both gold and platinum of cisplatin, serve as high atomic number radiosensitizers leading to the emission of ionizing photoelectrons and Auger electrons. This resulted in enhanced synergy between cisplatin and radiotherapy mediated cytotoxicity, and photo/Auger electron mediated radiosensitisation leading to complete ablation of the tumour cells in an in vitro model system. This study demonstrates the potential of designed nanoparticles to target aggressive cancers in the patient derived cell lines providing a platform to move towards treatment strategies.Glioblastoma multiforme (GBM) remains the most aggressive and challenging brain tumour to treat. We report the first successful chemo-radiotherapy on patient derived treatment resistant GBM cells using a cisplatin-tethered gold nanosphere. After intracellular uptake, the nanosphere effects DNA damage which initiates caspase-mediated apoptosis in those cells. In the presence of radiation, both gold and platinum of cisplatin, serve as high atomic number radiosensitizers leading to the emission of ionizing photoelectrons and Auger electrons. This resulted in enhanced synergy between cisplatin and radiotherapy mediated cytotoxicity, and photo/Auger electron mediated radiosensitisation leading to complete ablation of the tumour cells in an in vitro model system. This study demonstrates the potential of designed nanoparticles to target aggressive cancers in the patient derived cell lines providing a platform to move towards treatment strategies. Electronic supplementary information (ESI) available: Additional figures. See DOI: 10.1039/c

  2. Imatinib in combination with hydroxyurea versus hydroxyurea alone as oral therapy in patients with progressive pretreated glioblastoma resistant to standard dose temozolomide

    DEFF Research Database (Denmark)

    Dresemann, G.; Weller, M.; Ostenfeld-Rosenthal, Ann Maria

    2010-01-01

    activity compared with HU monotherapy in the treatment of recurrent GBM. The target population consisted of patients with confirmed recurrent GBM and an Eastern Cooperative Oncology Group performance status of 0-2 who had completed previous treatment comprising surgical resection, irradiation therapy......A randomized, multicenter, open-label, phase 3 study of patients with progressive, recurrent glioblastoma multiforme (GBM) for whom front-line therapy had failed was conducted. This study was designed to determine whether combination therapy with imatinib and hydroxyurea (HU) has superior antitumor...

  3. Reverse engineering of modified genes by Bayesian network analysis defines molecular determinants critical to the development of glioblastoma.

    Directory of Open Access Journals (Sweden)

    Brian W Kunkle

    Full Text Available In this study we have identified key genes that are critical in development of astrocytic tumors. Meta-analysis of microarray studies which compared normal tissue to astrocytoma revealed a set of 646 differentially expressed genes in the majority of astrocytoma. Reverse engineering of these 646 genes using Bayesian network analysis produced a gene network for each grade of astrocytoma (Grade I-IV, and 'key genes' within each grade were identified. Genes found to be most influential to development of the highest grade of astrocytoma, Glioblastoma multiforme were: COL4A1, EGFR, BTF3, MPP2, RAB31, CDK4, CD99, ANXA2, TOP2A, and SERBP1. All of these genes were up-regulated, except MPP2 (down regulated. These 10 genes were able to predict tumor status with 96-100% confidence when using logistic regression, cross validation, and the support vector machine analysis. Markov genes interact with NFkβ, ERK, MAPK, VEGF, growth hormone and collagen to produce a network whose top biological functions are cancer, neurological disease, and cellular movement. Three of the 10 genes - EGFR, COL4A1, and CDK4, in particular, seemed to be potential 'hubs of activity'. Modified expression of these 10 Markov Blanket genes increases lifetime risk of developing glioblastoma compared to the normal population. The glioblastoma risk estimates were dramatically increased with joint effects of 4 or more than 4 Markov Blanket genes. Joint interaction effects of 4, 5, 6, 7, 8, 9 or 10 Markov Blanket genes produced 9, 13, 20.9, 26.7, 52.8, 53.2, 78.1 or 85.9%, respectively, increase in lifetime risk of developing glioblastoma compared to normal population. In summary, it appears that modified expression of several 'key genes' may be required for the development of glioblastoma. Further studies are needed to validate these 'key genes' as useful tools for early detection and novel therapeutic options for these tumors.

  4. Drug induced oral erythema multiforme: A rare and less recognized variant of erythema multiforme.

    Science.gov (United States)

    Joseph, T Isaac; Vargheese, Geetha; George, Deepu; Sathyan, Pradeesh

    2012-01-01

    Oral erythema multiforme (EM) is considered as a third category of EM other than EM minor and major. Patients present with oral and lip ulcerations typical of EM but without any skin target lesions. It has been reported that primary attacks of oral EM is confined to the oral mucosa but the subsequent attacks can produce more severe forms of EM involving the skin. Hence, it is important to identify and distinguish them from other ulcerative disorders involving oral cavity for early management. This article reports two cases of oral EM that presented with oral and lip ulcerations typical of EM without any skin lesions and highlights the importance of early diagnosis and proper management.

  5. Intermittent oral cyclosporin for recurrent herpes simplex-associated erythema multiforme.

    Science.gov (United States)

    Bakis, Sophie; Zagarella, Samuel

    2005-02-01

    Recurrent erythema multiforme is one of three distinct clinical subtypes of erythema multiforme. We present a 42-year-old man with a 10-year history of recurrent herpes simplex virus-induced erythema multiforme. Our patient was debilitated by the frequency of his attacks and the associated pain, for which he often required leave from work. The frequency, duration and morbidity of the attacks were poorly controlled using oral prednisone and oral aciclovir. Three episodes of his recurrent herpes simplex virus-induced erythema multiforme were treated with intermittent oral cyclosporin. Oral cyclosporin rapidly reduced his symptoms and led to rapid resolution of his erythema multiforme, provided the cyclosporin was commenced on day 1 or 2 of the erythema multiforme episode. Consequently, his quality of life has dramatically improved. We recommend the use of intermittent oral cyclosporin for recurrent, debilitating episodes of erythema multiforme.

  6. Stereotactic radiosurgery for glioblastoma: retrospective analysis

    OpenAIRE

    Walter Kevin A; Vates G Edward; Bakos Robert S; Pilcher Webster H; Smudzin Therese; Schell Michael C; Okunieff Paul; Biswas Tithi; Wensel Andrew; Korones David N; Milano Michael T

    2009-01-01

    Abstract Purpose This retrospective study was done to better understand the conditions for which stereotactic radiosurgery (SRS) for glioblastoma may be efficacious. Methods Between 2000 and 2007, 33 patients with a pathological diagnosis of glioblastoma received SRS with the Novalis® Shaped Beam Radiosurgery system. Eighteen patients (54%) underwent salvage SRS for recurrence while 15 (45%) patients received upfront SRS following standard fractionated RT for newly diagnosed glioblastoma. Res...

  7. Recurrent erythema multiforme with arthritis – A rare association

    OpenAIRE

    Yasmeen Jabeen Bhat; Sumaya Zeerak; Asif Nazir Baba; Iffat Hassan; Roohi Wani

    2017-01-01

    Erythema multiforme (EM) is an acute, immune-mediated, self-limiting mucocutaneous condition characterized by distinctive target lesions. The etiology is diverse and numerous diseases have been associated with EM. However, arthritis has been rarely reported with it. We report a rare association between EM, localized mainly over the joints, and polyarthritis in a male patient, who responded successfully to oral acyclovir.

  8. Erythema multiforme as the result of taking carbamazepine

    Directory of Open Access Journals (Sweden)

    Maharani Laillyza Apriasari

    2010-06-01

    Full Text Available Background: Erythema multiforme is an acute mucocutaneus disease which is caused by the hypersensitivity reaction. It is characterized by target lesions on the skin or ulcerative oral lesion. Etiology of the disease is unknown, it is currently considered as immunologic disease. The triggering factors is the use of certain type of drugs like antibiotics, anticonvulsant, and NSAID. Most of the dentists do not know about it is mechanism, so a lot of people consider it as a malpractice. Purpose: This paper reported a case of a man, 46 years old which had ulcerative oral mucous, peeled and pain lips after taking carbamazepine drugs. Case: The clinical diagnosis of this case was erythema multiforme because of the hypersensitivity reaction as the result of taking carbamazepine. Case management: The final diagnosis based on anamnesis history of taking systemic drugs and clinical manifestation of erythema multiforme in the oral cavity. The drugs therapy that had been given were antihistamine, oral corticosteroid, gargle liquid contained of topical anesthetic, corticosteroid, and antibiotic. Conclusion: In this case, it can be concluded that erythema multiforme appeared was triggered by taking carbamazepine as the drug of choice for trigeminal neuralgia therapy. These drugs can cause type III hypersensitivity reaction. The final diagnosis based on anamnesis history of taking carbamazepine before lesions erupted and the characterized clinical manifestation.Latar belakang: Erythema multiforme adalah penyakit mukokutaneus akut yang menyerang kulit dan mukosa sebagai akibat dari reaksi hipersensitivitas. Secara karakteristik ditandai oleh lesi target pada kulit atau lesi ulserasi pada mukosa rongga mulut. Etiologi penyakit ini belum jelas, diduga karena adanya reaksi imunologi. Pencetusnya dikarenakan adanya pemakaian obat-obatan tertentu seperti antibiotik, antikonvulsan dan NSAID. Banyak dokter gigi kurang memahami mekanisme timbulnya penyakit ini, sehingga

  9. Effects of single or combined treatments with radiation and chemotherapy on survival and danger signals expression in glioblastoma cell lines.

    Science.gov (United States)

    Pasi, Francesca; Paolini, Alessandro; Nano, Rosanna; Di Liberto, Riccardo; Capelli, Enrica

    2014-01-01

    The success of chemo- and radiotherapy in glioblastoma multiforme, the most common and lethal primary brain tumour, could rely on the induction of immunogenic tumour cell death and on the induction of anticancer immune response. In this study we investigated cell survival to single treatments or combination of X-rays and temozolomide in glioblastoma cell lines (T98G and U251MG) and we attempted to identify danger signals (HMGB1 and HSP70) released by dying cells in the microenvironment that could activate antitumour immunity contributing to the therapeutic efficacy of conventional treatments. Our data suggest that HSP70 translocates from cytoplasm to extracellular environment after an increase in radiation dose and HMGB1 translocates from the nucleus to the cytoplasm and subsequently is released into the extracellular space, confirming a role of these proteins as signals released after radiation-induced damage in glioblastoma cells. We also could state that TMZ had limited effectiveness in activating HMGB1 and HSP70 signalling and, instead, an adjuvant effect was observed in some combined treatments, depending on schedule, cell line, and timing. A big challenge in tumour therapy is, therefore, to identify the most beneficial combination and chronology of multiple treatment options to contribute to the improvement of the therapeutic outcome.

  10. Presbycusis and auditory brainstem responses: a review

    Directory of Open Access Journals (Sweden)

    Shilpa Khullar

    2011-06-01

    Full Text Available Age-related hearing loss or presbycusis is a complex phenomenon consisting of elevation of hearing levels as well as changes in the auditory processing. It is commonly classified into four categories depending on the cause. Auditory brainstem responses (ABRs are a type of early evoked potentials recorded within the first 10 ms of stimulation. They represent the synchronized activity of the auditory nerve and the brainstem. Some of the changes that occur in the aging auditory system may significantly influence the interpretation of the ABRs in comparison with the ABRs of the young adults. The waves of ABRs are described in terms of amplitude, latencies and interpeak latency of the different waves. There is a tendency of the amplitude to decrease and the absolute latencies to increase with advancing age but these trends are not always clear due to increase in threshold with advancing age that act a major confounding factor in the interpretation of ABRs.

  11. A generative model for segmentation of tumor and organs-at-risk for radiation therapy planning of glioblastoma patients

    Science.gov (United States)

    Agn, Mikael; Law, Ian; Munck af Rosenschöld, Per; Van Leemput, Koen

    2016-03-01

    We present a fully automated generative method for simultaneous brain tumor and organs-at-risk segmentation in multi-modal magnetic resonance images. The method combines an existing whole-brain segmentation technique with a spatial tumor prior, which uses convolutional restricted Boltzmann machines to model tumor shape. The method is not tuned to any specific imaging protocol and can simultaneously segment the gross tumor volume, peritumoral edema and healthy tissue structures relevant for radiotherapy planning. We validate the method on a manually delineated clinical data set of glioblastoma patients by comparing segmentations of gross tumor volume, brainstem and hippocampus. The preliminary results demonstrate the feasibility of the method.

  12. Glioblastoma-Initiating Cells: Relationship with Neural Stem Cells and the Micro-Environment

    Energy Technology Data Exchange (ETDEWEB)

    Goffart, Nicolas [Laboratory of Developmental Neurobiology, GIGA-Neurosciences Research Center, University of Liège, Liège 4000 (Belgium); Kroonen, Jérôme [Human Genetics, CHU and University of Liège, Liège 4000 (Belgium); The T& P Bohnenn Laboratory for Neuro-Oncology, Department of Neurology and Neurosurgery, UMC Utrecht, Utrecht 3556 (Netherlands); Rogister, Bernard, E-mail: Bernard.Register@ulg.ac.be [Laboratory of Developmental Neurobiology, GIGA-Neurosciences Research Center, University of Liège, Liège 4000 (Belgium); Department of Neurology, CHU and University of Liège, Liège 4000 (Belgium); GIGA-Development, Stem Cells and Regenerative Medicine, University of Liège, Liège 4000 (Belgium)

    2013-08-14

    Glioblastoma multiforme (GBM, WHO grade IV) is the most common and lethal subtype of primary brain tumor with a median overall survival of 15 months from the time of diagnosis. The presence in GBM of a cancer population displaying neural stem cell (NSC) properties as well as tumor-initiating abilities and resistance to current therapies suggests that these glioblastoma-initiating cells (GICs) play a central role in tumor development and are closely related to NSCs. However, it is nowadays still unclear whether GICs derive from NSCs, neural progenitor cells or differentiated cells such as astrocytes or oligodendrocytes. On the other hand, NSCs are located in specific regions of the adult brain called neurogenic niches that have been shown to control critical stem cell properties, to nourish NSCs and to support their self-renewal. This “seed-and-soil” relationship has also been adapted to cancer stem cell research as GICs also require a specific micro-environment to maintain their “stem cell” properties. In this review, we will discuss the controversies surrounding the origin and the identification of GBM stem cells and highlight the micro-environment impact on their biology.

  13. Post-mortem studies in glioblastoma patients treated with thermotherapy using magnetic nanoparticles.

    Science.gov (United States)

    van Landeghem, Frank K H; Maier-Hauff, K; Jordan, A; Hoffmann, Karl-Titus; Gneveckow, U; Scholz, R; Thiesen, B; Brück, W; von Deimling, A

    2009-01-01

    Patients with glioblastoma multiforme (GBM), the most common primary brain tumor in adults, have still a poor prognosis though new strategies of radio- and chemotherapy have been developed. Recently, our group demonstrated the feasibility, tolerability and anti-tumoral effects of a newly developed therapeutic approach, termed thermotherapy using magnetic nanoparticles or magnetic fluid hyperthermia (MFH), in a murine model of malignant glioma. Currently, the efficacy of MFH is being evaluated in a phase II study. Here, we report on post-mortem neuropathological findings of patients with GBM receiving MFH. In brain autopsies the installed magnetic nanoparticles were dispersed or distributed as aggregates within geographic tumor necroses, restricted in distribution to the sites of instillation. Therefore, our results underscore the need for multiple trajectories of instillation. The typical GBM necrosis with pseudopalisading was free of particles. Dispersed particles and particle aggregates were phagocytosed mainly by macrophages whereas glioblastoma cells showed an uptake to a minor extent. MFH therapy further promotes uptake of nanoparticles in macrophages, likely as a consequence of tumor inherent and therapy induced formation of necrosis with subsequent infiltration and activation of phagocytes. We did not observe bystander effects of MFH such as sarcomatous tumour formation, formation of a sterile abscess or foreign body giant cell reaction. Furthermore, all patients did not present any clinical symptoms related to possible adverse effects of MFH.

  14. Pediatric giant cell glioblastoma: New insights into a rare tumor entity.

    Science.gov (United States)

    Karremann, Michael; Butenhoff, Sandra; Rausche, Ulrike; Pietsch, Torsten; Wolff, Johannes E A; Kramm, Christof M

    2009-06-01

    Little is known about giant cell glioblastoma (GCG) in pediatric patients. The present study identified 18 pediatric patients with centrally reviewed GCG from the HIT-GBM database of the Gesellschaft für Paediatrische Onkologie und Haematologie in Germany, Austria, and Switzerland. Clinical and epidemiological data were compared with those of 178 pediatric patients with centrally reviewed glioblastoma multiforme (GBM) from the same database. In this unique series, median age, male preference, and median clinical history did not differ significantly between pediatric GCG and GBM patients. GCG showed a stronger predilection for cerebral hemispheres than did GBM, which may only partly explain the higher percentage of gross total tumor resections in GCG patients. Most surprising, the widely distributed hypothesis that GCG may imply a better prognosis than GBM could not be substantiated for our pediatric series. Future studies with larger patient numbers and molecular pathological analyses are still needed to corroborate the present findings and further elucidate the biology of GCG in children.

  15. Glioblastoma-Initiating Cells: Relationship with Neural Stem Cells and the Micro-Environment

    Directory of Open Access Journals (Sweden)

    Nicolas Goffart

    2013-08-01

    Full Text Available Glioblastoma multiforme (GBM, WHO grade IV is the most common and lethal subtype of primary brain tumor with a median overall survival of 15 months from the time of diagnosis. The presence in GBM of a cancer population displaying neural stem cell (NSC properties as well as tumor-initiating abilities and resistance to current therapies suggests that these glioblastoma-initiating cells (GICs play a central role in tumor development and are closely related to NSCs. However, it is nowadays still unclear whether GICs derive from NSCs, neural progenitor cells or differentiated cells such as astrocytes or oligodendrocytes. On the other hand, NSCs are located in specific regions of the adult brain called neurogenic niches that have been shown to control critical stem cell properties, to nourish NSCs and to support their self-renewal. This “seed-and-soil” relationship has also been adapted to cancer stem cell research as GICs also require a specific micro-environment to maintain their “stem cell” properties. In this review, we will discuss the controversies surrounding the origin and the identification of GBM stem cells and highlight the micro-environment impact on their biology.

  16. Effects of Caffeine on Auditory Brainstem Response

    Directory of Open Access Journals (Sweden)

    Saleheh Soleimanian

    2008-06-01

    Full Text Available Background and Aim: Blocking of the adenosine receptor in central nervous system by caffeine can lead to increasing the level of neurotransmitters like glutamate. As the adenosine receptors are present in almost all brain areas like central auditory pathway, it seems caffeine can change conduction in this way. The purpose of this study was to evaluate the effects of caffeine on latency and amplitude of auditory brainstem response(ABR.Materials and Methods: In this clinical trial study 43 normal 18-25 years old male students were participated. The subjects consumed 0, 2 and 3 mg/kg BW caffeine in three different sessions. Auditory brainstem responses were recorded before and 30 minute after caffeine consumption. The results were analyzed by Friedman and Wilcoxone test to assess the effects of caffeine on auditory brainstem response.Results: Compared to control group the latencies of waves III,V and I-V interpeak interval of the cases decreased significantly after 2 and 3mg/kg BW caffeine consumption. Wave I latency significantly decreased after 3mg/kg BW caffeine consumption(p<0.01. Conclusion: Increasing of the glutamate level resulted from the adenosine receptor blocking brings about changes in conduction in the central auditory pathway.

  17. Bacterial Carriers for Glioblastoma Therapy

    Directory of Open Access Journals (Sweden)

    Nalini Mehta

    2017-03-01

    Full Text Available Treatment of aggressive glioblastoma brain tumors is challenging, largely due to diffusion barriers preventing efficient drug dosing to tumors. To overcome these barriers, bacterial carriers that are actively motile and programmed to migrate and localize to tumor zones were designed. These carriers can induce apoptosis via hypoxia-controlled expression of a tumor suppressor protein p53 and a pro-apoptotic drug, Azurin. In a xenograft model of human glioblastoma in rats, bacterial carrier therapy conferred a significant survival benefit with 19% overall long-term survival of >100 days in treated animals relative to a median survival of 26 days in control untreated animals. Histological and proteomic analyses were performed to elucidate the safety and efficacy of these carriers, showing an absence of systemic toxicity and a restored neural environment in treated responders. In the treated non-responders, proteomic analysis revealed competing mechanisms of pro-apoptotic and drug-resistant activity. This bacterial carrier opens a versatile avenue to overcome diffusion barriers in glioblastoma by virtue of its active motility in extracellular space and can lead to tailored therapies via tumor-specific expression of tumoricidal proteins.

  18. Subacute Sclerosing Panencephalitis of the Brainstem as a Clinical Entity.

    Science.gov (United States)

    Upadhyayula, Pavan S; Yang, Jason; Yue, John K; Ciacci, Joseph D

    2017-11-07

    Subacute sclerosing panencephalitis (SSPE) is a rare progressive neurological disorder of early adolescence caused by persistent infection of the measles virus, which remains prevalent worldwide despite an effective vaccine. SSPE is a devastating disease with a characteristic clinical course in subcortical white matter; however, atypical presentations of brainstem involvement may be seen in rare cases. This review summarizes reports to date on brainstem involvement in SSPE, including the clinical course of disease, neuroimaging presentations, and guidelines for treatment. A comprehensive literature search was performed for English-language publications with keywords "subacute sclerosing panencephalitis" and "brainstem" using the National Library of Medicine PubMed database (March 1981-September 2017). Eleven articles focusing on SSPE of the brainstem were included. Predominant brainstem involvement remains uncharacteristic of SSPE, which may lead to misdiagnosis and poor outcome. A number of case reports have demonstrated brainstem involvement associated with other intracranial lesions commonly presenting in later SSPE stages (III and IV). However, brainstem lesions can appear in all stages, independent of higher cortical structures. The varied clinical presentations complicate diagnosis from a neuroimaging perspective. SSPE of the brainstem is a rare but important clinical entity. It may present like canonical SSPE or with unique clinical features such as absence seizures and pronounced ataxia. While SSPE generally progresses to the brainstem, it can also begin with a primary focus of infection in the brainstem. Awareness of varied SSPE presentations can aid in early diagnosis as well as guide management and treatment.

  19. Genetic profile of the giant cell glioblastoma.

    Science.gov (United States)

    Peraud, A; Watanabe, K; Schwechheimer, K; Yonekawa, Y; Kleihues, P; Ohgaki, H

    1999-02-01

    Giant cell glioblastoma is a rare glioblastoma variant characterized by the presence of large, bizarre, multinucleated giant cells. This glioblastoma subtype develops clinically de novo after a short clinical history and contains a high frequency of p53 mutations. In this study, we screened a series of 18 giant cell glioblastomas for additional genetic alterations. PCR-SSCP followed by DNA sequencing revealed PTEN mutations in 5 of 15 tumors (33%). Of these, two mutations were located in exon 5, two mutations in exon 6, and one mutation each in exons 1 and 9. Four mutations were point mutations and two mutations were deletions. One neoplasm contained two PTEN mutations (exons 5 and 6). None of the giant cell glioblastomas showed a homozygous deletion of PTEN orp16, or amplification of MDM2. Immunohistochemically, MDM2 overexpression was either not observed or detected in only a minor fraction of tumor cells. Differential PCR revealed EGFR amplification in only one of 17 tumors (6%). These results indicate that giant cell glioblastomas occupy a hybrid position, sharing with primary (de novo) glioblastomas a short clinical history, the absence of a less malignant precursor lesion and a 30% frequency of PTEN mutations. With secondary glioblastomas that develop through progression from low-grade astrocytomas, they have in common a younger patient age at manifestation and a high frequency (>70%) of p53 mutations.

  20. Inhibition of glioblastoma malignancy by Lgl1.

    Science.gov (United States)

    Gont, Alexander; Hanson, Jennifer E L; Lavictoire, Sylvie J; Daneshmand, Manijeh; Nicholas, Garth; Woulfe, John; Kassam, Amin; Da Silva, Vasco F; Lorimer, Ian A J

    2014-11-30

    lethal giant larvae (lgl) was first identified as a tumor suppressor in Drosophila, where its loss repressed the differentiation and promoted the invasion of neuroblasts, the Drosophila equivalent of the neural stem cell. Recently we have shown that a human homolog of Lgl, Lgl1 (LLGL1), is constitutively phosphorylated and inactivated in glioblastoma cells; this occurs as a downstream consequence of PTEN loss, one of the most frequent genetic events in glioblastoma. Here we have investigated the consequences of this loss of functional Lgl1 in glioblastoma in vivo. We used a doxycycline-inducible system to express a non-phosphorylatable, constitutively active version of Lgl1 (Lgl3SA) in either a glioblastoma cell line or primary glioblastoma cells isolated under neural stem cell culture conditions from patients. In both types of cells, expression of Lgl3SA, but not wild type Lgl1, inhibited cell motility in vitro. Induction of Lgl3SA in intracerebral xenografts markedly reduced the in vivo invasion of primary glioblastoma cells. Lgl3SA expression also induced the differentiation of glioblastoma cells in vitro and in vivo along the neuronal lineage. Thus the central features of Lgl function as a tumor suppressor in Drosophila are conserved in human glioblastoma.

  1. Utility of Glioblastoma Patient-Derived Orthotopic Xenografts in Drug Discovery and Personalized Therapy.

    Science.gov (United States)

    Patrizii, Michele; Bartucci, Monica; Pine, Sharon R; Sabaawy, Hatem E

    2018-01-01

    Despite substantial effort and resources dedicated to drug discovery and development, new anticancer agents often fail in clinical trials. Among many reasons, the lack of reliable predictive preclinical cancer models is a fundamental one. For decades, immortalized cancer cell cultures have been used to lay the groundwork for cancer biology and the quest for therapeutic responses. However, cell lines do not usually recapitulate cancer heterogeneity or reveal therapeutic resistance cues. With the rapidly evolving exploration of cancer "omics," the scientific community is increasingly investigating whether the employment of short-term patient-derived tumor cell cultures (two- and three-dimensional) and/or patient-derived xenograft models might provide a more representative delineation of the cancer core and its therapeutic response. Patient-derived cancer models allow the integration of genomic with drug sensitivity data on a personalized basis and currently represent the ultimate approach for preclinical drug development and biomarker discovery. The proper use of these patient-derived cancer models might soon influence clinical outcomes and allow the implementation of tailored personalized therapy. When assessing drug efficacy for the treatment of glioblastoma multiforme (GBM), currently, the most reliable models are generated through direct injection of patient-derived cells or more frequently the isolation of glioblastoma cells endowed with stem-like features and orthotopically injecting these cells into the cerebrum of immunodeficient mice. Herein, we present the key strengths, weaknesses, and potential applications of cell- and animal-based models of GBM, highlighting our experience with the glioblastoma stem-like patient cell-derived xenograft model and its utility in drug discovery.

  2. Unsupervised deep learning reveals prognostically relevant subtypes of glioblastoma.

    Science.gov (United States)

    Young, Jonathan D; Cai, Chunhui; Lu, Xinghua

    2017-10-03

    One approach to improving the personalized treatment of cancer is to understand the cellular signaling transduction pathways that cause cancer at the level of the individual patient. In this study, we used unsupervised deep learning to learn the hierarchical structure within cancer gene expression data. Deep learning is a group of machine learning algorithms that use multiple layers of hidden units to capture hierarchically related, alternative representations of the input data. We hypothesize that this hierarchical structure learned by deep learning will be related to the cellular signaling system. Robust deep learning model selection identified a network architecture that is biologically plausible. Our model selection results indicated that the 1st hidden layer of our deep learning model should contain about 1300 hidden units to most effectively capture the covariance structure of the input data. This agrees with the estimated number of human transcription factors, which is approximately 1400. This result lends support to our hypothesis that the 1st hidden layer of a deep learning model trained on gene expression data may represent signals related to transcription factor activation. Using the 3rd hidden layer representation of each tumor as learned by our unsupervised deep learning model, we performed consensus clustering on all tumor samples-leading to the discovery of clusters of glioblastoma multiforme with differential survival. One of these clusters contained all of the glioblastoma samples with G-CIMP, a known methylation phenotype driven by the IDH1 mutation and associated with favorable prognosis, suggesting that the hidden units in the 3rd hidden layer representations captured a methylation signal without explicitly using methylation data as input. We also found differentially expressed genes and well-known mutations (NF1, IDH1, EGFR) that were uniquely correlated with each of these clusters. Exploring these unique genes and mutations will allow us to

  3. Erythema multiforme following polymorphic light eruption: a report of two cases.

    Science.gov (United States)

    Fraser-Andrews, E A; Morris-Jones, R; Novakovic, L; Hawk, J L M

    2005-05-01

    We report two patients in whom episodes of polymorphic light eruption were followed by recurrent erythema multiforme on exposed and nonexposed sites. Treating the polymorphic light eruption with prophylactic PUVA and/or oral prednisolone or cyclosporin prevented the development of erythema multiforme, suggesting that the two events are related. It is possible that erythema multiforme develops as a response to the same causative antigen as polymorphic light eruption.

  4. Oral erythema multiforme: Laboratory findings in monitoring Herpes simplex virus involvement (A case report)

    OpenAIRE

    Maria Leny Raiyon; Gus Permana Subita

    2008-01-01

    Erythema Multiforme is polymorphous recurrent eruptions on the skin and oral mucosa. This case is describing a progression of a case of Erythema Multiforme in the oral mucosa of a 33-year-old man suggesting of herpes viral involvement. In the absence of identified inducing drugs, past medical history of clinical manifestation on Herpes Simplex Viral (HSV) but positive serum antibody against HSV-1 is suggesting of Herpes Associated Erythema Multiforme. This became the basis of the patient mana...

  5. Subacute Sclerosing Panencephalitis of the Brainstem as a Clinical Entity

    Directory of Open Access Journals (Sweden)

    Pavan S. Upadhyayula

    2017-11-01

    Full Text Available Subacute sclerosing panencephalitis (SSPE is a rare progressive neurological disorder of early adolescence caused by persistent infection of the measles virus, which remains prevalent worldwide despite an effective vaccine. SSPE is a devastating disease with a characteristic clinical course in subcortical white matter; however, atypical presentations of brainstem involvement may be seen in rare cases. This review summarizes reports to date on brainstem involvement in SSPE, including the clinical course of disease, neuroimaging presentations, and guidelines for treatment. A comprehensive literature search was performed for English-language publications with keywords “subacute sclerosing panencephalitis” and “brainstem” using the National Library of Medicine PubMed database (March 1981–September 2017. Eleven articles focusing on SSPE of the brainstem were included. Predominant brainstem involvement remains uncharacteristic of SSPE, which may lead to misdiagnosis and poor outcome. A number of case reports have demonstrated brainstem involvement associated with other intracranial lesions commonly presenting in later SSPE stages (III and IV. However, brainstem lesions can appear in all stages, independent of higher cortical structures. The varied clinical presentations complicate diagnosis from a neuroimaging perspective. SSPE of the brainstem is a rare but important clinical entity. It may present like canonical SSPE or with unique clinical features such as absence seizures and pronounced ataxia. While SSPE generally progresses to the brainstem, it can also begin with a primary focus of infection in the brainstem. Awareness of varied SSPE presentations can aid in early diagnosis as well as guide management and treatment.

  6. A CASE OF ERYTHEMA EXUDATIVUM MULTIFORME - IDIOPATHIC FORM - TREATMENT PROBLEMS

    Directory of Open Access Journals (Sweden)

    Asya Krasteva

    2010-12-01

    Full Text Available An idiopathic form of erythema exudativum multiforme, characterized by atypical localization and lack of skin manifestation at the moment of the clinical exam, was found. It was diagnosed rather late, after two biopsies of the skin and one of the oral lesion. The authors would like to accentuate the problems of treatment of idiopаthic forms their search for new solutions

  7. An unusual presentation of erythema multiforme in a paediatric patient.

    Science.gov (United States)

    BaniHani, A; Nazzal, H; Webb, L; Toumba, K J; Fabbroni, G

    2015-06-01

    Erythema multiforme (EM) is an acute, vesiculobullous disease of skin and mucous membranes with symptoms ranging from mild to severe. A complex interaction of different factors has been implicated the condition; the majority with a preceding herpes simplex infection. This report describes an unusual presentation of erythema multiforme affecting the lips and oral mucosa of a healthy 7-year-old boy in the form of lip adherence. Two weeks following eruption of oral ulcerations, a 7-year-old healthy boy developed severe erosive ulceration of both lips, causing complete lip adherence. This was accompanied by marked bilateral submandibular and cervical lymphadenopathy, tremor and sweating. Clinical and laboratory investigations led to a diagnosis of erythema multiforme. The patient was treated initially with gentle application of Vaseline between the lips using cotton buds in an attempt to release lip adhesion, followed by surgical release of the lips under general anaesthesia. Analgesics and topical steroid mouthwash were provided. Seven months later, the patient presented with a recurrence of his EM which included lesions on the skin. The patient was treated with antivirals, topical and systematic steroids to suppress the recurrent attacks of EM. Eighteen months following the initial presentation the patient and parent reported considerable decrease in the frequency, severity and duration of the occurrence of intra-oral ulcers, with no major episode of target lesions on the skin. Erythema multiforme is rare in children, however it should be considered in the differential diagnosis of recurrent erosive oral ulcerative lesions especially when the oral lesions resemble those of primary herpetic gingivostomatitis.

  8. Recurrent erythema multiforme with arthritis – A rare association

    Directory of Open Access Journals (Sweden)

    Yasmeen Jabeen Bhat

    2017-04-01

    Full Text Available Erythema multiforme (EM is an acute, immune-mediated, self-limiting mucocutaneous condition characterized by distinctive target lesions. The etiology is diverse and numerous diseases have been associated with EM. However, arthritis has been rarely reported with it. We report a rare association between EM, localized mainly over the joints, and polyarthritis in a male patient, who responded successfully to oral acyclovir.

  9. Prognostication of Survival Outcomes in Patients Diagnosed with Glioblastoma.

    Science.gov (United States)

    Nizamutdinov, Damir; Stock, Eileen M; Dandashi, Jad A; Vasquez, Eliana A; Mao, Ying; Dayawansa, Samantha; Zhang, Jun; Wu, Erxi; Fonkem, Ekokobe; Huang, Jason H

    2017-09-23

    Glioblastoma multiforme (GBM) is an aggressive primary brain tumor with dismal survival. This study aims to examine the prognostic value of primary tumor sites and race on survival outcomes. Patient data obtained from the Scott and White Hospital Brain Tumor Registry (1976-2013) were stratified according to sex, age, race, primary tumor site, vital status, and survival. Of the 645 patients, 580 (89.9%) were diagnosed with GBM not otherwise specified (GBM NOS), 57 (8.8%) with GBM, and 8 (1.2%) with giant-cell GBM. Most were male (53.5%), aged 50 years or older (78.7%). The white population had the highest GBM prevalence (87.1%) and the lowest overall survival versus all other race groups (6.6% vs. 30.1%; P < 0.01). The black population had a relatively low prevalence of GBM (5.9%) and the greatest overall survival versus all others (47.4% vs. 7.3%; P < 0.01). Primary tumor sites located in the temporal (25.8% vs. 20.2%; P = 0.03), occipital (8.1% vs. 2.9%; P = 0.05), and parietal lobes (24.2% vs. 20.8%; P = 0.05) had a greater occurrence in surviving individuals. The overall survival for men versus women was (62.9% vs. 37.1%; P = 0.12). Black racial background and temporal, occipital, or parietal primary tumor sites are suggestive of positive survival outcomes. Conversely, white racial background with primary tumor sites in the brain overlapping and NOS areas seem to be associated with negative outcomes and decreased survival. Thus, racial background and primary tumor site may be useful prognostic factors in patients with GBM. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  10. Cytoplasmic TRADD Confers a Worse Prognosis in Glioblastoma

    Directory of Open Access Journals (Sweden)

    Sharmistha Chakraborty

    2013-08-01

    Full Text Available Tumor necrosis factor receptor 1 (TNFR1-associated death domain protein (TRADD is an important adaptor in TNFR1 signaling and has an essential role in nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB activation and survival signaling. Increased expression of TRADD is sufficient to activate NF-κB. Recent studies have highlighted the importance of NF-κB activation as a key pathogenic mechanism in glioblastoma multiforme (GBM, the most common primary malignant brain tumor in adults.We examined the expression of TRADD by immunohistochemistry (IHC and find that TRADD is commonly expressed at high levels in GBM and is detected in both cytoplasmic and nuclear distribution. Cytoplasmic IHC TRADD scoring is significantly associated with worse progression-free survival (PFS both in univariate and multivariate analysis but is not associated with overall survival (n = 43 GBMs. PFS is a marker for responsiveness to treatment. We propose that TRADD-mediated NF-κB activation confers chemoresistance and thus a worse PFS in GBM. Consistent with the effect on PFS, silencing TRADD in glioma cells results in decreased NF-κB activity, decreased proliferation of cells, and increased sensitivity to temozolomide. TRADD expression is common in glioma-initiating cells. Importantly, silencing TRADD in GBM-initiating stem cell cultures results in decreased viability of stem cells, suggesting that TRADD may be required for maintenance of GBM stem cell populations. Thus, our study suggests that increased expression of cytoplasmic TRADD is both an important biomarker and a key driver of NF-κB activation in GBM and supports an oncogenic role for TRADD in GBM.

  11. High Dose Hyperfractionated Radiotherapy for Adults with Glioblastomas

    Energy Technology Data Exchange (ETDEWEB)

    Koukourakis, Michael; Scarlatos, John; Yiannakakis, Dimitrios [Hellenic Cancer Institute, Saint Savvas Hospital, Department of Radiation Oncology, 171 Leoforos Alexandras, Athens (Greece); Kordiolis, Nicolas [Department of Neurosurgery, 171 Leoforos Alexandras, Athens (Greece); Zambatis, Haralambos; Sotiropoulou, Anastasia [Hellenic Cancer Institute, Saint Savvas Hospital, Department of Radiation Oncology, 171 Leoforos Alexandras, Athens (Greece)

    2015-01-15

    From 1989 to 1991, 27 patients with glioblastoma multiforme or anaplastic astrocytoma of the brain were treated with radiotherapy. Fifteen of twenty-seven patients were treated through limited volume fields, with a thrice-a-day (1.1 Gy/f) or twice-a-day (1.4 Gy/f) hyperfractionated regimen to a total physical dose of 62–92 Gy (median dose 76 Gy). The remaining 12 were treated with whole brain irradiation (40 Gy of total conventionally fractionated dose) and a localised boost to a total dose of 60 Gy. The hyperfractionated regimen was well tolerated and there was no sign of increased brain oedema to indicate the insertion of a split. Of six patients who received a NTD10 (normalised total dose for α/β =10) higher than 71 Gy, five showed CR (83% CR rate) versus three of 21 patients who received a lower NTD10 (14% CR rate). For 13 patients who received a NTD10 higher than 66 Gy, the 18-months survival was 61% (8/13) versus 28% (4/14) for 14 patients who received a NTD10 less than 66 Gy. As far as the late morbidity is concerned, of six patients treated with 76-92 Gy of physical dose, none died because of radiation-induced brain necrosis within 18-42 months of follow-up, and three of them are without evidence of disease 18-31 months after the end of radiation treatment. None of our 15 patients who received less than whole brain irradiation relapsed outside the radiation portals. The present study strongly suggests the use of limited volume hyperfractionated radiotherapy schemes, so as to increase the local tumor dose (NTD10) to values higher than 79 Gy, at the same time keeping the NTD2 (NTD for α/β = 2) below 68 Gy.

  12. A reproducible brain tumour model established from human glioblastoma biopsies

    Directory of Open Access Journals (Sweden)

    Li Xingang

    2009-12-01

    Full Text Available Abstract Background Establishing clinically relevant animal models of glioblastoma multiforme (GBM remains a challenge, and many commonly used cell line-based models do not recapitulate the invasive growth patterns of patient GBMs. Previously, we have reported the formation of highly invasive tumour xenografts in nude rats from human GBMs. However, implementing tumour models based on primary tissue requires that these models can be sufficiently standardised with consistently high take rates. Methods In this work, we collected data on growth kinetics from a material of 29 biopsies xenografted in nude rats, and characterised this model with an emphasis on neuropathological and radiological features. Results The tumour take rate for xenografted GBM biopsies were 96% and remained close to 100% at subsequent passages in vivo, whereas only one of four lower grade tumours engrafted. Average time from transplantation to the onset of symptoms was 125 days ± 11.5 SEM. Histologically, the primary xenografts recapitulated the invasive features of the parent tumours while endothelial cell proliferations and necrosis were mostly absent. After 4-5 in vivo passages, the tumours became more vascular with necrotic areas, but also appeared more circumscribed. MRI typically revealed changes related to tumour growth, several months prior to the onset of symptoms. Conclusions In vivo passaging of patient GBM biopsies produced tumours representative of the patient tumours, with high take rates and a reproducible disease course. The model provides combinations of angiogenic and invasive phenotypes and represents a good alternative to in vitro propagated cell lines for dissecting mechanisms of brain tumour progression.

  13. Vesicular Contact Reaction May Progress into Erythema Multiforme.

    Science.gov (United States)

    Czarnecka-Operacz, Magdalena; Jenerowicz, Dorota; Szulczyńska-Gabor, Joanna; Teresiak-Mikołajczak, Ewa; Szyfter-Harris, Joanna; Bowszyc-Dmochowska, Monika

    2016-12-01

    Dear Editor, Erythema multiforme is considered an acute skin condition, characterized by a self-limiting and sometimes recurrent course. It is regarded as a type IV hypersensitivity reaction associated with certain infections, medications, and other various triggers. Allergic contact dermatitis is in turn a delayed type of induced allergy as a result of cutaneous contact with a specific allergen to which the patient develops specific sensitivity. This type of cutaneous reaction is associated with inflammation manifesting with erythema, edema, and vesicles. A 27-year old female patient presented with a 3-day history of erythematous and vesicular lesions which developed 24 hours after cesarean section. Initially the lesions were localized in the area of surgery (mainly the abdomen and upper thighs) and on the next day progressed to the buttocks and lumbar area. The patient was referred to the Outpatient Clinic and was treated with antihistamines, but her dermatological state deteriorated rapidly. At the day of admission to the Department of Dermatology, numerous erythematous and vesicular lesions were present on the skin of the abdomen, thighs, and back (Figure 1, a), but the skin of the neck, chest, and extremities was also covered with erythematous and edematous patches. On the second day of hospitalization, we observed the evolution of lesions localized within the chest and extremities into an erythema multiforme-like targetoid eruption (Figure 1, b). Initially the patient was treated with intravenous injections of dexamethasone and ceftriaxone and orally with second-generation antihistamines (in four-fold doses), followed by intravenous metyloprednisolone pulse-therapy (total dose of 3 g). As the new vesicobullous lesions started to appear on the face and arms, we introduced cyclosporine A orally 400 mg daily. We could then observe gradual remission, but on the seventh day of hospitalization the patient developed a massive labial herpes simplex infection and had

  14. Integrated Genomic Analysis Identifies Clinically Relevant Subtypes of Glioblastoma Characterized by Abnormalities in PDGFRA, IDH1, EGFR, and NF1

    Energy Technology Data Exchange (ETDEWEB)

    Verhaak, Roel GW; Hoadley, Katherine A; Purdom, Elizabeth; Wang, Victoria; Qi, Yuan; Wilkerson, Matthew D; Miller, C Ryan; Ding, Li; Golub, Todd; Mesirov, Jill P; Alexe, Gabriele; Lawrence, Michael; O' Kelly, Michael; Tamayo, Pablo; Weir, Barbara A; Gabriel, Stacey; Winckler, Wendy; Gupta, Supriya; Jakkula, Lakshmi; Feiler, Heidi S; Hodgson, J Graeme; James, C David; Sarkaria, Jann N; Brennan, Cameron; Kahn, Ari; Spellman, Paul T; Wilson, Richard K; Speed, Terence P; Gray, Joe W; Meyerson, Matthew; Getz, Gad; Perou, Charles M; Hayes, D Neil; Network, The Cancer Genome Atlas Research

    2009-09-03

    The Cancer Genome Atlas Network recently cataloged recurrent genomic abnormalities in glioblastoma multiforme (GBM). We describe a robust gene expression-based molecular classification of GBM into Proneural, Neural, Classical, and Mesenchymal subtypes and integrate multidimensional genomic data to establish patterns of somatic mutations and DNA copy number. Aberrations and gene expression of EGFR, NF1, and PDGFRA/IDH1 each define the Classical, Mesenchymal, and Proneural subtypes, respectively. Gene signatures of normal brain cell types show a strong relationship between subtypes and different neural lineages. Additionally, response to aggressive therapy differs by subtype, with the greatest benefit in the Classical subtype and no benefit in the Proneural subtype. We provide a framework that unifies transcriptomic and genomic dimensions for GBM molecular stratification with important implications for future studies.

  15. EGFR and EGFRvIII Promote Angiogenesis and Cell Invasion in Glioblastoma: Combination Therapies for an Effective Treatment

    Directory of Open Access Journals (Sweden)

    Stefanie Keller

    2017-06-01

    Full Text Available Epidermal growth factor receptor (EGFR and the mutant EGFRvIII are major focal points in current concepts of targeted cancer therapy for glioblastoma multiforme (GBM, the most malignant primary brain tumor. The receptors participate in the key processes of tumor cell invasion and tumor-related angiogenesis and their upregulation correlates with the poor prognosis of glioma patients. Glioma cell invasion and increased angiogenesis share mechanisms of the degradation of the extracellular matrix (ECM through upregulation of ECM-degrading proteases as well as the activation of aberrant signaling pathways. This review describes the role of EGFR and EGFRvIII in those mechanisms which might offer new combined therapeutic approaches targeting EGFR or EGFRvIII together with drug treatments against proteases of the ECM or downstream signaling to increase the inhibitory effects of mono-therapies.

  16. Neurodynamics, tonality, and the auditory brainstem response.

    Science.gov (United States)

    Large, Edward W; Almonte, Felix V

    2012-04-01

    Tonal relationships are foundational in music, providing the basis upon which musical structures, such as melodies, are constructed and perceived. A recent dynamic theory of musical tonality predicts that networks of auditory neurons resonate nonlinearly to musical stimuli. Nonlinear resonance leads to stability and attraction relationships among neural frequencies, and these neural dynamics give rise to the perception of relationships among tones that we collectively refer to as tonal cognition. Because this model describes the dynamics of neural populations, it makes specific predictions about human auditory neurophysiology. Here, we show how predictions about the auditory brainstem response (ABR) are derived from the model. To illustrate, we derive a prediction about population responses to musical intervals that has been observed in the human brainstem. Our modeled ABR shows qualitative agreement with important features of the human ABR. This provides a source of evidence that fundamental principles of auditory neurodynamics might underlie the perception of tonal relationships, and forces reevaluation of the role of learning and enculturation in tonal cognition. © 2012 New York Academy of Sciences.

  17. Brainstem projections to spinal motoneurons: an update.

    Science.gov (United States)

    Holstege, J C; Kuypers, H G

    1987-12-01

    1. The existence of direct projections to spinal motoneurons and interneurons from the raphe pallidus and obscurus, the adjoining ventral medial reticular formation and the locus coeruleus and subcoeruleus is now well substantiated by various anatomical techniques. 2. The spinal projections from the raphe nuclei and the adjoining medial reticular formation contain serotonergic and non-serotonergic fibres. These projections also contain various peptides, several of which are contained within the serotonergic fibres. Whether still other transmitter substances (e.g. acetylcholine) are present in the various descending brainstem projections to motoneurons remains to be determined. 3. The spinal projections from the locus coeruleus and subcoeruleus are mainly noradrenergic, but there also exists a non-noradrenergic spinal projection. 4. Pharmacological, physiological and behavioural studies indicate an overall facilitatory action of noradrenaline and serotonin (including several peptides) on motoneurons. This may lead to an enhanced susceptibility for excitatory inputs from other sources. 5. The brainstem areas in question receive an important projection from several components of the limbic system. This suggests that the emotional brain can exert a powerful influence on all regions of the spinal cord and may thus control both its sensory input and motor output.

  18. Speech Evoked Auditory Brainstem Response in Stuttering

    Directory of Open Access Journals (Sweden)

    Ali Akbar Tahaei

    2014-01-01

    Full Text Available Auditory processing deficits have been hypothesized as an underlying mechanism for stuttering. Previous studies have demonstrated abnormal responses in subjects with persistent developmental stuttering (PDS at the higher level of the central auditory system using speech stimuli. Recently, the potential usefulness of speech evoked auditory brainstem responses in central auditory processing disorders has been emphasized. The current study used the speech evoked ABR to investigate the hypothesis that subjects with PDS have specific auditory perceptual dysfunction. Objectives. To determine whether brainstem responses to speech stimuli differ between PDS subjects and normal fluent speakers. Methods. Twenty-five subjects with PDS participated in this study. The speech-ABRs were elicited by the 5-formant synthesized syllable/da/, with duration of 40 ms. Results. There were significant group differences for the onset and offset transient peaks. Subjects with PDS had longer latencies for the onset and offset peaks relative to the control group. Conclusions. Subjects with PDS showed a deficient neural timing in the early stages of the auditory pathway consistent with temporal processing deficits and their abnormal timing may underlie to their disfluency.

  19. Genetic Alterations in Gliosarcoma and Giant Cell Glioblastoma.

    Science.gov (United States)

    Oh, Ji Eun; Ohta, Takashi; Nonoguchi, Naosuke; Satomi, Kaishi; Capper, David; Pierscianek, Daniela; Sure, Ulrich; Vital, Anne; Paulus, Werner; Mittelbronn, Michel; Antonelli, Manila; Kleihues, Paul; Giangaspero, Felice; Ohgaki, Hiroko

    2016-07-01

    The majority of glioblastomas develop rapidly with a short clinical history (primary glioblastoma IDH wild-type), whereas secondary glioblastomas progress from diffuse astrocytoma or anaplastic astrocytoma. IDH mutations are the genetic hallmark of secondary glioblastomas. Gliosarcomas and giant cell glioblastomas are rare histological glioblastoma variants, which usually develop rapidly. We determined the genetic patterns of 36 gliosarcomas and 19 giant cell glioblastomas. IDH1 and IDH2 mutations were absent in all 36 gliosarcomas and in 18 of 19 giant cell glioblastomas analyzed, indicating that they are histological variants of primary glioblastoma. Furthermore, LOH 10q (88%) and TERT promoter mutations (83%) were frequent in gliosarcomas. Copy number profiling using the 450k methylome array in 5 gliosarcomas revealed CDKN2A homozygous deletion (3 cases), trisomy chromosome 7 (2 cases), and monosomy chromosome 10 (2 cases). Giant cell glioblastomas had LOH 10q in 50% and LOH 19q in 42% of cases. ATRX loss was detected immunohistochemically in 19% of giant cell glioblastomas, but absent in 17 gliosarcomas. These and previous results suggest that gliosarcomas are a variant of, and genetically similar to, primary glioblastomas, except for a lack of EGFR amplification, while giant cell glioblastoma occupies a hybrid position between primary and secondary glioblastomas. © 2015 International Society of Neuropathology.

  20. Morphometric study of the human brainstem and its neurovascular relations.

    Science.gov (United States)

    Szabo, Bianca Aurora; Pascalau, Raluca; Padurean, Vlad Adrian

    2017-10-02

    The brainstem is a very complex segment of the central nervous system because it has a high density of nuclei and tracts with vital functional roles. This explains the considerable difficulty of surgery for lesions located in or around the brainstem. Our paper aims to provide a concise description of the external configuration, its internal correspondence and the neurovascular relations of the brainstem with morphometric data that can be useful in surgical planning. The study was conducted on formalin fixed brainstem specimens, which were harvested with respect to the topographic anatomy. Macroscopic measurements were performed with a Vernier caliper. The anatomical structures on the ventral and dorsal aspects of the brainstem are described and illustrated schematically. Their dimensions are also graphically represented using the mean values. Serial axial sections through the brainstem demonstrate the internal correspondence of its external features. Then there are presented the apparent origins and the proximal diameters of the cranial nerves and the arteries of the posterior circulation as well as their anatomical relations. The external morphometry of the brainstem correlated with the position of the internal structures provides landmarks with aplicability in neurosurgery especially in the fields of intrinsic brainstem lesions, posterior fossa and fourth ventricle surgery.

  1. Giant cell glioblastoma and pleomorphic xanthoastrocytoma show different immunohistochemical profiles for neuronal antigens and p53 but share reactivity for class III beta-tubulin.

    Science.gov (United States)

    Martinez-Diaz, Hilda; Kleinschmidt-DeMasters, B K; Powell, Suzanne Z; Yachnis, Anthony T

    2003-09-01

    Giant cell glioblastoma multiforme (GCGBM) and pleomorphic xanthoastrocytoma (PXA) are clinically, radiographically, and histologically distinct tumors of the central nervous system. However, they share features of gross circumscription, reticulin deposition, lymphocytic infiltrates, and prominent populations of tumor giant cells. Neuronal antigens have been detected in the neoplastic cells of PXAs, but to our knowledge have not been studied previously in GCGBMs. While TP53 is mutated in most GCGBMs, a feature usually paralleled by strong immunostaining of the protein, the expression pattern of PXAs has not been extensively studied. To compare the immunoprofiles of GCGBM and PXA with regard to neuronal antigens and p53 and to evaluate the potential diagnostic utility of such a panel. Archival paraffin sections of 9 GCGBMs and 9 PXAs were immunostained for class III beta-tubulin, neuronal nuclear antigen, neurofilament protein, synaptophysin, glial fibrillary acidic protein, and p53. Giant cell glioblastomas were strongly immunoreactive for class III beta-tubulin and glial fibrillary acidic protein, but showed only rare staining for the other neuronal polypeptides. In contrast, PXAs usually showed at least focal staining of individual tumor cells for most of the neuronal antigens tested. Tubulin was strongly positive in tumor giant cells and in smaller neoplastic cells of both tumor types. Double-immunolabeling revealed distinct populations of tumor cells that expressed either glial fibrillary acidic protein or tubulin and dual-labeling of individual cells in GCGBM and PXA. Strong p53 staining was observed in many tumor cells in 5 of 8 GCGBMs tested, while staining for this antigen was negative or focally positive in 6 of 8 PXAs examined. Giant cell glioblastoma multiforme and PXA show distinct patterns of immunoreactivity for neuronal antigens and p53 that may be useful diagnostically in difficult cases or in limited samples. These results provide further evidence

  2. Clinical Approach to Supranuclear Brainstem Saccadic Gaze Palsies

    Directory of Open Access Journals (Sweden)

    Alexandra Lloyd-Smith Sequeira

    2017-08-01

    Full Text Available Failure of brainstem supranuclear centers for saccadic eye movements results in the clinical presence of a brainstem-mediated supranuclear saccadic gaze palsy (SGP, which is manifested as slowing of saccades with or without range of motion limitation of eye movements and as loss of quick phases of optokinetic nystagmus. Limitation in the range of motion of eye movements is typically worse with saccades than with smooth pursuit and is overcome with vestibular–ocular reflexive eye movements. The differential diagnosis of SGPs is broad, although acute-onset SGP is most often from brainstem infarction and chronic vertical SGP is most commonly caused by the neurodegenerative condition progressive supranuclear palsy. In this review, we discuss the brainstem anatomy and physiology of the brainstem saccade-generating network; we discuss the clinical features of SGPs, with an emphasis on insights from quantitative ocular motor recordings; and we consider the broad differential diagnosis of SGPs.

  3. Oral blistering - report of two cases of erythema multiforme & literature review.

    Science.gov (United States)

    Patil, Bharati; Hegde, Sushmini; Naik, Shobha; Sharma, Rakesh

    2013-09-01

    Erythema multiforme and related disorders comprise a group of mucocutaneous disorders that often compromise the quality of life. The clinical classification of these disorders is variable, thus making definitive diagnosis difficult. Early recognition and prompt management will benefit the patients. This article highlights two such cases of erythema multiforme with detailed literature review on etiopathogenesis, clinical features, and treatment.

  4. Oral Blistering - Report of Two Cases of Erythema Multiforme & Literature Review

    OpenAIRE

    Patil, Bharati; Hegde, Sushmini; Naik, Shobha; Sharma, Rakesh

    2013-01-01

    Erythema multiforme and related disorders comprise a group of mucocutaneous disorders that often compromise the quality of life. The clinical classification of these disorders is variable, thus making definitive diagnosis difficult. Early recognition and prompt management will benefit the patients. This article highlights two such cases of erythema multiforme with detailed literature review on etiopathogenesis, clinical features, and treatment.

  5. Erythema multiforme and persistent erythema as early cutaneous manifestations of Lyme disease

    NARCIS (Netherlands)

    Schuttelaar, M L; Laeijendecker, R; Heinhuis, R J; Van Joost, T

    1997-01-01

    We report two cases of borreliosis (Lyme disease) with unusual cutaneous manifestations, erythema multiforme, and persistent erythema. The lesions in both of our patients had distinctive histopathologic features. To our knowledge, this is the first report of erythema multiforme and persistent

  6. Recidiverende erythema multiforme udløst af herpes simplex-virus

    DEFF Research Database (Denmark)

    Vestergård Grejsen, Dorthe; Henningsen, Emil

    2012-01-01

    We describe two cases of recurrent erythema multiforme, both associated to infection with herpes simplex virus. The importance of subclinical herpes is illustrated. Antiviral and additional treatment is described.......We describe two cases of recurrent erythema multiforme, both associated to infection with herpes simplex virus. The importance of subclinical herpes is illustrated. Antiviral and additional treatment is described....

  7. MicroRNA involvement in glioblastoma pathogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Novakova, Jana [University Cell Immunotherapy Center, Faculty of Medicine, Masaryk University, Brno (Czech Republic); Department of Biochemistry, Faculty of Science, Masaryk University, Brno (Czech Republic); Slaby, Ondrej, E-mail: slaby@mou.cz [University Cell Immunotherapy Center, Faculty of Medicine, Masaryk University, Brno (Czech Republic); Masaryk Memorial Cancer Institute, Department of Laboratory Medicine, Zluty kopec 7, 656 53 Brno (Czech Republic); Vyzula, Rostislav [Masaryk Memorial Cancer Institute, Department of Comprehensive Cancer Care, Brno (Czech Republic); Michalek, Jaroslav [University Cell Immunotherapy Center, Faculty of Medicine, Masaryk University, Brno (Czech Republic)

    2009-08-14

    MicroRNAs are endogenously expressed regulatory noncoding RNAs. Altered expression levels of several microRNAs have been observed in glioblastomas. Functions and direct mRNA targets for these microRNAs have been relatively well studied over the last years. According to these data, it is now evident, that impairment of microRNA regulatory network is one of the key mechanisms in glioblastoma pathogenesis. MicroRNA deregulation is involved in processes such as cell proliferation, apoptosis, cell cycle regulation, invasion, glioma stem cell behavior, and angiogenesis. In this review, we summarize the current knowledge of miRNA functions in glioblastoma with an emphasis on its significance in glioblastoma oncogenic signaling and its potential to serve as a disease biomarker and a novel therapeutic target in oncology.

  8. Glioblastoma after radiotherapy for pituitary adenoma

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jong Young; Park, Kyung Ran; KIm, Jun Joo; Lee, Chong In; Kim, Myung Soon; Jung, Soon Hee [Wonju College of Medicine, Yonsei Univ., Wonju (Korea, Republic of)

    1999-12-01

    A 39-year-old woman developed a glioblastoma about 7 years and 10 months after local radiotherapy (45 Gy) for pituitary adenoma. Clinical and histopathological details are presented, and previously reported cases of radiation-induced glioma are reviewed.

  9. Combining Immunotherapy with Standard Glioblastoma Therapy

    Science.gov (United States)

    This clinical trial is testing standard therapy (surgery, radiation and temozolomide) plus immunotherapy with pembrolizumab with or without a cancer treatment vaccine for patients with newly diagnosed glioblastoma, a common and deadly type of brain tumor.

  10. Overcoming the blood-brain tumor barrier for effective glioblastoma treatment.

    Science.gov (United States)

    van Tellingen, O; Yetkin-Arik, B; de Gooijer, M C; Wesseling, P; Wurdinger, T; de Vries, H E

    2015-03-01

    Gliomas are the most common primary brain tumors. Particularly in adult patients, the vast majority of gliomas belongs to the heterogeneous group of diffuse gliomas, i.e. glial tumors characterized by diffuse infiltrative growth in the preexistent brain tissue. Unfortunately, glioblastoma, the most aggressive (WHO grade IV) diffuse glioma is also by far the most frequent one. After standard treatment, the 2-year overall survival of glioblastoma patients is approximately only 25%. Advanced knowledge in the molecular pathology underlying malignant transformation has offered new handles and better treatments for several cancer types. Unfortunately, glioblastoma multiforme (GBM) patients have not yet profited as although numerous experimental drugs have been tested in clinical trials, all failed miserably. This grim prognosis for GBM is at least partly due to the lack of successful drug delivery across the blood-brain tumor barrier (BBTB). The human brain comprises over 100 billion capillaries with a total length of 400 miles, a total surface area of 20 m(2) and a median inter-capillary distance of about 50 μm, making it the best perfused organ in the body. The BBTB encompasses existing and newly formed blood vessels that contribute to the delivery of nutrients and oxygen to the tumor and facilitate glioma cell migration to other parts of the brain. The high metabolic demands of high-grade glioma create hypoxic areas that trigger increased expression of VEGF and angiogenesis, leading to the formation of abnormal vessels and a dysfunctional BBTB. Even though the BBTB is considered 'leaky' in the core part of glioblastomas, in large parts of glioblastomas and, even more so, in lower grade diffuse gliomas the BBTB more closely resembles the intact blood-brain barrier (BBB) and prevents efficient passage of cancer therapeutics, including small molecules and antibodies. Thus, many drugs can still be blocked from reaching the many infiltrative glioblastoma cells that

  11. Management of erythema multiforme associated with recurrent herpes infection: a case report.

    Science.gov (United States)

    Osterne, Rafael Lima Verde; Matos Brito, Renata Galvão de; Pacheco, Isabela Alves; Alves, Ana Paula Negreiros Nunes; Sousa, Fabrício Bitu

    2009-10-01

    Erythema multiforme is an acute mucocutaneous disorder, characterized by varying degrees of blistering and ulceration. We report a case of recurrent herpes-associated erythema multiforme managed with prophylactic acyclovir. An 11-year-old boy had lesions in the oral cavity and lips, which had been diagnosed as erythema multiforme minor. Four months later, the patient had desquamative gingivitis with erythematous lesions and necrotic areas in the skin. This episode was not related to drug intake, which suggests that the erythema multiforme was a result of herpetic infection. This hypothesis was supported by positive serology for herpes simplex virus. Five months later, the patient returned with new oral, skin and penis mucosal lesions. The diagnosis was confirmed as herpes simplex virus-associated erythema multiforme major. The episode was treated with acyclovir, and acyclovir was used prophylactically for 7 months to control the disease.

  12. Inhibition of glioblastoma malignancy by Lgl1

    OpenAIRE

    Gont, Alexander; Hanson, Jennifer E L; Lavictoire, Sylvie J.; Daneshmand, Manijeh; Nicholas, Garth; Woulfe, John; Kassam, Amin; Da Silva, Vasco F; Ian A. J. Lorimer

    2014-01-01

    lethal giant larvae (lgl) was first identified as a tumor suppressor in Drosophila, where its loss repressed the differentiation and promoted the invasion of neuroblasts, the Drosophila equivalent of the neural stem cell. Recently we have shown that a human homolog of Lgl, Lgl1 (LLGL1), is constitutively phosphorylated and inactivated in glioblastoma cells; this occurs as a downstream consequence of PTEN loss, one of the most frequent genetic events in glioblastoma. Here we have investigated ...

  13. Immunotherapy for the Treatment of Glioblastoma

    Science.gov (United States)

    Thomas, Alissa A.; Ernstoff, Marc S.; Fadul, Camilo E.

    2012-01-01

    Glioblastoma, the most aggressive primary brain tumor, thrives in a microenvironment of relative immunosuppression within the relatively immune-privileged central nervous system. Despite treatments with surgery, radiation therapy, and chemotherapy, prognosis remains poor. The recent success of immunotherapy in the treatment of other cancers has renewed interest in vaccine therapy for the treatment of gliomas. In this article, we outline various immunotherapeutic strategies, review recent clinical trials data, and discuss the future of vaccine therapy for glioblastoma. PMID:22290259

  14. Current Studies of Immunotherapy on Glioblastoma

    OpenAIRE

    Agrawal, Neena Stephanie; Miller, Rickey; Lal, Richa; Mahanti, Harshini; Dixon-Mah, Yaenette N.; Decandio, Michele L.; Vandergrift, W Alex; Varma, Abhay K.; Patel, Sunil J.; Banik, Naren L.; Lindhorst, Scott M.; Giglio, Pierre; Das, Arabinda

    2014-01-01

    Glioblastoma is a form of brain tumor with a very high morbidity and mortality. Despite decades of research, the best treatments currently in clinical practice only extend survival by a number of months. A promising alternative to conventional treatment for glioblastomas is immunotherapy. Although proposed over a century ago, the field of cancer immunotherapy has historically struggled to translate it into effective clinical treatments. Better understanding is needed of the various regulatory...

  15. Intracranial neurenteric cyst traversing the brainstem

    Directory of Open Access Journals (Sweden)

    Jasmit Singh

    2015-01-01

    Full Text Available Neurenteric cysts (NECs, also called enterogenous cysts, are rare benign endodermal lesions of the central nervous system that probably result from separation failure of the notochord and upper gastrointestinal tract. Most frequently they are found in the lower cervical spine or the upper thoracic spine. Intracranial occurrence is rare and mostly confined to infratentorial compartment, in prepontine region [51%]. Other common locations are fourth ventricle and cerebellopontine angle. There are few reports of NEC in medulla or the cerebellum. Because of the rarity of the disease and common radiological findings, they are misinterpreted as arachnoid or simple cysts until the histopathological confirmation, unless suspected preoperatively. We herein report a rare yet interesting case of intracranial NEC traversing across the brainstem.

  16. Detection of glioblastoma in biofluids.

    Science.gov (United States)

    Figueroa, Javier M; Carter, Bob S

    2017-10-20

    The detection of glioblastoma (GBM) in biofluids offers potential advantages over existing paradigms for the diagnosis and therapeutic monitoring of glial tumors. Biofluid-based detection of GBM focuses on detecting tumor-specific biomarkers in the blood and CSF. Current clinical research concentrates on studying 3 distinct tumor-related elements: extracellular macromolecules, extracellular vesicles, and circulating tumor cells. Investigations into these 3 biological classifications span the range of locales for tumor-specific biomarker discovery, and combined, have the potential to significantly impact GBM diagnosis, monitoring for treatment response, and surveillance for recurrence. This review highlights the recent advancements in the development of biomarkers and their efficacy for the detection of GBM.

  17. [Erythema multiforme-like reaction to para-phenylenediamine].

    Science.gov (United States)

    Mikkelsen, Carsten Sauer; Liljefred, Frederik; Mikkelsen, Dorthe Bisgaard

    2011-01-03

    A case of a 15 year-old girl who developed an erythema multiforme-like reaction to para-phenylenediamine (PPD) after Henna tattoos is described. The patient was treated successfully with oral prednisolone and highly potent topical corticosteroids. The patient developed a long-lasting post-inflammatory hyperpigmentation. Potential hyperreactive response was prevented by applying the PPD patch for only 30 minutes, but still there was a significantly positive reaction. This case highlights the need to ban the use of para-phenylenediamine and its derivates in dyes.

  18. Crizotinib-associated erythema multiforme in a lung cancer patient.

    Science.gov (United States)

    Sawamura, Soichiro; Kajihara, Ikko; Ichihara, Asako; Fukushima, Satoshi; Jinnin, Masatoshi; Yamaguchi, Emi; Kohrogi, Hirotsugu; Ihn, Hironobu

    2015-04-01

    Crizotinib is an oral small-molecule anaplastic lymphoma kinase (ALK) tyrosine-kinase inhibitor for the treatment of ALK-positive non-small-cell lung cancer (NSCLC). A 63-year old woman with postoperative relapsed ALK-positive NSCLC was treated with crizotinib. Erythema multiforme (EM) occurred one week after initiation of crizotinib therapy. Skin biopsy specimen showed compatible drug eruption. The discontinuation of crizotinib improved her eruption within one week. This report presented the first case of crizotinib-associated EM, which is the preclinical stage of Stevens-Johnson syndrome. Although crizotinib is clinically available, we should be aware of its potential severe skin adverse event.

  19. Oral erythema multiforme major: a triple case report.

    Science.gov (United States)

    Brown, Ronald S; Farquharson, Andre A; Morton, Iris; Tyler, Martin T

    2011-01-01

    This article presents three cases of erythema multiforme (EM) major with predominant oral mucosal lesions. Two males, aged 28 and 10, and a 19-year-old woman came to the clinic with oral vesiculoerosive lesions consistent with a diagnosis of EM major. All three patients reported histories consistent with an initial oral herpetic infection. Management with topical and systemic steroids resolved the lesions successfully in all three cases. The relatively recent literature has documented differences between EM and Stevens-Johnson syndrome. It is important for dentists to understand the etiology of EM and the associated diagnostic and management issues.

  20. Local delivery of cannabinoid-loaded microparticles inhibits tumor growth in a murine xenograft model of glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Dolores Hernán Pérez de la Ossa

    Full Text Available Cannabinoids, the active components of marijuana and their derivatives, are currently investigated due to their potential therapeutic application for the management of many different diseases, including cancer. Specifically, Δ(9-Tetrahydrocannabinol (THC and Cannabidiol (CBD - the two major ingredients of marijuana - have been shown to inhibit tumor growth in a number of animal models of cancer, including glioma. Although there are several pharmaceutical preparations that permit the oral administration of THC or its analogue nabilone or the oromucosal delivery of a THC- and CBD-enriched cannabis extract, the systemic administration of cannabinoids has several limitations in part derived from the high lipophilicity exhibited by these compounds. In this work we analyzed CBD- and THC-loaded poly-ε-caprolactone microparticles as an alternative delivery system for long-term cannabinoid administration in a murine xenograft model of glioma. In vitro characterization of THC- and CBD-loaded microparticles showed that this method of microencapsulation facilitates a sustained release of the two cannabinoids for several days. Local administration of THC-, CBD- or a mixture (1:1 w:w of THC- and CBD-loaded microparticles every 5 days to mice bearing glioma xenografts reduced tumour growth with the same efficacy than a daily local administration of the equivalent amount of those cannabinoids in solution. Moreover, treatment with cannabinoid-loaded microparticles enhanced apoptosis and decreased cell proliferation and angiogenesis in these tumours. Our findings support that THC- and CBD-loaded microparticles could be used as an alternative method of cannabinoid delivery in anticancer therapies.

  1. Neoadjuvant bevacizumab and irinotecan versus bevacizumab and temozolomide followed by concomitant chemoradiotherapy in newly diagnosed glioblastoma multiforme

    DEFF Research Database (Denmark)

    Hofland, Kenneth F; Hansen, Steinbjørn; Sorensen, Morten

    2014-01-01

    from febrile neutropenia whereas non-hematological toxicity was manageable. CONCLUSIONS: Only the Bev-Tem arm met the pre-specified level of activity of interest. Our results did not indicate any benefit from Bev-Iri in first-line therapy as opposed to Bev-Tem in terms of response and PFS....

  2. Treatment of newly diagnosed glioblastoma multiforme with carmustine, cisplatin and etoposide followed by radiotherapy. A phase II study

    DEFF Research Database (Denmark)

    Lassen, U; Kristjansen, P E; Wagner, A

    1999-01-01

    A meta-analysis and several studies of patients with grade III and IV gliomas have indicated that the addition of nitrosurea based chemotherapy to surgery and radiation may improve survival. We performed a phase II study of pre-irradiative chemotherapy with BCNU, cisplatin and etoposide. This imp......A meta-analysis and several studies of patients with grade III and IV gliomas have indicated that the addition of nitrosurea based chemotherapy to surgery and radiation may improve survival. We performed a phase II study of pre-irradiative chemotherapy with BCNU, cisplatin and etoposide....... This implies a short total treatment duration and a reliable response evaluation. The treatment schedule was three cycles of BCNU 200 mg/m2 i.v. on day 1, cisplatin 20 mg/m2 i.v. on day 1-5 and etoposide (VP-16) 100 mg/m2 i.v. on day 1-5, given every five weeks and followed by localized radiation, 60 Gy in 30...

  3. Maintenance of EGFR and EGFRvIII expressions in an in vivo and in vitro model of human glioblastoma multiforme

    DEFF Research Database (Denmark)

    Stockhausen, Marie-Thérése; Broholm, Helle; Villingshøj, Mette

    2011-01-01

    , clinical studies with EGFR inhibitors have shown inconsistent results, and as such, further knowledge regarding the role of EGFR and EGFRvIII in GBM is needed. For this, an appropriate in vivo/in vitro tumor model is required. Here, we report the establishment of an experimental GBM model in which...... the expressions of EGFR and EGFRvIII are maintained both in xenograft tumors growing subcutaneously on mice and in cell cultures established in stem cell conditions. With this model it will be possible to further study the role of EGFR and EGFRvIII, and response to targeted therapy, in GBM....

  4. Impact of therapy on quality of life, neurocognitive function and their correlates in glioblastoma multiforme: a review

    DEFF Research Database (Denmark)

    Henriksson, Roger; Asklund, Thomas; Poulsen, Hans Skovgaard

    2011-01-01

    response or survival, but produce toxicity that is likely to negatively impact QoL. New biological agents, such as bevacizumab, can induce a clinically meaningful proportion of durable responses among patients with recurrent GBM with an acceptable safety profile. Emerging evidence suggests that bevacizumab...... that extend survival in patients with recurrent GBM, so one of the primary aims of new therapies is to reduce morbidity, restore or preserve neurologic functions, and the capacity to perform daily activities. Apart from temozolomide, cytotoxic chemotherapeutic agents do not appear to significantly impact...

  5. Fatal glioblastoma multiforme in a patient with neurofibromatosis type I: the dilemma of systematic medical follow-up.

    NARCIS (Netherlands)

    Distelmaier, F.; Fahsold, R.; Reifenberger, G.; Messing-Juenger, M.; Schaper, J.; Schneider, D.T.; Gobel, U.; Mayatepek, E.; Rosenbaum, T.

    2007-01-01

    INTRODUCTION: Neurofibromatosis type I (NF1) is one of the most prevalent genetic diseases of the nervous system. Although the majority of NF1 patients are only mildly affected, the risk of developing malignancies is significantly increased in this population. CASE REPORT: Here, we present a

  6. Accelerated radiotherapy, carbogen, and nicotinamide in glioblastoma multiforme: report of European Organization for Research and Treatment of Cancer trial 22933

    NARCIS (Netherlands)

    Miralbell, R.; Mornex, F.; Greiner, R.; Bolla, M.; Storme, G.; Hulshof, M.; Bernier, J.; Denekamp, J.; Rojas, A. M.; Pierart, M.; van Glabbeke, M.; Mirimanoff, R. O.

    1999-01-01

    A three-step phase I/II trial associating accelerated radiotherapy with carbogen (step 1, ARCO), with nicotinamide (step 2, ARN), or with both (step 3, ARCON) was conducted, the aim of which was to overcome the effects of proliferation and hypoxia as potential causes of tumor radioresistance in

  7. Stereotactic intracranial implantation and in vivo bioluminescent imaging of tumor xenografts in a mouse model system of glioblastoma multiforme

    National Research Council Canada - National Science Library

    Baumann, Brian C; Dorsey, Jay F; Benci, Joseph L; Joh, Daniel Y; Kao, Gary D

    2012-01-01

    .... In this paper, we describe our technique for the precise stereotactic implantation of bio-imageable GBM cancer cells into the brains of nude mice resulting in tumor xenografts that recapitulate key...

  8. Treatment of glioblastoma multiforme cells with temozolomide-BioShuttle ligated by the inverse Diels-Alder ligation chemistry

    OpenAIRE

    Klaus Braun; Manfred Wiessler; Volker Ehemann; Ruediger Pipkorn; Herbert Spring; et al

    2009-01-01

    Klaus Braun1, Manfred Wiessler1, Volker Ehemann2, Ruediger Pipkorn3, Herbert Spring4, Juergen Debus5, Bernd Didinger5, Mario Koch3, Gabriele Muller6, Waldemar Waldeck61German Cancer Research Center, Dept of Imaging and Radiooncology, Heidelberg, Germany; 2University of Heidelberg, Institute of Pathology, Heidelberg, Germany; 3German Cancer Research Center, Central Peptide Synthesis Unit, Heidelberg, Germany; 4German Cancer Research Center, Dept of Structural Analysis of Gene Structure and Fun...

  9. Phenethyl isothiocyanate alters the gene expression and the levels of protein associated with cell cycle regulation in human glioblastoma GBM 8401 cells.

    Science.gov (United States)

    Chou, Yu-Cheng; Chang, Meng-Ya; Wang, Mei-Jen; Liu, Hsin-Chung; Chang, Shu-Jen; Harnod, Tomor; Hung, Chih-Huang; Lee, Hsu-Tung; Shen, Chiung-Chyi; Chung, Jing-Gung

    2017-01-01

    Glioblastoma is the most common and aggressive primary brain malignancy. Phenethyl isothiocyanate (PEITC), a member of the isothiocyanate family, can induce apoptosis in many human cancer cells. Our previous study disclosed that PEITC induces apoptosis through the extrinsic pathway, dysfunction of mitochondria, reactive oxygen species (ROS)-induced endoplasmic reticulum (ER) stress, and intrinsic (mitochondrial) pathway in human brain glioblastoma multiforme (GBM) 8401 cells. To the best of our knowledge, we first investigated the effects of PEITC on the genetic levels of GBM 8401 cells in vitro. PEITC may induce G0/G1 cell-cycle arrest through affecting the proteins such as cdk2, cyclin E, and p21 in GBM 8401 cells. Many genes associated with cell-cycle regulation of GBM 8401 cells were changed after PEITC treatment: 48 genes were upregulated and 118 were downregulated. The cell-division cycle protein 20 (CDC20), Budding uninhibited by benzimidazole 1 homolog beta (BUB1B), and cyclin B1 were downregulated, and clusterin was upregulated in GBM 8401 cells treated with PEITC. These changes of gene expression can provide the effects of PEITC on the genetic levels and potential biomarkers for glioblastoma. © 2015 Wiley Periodicals, Inc. Environ Toxicol 32: 176-187, 2017. © 2015 Wiley Periodicals, Inc.

  10. Bickerstaff's brainstem encephalitis after an outbreak of Campylobacter jejuni enteritis.

    Science.gov (United States)

    Mori, Masahiro; Koga, Michiaki; Yuki, Nobuhiro; Hattori, Takamichi; Kuwabara, Satoshi

    2008-05-30

    Twenty-eight patients suffered Campylobacter jejuni enteritis after eating raw chicken. Among them, only one patient developed Bickerstaff's brainstem encephalitis, who carried anti-GQ1b IgG antibodies. In contrast, none of the others did the autoantibodies. C. jejuni was cultured from all stool samples from five patients with enteritis alone. All the isolates had the same genotype, cst-II (Asn51), which are characteristic of strains isolated from Bickerstaff's brainstem encephalitis. These findings suggest that host susceptibility may play a role in inducing the production of anti-ganglioside antibodies and the development of Bickerstaff's brainstem encephalitis.

  11. Glioblastoma

    Science.gov (United States)

    ... of Tumors Astrocytoma Atypical Teratoid Rhaboid Tumor (ATRT) Chondrosarcoma Choroid Plexus Craniopharyngioma Cysts Ependymoma Germ Cell Tumor ... of Tumors Astrocytoma Atypical Teratoid Rhaboid Tumor (ATRT) Chondrosarcoma Choroid Plexus Craniopharyngioma Cysts Ependymoma Germ Cell Tumor ...

  12. Investigating the link between molecular subtypes of glioblastoma, epithelial-mesenchymal transition, and CD133 cell surface protein.

    Directory of Open Access Journals (Sweden)

    Hadi Zarkoob

    Full Text Available In this manuscript, we use genetic data to provide a three-faceted analysis on the links between molecular subclasses of glioblastoma, epithelial-to-mesenchymal transition (EMT and CD133 cell surface protein. The contribution of this paper is three-fold: First, we use a newly identified signature for epithelial-to-mesenchymal transition in human mammary epithelial cells, and demonstrate that genes in this signature have significant overlap with genes differentially expressed in all known GBM subtypes. However, the overlap between genes up regulated in the mesenchymal subtype of GBM and in the EMT signature was more significant than other GBM subtypes. Second, we provide evidence that there is a negative correlation between the genetic signature of EMT and that of CD133 cell surface protein, a putative marker for neural stem cells. Third, we study the correlation between GBM molecular subtypes and the genetic signature of CD133 cell surface protein. We demonstrate that the mesenchymal and neural subtypes of GBM have the strongest correlations with the CD133 genetic signature. While the mesenchymal subtype of GBM displays similarity with the signatures of both EMT and CD133, it also exhibits some differences with each of these signatures that are partly due to the fact that the signatures of EMT and CD133 are inversely related to each other. Taken together these data shed light on the role of the mesenchymal transition and neural stem cells, and their mutual interaction, in molecular subtypes of glioblastoma multiforme.

  13. Intratumoral decorin gene delivery by AAV vector inhibits brain glioblastomas and prolongs survival of animals by inducing cell differentiation.

    Science.gov (United States)

    Ma, Hsin-I; Hueng, Dueng-Yuan; Shui, Hao-Ai; Han, Jun-Ming; Wang, Chi-Hsien; Lai, Ying-Hsiu; Cheng, Shi-Yuan; Xiao, Xiao; Chen, Ming-Teh; Yang, Yi-Ping

    2014-03-12

    Glioblastoma multiforme (GBM) is the most malignant cancer in the central nervous system with poor clinical prognosis. In this study, we investigated the therapeutic effect of an anti-cancer protein, decorin, by delivering it into a xenograft U87MG glioma tumor in the brain of nude mice through an adeno-associated viral (AAV2) gene delivery system. Decorin expression from the AAV vector in vitro inhibited cultured U87MG cell growth by induction of cell differentiation. Intracranial injection of AAV-decorin vector to the glioma-bearing nude mice in vivo significantly suppressed brain tumor growth and prolonged survival when compared to control non-treated mice bearing the same U87MG tumors. Proteomics analysis on protein expression profiles in the U87MG glioma cells after AAV-mediated decorin gene transfer revealed up- and down-regulation of important proteins. Differentially expressed proteins between control and AAV-decorin-transduced cells were identified through MALDI-TOF MS and database mining. We found that a number of important proteins that are involved in apoptosis, transcription, chemotherapy resistance, mitosis, and fatty acid metabolism have been altered as a result of decorin overexpression. These findings offer valuable insight into the mechanisms of the anti-glioblastoma effects of decorin. In addition, AAV-mediated decorin gene delivery warrants further investigation as a potential therapeutic approach for brain tumors.

  14. Intratumoral Decorin Gene Delivery by AAV Vector Inhibits Brain Glioblastomas and Prolongs Survival of Animals by Inducing Cell Differentiation

    Directory of Open Access Journals (Sweden)

    Hsin-I Ma

    2014-03-01

    Full Text Available Glioblastoma multiforme (GBM is the most malignant cancer in the central nervous system with poor clinical prognosis. In this study, we investigated the therapeutic effect of an anti-cancer protein, decorin, by delivering it into a xenograft U87MG glioma tumor in the brain of nude mice through an adeno-associated viral (AAV2 gene delivery system. Decorin expression from the AAV vector in vitro inhibited cultured U87MG cell growth by induction of cell differentiation. Intracranial injection of AAV-decorin vector to the glioma-bearing nude mice in vivo significantly suppressed brain tumor growth and prolonged survival when compared to control non-treated mice bearing the same U87MG tumors. Proteomics analysis on protein expression profiles in the U87MG glioma cells after AAV-mediated decorin gene transfer revealed up- and down-regulation of important proteins. Differentially expressed proteins between control and AAV-decorin-transduced cells were identified through MALDI-TOF MS and database mining. We found that a number of important proteins that are involved in apoptosis, transcription, chemotherapy resistance, mitosis, and fatty acid metabolism have been altered as a result of decorin overexpression. These findings offer valuable insight into the mechanisms of the anti-glioblastoma effects of decorin. In addition, AAV-mediated decorin gene delivery warrants further investigation as a potential therapeutic approach for brain tumors.

  15. Up-regulation of cholesterol associated genes as novel resistance mechanism in