WorldWideScience

Sample records for bp deletion induced

  1. Association between the CCR5 32-bp deletion allele and late onset of schizophrenia

    DEFF Research Database (Denmark)

    Rasmussen, H.B.; Timm, S.; Wang, A.G.

    2006-01-01

    OBJECTIVE: The 32-bp deletion allele in chemokine receptor CCR5 has been associated with several immune-mediated diseases and might be implicated in schizophrenia as well. METHOD: The authors genotyped DNA samples from 268 schizophrenia patients and 323 healthy subjects. Age at first admission...... of the deletion allele in the latter subgroup of patients. CONCLUSIONS: These findings suggest that the CCR5 32-bp deletion allele is a susceptibility factor for schizophrenia with late onset. Alternatively, the CCR5 32-bp deletion allele may act as a modifier by delaying the onset of schizophrenia without...

  2. Analysis of the mitochondrial 4977 bp deletion in patients with hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Guo ZS

    2017-06-01

    Full Text Available Mutations in the mitochondrial (mt genome that result in mt dysfunction, have long been proposed to play important roles in the pathogenesis of hepatocellular carcinoma (HCC. Among these, the common mtDNA 4977 bp deletion is one of the most frequent mutations observed in various cancers. To understand the relationship between the mtDNA 4977 bp deletion and HCC, we performed mutational screening for the presence of this deletion in 105 HCC patients and 69 unrelated healthy subjects. After nested-polymerase chain reaction (nested-PCR amplification, we found that there were 10 patients carrying the mtDNA 4977 bp deletion, and this deletion was absent in control subjects. Moreover, HCC patients carrying this deletion showed a marked increase in reactive oxygen species (ROS level and mtDNA copy number when compared with the healthy controls. Taken together, our data indicated that the mtDNA 4977 bp deletion may play important role in the carcinogenesis of HCC, possibly via the alternation of mtDNA copy number and oxidative stress.

  3. Association of the UCP2 45-bp insertion/deletion polymorphism with ...

    African Journals Online (AJOL)

    Uncoupling protein-2 (UCP2) regulates insulin secretion and may play an important role in linking obesity to diabetes type 2 (T2D) that represents a major public health problem in Saudi Arabia. The present study aimed to evaluate the association between the 45-bp insertion/deletion (ins/del) in 3'UTR exon 8 within the ...

  4. Origins and dispersal of the mitochondrial DNA region V 9 bp deletion and insertion in Nigeria and the Ivory Coast

    Energy Technology Data Exchange (ETDEWEB)

    Merriwether, D.A.; Huston, S.L.; Bunker, C.A. [Univ. of Pittsburgh, PA (United States)] [and others

    1994-09-01

    An intergenic region V Mitochondrial DNA (mtDNA) 9 bp deletion located between the genes for tRNA{sup LYS} and cytochrome oxidase II was discovered in a small percentage of Nigerian and Ivory Coast natives. Previously this deletion has been described as Asian-specific and has been reported throughout the New World, Asia, S.E. Asia, and the Pacific Islands at frequencies ranging from 0% to 100%. In the New World and the Pacific Islands, the deletion is almost always accompanied by an Hae III restriction site gain at nt 16517. All 9 occurrences of the deletion observed in Africa (from four different populations) co-occur with the Hae III 16517 site gain, indicating that the African deletion probably shares a common origin with the deletion described as {open_quotes}Asian-specific{close_quotes}. The deletion was found in Benin and Sokoto, Nigeria in 2/54 Edo Bini, 1/2 Edo Ishan, 3/99 Hausa, 0/18 Fulani, and 0/16 other Nigerians. The deletion was also detected in 3/115 Ivory Coast natives from Abidjan. A 9 bp insertion (triplication) was observed in 1/115 Ivory Coast natives. The triplicated individual also possessed the Hae III 16517 site gain. The fragment containing the African deletion was sequenced and found to be identical in sequence to the Asian deletion region. D-loop sequence of nts 15975 to 00048 revealed that 2 of the 3 Ivory Coast deleted individuals and 1 of the 6 Nigerians deleted (Hausa) had a T-C transition at nt position 16189 which is common in New World-deleted individuals. These results raise the possibility that the occurrence of this deletion predates the separation of Asian and African populations from a common ancestral populations, or that the deletion has occurred more than once in human evolution. Either explanation requires that caution be exercised when using the 9 bp deletion as a population marker.

  5. Quantitative Analysis of Mitochondrial DNA 4977-bp Deletion in Sporadic Breast Cancer and Benign Breast Tumors

    OpenAIRE

    Ye, Chuanzhong; Shu, Xiao-Ou; Wen, Wanqing; Pierce, Larry; Courtney, Regina; Gao, Yu-Tang; Zheng, Wei; Cai, Qiuyin

    2007-01-01

    The mitochondrial DNA (mtDNA) 4977-bp deletion (ΔmtDNA4977 mutation) is one of the most frequently observed mtDNA mutations in human tissues, and may play a role in carcinogenesis. Only a few studies have evaluated ΔmtDNA4977 mutation in breast cancer tissue, and the findings have been inconsistent, which may be due to methodological differences. In this study, we developed a quantitative real-time PCR assay to assess the level of the ΔmtDNA4977 mutation in tumor tissue samples from 55 primar...

  6. Treacher Collins Syndrome with a de Novo 5-bp Deletion in the TCOF1 Gene

    Directory of Open Access Journals (Sweden)

    Pen-Hua Su

    2006-01-01

    Full Text Available Treacher Collins syndrome (TCS is an autosomal dominant disorder of craniofacial development with features including malar hypoplasia, micrognathia, microtia, downward slanting palpebral fissures, lower eyelid coloboma, conductive hearing loss, and cleft palate. TCS is caused by mutations in the TCOF1 gene, which encodes the nuclear phosphoprotein treacle. Here, we describe a 1-day-old male infant with classical TCS presentation. A 5-bp deletion in exon 22 of the TCOF1 gene (3469del ACTCT was found to cause a premature stop codon. This is the first report of TCOF1 gene mutation in the Taiwanese population.

  7. Detection of a 640-bp deletion in the Aggregatibacter actinomycetemcomitans leukotoxin promoter region in isolates from an adolescent of Ethiopian origin

    Directory of Open Access Journals (Sweden)

    Rolf Claesson

    2015-04-01

    Full Text Available The expression of the leukotoxin of Aggregatibacter actinomycetemcomitans is regulated by the leukotoxin promoter. A 530-bp deletion or an 886-bp insertion sequence (IS element in this region has earlier been described in highly leukotoxic isolates. Here, we report on highly leukotoxic isolate with a 640-bp deletion, which was detected in an adolescent of Ethiopian origin.

  8. A heterozygous 21-bp deletion in CAPN3 causes dominantly inherited limb girdle muscular dystrophy

    DEFF Research Database (Denmark)

    Vissing, John; Barresi, Rita; Witting, Nanna

    2016-01-01

    Limb girdle muscular dystrophy type 2A is the most common limb girdle muscular dystrophy form worldwide. Although strict recessive inheritance is assumed, patients carrying a single mutation in the calpain 3 gene (CAPN3) are reported. Such findings are commonly attributed to incomplete mutation...... creatine kinase or myoglobin. Muscle weakness was generally milder than observed in limb girdle muscular dystrophy type 2A, but affected the same muscle groups (proximal leg, lumbar paraspinal and medial gastrocnemius muscles). In some cases, the weakness was severely disabling. The 21-bp deletion did...... affecting the calpain 3 homodimer. This renders patients deficient in calpain 3 as in limb girdle muscular dystrophy type 2A, albeit in a milder form in most cases. Based on findings in 10 families, our study indicates that a dominantly inherited pattern of calpainopathy exists, and should be considered...

  9. Distribution of a 27-bp deletion in the band 3 gene in South Pacific islanders.

    Science.gov (United States)

    Kimura, Masako; Tamam, Moedrik; Soemantri, Augustinus; Nakazawa, Minato; Ataka, Yuji; Ohtsuka, Ryutaro; Ishida, Takafumi

    2003-01-01

    Distribution of a 27-bp deletion in the band 3 gene (B3Delta27) that causes Southeast Asian/Melanesian ovalocytosis has scarcely been studied in remote insular Southeast Asia and New Guinea. Here the presence of the B3Delta27 was surveyed among a total of 756 subjects from the indigenous populations inhabiting New Guinean islands and remote insular Southeast Asia by using a polymerase chain reaction method. In remote insular Southeast Asia where Austronesian-speaking peoples inhabit, the B3Delta27 frequency ranged between 0.04 and 0.15. In New Guinea Island, hinterland or Papuan groups showed the absence of the B3Delta27 or a very low gene frequency (0.01 in the Gidra) of the B3Delta27. However, groups of the coastal regions (Asmat, Sorong, and others) and of the nearby islands (Biak and Manus) where Austronesian infiltration had occurred showed substantial frequencies of the deletion (0.02-0.09). It is likely that the B3Delta27 was introduced into this region about 3,500 years ago with the arrival of Austronesian-speaking peoples. Once being introduced, the B3Delta27 may have been selected because of its resistance against malaria, while founder effect and genetic drift might have occurred in the New Guinean tribes with small population size, which helped to generate a variety of the B3Delta27 frequencies.

  10. Wasted (wst) mice have 3-bp deletion in the PCNA promoter

    Energy Technology Data Exchange (ETDEWEB)

    Paunesku, T.; Woloschak, G.E. [Argonne National Lab., IL (United States). Center for Mechanistic Biology and Biotechnology

    1997-08-01

    Mice homozygous for the autosomal recessive wasted mutation (wst/wst) have abnormalities in T-lymphocytes and in the anterior motor neuron cells of the spinal cord, leading to sensitivity to ionizing radiation, hind limb paralysis, and immunodeficiency. This defect results in a failure to gain weight by 20 days and death at 28 days of age. Previous results from the authors` group have shown that (1) wasted mice have little if any detectable PCNA protein or mRNA in thymus, but levels in liver, brain, and other tissues are similar to those in controls; and (2) the coding region for PCNA is the same in wasted mice and in control littermates. These observations gave rise to the present study, in which the PCNA promoter was sequenced for wst/wst mice, control littermates ({center_dot}wst/+) and BCF{sub 1} (or BALB/c x C57BL/6) F{sub 1} controls. Sequence analysis revealed only one difference between wst/wst and BALB/c x C57BL/6 F{sub 1} littermates: a 3-bp deletion in the 5 foot upstream region of the PCNA gene of wasted mice that was observed on only one allele or no alleles of normal littermates. The mutated sites in PCNA promoter from two litters plus two additional wst/wst and two known wst/+ animals were screened with 8G and 11G probes, and each confirmed this pattern. The short term DNA segment encompassing the deletion was shown in gel shift experiments to bind a nuclear protein(s) present in a broad variety of cells including thymus and spleen nuclear extract from wst/wst and control mice. The mutated oligomer that was homozygous only in wst/wst mice was not able to bind the same nuclear protein(s).

  11. Characterization of a de novo 43-bp deletion of the Gs[alpha] gene (GNAS1) in Albright hereditary osteodystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Luttikhuis, M.E.M.O.; Trembath, R.C. (Univ. of Leicester (United Kingdom)); Wilson, L.C. (Univ. of Leicester (United Kingdom) Institute of Child Health, London (United Kingdom)); Leonard, J.V. (Institute of Child Health, London (United Kingdom))

    1994-05-15

    Albright hereditary osteodystrophy (AHO) is an autosomal dominant disorder characterized by short stature, obesity, mental retardation, subcutaneous calcification, and brachy-metaphalangia. Two distinct forms of AHO exist; pseudohypoparathyroidism type I (PHPI) and pseudopseudohypoparathyrodism (PPHP). The classification is dependent upon the presence or absence, respectively, of resistance to parathyroid and other hormones that bind to Gs-protein-coupled membrane receptors stimulating adenylyl cyclase. Gs is a heterotrimeric protein comprising [alpha], [beta], and [gamma]-subunits encoded by separate genes. Genomic DNA was isolated from peripheral leukocytes from 13 unrelated AHO patients. Exon 4 and flanking intronic sequence of GNAS1 were PCR amplified. A single PCR product corresponding to the expected 159-bp fragment was identified in 12 affected individuals with either PHPIa or PPHP. In patient 10285 an additional smaller fragment was detected but was not present in either of the unaffected parents. These two fragments were isolated from a 2% agarose gel. Direct sequencing of the smaller fragment revealed a 43-bp deletion comprising at least 35 hp of the 3[prime] end of exon 4 and the donor splice site of intron 4 and extending into the following intro. The 43-bp deletion would lead to a premature stop codon, 62 codons downstream of the deletion. The de novo mutation reported here is the largest deletion in the Gs[alpha] gene described so far for AHO patients.

  12. Mitochondrial DNA control region sequence variation suggests an independent origin of an {open_quotes}Asian-specific{close_quotes} 9-bp deletion in Africans

    Energy Technology Data Exchange (ETDEWEB)

    Soodyall, H.; Redd, A.; Vigilant [Pennsylvania State Univ., Univeristy Park, PA (United States)] [and others

    1994-09-01

    The intergenic noncoding region between the cytochrome oxidase II and lysyl tRNA genes of human mitochondrial DNA (mtDNA) is associated with two tandemly arranged copies of a 9-bp sequence. A deletion of one of these repeats has been found at varying frequencies in populations of Asian descent, and is commonly referred to as an {open_quotes}Asian-specific{close_quotes} marker. We report here that the 9-bp deletion is also found at a frequency of 10.2% (66/649) in some indigenous African populations, with frequencies of 28.6% (20/70) in Pygmies, 26.6% (12/45) in Malawians and 15.4% (31/199) in southeastern Bantu-speaking populations. The deletion was not found in 123 Khoisan individuals nor in 209 western Bantu-speaking individuals, with the exception of 3 individuals from one group that was admixed with Pygmies. Sequence analysis of the two hypervariable segments of the mtDNA control region reveals that the types associated with the African 9-bp deletion are different from those found in Asian-derived populations with the deletion. Phylogenetic analysis separates the {open_quotes}African{close_quotes} and {open_quotes}Asian{close_quotes} 9-bp deletion types into two different clusters which are statistically supported. Mismatch distributions based on the number of differences between pairs of mtDNA types are consistent with this separation. These findings strongly support the view that the 9-bp deletion originated independently in Africa and in Asia.

  13. Pushing it back. Dating the CCR5–32 bp deletion to the Mesolithic in Sweden and its implications for the Meso\\Neo transition

    Directory of Open Access Journals (Sweden)

    Kerstin Lidén

    2006-12-01

    Full Text Available Genetic variation in the chemokine receptor gene CCR5 has received considerable scientific interest during the last few years. Protection against HIV-infection and AIDS, together with specific geographic distribution are the major reasons for the great interest in CCR5 32bp deletion. The event for the occurrence of this mutation has been postulated by coalescence dating to the 14th century, or 5000 BP. In our prehistoric Swedish samples we show that the frequency of 32pb deletion in CCR5 in the Neolithic population does not deviate from the frequency in a modern Swedish population, and that the deletion existed in Sweden already during the Mesolithic period.

  14. Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

    Science.gov (United States)

    Li, Jie; Zhu, Xichun; Ma, Lin; Xu, Hongwei; Cao, Xin; Luo, Renyun; Chen, Hong; Sun, Xiuzhu; Cai, Yong; Lan, Xianyong

    2017-03-04

    Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

  15. Radiation-Induced Deletions in Mouse Spermatogonia are Usually Large (over 200 kb) and Contain Little Sequence Similarity at the Junctions.

    Science.gov (United States)

    Kodaira, Mieko; Asakawa, Jun-Ichi; Nakamura, Nori

    2017-06-01

    Ionizing radiation can induce mutations, and the majority of radiation-induced mutations in mammalian cells are deletions. The most critical types of radiation-induced DNA damage are DNA double-strand breaks, and these breaks are repaired by either the homologous recombination (HR) pathway or the non-homologous end joining (NHEJ) pathway. The HR pathway is not as mutagenic as the NHEJ pathway, and it is expected that radiation-induced deletions would usually have little sequence similarity around the deletion junction points. Here we report sequence data from the regions around the rejoined junctions of 33 de novo copy-number mutations (27 deletions and 6 duplications) obtained from offspring sired by male mice that were irradiated at the spermatogonia stage and from nonirradiated controls. The results indicate that deletions can be classified into three major groups. In group 1, nine deletions were found to share long blocks of similar sequences (200-6,000 bp) at the junctions and the deletion size varied extensively (1 kb to 2 Mb) (e.g., illegitimate recombination). In group 2, five deletions shared short identical sequences (0-7 bp) at the junctions, and the deletion sizes were shorter than 200 kb (e.g., micro-homology-mediated repair). Additional three-deletion candidates of this group were also found but turned out to be inherited from mosaic parents. They are therefore not included in germline mutations. In group 3, twelve deletions shared little sequence similarity (only 0-2 bp) at the junctions (likely due to NHEJ repair) and deletion sizes were longer than 200 kb. Group 1 consisted of deletions found in both spontaneous and irradiated genomes and thus, were probably caused by spontaneous events during meiosis or DNA replication. Group 2 consisted mainly of deletions found in nonexposed genomes. Group 3 consisted primarily of deletions that occurred in the irradiated genomes. Among the duplications, we found no indication of any association with radiation

  16. A re-sequencing based assessment of genomic heterogeneity and fast neutron-induced deletions in a common bean cultivar

    Directory of Open Access Journals (Sweden)

    Jamie A. O'Rourke

    2013-06-01

    Full Text Available A small fast neutron mutant population has been established from Phaseolus vulgaris cv. Red Hawk. We leveraged the available P. vulgaris genome sequence and high throughput next generation DNA sequencing to examine the genomic structure of five Phaseolus vulgaris cv. Red Hawk fast neutron mutants with striking visual phenotypes. Analysis of these genomes identified three classes of structural variation; between cultivar variation, natural variation within the fast neutron mutant population, and fast neutron induced mutagenesis. Our analyses focused on the latter two classes. We identified 23 large deletions (>40 bp common to multiple individuals, illustrating residual heterogeneity and regions of structural variation within the common bean cv. Red Hawk. An additional 18 large deletions were identified in individual mutant plants. These deletions, ranging in size from 40 bp to 43,000 bp, are potentially the result of fast neutron mutagenesis. Six of the 18 deletions lie near or within gene coding regions, identifying potential candidate genes causing the mutant phenotype.

  17. Coexistence of P190 BCR/ABL transcript and CALR 52-bp deletion in chronic myeloid leukemia blast crisis: a case report

    Directory of Open Access Journals (Sweden)

    najmaldin saki

    2016-01-01

    Full Text Available We present a case of a 78-year-old woman presented with thrombocytosis and high blast count, who had a history of splenectomy. Her cytogenetic analysis revealed aberrant chromosomal rearrangements in different clonal populations harboring 46XX karyotype with t(9;22(q34;q11. RT-PCR assay detected the e1a2 BCR-ABL translocation resulting from a rearrangement of the minor breakpoint cluster region (m-bcr in the BCR gene. Subsequent evaluations of the disease showed calreticulin (CALR 52-bp deletion as well as the absence of JAK2V617F heterozygous mutation in granulocyte population of peripheral blood using allele-specific PCR and bi-directional DNA sequencing. To our knowledge, this is the first case of a patient initially diagnosed as p190 BCR-ABL transcript positive CML in blastic crisis characterized with a 52-bp deletion in CALR gene.

  18. Androgen Insensitivity Syndrome in a Family of Warmblood Horses Caused by a 25-bp Deletion of the DNA-Binding Domain of the Androgen Receptor Gene

    DEFF Research Database (Denmark)

    Eastman Welsford, G.; Munk, Rikke; Villagómez, Daniel A.F.

    2017-01-01

    Testicular feminization, an earlier term coined for describing a syndrome resulting from failure of masculinization of target organs by androgen secretions during embryo development, has been well documented not only in humans but also in the domestic horse. The pathology, actually referred to as...... pedigree segregating AIS, where the molecular analyses of the androgen receptor gene in the family provided evidences that a 25-bp deletion of the DNA-binding domain is causative of this equine syndrome....

  19. Relationship between the HLA-G 14 bp insertion/deletion polymorphism and susceptibility to autoimmune disease: a meta-analysis.

    Science.gov (United States)

    Kim, S K; Jeong, K H; Kang, I J; Chung, J H; Shin, M K; Lee, M H

    2015-12-03

    Numerous studies have investigated the potential relationship between the human leukocyte antigen (HLA)-G 14-bp insertion/deletion (INS/DEL) polymorphisms and autoimmune disease (AID). However, published results are inconclusive. Our aim was to determine whether the 14-bp INS/DEL polymorphism in the HLA-G gene contributes to the risk of AID. A systemic literature search of the PubMed and EMBASE databases was conducted to identify eligible studies investigating the association of the HLA-G 14-bp INS/DEL polymorphism with AID. Our analysis included 11 publications involving a total of 6462 individuals. Overall, no significant association between the HLA-G 14-bp INS/DEL polymorphism and AID was detected in any comparison model. Further subgroup analyses based on AID types and ethnicity also revealed no significant associations. Our results suggest that the HLA-G 14-bp INS/DEL polymorphism is unrelated to the development of AID. Further studies including larger sample sizes are warranted to confirm these results.

  20. COII/tRNA[sup Lys] intergenic 9-bp deletion and other mtDNA markers clearly reveal that the Tharus (Southern Nepal) have oriental affinities

    Energy Technology Data Exchange (ETDEWEB)

    Passarino, G.; Semino, O.; Santachiara-Benerecetti, A.S.; Modiano, G. (Universita di Tor Vergata (Romania))

    1993-09-01

    The authors searched for the East Asian mtDNA 9-bp deletion in the intergenic COII/tRNA[sup Lys] region in a sample of 107 Tharus (50 from central Terai and 57 from eastern Terai), a population whose anthropological origin has yet to be completely clarified. The deletion, detected by electrophoresis of the PCR-amplified nt 7392-8628 mtDNA fragment after digestion with HaeIII, was found in about 8% of both Tharu groups but was found in none of the 76 Hindus who were examined as a non-Oriental neighboring control population. A complete triplication of the 9-bp unit, the second case so far reported, was also observed in one eastern Tharu. All the mtDNAs with the deletion, and that with the triplication, were further characterized (by PCR amplification of the relevant mTDNA fragments and their digestion with the appropriate enzymes) to locate them in the Ballinger et al. phylogeny of East Asian mtDNA haplotypes. The deletion was found to be associated with four different haplotypes, two of which are reported for the first time. One of the deletions and especially the triplication could be best explained by the assumption of novel length-change events. Ballinger's classification of East Asian mtDNA haplotypes is mainly based on the phenotypes for the DdeI site at nt 10394 and the AluI site at nt 10397. Analysis of the entire Tharu sample revealed that more than 70% of the Tharus have both sites, the association of which has been suggested as an ancient East Asian peculiarity. These results conclusively indicate that the Tharus have a predominantly maternal Oriental ancestry. Moreover, they show at least one and perhaps two further distinct length mutations, and this suggests that the examined region is a hot spot of rearrangements. 21 refs., 5 figs., 6 tabs.

  1. The Translational Repressor 4E-BP1 Contributes to Diabetes-Induced Visual Dysfunction.

    Science.gov (United States)

    Miller, William P; Mihailescu, Maria L; Yang, Chen; Barber, Alistair J; Kimball, Scot R; Jefferson, Leonard S; Dennis, Michael D

    2016-03-01

    The translational repressor 4E-BP1 interacts with the mRNA cap-binding protein eIF4E and thereby promotes cap-independent translation of mRNAs encoding proteins that contribute to diabetic retinopathy. Interaction of 4E-BP1 with eIF4E is enhanced in the retina of diabetic rodents, at least in part, as a result of elevated 4E-BP1 protein expression. In the present study, we examined the role of 4E-BP1 in diabetes-induced visual dysfunction, as well as the mechanism whereby hyperglycemia promotes 4E-BP1 expression. Nondiabetic and diabetic wild-type and 4E-BP1/2 knockout mice were evaluated for visual function using a virtual optomotor test (Optomotry). Retinas were harvested from nondiabetic and type 1 diabetic mice and analyzed for protein abundance and posttranslational modifications. Similar analyses were performed on cells in culture exposed to hyperglycemic conditions or an O-GlcNAcase inhibitor (Thiamet G [TMG]). Diabetes-induced visual dysfunction was delayed in mice deficient of 4E-BP1/2 as compared to controls. 4E-BP1 protein expression was enhanced by hyperglycemia in the retina of diabetic rodents and by hyperglycemic conditions in retinal cells in culture. A similar elevation in 4E-BP1 expression was observed with TMG. The rate of 4E-BP1 degradation was significantly prolonged by either hyperglycemic conditions or TMG. A PEST motif in the C-terminus of 4E-BP1 regulated polyubiquitination, turnover, and binding of an E3 ubiquitin ligase complex containing CUL3. The findings support a model whereby elevated 4E-BP1 expression observed in the retina of diabetic rodents is the result of O-GlcNAcylation of 4E-BP1 within its PEST motif.

  2. An HLA-G(∗)14bp insertion/deletion polymorphism associates with the development of autistic spectrum disorders.

    Science.gov (United States)

    Guerini, Franca R; Bolognesi, Elisabetta; Chiappedi, Matteo; Ghezzo, Alessandro; Canevini, Maria Paola; Mensi, Martina M; Vignoli, Aglaia; Agliardi, Cristina; Zanette, Michela; Clerici, Mario

    2015-02-01

    HLA-G expressed by the trophoblast ligates KIR molecules expressed by maternal NK cells at the uterine fetal/maternal interface: this interaction is involved in generating immune tolerance during pregnancy. A 14-bp insertion in the HLA-G 3'-UTR associates with significantly reduced levels of both HLA-G mRNA and soluble HLA-G, thus hampering the efficacy of HLA-G-mediated immune tolerance during pregnancy. Because prenatal immune activation is suggested to play an important role in the onset of autistic spectrum disorders (ASD) we performed an in-depth evaluation of HLA-G polymorphisms in a well-characterized cohort of Italian families of ASD children. Results showed that frequency of both homozygous 14bp+/14bp+ genotype and 14bp+ allele was significantly higher in ASD children and their mothers compared to controls (panalysis of the frequency of transmission of the 14bp+ allele from parents to ASD children and their non-ASD siblings showed that the 14bp+ allele was more frequently transmitted (T) to ASD children, whereas it was preferentially not transmitted (NT) to the non-ASD siblings (overall discrepancy: p=0.02; OR: 2.6, 95% CI: 1.1-6.4). Results herein suggest that HLA-G polymorphisms are associated with ASD development, possibly as a consequence of prenatal immune activation. These data infer that the immune alterations seen in ASD are associated with the maternal-fetal interaction alone, and reinforce the observation that different genetic backgrounds characterize ASD children and their non-ASD siblings. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Associations of MTHFR DNMT3b 4977 bp deletion in mtDNA and GSTM1 deletion, and aberrant CpG island hypermethylation of GSTM1 in non-obstructive infertility in Indian men.

    Science.gov (United States)

    Dhillon, Varinderpal S; Shahid, Mohd; Husain, Syed Akhtar

    2007-04-01

    Methylenetetrahydrofolate (MTHFR) and DNMT3b play imperative roles in DNA synthesis and de novo methylation. GSTM1 is involved in detoxification of carcinogens. Mitochondrial DNA deletion has been associated with lower motility in human sperm. We analysed if polymorphisms in MTHFR (C677T and A1298C) and DNMT3b (C46359T) are associated with non-obstructive male infertility. We also analysed if folate, vitamin B(12), homocysteine (Hcy), 8'-hydroxy-2'-deoxygnanosine (8-OHdG) levels, dietary folate intake and mtDNA deletion (4977 bp) affects fertility, such interactions are modified by deletion and methylation of GSTM1. In this case-control study, we included 179 oligoasthenoteratozoospermia patients and 200 fertile men. Single-nucleotide polymorphism analysis was performed by PCR-restriction fragment length polymorphism. The MTHFR (C677T and A1298C) and DNMT3b (C46359T) frequencies did not differ significantly in two groups. GSTM1 in association with mtDNA 4977 deletion is significantly associated with infertility. Plasma folate and vitamin B(12) levels are decreased and total Hcy is elevated in infertile men. GSTM1 methylation status was investigated by methylation-specific PCR. Methylation is significantly correlated with GSTM1 reduced/loss of expression in infertile men. Infertile men have significantly higher 8-OHdG levels. Dietary folate intake is not linked with GSTM1 methylation. Low folate intake in association with CT + TT genotypes (C677T) has significant protective effect on GSTM1 methylation. Results indicate that micronutrients, 8-OHdG levels, mtDNA deletion and GSTM1 promoter methylation are frequent alterations in infertility.

  4. The influence of large deletions on the mutation frequency induced by tritiated water and X-radiation in male Drosophila melanogaster post-meiotic germ cells

    Energy Technology Data Exchange (ETDEWEB)

    Fossett, N.G.; Byrne, B.J.; Kelley, S.J.; Tucker, A.B.; Arbour-Reily, P.; Lee, W.R. (Louisiana State Univ., Institute for Mutagenesis, Baton Rouge, LA (United States))

    1994-05-01

    Tritium beta radiation ([sup 3]H [beta]-radiation) in the form of tritiated water was used to induce mutations at the alcohol dehydrogenase (Adh) locus in male Drosophila melanogaster post-meiotic germ cells. All 23 Adh null mutations were large deletions (>20 kb), determined by genetic complementation and Southern blot analyses. 27 Adh null mutations have been induced by 100-kVp X-rays and have been genetically and molecularly characterized. In contrast to [sup 3]H [beta]-radiation, 100-kVp X-rays induced a bimodal distribution of Adh null mutations, intragenic mutations, [<=]250 bp, and large deletions, >100 kb. A statistically significant difference was observed between the frequency of large deletions (23/23 or 1.0) induced by [sup 3]H [beta]-radiation and the frequency of large deletions (19/27 or 0.7) induced by 100-kVp X-rays. However, a statistical difference was not observed between the size distribution of the large deletions induced by [sup 3]H [beta]-radiation and X-rays. The relative deletion frequency (RDF) induced by [sup 3]H [beta]-radiation and 100-kVp X-rays was (1.0/0.7=1.4). The relative biological effectiveness (RBE) of these two radiation sources was 1.4, determined from the ratio of the regression coefficients of the respective [sup 3]H [beta]-radiation and X-ray sex-linked recessive lethal (SLRL) dose-response data. The large difference in size between the two classes of X-ray-induced Adh null mutations and the increase in mutation frequency and deletion frequency for [sup 3]H [beta]-radiation with respect to X-rays may indicate that the relative deletion frequency (RDF) is the molecular biological basis for the increase in the RBE for radiation sources with a mean LET value [<=]10 keV/[mu]m.

  5. Association between human leukocyte antigen-G 14-bp insertion/deletion polymorphism and cancer risk: a meta-analysis and systematic review.

    Science.gov (United States)

    Ge, Yu-Zheng; Ge, Qian; Li, Ming-Hao; Shi, Guo-Mei; Xu, Xiao; Xu, Lu-Wei; Xu, Zheng; Lu, Tian-Ze; Wu, Ran; Zhou, Liu-Hua; Wu, Jian-Ping; Liang, Kai; Dou, Quan-Liang; Zhu, Jia-Geng; Li, Wen-Cheng; Jia, Rui-Peng

    2014-08-01

    Human leukocyte antigen-G (HLA-G) is involved in the development and progression of human cancers, and numerous molecular epidemiological studies have been conducted to explore the potential relationship of HLA-G 14-bp insertion/deletion (ins/del) polymorphism with cancer risk. However, results from published studies were inconclusive. Both PUBMED and EMBASE databases were searched comprehensively to identify eligible studies investigating the association of HLA-G 14-bp ins/del polymorphism with cancer risk. Statistical analysis was performed by using STATA 12.0 and Review Manager 5.0. Fourteen eligible studies with 2340 cancer patients and 3967 controls were included and analyzed with odds ratio (OR) and its corresponding 95% confidence interval (CI). Overall, no significant association between HLA-G 14-bp ins/del polymorphism and overall cancer risk was detected in all comparison models. Further subgroup analyses based on ethnicity and cancer types demonstrated the significant association among Asians (ins/del vs. del/del: OR = 0.80, 95% CI, 0.66-0.95; ins/ins+ins/del vs. del/del: OR = 0.80, 95% CI, 0.65-0.97) and for breast cancer (ins allele vs. del allele: OR = 0.76, 95% CI, 0.61-0.96; ins/ins vs. del/del: OR = 0.57, 95% CI, 0.37-0.87; and ins/ins vs. ins/del+del/del: OR = 0.60, 95% CI, 0.42-0.87). This study suggested that HLA-G 14-bp ins/del polymorphism might contribute to breast cancer susceptibility and overall cancer risk among Asians. Further well-designed studies with larger sample size are warranted to validate our conclusion. Copyright © 2014 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  6. Impact of the 7-bp deletion in HvGA20ox2 gene on agronomic important traits in barley (Hordeum vulgare L.).

    Science.gov (United States)

    Teplyakova, Serafima; Lebedeva, Marina; Ivanova, Nadezhda; Horeva, Valentina; Voytsutskaya, Nina; Kovaleva, Olga; Potokina, Elena

    2017-11-14

    Alike to Reduced height-1 (Rht-1) genes in wheat and the semi dwarfing (sd-1) gene in rice, the sdw1/denso locus involved in the metabolism of the GA, was designated as the 'Green Revolution' gene in barley. The recent molecular characterization of the candidate gene HvGA20ox2 for sdw1/denso locus allows to estimate the impact of the functional polymorphism of this gene on the variation of agronomically important traits in barley. We investigated the effect of the 7-bp deletion in exon 1 of HvGA20ox2 gene (sdw1.d mutation) on the variation of yield-related and malting quality traits in the population of DHLs derived from cross of medium tall barley Morex and semi-dwarf barley Barke. Segregation of plant height, flowering time, thousand grain weight, grain protein content and grain starch was evaluated in two diverse environments separated from one another by 15° of latitude. The 7-bp deletion in HvGA20ox2 gene reduced plant height by approximately 13 cm and delayed flowering time by 3-5 days in the barley segregating DHLs population independently on environmental cue. On other hand, the sdw1.d mutation did not affect significantly either grain quality traits (protein and starch content) or thousand grain weight. The beneficial effect of the sdw1.d allele could be associated in barley with lodging resistance and extended period of vegetative growth allowing to accumulate additional biomass that supports higher yield in certain environments. However, no direct effect of the sdw1.d mutation on thousand grain weight or grain quality traits in barley was detected.

  7. Association between DBH 19bp insertion/deletion polymorphism and cognition in schizophrenia with and without tardive dyskinesia.

    Science.gov (United States)

    Hui, Li; Han, Mei; Yin, Guang Zhong; Zhang, Yingyang; Huang, Xu Feng; Qian, Zheng Kang; Gu, Wei Guo; Gu, Xiao Chu; Zhu, Xiao Min; Soares, Jair C; Ning, Yuping; Zheng, Yingjun; Du, Xiang Dong; Zhang, Xiang Yang

    2017-04-01

    Long-term antipsychotic treatment for schizophrenia is associated with the development of tardive dyskinesia (TD), which is involved in increased cognitive impairment. Dopamine beta-hydroxylase (DBH) gene associated with dopamine and norepinephrine systems influences cognition. Schizophrenia with TD have higher DBH activity than those without TD. This study examined whether DBH5'-insertion/deletion (-Ins/Del) polymorphism could influence cognitive function in schizophrenia with and without TD. The presence of DBH5'-Ins/Del polymorphism was determined in 345 schizophrenia with TD and 397 schizophrenia without TD. The Abnormal Involuntary Movement Scale and Repeatable Battery for Assessment of Neuropsychological Status (RBANS) were used to assess TD severity and cognition. The allele and genotype frequencies of DBH5'-Ins/Del polymorphism did not differ between patients with and without TD (both p>0.05). RBANS total score and subscales did not differ by DBH5'-Ins/Del genotype groups in patients with TD (all p>0.05). However, attention score significantly differed by DBH5'-Ins/Del genotype groups in those without TD (pschizophrenia with TD, but it may influence cognitive function in schizophrenia with non-TD. Moreover, schizophrenia with TD experienced greater cognitive deficits than those with non-TD, especially in immediate memory and attention. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. The ID genotype of MDM2 40 bp insertion/deletion polymorphism was associated with lower risk of SLE.

    Science.gov (United States)

    Salimi, Saeedeh; Rezaei, Mahnaz; Mohammadpour-Gharehbagh, Abbas; Sajadian, Mojtaba; Sandoughi, Mahnaz

    2017-07-04

    In patients with systemic lupus erythematosus (SLE), loss of immunological tolerance to self-nuclear antigens and abnormal activation of self-reactive T and B cells lead to self-antibodies and immune complex production. The autoreactive lymphocytes are removed by the apoptotic process in healthy individuals; however, apoptosis disruption could cause accumulation of apoptotic bodies and nuclear debris. Therefore, apoptosis plays a crucial role in the pathogenesis of autoimmune diseases. To investigate the association between two polymorphisms in an apoptotic-related gene, MDM2, and SLE. A case-control study was conducted on 200 patients with SLE and 206 healthy volunteers matched for age, sex, and ethnicity. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and PCR methods were used for genotyping. No association was found between the MDM2 T309G polymorphism (rs2279744) and SLE. The ID genotype of the insertion/deletion (I/D) polymorphism (rs3730485) was significantly lower in patients with SLE, and the ID genotype could be a protective factor for SLE. The DD genotype was not associated with SLE. The frequency of combined TT/ID and GG/ID genotypes of MDM2 T309G and I/D polymorphisms was lower in the patients with SLE and was associated with a lower risk of SLE. The frequency of the TD haplotype of MDM2 T309G and I/D polymorphisms was significantly lower in patients with SLE and could reduce the SLE risk. The ID genotype of the MDM2 I/D polymorphism was associated with a lower risk of SLE. There was no association between MDM2 T309G polymorphism and SLE. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  9. Adaptive BP-Dock: An Induced Fit Docking Approach for Full Receptor Flexibility.

    Science.gov (United States)

    Bolia, Ashini; Ozkan, S Banu

    2016-04-25

    We present an induced fit docking approach called Adaptive BP-Dock that integrates perturbation response scanning (PRS) with the flexible docking protocol of RosettaLigand in an adaptive manner. We first perturb the binding pocket residues of a receptor and obtain a new conformation based on the residue response fluctuation profile using PRS. Next, we dock a ligand to this new conformation by RosettaLigand, where we repeat these steps for several iterations. We test this approach on several protein test sets including difficult unbound docking cases such as HIV-1 reverse transcriptase and HIV-1 protease. Adaptive BP-Dock results show better correlation with experimental binding affinities compared to other docking protocols. Overall, the results imply that Adaptive BP-Dock can easily capture binding induced conformational changes by simultaneous sampling of protein and ligand conformations. This can provide faster and efficient docking of novel targets for rational drug design.

  10. [Chromosomal large fragment deletion induced by CRISPR/Cas9 gene editing system].

    Science.gov (United States)

    Cheng, L H; Liu, Y; Niu, T

    2017-05-14

    Objective: Using CRISPR-Cas9 gene editing technology to achieve a number of genes co-deletion on the same chromosome. Methods: CRISPR-Cas9 lentiviral plasmid that could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse 11B3 chromosome was constructed via molecular clone. HEK293T cells were transfected to package lentivirus of CRISPR or Cas9 cDNA, then mouse NIH3T3 cells were infected by lentivirus and genomic DNA of these cells was extracted. The deleted fragment was amplified by PCR, TA clone, Sanger sequencing and other techniques were used to confirm the deletion of Aloxe3-Alox12b-Alox8 cluster genes. Results: The CRISPR-Cas9 lentiviral plasmid, which could induce deletion of Aloxe3-Alox12b-Alox8 cluster genes, was successfully constructed. Deletion of target chromosome fragment (Aloxe3-Alox12b-Alox8 cluster genes) was verified by PCR. The deletion of Aloxe3-Alox12b-Alox8 cluster genes was affirmed by TA clone, Sanger sequencing, and the breakpoint junctions of the CRISPR-Cas9 system mediate cutting events were accurately recombined, insertion mutation did not occur between two cleavage sites at all. Conclusion: Large fragment deletion of Aloxe3-Alox12b-Alox8 cluster genes located on mouse chromosome 11B3 was successfully induced by CRISPR-Cas9 gene editing system.

  11. Subepidermal blistering induced by human autoantibodies to BP180 requires innate immune players in a humanized bullous pemphigoid mouse model.

    Science.gov (United States)

    Liu, Zhi; Sui, Wen; Zhao, Minglang; Li, Zhuowei; Li, Ning; Thresher, Randy; Giudice, George J; Fairley, Janet A; Sitaru, Cassian; Zillikens, Detlef; Ning, Gang; Marinkovich, M Peter; Diaz, Luis A

    2008-12-01

    Bullous pemphigoid (BP) is a cutaneous autoimmune inflammatory disease associated with subepidermal blistering and autoantibodies against BP180, a transmembrane collagen and major component of the hemidesmosome. Numerous inflammatory cells infiltrate the upper dermis in BP. IgG autoantibodies in BP fix complement and target multiple BP180 epitopes that are highly clustered within a non-collagen linker domain, termed NC16A. Anti-BP180 antibodies induce BP in mice. In this study, we generated a humanized mouse strain, in which the murine BP180NC14A is replaced with the homologous human BP180NC16A epitope cluster region. We show that the humanized NC16A (NC16A+/+) mice injected with anti-BP180NC16A autoantibodies develop BP-like subepidermal blisters. The F(ab')(2) fragments of pathogenic IgG fail to activate the complement cascade and are no longer pathogenic. The NC16A+/+ mice pretreated with mast cell activation blocker or depleted of complement or neutrophils become resistant to BP. These findings suggest that the humoral response in BP critically depends on innate immune system players.

  12. A 2 bp deletion in the mitochondrial ATP 6 gene responsible for the NARP (neuropathy, ataxia, and retinitis pigmentosa) syndrome.

    Science.gov (United States)

    Mordel, Patrick; Schaeffer, Stéphane; Dupas, Quentin; Laville, Marie-Alice; Gérard, Marion; Chapon, Françoise; Allouche, S

    2017-12-09

    Mitochondrial (mt) DNA-associated NARP (neurogenic muscle weakness, ataxia, and retinitis pigmentosa) syndrome is due to mutation in the MT-ATP6 gene. We report the case of a 18-year-old man who presented with deafness, a myoclonic epilepsy, muscle weakness since the age of 10 and further developed a retinitis pigmentosa and ataxia. The whole mtDNA analysis by next-generation sequencing revealed the presence of the 2 bp microdeletion m.9127-9128 del AT in the ATP6 gene at 82% heteroplasmy in muscle and to a lower load in blood (10-20%) and fibroblasts (50%). Using the patient's fibroblasts, we demonstrated a 60% reduction of the oligomycin-sensitive ATPase hydrolytic activity, a 40% decrease in the ATP synthesis and determination of the mitochondrial membrane potential using the fluorescent probe tetramethylrhodamine, ethyl ester indicated a significant reduction in oligomycin sensitivity. In conclusion, we demonstrated that this novel AT deletion in the ATP6 gene is pathogenic and responsible for the NARP syndrome. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

    Directory of Open Access Journals (Sweden)

    Gregory N. Thyssen

    2016-06-01

    Full Text Available Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes.

  14. The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum) Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene.

    Science.gov (United States)

    Thyssen, Gregory N; Fang, David D; Zeng, Linghe; Song, Xianliang; Delhom, Christopher D; Condon, Tracy L; Li, Ping; Kim, Hee Jin

    2016-06-01

    Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im) gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR) gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes. Copyright © 2016 Thyssen et al.

  15. Inhibition of HIF-1{alpha} activity by BP-1 ameliorates adjuvant induced arthritis in rats

    Energy Technology Data Exchange (ETDEWEB)

    Shankar, J. [Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago (United States); Thippegowda, P.B., E-mail: btprabha@uic.edu [Department of Pharmacology, (M/C 868), College of Medicine, University of Illinois at Chicago, 835 S. Wolcott Ave., Chicago, IL 60612 (United States); Kanum, S.A. [Department of Chemistry, Yuvaraj' s College, University of Mysore, Mysore (India)

    2009-09-18

    Rheumatoid arthritis (RA) is a chronic inflammatory, angiogenic disease. Inflamed synovitis is a hallmark of RA which is hypoxic in nature. Vascular endothelial growth factor (VEGF), one of the key regulators of angiogenesis, is overexpressed in the pathogenesis of RA. VEGF expression is regulated by hypoxia-inducible factor-1{alpha} (HIF-1{alpha}), a master regulator of homeostasis which plays a pivotal role in hypoxia-induced angiogenesis. In this study we show that synthetic benzophenone analogue, 2-benzoyl-phenoxy acetamide (BP-1) can act as a novel anti-arthritic agent in an experimental adjuvant induced arthritis (AIA) rat model by targeting VEGF and HIF-1{alpha}. BP-1 administered hypoxic endothelial cells and arthritic animals clearly showed down regulation of VEGF expression. Further, BP-1 inhibits nuclear translocation of HIF-1{alpha}, which in turn suppresses transcription of the VEGF gene. These results suggest a further possible clinical application of the BP-1 derivative as an anti-arthritic agent in association with conventional chemotherapeutic agents.

  16. Isolation and Functional Validation of Salinity and Osmotic Stress Inducible Promoter from the Maize Type-II H+-Pyrophosphatase Gene by Deletion Analysis in Transgenic Tobacco Plants.

    Directory of Open Access Journals (Sweden)

    Jiajia Hou

    Full Text Available Salinity and drought severely affect both plant growth and productivity, making the isolation and characterization of salinity- or drought-inducible promoters suitable for genetic improvement of crop resistance highly desirable. In this study, a 1468-bp sequence upstream of the translation initiation codon ATG of the promoter for ZmGAPP (maize Type-II H+-pyrophosphatase gene was cloned. Nine 5´ deletion fragments (D1-D9 of different lengths of the ZmGAPP promoter were fused with the GUS reporter and translocated into tobacco. The deletion analysis showed that fragments D1-D8 responded well to NaCl and PEG stresses, whereas fragment D9 and CaMV 35S did not. The D8 segment (219 bp; -219 to -1 bp exhibited the highest promoter activity of all tissues, with the exception of petals among the D1-D9 transgenic tobacco, which corresponds to about 10% and 25% of CaMV 35S under normal and NaCl or PEG stress conditions, respectively. As such, the D8 segment may confer strong gene expression in a salinity and osmotic stress inducible manner. A 71-bp segment (-219 to -148 bp was considered as the key region regulating ZmGAPP response to NaCl or PEG stress, as transient transformation assays demonstrated that the 71-bp sequence was sufficient for the salinity or osmotic stress response. These results enhance our understanding of the molecular mechanisms regulating ZmGAPP expression, and that the D8 promoter would be an ideal candidate for moderating expression of drought and salinity response genes in transgenic plants.

  17. Polypeptone induces dramatic cell lysis in ura4 deletion mutants of fission yeast.

    Directory of Open Access Journals (Sweden)

    Yuzy Matsuo

    Full Text Available Polypeptone is widely excluded from Schizosaccharomyces pombe growth medium. However, the reasons why polypeptone should be avoided have not been documented. Polypeptone dramatically induced cell lysis in the ura4 deletion mutant when cells approached the stationary growth phase, and this phenotype was suppressed by supplementation of uracil. To determine the specificity of this cell lysis phenotype, we created deletion mutants of other genes involved in de novo biosynthesis of uridine monophosphate (ura1, ura2, ura3, and ura5. Cell lysis was not observed in these gene deletion mutants. In addition, concomitant disruption of ura1, ura2, ura3, or ura5 in the ura4 deletion mutant suppressed cell lysis, indicating that cell lysis induced by polypeptone is specific to the ura4 deletion mutant. Furthermore, cell lysis was also suppressed when the gene involved in coenzyme Q biosynthesis was deleted. This is likely because Ura3 requires coenzyme Q for its activity. The ura4 deletion mutant was sensitive to zymolyase, which mainly degrades (1,3-beta-D glucan, when grown in the presence of polypeptone, and cell lysis was suppressed by the osmotic stabiliser, sorbitol. Finally, the induction of cell lysis in the ura4 deletion mutant was due to the accumulation of orotidine-5-monophosphate. Cell wall integrity was dramatically impaired in the ura4 deletion mutant when grown in the presence of polypeptone. Because ura4 is widely used as a selection marker in S. pombe, caution needs to be taken when evaluating phenotypes of ura4 mutants.

  18. Neuronal Deletion of Ghrelin Receptor Almost Completely Prevents Diet-Induced Obesity.

    Science.gov (United States)

    Lee, Jong Han; Lin, Ligen; Xu, Pingwen; Saito, Kenji; Wei, Qiong; Meadows, Adelina G; Bongmba, Odelia Y N; Pradhan, Geetali; Zheng, Hui; Xu, Yong; Sun, Yuxiang

    2016-08-01

    Ghrelin signaling has major effects on energy and glucose homeostasis, but it is unknown whether ghrelin's functions are centrally and/or peripherally mediated. The ghrelin receptor, growth hormone secretagogue receptor (GHS-R), is highly expressed in the brain and detectable in some peripheral tissues. To understand the roles of neuronal GHS-R, we generated a mouse line where Ghsr gene is deleted in all neurons using synapsin 1 (Syn1)-Cre driver. Our data showed that neuronal Ghsr deletion abolishes ghrelin-induced spontaneous food intake but has no effect on total energy intake. Remarkably, neuronal Ghsr deletion almost completely prevented diet-induced obesity (DIO) and significantly improved insulin sensitivity. The neuronal Ghsr-deleted mice also showed improved metabolic flexibility, indicative of better adaption to different fuels. In addition, gene expression analysis suggested that hypothalamus and/or midbrain might be the sites that mediate the effects of GHS-R in thermogenesis and physical activity, respectively. Collectively, our results indicate that neuronal GHS-R is a crucial regulator of energy metabolism and a key mediator of DIO. Neuronal Ghsr deletion protects against DIO by regulating energy expenditure, not by energy intake. These novel findings suggest that suppressing central ghrelin signaling may serve as a unique antiobesity strategy. © 2016 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  19. Antibodies with higher bactericidal activity induced by a Neisseria gonorrhoeae Rmp deletion mutant strain.

    Directory of Open Access Journals (Sweden)

    Guocai Li

    Full Text Available Neisseria gonorrhoeae (N. gonorrhoeae outer membrane protein reduction modifiable protein (Rmp has strong immunogenicity. However, anti-Rmp antibodies block rather than preserve the antibacterial effects of protective antibodies, which hampers the development of vaccines for gonococcal infections. We herein constructed an Rmp deletion mutant strain of N. gonorrhoeae by gene homologous recombination. The 261-460 nucleotide residues of Rmp gene amplified from N. gonorrhoeae WHO-A strain were replaced with a kanamycin-resistant Kan gene amplified from pET-28a. The resultant hybridized DNA was transformed into N. gonorrhoeae WHO-A strain. PCR was used to screen the colonies in which wild-type Rmp gene was replaced with a mutant gene fragment. Western blotting revealed that the Rmp deletion mutant strain did not express Rmp protein. Rmp deletion did not alter the morphological and Gram staining properties of the mutant strain that grew slightly more slowly than the wild-type one. Rmp gene mutated stably throughout 25 generations of passage. Antibody-mediated complement-dependent cytotoxicity assay indicated that the antibodies induced by the mutant strain had evidently higher bactericidal activities than those induced by the wild-type strain. Further modification of the Rmp deletion mutant strain is still required in the development of novel live attenuated vaccines for gonorrhea by Opa genes deletion or screening of phenotypic variant strains that do not express Opa proteins.

  20. Antibodies with higher bactericidal activity induced by a Neisseria gonorrhoeae Rmp deletion mutant strain.

    Science.gov (United States)

    Li, Guocai; Xie, Rushan; Zhu, Xiaoping; Mao, Yanli; Liu, Shuangxi; Jiao, Hongmei; Yan, Hua; Xiong, Kun; Ji, Mingchun

    2014-01-01

    Neisseria gonorrhoeae (N. gonorrhoeae) outer membrane protein reduction modifiable protein (Rmp) has strong immunogenicity. However, anti-Rmp antibodies block rather than preserve the antibacterial effects of protective antibodies, which hampers the development of vaccines for gonococcal infections. We herein constructed an Rmp deletion mutant strain of N. gonorrhoeae by gene homologous recombination. The 261-460 nucleotide residues of Rmp gene amplified from N. gonorrhoeae WHO-A strain were replaced with a kanamycin-resistant Kan gene amplified from pET-28a. The resultant hybridized DNA was transformed into N. gonorrhoeae WHO-A strain. PCR was used to screen the colonies in which wild-type Rmp gene was replaced with a mutant gene fragment. Western blotting revealed that the Rmp deletion mutant strain did not express Rmp protein. Rmp deletion did not alter the morphological and Gram staining properties of the mutant strain that grew slightly more slowly than the wild-type one. Rmp gene mutated stably throughout 25 generations of passage. Antibody-mediated complement-dependent cytotoxicity assay indicated that the antibodies induced by the mutant strain had evidently higher bactericidal activities than those induced by the wild-type strain. Further modification of the Rmp deletion mutant strain is still required in the development of novel live attenuated vaccines for gonorrhea by Opa genes deletion or screening of phenotypic variant strains that do not express Opa proteins.

  1. Deletion of ASK1 Protects against Hyperoxia-Induced Acute Lung Injury.

    Directory of Open Access Journals (Sweden)

    Jutaro Fukumoto

    Full Text Available Apoptosis signal-regulating kinase 1 (ASK1, a member of the MAPK kinase kinase kinase (MAP3K family, is activated by various stimuli, which include oxidative stress, endoplasmic reticulum (ER stress, calcium influx, DNA damage-inducing agents and receptor-mediated signaling through tumor necrosis factor receptor (TNFR. Inspiration of a high concentration of oxygen is a palliative therapy which counteracts hypoxemia caused by acute lung injury (ALI-induced pulmonary edema. However, animal experiments so far have shown that hyperoxia itself could exacerbate ALI through reactive oxygen species (ROS. Our previous data indicates that ASK1 plays a pivotal role in hyperoxia-induced acute lung injury (HALI. However, it is unclear whether or not deletion of ASK1 in vivo protects against HALI. In this study, we investigated whether ASK1 deletion would lead to attenuation of HALI. Our results show that ASK1 deletion in vivo significantly suppresses hyperoxia-induced elevation of inflammatory cytokines (i.e. IL-1β and TNF-α, cell apoptosis in the lung, and recruitment of immune cells. In summary, the results from the study suggest that deletion of ASK1 in mice significantly inhibits hyperoxic lung injury.

  2. Effects of bpV(pic) and bpV(phen) on H9c2 cardiomyoblasts during both hypoxia/reoxygenation and H2O2-induced injuries.

    Science.gov (United States)

    Tian, Youqing; Daoud, Abdelkader; Shang, Jing

    2012-03-01

    Reactive oxygen species (ROS) are involved in myocardial injury. ROS are known to inactivate lipid phosphatase and tension homolog on chromosome 10 (PTEN), an enzyme that increases apoptosis in neonatal cardiomyocytes. BpV(pic) and bpV(phen), two bisperoxovanadium molecules and PTEN inhibitors, may be involved in limiting myocardial infarction. To compare the protective effects of bpV(pic) and bpV(phen) on ROS-induced cardiomyocyte injury and their possible mechanisms, we selected two popular models of hypoxia/reoxygenation (H/R) and H2O2-induced injury in H9c2 cardiomyoblasts to investigate their effects against injury. We found that pre-treatment with bpV(pic) and bpV(phen) increased the viability and protected the morphology of H9c2 cells under the conditions of H/R and H2O2 by inhibiting LDH release, apoptosis and caspases 3/8/9 activities. However, their respective inhibitory abilities in the two models were different, suggesting that the quantity of ROS from the two models might be different. However, the conflict between ROS and PTEN may affect the action of bpV(pic) and bpV(phen). Taken together, the results demonstrate that bpV(pic) and bpV(phen) have inhibitory effects on oxidative stress-induced cardiomyocyte injury that may be partially modulated by the action of ROS on PTEN.

  3. Transduced PEP-1-FK506BP ameliorates corneal injury in Botulinum toxin A-induced dry eye mouse model

    Science.gov (United States)

    Kim, Dae Won; Lee, Sung Ho; Ku, Sae Kwang; Cho, Soo Hyun; Cho, Sung-Woo; Yoon, Ga Hyeon; Hwang, Hyun Sook; Park, Jinseu; Eum, Won Sik; Kwon, Oh-Shin; Choi, Soo Young

    2013-01-01

    FK506 binding protein 12 (FK506BP) belongs to a family of immunophilins, and is involved in multiple biological processes. However, the function of FK506BP in corneal disease remains unclear. In this study, we examined the protective effects on dry eye disease in a Botulinum toxin A (BTX-A) induced mouse model, using a cell-permeable PEP-1-FK506BP protein. PEP-1-FK506BP efficiently transduced into human corneal epithelial cells in a time- and dose-dependent manner, and remained stable in the cells for 48 h. In addition, we demonstrated that topical application of PEP-1-FK506BP was transduced into mouse cornea and conjunctiva by immunohistochemistry. Furthermore, topical application of PEP-1-FK506BP to BTX-A-induced mouse model markedly inhibited expression levels of pro-inflammatory cytokines such as interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α) and macrophage inhibitory factor (MIF) in corneal and conjunctival epithelium. These results suggest PEP-1-FK506BP as a potential therapeutic agent for dry eye diseases. [BMB Reports 2013; 46(2): 124-129] PMID:23433117

  4. Adaptor protein 3BP2 and cherubism.

    Science.gov (United States)

    Hatani, Tomoko; Sada, Kiyonao

    2008-01-01

    The adaptor protein 3BP2 (c-Abl Src homology 3 domain-binding protein-2, also referred to SH3BP2) is known to play a regulatory role in signaling from immunoreceptors. In mast cells, 3BP2 is rapidly tyrosine phosphorylated by the aggregation of the high affinity IgE receptor and the overexpression of its SH2 domain results in the dramatic suppression of IgE-mediated tyrosine phosphorylation of PLC-alpha, Ca2+ mobilization and degranulation. 3BP2 is a substrate of the protein-tyrosine kinase Syk, which phosphorylates it on Tyr174, Tyr183, and Tyr446 (in the mouse protein). Phosphorylation of Tyr183 promotes the activation of Rac1 through the interaction with the SH2 domain of Vav1. Phosphorylation of Tyr446 induces the binding to the SH2 domain of the upstream protein-tyrosine kinase Lyn and enhances its kinase activity. Thus, 3BP2 has a positive regulatory role in IgE-mediated mast cell activation. In lymphocytes, engagement of T cell or B cell receptors triggers tyrosine phosphorylation of 3BP2. Suppression of the 3BP2 expression by siRNA results in the inhibition of T cell or B cell receptor-mediated activation of NFAT. Genetic analyses reveal that 3BP2 is required for the proliferation of B cells and B cell receptor signaling. Point mutations of the 3BP2 gene cause the rare human inherited disorder cherubism, characterized by excessive bone resorption in the jaw bones. These mutations include substitution and deletion mutations of 3BP2. "Cherubism" mice exhibit increased myeloid cell responses to M-CSF and RANKL leading to the activation of osteoclasts. Further analysis could demonstrate that inhibition of 3BP2 might have therapeutic potential.

  5. CtBP1/BARS is an activator of phospholipase D1 necessary for agonist-induced macropinocytosis.

    Science.gov (United States)

    Haga, Yuki; Miwa, Noriko; Jahangeer, Saleem; Okada, Taro; Nakamura, Shun-ichi

    2009-05-06

    Vesicular trafficking such as macropinocytosis is a dynamic process that requires coordinated interactions between specialized proteins and lipids. A recent report suggests the involvement of CtBP1/BARS in epidermal growth factor (EGF)-induced macropinocytosis. Detailed mechanisms as to how lipid remodelling is regulated during macropinocytosis are still undefined. Here, we show that CtBP1/BARS is a physiological activator of PLD1 required in agonist-induced macropinocytosis. EGF-induced macropinocytosis was specifically blocked by 1-butanol but not by 2-butanol. In addition, stimulation of cells by serum or EGF resulted in the association of CtBP1/BARS with PLD1. Finally, CtBP1/BARS activated PLD1 in a synergistic manner with other PLD activators, including ADP-ribosylation factors as demonstrated by in vitro and intact cell systems. The present results shed light on the molecular basis of how the 'fission protein' CtBP1/BARS controls vesicular trafficking events including macropinocytosis.

  6. CacyBP/SIP nuclear translocation induced by gastrin promotes gastric cancer cell proliferation.

    Science.gov (United States)

    Zhai, Hui-Hong; Meng, Juan; Wang, Jing-Bo; Liu, Zhen-Xiong; Li, Yuan-Fei; Feng, Shan-Shan

    2014-08-07

    To investigate the role of nuclear translocation of calcyclin binding protein, also called Siah-1 interacting protein (CacyBP/SIP), in gastric carcinogenesis. The expression of CacyBP/SIP protein in gastric cancer cell lines was detected by Western blot. Immunofluorescence experiments were performed on gastric cancer cell lines that had been either unstimulated or stimulated with gastrin. To confirm the immunofluorescence findings, the relative abundance of CacyBP/SIP in nuclear and cytoplasmic compartments was assessed by Western blot. The effect of nuclear translocation of CacyBP/SIP on cell proliferation was examined using MTT assay. The colony formation assay was used to measure clonogenic cell survival. The effect of CacyBP/SIP nuclear translocation on cell cycle progression was investigated. Two CacyBP/SIP-specific siRNA vectors were designed and constructed to inhibit CacyBP/SIP expression in order to reduce the nuclear translocation of CacyBP/SIP, and the expression of CacyBP/SIP in stably transfected cells was determined by Western blot. The effect of inhibiting CacyBP/SIP nuclear translocation on cell proliferation was then assessed. CacyBP/SIP protein was present in most of gastric cancer cell lines. In unstimulated cells, CacyBP/SIP was distributed throughout the cytoplasm; while in stimulated cells, CacyBP/SIP was found mainly in the perinuclear region. CacyBP/SIP nuclear translocation generated a growth-stimulatory effect on cells. The number of colonies in the CacyBP/SIP nuclear translocation group was significantly higher than that in the control group. The percentage of stimulated cells in G1 phase was significantly lower than that of control cells (69.70% ± 0.46% and 65.80% ± 0.60%, control cells and gastrin-treated SGC7901 cells, P = 0.008; 72.99% ± 0.46% and 69.36% ± 0.51%, control cells and gastrin-treated MKN45 cells, P = 0.022). CacyBP/SIPsi1 effectively down-regulated the expression of CacyBP/SIP, and cells stably transfected by CacyBP

  7. Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice

    Directory of Open Access Journals (Sweden)

    Shih-Yin Tsai

    2016-08-01

    Full Text Available Obesity is a major risk factor driving the global type II diabetes pandemic. However, the molecular factors linking obesity to disease remain to be elucidated. Gender differences are apparent in humans and are also observed in murine models. Here, we link these differences to expression of eukaryotic translation initiation factor 4E binding protein 1 (4E-BP1, which, upon HFD feeding, becomes significantly reduced in the skeletal muscle and adipose tissue of male but not female mice. Strikingly, restoring 4E-BP1 expression in male mice protects them against HFD-induced obesity and insulin resistance. Male 4E-BP1 transgenic mice also exhibit reduced white adipose tissue accumulation accompanied by decreased circulating levels of leptin and triglycerides. Importantly, transgenic 4E-BP1 male mice are also protected from aging-induced obesity and metabolic decline on a normal diet. These results demonstrate that 4E-BP1 is a gender-specific suppressor of obesity that regulates insulin sensitivity and energy metabolism.

  8. A closed-tube assay for genotyping of the 32-bp deletion polymorphism in the chemokine receptor 5 (CCR5) gene

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Werge, Thomas

    2007-01-01

    in the presence of Sybr Green I for allele discrimination. After having established robust conditions for the assay, we used it to genotype 590 unknown DNA samples. A blinded comparison with a procedure based upon agarose gel electrophoresis of amplified material revealed complete concordance between the two...... procedures. Our closed-tube assay is inexpensive and easy to carry out. Furthermore, it reduces or eliminates the risk of carry-over contamination with previously amplified products. The insights gained in this study can be applied to develop assays for genotyping of other insertion/deletion polymorphisms...

  9. NLRP3 deletion protects from hyperoxia-induced acute lung injury.

    Science.gov (United States)

    Fukumoto, Jutaro; Fukumoto, Itsuko; Parthasarathy, Prasanna Tamarapu; Cox, Ruan; Huynh, Bao; Ramanathan, Gurukumar Kollongod; Venugopal, Rajan Babu; Allen-Gipson, Diane S; Lockey, Richard F; Kolliputi, Narasaiah

    2013-07-15

    Inspiration of a high concentration of oxygen, a therapy for acute lung injury (ALI), could unexpectedly lead to reactive oxygen species (ROS) production and hyperoxia-induced acute lung injury (HALI). Nucleotide-binding domain and leucine-rich repeat PYD-containing protein 3 (NLRP3) senses the ROS, triggering inflammasome activation and interleukin-1β (IL-1β) production and secretion. However, the role of NLRP3 inflammasome in HALI is unclear. The main aim of this study is to determine the effect of NLRP3 gene deletion on inflammatory response and lung epithelial cell death. Wild-type (WT) and NLRP3(-/-) mice were exposed to 100% O2 for 48-72 h. Bronchoalveolar lavage fluid and lung tissues were examined for proinflammatory cytokine production and lung inflammation. Hyperoxia-induced lung pathological score was suppressed in NLRP3(-/-) mice compared with WT mice. Hyperoxia-induced recruitment of inflammatory cells and elevation of IL-1β, TNFα, macrophage inflammatory protein-2, and monocyte chemoattractant protein-1 were attenuated in NLRP3(-/-) mice. NLRP3 deletion decreased lung epithelial cell death and caspase-3 levels and a suppressed NF-κB levels compared with WT controls. Taken together, this research demonstrates for the first time that NLRP3-deficient mice have suppressed inflammatory response and blunted lung epithelial cell apoptosis to HALI.

  10. Identification of a Novel Heterozygous De Novo 7-bp Frameshift Deletion in PBX1 by Whole-Exome Sequencing Causing a Multi-Organ Syndrome Including Bilateral Dysplastic Kidneys and Hypoplastic Clavicles

    Directory of Open Access Journals (Sweden)

    Korbinian Maria Riedhammer

    2017-11-01

    Full Text Available IntroductionCongenital anomalies of the kidney and urinary tract (CAKUT represent the primary cause of chronic kidney disease in children. Many genes have been attributed to the genesis of this disorder. Recently, haploinsufficiency of PBX1 caused by microdeletions has been shown to result in bilateral renal hypoplasia and other organ malformations.Materials and methodsHere, we report on a 14-year-old male patient with congenital bilateral dysplastic kidneys, cryptorchidism, hypoplastic clavicles, developmental delay, impaired intelligence, and minor dysmorphic features. Presuming a syndromic origin, we performed SNP array analysis to scan for large copy number variations (CNVs followed by whole-exome sequencing (WES. Sanger sequencing was done to confirm the variant’s de novo status.ResultsSNP array analysis did not reveal any microdeletions or -duplications larger than 50 or 100 kb, respectively. WES identified a novel heterozygous 7-bp frameshift deletion in PBX1 (c.413_419del, p.Gly138Valfs*40 resulting in a loss-of-function. The de novo status could be confirmed by Sanger sequencing.DiscussionBy WES, we identified a novel heterozygous de novo 7-bp frameshift deletion in PBX1. Our findings expand the spectrum of causative variants in PBX1-related CAKUT. In this case, WES proved to be the apt technique to detect the variant responsible for the patient’s phenotype, as single gene testing is not feasible given the multitude of genes involved in CAKUT and SNP array analysis misses rare single-nucleotide variants and small Indels.

  11. SH3BP2 gain-of-function mutation exacerbates inflammation and bone loss in a murine collagen-induced arthritis model.

    Directory of Open Access Journals (Sweden)

    Tomoyuki Mukai

    Full Text Available SH3BP2 is a signaling adapter protein which regulates immune and skeletal systems. Gain-of-function mutations in SH3BP2 cause cherubism, characterized by jawbone destruction. This study was aimed to examine the role of SH3BP2 in inflammatory bone loss using a collagen-induced arthritis (CIA model.CIA was induced in wild-type (Sh3bp2(+/+ and heterozygous P416R SH3BP2 cherubism mutant knock-in (Sh3bp2(KI/+ mice, an SH3BP2 gain-of-function model. Severity of the arthritis was determined by assessing the paw swelling and histological analyses of the joints. Micro-CT analysis was used to determine the levels of bone loss. Inflammation and osteoclastogenesis in the joints were evaluated by quantitating the gene expression of inflammatory cytokines and osteoclast markers. Furthermore, involvement of the T- and B-cell responses was determined by draining lymph node cell culture and measurement of the serum anti-mouse type II collagen antibody levels, respectively. Finally, roles of the SH3BP2 mutation in macrophage activation and osteoclastogenesis were determined by evaluating the TNF-α production levels and osteoclast formation in bone marrow-derived M-CSF-dependent macrophage (BMM cultures.Sh3bp2(KI/+ mice exhibited more severe inflammation and bone loss, accompanying an increased number of osteoclasts. The mRNA levels for TNF-α and osteoclast marker genes were higher in the joints of Sh3bp2(KI/+ mice. Lymph node cell culture showed that lymphocyte proliferation and IFN-γ and IL-17 production were comparable between Sh3bp2(+/+ and Sh3bp2(KI/+ cells. Serum anti-type II collagen antibody levels were comparable between Sh3bp2(+/+ and Sh3bp2(KI/+ mice. In vitro experiments showed that TNF-α production in Sh3bp2(KI/+ BMMs is elevated compared with Sh3bp2(+/+ BMMs and that RANKL-induced osteoclastogenesis is enhanced in Sh3bp2(KI/+ BMMs associated with increased NFATc1 nuclear localization.Gain-of-function of SH3BP2 augments inflammation and bone loss

  12. Deletion of interleukin-6 prevents cardiac inflammation, fibrosis and dysfunction without affecting blood pressure in angiotensin II-high salt-induced hypertension.

    Science.gov (United States)

    González, Germán E; Rhaleb, Nour-Eddine; D'Ambrosio, Martin A; Nakagawa, Pablo; Liu, Yunhe; Leung, Pablo; Dai, Xiangguo; Yang, Xiao-Ping; Peterson, Edward L; Carretero, Oscar A

    2015-01-01

    Inflammation has been proposed as a key component in the development of hypertension and cardiac remodeling associated with different cardiovascular diseases. However, the role of the proinflammatory cytokine interleukin-6 in the chronic stage of hypertension is not well defined. Here, we tested the hypothesis that deletion of interleukin-6 protects against the development of hypertension, cardiac inflammation, fibrosis, remodeling and dysfunction induced by high salt diet and angiotensin II (Ang II). Male C57BL/6J and interleukin-6-knock out (KO) mice were implanted with telemetry devices for blood pressure (BP) measurements, fed a 4% NaCl diet, and infused with either vehicle or Ang II (90 ng/min per mouse subcutaneously) for 8 weeks. We studied BP and cardiac function by echocardiography at baseline, 4 and 8 weeks. Myocyte cross-sectional area (MCSA), macrophage infiltration, and myocardial fibrosis were also assessed. BP increased similarly in both strains when treated with Ang II and high salt (Ang II-high salt); however, C57BL/6J mice developed a more severe decrease in left ventricle ejection fraction, fibrosis, and macrophage infiltration compared with interleukin-6-KO mice. No differences between strains were observed in MCSA, capillary density and MCSA to capillary density ratio. In conclusion, absence of interleukin -6 did not alter the development of Ang II-high salt-induced hypertension and cardiac hypertrophy, but it prevented the development of cardiac dysfunction, myocardial inflammation, and fibrosis. This indicates that interleukin-6 plays an important role in hypertensive heart damage but not in the development of hypertension.

  13. Deletion of interleukin-6 prevents cardiac inflammation, fibrosis and dysfunction without affecting blood pressure in angiotensin II-high salt-induced hypertension

    Science.gov (United States)

    González, Germán E.; Rhaleb, Nour-Eddine; D’ambrosio, Martin A.; Nakagawa, Pablo; Liu, Yunhe; Leung, Pablo; Dai, Xiangguo; Yang, Xiao-Ping; Peterson, Edward L.; Carretero, Oscar A.

    2014-01-01

    Objective Inflammation has been proposed as a key component in the development of hypertension and cardiac remodeling associated with different cardiovascular diseases. However, the role of the proinflammatory cytokine interleukin-6 in the chronic stage of hypertension is not well defined. Here, we tested the hypothesis that deletion of interleukin-6 protects against the development of hypertension, cardiac inflammation, fibrosis, remodeling and dysfunction induced by high salt diet and angiotensin II (Ang II). Methods Male C57BL/6J and interleukin-6-knock out (KO) mice were implanted with telemetry devices for blood pressure (BP) measurements, fed a 4% NaCl diet, and infused with either vehicle or Ang II (90 ng/min per mouse subcutaneously) for 8 weeks. We studied BP and cardiac function by echocardiography at baseline, 4 and 8 weeks. Results Myocyte cross-sectional area (MCSA), macrophage infiltration, and myocardial fibrosis were also assessed. BP increased similarly in both strains when treated with Ang II and high salt (Ang II-high salt); however, C57BL/6J mice developed a more severe decrease in left ventricle ejection fraction, fibrosis, and macrophage infiltration compared with interleukin-6-KO mice. No differences between strains were observed in MCSA, capillary density and MCSA to capillary density ratio. Conclusion In conclusion, absence of interleukin -6 did not alter the development of Ang II-high salt-induced hypertension and cardiac hypertrophy, but it prevented the development of cardiac dysfunction, myocardial inflammation, and fibrosis. This indicates that interleukin-6 plays an important role in hypertensive heart damage but not in the development of hypertension. PMID:25304471

  14. ZnT3 Gene Deletion Reduces Colchicine-Induced Dentate Granule Cell Degeneration

    Directory of Open Access Journals (Sweden)

    Bo Young Choi

    2017-10-01

    Full Text Available Our previous study demonstrated that colchicine-induced dentate granule cell death is caused by blocking axonal flow and the accumulation of intracellular zinc. Zinc is concentrated in the synaptic vesicles via zinc transporter 3 (ZnT3, which facilitates zinc transport from the cytosol into the synaptic vesicles. The aim of the present study was to identify the role of ZnT3 gene deletion on colchicine-induced dentate granule cell death. The present study used young (3–5 months mice of the wild-type (WT or the ZnT3−/− genotype. Colchicine (10 µg/kg was injected into the hippocampus, and then brain sections were evaluated 12 or 24 h later. Cell death was evaluated by Fluoro-Jade B; oxidative stress was analyzed by 4-hydroxy-2-nonenal; and dendritic damage was detected by microtubule-associated protein 2. Zinc accumulation was detected by N-(6-methoxy-8-quinolyl-para-toluenesulfonamide (TSQ staining. Here, we found that ZnT3−/− reduced the number of degenerating cells after colchicine injection. The ZnT3−/−-mediated inhibition of cell death was accompanied by suppression of oxidative injury, dendritic damage and zinc accumulation. In addition, ZnT3−/− mice showed more glutathione content than WT mice and inhibited neuronal glutathione depletion by colchicine. These findings suggest that increased neuronal glutathione by ZnT3 gene deletion prevents colchicine-induced dentate granule cell death.

  15. Differential roles for Bim and Nur77 in thymocyte clonal deletion induced by ubiquitous self-antigen.

    Science.gov (United States)

    Hu, Qian Nancy; Baldwin, Troy A

    2015-03-15

    Negative selection, primarily mediated through clonal deletion of self-reactive thymocytes, is critical for establishing self-tolerance and preventing autoimmunity. Recent studies suggest that the molecular mechanisms of negative selection differ depending on the thymic compartment and developmental stage at which thymocytes are deleted. Using the physiological HY(cd4) TCR transgenic model of negative selection against ubiquitous self-antigen, we previously found that one of the principal mediators implicated in clonal deletion, Bim, is required for caspase-3 activation but is ultimately dispensable for negative selection. On the basis of these data, we hypothesized that Nur77, another molecule thought to be a key mediator of clonal deletion, could be responsible for Bim-independent deletion. Despite comparable Nur77 induction in thymocytes during negative selection, Bim deficiency resulted in an accumulation of high-affinity-signaled thymocytes as well as impairment in caspase-mediated and caspase-independent cell death. Although these data suggested that Bim may be required for Nur77-mediated cell death, we found that transgenic Nur77 expression was sufficient to induce apoptosis independently of Bim. However, transgenic Nur77-induced apoptosis was significantly inhibited in the context of TCR signaling, suggesting that endogenous Nur77 could be similarly regulated during negative selection. Although Nur77 deficiency alone did not alter positive or negative selection, combined deficiency in Bim and Nur77 impaired clonal deletion efficiency and significantly increased positive selection efficiency. Collectively, these data shed light on the different roles for Bim and Nur77 during ubiquitous Ag-mediated clonal deletion and highlight potential differences from their reported roles in tissue-restricted Ag-mediated clonal deletion. Copyright © 2015 by The American Association of Immunologists, Inc.

  16. Deletion of Rb1 induces both hyperproliferation and cell death in murine germinal center B cells.

    Science.gov (United States)

    He, Zhiwen; O'Neal, Julie; Wilson, William C; Mahajan, Nitin; Luo, Jun; Wang, Yinan; Su, Mack Y; Lu, Lan; Skeath, James B; Bhattacharya, Deepta; Tomasson, Michael H

    2016-03-01

    The retinoblastoma gene (RB1) has been implicated as a tumor suppressor in multiple myeloma (MM), yet its role remains unclear because in the majority of cases with 13q14 deletions, un-mutated RB1 remains expressed from the retained allele. To explore the role of Rb1 in MM, we examined the functional consequences of single- and double-copy Rb1 loss in germinal center B cells, the cells of origin of MM. We generated mice without Rb1 function in germinal center B cells by crossing Rb1(Flox/Flox) with C-γ-1-Cre (Cγ1) mice expressing the Cre recombinase in class-switched B cells in a p107(-/-) background to prevent p107 from compensating for Rb1 loss (Cγ1-Rb1(F/F)-p107(-/-)). All mice developed normally, but B cells with two copies of Rb1 deleted (Cγ1-Rb1(F/F)-p107(-/-)) exhibited increased proliferation and cell death compared with Cγ1-Rb1(+/+)-p107(-/-) controls ex vivo. In vivo, Cγ1-Rb1(F/F)-p107(-/-) mice had a lower percentage of splenic B220+ cells and reduced numbers of bone marrow antigen-specific secreting cells compared with control mice. Our data indicate that Rb1 loss induces both cell proliferation and death in germinal center B cells. Because no B-cell malignancies developed after 1 year of observation, our data also suggest that Rb1 loss is not sufficient to transform post-germinal center B cells and that additional, specific mutations are likely required to cooperate with Rb1 loss to induce malignant transformation. Copyright © 2016 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

  17. A nine-nucleotide deletion and splice variation in the coding region of the interferon induced ISG12 gene

    DEFF Research Database (Denmark)

    Smidt, Kamille; Hansen, Lise Lotte; Søgaard, T Max M

    2003-01-01

    Interferons (IFNs) are a family of cytokines with growth inhibitory, and antiviral functions. IFNs exert their biological actions through the expression of more than 1000 IFN stimulated genes, ISGs. ISG12 is an IFN type I induced gene encoding a protein of Mr 12,000. We have identified a novel, IFN...... inducible splice variant of ISG12 lacking exon 2 leading to a putative truncated protein isoform of Mr 7400, ISG12-S. In cells from blood and cervical cytobrush material from healthy women, the level of ISG12-S expression was higher than ISG12 expression, whereas the expression pattern was more evenly...... distributed between ISG12 and ISG12-S in breast carcinoma cells, in cancer cell lines and in cervical cytobrush material with neoplastic lesions. In addition, we have found a nine-nucleotide deletion situated in exon 4 of the ISG12 gene. This deletion leads to a three-amino-acid deletion (AMA) in the putative...

  18. Elevated levels of TRF2 induce telomeric ultrafine anaphase bridges and rapid telomere deletions.

    Science.gov (United States)

    Nera, Bernadette; Huang, Hui-Shun; Lai, Thao; Xu, Lifeng

    2015-12-07

    The shelterin protein TRF2 is essential for chromosome-end protection. Depletion of TRF2 causes chromosome end-to-end fusions, initiating genomic instability that can be cancer promoting. Paradoxically, significant increased levels of TRF2 are observed in a subset of human cancers. Experimental overexpression of TRF2 has also been shown to induce telomere shortening, through an unknown mechanism. Here we report that TRF2 overexpression results in replication stalling in duplex telomeric repeat tracts and the subsequent formation of telomeric ultrafine anaphase bridges (UFBs), ultimately leading to stochastic loss of telomeric sequences. These TRF2 overexpression-induced telomere deletions generate chromosome fusions resembling those detected in human cancers and in mammalian cells containing critically shortened telomeres. Therefore, our findings have uncovered a second pathway by which altered TRF2 protein levels can induce end-to-end fusions. The observations also provide mechanistic insight into the molecular basis of genomic instability in tumour cells containing significantly increased TRF2 levels.

  19. Identification of a 467 bp promoter of maize phosphatidylinositol synthase gene (ZmPIS which confers high–level gene expression and salinity or osmotic stress inducibility in transgenic tobacco

    Directory of Open Access Journals (Sweden)

    Hongli eZhang

    2016-02-01

    Full Text Available Salinity and drought often affect plant growth and crop yields. Cloning and identification of salinity and drought stress inducible promoters is of great significance for their use in the genetic improvement of crop resistance. Previous studies showed that phosphatidylinositol synthase (PIS is involved in plant salinity and drought stress responses but its promoter has not been characterized by far. In the study, the promoter (pZmPIS, 1834 bp upstream region of the translation initiation site was isolated from maize genome. To functionally validate the promoter, eight 5´ deletion fragments of pZmPIS in different lengths were fused to GUS to produce pZmPIS::GUS constructs and transformed into tobacco, namely PZ1-PZ8. The transcription activity and expression pattern obviously changed when the promoter was truncated. Previous studies have demonstrated that NaCl and PEG treatments are usually used to simulate salinity and drought treatments. The results showed that PZ1-PZ7 can respond well upon NaCl and PEG treatments, while PZ8 not. PZ7 (467 bp displayed the highest transcription activity in all tissues of transgenic tobacco amongst 5´ deleted promoter fragments, which corresponds to about 20% and 50% of CaMV35S under normal and NaCl or PEG treatment, respectively. This implied that PZ7 is the core region of pZmPIS which confers high-level gene expression and NaCl or PEG inducible nature. The 113 bp segment between PZ7 and PZ8 (-467 to -355 bp was considered as the key sequence for ZmPIS responding to NaCl or PEG treatment. GUS transient assay in tobacco leaves showed that this segment was sufficient for the NaCl or PEG stress response. Bioinformatic analysis revealed that the 113 bp sequence may contain new elements that are crucial for ZmPIS response to NaCl or PEG stress. These results promote our understanding on transcriptional regulation mechanism of ZmPIS and the characterized PZ7 promoter fragment would be an ideal candidate for the

  20. TARGETED DELETION OF INDUCIBLE HEAT SHOCK PROTEIN 70 ABROGATES THE LATE INFARCT-SPARING EFFECT OF MYOCARDIAL ISCHEMIC PRECONDITIONING

    Science.gov (United States)

    Abstract submitted for 82nd annual meeting of the American Association for Thoracic Surgery, May 4-8, 2002 in Washington D.C.Targeted Deletion of Inducible Heat Shock Protein 70 Abrogates the Late Infarct-Sparing Effect of Myocardial Ischemic PreconditioningCraig...

  1. ABCD1 deletion-induced mitochondrial dysfunction is corrected by SAHA: implication for adrenoleukodystrophy.

    Science.gov (United States)

    Baarine, Mauhamad; Beeson, Craig; Singh, Avtar; Singh, Inderjit

    2015-05-01

    X-linked Adrenoleukodystrophy (X-ALD), an inherited peroxisomal metabolic neurodegenerative disorder, is caused by mutations/deletions in the ATP-binding cassette transporter (ABCD1) gene encoding peroxisomal ABC transporter adrenoleukodystrophy protein (ALDP). Metabolic dysfunction in X-ALD is characterized by the accumulation of very long chain fatty acids ≥ C22:0) in the tissues and plasma of patients. Here, we investigated the mitochondrial status following deletion of ABCD1 in B12 oligodendrocytes and U87 astrocytes. This study provides evidence that silencing of peroxisomal protein ABCD1 produces structural and functional perturbations in mitochondria. Activities of electron transport chain-related enzymes and of citric acid cycle (TCA cycle) were reduced; mitochondrial redox status was dysregulated and the mitochondrial membrane potential was disrupted following ABCD1 silencing. A greater reduction in ATP levels and citrate synthase activities was observed in oligodendrocytes as compared to astrocytes. Furthermore, most of the mitochondrial perturbations induced by ABCD1 silencing were corrected by treating cells with suberoylanilide hydroxamic acid, an Histone deacetylase inhibitor. These observations indicate a novel relationship between peroxisomes and mitochondria in cellular homeostasis and the importance of intact peroxisomes in relation to mitochondrial integrity and function in the cell types that participate in the pathobiology of X-ALD. These observations suggest suberoylanilide hydroxamic acid as a potential therapy for X-ALD. Schematic description of the effects of loss of peroxisomal ATP-binding cassette transporter D1 (ABCD1) gene on cellular Redox and mitochondrial activities and their correction by suberoylanilide hydroxamic acid (SAHA) treatment. Pathogenomic accumulation of very long chain fatty acids (VLCFA) as a result of loss of ABCD1 leads to dysfunctions of mitochondrial biogenesis and its activities. Treatment with SAHA corrects

  2. Tissue-specific deletion of the coxsackievirus and adenovirus receptor (CAR) protects mice from virus-induced pancreatitis and myocarditis

    Science.gov (United States)

    Kallewaard, Nicole L.; Zhang, Lili; Chen, Jin-Wen; Guttenberg, Marta; Sanchez, Melissa D.; Bergelson, Jeffrey M.

    2009-01-01

    SUMMARY In cultured cells, infection by Group B coxsackieviruses (CVB) is mediated by the coxsackievirus and adenovirus receptor (CAR), but the importance of this molecule in CVB disease has not been determined. We used tissue-specific CAR gene deletion to generate mice that lacked CAR within each of two major CVB target organs, the pancreas and heart. Deletion of CAR from the pancreas resulted in a 1000-fold reduction in virus titers within the pancreas during infection, and a significant reduction in virus-induced tissue damage and inflammation. Similarly, cardiomyocyte-specific CAR deletion resulted in a 100-fold reduction in virus titer within the heart, and a marked reduction in cytokine production and histopathology. Although primary cardiomyocytes from control animals were susceptible to virus infection, CAR-deficient cardiomyocytes resisted infection in vitro. These results demonstrate a critical function for CAR in the pathogenesis of CVB infection in vivo, and in virus tropism for the heart and pancreas. PMID:19616768

  3. A composite six bp in-frame deletion in the melanocortin 1 receptor (MC1R gene is associated with the Japanese brindling coat colour in rabbits (Oryctolagus cuniculus

    Directory of Open Access Journals (Sweden)

    Russo Vincenzo

    2010-07-01

    Full Text Available Abstract Background In the domestic rabbit (Oryctolagus cuniculus, classical genetic studies have identified five alleles at the Extension locus: ED (dominant black, ES (steel, weaker version of ED, E (wild type, normal extension of black, eJ(Japanese brindling, mosaic distribution of black and yellow and e (non-extension of black, yellow/red with white belly. Sequencing almost the complete coding sequence (CDS of the rabbit MC1R gene, we recently identified two in-frame deletions associated with dominant black (c.280_285del6; alleles ED or ES and recessive red (c.304_333del30; allele e coat colours. It remained to characterize the eJallele whose phenotypic effect is similar to the Orange and Sex-linked yellow loci of cat and Syrian hamster. Results We sequenced the whole CDS in 25 rabbits of different coat colours including 10 Japanese and 10 Rhinelander (tricolour rabbits and identified another 6 bp-in frame deletion flanked by a G > A transition in 5' (c.[124G>A;125_130del6] that was present in all animals with Japanese brindling coat colour and pattern. These mutations eliminate two amino acids in the first transmembrane domain and, in addition, cause an amino acid substitution at position 44 of the wild type sequence. Genotyping 371 rabbits of 31 breeds with different coat colour this allele (eJ was present in homozygous state in Japanese, Rhinelander and Dutch tricolour rabbits only (except one albino rabbit. Rabbits with eJ/eJ genotype were non fixed at the non-agouti mutation we previously identified in the ASIP gene. Segregation in F1 and F2 families confirmed the order of dominance already determined by classical genetic experiments with a possible dose effect evident comparing eJ/eJ and eJ/e animals. MC1R mRNA was expressed in black hair skin regions only. Conclusions The c.[124A;125_130del6] allele may be responsible for a MC1R variant determining eumelanin production in the black areas. However, the mechanism determining the

  4. Protective Role of Aldose Reductase Deletion in an Animal Model of Oxygen-Induced Retinopathy

    Directory of Open Access Journals (Sweden)

    Zhongjie Fu

    2011-05-01

    Full Text Available Retinopathy of prematurity (ROP is a common disease occurred in premature babies. Both vascular abnormality and neural dysfunction of the retina were reported, and oxidative stress was involved. Previously, it has been showed that deficiency of aldose reductase (AR, the rate-limiting enzyme in polyol pathway, lowered oxidative stress. Here, the effect of AR deletion on neonatal retinal injury was investigated by using a mouse model of ROP (oxygen-induced retinopathy, OIR. Seven-day-old pups were exposed to 75% oxygen for 5 days and then returned to room air. The vascular changes and neuronal/glial responses were examined and compared between wild-type and AR-deficient OIR mice. Significantly reduced vaso-obliterated area, blood vessel leakage, and early revascularization were observed in AR-deficient OIR mice. Moreover, reduced amacrine cells and less distorted strata were observed in AR-deficient OIR mice. Less astrocytic immunoreactivity and reduced Müller cell gliosis were also observed in AR-deficient mice. After OIR, nitrotyrosine immunoreactivity and poly (ADP-ribose (PAR translocation, which are two oxidative stress markers, were decreased in AR-deficient mice. Significant decrease in VEGF, pho-Erk1/2, pho-Akt, and pho-I?B expression was found in AR-deficient OIR retinae. Thus, these observations suggest that the deficiency of aldose reductase may protect the retina in the OIR model.

  5. The PTEN inhibitor bpV(pic) promotes neuroprotection against amyloid β-peptide (25-35)-induced oxidative stress and neurotoxicity.

    Science.gov (United States)

    Liu, Xiao-Ying; Zhang, Li-Jing; Chen, Zhou; Liu, Li-Bin

    2017-08-01

    The aim of this study was to elucidate the mechanism underlying the neuroprotective effects of the phosphatase and tensin homolog (PTEN) inhibitor, bisperoxovanadium-pic [bpV(pic)]. We determined the effects of bpV(pic) on amyloid-β-peptide-(25-35)-induced neurotoxicity, particularly intracellular reactive oxygen species (ROS) production and mitochondria-mediated apoptotic signaling, in a human neuroblastoma (SH-SY5Y) cell model. We found that exposure of SH-SY5Y cells to amyloid β peptides (Aβ 25-35 ) resulted in a significant reduction in cell viability accompanied by increased lactate dehydrogenase (LDH) release, elevated levels of intracellular ROS, and decreased superoxide dismutase (SOD) activities, all of which were reversed by co-treatment with bpV(pic). Moreover, bpV(pic) induced significant protection against Aβ 25-35 -induced apoptosis, and effectively suppressed mitochondria-dependent apoptotic signaling triggered by Aβ 25-35 . Aβ peptides are thought to cause neurodegeneration in Alzheimer's disease (AD), via the induction of free radical oxidative stress. Our results indicate that bpV(pic) provides protection against Aβ 25-35 -induced oxidative stress and neurotoxicity, suggesting that bpV(pic) could be a potential therapeutic candidate in the treatment of neurodegenerative diseases such as AD.

  6. Heritable Genomic Fragment Deletions and Small Indels in the Putative ENGase Gene Induced by CRISPR/Cas9 in Barley

    Directory of Open Access Journals (Sweden)

    Eva Stoger

    2017-04-01

    Full Text Available Targeted genome editing with the CRISPR/Cas9 system has been used extensively for the selective mutation of plant genes. Here we used CRISPR/Cas9 to disrupt the putative barley (Hordeum vulgare cv. “Golden Promise” endo-N-acetyl-β-D-glucosaminidase (ENGase gene. Five single guide RNAs (sgRNAs were designed for different target sites in the upstream part of the ENGase coding region. Targeted fragment deletions were induced by co-bombarding selected combinations of sgRNA with wild-type cas9 using separate plasmids, or by co-infection with separate Agrobacterium tumefaciens cultures. Genotype screening was carried out in the primary transformants (T0 and their T1 progeny to confirm the presence of site-specific small insertions and deletions (indels and genomic fragment deletions between pairs of targets. Cas9-induced mutations were observed in 78% of the plants, a higher efficiency than previously reported in barley. Notably, there were differences in performance among the five sgRNAs. The induced indels and fragment deletions were transmitted to the T1 generation, and transgene free (sgRNA:cas9 negative genome-edited homozygous ENGase knock outs were identified among the T1 progeny. We have therefore demonstrated that mutant barley lines with a disrupted endogenous ENGase and defined fragment deletions can be produced efficiently using the CRISPR/Cas9 system even when this requires co-transformation with multiple plasmids by bombardment or Agrobacterium-mediated transformation. We confirm the specificity and heritability of the mutations and the ability to efficiently generate homozygous mutant T1 plants.

  7. Degradation of reactive brilliant red K-2BP in aqueous solution using swirling jet-induced cavitation combined with H2O2.

    Science.gov (United States)

    Wang, Jingang; Wang, Xikui; Guo, Peiquan; Yu, Jiemei

    2011-03-01

    The degradation of reactive brilliant red K-2BP (K-2BP) in aqueous solution by using swirling jet-induced cavitation, ultrasonic cavitation, and swirling jet-induced cavitation combined with H(2)O(2), ultrasonic cavitation combined with H(2)O(2) was investigated. An obvious synergetic effect between hydrodynamic cavitation and H(2)O(2) was found and a variety of reaction parameters were investigated for the degradation of K-2BP. It was found that the degradation of K-2BP by hydrodynamic cavitation combined with H(2)O(2) follows a pseudo-first-order kinetics. Higher temperature of medium, higher-pressure of fluid and higher concentration of H(2)O(2) are favorable for the degradation of K-2BP, and lower medium pH, lower initial dye concentrations also favored K-2BP degradation. The degradation mechanism of reactive brilliant red K-2BP also discussed with the UV-Vis spectra of the dye solution at different degradation time. Copyright © 2010 Elsevier B.V. All rights reserved.

  8. Liver-Specific Deletion of Phosphatase and Tensin Homolog Deleted on Chromosome 10 Significantly Ameliorates Chronic EtOH-Induced Increases in Hepatocellular Damage.

    Directory of Open Access Journals (Sweden)

    Colin T Shearn

    Full Text Available Alcoholic liver disease is a significant contributor to global liver failure. In murine models, chronic ethanol consumption dysregulates PTEN/Akt signaling. Hepatospecific deletion of phosphatase and tensin homolog deleted on chromosome 10 (PTENLKO mice possess constitutive activation of Akt(s and increased de novo lipogenesis resulting in increased hepatocellular steatosis. This makes PTENLKO a viable model to examine the effects of ethanol in an environment of preexisting steatosis. The aim of this study was to determine the impact of chronic ethanol consumption and the absence of PTEN (PTENLKO compared to Alb-Cre control mice (PTENf/f on hepatocellular damage as evidenced by changes in lipid accumulation, protein carbonylation and alanine amino transferase (ALT. In the control PTENf/f animals, ethanol significantly increased ALT, liver triglycerides and steatosis. In contrast, chronic ethanol consumption in PTENLKO mice decreased hepatocellular damage when compared to PTENLKO pair-fed controls. Consumption of ethanol elevated protein carbonylation in PTENf/f animals but had no effect in PTENLKO animals. In PTENLKO mice, overall hepatic mRNA expression of genes that contribute to GSH homeostasis as well as reduced glutathione (GSH and oxidized glutathione (GSSG concentrations were significantly elevated compared to respective PTENf/f counterparts. These data indicate that during conditions of constitutive Akt activation and steatosis, increased GSH homeostasis assists in mitigation of ethanol-dependent induction of oxidative stress and hepatocellular damage. Furthermore, data herein suggest a divergence in EtOH-induced hepatocellular damage and increases in steatosis due to polyunsaturated fatty acids downstream of PTEN.

  9. Tissue-specific deletion of the coxsackievirus and adenovirus receptor protects mice from virus-induced pancreatitis and myocarditis.

    Science.gov (United States)

    Kallewaard, Nicole L; Zhang, Lili; Chen, Jin-Wen; Guttenberg, Marta; Sanchez, Melissa D; Bergelson, Jeffrey M

    2009-07-23

    In cultured cells, infection by group B coxsackievirus (CVB) is mediated by the coxsackievirus and adenovirus receptor (CAR), but the importance of this molecule in CVB-induced disease has not been determined. We generated mice with tissue-specific ablation of CAR within each of two major CVB target organs, the pancreas and heart. In the pancreas, deletion of CAR resulted in a significant reduction in both virus titers and virus-induced tissue damage. Similarly, cardiomyocyte-specific CAR deletion resulted in a marked reduction in virus titer, infection-associated cytokine production, and histopathology within the heart. Consistent with the in vivo phenotype, CAR-deficient cardiomyocytes resisted infection in vitro. These results demonstrate a critical function for CAR in the pathogenesis of CVB infection in vivo and in virus tropism for the heart and pancreas.

  10. The GCN2-ATF4 Signaling Pathway Induces 4E-BP to Bias Translation and Boost Antimicrobial Peptide Synthesis in Response to Bacterial Infection

    Directory of Open Access Journals (Sweden)

    Deepika Vasudevan

    2017-11-01

    Full Text Available Bacterial infection often leads to suppression of mRNA translation, but hosts are nonetheless able to express immune response genes through as yet unknown mechanisms. Here, we use a Drosophila model to demonstrate that antimicrobial peptide (AMP production during infection is paradoxically stimulated by the inhibitor of cap-dependent translation, 4E-BP (eIF4E-binding protein; encoded by the Thor gene. We found that 4E-BP is induced upon infection with pathogenic bacteria by the stress-response transcription factor ATF4 and its upstream kinase, GCN2. Loss of gcn2, atf4, or 4e-bp compromised immunity. While AMP transcription is unaffected in 4e-bp mutants, AMP protein levels are substantially reduced. The 5′ UTRs of AMPs score positive in cap-independent translation assays, and this cap-independent activity is enhanced by 4E-BP. These results are corroborated in vivo using transgenic 5′ UTR reporters. These observations indicate that ATF4-induced 4e-bp contributes to innate immunity by biasing mRNA translation toward cap-independent mechanisms, thus enhancing AMP synthesis.

  11. The protective effect of intrasplenic transplantation of Ad-IL-18BP/IL-4 gene-modified fetal hepatocytes on ConA-induced hepatitis in mice.

    Science.gov (United States)

    Shao, Xueting; Qian, Yun; Xu, Chenhuai; Hong, Bo; Xu, Wanhong; Shen, Ling; Jin, Changzhong; Wu, Zhigang; Tong, Xiangmin; Yao, Hangping

    2013-01-01

    Concanavalin A (ConA)-induced hepatitis is an experimental murine model mirroring the pathology of human autoimmune hepatitis. To investigate the effects of intrasplenically transplanted fetal hepatocytes (BNL.CL2) transfected with recombinant adenovirus vector expressing the IL-18 binding protein (IL-18BP) and IL-4 fusion protein on ConA-induced hepatitis in mice. Ad-IL-18BP/IL-4 was used to infect BNL.CL2 cells. IL-4 and IL-18BP fusion protein expression were detected by ELISA and Western blotting. BNL.CL2 cells infected with Ad-IL-18BP/IL-4 were intrasplenically transplanted into mice. After 10 days, mice were injected with ConA (15 mg/kg), and sacrificed 18 hours later. Liver injury was assessed by serum transaminase and liver histology. TNF-α, IL-18, IL-4, IL-10, IL-12p70 and monocyte-chemoattracting protein (MCP)-1 levels in serum and liver homogenates were detected by ELISA. Signaling molecules in liver homogenates were analyzed by Western blotting. Ad-IL-18BP/IL-4 effectively expressed the IL-18BP/IL-4 fusion protein for more than 14 days in BNL.CL12 cells. Treatment of mice with Ad-IL-18BP/IL-4-BNL.CL2 before ConA injection significantly reduced the elevated plasma levels of transaminases compared with ConA control groups. TNF-α, IL-18, IL-12p70 and MCP-1 levels in serum and liver homogenates from mice transplanted with Ad-IL-18BP/IL-4-BNL.CL2 were lower and IL-4 and IL-10 levels were higher than control groups. Phosphorylation levels of NF-κB p65, AKT, p38 and JNK1/2 in liver homogenates were markedly suppressed by Ad-IL-18BP/IL-4. Ad-IL-18BP/IL-4 was effectively transfected into mouse BNL.CL2 cells. Intrasplenic transplantation of Ad-IL-18BP/IL-4-BNL.CL12 cells alleviated the severity of inflammation in ConA-induced experimental hepatitis and provides a useful basis for the targeted gene therapy of liver disease.

  12. The protective effect of intrasplenic transplantation of Ad-IL-18BP/IL-4 gene-modified fetal hepatocytes on ConA-induced hepatitis in mice.

    Directory of Open Access Journals (Sweden)

    Xueting Shao

    Full Text Available Concanavalin A (ConA-induced hepatitis is an experimental murine model mirroring the pathology of human autoimmune hepatitis.To investigate the effects of intrasplenically transplanted fetal hepatocytes (BNL.CL2 transfected with recombinant adenovirus vector expressing the IL-18 binding protein (IL-18BP and IL-4 fusion protein on ConA-induced hepatitis in mice.Ad-IL-18BP/IL-4 was used to infect BNL.CL2 cells. IL-4 and IL-18BP fusion protein expression were detected by ELISA and Western blotting. BNL.CL2 cells infected with Ad-IL-18BP/IL-4 were intrasplenically transplanted into mice. After 10 days, mice were injected with ConA (15 mg/kg, and sacrificed 18 hours later. Liver injury was assessed by serum transaminase and liver histology. TNF-α, IL-18, IL-4, IL-10, IL-12p70 and monocyte-chemoattracting protein (MCP-1 levels in serum and liver homogenates were detected by ELISA. Signaling molecules in liver homogenates were analyzed by Western blotting.Ad-IL-18BP/IL-4 effectively expressed the IL-18BP/IL-4 fusion protein for more than 14 days in BNL.CL12 cells. Treatment of mice with Ad-IL-18BP/IL-4-BNL.CL2 before ConA injection significantly reduced the elevated plasma levels of transaminases compared with ConA control groups. TNF-α, IL-18, IL-12p70 and MCP-1 levels in serum and liver homogenates from mice transplanted with Ad-IL-18BP/IL-4-BNL.CL2 were lower and IL-4 and IL-10 levels were higher than control groups. Phosphorylation levels of NF-κB p65, AKT, p38 and JNK1/2 in liver homogenates were markedly suppressed by Ad-IL-18BP/IL-4.Ad-IL-18BP/IL-4 was effectively transfected into mouse BNL.CL2 cells. Intrasplenic transplantation of Ad-IL-18BP/IL-4-BNL.CL12 cells alleviated the severity of inflammation in ConA-induced experimental hepatitis and provides a useful basis for the targeted gene therapy of liver disease.

  13. CtBP2 downregulation during neural crest specification induces expression of Mitf and REST, resulting in melanocyte differentiation and sympathoadrenal lineage suppression.

    Science.gov (United States)

    Liang, Hongzi; Fekete, Donna M; Andrisani, Ourania M

    2011-03-01

    Trunk neural crest (NC) cells differentiate to neurons, melanocytes, and glia. In NC cultures, cyclic AMP (cAMP) induces melanocyte differentiation while suppressing the neuronal sympathoadrenal lineage, depending on the signal intensity. Melanocyte differentiation requires activation of CREB and cAMP-dependent protein kinase A (PKA), but the role of PKA is not understood. We have demonstrated, in NC cultures, cAMP-induced transcription of the microphthalmia-associated transcription factor gene (Mitf) and the RE-1 silencing transcription factor gene (REST), both Wnt-regulated genes. In NC cultures and zebrafish, knockdown of the corepressor of Wnt-mediated transcription C-terminal binding protein 2 (CtBP2) but not CtBP1 derepressed Mitf and REST expression and enhanced melanocyte differentiation. cAMP in NC and B16 melanoma cells decreased CtBP2 protein levels, while inhibition of PKA or proteasome rescued CtBP2 degradation. Interestingly, knockdown of homeodomain-interacting protein kinase 2 (HIPK2), a CtBP stability modulator, increased CtBP2 levels, suppressed expression of Mitf, REST, and melanocyte differentiation, and increased neuronal gene expression and sympathoadrenal lineage differentiation. We conclude that cAMP/PKA via HIPK2 promotes CtBP2 degradation, leading to Mitf and REST expression. Mitf induces melanocyte specification, and REST suppresses neuron-specific gene expression and the sympathoadrenal lineage. Our studies identify a novel role for REST in NC cell differentiation and suggest cross talk between cAMP and Wnt signaling in NC lineage specification.

  14. CtBP2 Downregulation during Neural Crest Specification Induces Expression of Mitf and REST, Resulting in Melanocyte Differentiation and Sympathoadrenal Lineage Suppression ▿

    Science.gov (United States)

    Liang, Hongzi; Fekete, Donna M.; Andrisani, Ourania M.

    2011-01-01

    Trunk neural crest (NC) cells differentiate to neurons, melanocytes, and glia. In NC cultures, cyclic AMP (cAMP) induces melanocyte differentiation while suppressing the neuronal sympathoadrenal lineage, depending on the signal intensity. Melanocyte differentiation requires activation of CREB and cAMP-dependent protein kinase A (PKA), but the role of PKA is not understood. We have demonstrated, in NC cultures, cAMP-induced transcription of the microphthalmia-associated transcription factor gene (Mitf) and the RE-1 silencing transcription factor gene (REST), both Wnt-regulated genes. In NC cultures and zebrafish, knockdown of the corepressor of Wnt-mediated transcription C-terminal binding protein 2 (CtBP2) but not CtBP1 derepressed Mitf and REST expression and enhanced melanocyte differentiation. cAMP in NC and B16 melanoma cells decreased CtBP2 protein levels, while inhibition of PKA or proteasome rescued CtBP2 degradation. Interestingly, knockdown of homeodomain-interacting protein kinase 2 (HIPK2), a CtBP stability modulator, increased CtBP2 levels, suppressed expression of Mitf, REST, and melanocyte differentiation, and increased neuronal gene expression and sympathoadrenal lineage differentiation. We conclude that cAMP/PKA via HIPK2 promotes CtBP2 degradation, leading to Mitf and REST expression. Mitf induces melanocyte specification, and REST suppresses neuron-specific gene expression and the sympathoadrenal lineage. Our studies identify a novel role for REST in NC cell differentiation and suggest cross talk between cAMP and Wnt signaling in NC lineage specification. PMID:21199918

  15. SH3BP2 cherubism mutation potentiates TNF-α-induced osteoclastogenesis via NFATc1 and TNF-α-mediated inflammatory bone loss.

    Science.gov (United States)

    Mukai, Tomoyuki; Ishida, Shu; Ishikawa, Remi; Yoshitaka, Teruhito; Kittaka, Mizuho; Gallant, Richard; Lin, Yi-Ling; Rottapel, Robert; Brotto, Marco; Reichenberger, Ernst J; Ueki, Yasuyoshi

    2014-12-01

    Cherubism (OMIM# 118400) is a genetic disorder with excessive jawbone resorption caused by mutations in SH3 domain binding protein 2 (SH3BP2), a signaling adaptor protein. Studies on the mouse model for cherubism carrying a P416R knock-in (KI) mutation have revealed that mutant SH3BP2 enhances tumor necrosis factor (TNF)-α production and receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclast differentiation in myeloid cells. TNF-α is expressed in human cherubism lesions, which contain a large number of tartrate-resistant acid phosphatase (TRAP)-positive multinucleated cells, and TNF-α plays a critical role in inflammatory bone destruction in homozygous cherubism mice (Sh3bp2(KI/KI) ). The data suggest a pathophysiological relationship between mutant SH3BP2 and TNF-α-mediated bone loss by osteoclasts. Therefore, we investigated whether P416R mutant SH3BP2 is involved in TNF-α-mediated osteoclast formation and bone loss. Here, we show that bone marrow-derived M-CSF-dependent macrophages (BMMs) from the heterozygous cherubism mutant (Sh3bp2(KI/+) ) mice are highly responsive to TNF-α and can differentiate into osteoclasts independently of RANKL in vitro by a mechanism that involves spleen tyrosine kinase (SYK) and phospholipase Cγ2 (PLCγ2) phosphorylation, leading to increased nuclear translocation of NFATc1. The heterozygous cherubism mutation exacerbates bone loss with increased osteoclast formation in a mouse calvarial TNF-α injection model as well as in a human TNF-α transgenic mouse model (hTNFtg). SH3BP2 knockdown in RAW264.7 cells results in decreased TRAP-positive multinucleated cell formation. These findings suggest that the SH3BP2 cherubism mutation can cause jawbone destruction by promoting osteoclast formation in response to TNF-α expressed in cherubism lesions and that SH3BP2 is a key regulator for TNF-α-induced osteoclastogenesis. Inhibition of SH3BP2 expression in osteoclast progenitors could be a potential strategy for

  16. SH3BP2 cherubism mutation potentiates TNF-α-induced osteoclastogenesis via NFATc1 and TNF-α-mediated inflammatory bone loss

    Science.gov (United States)

    Mukai, Tomoyuki; Ishida, Shu; Ishikawa, Remi; Yoshitaka, Teruhito; Kittaka, Mizuho; Gallant, Richard; Lin, Yi-Ling; Rottapel, Robert; Brotto, Marco; Reichenberger, Ernst J.; Ueki, Yasuyoshi

    2014-01-01

    Cherubism (OMIM#118400) is a genetic disorder with excessive jawbone resorption caused by mutations in the signaling adaptor protein SH3BP2. Studies on the mouse model for cherubism carrying a P416R knock-in mutation have revealed that mutant SH3BP2 enhances TNF-α production and RANKL-induced osteoclast differentiation in myeloid cells. TNF-α is expressed in human cherubism lesions, which contain a large number of TRAP-positive multinucleated cells, and TNF-α plays a critical role in inflammatory bone destruction in homozygous cherubism mice (Sh3bp2KI/KI). The data suggest a pathophysiological relationship between mutant SH3BP2 and TNF-α-mediated bone loss by osteoclasts. Therefore, we investigated whether P416R mutant SH3BP2 is involved in TNF-α-mediated osteoclast formation and bone loss. Here, we show that bone marrow-derived M-CSF-dependent macrophages (BMMs) from the heterozygous cherubism mutant (Sh3bp2KI/+) mice are highly responsive to TNF-α and can differentiate into osteoclasts independently of RANKL in vitro by a mechanism that involves SYK and PLCγ2 phosphorylation, leading to increased nuclear translocation of NFATc1. The heterozygous cherubism mutation exacerbates bone loss with increased osteoclast formation in a mouse calvarial TNF-α injection model as well as in a human TNF-α transgenic mouse model (hTNFtg). SH3BP2 knockdown in RAW264.7 cells results in decreased TRAP-positive multinucleated cell formation. These findings suggest that the SH3BP2 cherubism mutation can cause jawbone destruction by promoting osteoclast formation in response to TNF-α expressed in cherubism lesions and that SH3BP2 is a key regulator for TNF-α-induced osteoclastogenesis. Inhibition of SH3BP2 expression in osteoclast progenitors could be a potential strategy for the treatment of bone loss in cherubism as well as in other inflammatory bone disorders. PMID:24916406

  17. Occurrence of a 2-bp (AT) deletion allele and a nonsense (G-to-T) mutant allele at the E2 (DBT) locus of six patients with maple syrup urine disease: Multiple-exon skipping as a secondary effect of the mutations

    Energy Technology Data Exchange (ETDEWEB)

    Fisher, C.W.; Fisher, C.R.; Chuang, J.L.; Lau, K.S.; Chuang, D.T.; Cox, R.P. (Univ. of Texas, Dallas (United States))

    1993-02-01

    The authors have identified two novel mutant alleles in the transacylase (E2) gene of the human branched-chain [alpha]-keto acid dehydrogenase (BCKAD) complex in 6 of 38 patients with maple syrup urine disease (MSUD). One mutation, a 2-bp (AT) deletion in exon 2 of the E2 gene, causes a frameshift downstream of residue ([minus]26) in the mitochondrial targeting presequence. The second mutation, a G-to-T transversion in exon 6 of the E2 gene, produces a premature stop codon at Glu-163 (E163*). Transfection of constructs harboring the E163* mutation into an E2-deficient MSUD cell line produced a truncated E2 subunit. However, this mutant E2 chain is unable to assemble into a 24-mer cubic structure and is degraded in the cell. The 2-bp (AT) deletion and the E163* mutant alleles occur in either the homozygous or compound-heterozygous state in the 6 of 38 unrelated MSUD patients studied. Moreover, an array of precise single- and multiple-exon deletions were observed in many amplified E2 mutant cDNAs. The latter results appear to represent secondary effects on RNA processing that are associated with the MSUD mutations at the E2 locus. 30 refs., 8 figs.

  18. Increasing on-target cleavage efficiency for CRISPR/Cas9-induced large fragment deletion in Myxococcus xanthus.

    Science.gov (United States)

    Yang, Ying-Jie; Wang, Ye; Li, Zhi-Feng; Gong, Ya; Zhang, Peng; Hu, Wen-Chao; Sheng, Duo-Hong; Li, Yue-Zhong

    2017-08-16

    The CRISPR/Cas9 system is a powerful tool for genome editing, in which the sgRNA binds and guides the Cas9 protein for the sequence-specific cleavage. The protocol is employable in different organisms, but is often limited by cell damage due to the endonuclease activity of the introduced Cas9 and the potential off-target DNA cleavage from incorrect guide by the 20 nt spacer. In this study, after resolving some critical limits, we have established an efficient CRISPR/Cas9 system for the deletion of large genome fragments related to the biosynthesis of secondary metabolites in Myxococcus xanthus cells. We revealed that the high expression of a codon-optimized cas9 gene in M. xanthus was cytotoxic, and developed a temporally high expression strategy to reduce the cell damage from high expressions of Cas9. We optimized the deletion protocol by using the tRNA-sgRNA-tRNA chimeric structure to ensure correct sgRNA sequence. We found that, in addition to the position-dependent nucleotide preference, the free energy of a 20 nt spacer was a key factor for the deletion efficiency. By using the developed protocol, we achieved the CRISPR/Cas9-induced deletion of large biosynthetic gene clusters for secondary metabolites in M. xanthus DK1622 and its epothilone-producing mutant. The findings and the proposals described in this paper were suggested to be workable in other organisms, for example, other Gram negative bacteria with high GC content.

  19. Cardiac amyloidosis induces up-regulation of Deleted in Malignant Brain Tumors 1 (DMBT1)

    DEFF Research Database (Denmark)

    Müller, Hanna; Renner, Marcus; Bergmann, Frank

    2013-01-01

    Amyloidosis is a life-threatening protein misfolding disease and affects cardiac tissue, leading to heart failure, myocardial ischemia and arrhythmia. Amyloid deposits result in oxidative stress, inflammation and apoptosis. The purpose of this study was to examine the role of innate defense...... components, i.e., Deleted in Malignant Brain Tumors 1 (DMBT1) and the complement system, in different types of cardiac amyloidosis....

  20. Isolation of deletion alleles by G4 DNA-induced mutagenesis.

    Science.gov (United States)

    Pontier, Daphne B; Kruisselbrink, Evelien; Guryev, Victor; Tijsterman, Marcel

    2009-09-01

    Metazoan genomes contain thousands of sequence tracts that match the guanine-quadruplex (G4) DNA signature G(3)N(x)G(3)N(x)G(3)N(x)G(3), a motif that is intrinsically mutagenic, probably because it can form secondary structures during DNA replication. Here we show how and to what extent this feature can be used to generate deletion alleles of many Caenorhabditis elegans genes.

  1. A West Nile virus NS4B-P38G mutant strain induces adaptive immunity via TLR7-MyD88-dependent and independent signaling pathways

    OpenAIRE

    Xie, Guorui; Welte, Thomas; Wang, Jia; Whiteman, Melissa C.; Wicker, Jason A.; Saxena, Vandana; Cong, Yingzi; Barrett, Alan D.T.; Wang, Tian

    2013-01-01

    Prior work shows that an attenuated West Nile virus (WNV), the nonstructural (NS)4B-P38G mutant infection in mice induced strong immune responses and protected host from subsequent lethal wild-type WNV infection. Here, we investigated NS4B-P38G mutant infection in myeloid differentiation factor 88-deficient (MyD88−/−) and Toll-like receptor 7-deficient (TLR7−/−) mice and found they had enhanced susceptibility compared to wild-type mice. Both groups had lower WNV-specific IgM response and redu...

  2. Tph2 gene deletion enhances amphetamine-induced hypermotility: effect of 5-HT restoration and role of striatal noradrenaline release.

    Science.gov (United States)

    Carli, Mirjana; Kostoula, Chrysaugi; Sacchetti, Giuseppina; Mainolfi, Pierangela; Anastasia, Alessia; Villani, Claudia; Invernizzi, Roberto William

    2015-11-01

    Variants of tryptophan hydroxylase-2 (Tph2), the gene encoding enzyme responsible for the synthesis of brain serotonin (5-HT), have been associated with neuropsychiatric disorders, substance abuse and addiction. This study assessed the effect of Tph2 gene deletion on motor behavior and found that motor activity induced by 2.5 and 5 mg/kg amphetamine was enhanced in Tph2(-/-) mice. Using the in vivo microdialysis technique we found that the ability of amphetamine to stimulate noradrenaline (NA) release in the striatum was reduced by about 50% in Tph2(-/-) mice while the release of dopamine (DA) was not affected. Tph2 deletion did not affect the release of NA and DA in the prefrontal cortex. The role of endogenous 5-HT in enhancing the effect of amphetamine was confirmed showing that treatment with the 5-HT precursor 5-hydroxytryptophan (10 mg/kg) restored tissue and extracellular levels of brain 5-HT and the effects of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. Treatment with the NA precursor dihydroxyphenylserine (400 mg/kg) was sufficient to restore the effect of amphetamine on striatal NA release and motor activity in Tph2(-/-) mice. These findings indicate that amphetamine-induced hyperactivity is attenuated by endogenous 5-HT through the inhibition of striatal NA release. Tph2(-/-) mice may be a useful preclinical model to assess the role of 5-HT-dependent mechanisms in the action of psychostimulants. Acute sensitivity to the motor effects of amphetamine has been associated to increased risk of psychostimulant abuse. Here, we show that deletion of Tph2, the gene responsible for brain 5-HT synthesis, enhances the motor effect of amphetamine in mice through the inhibition of striatal NA release. This suggests that Tph2(-/-) mice is a useful preclinical model to assess the role of 5-HT-dependent mechanisms in psychostimulants action. Tph2, tryptophan hydroxylase-2. © 2015 International Society for Neurochemistry.

  3. Deletion of p66Shc longevity gene protects against experimental diabetic glomerulopathy by preventing diabetes-induced oxidative stress.

    Science.gov (United States)

    Menini, Stefano; Amadio, Lorena; Oddi, Giovanna; Ricci, Carlo; Pesce, Carlo; Pugliese, Francesco; Giorgio, Marco; Migliaccio, Enrica; Pelicci, PierGiuseppe; Iacobini, Carla; Pugliese, Giuseppe

    2006-06-01

    p66(Shc) regulates both steady-state and environmental stress-dependent reactive oxygen species (ROS) generation. Its deletion was shown to confer resistance to oxidative stress and protect mice from aging-associated vascular disease. This study was aimed at verifying the hypothesis that p66(Shc) deletion also protects from diabetic glomerulopathy by reducing oxidative stress. Streptozotocin-induced diabetic p66(Shc) knockout (KO) mice showed less marked changes in renal function and structure, as indicated by the significantly lower levels of proteinuria, albuminuria, glomerular sclerosis index, and glomerular and mesangial areas. Glomerular content of fibronectin and collagen IV was also lower in diabetic KO versus wild-type mice, whereas apoptosis was detected only in diabetic wild-type mice. Serum and renal tissue advanced glycation end products and plasma isoprostane 8-epi-prostaglandin F2alpha levels and activation of nuclear factor kappaB (NF-kappaB) were also lower in diabetic KO than in wild-type mice. Mesangial cells from KO mice grown under high-glucose conditions showed lower cell death rate, matrix production, ROS levels, and activation of NF-kappaB than those from wild-type mice. These data support a role for oxidative stress in the pathogenesis of diabetic glomerulopathy and indicate that p66(Shc) is involved in the molecular mechanism(s) underlying diabetes-induced oxidative stress and oxidant-dependent renal injury.

  4. Temporal control of gene deletion in sensory ganglia using a tamoxifen-inducible Advillin-Cre-ERT2 recombinase mouse

    Directory of Open Access Journals (Sweden)

    Lau Joanne

    2011-12-01

    Full Text Available Abstract Background Tissue-specific gene deletion has proved informative in the analysis of pain pathways. Advillin has been shown to be a pan-neuronal marker of spinal and cranial sensory ganglia. We generated BAC transgenic mice using the Advillin promoter to drive a tamoxifen-inducible CreERT2 recombinase construct in order to be able to delete genes in adult animals. We used a floxed stop ROSA26LacZ reporter mouse to examine functional Cre expression, and analysed the behaviour of mice expressing Cre recombinase. Results We used recombineering to introduce a CreERT2 cassette in place of exon 2 of the Advillin gene into a BAC clone (RPCI23-424F19 containing the 5' region of the Advillin gene. Transgenic mice were generated using pronuclear injection. The resulting AvCreERT2 transgenic mice showed a highly specific expression pattern of Cre activity after tamoxifen induction. Recombinase activity was confined to sensory neurons and no expression was found in other organs. Less than 1% of neurons showed Cre expression in the absence of tamoxifen treatment. Five-day intraperitoneal treatment with tamoxifen (2 mg per day induced Cre recombination events in ≈90% of neurons in dorsal root and cranial ganglia. Cell counts of dorsal root ganglia (DRG from transgenic animals with or without tamoxifen treatment showed no neuronal cell loss. Sensory neurons in culture showed ≈70% induction after 3 days treatment with tamoxifen. Behavioural tests showed no differences between wildtype, AvCreERT2 and tamoxifen-treated animals in terms of motor function, responses to light touch and noxious pressure, thermal thresholds as well as responses to inflammatory agents. Conclusions Our results suggest that the inducible pan-DRG AvCreERT2 deleter mouse strain is a useful tool for studying the role of individual genes in adult sensory neuron function. The pain phenotype of the Cre-induced animal is normal; therefore any alterations in pain processing can be

  5. Hepatitis C virus core protein targets 4E-BP1 expression and phosphorylation and potentiates Myc-induced liver carcinogenesis in transgenic mice.

    Science.gov (United States)

    Abdallah, Cosette; Lejamtel, Charlène; Benzoubir, Nassima; Battaglia, Serena; Sidahmed-Adrar, Nazha; Desterke, Christophe; Lemasson, Matthieu; Rosenberg, Arielle R; Samuel, Didier; Bréchot, Christian; Pflieger, Delphine; Le Naour, François; Bourgeade, Marie-Françoise

    2017-08-22

    Hepatitis C virus (HCV) is a leading cause of liver diseases including the development of hepatocellular carcinoma (HCC). Particularly, core protein has been involved in HCV-related liver pathologies. However, the impact of HCV core on signaling pathways supporting the genesis of HCC remains largely elusive. To decipher the host cell signaling pathways involved in the oncogenic potential of HCV core, a global quantitative phosphoproteomic approach was carried out. This study shed light on novel differentially phosphorylated proteins, in particular several components involved in translation. Among the eukaryotic initiation factors that govern the translational machinery, 4E-BP1 represents a master regulator of protein synthesis that is associated with the development and progression of cancers due to its ability to increase protein expression of oncogenic pathways. Enhanced levels of 4E-BP1 in non-modified and phosphorylated forms were validated in human hepatoma cells and in mouse primary hepatocytes expressing HCV core, in the livers of HCV core transgenic mice as well as in HCV-infected human primary hepatocytes. The contribution of HCV core in carcinogenesis and the status of 4E-BP1 expression and phosphorylation were studied in HCV core/Myc double transgenic mice. HCV core increased the levels of 4E-BP1 expression and phosphorylation and significantly accelerated the onset of Myc-induced tumorigenesis in these double transgenic mice. These results reveal a novel function of HCV core in liver carcinogenesis potentiation. They position 4E-BP1 as a tumor-specific target of HCV core and support the involvement of the 4E-BP1/eIF4E axis in hepatocarcinogenesis.

  6. Deletion of Pofut1 in Mouse Skeletal Myofibers Induces Muscle Aging-Related Phenotypes in cis and in trans

    Science.gov (United States)

    Zygmunt, Deborah A.; Singhal, Neha; Kim, Mi-Lyang; Cramer, Megan L.; Crowe, Kelly E.; Xu, Rui; Jia, Ying; Adair, Jessica; Martinez-Pena y Valenzuela, Isabel; Akaaboune, Mohammed; White, Peter; Janssen, Paulus M.

    2017-01-01

    ABSTRACT Sarcopenia, the loss of muscle mass and strength during normal aging, involves coordinate changes in skeletal myofibers and the cells that contact them, including satellite cells and motor neurons. Here we show that the protein O-fucosyltransferase 1 gene (Pofut1), which encodes a glycosyltransferase required for NotchR-mediated cell-cell signaling, has reduced expression in aging skeletal muscle. Moreover, premature postnatal deletion of Pofut1 in skeletal myofibers can induce aging-related phenotypes in cis within skeletal myofibers and in trans within satellite cells and within motor neurons via the neuromuscular junction. Changed phenotypes include reduced skeletal muscle size and strength, decreased myofiber size, increased slow fiber (type 1) density, increased muscle degeneration and regeneration in aged muscles, decreased satellite cell self-renewal and regenerative potential, and increased neuromuscular fragmentation and occasional denervation. Pofut1 deletion in skeletal myofibers reduced NotchR signaling in young adult muscles, but this effect was lost with age. Increasing muscle NotchR signaling also reduced muscle size. Gene expression studies point to regulation of cell cycle genes, muscle myosins, NotchR and Wnt pathway genes, and connective tissue growth factor by Pofut1 in skeletal muscle, with additional effects on α dystroglycan glycosylation. PMID:28265002

  7. Targeted deletion of RANKL in M cell inducer cells by the Col6a1-Cre driver.

    Science.gov (United States)

    Nagashima, Kazuki; Sawa, Shinichiro; Nitta, Takeshi; Prados, Alejandro; Koliaraki, Vasiliki; Kollias, George; Nakashima, Tomoki; Takayanagi, Hiroshi

    2017-11-04

    The gut-associated lymphoid tissues (GALTs), including Peyer's patches (PPs), cryptopatches (CPs) and isolated lymphoid follicles (ILFs), establish a host-microbe symbiosis by the promotion of immune reactions against gut microbes. Microfold cell inducer (MCi) cells in GALTs are the recently identified mesenchymal cells that express the cytokine RANKL and initiate bacteria-specific immunoglobulin A (IgA) production via induction of microfold (M) cell differentiation. In the previous study, the Twist2-Cre driver was utilized for gene deletion in mesenchymal cells including MCi cells. In order to investigate MCi cells more extensively, it will be necessary to develop experimental tools in addition to the Twist2-Cre driver mice and characterize such drivers in specificity and efficiency. Here we show that M cell differentiation and IgA production are impaired in the targeted deletion of RANKL by the Col6a1-Cre driver. We compared Col6a1-Cre with Twist2-Cre in terms of the specificity for mesenchymal cells in GALTs. Col6a1-Cre CAG-CAT-EGFP mice exhibited EGFP expression in podoplanin+CD31- cells including MCi cells, while Twist2-Cre mice were shown to target endothelial cells and podoplanin+CD31- cells. Tnfsf11fl/ΔCol6a1-Cre mice exhibited the absence of M cells and severe IgA reduction together with an alteration in gut microbial composition. Moreover, we analyzed germ free mice to test whether changes in the microbiota are the cause of M cell deficiency. M cell differentiation was normal in the CPs/ILFs of germ free mice, indicating that MCi cells induce M cells independently of microbial colonization. This study demonstrates that Col6a1-Cre driver mice are as useful as Twist2-Cre driver mice for functional analyses of GALT-resident mesenchymal cells, including MCi cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Deletion of Protein Kinase C λ in POMC Neurons Predisposes to Diet-Induced Obesity.

    Science.gov (United States)

    Dorfman, Mauricio D; Krull, Jordan E; Scarlett, Jarrad M; Guyenet, Stephan J; Sajan, Mini P; Damian, Vincent; Nguyen, Hong T; Leitges, Michael; Morton, Gregory J; Farese, Robert V; Schwartz, Michael W; Thaler, Joshua P

    2017-04-01

    Effectors of the phosphoinositide 3-kinase (PI3K) signal transduction pathway contribute to the hypothalamic regulation of energy and glucose homeostasis in divergent ways. Here we show that central nervous system (CNS) action of the PI3K signaling intermediate atypical protein kinase C (aPKC) constrains food intake, weight gain, and glucose intolerance in both rats and mice. Pharmacological inhibition of CNS aPKC activity acutely increases food intake and worsens glucose tolerance in chow-fed rodents and causes excess weight gain during high-fat diet (HFD) feeding. Similarly, selective deletion of the aPKC isoform Pkc-λ in proopiomelanocortin (POMC) neurons disrupts leptin action, reduces melanocortin content in the paraventricular nucleus, and markedly increases susceptibility to obesity, glucose intolerance, and insulin resistance specifically in HFD-fed male mice. These data implicate aPKC as a novel regulator of energy and glucose homeostasis downstream of the leptin-PI3K pathway in POMC neurons. © 2017 by the American Diabetes Association.

  9. Constitutive gray hair in mice induced by melanocyte-specific deletion of c-Myc.

    Science.gov (United States)

    Pshenichnaya, Irina; Schouwey, Karine; Armaro, Marzia; Larue, Lionel; Knoepfler, Paul S; Eisenman, Robert N; Trumpp, Andreas; Delmas, Véronique; Beermann, Friedrich

    2012-05-01

    c-Myc is involved in the control of diverse cellular processes and implicated in the maintenance of different tissues including the neural crest. Here, we report that c-Myc is particularly important for pigment cell development and homeostasis. Targeting c-Myc specifically in the melanocyte lineage using the floxed allele of c-Myc and Tyr::Cre transgenic mice results in a congenital gray hair phenotype. The gray coat color is associated with a reduced number of functional melanocytes in the hair bulb and melanocyte stem cells in the hair bulge. Importantly, the gray phenotype does not progress with time, suggesting that maintenance of the melanocyte through the hair cycle does not involve c-Myc function. In embryos, at E13.5, c-Myc-deficient melanocyte precursors are affected in proliferation in concordance with a reduction in numbers, showing that c-Myc is required for the proper melanocyte development. Interestingly, melanocytes from c-Myc-deficient mice display elevated levels of the c-Myc paralog N-Myc. Double deletion of c-Myc and N-Myc results in nearly complete loss of the residual pigmentation, indicating that N-Myc is capable of compensating for c-Myc loss of function in melanocytes. © 2012 John Wiley & Sons A/S.

  10. Mitochondrial Ferritin Deletion Exacerbates β-Amyloid-Induced Neurotoxicity in Mice

    Directory of Open Access Journals (Sweden)

    Peina Wang

    2017-01-01

    Full Text Available Mitochondrial ferritin (FtMt is a mitochondrial iron storage protein which protects mitochondria from iron-induced oxidative damage. Our previous studies indicate that FtMt attenuates β-amyloid- and 6-hydroxydopamine-induced neurotoxicity in SH-SY5Y cells. To explore the protective effects of FtMt on β-amyloid-induced memory impairment and neuronal apoptosis and the mechanisms involved, 10-month-old wild-type and Ftmt knockout mice were infused intracerebroventricularly (ICV with Aβ25–35 to establish an Alzheimer’s disease model. Knockout of Ftmt significantly exacerbated Aβ25–35-induced learning and memory impairment. The Bcl-2/Bax ratio in mouse hippocampi was decreased and the levels of cleaved caspase-3 and PARP were increased. The number of neuronal cells undergoing apoptosis in the hippocampus was also increased in Ftmt knockout mice. In addition, the levels of L-ferritin and FPN1 in the hippocampus were raised, and the expression of TfR1 was decreased. Increased MDA levels were also detected in Ftmt knockout mice treated with Aβ25–35. In conclusion, this study demonstrated that the neurological impairment induced by Aβ25–35 was exacerbated in Ftmt knockout mice and that this may relate to increased levels of oxidative stress.

  11. NLRP3 Deletion Inhibits the Non-alcoholic Steatohepatitis Development and Inflammation in Kupffer Cells Induced by Palmitic Acid.

    Science.gov (United States)

    Cai, Can; Zhu, Xiwen; Li, Peizhi; Li, Jinzheng; Gong, Jianping; Shen, Wei; He, Kun

    2017-12-01

    The cleavage and secretion of pro-inflammatory cytokines IL-1β and IL-18 is regulated by NLRP3 (NACHT, LRR, and PYD domain-containing protein 3) inflammasome activation. Kupffer cells (KCs) are implicated in the pathogenesis of various liver diseases, such as non-alcoholic fatty liver disease (NAFLD), alcoholic liver disease, and liver fibrosis. However, the role of NLRP3 played in the non-alcoholic steatohepatitis (NASH) has yet to be evaluated. In the present study, methionine-choline-deficient (MCD) diet was used to establish the mice NASH model. The expression levels of F4/80 and NLRP3 in liver tissues were evaluated, and the IL-1β and IL-18 in serum were also evaluated. KCs were isolated from wild-type (WT) mice and NLRP3 knockout (NLRP3 -/- ) mice and then randomly divided into two groups: the control and palmitic acid (PA) groups. The expression levels of NLRP3, ASC, and caspase-1 in KCs were determined by RT-PCR, western blotting, and immunofluorescence. The levels of IL-1β and IL-18 in the supernatant (SN) of KCs were evaluated by enzyme-linked immunosorbent assay (ELISA). We found that KCs and NLRP3 play pro-inflammatory roles in the progression of NASH, probably through secretions of IL-1β and IL-18 by KCs induced by PA. PA could act as a kind of damage-associated molecular patterns to elevate the messenger RNA and protein expression levels of NLRP3, ASC, and caspase-1 in KCs from WT mice. In the contrast, NLRP3 deletion could inhibit the NLRP3 inflammasome upregulation and activation in KCs induced by PA. Furthermore, the levels of pro-inflammatory cytokines IL-1β and IL-18 in the SN of KCs from WT mice were all elevated with the stimulation of PA, and the increase of these cytokines in the SN was blocked by NLRP3 deletion. In conclusion, our novel findings demonstrate that NLRP3 plays a pivotal role in NASH development and pro-inflammatory cytokines IL-1β and IL-18 secretion induced by PA stimulation, and NLRP3 might be an effective potential

  12. Deletion of miR-150 Exacerbates Retinal Vascular Overgrowth in High-Fat-Diet Induced Diabetic Mice.

    Directory of Open Access Journals (Sweden)

    Liheng Shi

    Full Text Available Diabetic retinopathy (DR is the leading cause of blindness among American adults above 40 years old. The vascular complication in DR is a major cause of visual impairment, making finding therapeutic targets to block pathological angiogenesis a primary goal for developing DR treatments. MicroRNAs (miRs have been proposed as diagnostic biomarkers and potential therapeutic targets for various ocular diseases including DR. In diabetic animals, the expression levels of several miRs, including miR-150, are altered. The expression of miR-150 is significantly suppressed in pathological neovascularization in mice with hyperoxia-induced retinopathy. The purpose of this study was to investigate the functional role of miR-150 in the development of retinal microvasculature complications in high-fat-diet (HFD induced type 2 diabetic mice. Wild type (WT and miR-150 null mutant (miR-150-/- male mice were given a HFD (59% fat calories or normal chow diet. Chronic HFD caused a decrease of serum miR-150 in WT mice. Mice on HFD for 7 months (both WT and miR-150-/- had significant decreases in retinal light responses measured by electroretinograms (ERGs. The retinal neovascularization in miR-150-/--HFD mice was significantly higher compared to their age matched WT-HFD mice, which indicates that miR-150 null mutation exacerbates chronic HFD-induced neovascularization in the retina. Overexpression of miR-150 in cultured endothelial cells caused a significant reduction of vascular endothelial growth factor receptor 2 (VEGFR2 protein levels. Hence, deletion of miR-150 significantly increased the retinal pathological angiogenesis in HFD induced type 2 diabetic mice, which was in part through VEGFR2.

  13. Deletion of the Men1 Gene Prevents Streptozotocin-Induced Hyperglycemia in Mice

    Directory of Open Access Journals (Sweden)

    Yuqing Yang

    2010-01-01

    Full Text Available Diabetes ultimately results from an inadequate number of functional beta cells in the islets of Langerhans. Enhancing proliferation of functional endogenous beta cells to treat diabetes remains underexplored. Here, we report that excision of the Men1 gene, whose loss-of-function mutation leads to inherited multiple endocrine neoplasia type 1 (MEN1, rendered resistant to streptozotocin-induced hyperglycemia in a tamoxifen-inducible and temporally controlled Men1 excision mouse model as well as in a tissue-specific Men1 excision mouse model. Men1 excision prevented mice from streptozotocin-induced hyperglycemia mainly through increasing the number of functional beta cells. BrdU incorporation by beta cells, islet size, and circulating insulin levels were significantly increased in Men1-excised mice. Membrane localization of glucose transporter 2 was largely preserved in Men1-excised beta cells, but not in Men1-expressing beta cells. Our findings suggest that repression of menin, a protein encoded by the Men1 gene, might be a valuable means to maintain or increase the number of functional endogenous beta cells to prevent or ameliorate diabetes.

  14. Gli1 deletion prevents Helicobacter-induced gastric metaplasia and expansion of myeloid cell subsets.

    Science.gov (United States)

    El-Zaatari, Mohamad; Kao, John Y; Tessier, Art; Bai, Longchuan; Hayes, Michael M; Fontaine, Clinton; Eaton, Kathryn A; Merchant, Juanita L

    2013-01-01

    Chronic inflammation in the stomach induces metaplasia, the pre-cancerous lesion that precedes inflammation-driven neoplastic transformation. While Hedgehog signaling contributes to the initiation of some cancers, its role in gastric transformation remains poorly defined. We found that Helicobacter-infected C57BL/6 mice develop extensive mucous cell metaplasia at 6 month but not at 2 months post-infection. Gastric metaplasia coincided with the appearance of CD45(+)MHCII(+)CD11b(+)CD11c(+) myeloid cells that were normally not present in the chronic gastritis at 2 months. The myeloid regulatory gene Schlafen-4 was identified in a microarray analysis comparing infected WT versus Gli1 null mice and was expressed in the CD11b(+)CD11c(+) myeloid population. Moreover this same population expressed IL-1β and TNFα pro-inflammatory cytokines. By 6 months, the mucous neck cell metaplasia (SPEM) expressed IL-6, phosphorylated STAT3 and the proliferative marker Ki67. Expression was not observed in Gli1 mutant mice consistent with the requirement of Gli1 to induce this pre-neoplastic phenotype. Ectopic Shh ligand expression alone was not sufficient to induce SPEM, but with Helicobacter infection synergistically increased the histologic severity observed with the inflammation. Therefore Hedgehog signaling is required, but is not sufficient to generate pre-neoplastic changes during chronic gastritis. Gli1-dependent myeloid cell differentiation plays a pivotal role in the appearance of myeloid cell subtypes ostensibly required for SPEM development. Moreover, it suggests that therapies capable of targeting this phenotypic switch might prevent progression to metaplasia, the pre-neoplastic change that develops prior to dysplasia and gastric cancer, which also occurs in other epithelial-derived neoplasias initiated by chronic inflammation.

  15. Gli1 deletion prevents Helicobacter-induced gastric metaplasia and expansion of myeloid cell subsets.

    Directory of Open Access Journals (Sweden)

    Mohamad El-Zaatari

    Full Text Available Chronic inflammation in the stomach induces metaplasia, the pre-cancerous lesion that precedes inflammation-driven neoplastic transformation. While Hedgehog signaling contributes to the initiation of some cancers, its role in gastric transformation remains poorly defined. We found that Helicobacter-infected C57BL/6 mice develop extensive mucous cell metaplasia at 6 month but not at 2 months post-infection. Gastric metaplasia coincided with the appearance of CD45(+MHCII(+CD11b(+CD11c(+ myeloid cells that were normally not present in the chronic gastritis at 2 months. The myeloid regulatory gene Schlafen-4 was identified in a microarray analysis comparing infected WT versus Gli1 null mice and was expressed in the CD11b(+CD11c(+ myeloid population. Moreover this same population expressed IL-1β and TNFα pro-inflammatory cytokines. By 6 months, the mucous neck cell metaplasia (SPEM expressed IL-6, phosphorylated STAT3 and the proliferative marker Ki67. Expression was not observed in Gli1 mutant mice consistent with the requirement of Gli1 to induce this pre-neoplastic phenotype. Ectopic Shh ligand expression alone was not sufficient to induce SPEM, but with Helicobacter infection synergistically increased the histologic severity observed with the inflammation. Therefore Hedgehog signaling is required, but is not sufficient to generate pre-neoplastic changes during chronic gastritis. Gli1-dependent myeloid cell differentiation plays a pivotal role in the appearance of myeloid cell subtypes ostensibly required for SPEM development. Moreover, it suggests that therapies capable of targeting this phenotypic switch might prevent progression to metaplasia, the pre-neoplastic change that develops prior to dysplasia and gastric cancer, which also occurs in other epithelial-derived neoplasias initiated by chronic inflammation.

  16. NLRP3 deletion protects from hyperoxia-induced acute lung injury

    OpenAIRE

    Fukumoto, Jutaro; Fukumoto, Itsuko; Parthasarathy, Prasanna Tamarapu; Cox, Ruan; Huynh, Bao; Ramanathan, Gurukumar Kollongod; Venugopal, Rajan Babu; Allen-Gipson, Diane S.; Lockey, Richard F.; Kolliputi, Narasaiah

    2013-01-01

    Inspiration of a high concentration of oxygen, a therapy for acute lung injury (ALI), could unexpectedly lead to reactive oxygen species (ROS) production and hyperoxia-induced acute lung injury (HALI). Nucleotide-binding domain and leucine-rich repeat PYD-containing protein 3 (NLRP3) senses the ROS, triggering inflammasome activation and interleukin-1β (IL-1β) production and secretion. However, the role of NLRP3 inflammasome in HALI is unclear. The main aim of this study is to determine the e...

  17. Topography of multi-locus deletions induced by gamma-rays and neutrons in the black, cinnabar and vestigial regions of drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrov, I.V.; Lapidus, I.L.; Alexandrova, M.V. [Joint Institute for Nuclear Research, Moscov (Russian Federation)

    1997-03-01

    The extend and breakpoint location of 85 chromosomal-scale deletions induced by gamma-rays or fission neutrons in the black, cinnabar and vestigial regions of Drosophila genome have been examined by conventional cytogenetic analysis of the polytene chromosomes. It was found that the topographies of deletions are similar for both type of radiation and for all regions under study: the largest deletions have 3.5 Mb length, i.e. more than 2 divisions of the polytene chromosome; the breakpoints of deletions are located within the inter-bands and mapped more often in the centro-metric directions; the sizes of deletions are multiple to one, two or more visible chromomeres of polytene chromosome. These findings seem to be very well explained within the framework of the rosette-loopy model of higher (super-chromosome) level of the chromatin organization and of the notions about the illegitimate recombination promoted by the clustered damages of the core DNA resulting from the one-hit events of energy deposition at this target supported by the linear relationship observed between the delation yield and the dose of radiations studied. (authors)

  18. WNK4 is an Adipogenic Factor and Its Deletion Reduces Diet-Induced Obesity in Mice

    Directory of Open Access Journals (Sweden)

    Daiei Takahashi

    2017-04-01

    Full Text Available The with-no-lysine kinase (WNK 4 gene is a causative gene in pseudohypoaldosteronism type II. Although WNKs are widely expressed in the body, neither their metabolic functions nor their extrarenal role is clear. In this study, we found that WNK4 was expressed in mouse adipose tissue and 3T3-L1 adipocytes. In mouse primary preadipocytes and in 3T3-L1 adipocytes, WNK4 was markedly induced in the early phase of adipocyte differentiation. WNK4 expression preceded the expression of key transcriptional factors PPARγ and C/EBPα. WNK4-siRNA-transfected 3T3-L1 cells and human mesenchymal stem cells showed reduced expression of PPARγ and C/EBPα and lipid accumulation. WNK4 protein affected the DNA-binding ability of C/EBPβ and thereby reduced PPARγ expression. In the WNK4−/− mice, PPARγ and C/EBPα expression were decreased in adipose tissues, and the mice exhibited partial resistance to high-fat diet-induced adiposity. These data suggest that WNK4 may be a proadipogenic factor, and offer insights into the relationship between WNKs and energy metabolism.

  19. Exercise-induced muscle glucose uptake in mice with graded, muscle-specific GLUT-4 deletion

    Science.gov (United States)

    Howlett, Kirsten F; Andrikopoulos, Sofianos; Proietto, Joseph; Hargreaves, Mark

    2013-01-01

    To investigate the importance of the glucose transporter GLUT-4 for muscle glucose uptake during exercise, transgenic mice with skeletal muscle GLUT-4 expression approximately 30–60% of normal (CON) and approximately 5–10% of normal (KO) were generated using the Cre/Lox system and compared with wild-type (WT) mice during approximately 40 min of treadmill running (KO: 37.7 ± 1.3 min; WT: 40 min; CON: 40 min, P = 0.18). In WT and CON animals, exercise resulted in an overall increase in muscle glucose uptake. More specifically, glucose uptake was increased in red gastrocnemius of WT mice and in the soleus and red gastrocnemius of CON mice. In contrast, the exercise-induced increase in muscle glucose uptake in all muscles was completely abolished in KO mice. Muscle glucose uptake increased during exercise in both red and white quadriceps of WT mice, while the small increases in CON mice were not statistically significant. In KO mice, there was no change at all in quadriceps muscle glucose uptake. No differences in muscle glycogen use during exercise were observed between any of the groups. However, there was a significant increase in plasma glucose levels after exercise in KO mice. The results of this study demonstrated that a reduction in skeletal muscle GLUT-4 expression to approximately 10% of normal levels completely abolished the exercise-induced increase in muscle glucose uptake. PMID:24303141

  20. Deletion of glutathione peroxidase-2 inhibits azoxymethane-induced colon cancer development.

    Directory of Open Access Journals (Sweden)

    Mike F Müller

    Full Text Available The selenoprotein glutathione peroxidase-2 (GPx2 appears to have a dual role in carcinogenesis. While it protected mice from colon cancer in a model of inflammation-triggered carcinogenesis (azoxymethane and dextran sodium sulfate treatment, it promoted growth of xenografted tumor cells. Therefore, we analyzed the effect of GPx2 in a mouse model mimicking sporadic colorectal cancer (azoxymethane-treatment only. GPx2-knockout (KO and wild-type (WT mice were adjusted to an either marginally deficient (-Se, adequate (+Se, or supranutritional (++Se selenium status and were treated six times with azoxymethane (AOM to induce tumor development. In the -Se and ++Se groups, the number of tumors was significantly lower in GPx2-KO than in respective WT mice. On the +Se diet, the number of dysplastic crypts was reduced in GPx2-KO mice. This may be explained by more basal and AOM-induced apoptotic cell death in GPx2-KO mice that eliminates damaged or pre-malignant epithelial cells. In WT dysplastic crypts GPx2 was up-regulated in comparison to normal crypts which might be an attempt to suppress apoptosis. In contrast, in the +Se groups tumor numbers were similar in both genotypes but tumor size was larger in GPx2-KO mice. The latter was associated with an inflammatory and tumor-promoting environment as obvious from infiltrated inflammatory cells in the intestinal mucosa of GPx2-KO mice even without any treatment and characterized as low-grade inflammation. In WT mice the number of tumors tended to be lowest in +Se compared to -Se and ++Se feeding indicating that selenium might delay tumorigenesis only in the adequate status. In conclusion, the role of GPx2 and presumably also of selenium depends on the cancer stage and obviously on the involvement of inflammation.

  1. Deletion of c-FLIP from CD11bhiMacrophages Prevents Development of Bleomycin-induced Lung Fibrosis.

    Science.gov (United States)

    McCubbrey, Alexandra L; Barthel, Lea; Mohning, Michael P; Redente, Elizabeth F; Mould, Kara J; Thomas, Stacey M; Leach, Sonia M; Danhorn, Thomas; Gibbings, Sophie L; Jakubzick, Claudia V; Henson, Peter M; Janssen, William J

    2018-01-01

    Idiopathic pulmonary fibrosis is a progressive lung disease with complex pathophysiology and fatal prognosis. Macrophages (MΦ) contribute to the development of lung fibrosis; however, the underlying mechanisms and specific MΦ subsets involved remain unclear. During lung injury, two subsets of lung MΦ coexist: Siglec-F hi resident alveolar MΦ and a mixed population of CD11b hi MΦ that primarily mature from immigrating monocytes. Using a novel inducible transgenic system driven by a fragment of the human CD68 promoter, we targeted deletion of the antiapoptotic protein cellular FADD-like IL-1β-converting enzyme-inhibitory protein (c-FLIP) to CD11b hi MΦ. Upon loss of c-FLIP, CD11b hi MΦ became susceptible to cell death. Using this system, we were able to show that eliminating CD11b hi MΦ present 7-14 days after bleomycin injury was sufficient to protect mice from fibrosis. RNA-seq analysis of lung MΦ present during this time showed that CD11b hi MΦ, but not Siglec-F hi MΦ, expressed high levels of profibrotic chemokines and growth factors. Human MΦ from patients with idiopathic pulmonary fibrosis expressed many of the same profibrotic chemokines identified in murine CD11b hi MΦ. Elimination of monocyte-derived MΦ may help in the treatment of fibrosis. We identify c-FLIP and the associated extrinsic cell death program as a potential pathway through which these profibrotic MΦ may be pharmacologically targeted.

  2. Podocyte-specific deletion of Rac1 leads to aggravation of renal injury in STZ-induced diabetic mice

    Energy Technology Data Exchange (ETDEWEB)

    Ishizaka, Masanori [Division of Nephrology, Department of Internal Medicine, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421 (Japan); Gohda, Tomohito, E-mail: goda@juntendo.ac.jp [Division of Nephrology, Department of Internal Medicine, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421 (Japan); Takagi, Miyuki; Omote, Keisuke; Sonoda, Yuji [Division of Nephrology, Department of Internal Medicine, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421 (Japan); Oliva Trejo, Juan Alejandro [Laboratory for Kidney Research (TMK Project), Medical Innovation Center, Kyoto University Graduate School of Medicine, 53 Shogoin Kawaharacho, Sakyo-ku, Kyoto 606-8397 (Japan); Asao, Rin; Hidaka, Teruo [Division of Nephrology, Department of Internal Medicine, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421 (Japan); Asanuma, Katsuhiko [Division of Nephrology, Department of Internal Medicine, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421 (Japan); Laboratory for Kidney Research (TMK Project), Medical Innovation Center, Kyoto University Graduate School of Medicine, 53 Shogoin Kawaharacho, Sakyo-ku, Kyoto 606-8397 (Japan); Horikoshi, Satoshi [Division of Nephrology, Department of Internal Medicine, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421 (Japan); Tomino, Yasuhiko [Division of Nephrology, Department of Internal Medicine, Juntendo University Faculty of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421 (Japan); Medical Corporation SHOWAKAI, 3-12-12 Nishishinjuku, Shinjuku-ku, Tokyo 160-0023 (Japan)

    2015-11-20

    Rac1, a GTPase of the Rho subfamily, has a crucial role in cytoskeletal architecture, as well as the regulation of cell migration and growth. However, renal injury in mice with podocyte-specific deletion of Rac1 has yet to be elucidated fully due to conflicting findings. Herein, we identified a possible role for Rac1 in podocytes of streptozotocin- (STZ) induced diabetic mice. The urinary albumin/creatinine ratio (ACR) in the knockout (KO) group was significantly higher than that in the wild type (WT) group at any week of age. A more marked ACR increase was observed in STZ/KO group than STZ/WT group, although ACR did increase with weeks of age in both diabetic groups. The kidney sections from diabetic mice revealed a glomerular hypertrophy with mesangial expansion, but there was no appreciable difference in glomerular findings under a light microscope between STZ/WT and STZ/KO mice. However, an electron microscopy analysis revealed that regardless of the presence or absence of diabetes, both KO (KO and STZ/KO) groups had a higher rate of foot process effacement compared with both WT (WT and STZ/WT) groups. The expression levels of the slit diaphragm protein, podocin, was reduced with the induction of diabetes, and the levels in the STZ/KO group experienced a further reduction compared with the STZ/WT group. The number of WT1-positive cells in the STZ/KO group was more significantly decreased than that in the other three groups. In contrast, the numbers of cleaved caspase 3- and TUNEL-positive cells in the glomeruli of the STZ/KO group were more increased than those in the STZ/WT group. Thus, this study provides evidence that podocyte-specific deletion of Rac1 results in morphological alteration in podocytes, and that the induction of apoptosis or decreased expression of the slit diaphragm proteins by hyperglycemic stimuli are associated with the progression of diabetic nephropathy.

  3. Vaccination using live attenuated Leishmania donovani centrin deleted parasites induces protection in dogs against Leishmania infantum.

    Science.gov (United States)

    Fiuza, Jacqueline Araújo; Gannavaram, Sreenivas; Santiago, Helton da Costa; Selvapandiyan, Angamuthu; Souza, Daniel Menezes; Passos, Lívia Silva Araújo; de Mendonça, Ludmila Zanandreis; Lemos-Giunchetti, Denise da Silveira; Ricci, Natasha Delaqua; Bartholomeu, Daniella Castanheira; Giunchetti, Rodolfo Cordeiro; Bueno, Lilian Lacerda; Correa-Oliveira, Rodrigo; Nakhasi, Hira L; Fujiwara, Ricardo Toshio

    2015-01-03

    Live attenuated Leishmania donovani parasites such as LdCen(-/-) have been shown elicit protective immunity against leishmanial infection in mice and hamster models. Previously, we have reported on the induction of strong immunogenicity in dogs upon vaccination with LdCen(-/-) including an increase in immunoglobulin isotypes, higher lymphoproliferative response, higher frequencies of activated CD4(+) and CD8(+) T cells, IFN-γ production by CD8(+) T cells, increased secretion of TNF-α and IL-12/IL-23p40 and, finally, decreased secretion of IL-4. To further explore the potential of LdCen(-/-) parasites as vaccine candidates, we performed a 24-month follow up of LdCen(-/-) immunized dogs after challenge with virulent Leishmania infantum, aiming determination of parasite burden by qPCR, antibody production (ELISA) and cellular responses (T cell activation and cytokine production) by flow cytometry and sandwich ELISA. Our data demonstrated that vaccination with a single dose of LdCen(-/-) (without any adjuvant) resulted in the reduction of up to 87.3% of parasite burden after 18 months of virulent challenge. These results are comparable to those obtained with commercially available vaccine in Brazil (Leishmune(®)). The protection was associated with antibody production and CD4(+) and CD8(+) proliferative responses, as well as T cell activation and significantly higher production of IFN-γ, IL-12/IL-23p40 and TNF-α, which was comparable to responses induced by immunization with Leishmune(®), with significant differences when compared to control animals (Placebo). Moreover, only animals immunized with LdCen(-/-) expressed lower levels of IL-4 when compared to animals vaccinated either with Leishmune(®) or PBS. Our results support further studies aiming to demonstrate the potential of genetically modified live attenuated L. donovani vaccine to control L. infantum transmission in endemic areas for CVL. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. The Angiotensin Converting Enzyme Insertion/Deletion Polymorphism Modifies Exercise-Induced Muscle Metabolism.

    Directory of Open Access Journals (Sweden)

    David Vaughan

    Full Text Available A silencer region (I-allele within intron 16 of the gene for the regulator of vascular perfusion, angiotensin-converting enzyme (ACE, is implicated in phenotypic variation of aerobic fitness and the development of type II diabetes. We hypothesised that the reportedly lower aerobic performance in non-carriers compared to carriers of the ACE I-allele, i.e. ACE-DD vs. ACE-ID/ACE-II genotype, is associated with alterations in activity-induced glucose metabolism and capillarisation in exercise muscle.Fifty-three, not-specifically trained Caucasian men carried out a one-legged bout of cycling exercise to exhaustion and/or participated in a marathon, the aim being to identify and validate genotype effects on exercise metabolism. Respiratory exchange ratio (RER, serum glucose and lipid concentration, glycogen, and metabolite content in vastus lateralis muscle based on ultra-performance lipid chromatography-mass spectrometry (UPLC-MS, were assessed before and after the cycling exercise in thirty-three participants. Serum metabolites were measured in forty subjects that completed the marathon. Genotype effects were assessed post-hoc.Cycling exercise reduced muscle glycogen concentration and this tended to be affected by the ACE I-allele (p = 0.09. The ACE-DD genotype showed a lower maximal RER and a selective increase in serum glucose concentration after exercise compared to ACE-ID and ACE-II genotypes (+24% vs. +2% and -3%, respectively. Major metabolites of mitochondrial metabolism (i.e. phosphoenol pyruvate, nicotinamide adenine dinucleotide phosphate, L-Aspartic acid, glutathione were selectively affected in vastus lateralis muscle by exercise in the ACE-DD genotype. Capillary-to-fibre ratio was 24%-lower in the ACE-DD genotype. Individuals with the ACE-DD genotype demonstrated an abnormal increase in serum glucose to 7.7 mM after the marathon.The observations imply a genetically modulated role for ACE in control of glucose import and oxidation in

  5. The Angiotensin Converting Enzyme Insertion/Deletion Polymorphism Modifies Exercise-Induced Muscle Metabolism.

    Science.gov (United States)

    Vaughan, David; Brogioli, Michael; Maier, Thomas; White, Andy; Waldron, Sarah; Rittweger, Jörn; Toigo, Marco; Wettstein, Jessica; Laczko, Endre; Flück, Martin

    2016-01-01

    A silencer region (I-allele) within intron 16 of the gene for the regulator of vascular perfusion, angiotensin-converting enzyme (ACE), is implicated in phenotypic variation of aerobic fitness and the development of type II diabetes. We hypothesised that the reportedly lower aerobic performance in non-carriers compared to carriers of the ACE I-allele, i.e. ACE-DD vs. ACE-ID/ACE-II genotype, is associated with alterations in activity-induced glucose metabolism and capillarisation in exercise muscle. Fifty-three, not-specifically trained Caucasian men carried out a one-legged bout of cycling exercise to exhaustion and/or participated in a marathon, the aim being to identify and validate genotype effects on exercise metabolism. Respiratory exchange ratio (RER), serum glucose and lipid concentration, glycogen, and metabolite content in vastus lateralis muscle based on ultra-performance lipid chromatography-mass spectrometry (UPLC-MS), were assessed before and after the cycling exercise in thirty-three participants. Serum metabolites were measured in forty subjects that completed the marathon. Genotype effects were assessed post-hoc. Cycling exercise reduced muscle glycogen concentration and this tended to be affected by the ACE I-allele (p = 0.09). The ACE-DD genotype showed a lower maximal RER and a selective increase in serum glucose concentration after exercise compared to ACE-ID and ACE-II genotypes (+24% vs. +2% and -3%, respectively). Major metabolites of mitochondrial metabolism (i.e. phosphoenol pyruvate, nicotinamide adenine dinucleotide phosphate, L-Aspartic acid, glutathione) were selectively affected in vastus lateralis muscle by exercise in the ACE-DD genotype. Capillary-to-fibre ratio was 24%-lower in the ACE-DD genotype. Individuals with the ACE-DD genotype demonstrated an abnormal increase in serum glucose to 7.7 mM after the marathon. The observations imply a genetically modulated role for ACE in control of glucose import and oxidation in working

  6. High-molecular-weight glutenin subunit-deficient mutants induced by ion beam and the effects of Glu-1 loci deletion on wheat quality properties.

    Science.gov (United States)

    Zhang, Lujun; Chen, Qiufang; Su, Mingjie; Yan, Biao; Zhang, Xiangqi; Jiao, Zhen

    2016-03-15

    High-molecular-weight glutenin subunits (HMW-GSs) play a critical role in determining the viscoelastic properties of wheat. Mutations induced by ion beam radiation have been applied to improve the yield and quality of crop. In this study, HMW-GS-deficient mutant lines were selected and the effects of Glu-1 loci deletion on wheat quality properties were illustrated according to the analysis of dry seeds of common wheat (Triticum aestivum L.) Xiaoyan 81 treated with a nitrogen ion beam. Three HMW-GS-deficient mutant lines were obtained and then detected by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Large-chromosome-fragment deletion resulted in specific deficiencies, and the deleted region sizes were determined using molecular markers. Agronomic characters, quantity and proportion of glutenins and dough microstructure of the deletion lines all proved to be quite different from those of wild-type Xiaoyan 81. Analysis of quality properties suggested that GluA1(-) had superior property parameters, while GluB1(-) and GluD1(-) both showed a significant decrease in quality properties compared with Xiaoyan 81. The effects of the three Glu-1 loci on flour and dough quality-related parameters should be Glu-D1 > Glu-B1 > Glu-A1. Ion beam radiation can be used as a mutagen to create new crop mutants. © 2015 Society of Chemical Industry.

  7. Deletion of Inducible Nitric-Oxide Synthase in Leptin-Deficient Mice Improves Brown Adipose Tissue Function

    Science.gov (United States)

    Becerril, Sara; Rodríguez, Amaia; Catalán, Victoria; Sáinz, Neira; Ramírez, Beatriz; Collantes, María; Peñuelas, Iván; Gómez-Ambrosi, Javier; Frühbeck, Gema

    2010-01-01

    Background Leptin and nitric oxide (NO) on their own participate in the control of non-shivering thermogenesis. However, the functional interplay between both factors in this process has not been explored so far. Therefore, the aim of the present study was to analyze the impact of the absence of the inducible NO synthase (iNOS) gene in the regulation of energy balance in ob/ob mice. Methods and Findings Double knockout (DBKO) mice simultaneously lacking the ob and iNOS genes were generated, and the expression of molecules involved in the control of brown fat cell function was analyzed by real-time PCR, western-blot and immunohistochemistry. Twelve week-old DBKO mice exhibited reduced body weight (p<0.05), decreased amounts of total fat pads (p<0.05), lower food efficiency rates (p<0.05) and higher rectal temperature (p<0.05) than ob/ob mice. Ablation of iNOS also improved the carbohydrate and lipid metabolism of ob/ob mice. DBKO showed a marked reduction in the size of brown adipocytes compared to ob/ob mutants. In this sense, in comparison to ob/ob mice, DBKO rodents showed an increase in the expression of PR domain containing 16 (Prdm16), a transcriptional regulator of brown adipogenesis. Moreover, iNOS deletion enhanced the expression of mitochondria-related proteins, such as peroxisome proliferator-activated receptor γ coactivator-1 α (Pgc-1α), sirtuin-1 (Sirt-1) and sirtuin-3 (Sirt-3). Accordingly, mitochondrial uncoupling proteins 1 and 3 (Ucp-1 and Ucp-3) were upregulated in brown adipose tissue (BAT) of DBKO mice as compared to ob/ob rodents. Conclusion Ablation of iNOS improved the energy balance of ob/ob mice by decreasing food efficiency through an increase in thermogenesis. These effects may be mediated, in part, through the recovery of the BAT phenotype and brown fat cell function improvement. PMID:20532036

  8. Deletion of a target gene in Indica rice via CRISPR/Cas9.

    Science.gov (United States)

    Wang, Ying; Geng, Lizhao; Yuan, Menglong; Wei, Juan; Jin, Chen; Li, Min; Yu, Kun; Zhang, Ya; Jin, Huaibing; Wang, Eric; Chai, Zhijian; Fu, Xiangdong; Li, Xianggan

    2017-08-01

    Using CRISPR/Cas9, we successfully deleted large fragments of the yield-related gene DENSE AND ERECT PANICLE1 in Indica rice at relatively high frequency and generated gain-of-function dep1 mutants. CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 is a rapidly developing technology used to produce gene-specific modifications in both mammalian and plant systems. Most CRISPR-induced modifications in plants reported to date have been small insertions or deletions. Few large target gene deletions have thus far been reported, especially for Indica rice. In this study, we designed multiple CRISPR sgRNAs and successfully deleted DNA fragments in the gene DENSE AND ERECT PANICLE1 (DEP1) in the elite Indica rice line IR58025B. We achieved deletion frequencies of up to 21% for a 430 bp target and 9% for a 10 kb target among T0 events. Constructs with four sgRNAs did not generate higher full-length deletion frequencies than constructs with two sgRNAs. The multiple mutagenesis frequency reached 93% for four targets, and the homozygous mutation frequency reached 21% at the T0 stage. Important yield-related trait characteristics, such as dense and erect panicles and reduced plant height, were observed in dep1 homozygous T0 mutant plants produced by CRISPR/Cas9. Therefore, we successfully obtained deletions in DEP1 in the Indica background using the CRISPR/Cas9 editing tool at relatively high frequency.

  9. Identification of a novel functional deletion variant in the 5'-UTR of the DJ-1 gene

    Directory of Open Access Journals (Sweden)

    Warnich Louise

    2009-10-01

    Full Text Available Abstract Background DJ-1 forms part of the neuronal cellular defence mechanism against oxidative insults, due to its ability to undergo self-oxidation. Oxidative stress has been implicated in the pathogenesis of central nervous system damage in different neurodegenerative disorders including Alzheimer's disease and Parkinson's disease (PD. Various mutations in the DJ-1 (PARK7 gene have been shown to cause the autosomal recessive form of PD. In the present study South African PD patients were screened for mutations in DJ-1 and we aimed to investigate the functional significance of a novel 16 bp deletion variant identified in one patient. Methods The possible effect of the deletion on promoter activity was investigated using a Dual-Luciferase Reporter assay. The DJ-1 5'-UTR region containing the sequence flanking the 16 bp deletion was cloned into a pGL4.10-Basic luciferase-reporter vector and transfected into HEK293 and BE(2-M17 neuroblastoma cells. Promoter activity under hydrogen peroxide-induced oxidative stress conditions was also investigated. Computational (in silico cis-regulatory analysis of DJ-1 promoter sequence was performed using the transcription factor-binding site database, TRANSFAC via the PATCH™ and rVISTA platforms. Results A novel 16 bp deletion variant (g.-6_+10del was identified in DJ-1 which spans the transcription start site and is situated 93 bp 3' from a Sp1 site. The deletion caused a reduction in luciferase activity of approximately 47% in HEK293 cells and 60% in BE(2-M17 cells compared to the wild-type (P Conclusion This is the first report of a functional DJ-1 promoter variant, which has the potential to influence transcript stability or translation efficiency. Further work is necessary to determine the extent to which the g.-6_+10del variant affects the normal function of the DJ-1 promoter and whether this variant confers a risk for PD.

  10. Deletion of the mitochondrial flavoprotein apoptosis inducing factor (AIF induces beta-cell apoptosis and impairs beta-cell mass.

    Directory of Open Access Journals (Sweden)

    Fabienne T Schulthess

    Full Text Available BACKGROUND: Apoptosis is a hallmark of beta-cell death in both type 1 and type 2 diabetes mellitus. Understanding how apoptosis contributes to beta-cell turnover may lead to strategies to prevent progression of diabetes. A key mediator of apoptosis, mitochondrial function, and cell survival is apoptosis inducing factor (AIF. In the present study, we investigated the role of AIF on beta-cell mass and survival using the Harlequin (Hq mutant mice, which are hypomorphic for AIF. METHODOLOGY/PRINCIPAL FINDINGS: Immunohistochemical evaluation of pancreata from Hq mutant mice displayed much smaller islets compared to wild-type mice (WT. Analysis of beta-cell mass in these mice revealed a greater than 4-fold reduction in beta-cell mass together with an 8-fold increase in beta-cell apoptosis. Analysis of cell cycle dynamics, using BrdU pulse as a marker for cells in S-phase, did not detect significant differences in the frequency of beta-cells in S-phase. In contrast, double staining for phosphorylated Histone H3 and insulin showed a 3-fold increase in beta-cells in the G2 phase in Hq mutant mice, but no differences in M-phase compared to WT mice. This suggests that the beta-cells from Hq mutant mice are arrested in the G2 phase and are unlikely to complete the cell cycle. beta-cells from Hq mutant mice display increased sensitivity to hydrogen peroxide-induced apoptosis, which was confirmed in human islets in which AIF was depleted by siRNA. AIF deficiency had no effect on glucose stimulated insulin secretion, but the impaired effect of hydrogen peroxide on beta-cell function was potentiated. CONCLUSIONS/SIGNIFICANCE: Our results indicate that AIF is essential for maintaining beta-cell mass and for oxidative stress response. A decrease in the oxidative phosphorylation capacity may counteract the development of diabetes, despite its deleterious effects on beta-cell survival.

  11. A Deletion Variant of the α2b-Adrenoceptor Modulates the Stress-Induced Shift from "Cognitive" to "Habit" Memory.

    Science.gov (United States)

    Wirz, Lisa; Wacker, Jan; Felten, Andrea; Reuter, Martin; Schwabe, Lars

    2017-02-22

    Stress induces a shift from hippocampus-based "cognitive" toward dorsal striatum-based "habitual" learning and memory. This shift is thought to have important implications for stress-related psychopathologies, including post-traumatic stress disorder (PTSD). However, there is large individual variability in the stress-induced bias toward habit memory, and the factors underlying this variability are completely unknown. Here we hypothesized that a functional deletion variant of the gene encoding the α2b-adrenoceptor (ADRA2B), which has been linked to emotional memory processes and increased PTSD risk, modulates the stress-induced shift from cognitive toward habit memory. In two independent experimental studies, healthy humans were genotyped for the ADRA2B deletion variant. After a stress or control manipulation, participants completed a dual-solution learning task while electroencephalographic (Study I) or fMRI measurements (Study II) were taken. Carriers compared with noncarriers of the ADRA2B deletion variant exhibited a significantly reduced bias toward habit memory after stress. fMRI results indicated that, whereas noncarriers of the ADRA2B deletion variant showed increased functional connectivity between amygdala and putamen after stress, this increase in connectivity was absent in carriers of the deletion variant, who instead showed overall enhanced connectivity between amygdala and entorhinal cortex. Our results indicate that a common genetic variation of the noradrenergic system modulates the impact of stress on the balance between cognitive and habitual memory systems, most likely via altered amygdala orchestration of these systems.SIGNIFICANCE STATEMENT Stressful events have a powerful effect on human learning and memory. Specifically, accumulating evidence suggests that stress favors more rigid dorsal striatum-dependent habit memory, at the expense of flexible hippocampus-dependent cognitive memory. Although this shift may have important implications for

  12. Mitochondrial DNA deletions in patients with chronic suppurative otitis media.

    Science.gov (United States)

    Tatar, Arzu; Tasdemir, Sener; Sahin, Ibrahim; Bozoglu, Ceyda; Erdem, Haktan Bagis; Yoruk, Ozgur; Tatar, Abdulgani

    2016-09-01

    The aim of this study was to investigate the 4977 and 7400 bp deletions of mitochondrial DNA in patients with chronic suppurative otitis media and to indicate the possible association of mitochondrial DNA deletions with chronic suppurative otitis media. Thirty-six patients with chronic suppurative otitis media were randomly selected to assess the mitochondrial DNA deletions. Tympanomastoidectomy was applied for the treatment of chronic suppurative otitis media, and the curettage materials including middle ear tissues were collected. The 4977 and 7400 bp deletion regions and two control regions of mitochondrial DNA were assessed by using the four pair primers. DNA was extracted from middle ear tissues and peripheral blood samples of the patients, and then polymerase chain reactions (PCRs) were performed. PCR products were separated in 2 % agarose gel. Seventeen of 36 patients had the heterozygote 4977 bp deletion in the middle ear tissue but not in peripheral blood. There wasn't any patient who had the 7400 bp deletion in mtDNA of their middle ear tissue or peripheral blood tissue. The patients with the 4977 bp deletion had a longer duration of chronic suppurative otitis media and a higher level of hearing loss than the others (p otitis media and the reactive oxygen species can cause the mitochondrial DNA deletions and this may be a predisposing factor to sensorineural hearing loss in chronic suppurative otitis media. An antioxidant drug as a scavenger agent may be used in long-term chronic suppurative otitis media.

  13. Deletion of inducible nitric-oxide synthase in leptin-deficient mice improves brown adipose tissue function.

    Directory of Open Access Journals (Sweden)

    Sara Becerril

    Full Text Available BACKGROUND: Leptin and nitric oxide (NO on their own participate in the control of non-shivering thermogenesis. However, the functional interplay between both factors in this process has not been explored so far. Therefore, the aim of the present study was to analyze the impact of the absence of the inducible NO synthase (iNOS gene in the regulation of energy balance in ob/ob mice. METHODS AND FINDINGS: Double knockout (DBKO mice simultaneously lacking the ob and iNOS genes were generated, and the expression of molecules involved in the control of brown fat cell function was analyzed by real-time PCR, western-blot and immunohistochemistry. Twelve week-old DBKO mice exhibited reduced body weight (p<0.05, decreased amounts of total fat pads (p<0.05, lower food efficiency rates (p<0.05 and higher rectal temperature (p<0.05 than ob/ob mice. Ablation of iNOS also improved the carbohydrate and lipid metabolism of ob/ob mice. DBKO showed a marked reduction in the size of brown adipocytes compared to ob/ob mutants. In this sense, in comparison to ob/ob mice, DBKO rodents showed an increase in the expression of PR domain containing 16 (Prdm16, a transcriptional regulator of brown adipogenesis. Moreover, iNOS deletion enhanced the expression of mitochondria-related proteins, such as peroxisome proliferator-activated receptor gamma coactivator-1 alpha (Pgc-1alpha, sirtuin-1 (Sirt-1 and sirtuin-3 (Sirt-3. Accordingly, mitochondrial uncoupling proteins 1 and 3 (Ucp-1 and Ucp-3 were upregulated in brown adipose tissue (BAT of DBKO mice as compared to ob/ob rodents. CONCLUSION: Ablation of iNOS improved the energy balance of ob/ob mice by decreasing food efficiency through an increase in thermogenesis. These effects may be mediated, in part, through the recovery of the BAT phenotype and brown fat cell function improvement.

  14. Biologic properties of viable deletion mutants of simian virus 40 (SV40) rescued from the cells of an SV40-induced hamster lymphocytic leukemia.

    Science.gov (United States)

    Diamandopoulos, G T; Carmichael, G

    1983-12-01

    A lymphocytic leukemia induced by the oncogenic DNA simian virus 40 (SV40) in an inbred LSH/SsLak Syrian golden hamster was evoked to produce infectious SV40 by fusion of the leukemia cells with grivet monkey kidney (GMK) cells and by exposure of the leukemia cells to the chemical inducers mitomycin C and cycloheximide. Plaque-purified viable substrains of the rescued SV40 when studied by restriction endonuclease digestion of viral DNA were found to contain small deletions within the Hind III restriction fragment C. These deletions lay near the viral origin of DNA replication. Ten plaque-purified substrains of the rescued virus identified by immunofluorescence as being SV40 were found, when compared to the wild-type SV40, to replicate slowly and to form small plaques. Although these substrains transformed NIH/3T3 cells as efficiently as the wild-type SV40 in tissue culture, they were generally less oncogenic in vivo--7 of the 10 failed to induce tumors. The 3 oncogenic SV40-rescued substrains were not found to exhibit "lymphocytotropism," i.e., the capacity to infect and neoplastically transform preferentially hamster lymphocytes. Thus the hamster lymphocytic leukemia originally induced by the wild-type SV40 was most likely a chance-stochastic event rather than the result of tropism-determinism mediated by the virus, as is usually the case with leukemogenic RNA viruses.

  15. Sab (Sh3bp5) dependence of JNK mediated inhibition of mitochondrial respiration in palmitic acid induced hepatocyte lipotoxicity.

    Science.gov (United States)

    Win, Sanda; Than, Tin Aung; Le, Bao Han Allison; García-Ruiz, Carmen; Fernandez-Checa, Jose C; Kaplowitz, Neil

    2015-06-01

    Sustained c-Jun N-terminal kinase (JNK) activation by saturated fatty acids plays a role in lipotoxicity and the pathogenesis of non-alcoholic steatohepatitis (NASH). We have reported that the interaction of JNK with mitochondrial Sab leads to inhibition of respiration, increased reactive oxygen species (ROS), cell death and hepatotoxicity. We tested whether this pathway underlies palmitic acid (PA)-induced lipotoxicity in hepatocytes. Primary mouse hepatocytes (PMH) from adeno-shlacZ or adeno-shSab treated mice and HuH7 cells were used. In PMH, PA dose-dependently up to 1mM stimulated oxygen consumption rate (OCR) due to mitochondrial β-oxidation. At ⩾1.5mM, PA gradually reduced OCR, followed by cell death. Inhibition of JNK, caspases or treatment with antioxidant butylated hydroxyanisole (BHA) protected PMH against cell death. Sab knockdown or a membrane permeable Sab blocking peptide prevented PA-induced mitochondrial impairment, but inhibited only the late phase of both JNK activation (beyond 4h) and cell death. In PMH, PA increased p-PERK and its downstream target CHOP, but failed to activate the IRE-1α arm of the UPR. However, Sab silencing did not affect PA-induced PERK activation. Conversely, specific inhibition of PERK prevented JNK activation and cell death, indicating a major role upstream of JNK activation. The effect of p-JNK on mitochondria plays a key role in PA-mediated lipotoxicity. The interplay of p-JNK with mitochondrial Sab leads to impaired respiration, ROS production, sustained JNK activation, and apoptosis. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  16. H-ras deletion protects against angiotensin II-induced arterial hypertension and cardiac remodeling through protein kinase G-Iβ pathway activation.

    Science.gov (United States)

    Martín-Sánchez, Paloma; Luengo, Alicia; Griera, Mercedes; Orea, María Jesús; López-Olañeta, Marina; Chiloeches, Antonio; Lara-Pezzi, Enrique; de Frutos, Sergio; Rodríguez-Puyol, Manuel; Calleros, Laura; Rodríguez-Puyol, Diego

    2017-10-20

    Ras proteins regulate cell survival, growth, differentiation, blood pressure, and fibrosis in some organs. We have demonstrated that H-ras gene deletion produces mice hypotension via a soluble guanylate cyclase-protein kinase G (PKG)-dependent mechanism. In this study, we analyzed the consequences of H-ras deletion on cardiac remodeling induced by continuous angiotensin II (AngII) infusion and the molecular mechanisms implied. Left ventricular posterior wall thickness and mass and cardiomyocyte cross-sectional area were similar between AngII-treated H-Ras knockout (H-ras(-/-) ) and control wild-type (H-ras(+/+) ) mice, as were extracellular matrix protein expression. Increased cardiac PKG-Iβ protein expression in H-ras(-/-) mice suggests the involvement of this protein in heart protection. Ex vivo experiments on cardiac explants could support this mechanism, as PKG blockade blunted protection against AngII-induced cardiac hypertrophy and fibrosis markers in H-ras(-/-) mice. Genetic modulation studies in cardiomyocytes and cardiac and embryonic fibroblasts revealed that the lack of H-Ras down-regulates the B-RAF/MEK/ERK pathway, which induces the glycogen synthase kinase-3β-dependent activation of the transcription factor, cAMP response element-binding protein, which is responsible for PKG-Iβ overexpression in H-ras(-/-) mouse embryonic fibroblasts. This study demonstrates that H-ras deletion protects against AngII-induced cardiac remodeling, possibly via a mechanism in which PKG-Iβ overexpression could play a partial role, and points to H-Ras and/or downstream proteins as potential therapeutic targets in cardiovascular disease.-Martín-Sánchez, P., Luengo, A., Griera, M., Orea, M. J., López-Olañeta, M., Chiloeches, A., Lara-Pezzi, E., de Frutos, S., Rodríguez-Puyol, M., Calleros, L., Rodríguez-Puyol, D. H-ras deletion protects against angiotensin II-induced arterial hypertension and cardiac remodeling through protein kinase G-Iβ pathway activation.

  17. Targeted Pten deletion plus p53-R270H mutation in mouse mammary epithelium induces aggressive claudin-low and basal-like breast cancer.

    Science.gov (United States)

    Wang, Sharon; Liu, Jeff C; Kim, Danbi; Datti, Alessandro; Zacksenhaus, Eldad

    2016-01-19

    Triple-negative breast cancer (TNBC), an aggressive disease comprising several subtypes including basal-like and claudin-low, involves frequent deletions or point mutations in TP53, as well as loss of PTEN. We previously showed that combined deletion of both tumor suppressors in the mouse mammary epithelium invariably induced claudin-low-like TNBC. The effect of p53 mutation plus Pten deletion on mammary tumorigenesis and whether this combination can induce basal-like TNBC in the mouse are unknown. WAP-Cre:Pten(f/f):p53(lox.stop.lox_R270H) composite mice were generated in which Pten is deleted and a p53-R270H mutation in the DNA-binding domain is induced upon expression of Cre-recombinase in pregnancy-identified alveolar progenitors. Tumors were characterized by histology, marker analysis, transcriptional profiling [GEO-GSE75989], bioinformatics, high-throughput (HTP) FDA drug screen as well as orthotopic injection to quantify tumor-initiating cells (TICs) and tail vein injection to identify lung metastasis. Combined Pten deletion plus induction of p53-R270H mutation accelerated formation of four distinct mammary tumors including poorly differentiated adenocarcinoma (PDA) and spindle/mesenchymal-like lesions. Transplantation assays revealed highest frequency of TICs in PDA and spindle tumors compared with other subtypes. Hierarchical clustering demonstrated that the PDA and spindle tumors grouped closely with human as well as mouse models of basal and claudin-low subtypes, respectively. HTP screens of primary Pten(∆):p53(∆) vs. Pten(∆):p53(R270H) spindle tumor cells with 1120 FDA-approved drugs identified 8-azaguanine as most potent for both tumor types, but found no allele-specific inhibitor. A gene set enrichment analysis revealed increased expression of a metastasis pathway in Pten(∆):p53(R270H) vs. Pten(∆):p53(∆) spindle tumors. Accordingly, following tail vein injection, both Pten(∆):p53(R270H) spindle and PDA tumor cells induced lung metastases

  18. P16 (INK4a) Deletion Ameliorated Renal Tubulointerstitial Injury in a Stress-induced Premature Senescence Model of Bmi-1 Deficiency.

    Science.gov (United States)

    Jin, Jianliang; Tao, Jianguo; Gu, Xin; Yu, Zhenzhen; Wang, Rong; Zuo, Guoping; Li, Qing; Lv, Xianhui; Miao, Dengshun

    2017-08-08

    To determine whether p16 (INK4a) deletion ameliorated renal tubulointerstitial injury by inhibiting a senescence-associated secretory phenotype (SASP) in Bmi-1-deficient (Bmi-1 (-/-)) mice, renal phenotypes were compared among 5-week-old Bmi-1 and p16 (INK4a) double-knockout, and Bmi-1 (-/-) and wild-type mice. Fifth-passage renal interstitial fibroblasts (RIFs) from the three groups were analyzed for senescence and proliferation. The effect of Bmi-1 deficiency on epithelial-to-mesenchymal transition (EMT) was examined in Bmi-1-knockdown human renal proximal tubular epithelial (HK2) cells, which were treated with concentrated conditioned medium (CM) from the fifth-passage renal interstitial fibroblasts (RIFs) of above three group mice or with exogenous TGF-β1. Our results demonstrated that p16 (INK4a) deletion largely rescued renal aging phenotypes caused by Bmi-1 deficiency, including impaired renal structure and function, decreased proliferation, increased apoptosis, senescence and SASP, DNA damage, NF-κB and TGF-β1/Smad signal activation, inflammatory cell infiltration, and tubulointerstitial fibrosis and tubular atrophy. P16 (INK4a) deletion also promoted proliferation, reduced senescence and SASP of RIFs and subsequently inhibited EMT of Bmi-1-knockdown HK2 cells. TGF-β1 further induced the EMT of Bmi-1-knockdown HK2 cells. Thus, p16 (INK4a) positive senescent cells would be a therapeutic target for preventing renal tubulointerstitial injury.

  19. Characterization of FeDREB1 promoter involved in cold- and drought-inducible expression from common buckwheat (Fagopyrum esculentum).

    Science.gov (United States)

    Fang, Z W; Xu, X Y; Gao, J F; Wang, P K; Liu, Z X; Feng, B L

    2015-07-17

    C-repeat-binding factor (CBF)/dehydration-responsive element (DREB) transcription factors play key roles in plant stress responses. However, little information is available on the regulation of CBF/DREB expression. In this study, we isolated and characterized the FeDREB1 promoter sequence from the common buckwheat accession Xinong 9976. To identify the upstream region of the FeDREB1 gene required for promoter activity, we constructed a series of FeDREB1 promoter deletion derivatives. Each deletion construct was analyzed through Agrobacterium-mediated transient transformation in tobacco leaves treated with 4°C cold or drought stress. Promoter-beta-glucuronidase fusion assays revealed that the pCD1 (-270 bp) deletion in the upstream region of FeDREB1 could activate expression of the GUS gene at 4°C. The pCD1 (-270 bp), pCD2 (-530 bp), and pCD3 (-904 bp) deletion induced low-level GUS expression under drought stress. However, the pCD4 (-1278 bp) deletion clearly activated GUS gene expression. Our results suggest that sections pCD1 (-270 bp) and pCD4 (-1278 bp) in the FeDREB1 gene promoter are new sources of induced promoters for adversity-resistance breeding in plant genetic engineering.

  20. Inefficient viral replication of bovine leukemia virus induced by spontaneous deletion mutation in the G4 gene.

    Science.gov (United States)

    Murakami, Hironobu; Uchiyama, Jumpei; Nikaido, Sae; Sato, Reiichiro; Sakaguchi, Masahiro; Tsukamoto, Kenji

    2016-10-01

    Enzootic bovine leucosis is caused by bovine leukemia virus (BLV) infection, which is highly prevalent in several regions of the world and significantly impacts the livestock industry. In BLV infection, the proviral load in the blood reflects disease progression. Although the BLV genome is highly conserved among retroviruses, genetic variation has been reported. However, the relationship between proviral load and genetic variation is poorly understood. In this study, we investigated the changes in proviral load in BLV-infected cattle in Japan and then identified and analysed a BLV strain pvAF967 that had a static proviral load. First, examining the proviral load in the aleukaemic cattle in 2014 and 2015, cow AF967 showed a static proviral load, while the other cows showed significant increases in proviral load. Sequencing the provirus in cow AF967 showed a deletion of 12 nt located in the G4 gene. An in vitro assay system using BLV molecular clone was set up to evaluate viral replication and production. In this in vitro assay, the deletion mutation in the G4 gene resulted in a significant decrease in viral replication and production. In addition, we showed that the deletion mutation did not affect the viral transcriptional activity of Tax protein, which is also important for virus replication. The emergence of strain pvAF967 that showed a static proviral load, combined with other retrovirus evolutionary traits, suggests that some BLV strains may have evolved to be symbiotic with cattle.

  1. Deletion of Protein Tyrosine Phosphatase 1B (PTP1B Enhances Endothelial Cyclooxygenase 2 Expression and Protects Mice from Type 1 Diabetes-Induced Endothelial Dysfunction.

    Directory of Open Access Journals (Sweden)

    David J Herren

    Full Text Available Protein tyrosine phosphatase 1B (PTP1B dephosphorylates receptors tyrosine kinase and acts as a molecular brake on insulin signaling pathway. Conditions of metabolic dysfunction increase PTP1B, when deletion of PTP1B protects against metabolic disorders by increasing insulin signaling. Although vascular insulin signaling contributes to the control of glucose disposal, little is known regarding the direct role of PTP1B in the control of endothelial function. We hypothesized that metabolic dysfunctions increase PTP1B expression in endothelial cells and that PTP1B deletion prevents endothelial dysfunction in situation of diminished insulin secretion. Type I diabetes (T1DM was induced in wild-type (WT and PTP1B-deficient mice (KO with streptozotocin (STZ injection. After 28 days of T1DM, KO mice exhibited a similar reduction in body weight and plasma insulin levels and a comparable increase in glycemia (WT: 384 ± 20 vs. Ko: 432 ± 29 mg/dL, cholesterol and triglycerides, as WT mice. T1DM increased PTP1B expression and impaired endothelial NO-dependent relaxation, in mouse aorta. PTP1B deletion did not affect baseline endothelial function, but preserved endothelium-dependent relaxation, in T1DM mice. NO synthase inhibition with L-NAME abolished endothelial relaxation in control and T1DM WT mice, whereas L-NAME and the cyclooxygenases inhibitor indomethacin were required to abolish endothelium relaxation in T1DM KO mice. PTP1B deletion increased COX-2 expression and PGI2 levels, in mouse aorta and plasma respectively, in T1DM mice. In parallel, simulation of diabetic conditions increased PTP1B expression and knockdown of PTP1B increased COX-2 but not COX-1 expression, in primary human aortic endothelial cells. Taken together these data indicate that deletion of PTP1B protected endothelial function by compensating the reduction in NO bioavailability by increasing COX-2-mediated release of the vasodilator prostanoid PGI2, in T1DM mice.

  2. Translation of the radioresistance kinase TLK1B is induced by γ-irradiation through activation of mTOR and phosphorylation of 4E-BP1

    Directory of Open Access Journals (Sweden)

    De Benedetti Arrigo

    2004-04-01

    Full Text Available Abstract Background The mammalian protein kinase TLK1 is a homologue of Tousled, a gene involved in flower development in Arabidopsis thaliana. The function of TLK1 is not well known, although knockout of the gene in Drosophila, or expression of a dominant negative mutant in mouse cells causes loss of nuclear divisions and chromosome missegregation probably due to alterations in chromatin remodeling capacity. Overexpression of TLK1B, a spliced variant of the TLK1 mRNA, in a model mouse cell line increases their resistance to ionizing radiation, also likely through changes in chromatin remodeling. The TLK1B mRNA is translationally repressed by its 5'UTR and is regulated by the availability of eIF4E. We now report that radiation or doxorubicin result in an increase in the translation of TLK1B, and we have uncovered the likely mechanism for this effect. Results Radiation causes a shift in the polysomal distribution of TLK1B mRNA, from the untranslated region and small polysomes to the large polysomes, concomitant with an increase in the expression of TLK1B protein. This change is preceded by an increase in phosphorylation of the eIF4E inhibitory protein 4E-BP1, which releases eIF4E when it is phosphorylated. The phosphorylation of 4E-BP1 depends on mTOR, since rapamycin blocked the increase in phosphorylation induced by radiation, and prevented the increase in TLK1B protein expression. The activation of mTOR was likely due to the rapid activation of Akt following radiation. The activation of Akt could be inhibited with wortmannin, an inhibitor of PI3 kinase, hence placing PI3 kinase upstream of Akt as a very early event following radiation. Wortmannin also inhibited translation of TLK1B mRNA following activation by IR. This was shown both by western blot and by measuring the initiation capacity of the mRNA, as indicated by its distribution on polysomes. Conclusions The translational upregulation of TLK1B elicited by DNA double strand breaks

  3. Two new large deletions of the AVPR2 gene causing nephrogenic diabetes insipidus and a review of previously published deletions.

    Science.gov (United States)

    Anesi, Laura; de Gemmis, Paola; Galla, Daniela; Hladnik, Uros

    2012-10-01

    In this paper, we report two new original deletions and present an extended review of the previously characterized AVPR2 gene deletions to better understand the underlying deletion mechanisms. The two novel deletions were defined using polymerase chain reaction mapping and junction fragment sequencing. Bioinformatic analysis was performed on both the previously mapped deletions and the novel ones through several web tools. In our two patients with nephrogenic diabetes insipidus, we found a 23 755 bp deletion and a 9264 bp deletion both comprising the entire AVPR2 gene and part of the ARHGAP4 gene. Through bioinformatic studies, the smallest overlapping region as well as several motifs and repeats that are known to promote rearrangements were confirmed. Through this study, it was determined that the deletion mechanisms in the AVPR2 region do not follow the rules of non-allelic homologous recombination. Two of the 13 deletions can be attributed to the fork stalling and template switching (FoSTeS) mechanism, whereas the remaining 11 deletions could be caused either by non-homologous end joining or by the FoSTeS mechanism. Although no recurrence was found, several groupings of deletion breakpoints were identified.

  4. CCAAT/enhancer binding protein {beta} deletion increases mitochondrial function and protects mice from LXR-induced hepatic steatosis

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, Shaikh M., E-mail: rmizanoor@hotmail.com [Department of Pediatrics, School of Medicine, University of Colorado Denver, Aurora, CO 80045 (United States); Choudhury, Mahua; Janssen, Rachel C.; Baquero, Karalee C. [Department of Pediatrics, School of Medicine, University of Colorado Denver, Aurora, CO 80045 (United States); Miyazaki, Makoto [Division of Renal Diseases and Hypertension, School of Medicine, University of Colorado Denver, Aurora, CO 80045 (United States); Friedman, Jacob E. [Department of Pediatrics, School of Medicine, University of Colorado Denver, Aurora, CO 80045 (United States); Department of Biochemistry and Molecular Genetics, School of Medicine, University of Colorado Denver, Aurora, CO 80045 (United States)

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer LXR agonist activation increases liver TG accumulation by increasing lipogenesis. Black-Right-Pointing-Pointer C/EBP{beta}{sup -/-} mouse prevents LXR activation-mediated induction of hepatic lipogenesis. Black-Right-Pointing-Pointer C/EBP{beta} deletion increases mitochondrial transport chain function. Black-Right-Pointing-Pointer Beneficial effects of LXR activation on liver cholesterol metabolism did not change. Black-Right-Pointing-Pointer C/EBP{beta} inhibition might have important therapeutic potential. -- Abstract: Drugs designed specifically to activate liver X receptors (LXRs) have beneficial effects on lowering cholesterol metabolism and inflammation but unfortunately lead to severe hepatic steatosis. The transcription factor CCAAT/enhancer binding protein beta (C/EBP{beta}) is an important regulator of liver gene expression but little is known about its involvement in LXR-based steatosis and cholesterol metabolism. The present study investigated the role of C/EBP{beta} expression in LXR agonist (T0901317)-mediated alteration of hepatic triglyceride (TG) and lipogenesis in mice. C/EBP{beta} deletion in mice prevented LXR agonist-mediated induction of lipogenic gene expression in liver in conjunction with significant reduction of liver TG accumulation. Surprisingly, C/EBP{beta}{sup -/-} mice showed a major increase in liver mitochondrial electron chain function compared to WT mice. Furthermore, LXR activation in C/EBP{beta}{sup -/-} mice increased the expression of liver ATP-binding cassette transporter ABCG1, a gene implicated in cholesterol efflux and reducing blood levels of total and LDL-cholesterol. Together, these findings establish a central role for C/EBP{beta} in the LXR-mediated steatosis and mitochondrial function, without impairing the influence of LXR activation on lowering LDL and increasing HDL-cholesterol. Inactivation of C/EBP{beta} might therefore be an important therapeutic strategy to prevent LXR

  5. Targeted deletion of the murine Lgr4 gene decreases lens epithelial cell resistance to oxidative stress and induces age-related cataract formation.

    Directory of Open Access Journals (Sweden)

    Jun Zhu

    Full Text Available Oxidative stress contributes to the formation of cataracts. The leucine rich repeat containing G protein-coupled receptor 4 (LGR4, also known as GPR48, is important in many developmental processes. Since deletion of Lgr4 has previously been shown to lead to cataract formation in mice, we sought to determine the specific role that Lgr4 plays in the formation of cataracts. Initially, the lens opacities of Lgr4(-/- mice at different ages without ocular anterior segment dysgenesis (ASD were evaluated with slit-lamp biomicroscopy. Lenses from both Lgr4(-/- and wild-type mice were subjected to oxidation induced protein denaturation to assess the ability of the lens to withstand oxidation. The expression of antioxidant enzymes was evaluated with real-time quantitative PCR. Phenotypically, Lgr4(-/- mice showed earlier onset of lens opacification and higher incidence of cataract formation compared with wild-type mice of similar age. In addition, Lgr4(-/- mice demonstrated increased sensitivity to environmental oxidative damage, as evidenced by altered protein expression. Real-time quantitative PCR showed that two prominent antioxidant defense enzymes, catalase (CAT and superoxidase dismutase-1 (SOD1, were significantly decreased in the lens epithelial cells of Lgr4(-/- mice. Our results suggest that the deletion of Lgr4 can lead to premature cataract formation, as well as progressive deterioration with aging. Oxidative stress and altered expression of several antioxidant defense enzymes contribute to the formation of cataracts.

  6. Visible Light-Responsive Platinum-Containing Titania Nanoparticle-Mediated Photocatalysis Induces Nucleotide Insertion, Deletion and Substitution Mutations

    Directory of Open Access Journals (Sweden)

    Der-Shan Sun

    2016-12-01

    Full Text Available Conventional photocatalysts are primarily stimulated using ultraviolet (UV light to elicit reactive oxygen species and have wide applications in environmental and energy fields, including self-cleaning surfaces and sterilization. Because UV illumination is hazardous to humans, visible light-responsive photocatalysts (VLRPs were discovered and are now applied to increase photocatalysis. However, fundamental questions regarding the ability of VLRPs to trigger DNA mutations and the mutation types it elicits remain elusive. Here, through plasmid transformation and β-galactosidase α-complementation analyses, we observed that visible light-responsive platinum-containing titania (TiO2 nanoparticle (NP-mediated photocatalysis considerably reduces the number of Escherichia coli transformants. This suggests that such photocatalytic reactions cause DNA damage. DNA sequencing results demonstrated that the DNA damage comprises three mutation types, namely nucleotide insertion, deletion and substitution; this is the first study to report the types of mutations occurring after photocatalysis by TiO2-VLRPs. Our results may facilitate the development and appropriate use of new-generation TiO2 NPs for biomedical applications.

  7. Visible Light-Responsive Platinum-Containing Titania Nanoparticle-Mediated Photocatalysis Induces Nucleotide Insertion, Deletion and Substitution Mutations.

    Science.gov (United States)

    Sun, Der-Shan; Tseng, Yao-Hsuan; Wu, Wen-Shiang; Wong, Ming-Show; Chang, Hsin-Hou

    2016-12-28

    Conventional photocatalysts are primarily stimulated using ultraviolet (UV) light to elicit reactive oxygen species and have wide applications in environmental and energy fields, including self-cleaning surfaces and sterilization. Because UV illumination is hazardous to humans, visible light-responsive photocatalysts (VLRPs) were discovered and are now applied to increase photocatalysis. However, fundamental questions regarding the ability of VLRPs to trigger DNA mutations and the mutation types it elicits remain elusive. Here, through plasmid transformation and β-galactosidase α-complementation analyses, we observed that visible light-responsive platinum-containing titania (TiO₂) nanoparticle (NP)-mediated photocatalysis considerably reduces the number of Escherichia coli transformants. This suggests that such photocatalytic reactions cause DNA damage. DNA sequencing results demonstrated that the DNA damage comprises three mutation types, namely nucleotide insertion, deletion and substitution; this is the first study to report the types of mutations occurring after photocatalysis by TiO₂-VLRPs. Our results may facilitate the development and appropriate use of new-generation TiO₂ NPs for biomedical applications.

  8. Genetic deletion of low density lipoprotein receptor impairs sterol-induced mouse macrophage ABCA1 expression. A new SREBP1-dependent mechanism.

    Science.gov (United States)

    Zhou, Xiaoye; He, Wei; Huang, Zhiping; Gotto, Antonio M; Hajjar, David P; Han, Jihong

    2008-01-25

    Low density lipoprotein receptor (LDLR) mutations cause familial hypercholesterolemia and early atherosclerosis. ABCA1 facilitates free cholesterol efflux from peripheral tissues. We investigated the effects of LDLR deletion (LDLR(-/-)) on ABCA1 expression. LDLR(-/-) macrophages had reduced basal levels of ABCA1, ABCG1, and cholesterol efflux. A high fat diet increased cholesterol in LDLR(-/-) macrophages but not wild type cells. A liver X receptor (LXR) agonist induced expression of ABCA1, ABCG1, and cholesterol efflux in both LDLR(-/-) and wild type macrophages, whereas expression of LXRalpha or LXRbeta was similar. Interestingly, oxidized LDL induced more ABCA1 in wild type macrophages than LDLR(-/-) cells. LDL induced ABCA1 expression in wild type cells but inhibited it in LDLR(-/-) macrophages in a concentration-dependent manner. However, lipoproteins regulated ABCG1 expression similarly in LDLR(-/-) and wild type macrophages. Cholesterol or oxysterols induced ABCA1 expression in wild type macrophages but had little or inhibitory effects on ABCA1 expression in LDLR(-/-) macrophages. Active sterol regulatory element-binding protein 1a (SREBP1a) inhibited ABCA1 promoter activity in an LXRE-dependent manner and decreased both macrophage ABCA1 expression and cholesterol efflux. Expression of ABCA1 in animal tissues was inversely correlated to active SREBP1. Oxysterols inactivated SREBP1 in wild type macrophages but not in LDLR(-/-) cells. Oxysterol synergized with nonsteroid LXR ligand induced ABCA1 expression in wild type macrophages but blocked induction in LDLR(-/-) cells. Taken together, our studies suggest that LDLR is critical in the regulation of cholesterol efflux and ABCA1 expression in macrophage. Lack of the LDLR impairs sterol-induced macrophage ABCA1 expression by a sterol regulatory element-binding protein 1-dependent mechanism that can result in reduced cholesterol efflux and lipid accumulation in macrophages under hypercholesterolemic conditions.

  9. Deleting exon 55 from the nebulin gene induces severe muscle weakness in a mouse model for nemaline myopathy.

    Science.gov (United States)

    Ottenheijm, Coen A C; Buck, Danielle; de Winter, Josine M; Ferrara, Claudia; Piroddi, Nicoletta; Tesi, Chiara; Jasper, Jeffrey R; Malik, Fady I; Meng, Hui; Stienen, Ger J M; Beggs, Alan H; Labeit, Siegfried; Poggesi, Corrado; Lawlor, Michael W; Granzier, Henk

    2013-06-01

    Nebulin--a giant sarcomeric protein--plays a pivotal role in skeletal muscle contractility by specifying thin filament length and function. Although mutations in the gene encoding nebulin (NEB) are a frequent cause of nemaline myopathy, the most common non-dystrophic congenital myopathy, the mechanisms by which mutations in NEB cause muscle weakness remain largely unknown. To better understand these mechanisms, we have generated a mouse model in which Neb exon 55 is deleted (Neb(ΔExon55)) to replicate a founder mutation seen frequently in patients with nemaline myopathy with Ashkenazi Jewish heritage. Neb(ΔExon55) mice are born close to Mendelian ratios, but show growth retardation after birth. Electron microscopy studies show nemaline bodies--a hallmark feature of nemaline myopathy--in muscle fibres from Neb(ΔExon55) mice. Western blotting studies with nebulin-specific antibodies reveal reduced nebulin levels in muscle from Neb(ΔExon55) mice, and immunofluorescence confocal microscopy studies with tropomodulin antibodies and phalloidin reveal that thin filament length is significantly reduced. In line with reduced thin filament length, the maximal force generating capacity of permeabilized muscle fibres and single myofibrils is reduced in Neb(ΔExon55) mice with a more pronounced reduction at longer sarcomere lengths. Finally, in Neb(ΔExon55) mice the regulation of contraction is impaired, as evidenced by marked changes in crossbridge cycling kinetics and by a reduction of the calcium sensitivity of force generation. A novel drug that facilitates calcium binding to the thin filament significantly augmented the calcium sensitivity of submaximal force to levels that exceed those observed in untreated control muscle. In conclusion, we have characterized the first nebulin-based nemaline myopathy model, which recapitulates important features of the phenotype observed in patients harbouring this particular mutation, and which has severe muscle weakness caused by

  10. Dissociable role of tumor necrosis factor alpha gene deletion in methamphetamine self-administration and cue-induced relapsing behavior in mice.

    Science.gov (United States)

    Yan, Yijin; Nitta, Atsumi; Koseki, Takenao; Yamada, Kiyofumi; Nabeshima, Toshitaka

    2012-06-01

    During the development of addiction, addictive drugs induce transient and long-lasting changes in the brain including expression of endogenous molecules and alteration of morphological structure. Of the altered endogenous molecules, some facilitate but others slow the development of drug addiction. Previously, we have reported that tumor necrosis factor alpha (TNF-α) is a critical molecule among endogenous anti-addictive modulators using animal models of drug-conditioned place preference and drug discrimination. Does targeted deletion of the TNF-α gene in mice affect methamphetamine (METH) self-administration, motivation to self-administer METH, cue-induced reinstatement of METH-seeking behavior, and food reinforcement or seeking behavior? Both METH self-administration and reinstatement of drug-seeking behavior and food self-delivery and food-seeking behavior were measured in TNF-α (-/-) and wild-type mice. There were an upward shift of dose responses to METH self-administration under a fixed ratio schedule of reinforcement and higher breaking points under a progressive ratio schedule of reinforcement in TNF-α knockout (TNF-α (-/-)) mice as compared with wild-type mice. There was no significant difference in cue-induced reinstatement of METH-seeking behavior, food-maintained operant behavior, motivation to natural food, and cue-induced food-seeking behavior between TNF-α (-/-) and wild-type mice. TNF-α affects METH self-administration and motivation to self-administer METH but contributes to neither METH-associated cue-induced relapsing behavior nor food reward and food-seeking behavior. TNF-α may be explored for use as a diagnostic biomarker for the early stage of drug addiction.

  11. Live AttenuatedLeishmania donovaniCentrin Gene-Deleted Parasites Induce IL-23-Dependent IL-17-Protective Immune Response against Visceral Leishmaniasis in a Murine Model.

    Science.gov (United States)

    Banerjee, Antara; Bhattacharya, Parna; Dagur, Pradeep K; Karmakar, Subir; Ismail, Nevien; Joshi, Amritanshu B; Akue, Adovi D; KuKuruga, Mark; McCoy, John Philip; Dey, Ranadhir; Nakhasi, Hira L

    2018-01-01

    No vaccine exists against visceral leishmaniasis. To develop effective vaccines, we have previously reported protective role of live attenuated centrin gene-deleted Leishmania donovani ( LdCen -/- ) parasites through induction of Th1 type immune response in mice, hamsters, and dogs. In this study, we specifically explored the role of Th17 cells in LdCen -/- -induced host protection in mice. Our results showed that compared with wild-type L. donovani infection, LdCen -/- parasites induce significantly higher expression of Th17 differentiation cytokines in splenic dendritic cells. There was also induction of IL-17 and its promoting cytokines in total splenocytes and in both CD4 and CD8 T cells following immunization with LdCen -/- Upon challenge with wild-type parasites, IL-17 and its differentiating cytokines were significantly higher in LdCen -/- -immunized mice compared with nonimmunized mice that resulted in parasite control. Alongside IL-17 induction, we observed induction of IFN-γ-producing Th1 cells as reported earlier. However, Th17 cells are generated before Th1 cells. Neutralization of either IL-17 or IFN-γ abrogated LdCen -/- -induced host protection further confirming the essential role of Th17 along with Th1 cytokines in host protection. Treatment with recombinant IL-23, which is required for stabilization and maintenance of IL-17, heightened Th17, and Tc17 responses in immunized mice splenocytes. In contrast, Th17 response was absent in immunized IL-23R -/- mice that failed to induce protection upon virulent Leishmania challenge suggesting that IL-23 plays an essential role in IL-17-mediated protection by LdCen -/- parasites. This study unveiled the role of IL-23-dependent IL-17 induction in LdCen -/- parasite-induced immunity and subsequent protection against visceral leishmaniasis.

  12. 78 FR 60270 - BP America Inc., BP Corporation North America Inc., BP America Production Company, and BP Energy...

    Science.gov (United States)

    2013-10-01

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission BP America Inc., BP Corporation North America Inc., BP America Production Company, and BP Energy Company; Notice of Designation of Commission Staff as Non-Decisional With respect...

  13. Genetic deletion of IL-25 (IL-17E) confers resistance to dextran sulfate sodium-induced colitis in mice

    Science.gov (United States)

    IL-25 is emerging as a key regulator of inflammation in the intestinal mucosa because of its ability to promote Th2 while suppressing Th1 and Th17 cytokine responses. We investigated the contribution of endogenous IL-25 to DSS-induced colitis in mice. Mice were exposed to DSS in drinking water ad li...

  14. A spontaneous direct repeat deletion in the pGEX fusion vector decreases the expression level of recombinant proteins in Escherichia coli.

    Science.gov (United States)

    Borgi, Ines; Gargouri, Ali

    2008-07-01

    pGEX vectors are widely used for GST-fusion protein expression in Escherichia coli under the control of a strong IPTG inducible tac promoter. While using pGEX-4T-2 vector in heterologous protein expression we noticed that the GST or GST-fusion protein were expressed at a very low levels. Interestingly, we found a spontaneous deletion of 701 bp DNA fragment harbouring the tac promoter in both, native and recombinant pGEX-4T-2 vectors. This deletion took place between two direct repeats of 43 bases and led to the loss of a 701 bp DNA fragment. This explained the decrease in GST or GST-fused protein level since the tac promoter, that directs transcription was deleted. The lacZ promoter, located upstream of the deleted fragment, replaced tac promoter but was less efficient. The deleted DNA also specifies part of the lacZ gene coding for the N-terminal end of the beta-galactosidase (the alpha-peptide), which is slightly functional. Consequently, bacterial cells transformed with the original pGEX are of a faint blue colour while those bearing the deleted ones are white, when plated on X-Gal containing medium. The deletion, did not affect neither the sequence nor the molecular weight of GST and fusion protein since it took place just before the GST start codon. It occurred in E. coli TOP10 cells which are deficient in RecA protein, suggesting that the deletion did not require the RecA recombination system.

  15. Inhibiting heat shock protein 90 (HSP90 limits the formation of liver cysts induced by conditional deletion of Pkd1 in mice.

    Directory of Open Access Journals (Sweden)

    Zachary B Smithline

    Full Text Available Polycystic liver disease (PLD occurs in 75-90% of patients affected by autosomal dominant polycystic kidney disease (ADPKD, which affects 1∶400-1,000 adults and arises from inherited mutations in the PKD1 or PKD2 genes. PLD can lead to bile duct obstructions, infected or bleeding cysts, and hepatomegaly, which can diminish quality of life. At present, no effective, approved therapy exists for ADPKD or PLD. We recently showed that inhibition of the molecular chaperone heat shock protein 90 (HSP90 with a small molecule inhibitor, STA-2842, induced the degradation of multiple HSP90-dependent client proteins that contribute to ADPKD pathogenesis and slowed the progression of renal cystogenesis in mice with conditional deletion of Pkd1. Here, we analyzed the effects of STA-2842 on liver size and cystic burden in Pkd-/- mice with established PLD. Using magnetic resonance imaging over time, we demonstrate that ten weeks of STA-2842 treatment significantly reduced both liver mass and cystic index suggesting selective elimination of cystic tissue. Pre-treatment cystic epithelia contain abundant HSP90; the degree of reduction in cysts was accompanied by inhibition of proliferation-associated signaling proteins EGFR and others, and induced cleavage of caspase 8 and PARP1, and correlated with degree of HSP90 inhibition and with inactivation of ERK1/2. Our results suggest that HSP90 inhibition is worth further evaluation as a therapeutic approach for patients with PLD.

  16. Genetic deletion of the MT1 or MT2 melatonin receptors abrogates methamphetamine-induced reward in C3H/HeN mice.

    Science.gov (United States)

    Clough, Shannon J; Hutchinson, Anthony J; Hudson, Randall L; Dubocovich, Margarita L

    2014-06-10

    The drug of abuse methamphetamine (METH) is known for its ability to enhance reward responses. The rewarding properties of psychostimulants have been shown to vary across time of day in mice. The goal of this study was to determine the role of the MT1 and MT2 melatonin receptors in METH-induced reward, as measured by the conditioned place preference (CPP) paradigm during the light and dark phases. C3H/HeN wild-type mice were trained for METH-induced CPP at either ZT 6-8 (ZT: Zeitgeber time; ZT 0=lights on), when endogenous melatonin levels are low, or ZT 19-21, when melatonin levels are high. These time points also correspond to the high and low points for expression of the circadian gene Period1, respectively. The locomotor response to METH (1.2mg/kg, ip) treatment was of similar magnitude at both times; however only C3H/HeN mice conditioned to METH at ZT 6-8 developed a place preference. C3H/HeN mice with a genetic deletion of either the MT1 (MT1KO) or MT2 (MT2KO) receptor tested at ZT 6-8 or ZT 19-21 did not develop a place preference for METH, though both showed a similar increase in locomotor activity following METH treatment when compared to wild-type mice. We conclude that in our mouse model METH-induced CPP is dependent on time of day and the presence of the MT1 or MT2 receptors, suggesting a role for melatonin in METH-induced reward. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Seven gene deletions in seven days

    DEFF Research Database (Denmark)

    Ingemann Jensen, Sheila; Lennen, Rebecca; Herrgard, Markus

    2015-01-01

    Generation of multiple genomic alterations is currently a time consuming process. Here, a method was established that enables highly efficient and simultaneous deletion of multiple genes in Escherichia coli. A temperature sensitive plasmid containing arabinose inducible lambda Red recombineering...... genes and a rhamnose inducible flippase recombinase was constructed to facilitate fast marker-free deletions. To further speed up the procedure, we integrated the arabinose inducible lambda Red recombineering genes and the rhamnose inducible FLP into the genome of E. coli K-12 MG1655. This system...... enables growth at 37 °C, thereby facilitating removal of integrated antibiotic cassettes and deletion of additional genes in the same day. Phosphorothioated primers were demonstrated to enable simultaneous deletions during one round of electroporation. Utilizing these methods, we constructed strains...

  18. Deletion of Running-Induced Hippocampal Neurogenesis by Irradiation Prevents Development of an Anxious Phenotype in Mice

    Science.gov (United States)

    Hensley, Frank W.; Weber, Klaus-Josef; Hellweg, Rainer; Gass, Peter

    2010-01-01

    Recent evidence postulates a role of hippocampal neurogenesis in anxiety behavior. Here we report that elevated levels of neurogenesis elicit increased anxiety in rodents. Mice performing voluntary wheel running displayed both highly elevated levels of neurogenesis and increased anxiety in three different anxiety-like paradigms: the open field, elevated O-maze, and dark-light box. Reducing neurogenesis by focalized irradiation of the hippocampus abolished this exercise-induced increase of anxiety, suggesting a direct implication of hippocampal neurogenesis in this phenotype. On the other hand, irradiated mice explored less frequently the lit compartment of the dark-light box test irrespective of wheel running, suggesting that irradiation per se induced anxiety as well. Thus, our data suggest that intermediate levels of neurogenesis are related to the lowest levels of anxiety. Moreover, using c-Fos immunocytochemistry as cellular activity marker, we observed significantly different induction patterns between runners and sedentary controls when exposed to a strong anxiogenic stimulus. Again, this effect was altered by irradiation. In contrast, the well-known induction of brain-derived neurotrophic factor (BDNF) by voluntary exercise was not disrupted by focal irradiation, indicating that hippocampal BDNF levels were not correlated with anxiety under our experimental conditions. In summary, our data demonstrate to our knowledge for the first time that increased neurogenesis has a causative implication in the induction of anxiety. PMID:20862278

  19. Deletion of running-induced hippocampal neurogenesis by irradiation prevents development of an anxious phenotype in mice.

    Directory of Open Access Journals (Sweden)

    Johannes Fuss

    Full Text Available Recent evidence postulates a role of hippocampal neurogenesis in anxiety behavior. Here we report that elevated levels of neurogenesis elicit increased anxiety in rodents. Mice performing voluntary wheel running displayed both highly elevated levels of neurogenesis and increased anxiety in three different anxiety-like paradigms: the open field, elevated O-maze, and dark-light box. Reducing neurogenesis by focalized irradiation of the hippocampus abolished this exercise-induced increase of anxiety, suggesting a direct implication of hippocampal neurogenesis in this phenotype. On the other hand, irradiated mice explored less frequently the lit compartment of the dark-light box test irrespective of wheel running, suggesting that irradiation per se induced anxiety as well. Thus, our data suggest that intermediate levels of neurogenesis are related to the lowest levels of anxiety. Moreover, using c-Fos immunocytochemistry as cellular activity marker, we observed significantly different induction patterns between runners and sedentary controls when exposed to a strong anxiogenic stimulus. Again, this effect was altered by irradiation. In contrast, the well-known induction of brain-derived neurotrophic factor (BDNF by voluntary exercise was not disrupted by focal irradiation, indicating that hippocampal BDNF levels were not correlated with anxiety under our experimental conditions. In summary, our data demonstrate to our knowledge for the first time that increased neurogenesis has a causative implication in the induction of anxiety.

  20. Expanding the BP1-BP2 15q11.2 Microdeletion Phenotype: Tracheoesophageal Fistula and Congenital Cataracts

    Directory of Open Access Journals (Sweden)

    D. Wong

    2013-01-01

    Full Text Available The proximal q arm of chromosome 15 contains breakpoint regions BP1–BP5 with the classic deletion of BP1–BP3 best known to be associated with Prader-Willi and Angelman syndromes. The region is approximately 500 kb and microdeletions within the BP1-BP2 region have been reported in patients with developmental delay, behavioral abnormalities, and motor apraxia as well as dysmorphic features including hypertelorism, cleft or narrow palate, ear abnormalities, and recurrent upper airway infections. We report two patients with unique, never-before-reported 15q11.2 BP1-2 microdeletion syndrome findings, one with proximal esophageal atresia and distal tracheoesophageal fistula (type C and one with congenital cataracts. Cataracts have been described in Prader-Willi syndrome but we could not find any description of cataracts in Angelman syndrome. Esophageal atresia and tracheoesophageal fistula have not been reported to our knowledge in either syndrome. A chance exists that both cases are sporadic birth defects; however, the findings of the concomitant microdeletion cannot be overlooked as a possible cause. Based on our review of the literature and the presentation of our patients, we recommend that esophageal atresia and distal tracheoesophageal fistula as well as congenital cataracts be included in the phenotypic spectrum of 15q11.2 BP1-2 microdeletion syndrome.

  1. Microarray-based optimization to detect genomic deletion mutations

    Directory of Open Access Journals (Sweden)

    Eric J. Belfield

    2014-12-01

    Full Text Available We performed array comparative genome hybridization (aCGH analyses of five Arabidopsis thaliana mutants with genomic deletions ranging in size from 4 bp to >5 kb. We used the Roche NimbleGen Arabidopsis CGH 3 × 720 K whole genome custom tiling array to optimize deletion detection. Details of the microarray design and hybridization data have been deposited at the NCBI GEO repository with accession number GSE55327.

  2. Microarray-based optimization to detect genomic deletion mutations.

    Science.gov (United States)

    Belfield, Eric J; Brown, Carly; Gan, Xiangchao; Jiang, Caifu; Baban, Dilair; Mithani, Aziz; Mott, Richard; Ragoussis, Jiannis; Harberd, Nicholas P

    2014-12-01

    We performed array comparative genome hybridization (aCGH) analyses of five Arabidopsis thaliana mutants with genomic deletions ranging in size from 4 bp to > 5 kb. We used the Roche NimbleGen Arabidopsis CGH 3 × 720 K whole genome custom tiling array to optimize deletion detection. Details of the microarray design and hybridization data have been deposited at the NCBI GEO repository with accession number GSE55327.

  3. Mice with a targeted deletion of the type 2 deiodinase are insulin resistant and susceptible to diet induced obesity.

    Directory of Open Access Journals (Sweden)

    Alessandro Marsili

    Full Text Available The type 2 iodothyronine deiodinase (D2 converts the pro-hormone thyroxine into T3 within target tissues. D2 is essential for a full thermogenic response of brown adipose tissue (BAT, and mice with a disrupted Dio2 gene (D2KO have an impaired response to cold. BAT is also activated by overfeeding.After 6-weeks of HFD feeding D2KO mice gained 5.6% more body weight and had 28% more adipose tissue. Oxygen consumption (V0(2 was not different between genotypes, but D2KO mice had an increased respiratory exchange ratio (RER, suggesting preferential use of carbohydrates. Consistent with this, serum free fatty acids and β-hydroxybutyrate were lower in D2KO mice on a HFD, while hepatic triglycerides were increased and glycogen content decreased. Neither genotype showed glucose intolerance, but D2KO mice had significantly higher insulin levels during GTT independent of diet. Accordingly, during ITT testing D2KO mice had a significantly reduced glucose uptake, consistent with insulin resistance. Gene expression levels in liver, muscle, and brown and white adipose tissue showed no differences that could account for the increased weight gain in D2KO mice. However, D2KO mice have higher PEPCK mRNA in liver suggesting increased gluconeogenesis, which could also contribute to their apparent insulin resistance.We conclude that the loss of the Dio2 gene has significant metabolic consequences. D2KO mice gain more weight on a HFD, suggesting a role for D2 in protection from diet-induced obesity. Further, D2KO mice appear to have a greater reliance on carbohydrates as a fuel source, and limited ability to mobilize and to burn fat. This results in increased fat storage in adipose tissue, hepatic steatosis, and depletion of liver glycogen in spite of increased gluconeogenesis. D2KO mice are also less responsive to insulin, independent of diet-induced obesity.

  4. Three types of preS1 start codon deletion variants in the natural course of chronic hepatitis B infection.

    Science.gov (United States)

    Choe, Won Hyeok; Kim, Hong; Lee, So-Young; Choi, Yu-Min; Kwon, So Young; Moon, Hee Won; Hur, Mina; Kim, Bum-Joon

    2017-12-12

    Naturally occurring hepatitis B virus variants carrying a deletion in the preS1 start codon region may evolve during long-lasting virus-host interactions in chronic hepatitis B (CHB). The aim of this study was to determine the immune phase-specific prevalent patterns of preS1 start codon deletion variants and related factors during the natural course of CHB. A total of 399 CHB patients were enrolled. Genotypic analysis of three different preS1 start codon deletion variants (classified by deletion size: 15-base pair [bp], 18-bp, and 21-bp deletion variants) was performed. PreS1 start codon deletion variants were detected in 155 of 399 patients (38.8%). The predominant variant was a 15-bp deletion in the immune-tolerance phase (18/50, 36%) and an 18-bp deletion in the immune-clearance phase (69/183, 37.7%). A 21-bp deletion was the predominant variant in the low replicative phase (3/25, 12.0%) and reactivated hepatitis Be antigen (HBeAg)-negative phase (22/141, 15.6%). The 15-bp and 18-bp deletion variants were more frequently found in HBeAg-positive patients (P start codon deletion variants changes according to the immune phases of CHB infection, and each variant type is associated with different clinical parameters. PreS1 start codon deletion variants might interact with the host immune response differently according to their variant types. © 2017 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  5. Intragenic DOK7 deletion detected by whole-genome sequencing in congenital myasthenic syndromes.

    Science.gov (United States)

    Azuma, Yoshiteru; Töpf, Ana; Evangelista, Teresinha; Lorenzoni, Paulo José; Roos, Andreas; Viana, Pedro; Inagaki, Hidehito; Kurahashi, Hiroki; Lochmüller, Hanns

    2017-06-01

    To identify the genetic cause in a patient affected by ptosis and exercise-induced muscle weakness and diagnosed with congenital myasthenic syndromes (CMS) using whole-genome sequencing (WGS). Candidate gene screening and WGS analysis were performed in the case. Allele-specific PCR was subsequently performed to confirm the copy number variation (CNV) that was suspected from the WGS results. In addition to the previously reported frameshift mutation c.1124_1127dup, an intragenic 6,261 bp deletion spanning from the 5' untranslated region to intron 2 of the DOK7 gene was identified by WGS in the patient with CMS. The heterozygous deletion was suspected based on reduced coverage on WGS and confirmed by allele-specific PCR. The breakpoints had microhomology and an inverted repeat, which may have led to the development of the deletion during DNA replication. We report a CMS case with identification of the breakpoints of the intragenic DOK7 deletion using WGS analysis. This case illustrates that CNVs undetected by Sanger sequencing may be identified by WGS and highlights their relevance in the molecular diagnosis of a treatable neurologic condition such as CMS.

  6. A neuron-specific deletion of the microRNA-processing enzyme DICER induces severe but transient obesity in mice.

    Directory of Open Access Journals (Sweden)

    Géraldine M Mang

    Full Text Available MicroRNAs (miRNAs are small, non-coding RNA molecules that regulate gene expression post-transcriptionally. MiRNAs are implicated in various biological processes associated with obesity, including adipocyte differentiation and lipid metabolism. We used a neuronal-specific inhibition of miRNA maturation in adult mice to study the consequences of miRNA loss on obesity development. Camk2a-CreERT2 (Cre+ and floxed Dicer (Dicerlox/lox mice were crossed to generate tamoxifen-inducible conditional Dicer knockouts (cKO. Vehicle- and/or tamoxifen-injected Cre+;Dicerlox/lox and Cre+;Dicer+/+ served as controls. Four cohorts were used to a measure body composition, b follow food intake and body weight dynamics, c evaluate basal metabolism and effects of food deprivation, and d assess the brain transcriptome consequences of miRNA loss. cKO mice developed severe obesity and gained 18 g extra weight over the 5 weeks following tamoxifen injection, mainly due to increased fat mass. This phenotype was highly reproducible and observed in all 38 cKO mice recorded and in none of the controls, excluding possible effects of tamoxifen or the non-induced transgene. Development of obesity was concomitant with hyperphagia, increased food efficiency, and decreased activity. Surprisingly, after reaching maximum body weight, obese cKO mice spontaneously started losing weight as rapidly as it was gained. Weight loss was accompanied by lowered O2-consumption and respiratory-exchange ratio. Brain transcriptome analyses in obese mice identified several obesity-related pathways (e.g. leptin, somatostatin, and nemo-like kinase signaling, as well as genes involved in feeding and appetite (e.g. Pmch, Neurotensin and in metabolism (e.g. Bmp4, Bmp7, Ptger1, Cox7a1. A gene cluster with anti-correlated expression in the cerebral cortex of post-obese compared to obese mice was enriched for synaptic plasticity pathways. While other studies have identified a role for miRNAs in obesity, we

  7. A neuron-specific deletion of the microRNA-processing enzyme DICER induces severe but transient obesity in mice.

    Science.gov (United States)

    Mang, Géraldine M; Pradervand, Sylvain; Du, Ngoc-Hien; Arpat, Alaaddin Bulak; Preitner, Frédéric; Wigger, Leonore; Gatfield, David; Franken, Paul

    2015-01-01

    MicroRNAs (miRNAs) are small, non-coding RNA molecules that regulate gene expression post-transcriptionally. MiRNAs are implicated in various biological processes associated with obesity, including adipocyte differentiation and lipid metabolism. We used a neuronal-specific inhibition of miRNA maturation in adult mice to study the consequences of miRNA loss on obesity development. Camk2a-CreERT2 (Cre+) and floxed Dicer (Dicerlox/lox) mice were crossed to generate tamoxifen-inducible conditional Dicer knockouts (cKO). Vehicle- and/or tamoxifen-injected Cre+;Dicerlox/lox and Cre+;Dicer+/+ served as controls. Four cohorts were used to a) measure body composition, b) follow food intake and body weight dynamics, c) evaluate basal metabolism and effects of food deprivation, and d) assess the brain transcriptome consequences of miRNA loss. cKO mice developed severe obesity and gained 18 g extra weight over the 5 weeks following tamoxifen injection, mainly due to increased fat mass. This phenotype was highly reproducible and observed in all 38 cKO mice recorded and in none of the controls, excluding possible effects of tamoxifen or the non-induced transgene. Development of obesity was concomitant with hyperphagia, increased food efficiency, and decreased activity. Surprisingly, after reaching maximum body weight, obese cKO mice spontaneously started losing weight as rapidly as it was gained. Weight loss was accompanied by lowered O2-consumption and respiratory-exchange ratio. Brain transcriptome analyses in obese mice identified several obesity-related pathways (e.g. leptin, somatostatin, and nemo-like kinase signaling), as well as genes involved in feeding and appetite (e.g. Pmch, Neurotensin) and in metabolism (e.g. Bmp4, Bmp7, Ptger1, Cox7a1). A gene cluster with anti-correlated expression in the cerebral cortex of post-obese compared to obese mice was enriched for synaptic plasticity pathways. While other studies have identified a role for miRNAs in obesity, we here

  8. Adipocyte Dynamics and Reversible Metabolic Syndrome in Mice with an Inducible Adipocyte-Specific Deletion of the Insulin Receptor.

    Science.gov (United States)

    Sakaguchi, Masaji; Fujisaka, Shiho; Cai, Weikang; Winnay, Jonathon N; Konishi, Masahiro; O'Neill, Brian T; Li, Mengyao; García-Martín, Rubén; Takahashi, Hirokazu; Hu, Jiang; Kulkarni, Rohit N; Kahn, C Ronald

    2017-02-07

    Insulin and IGF1 signaling are important for adipose tissue development and function; however, their role in mature adipocytes is unclear. Mice with a tamoxifen-inducible knockout of insulin and/or IGF1 receptors (IR/IGF1R) demonstrate a rapid loss of white and brown fat due to increased lipolysis and adipocyte apoptosis. This results in insulin resistance, glucose intolerance, hepatosteatosis, islet hyperplasia with hyperinsulinemia, and cold intolerance. This phenotype, however, resolves over 10-30 days due to a proliferation of preadipocytes and rapid regeneration of both brown and white adipocytes as identified by mTmG lineage tracing. This cycle can be repeated with a second round of receptor inactivation. Leptin administration prior to tamoxifen treatment blocks development of the metabolic syndrome without affecting adipocyte loss or regeneration. Thus, IR is critical in adipocyte maintenance, and this loss of adipose tissue stimulates regeneration of brown/white fat and reversal of metabolic syndrome associated with fat loss. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Deletion of the MAG1 DNA glycosylase gene suppresses alkylation-induced killing and mutagenesis in yeast cells lacking AP endonucleases.

    Science.gov (United States)

    Xiao, W; Chow, B L; Hanna, M; Doetsch, P W

    2001-12-19

    DNA base excision repair (BER) is initiated by DNA glycosylases that recognize and remove damaged bases. The phosphate backbone adjacent to the resulting apurinic/apyrimidinic (AP) site is then cleaved by an AP endonuclease or glycosylase-associated AP lyase to invoke subsequent BER steps. We have used a genetic approach in Saccharomyces cerevisiae to address whether AP sites are blocks to DNA replication and the biological consequences if AP sites persist in the genome. We found that yeast cells deficient in the two AP endonucleases (apn1 apn2 double mutant) are extremely sensitive to killing by methyl methanesulfonate (MMS), a model DNA alkylating agent. Interestingly, this sensitivity can be reduced up to 2500-fold by deleting the MAG1 3-methyladenine DNA glycosylase gene, suggesting that Mag1 not only removes lethal base lesions, but also benign lesions and possibly normal bases, and that the resulting AP sites are highly toxic to the cells. This rescuing effect appears to be specific for DNA alkylation damage, since the mag1 mutation reduces killing effects of two other DNA alkylating agents, but does not alter the sensitivity of apn cells to killing by UV, gamma-ray or H(2)O(2). Our mutagenesis assays indicate that nearly half of spontaneous and almost all MMS-induced mutations in the AP endonuclease-deficient cells are due to Mag1 DNA glycosylase activity. Although the DNA replication apparatus appears to be incapable of replicating past AP sites, Polzeta-mediated translesion synthesis is able to bypass AP sites, and accounts for all spontaneous and MMS-induced mutagenesis in the AP endonuclease-deficient cells. These results allow us to delineate base lesion flow within the BER pathway and link AP sites to other DNA damage repair and tolerance pathways.

  10. Targeted Deletion of Adipocyte Abca1 (ATP-Binding Cassette Transporter A1) Impairs Diet-Induced Obesity.

    Science.gov (United States)

    Cuffe, Helen; Liu, Mingxia; Key, Chia-Chi C; Boudyguina, Elena; Sawyer, Janet K; Weckerle, Allison; Bashore, Alexander; Fried, Susan K; Chung, Soonkyu; Parks, John S

    2018-01-18

    Adipose tissue cholesterol increases with adipocyte triglyceride content and size during development of obesity. However, how adipocyte cholesterol affects adipocyte function is poorly understood. The aim of this study was to evaluate the role of the cellular cholesterol exporter, Abca1 (ATP-binding cassette transporter A1), on adipose tissue function during diet-induced obesity. Adiponectin Cre recombinase transgenic mice were crossed with Abca1flox/flox mice to generate ASKO (adipocyte-specific Abca1 knockout) mice. Control and ASKO mice were then fed a high-fat, high-cholesterol (45% calories as fat and 0.2% cholesterol) diet for 16 weeks. Compared with control mice, ASKO mice had a 2-fold increase in adipocyte plasma membrane cholesterol content and significantly lower body weight, epididymal fat pad weight, and adipocyte size. ASKO versus control adipose tissue had decreased PPARγ (peroxisome proliferator-activated receptor γ) and CCAAT/enhancer-binding protein expression, nuclear SREBP1 (sterol regulatory element-binding protein 1) protein, lipogenesis, and triglyceride accretion but similar Akt activation after acute insulin stimulation. Acute siRNA-mediated Abca1 silencing during 3T3L1 adipocyte differentiation reduced adipocyte Abca1 and PPARγ protein expression and triglyceride content. Systemic stimulated triglyceride lipolysis and glucose homeostasis was similar between control and ASKO mice. Adipocyte Abca1 is a key regulator of adipocyte lipogenesis and lipid accretion, likely because of increased adipose tissue membrane cholesterol, resulting in decreased activation of lipogenic transcription factors PPARγ and SREBP1. © 2018 American Heart Association, Inc.

  11. Secretory leukocyte protease inhibitor gene deletion alters bleomycin-induced lung injury, but not development of pulmonary fibrosis.

    Science.gov (United States)

    Habgood, Anthony N; Tatler, Amanda L; Porte, Joanne; Wahl, Sharon M; Laurent, Geoffrey J; John, Alison E; Johnson, Simon R; Jenkins, Gisli

    2016-06-01

    following lung injury. However, these changes do not prevent the development of lung fibrosis. Overall, these data suggest that the absence of Slpi does not markedly modify the development of lung fibrosis following bleomycin-induced lung injury.

  12. Microwaves from UMTS/GSM mobile phones induce long-lasting inhibition of 53BP1/gamma-H2AX DNA repair foci in human lymphocytes.

    Science.gov (United States)

    Belyaev, Igor Y; Markovà, Eva; Hillert, Lena; Malmgren, Lars O G; Persson, Bertil R R

    2009-02-01

    We have recently described frequency-dependent effects of mobile phone microwaves (MWs) of global system for mobile communication (GSM) on human lymphocytes from persons reporting hypersensitivity to electromagnetic fields and healthy persons. Contrary to GSM, universal global telecommunications system (UMTS) mobile phones emit wide-band MW signals. Hypothetically, UMTS MWs may result in higher biological effects compared to GSM signal because of eventual "effective" frequencies within the wideband. Here, we report for the first time that UMTS MWs affect chromatin and inhibit formation of DNA double-strand breaks co-localizing 53BP1/gamma-H2AX DNA repair foci in human lymphocytes from hypersensitive and healthy persons and confirm that effects of GSM MWs depend on carrier frequency. Remarkably, the effects of MWs on 53BP1/gamma-H2AX foci persisted up to 72 h following exposure of cells, even longer than the stress response following heat shock. The data are in line with the hypothesis that the type of signal, UMTS MWs, may have higher biological efficiency and possibly larger health risk effects compared to GSM radiation emissions. No significant differences in effects between groups of healthy and hypersensitive subjects were observed, except for the effects of UMTS MWs and GSM-915 MHz MWs on the formation of the DNA repair foci, which were different for hypersensitive (P 0.05). The non-parametric statistics used here did not indicate specificity of the differences revealed between the effects of GSM and UMTS MWs on cells from hypersensitive subjects and more data are needed to study the nature of these differences. Copyright 2008 Wiley-Liss, Inc.

  13. Intestine-specific Mttp deletion decreases mortality and prevents sepsis-induced intestinal injury in a murine model of Pseudomonas aeruginosa pneumonia.

    Directory of Open Access Journals (Sweden)

    Jessica A Dominguez

    Full Text Available BACKGROUND: The small intestine plays a crucial role in the pathophysiology of sepsis and has been referred to as the "motor" of the systemic inflammatory response. One proposed mechanism is that toxic gut-derived lipid factors, transported in mesenteric lymph, induce systemic injury and distant organ failure. However, the pathways involved are yet to be defined and the role of intestinal chylomicron assembly and secretion in transporting these lipid factors is unknown. Here we studied the outcome of sepsis in mice with conditional, intestine-specific deletion of microsomal triglyceride transfer protein (Mttp-IKO, which exhibit a block in chylomicron assembly together with lipid malabsorption. METHODOLOGY/PRINCIPAL FINDINGS: Mttp-IKO mice and controls underwent intratracheal injection with either Pseudomonas aeruginosa or sterile saline. Mttp-IKO mice exhibited decreased seven-day mortality, with 0/20 (0% dying compared to 5/17 (29% control mice (p<0.05. This survival advantage in Mttp-IKO mice, however, was not associated with improvements in pulmonary bacterial clearance or neutrophil infiltration. Rather, Mttp-IKO mice exhibited protection against sepsis-associated decreases in villus length and intestinal proliferation and were also protected against increased intestinal apoptosis, both central features in control septic mice. Serum IL-6 levels, a major predictor of mortality in human and mouse models of sepsis, were elevated 8-fold in septic control mice but remained unaltered in septic Mttp-IKO mice. Serum high density lipoprotein (HDL levels were reduced in septic control mice but were increased in septic Mttp-IKO mice. The decreased levels of HDL were associated with decreased hepatic expression of apolipoprotein A1 in septic control mice. CONCLUSIONS/SIGNIFICANCE: These studies suggest that strategies directed at blocking intestinal chylomicron secretion may attenuate the progression and improve the outcome of sepsis through effects

  14. Partial deletion 11q

    DEFF Research Database (Denmark)

    Hertz, Jens Michael; Tommerup, N; Sørensen, F B

    1995-01-01

    We describe the cytogenetic findings and the dysmorphic features in a stillborn girl with a large de novo terminal deletion of the long arm of chromosome 11. The karyotype was 46,XX,del(11)(q21qter). By reviewing previous reports of deletion 11q, we found that cleft lip and palate are most...

  15. Molecular characterization of microbial mutations induced by ion beam irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Ichida, Hiroyuki [Graduate School of Science and Technology, Chiba University, Matsudo, Chiba 271-8510 (Japan); Accelerator Applications Research Group, Nishina Center for Accelerator-Based Science, RIKEN, Wako, Saitama 351-0198 (Japan)], E-mail: ichida@riken.jp; Matsuyama, Tomoki [Cellular Biochemistry Laboratory, Discovery Research Institute, RIKEN, Wako, Saitama 351-0198 (Japan); Ryuto, Hiromichi [Accelerator Operation Group, Nishina Center for Accelerator-Based Science, RIKEN, Wako, Saitama 351-0198 (Japan); Hayashi, Yoriko [Accelerator Applications Research Group, Nishina Center for Accelerator-Based Science, RIKEN, Wako, Saitama 351-0198 (Japan); Fukunishi, Nobuhisa [Accelerator Operation Group, Nishina Center for Accelerator-Based Science, RIKEN, Wako, Saitama 351-0198 (Japan); Abe, Tomoko [Accelerator Applications Research Group, Nishina Center for Accelerator-Based Science, RIKEN, Wako, Saitama 351-0198 (Japan); Koba, Takato [Graduate School of Science and Technology, Chiba University, Matsudo, Chiba 271-8510 (Japan)

    2008-03-01

    A positive selection system for gene disruption using a sucrose-sensitive transgenic rhizobium was established and used for the molecular characterization of mutations induced by ion beam irradiations. Single nucleotide substitutions, insertions, and deletions were found to occur in the sucrose sensitivity gene, sacB, when the reporter line was irradiated with highly accelerated carbon and iron ion beams. In all of the insertion lines, fragments of essentially the same sequence and of approximately 1188 bp in size were identified in the sacB regions. In the deletion lines, iron ions showed a tendency to induce larger deletions than carbon ions, suggesting that higher LET beams cause larger deletions. We found also that ion beams, particularly 'heavier' ion beams, can produce single gene disruptions and may present an effective alternative to transgenic approaches.

  16. Etanercept administration to neonatal SH3BP2 knock-in cherubism mice prevents TNF-α-induced inflammation and bone loss.

    Science.gov (United States)

    Yoshitaka, Teruhito; Ishida, Shu; Mukai, Tomoyuki; Kittaka, Mizuho; Reichenberger, Ernst J; Ueki, Yasuyoshi

    2014-01-01

    Cherubism is a genetic disorder of the craniofacial skeleton caused by gain-of-function mutations in the signaling adaptor protein, SH3-domain binding protein 2 (SH3BP2). In a knock-in mouse model for cherubism, we previously demonstrated that homozygous mutant mice develop T/B cell-independent systemic macrophage inflammation leading to bone erosion and joint destruction. Homozygous mice develop multiostotic bone lesions whereas cherubism lesions in humans are limited to jawbones. We identified a critical role of tumor necrosis factor α (TNF-α) in the development of autoinflammation by creating homozygous TNF-α-deficient cherubism mutants, in which systemic inflammation and bone destruction were rescued. In this study, we examined whether postnatal administration of an anti-TNF-α antagonist can prevent or ameliorate the disease progression in cherubism mice. Neonatal homozygous mutants, in which active inflammation has not yet developed, were treated with a high dose of etanercept (25 mg/kg, twice/week) for 7 weeks. Etanercept-treated neonatal mice showed strong rescue of facial swelling and bone loss in jaws and calvariae. Destruction of joints was fully rescued in the high-dose group. Moreover, the high-dose treatment group showed a significant decrease in lung and liver inflammatory lesions. However, inflammation and bone loss, which were successfully treated by etanercept administration, recurred after etanercept discontinuation. No significant effect was observed in low-dose-treated (0.5 mg/kg, twice/week) and vehicle-treated groups. In contrast, when 10-week-old cherubism mice with fully active inflammation were treated with etanercept for 7 weeks, even the high-dose administration did not decrease bone loss or lung or liver inflammation. Taken together, the results suggest that anti-TNF-α therapy may be effective in young cherubism patients, if treated before the inflammatory phase or bone resorption occurs. Therefore, early genetic diagnosis and

  17. Etanercept Administration to Neonatal SH3BP2 Knock-In Cherubism Mice Prevents TNF-α-induced Inflammation and Bone Loss

    Science.gov (United States)

    Yoshitaka, Teruhito; Ishida, Shu; Mukai, Tomoyuki; Kittaka, Mizuho; Reichenberger, Ernst J.; Ueki, Yasuyoshi

    2014-01-01

    Cherubism is a genetic disorder of the craniofacial skeleton caused by gain-of-function mutations in the signaling adaptor protein, SH3-domain binding protein 2 (SH3BP2). In a knock-in mouse model for cherubism, we previously demonstrated that homozygous mutant mice develop T/B cell-independent systemic macrophage inflammation leading to bone erosion and joint destruction. Homozygous mice develop multiostotic bone lesions while cherubism lesions in humans are limited to jawbones. We identified a critical role of TNF-α in the development of autoinflammation by creating homozygous TNF-α-deficient cherubism mutants, where systemic inflammation and bone destruction were rescued. In the current study, we examined whether postnatal administration of an anti-TNF-α antagonist can prevent or ameliorate the disease progression in cherubism mice. Neonatal homozygous mutants, where active inflammation has not yet developed, were treated with a high dose of etanercept (25 mg/kg, twice/week) for 7 weeks. Etanercept-treated neonatal mice showed strong rescue of facial swelling and bone loss in jaws and calvariae. Destruction of joints was fully rescued in the high dose group. Moreover, the high dose treatment group showed a significant decrease in lung and liver inflammatory lesions. However, inflammation and bone loss, which were successfully treated by etanercept administration recurred after etanercept discontinuation. No significant effect was observed in low dose- (0.5 mg/kg, twice/week) and vehicle-treated groups. In contrast, when 10-week-old cherubism mice with fully active inflammation were treated with etanercept for 7 weeks, even the high dose administration did not decrease bone loss, lung or liver inflammation. Taken together, the results suggest that anti-TNF-α therapy may be effective in young cherubism patients, if treated before the inflammatory phase or bone resorption occurs. Therefore, early genetic diagnosis and early treatment with anti

  18. Z-DNA-forming sequences generate large-scale deletions in mammalian cells.

    Science.gov (United States)

    Wang, Guliang; Christensen, Laura A; Vasquez, Karen M

    2006-02-21

    Spontaneous chromosomal breakages frequently occur at genomic hot spots in the absence of DNA damage and can result in translocation-related human disease. Chromosomal breakpoints are often mapped near purine-pyrimidine Z-DNA-forming sequences in human tumors. However, it is not known whether Z-DNA plays a role in the generation of these chromosomal breakages. Here, we show that Z-DNA-forming sequences induce high levels of genetic instability in both bacterial and mammalian cells. In mammalian cells, the Z-DNA-forming sequences induce double-strand breaks nearby, resulting in large-scale deletions in 95% of the mutants. These Z-DNA-induced double-strand breaks in mammalian cells are not confined to a specific sequence but rather are dispersed over a 400-bp region, consistent with chromosomal breakpoints in human diseases. This observation is in contrast to the mutations generated in Escherichia coli that are predominantly small deletions within the repeats. We found that the frequency of small deletions is increased by replication in mammalian cell extracts. Surprisingly, the large-scale deletions generated in mammalian cells are, at least in part, replication-independent and are likely initiated by repair processing cleavages surrounding the Z-DNA-forming sequence. These results reveal that mammalian cells process Z-DNA-forming sequences in a strikingly different fashion from that used by bacteria. Our data suggest that Z-DNA-forming sequences may be causative factors for gene translocations found in leukemias and lymphomas and that certain cellular conditions such as active transcription may increase the risk of Z-DNA-related genetic instability.

  19. Generation of induced pluripotent stem cell (iPSC) line from a patient with triple negative breast cancer with hereditary exon 17 deletion of BRCA1 gene.

    Science.gov (United States)

    Griscelli, Frank; Oudrhiri, Noufissa; Feraud, Olivier; Divers, Dominique; Portier, Lucie; Turhan, Ali G; Bennaceur Griscelli, Annelise

    2017-10-01

    BRCA1 germline mutation confers hereditary predisposition for breast and ovarian cancer. To understand the physiopathology of mammary and ovarian epithelial cancer transformation, and to identify early driver molecular events, we have generated an iPSC line from a patient carrying a germline exon 17 deletion in BRCA1 gene (BRAC1Ex17 iPSC) in a high-risk family context. Blood cells were reprogrammed used non-integrative virus of Sendaï. The BRCA1-deleted iPSC had normal karyotype, harboured a deletion in the exon 17 of the BRCA1 gene, expressed pluripotent hallmarks and had the differentiation capacity into the three germ layers. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  20. Generation of induced pluripotent stem cell (iPSC line from a patient with triple negative breast cancer with hereditary exon 17 deletion of BRCA1 gene

    Directory of Open Access Journals (Sweden)

    Frank Griscelli

    2017-10-01

    Full Text Available BRCA1 germline mutation confers hereditary predisposition for breast and ovarian cancer. To understand the physiopathology of mammary and ovarian epithelial cancer transformation, and to identify early driver molecular events, we have generated an iPSC line from a patient carrying a germline exon 17 deletion in BRCA1 gene (BRAC1Ex17 iPSC in a high-risk family context. Blood cells were reprogrammed used non-integrative virus of Sendaï. The BRCA1-deleted iPSC had normal karyotype, harboured a deletion in the exon 17 of the BRCA1 gene, expressed pluripotent hallmarks and had the differentiation capacity into the three germ layers.

  1. Nature of frequent deletions in CEBPA.

    Science.gov (United States)

    Fuchs, Ota; Kostecka, Arnost; Provaznikova, Dana; Krasna, Blazena; Brezinova, Jana; Filkukova, Jitka; Kotlin, Roman; Kouba, Michal; Kobylka, Petr; Neuwirtova, Radana; Jonasova, Anna; Caniga, Miroslav; Schwarz, Jiri; Markova, Jana; Maaloufova, Jacqueline; Sponerova, Dana; Novakova, Ludmila; Cermak, Jaroslav

    2009-01-01

    C/EBPalpha (CCAAT/enhancer binding protein alpha) belongs to the family of leucine zipper transcription factors and is necessary for transcriptional control of granulocyte, adipocyte and hepatocyte differentiation, glucose metabolism and lung development. C/EBPalpha is encoded by an intronless gene. CEBPA mutations cause a myeloid differentiation block and were detected in acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), multiple myeloma and non-Hodgkin's lymphoma (NHL) patients. In this study we identified in 41 individuals from 824 screened individuals (290 AML patients, 382 MDS patients, 56 NHL patients and 96 healthy individuals) a single class of 23 deletions in CEBPA gene which involved a direct repeat of at least 2 bp. These mutations are characterised by the loss of one of two same repeats at the ends of deleted sequence. Three most frequent repeats included in these deletions in CEBPA gene are CGCGAG (493-498_865-870), GCCAAGCAGC (508-517_907-916) and GG (486-487_885-886), all according to GenBank accession no. NM_004364.2. A mechanism for deletion formation between two repetitive sequences can be recombination events in the repair process. Double-stranded cut in DNA can initiate these recombination events of adjacent DNA sequences.

  2. In vitro and in silico studies of urea-induced denaturation of yeast iso-1-cytochrome c and its deletants at pH 6.0 and 25 °C.

    Science.gov (United States)

    Haque, Md Anzarul; Zaidi, Sobia; Ubaid-Ullah, Shah; Prakash, Amresh; Hassan, Md Imtaiyaz; Islam, Asimul; Batra, Janendra K; Ahmad, Faizan

    2015-01-01

    Yeast iso-1-cytochrome c (y-cyt-c) has five extra residues at N-terminus in comparison to the horse cytochrome c. These residues are numbered as -5 to -1. Here, these extra residues are sequentially removed from y-cyt-c to establish their role in folding and stability of the protein. We performed urea-induced denaturation of wild-type (WT) y-cyt-c and its deletants. Denaturation was followed by observing change in Δε405 (probe for measuring change in the heme environment within the protein), [θ]405 (probe for measuring the change in Phe82 and Met80 axial bonding), [θ]222 (probe for measuring change in secondary structure) and [θ]416 (probe for measuring change in the heme-methionine environment). The urea-induced reversible denaturation curves were used to estimate Δ[Formula: see text], the value of Gibbs free energy change (ΔGD) in the absence of urea; Cm, the midpoint of the denaturation curve, i.e. molar urea concentration ([urea]) at which ΔGD = 0; and m, the slope (=∂ΔGD/∂[urea]). Our in vitro results clearly show that except Δ(-5/-4) all deletants are less stable than WT protein. Coincidence of normalized transition curves of all physical properties suggests that unfolding/refolding of WT protein and its deletants is a two-state process. To confirm our in vitro observations, we performed 40 ns MD simulation of both WT y-cyt-c and its deletants. MD simulation results clearly show that extra N-terminal residues play a role in stability but not in folding of the protein.

  3. Acute Toxicity and Ecological Risk Assessment of Benzophenone-3 (BP-3 and Benzophenone-4 (BP-4 in Ultraviolet (UV-Filters

    Directory of Open Access Journals (Sweden)

    Yang Du

    2017-11-01

    Full Text Available Ultraviolet (UV-absorbing chemicals (UV filters are used in personal care products for the protection of human skin and hair from damage by UV radiation. Although these substances are released into the environment in the production and consumption processes, little is known about their ecotoxicology effects. The acute toxicity and potential ecological risk of UV filters benzophenone-3 (BP-3 and benzophenone-4 (BP-4 on Chlorella vulgaris, Daphnia magna, and Brachydanio rerio were analyzed in the present study. The EC50 values (96 h of BP-3 and BP-4 on C. vulgaris were 2.98 and 201.00 mg/L, respectively. The 48 h-LC50 of BP-3 and BP-4 on D. magna were 1.09 and 47.47 mg/L, respectively. The 96 h-LC50 of BP-3 and BP-4 on B. rerio were 3.89 and 633.00 mg/L, respectively. The toxicity of a mixture of BP-3 and BP-4 on C. vulgaris, D. magna, and B. rerio all showed antagonistic effects. The induced predicted no-effect concentrations of BP-3 and BP-4 by the assessment factor method were 1.80 × 10−3 and 0.47 mg/L, respectively, by assessment factor (AF method, which were both lower than the concentrations detected in the environment at present, verifying that BP-3 and BP-4 remain low-risk chemicals to the aquatic ecosystem.

  4. A 200 bp region of the pea ENOD12 promoter is sufficient for nodule-specific and nod factor induced expression

    DEFF Research Database (Denmark)

    Vijn, I; Christiansen, H; Lauridsen, P

    1995-01-01

    ENOD12 is one of the first nodulin genes expressed upon inoculation with Rhizobium and also purified Nod factors are able to induce ENOD12 expression. The ENOD12 gene family in pea (Pisum sativum) has two members. A cDNA clone representing PsENOD12A [26] and a PsENOD12B genomic clone [7] have been...

  5. [Analysis of the molecular motif for inducing response to jasmonic acid and ethylene in Pib promoter via rice transformation].

    Science.gov (United States)

    Yu, Li; Yang, Shi-Hu; Jin, Yu-Kuan; Wan, Jian-Min; Zhao, Bao-Quan

    2010-01-01

    The expression of Pib gene in rice was induced by hormone, such as jasmonic acid and ethylene. In order to determine the necessary regions of sequence or motifs for response to jasmonic acid and ethylene in Pib promoter, the full length promoter of Pib (-3,572 approximately 2 bp) and three different 5' deletion fragments of Pib promoter (-2,692 approximately 2 bp, -1,335 approximately 2 bp, -761 approximately 2 bp) were synthesized by PCR and then were substituted for 35S upstream gus in a binary plasmid to construct re-combined plasmids of Pib promoter-gus fusions. Transgenic rice plants of the four recombined plasmids were produced by Agrobacterium-mediated transformation. Quality and quantum analysis of gus activities in transgenic plants at both protein and mRNA levels were conducted. The promotion activity of the full length promoter of Pib (-3,572 approximately 2 bp, pNAR901) was the highest in the four recombinants and the gus activities in its transgenic plant organs were enhanced obviously at 6 h after treatment with jasmonic acid or ethylene. The promotion activity of the deleted Pib promoters was significantly decreased and the response to jasmonic acid or ethylene treatment was not present when the -3,572 approximately -2,692 bp sequence was knocked out from the Pib promoter. Although the disparity in the lengths of the deleted Pib promoter of pNAR902 (-2,692 approximately 2 bp), pNAR903 (-1,335 approximately 2 bp), and pNAR904 (-761 approximately 2 bp) was more than 2 or 3 times, the response to jasmonic acid or ethylene treatment was not different among their transgenic plants. All these results indicated that the common deleted sequences (-3,572 approximately -2,692 bp) in the three deleted Pib promoter constructs were the essential region to the response to jasmonic acid and ethylene treatment. The result of pib promoter sequence searching indicated that there was only one GCCGCC motif at -2,722 bp of this common deleted segment in the Pib promoter

  6. A Novel Large-Scale Deletion of The Mitochondrial DNA of Spermatozoa of Men in North Iran

    Directory of Open Access Journals (Sweden)

    Maryam Gholinezhad Chari

    2015-02-01

    Full Text Available Background: To investigate the level of correlation between large-scale deletions of the mitochondrial DNA (mtDNA with defective sperm function. Materials and Methods: In this analytic study, a total of 25 semen samples of the normozoospermic infertile men from North of Iran were collected from the IVF center in an infertility clinic. The swim-up procedure was performed for the separation of spermatozoa into two groups; (normal motility group and abnormal motility group by 2.0 ml of Ham’s F-10 medium and 1.0 ml of semen. After total DNA extraction, a long-range polymerase chain reaction (PCR technique was used to determine the mtDNA deletions in human spermatozoa. Results: The products of PCR analysis showed a common 4977 bp deletion and a novel 4866 bp deletion (flanked by a seven-nucleotide direct repeat of 5΄-ACCCCCT-3΄ within the deleted area from the mtDNA of spermatozoa in both groups. However, the frequency of mtDNA deletions in abnormal motility group was significantly higher than the normal motility group (56, and 24% for 4866 bp-deleted mtDNA and, 52, and 28% for 4977 bp-deleted mtDNA, respectively. Conclusion: It is suggested that large-scale deletions of the mtDNA is associated with poor sperm motility and may be a causative factor in the decline of fertility in men.

  7. The rates and patterns of deletions in the human factor IX gene

    Energy Technology Data Exchange (ETDEWEB)

    Ketterling, R.P.; Vielhaber, E.L.; Lind, T.J.; Thorland, E.C.; Sommer S.S. (Mayo Clinic/Foundation, Rochester, MN (United States))

    1994-02-01

    Deletions are commonly observed in genes with either segments of highly homologous sequences or excessive gene length. However, in the factor IX gene and in most genes, deletions (of [ge]21 bp) are uncommon. The authors have analyzed DNA from 290 families with hemophilia B (203 independent mutations) and have found 12 deletions >20 bp. Eleven of these are >2 kb (range >3-163 kb), and one is 1.1 kb. The junctions of the four deletions that are completely contained within the factor IX gene have been determined. A novel mutation occurred in patient HB128: the data suggest that a 26.8-kb deletion occurred between two segments of alternating purines and pyrimidines and that a 2.3-kb sense strand segment derived from the deleted region was inserted. For a sample of 203 independent mutations, the authors estimate the [open quotes]baseline[close quotes] rates of deletional mutation per base pair per generation as a function of size. The rate for large (>2 kb)I deletions is exceedingly low. For every mutational event in which a given base is at the junction of a large deletion, there are an estimated 58 microdeletions (<20 bp) and 985 single-base substitutions at that base. Analysis of the nine reported deletion junctions in the factor IX gene literature reveals that (i) five are associated with inversion, orphan sequences, or sense strand insertions; (ii) four are simple deletions that display an excess of short direct repeats at their junctions; (iii) there is no dramatic clustering of junctions within the gene; and (iv) with the exception of alternating purines and pyrimidines, deletion junctions are not preferentially associated with repetitive DNA. 58 refs., 5 figs., 5 tabs.

  8. Competition between siRNA duplexes: impact of RNA-induced silencing complex loading efficiency and comparison between conventional-21 bp and Dicer-substrate siRNAs.

    Science.gov (United States)

    Tanudji, Marcel; Machalek, Dorothy; Arndt, Greg M; Rivory, Laurent

    2010-02-01

    Cotransfection of a mixture of siRNAs species is typically used when simultaneous targeting of more than one mRNA is required. However, competition between siRNAs could occur and reduce the activity of some siRNAs within the mixture. To further study the factors affecting the degree of competition between siRNAs, we cotransfected luciferase targeting siRNAs with various irrelevant (ie, nonluciferase targeting) siRNAs into cells and examined differences in their competition profiles by assessing the effect on luciferase expression. We show that the degree of competition varies between irrelevant siRNAs and occurs at the point of RISC loading. Although the competition profile appears to be related to the calculated RNA-induced silencing complex (RISC) loading potential, empirical testing is required to confirm the competitive effects. We also observed reduced competition with siRNAs in the Dicer-substrate format, presumably due to more efficient RISC loading as a consequence of the physical transfer of the processed siRNA from Dicer.

  9. Deletion of von Hippel–Lindau Protein Converts Renin-Producing Cells into Erythropoietin-Producing Cells

    Science.gov (United States)

    Paliege, Alexander; Willam, Carsten; Schwarzensteiner, Ilona; Schucht, Kathrin; Neymeyer, Hanna; Sequeira-Lopez, Maria Luisa S.; Bachmann, Sebastian; Gomez, R. Ariel; Eckardt, Kai-Uwe; Kurtz, Armin

    2013-01-01

    States of low perfusion pressure of the kidney associate with hyperplasia or expansion of renin-producing cells, but it is unknown whether hypoxia-triggered genes contribute to these changes. Here, we stabilized hypoxia-inducible transcription factors (HIFs) in mice by conditionally deleting their negative regulator, Vhl, using the Cre/loxP system with renin-1d promoter-driven Cre expression. Vhl −/−REN mice were viable and had normal BP. Deletion of Vhl resulted in constitutive accumulation of HIF-2α in afferent arterioles and glomerular cells and HIF-1α in collecting duct cells of the adult kidney. The preglomerular vascular tree developed normally, but far fewer renin-expressing cells were present, with more than 70% of glomeruli not containing renin cells at the typical juxtaglomerular position. Moreover, these mice had an attenuated expansion of renin-producing cells in response to a low-salt diet combined with an ACE inhibitor. However, renin-producing cells of Vhl −/−REN mice expressed the erythropoietin gene, and they were markedly polycythemic. Taken together, these results suggest that hypoxia-inducible genes, regulated by VHL, are essential for normal development and physiologic adaptation of renin-producing cells. In addition, deletion of Vhl shifts the phenotype of juxtaglomerular cells from a renin- to erythropoietin-secreting cell type, presumably in response to HIF-2 accumulation. PMID:23393316

  10. Myocardial infarction-induced N-terminal fragment of cardiac myosin-binding protein C (cMyBP-C) impairs myofilament function in human myocardium.

    Science.gov (United States)

    Witayavanitkul, Namthip; Ait Mou, Younss; Kuster, Diederik W D; Khairallah, Ramzi J; Sarkey, Jason; Govindan, Suresh; Chen, Xin; Ge, Ying; Rajan, Sudarsan; Wieczorek, David F; Irving, Thomas; Westfall, Margaret V; de Tombe, Pieter P; Sadayappan, Sakthivel

    2014-03-28

    Myocardial infarction (MI) is associated with depressed cardiac contractile function and progression to heart failure. Cardiac myosin-binding protein C, a cardiac-specific myofilament protein, is proteolyzed post-MI in humans, which results in an N-terminal fragment, C0-C1f. The presence of C0-C1f in cultured cardiomyocytes results in decreased Ca(2+) transients and cell shortening, abnormalities sufficient for the induction of heart failure in a mouse model. However, the underlying mechanisms remain unclear. Here, we investigate the association between C0-C1f and altered contractility in human cardiac myofilaments in vitro. To accomplish this, we generated recombinant human C0-C1f (hC0C1f) and incorporated it into permeabilized human left ventricular myocardium. Mechanical properties were studied at short (2 μm) and long (2.3 μm) sarcomere length (SL). Our data demonstrate that the presence of hC0C1f in the sarcomere had the greatest effect at short, but not long, SL, decreasing maximal force and myofilament Ca(2+) sensitivity. Moreover, hC0C1f led to increased cooperative activation, cross-bridge cycling kinetics, and tension cost, with greater effects at short SL. We further established that the effects of hC0C1f occur through direct interaction with actin and α-tropomyosin. Our data demonstrate that the presence of hC0C1f in the sarcomere is sufficient to induce depressed myofilament function and Ca(2+) sensitivity in otherwise healthy human donor myocardium. Decreased cardiac function post-MI may result, in part, from the ability of hC0C1f to bind actin and α-tropomyosin, suggesting that cleaved C0-C1f could act as a poison polypeptide and disrupt the interaction of native cardiac myosin-binding protein C with the thin filament.

  11. Adding and Deleting Images

    Science.gov (United States)

    Images are added via the Drupal WebCMS Editor. Once an image is uploaded onto a page, it is available via the Library and your files. You can edit the metadata, delete the image permanently, and/or replace images on the Files tab.

  12. Do mtDNA Deletions Play a Role in the Development of Nasal Polyposis?

    Directory of Open Access Journals (Sweden)

    Arzu Tatar

    2014-04-01

    Full Text Available Objective:Nasal polyposis (NP is an inflammatory disease of the nasal mucosa and paranasal sinuses. Mitochondria are the cellular organelles which produce cellular energy by Oxidative Phosphorylation (OXPHOS, and they have own inheritance material, mtDNA. mtDNA is affected by reactive oxygen samples (ROS which are produced by both OXPHOS and the inflammatory process. The aim of this study was to investigate the 4977 bp and 7400 bp deletions of mtDNA in nasal polyposis tissue, and to indicate the possible association of mtDNA deletions with NP. Methods:Thirty-three patients, aged 15 to 65 years, with nasal polyposis were selected to be assessed for mitochondrial DNA deletions. The patients with possible mtDNA mutations due to mitochondrial disease, being treated with radiotherapy, of advanced age, with a familiar history, aspirin hypersensitivity, or a history of asthma, were excluded. Polyp excision surgery was applied to the treatment of the NP, and after histopathological diagnosis 1x1 cm of polyp tissue samples were used to isolate mtDNA. The 4977 bp and 7400 bp deletion regions, and two control regions of mtDNA were assessed by using four pairs of primers. DNA extractions from the NP tissues and peripheral blood samples of the patients were made, and then Polymerase Chain Reactions (PCR were made. PCR products were separated in 2% agarose gel.Results:No patient had either the 4977 bp deletion or the 7400 bp deletion in their NP tissue, and neither were these deletions evident in their peripheral blood. Two control sequences, one of them from a non-deleted region, and the other from a possible deletion region, were detected in the NP tissues and peripheral blood of all the patients.Conclusions:We had anticipated that some mtDNA deletion might have occurred in NP tissue due to the increased ROS levels caused by chronic inflammation, but we did not detect any deletion. Probably, the duration of inflammation in NP is insufficient to form mt

  13. African Swine Fever Virus Georgia 2007 with a Deletion of Virulence-Associated Gene 9GL (B119L), when Administered at Low Doses, Leads to Virus Attenuation in Swine and Induces an Effective Protection against Homologous Challenge.

    Science.gov (United States)

    O'Donnell, Vivian; Holinka, Lauren G; Krug, Peter W; Gladue, Douglas P; Carlson, Jolene; Sanford, Brenton; Alfano, Marialexia; Kramer, Edward; Lu, Zhiqiang; Arzt, Jonathan; Reese, Bo; Carrillo, Consuelo; Risatti, Guillermo R; Borca, Manuel V

    2015-08-01

    African swine fever virus (ASFV) is the etiological agent of an often lethal disease of domestic pigs. Disease control strategies have been hampered by the unavailability of vaccines against ASFV. Since its introduction in the Republic of Georgia, a highly virulent virus, ASFV Georgia 2007 (ASFV-G), has caused an epizootic that spread rapidly into Eastern European countries. Currently no vaccines are available or under development to control ASFV-G. In the past, genetically modified ASFVs harboring deletions of virulence-associated genes have proven attenuated in swine, inducing protective immunity against challenge with homologous parental viruses. Deletion of the gene 9GL (open reading frame [ORF] B119L) in highly virulent ASFV Malawi-Lil-20/1 produced an attenuated phenotype even when administered to pigs at 10(6) 50% hemadsorption doses (HAD50). Here we report the construction of a genetically modified ASFV-G strain (ASFV-G-Δ9GLv) harboring a deletion of the 9GL (B119L) gene. Like Malawi-Lil-20/1-Δ9GL, ASFV-G-Δ9GL showed limited replication in primary swine macrophages. However, intramuscular inoculation of swine with 10(4) HAD50 of ASFV-G-Δ9GL produced a virulent phenotype that, unlike Malawi-Lil-20/1-Δ9GL, induced a lethal disease in swine like parental ASFV-G. Interestingly, lower doses (10(2) to 10(3) HAD50) of ASFV-G-Δ9GL did not induce a virulent phenotype in swine and when challenged protected pigs against disease. A dose of 10(2) HAD50 of ASFV-G-Δ9GLv conferred partial protection when pigs were challenged at either 21 or 28 days postinfection (dpi). An ASFV-G-Δ9GL HAD50 of 10(3) conferred partial and complete protection at 21 and 28 dpi, respectively. The information provided here adds to our recent report on the first attempts toward experimental vaccines against ASFV-G. The main problem for controlling ASF is the lack of vaccines. Studies on ASFV virulence lead to the production of genetically modified attenuated viruses that induce protection

  14. (AJST) GENERALISED DELETION DESIGNS

    African Journals Online (AJOL)

    Following Dean (1978), for a given contrast vector x c , the loss of information x ψ ,. 1. 0. ≤. ≤ x ψ. , due to confounding with blocks, is given by x x x. 1 x x cc. cN. KNc ψ. 1. ′. = −. ′. (3.3). Where N is the incidence matrix and K is the diagonal matrix of block sizes. We consider deletion designs of the form. ( ) 1. 1 m m n ls s.

  15. Deletion of GPR40 Impairs Glucose-Induced Insulin Secretion In Vivo in Mice Without Affecting Intracellular Fuel Metabolism in Islets

    Energy Technology Data Exchange (ETDEWEB)

    Alquier, Thierry; Peyot, Marie-Line; Latour, M. G.; Kebede, Melkam; Sorensen, Christina M.; Gesta, Stephane; Kahn, C. R.; Smith, Richard D.; Jetton, Thomas L.; Metz, Thomas O.; Prentki, Marc; Poitout, Vincent J.

    2009-11-01

    The G protein-coupled receptor GPR40 mediates fatty-acid potentiation of glucose-stimulated insulin secretion, but its contribution to insulin secretion in vivo and mechanisms of action remain uncertain. This study was aimed to ascertain whether GPR40 controls insulin secretion in vivo and modulates intracellular fuel metabolism in islets. We observed that glucose- and arginine-stimulated insulin secretion, assessed by hyperglycemic clamps, was decreased by approximately 60% in GPR40 knock-out (KO) fasted and fed mice, without changes in insulin sensitivity assessed by hyperinsulinemic-euglycemic clamps. Glucose and palmitate metabolism were not affected by GPR40 deletion. Lipid profiling revealed a similar increase in triglyceride and decrease in lysophosphatidylethanolamine species in WT and KO islets in response to palmitate. These results demonstrate that GPR40 regulates insulin secretion in vivo not only in response to fatty acids but also to glucose and arginine, without altering intracellular fuel metabolism.

  16. Sleep-Time Ambulatory BP Is an Independent Prognostic Marker of CKD.

    Science.gov (United States)

    Hermida, Ramón C; Ayala, Diana E; Mojón, Artemio; Fernández, José R

    2017-09-01

    The prognostic value of clinic and ambulatory BP in predicting incident CKD and whether CKD risk reduction associates with progressive treatment-induced decrease of clinic, awake, or asleep BP are unknown. We prospectively evaluated 2763 individuals without CKD, 1343 men and 1420 women (mean±SD age: 51.5±14.3 years old), with baseline ambulatory BP ranging from normotension to hypertension. On recruitment and annually thereafter (more frequently if hypertension treatment was adjusted on the basis of ambulatory BP), we simultaneously monitored BP and physical activity (wrist actigraphy) for 48 hours to accurately derive individualized mean awake and asleep BP. During a median 5.9-year follow-up, 404 participants developed CKD. Mean asleep systolic BP was the most significant predictor of CKD in a Cox proportional hazard model adjusted for age, diabetes, serum creatinine concentration, urinary albumin concentration, previous cardiovascular event, and hypertension treatment time (on awakening versus at bedtime; per 1-SD elevation: hazard ratio, 1.44; 95% confidence interval, 1.31 to 1.56; Pambulatory BP was not significant when corrected by mean asleep BP. Analyses of BP changes during follow-up revealed 27% reduction in the risk of CKD per 1-SD decrease in mean asleep systolic BP, independent of changes in mean clinic BP or awake ambulatory BP. In conclusion, sleep-time BP is a highly significant independent prognostic marker for CKD. Furthermore, progressive treatment-induced decrease of asleep BP, a potential therapeutic target requiring ambulatory BP evaluation, might be a significant method for reducing CKD risk. Copyright © 2017 by the American Society of Nephrology.

  17. Deletion of fucose residues in plant N-glycans by repression of the GDP-mannose 4,6-dehydratase gene using virus-induced gene silencing and RNA interference.

    Science.gov (United States)

    Matsuo, Kouki; Matsumura, Takeshi

    2011-02-01

    Production of pharmaceutical glycoproteins in plants has many advantages in terms of safety and reduced costs. However, plant-produced glycoproteins have N-glycans with plant-specific sugar residues (core β-1,2-xylose and α-1,3-fucose) and a Lewis a (Le(a) ) epitope, i.e., Galβ(1-3)[Fucα(1-4)]GlcNAc. Because these sugar residues and glycan structures seemed to be immunogenic, several attempts have been made to delete them by repressing their respective glycosyltransferase genes. However, until date, such deletions have not been successful in completely eliminating the fucose residues. In this study, we simultaneously reduced the plant-specific core α-1,3-fucose and α-1,4-fucose residues in the Le(a) epitopes by repressing the Guanosine 5'-diphosphate (GDP)-D-mannose 4,6-dehydratase (GMD) gene, which is associated with GDP-L-fucose biosynthesis, in Nicotiana benthamiana plants. Repression of GMD was achieved using virus-induced gene silencing (VIGS) and RNA interference (RNAi). The proportion of fucose-free N-glycans found in total soluble protein from GMD gene-repressed plants increased by 80% and 95% following VIGS and RNAi, respectively, compared to wild-type plants. A small amount of putative galactose substitution in N-glycans from the NbGMD gene-repressed plants was observed, similar to what has been previously reported GMD-knockout Arabidopsis mutant. On the other hand, the recombinant mouse granulocyte-macrophage colony-stimulating factor (GM-CSF) with fucose-deleted N-glycans was successfully produced in NbGMD-RNAi transgenic N. benthamiana plants. Thus, repression of the GMD gene is thus very useful for deleting immunogenic total fucose residues and facilitating the production of pharmaceutical glycoproteins in plants. © 2010 The Authors. Plant Biotechnology Journal © 2010 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  18. Deletion of apoptosis signal-regulating kinase 1 (ASK1 protects pancreatic beta-cells from stress-induced death but not from glucose homeostasis alterations under pro-inflammatory conditions.

    Directory of Open Access Journals (Sweden)

    Emilie Pepin

    Full Text Available Type 2 diabetes is characterized by pancreatic beta-cell dysfunction and is associated with low-grade inflammation. Recent observations suggest that apoptosis signal-regulating kinase 1 (ASK1 is involved in beta-cell death in response to different stressors. In this study, we tested whether ASK1 deficiency protects beta-cells from glucolipotoxic conditions and cytokines treatment or from glucose homeostasis alteration induced by endotoxemia.Insulin secretion was neither affected upon shRNA-mediated downregulation of ASK1 in MIN6 cells nor in islets from ASK1-deficient mice. ASK1 silencing in MIN6 cells and deletion in islets did not prevent the deleterious effect of glucolipotoxic conditions or cytokines on insulin secretion. However, it protected MIN6 cells from death induced by ER stress or palmitate and islets from short term caspase activation in response to cytokines. Moreover, endotoxemia induced by LPS infusion increased insulin secretion during hyperglycemic clamps but the response was similar in wild-type and ASK1-deficient mice. Finally, insulin sensitivity in the presence of LPS was not affected by ASK1-deficiency.Our study demonstrates that ASK1 is not involved in beta-cell function and dysfunction but controls stress-induced beta-cell death.

  19. Dystrophin expression in a Duchenne muscular dystrophy patient with a frame shift deletion.

    Science.gov (United States)

    Prior, T W; Bartolo, C; Papp, A C; Snyder, P J; Sedra, M S; Burghes, A H; Kissel, J T; Luquette, M H; Tsao, C Y; Mendell, J R

    1997-02-01

    The exon 45 deletion is a common dystrophin gene deletion. Although this is an out-of-frame deletion, which should not allow for protein synthesis, it has been observed in mildly affected patients. We describe a patient with an exon 45 deletion who produced protein, but still had a severe Duchenne muscular dystrophy phenotype. RT-PCR analysis and cDNA sequencing from the muscle biopsy sample revealed that the exon 45 deletion induced exon skipping of exon 44, which resulted in an in-frame deletion and the production of dystrophin. A conformational change in dystrophin induced by the deletion is proposed as being responsible for the severe phenotype in the patient. We feel that the variable clinical phenotype observed in patients with the exon 45 deletion is not due to exon splicing but may be the result of other environmental or genetic factors, or both.

  20. Enhanced Expression of IL-18 and IL-18BP in Plasma of Patients with Eczema: Altered Expression of IL-18BP and IL-18 Receptor on Mast Cells

    Directory of Open Access Journals (Sweden)

    Yalin Hu

    2017-01-01

    Full Text Available IL-18 has been found to be associated with eczema. However, little is known of the role of IL-18 binding protein (BP and IL-18 receptor (R in eczema. We therefore investigated the expression of IL-18, IL-18BP, and IL-18R on mast cells by using flow cytometry analysis and mouse eczema model. The results showed that plasma free IL-18 and free IL-18BP levels in eczema patients were higher than those in healthy controls. IL-18 provoked up to 3.1-fold increase in skin mast cells. IL-18 induced also an increase in IL-18BP+ mast cells, but a reduction of IL-18R+ mast cells in mouse eczema skin. It was found that house dust mite allergen Der p1 and egg allergen OVA induced upregulation of the expression of IL-18, IL-18BP, and IL-18R mRNAs in HMC-1 cells following 2 and 16 h incubation. In conclusion, correlation of IL-18 and IL-18BP in eczema plasma suggests an important balance between IL-18 and IL-18BP in eczema. The decrease in molar concentration ratio of plasma IL-18BP/IL-18 and allergen-induced upregulated expression of IL-18 and IL-18R in skin mast cells of the patients with eczema suggests that anti-IL-18 including IL-18BP therapy may be useful for the treatment of eczema.

  1. Interleukin-6 deletion in mice driven by aP2-Cre-ERT2 prevents against high-fat diet-induced gain weight and adiposity in female mice.

    Science.gov (United States)

    Navia, B; Ferrer, B; Giralt, M; Comes, G; Carrasco, J; Molinero, A; Quintana, A; Leclerc, J; Viollet, B; Señarís, R M; Hidalgo, J

    2014-08-01

    Interleukin-6 (IL-6) is a major cytokine controlling body weight and metabolism, but because many types of cells can synthesize and respond to IL-6 considerable uncertainty still exists about the mechanisms underlying IL-6 effects. Therefore, the aim of this study was to analyse the effects of tissue-specific deletion of IL-6 using a fatty acid binding protein (aP2) promoter-Cre inducible system (aP2-Cre-ERT2). Tissue-specific IL-6 KO mice (aP2-IL-6 KO mice) were produced upon tamoxifen administration and were fed a high-fat diet (HFD, 58.4% kcal from fat) or a control diet (18%) for 14 weeks. aP2-IL-6 KO female mice on a HFD gained less weight and adiposity than littermate wild-type mice, but these effects were not observed in males. Hypothalamic factors such as NPY and AgRP showed a pattern of expression consistent with this sex-specific phenotype. PGC-1α expression was increased in several tissues in aP2-IL-6 KO female mice, which is compatible with increased energy expenditure. Serum leptin, insulin, glucose, cholesterol and triglycerides levels were increased by HFD, and in females IL-6 deficiency reversed this effect in the case of insulin and cholesterol. HFD induced impaired responses to insulin and glucose tolerance tests, but no significant differences between genotypes were observed. The present results demonstrate that deletion of IL-6 driven by aP2-Cre regulates body weight, body fat and metabolism in a sex-specific fashion. © 2014 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

  2. FASTA barcodes: a simple method for the identification of yeast ORF deletions.

    Science.gov (United States)

    McMahon, K Wyatt; Manukyan, Arkadi; Dungrawala, Huzefa; Montgomery, Micah; Nordstrom, Brian; Wright, Jill; Abraham, Lesley; Schneider, Brandt L

    2011-09-01

    A consortium of yeast geneticists have created -6000 individual ORF deletions, representing > 96% of the currently verified or predicted ORFs in S. cerevisiae. Importantly, molecular barcodes (each a unique 20 bp sequence termed either Uptag or Downtag) were used as identifiers for every ORF deletion. Microarray analyses of pooled yeast deletions has been used to identify thousands of genes involved in general fitness, haploinsufficiency, drug resistance and DNA damage repair. However, application of this powerful technology requires considerable expense, expertise and specialized equipment. While standard PCR techniques and specifically designed PCR primers can be used to confirm that a given ORF is in fact deleted, this procedure cannot be used to identify unknown deletions. In theory, every ORF deletion could be determined by barcode sequencing. However, neither a consolidated barcode database nor a reliable search engine is currently available for this purpose. To address this need, we have adapted a FASTA sequence program that utilizes the unique barcode database to allow users to identify individual ORF deletions, based upon simple sequencing reactions of PCR amplifications of either Uptag or Downtag barcodes. In silico and practical testing of this application reveals that it is an inexpensive, reliable and reproducible method for rapidly identifying unknown deletions. This approach allows laboratories to conduct small- or large-scale genetic screens with pooled yeast deletion strains and identify or verify any ORF deletion without the need for microarray technology. Copyright © 2011 John Wiley & Sons, Ltd.

  3. Skin-specific Deletion of Stearoyl-CoA Desaturase-1 Alters Skin Lipid Composition and Protects Mice from High Fat Diet-induced Obesity

    National Research Council Canada - National Science Library

    Harini Sampath; Matthew T. Flowers; Xueqing Liu; Chad M. Paton; Ruth Sullivan; Kiki Chu; Minghui Zhao; James M. Ntambi

    2009-01-01

    .... In addition, SKO mice have significantly increased energy expenditure and are protected from high fat diet-induced obesity, thereby recapitulating the hypermetabolic phenotype of global SCD1 deficiency...

  4. Human Genomic Deletions Generated by SVA-Associated Events.

    Science.gov (United States)

    Lee, Jungnam; Ha, Jungsu; Son, Seung-Yeol; Han, Kyudong

    2012-01-01

    Mobile elements are responsible for half of the human genome. Among the elements, L1 and Alu are most ubiquitous. They use L1 enzymatic machinery to move in their host genomes. A significant amount of research has been conducted about these two elements. The results showed that these two elements have played important roles in generating genomic variations between human and chimpanzee lineages and even within a species, through various mechanisms. SVA elements are a third type of mobile element which uses the L1 enzymatic machinery to propagate in the human genome but has not been studied much relative to the other elements. Here, we attempt the first identification of the human genomic deletions caused by SVA elements, through the comparison of human and chimpanzee genome sequences. We identified 13 SVA recombination-associated deletions (SRADs) and 13 SVA insertion-mediated deletions (SIMDs) in the human genome and characterized them, focusing on deletion size and the mechanisms causing the events. The results showed that the SRADs and SIMDs have deleted 15,752 and 30,785 bp, respectively, in the human genome since the divergence of human and chimpanzee and that SRADs were caused by two different mechanisms, nonhomologous end joining and nonallelic homologous recombination.

  5. Microarray-based ultra-high resolution discovery of genomic deletion mutations.

    Science.gov (United States)

    Belfield, Eric J; Brown, Carly; Gan, Xiangchao; Jiang, Caifu; Baban, Dilair; Mithani, Aziz; Mott, Richard; Ragoussis, Jiannis; Harberd, Nicholas P

    2014-03-22

    Oligonucleotide microarray-based comparative genomic hybridization (CGH) offers an attractive possible route for the rapid and cost-effective genome-wide discovery of deletion mutations. CGH typically involves comparison of the hybridization intensities of genomic DNA samples with microarray chip representations of entire genomes, and has widespread potential application in experimental research and medical diagnostics. However, the power to detect small deletions is low. Here we use a graduated series of Arabidopsis thaliana genomic deletion mutations (of sizes ranging from 4 bp to ~5 kb) to optimize CGH-based genomic deletion detection. We show that the power to detect smaller deletions (4, 28 and 104 bp) depends upon oligonucleotide density (essentially the number of genome-representative oligonucleotides on the microarray chip), and determine the oligonucleotide spacings necessary to guarantee detection of deletions of specified size. Our findings will enhance a wide range of research and clinical applications, and in particular will aid in the discovery of genomic deletions in the absence of a priori knowledge of their existence.

  6. [A single deletion of mitochondrial DNA in a Brazilian patient with chronic progressive external ophthalmoplegia].

    Science.gov (United States)

    Carod-Artal, F J; Solano-Palacios, A; Playán-Ariso, A; Viana-Brandi, I; López-Gallardo, E; Andreu, A; López-Pérez, M; Montoya, J

    The syndrome of chronic progressive external ophthalmoplegia (CPEO) has been associated to the presence of large deletion, single or multiple, in the mitochondrial DNA of skeletal muscle. We report a sporadic case of chronic progressive external ophthalmoplegia that began at age 19 years and was associated with ragged red fibers in skeletal muscle. Genetic analysis of mitochondrial DNA revealed the presence of a single deletion of 4237 bp that encompasses the nucleotide positions 9486 to 13722, a location that has not been described before, and flanked by a direct repeat sequence. The deletion is flanked by a direct repeat. The amount of deleted mitochondrial DNA (55%) in this patient's muscle suggests that this deletion is the molecular cause of the phenotypic presentation of this patient.

  7. Endogenous sequence patterns predispose the repair modes of CRISPR/Cas9-induced DNA double-stranded breaks in Arabidopsis thaliana.

    Science.gov (United States)

    Vu, Giang T H; Cao, Hieu X; Fauser, Friedrich; Reiss, Bernd; Puchta, Holger; Schubert, Ingo

    2017-10-01

    The possibility to predict the outcome of targeted DNA double-stranded break (DSB) repair would be desirable for genome editing. Furthermore the consequences of mis-repair of potentially cell-lethal DSBs and the underlying pathways are not yet fully understood. Here we study the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9-induced mutation spectra at three selected endogenous loci in Arabidopsis thaliana by deep sequencing of long amplicon libraries. Notably, we found sequence-dependent genomic features that affected the DNA repair outcome. Deletions of 1-bp to 1 kbp (all due to NHEJ) and deletions combined with insertions between 5-bp to >100 bp [caused by a synthesis-dependent strand annealing (SDSA)-like mechanism] occurred most frequently at all three loci. The appearance of single-stranded annealing events depends on the presence and distance between repeats flanking the DSB. The frequency and size of insertions is increased if a sequence with high similarity to the target site was available in cis. Most deletions were linked to pre-existing microhomology. Deletion and/or insertion mutations were blunt-end ligated or via de novo generated microhomology. While most mutation types and, to some degree, their predictability are comparable with animal systems, the broad range of deletion mutations seems to be a peculiar feature of the plant A. thaliana. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  8. Deletion of CDKAL1 affects high-fat diet-induced fat accumulation and glucose-stimulated insulin secretion in mice, indicating relevance to diabetes.

    Directory of Open Access Journals (Sweden)

    Tadashi Okamura

    Full Text Available BACKGROUND/OBJECTIVE: The CDKAL1 gene is among the best-replicated susceptibility loci for type 2 diabetes, originally identified by genome-wide association studies in humans. To clarify a physiological importance of CDKAL1, we examined effects of a global Cdkal1-null mutation in mice and also evaluated the influence of a CDKAL1 risk allele on body mass index (BMI in Japanese subjects. METHODS: In Cdkal1-deficient (Cdkal1⁻/⁻ mice, we performed oral glucose tolerance test, insulin tolerance test, and perfusion experiments with and without high-fat feeding. Based on the findings in mice, we tested genetic association of CDKAL1 variants with BMI, as a measure of adiposity, and type 2 diabetes in Japanese. PRINCIPAL FINDINGS: On a standard diet, Cdkal1⁻/⁻ mice were modestly lighter in weight than wild-type littermates without major alterations in glucose metabolism. On a high fat diet, Cdkal1⁻/⁻ mice showed significant reduction in fat accumulation (17% reduction in %intraabdominal fat, P = 0.023 vs. wild-type littermates with less impaired insulin sensitivity at an early stage. High fat feeding did not potentiate insulin secretion in Cdkal1⁻/⁻ mice (1.0-fold, contrary to the results in wild-type littermates (1.6-fold, P<0.01. Inversely, at a later stage, Cdkal1⁻/⁻ mice showed more prominent impairment of insulin sensitivity and glucose tolerance. mRNA expression analysis indicated that Scd1 might function as a critical mediator of the altered metabolism in Cdkal1⁻/⁻ mice. In accordance with the findings in mice, a nominally significant (P<0.05 association between CDKAL1 rs4712523 and BMI was replicated in 2 Japanese general populations comprising 5,695 and 12,569 samples; the risk allele for type 2 diabetes was also associated with decreased BMI. CONCLUSIONS: Cdkal1 gene deletion is accompanied by modestly impaired insulin secretion and longitudinal fluctuations in insulin sensitivity during high-fat feeding in mice

  9. Modulation of splicing of the preceding intron by antisense oligonucleotide complementary to intra-exon sequence deleted in dystrophin Kobe

    Energy Technology Data Exchange (ETDEWEB)

    Takeshima, Y.; Matuso, M.; Sakamoto, H.; Nishio, H. [Kobe Univ. School of Medicine and Science (Japan)

    1994-09-01

    Molecular analysis of dystrophin Kobe showed that exon 19 of the dystrophin gene bearing a 52 bp deletion was skipped during splicing, although the known consensus sequences at the 5{prime} and 3{prime} splice site of exon 19 were maintained. These data suggest that the deleted sequence of exon 19 may function as a cis-acting factor for exact splicing for the upstream intron. To investigate this potential role, an in vitro splicing system using dystrophin precursors was established. A two-exon precursor containing exon 18, truncated intron 18, and exon 19 was accurately spliced. However, splicing of intron 18 was dramatically inhibited when wild exon 19 was replaced with mutated exon 19. Even though the length of exon 19 was restored to normal by replacing the deleted sequence with other sequence, splicing of intron 18 was not fully reactivated. Characteristically, splicing of intron 18 was inactivated more markedly when the replaced sequence contained less polypurine stretches. These data suggested that modification of the exon sequence would result in a splicing abnormality. Antisense 31 mer 2`-O-methyl ribonucleotide was targeted against 5{prime} end of deleted region of exon 19 to modulate splicing of the mRNA precursor. Splicing of intron 18 was inhibited in a dose- and time-dependent manner. This is the first in vitro evidence to show splicing of dystrophin pre-mRNA can be managed by antisense oligonucleotides. These experiments represent an approach in which antisense oligonucleotides are used to restore the function of a defective dystrophin gene in Duchenne muscular dystrophy by inducing skipping of certain exons during splicing.

  10. An Interstitial 15q11-q14 Deletion: Expanded Prader-Willi Syndrome Phenotype

    Science.gov (United States)

    Butler, Merlin G.; Bittel, Douglas C.; Kibiryeva, Nataliya; Cooley, Linda D.; Yu, Shihui

    2009-01-01

    We present an infant girl with a de novo interstitial deletion of the chromosome 15q11-q14 region, larger than the typical deletion seen in Prader-Willi syndrome (PWS). She presented with features seen in PWS including hypotonia, a poor suck, feeding problems and mild micrognathia. She also presented with features not typically seen in PWS such as preauricular ear tags, a high arched palate, edematous feet, coarctation of the aorta, a PDA and a bicuspid aortic valve. G-banded chromosome analysis showed a large de novo deletion of the proximal long arm of chromosome 15 confirmed using FISH probes (D15511 and GABRB3). Methylation testing was abnormal and consistent with the diagnosis of PWS. Because of the large appearing deletion by karyotype analysis, an array comparative genomic hybridization (CGH) was performed. A 12.3 Mb deletion was found which involved the 15q11-q14 region containing approximately 60 protein coding genes. This rare deletion was approximately twice the size of the typical deletion seen in PWS and involved the proximal breakpoint BP1 and the distal breakpoint was located in the 15q14 band between previously recognized breakpoints BP5 and BP6. The deletion extended slightly distal to the AVEN gene including the neighboring CHRM5 gene. There is no evidence that the genes in the 15q14 band are imprinted; therefore, their potential contribution in this patient's expanded Prader-Willi syndrome phenotype must be a consequence of dosage sensitivity of the genes or due to altered expression of intact neighboring genes from a position effect. PMID:20082457

  11. Inhibition of Adult Neurogenesis by Inducible and Targeted Deletion of ERK5 MAP Kinase Specifically in Adult Neurogenic Regions Impairs Contextual Fear Memory Extinction and Remote Fear Memory

    OpenAIRE

    Pan, Yung-Wei; Chan, Guy C.K.; Kuo, Chay T.; Storm, Daniel R.; Xia, Zhengui

    2012-01-01

    Although there is evidence suggesting that adult neurogenesis may contribute to hippocampus-dependent memory, signaling mechanisms responsible for adult hippocampal neurogenesis are not well characterized. Here we report that ERK5 MAP kinase is specifically expressed in the neurogenic regions of the adult mouse brain. The inducible and conditional knockout (icKO) of erk5 specifically in neural progenitors of the adult mouse brain attenuated adult hippocampal neurogenesis. It also caused defic...

  12. Ku80-deleted cells are defective at base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Li, Han [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain); Marple, Teresa [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Hasty, Paul, E-mail: hastye@uthscsa.edu [The University of Texas Health Science Center at San Antonio, The Institute of Biotechnology, The Department of Molecular Medicine, 15355 Lambda Drive, San Antonio, TX 78245-3207 (United States); Tumor Suppression Group, Spanish National Cancer Research Centre (CNIO), Madrid 28029 (Spain)

    2013-05-15

    Graphical abstract: - Highlights: • Ku80-deleted cells are hypersensitive to ROS and alkylating agents. • Cells deleted for Ku80, but not Ku70 or Lig4, have reduced BER capacity. • OGG1 rescues hypersensitivity to H{sub 2}O{sub 2} and paraquat in Ku80-mutant cells. • Cells deleted for Ku80, but not Lig4, are defective at repairing AP sites. • Cells deleted for Ku80, but not Lig4 or Brca2 exon 27, exhibit increased PAR. - Abstract: Ku80 forms a heterodimer with Ku70, called Ku, that repairs DNA double-strand breaks (DSBs) via the nonhomologous end joining (NHEJ) pathway. As a consequence of deleting NHEJ, Ku80-mutant cells are hypersensitive to agents that cause DNA DSBs like ionizing radiation. Here we show that Ku80 deletion also decreased resistance to ROS and alkylating agents that typically cause base lesions and single-strand breaks (SSBs). This is unusual since base excision repair (BER), not NHEJ, typically repairs these types of lesions. However, we show that deletion of another NHEJ protein, DNA ligase IV (Lig4), did not cause hypersensitivity to these agents. In addition, the ROS and alkylating agents did not induce γ-H2AX foci that are diagnostic of DSBs. Furthermore, deletion of Ku80, but not Lig4 or Ku70, reduced BER capacity. Ku80 deletion also impaired BER at the initial lesion recognition/strand scission step; thus, involvement of a DSB is unlikely. Therefore, our data suggests that Ku80 deletion impairs BER via a mechanism that does not repair DSBs.

  13. Suppressor of cytokine signaling 2 (SOCS2) deletion protects against multiple low dose streptozotocin-induced type 1 diabetes in adult male mice

    DEFF Research Database (Denmark)

    Alkharusi, Amira; Mirecki-Garrido, Mercedes; Ma, Zuheng

    2016-01-01

    be overcome by ligands, which bind to GH or PRL receptors. Conclusion: Knockdown of SOCS2 makes mice less sensitive to MLDSTZ. These results are consistent with the proposal that elimination of SOCS2 in pancreatic islets creates a state of β-cell hypersensitivity to GH/PRL that mimics events in pregnancy...... prevent the development of type I diabetes in mice and that SOCS2 deficiency mimics a state of increased GH sensitivity. Methodology: The elevated sensitivity of SOCS2-/- mice to GH and possibly to PRL was the rationale to analyze the effects of multiple low dose streptozotocin (MLDSTZ)-induced diabetes...

  14. Role of neurokinin 1 receptors in dextran sulfate-induced colitis: studies with gene-deleted mice and the selective receptor antagonist netupitant.

    Science.gov (United States)

    Szitter, István; Pintér, Erika; Perkecz, Anikó; Kemény, Agnes; Kun, József; Kereskai, László; Pietra, Claudio; Quinn, John P; Zimmer, Andreas; Berger, Alexandra; Paige, Christopher J; Helyes, Zsuzsanna

    2014-05-01

    The function of the neurokinin 1 (NK1) receptor was investigated in the DSS-induced mouse colitis model using NK1 receptor-deficient mice and the selective antagonist netupitant. Colitis was induced by oral administration of 20 mg/ml DSS solution for 7 days in C57BL/6 and Tacr1 KO animals (n = 5-7). During the induction, one-half of the C57BL/6 and Tacr1 KO group received one daily dose of 6 mg/kg netupitant, administered intraperitoneally, the other half of the group received saline, respectively. Disease activity index (DAI), on the basis of stool consistency, blood and weight loss, was determined over 7 days. Histological evaluation, myeloperoxidase (MPO) measurement, cytokine concentrations and receptor expression analysis were performed on the colon samples. NK1 receptors are up-regulated in the colon in response to DSS treatment. DSS increased DAI, histopathological scores, BLC, sICAM-1, IFN-γ, IL-16 and JE in wildtype mice, which were significantly reduced in NK1 receptor-deficient ones. NK1 receptor antagonism with netupitant significantly diminished DAI, inflammatory histopathological alterations, BLC, IFN-γ, IL-13 and IL-16 in wildtype mice, but not in the NK1-deficient ones. MPO was similarly elevated and netupitant significantly decreased its activity in both groups. NK1 receptor antagonism could be beneficial for colitis via inhibiting different inflammatory mechanisms.

  15. Deletion of serum amyloid A3 improves high fat high sucrose diet-induced adipose tissue inflammation and hyperlipidemia in female mice.

    Directory of Open Access Journals (Sweden)

    Laura J den Hartigh

    Full Text Available Serum amyloid A (SAA increases in response to acute inflammatory stimuli and is modestly and chronically elevated in obesity. SAA3, an inducible form of SAA, is highly expressed in adipose tissue in obese mice where it promotes monocyte chemotaxis, providing a mechanism for the macrophage accumulation that occurs with adipose tissue expansion in obesity. Humans do not express functional SAA3 protein, but instead express SAA1 and SAA2 in hepatic as well as extrahepatic tissues, making it difficult to distinguish between liver and adipose tissue-specific SAA effects. SAA3 does not circulate in plasma, but may exert local effects that impact systemic inflammation. We tested the hypothesis that SAA3 contributes to chronic systemic inflammation and adipose tissue macrophage accumulation in obesity using mice deficient for Saa3 (Saa3(-/-. Mice were rendered obese by feeding a pro-inflammatory high fat, high sucrose diet with added cholesterol (HFHSC. Both male and female Saa3(-/- mice gained less weight on the HFHSC diet compared to Saa3(+/+ littermate controls, with no differences in body composition or resting metabolism. Female Saa3(-/- mice, but not males, had reduced HFHSC diet-induced adipose tissue inflammation and macrophage content. Both male and female Saa3(-/- mice had reduced liver Saa1 and Saa2 expression in association with reduced plasma SAA. Additionally, female Saa3(-/- mice, but not males, showed improved plasma cholesterol, triglycerides, and lipoprotein profiles, with no changes in glucose metabolism. Taken together, these results suggest that the absence of Saa3 attenuates liver-specific SAA (i.e., SAA1/2 secretion into plasma and blunts weight gain induced by an obesogenic diet. Furthermore, adipose tissue-specific inflammation and macrophage accumulation are attenuated in female Saa3(-/- mice, suggesting a novel sexually dimorphic role for this protein. These results also suggest that Saa3 influences liver-specific SAA1

  16. Selective Deletion of Leptin Signaling in Endothelial Cells Enhances Neointima Formation and Phenocopies the Vascular Effects of Diet-Induced Obesity in Mice.

    Science.gov (United States)

    Hubert, Astrid; Bochenek, Magdalena L; Schütz, Eva; Gogiraju, Rajinikanth; Münzel, Thomas; Schäfer, Katrin

    2017-09-01

    Obesity is associated with elevated circulating leptin levels and hypothalamic leptin resistance. Leptin receptors (LepRs) are expressed on endothelial cells, and leptin promotes neointima formation in a receptor-dependent manner. Our aim was to examine the importance of endothelial LepR (End.LepR) signaling during vascular remodeling and to determine whether the cardiovascular consequences of obesity are because of hyperleptinemia or endothelial leptin resistance. Mice with loxP-flanked LepR alleles were mated with mice expressing Cre recombinase controlled by the inducible endothelial receptor tyrosine kinase promoter. Obesity was induced with high-fat diet. Neointima formation was examined after chemical carotid artery injury. Morphometric quantification revealed significantly greater intimal hyperplasia, neointimal cellularity, and proliferation in End.LepR knockout mice, and similar findings were obtained in obese, hyperleptinemic End.LepR wild-type animals. Analysis of primary endothelial cells confirmed abrogated signal transducer and activator of transcription-3 phosphorylation in response to leptin in LepR knockout and obese LepR wild-type mice. Quantitative PCR, ELISA, and immunofluorescence analyses revealed increased expression and release of endothelin-1 in End.LepR-deficient and LepR-resistant cells, and ET receptor A/B antagonists abrogated their paracrine effects on murine aortic smooth muscle cell proliferation. Reduced expression of peroxisome proliferator-activated receptor-γ and increased nuclear activator protein-1 staining was observed in End.LepR-deficient and LepR-resistant cells, and peroxisome proliferator-activated receptor-γ antagonization increased endothelial endothelin-1 expression. Our findings suggest that intact endothelial leptin signaling limits neointima formation and that obesity represents a state of endothelial leptin resistance. These observations and the identification of endothelin-1 as soluble mediator of the

  17. A large deletion on chromosome 11 in acute intermittent porphyria.

    Science.gov (United States)

    Di Pierro, Elena; Besana, Valeria; Moriondo, Valeria; Brancaleoni, Valentina; Tavazzi, Dario; Casalgrandi, Giovanna; Ventura, Paolo; Rocchi, Emilio; Cappellini, Maria Domenica

    2006-01-01

    Acute intermittent porphyria (AIP) is an autosomal disorder caused by molecular abnormalities in the gene coding for hydroxymethylbilane synthase (HMBS), the third enzyme in the heme biosynthetic pathway. So far, more than 242 different mutations responsible for AIP have been identified in this gene. In an Italian family with typical clinical and biochemical signs of AIP, no mutation was found by direct sequencing of the entire hydroxymethylbilane synthase gene (HMBS). All the symptomatic patients showed apparent homozygosity and absence of mendelian segregation for eleven common polymorphisms along the gene. Excluding interference of polymorphisms in the primer sites, we assumed the presence of a complete HMBS gene deletion. In order to identify the size of this deletion, single nucleotide polymorphisms (SNPs) analysis was extended to flanking genes, H2A Histone Family member X (H2AFX) and Dolichyl-Phosphate N-Acetylglucosamine Phosphotransferase 1 (DPAGT1), downstream and Vacuolar protein sorting 11 (VPS11), upstream. Heterozygous polymorphisms in the VPS11 and DPAGT1 genes were found. Thus, we performed a Long-PCR with primers situated in regions outside the homozygous polymorphisms and we identified a double deletion with inversion on chromosome 11 (g22516974_22524062del7088, g22524062_22524278inv216, g22524278_22531093del6815). Even if the deletions include the entire HMBS and H2AFX genes and 1463 bp of the final portion of DPAGT1 gene, our patients had no other symptoms than AIP.

  18. Deletion Mutagenesis and Identification of Causative Mutations in Maize.

    Science.gov (United States)

    Jia, Shangang; Li, Aixia; Zhang, Chi; Holding, David

    2018-01-01

    We describe a method for gamma-irradiation of mature maize seeds to generate mutants with opaque endosperm and reduced kernel fill phenotypes. We also describe methods for mapping mutants and identifying causal gene mutations. Using this method, a population of 1788M2 families and 47 Mo17 × F2s showing stable, segregating, and viable kernel phenotypes was developed. For molecular characterization of the mutants, we utilized a novel functional genomics platform that combines separate Bulked Segregant RNA and exome sequencing data sets (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. We also describe the use of exome capture sequencing of F2 mutant and normal pools to perform mapping and candidate gene identification without the need for separate RNA-seq (BSEx-seq). To exemplify the utility of the deletion mutants for functional genomics and provide proof-of-concept for the bioinformatics platform, we summarize the identification of the causative deletion in two mutants. Mutant 937, which was characterized by BSREx-seq, harbors a 6203-bp in-frame deletion covering six exons within the Opaque-1 gene on chromosome 4. Preliminary investigation of opaque mutant 1486 with BSEx-seq shows a tight mapping interval and associated deletion on chromosome 10.

  19. Synergistic and Additive Properties of the Beta-Globin Locus Control Region (LCR) Revealed by 5′HS3 Deletion Mutations: Implication for LCR Chromatin Architecture

    OpenAIRE

    Fang, Xiangdong; Sun, Jin; Xiang, Ping; Yu, Man; Navas, Patrick A.; Peterson, Kenneth R.; Stamatoyannopoulos, George; Li, Qiliang

    2005-01-01

    Deletion of the 234-bp core element of the DNase I hypersensitive site 3 (5′HS3) of the locus control region (LCR) in the context of a human beta-globin locus yeast artificial chromosome (β-YAC) results in profound effects on globin gene expression in transgenic mice. In contrast, deletion of a 2.3-kb 5′HS3 region, which includes the 234-bp core sequence, has a much milder phenotype. Here we report the effects of these deletions on chromatin structure in the beta-globin locus of adult erythro...

  20. TopBP1 is required at mitosis to reduce transmission of DNA damage to G1 daughter cells

    DEFF Research Database (Denmark)

    Pedersen, Rune Troelsgaard; Kruse, Thomas; Nilsson, Jakob

    2015-01-01

    mitotic entry. In early mitosis, TopBP1 marks sites of and promotes unscheduled DNA synthesis. Moreover, TopBP1 is required for focus formation of the structure-selective nuclease and scaffold protein SLX4 in mitosis. Persistent TopBP1 foci transition into 53BP1 nuclear bodies (NBs) in G1 and precise...... temporal depletion of TopBP1 just before mitotic entry induced formation of 53BP1 NBs in the next cell cycle, showing that TopBP1 acts to reduce transmission of DNA damage to G1 daughter cells. Based on these results, we propose that TopBP1 maintains genome integrity in mitosis by controlling chromatin...

  1. Cardiac Specific, Inducible ClC-3 Gene Deletion Eliminates Native Volume-Sensitive Chloride Channels and Produces Myocardial Hypertrophy in Adult Mice

    Science.gov (United States)

    Xiong, Dazhi; Heyman, Nathanael S.; Airey, Judith; Zhang, Mi; Singer, Cherie A.; Rawat, Shanti; Ye, Linda; Evans, Rebecca; Burkin, Dean J.; Tian, Honglin; McCloskey, Diana T; Valencik, Maria; Britton, Fiona C.; Duan, Dayue; Hume, Joseph R.

    2009-01-01

    Native volume-sensitive outwardly rectifying anion channels (VSOACs) play a significant role in cell volume homeostasis in mammalian cells. However, the molecular correlate of VSOACs has been elusive to identify. The short isoform of ClC-3 (sClC-3) is a member of the mammalian ClC gene family and has been proposed to be a molecular candidate for VSOACs in cardiac myocytes and vascular smooth muscle cells. To directly test this hypothesis, and assess the physiological role of ClC-3 in cardiac function, we generated a novel line of cardiac specific inducible ClC-3 knock-out mice. These transgenic mice were maintained on a doxycycline diet to preserve ClC-3 expression; removal of doxycycline activates Cre recombinase to inactivate the Clcn3 gene. Echocardiography revealed dramatically reduced ejection fraction and fractional shortening, and severe signs of myocardial hypertrophy and heart failure in the knock-out mice at both 1.5 and 3 weeks off doxycycline. In mice off doxyclycline, time-dependent inactivation of ClC-3 gene expression was confirmed in atrial and ventricular cells by qRT-PCR and Western blot analysis. Electrophysiological examination of native VSOACs in isolated atrial and ventricular myocytes 3 weeks off doxycycline revealed a complete elimination of the currents, whereas at 1.5 weeks, VSOAC current densities were significantly reduced, compared to age-matched control mice maintained on doxycycline. These results indicate that ClC-3 is a key component of native VSOACs in mammalian heart and plays a significant cardioprotective role against cardiac hypertrophy and failure. PMID:19615374

  2. Cardiac-specific, inducible ClC-3 gene deletion eliminates native volume-sensitive chloride channels and produces myocardial hypertrophy in adult mice.

    Science.gov (United States)

    Xiong, Dazhi; Heyman, Nathanael S; Airey, Judith; Zhang, Mi; Singer, Cherie A; Rawat, Shanti; Ye, Linda; Evans, Rebecca; Burkin, Dean J; Tian, Honglin; McCloskey, Diana T; Valencik, Maria; Britton, Fiona C; Duan, Dayue; Hume, Joseph R

    2010-01-01

    Native volume-sensitive outwardly rectifying anion channels (VSOACs) play a significant role in cell volume homeostasis in mammalian cells. However, the molecular correlate of VSOACs has been elusive to identify. The short isoform of ClC-3 (sClC-3) is a member of the mammalian ClC gene family and has been proposed to be a molecular candidate for VSOACs in cardiac myocytes and vascular smooth muscle cells. To directly test this hypothesis, and assess the physiological role of ClC-3 in cardiac function, we generated a novel line of cardiac-specific inducible ClC-3 knock-out mice. These transgenic mice were maintained on a doxycycline diet to preserve ClC-3 expression; removal of doxycycline activates Cre recombinase to inactivate the Clcn3 gene. Echocardiography revealed dramatically reduced ejection fraction and fractional shortening, and severe signs of myocardial hypertrophy and heart failure in the knock-out mice at both 1.5 and 3 weeks off doxycycline. In mice off doxycycline, time-dependent inactivation of ClC-3 gene expression was confirmed in atrial and ventricular cells by qRT-PCR and Western blot analysis. Electrophysiological examination of native VSOACs in isolated atrial and ventricular myocytes 3 weeks off doxycycline revealed a complete elimination of the currents, whereas at 1.5 weeks, VSOAC current densities were significantly reduced, compared to age-matched control mice maintained on doxycycline. These results indicate that ClC-3 is a key component of native VSOACs in mammalian heart and plays a significant cardioprotective role against cardiac hypertrophy and failure. Copyright 2009 Elsevier Inc. All rights reserved.

  3. Renal Dysfunction Induced by Kidney-Specific Gene Deletion ofHsd11b2as a Primary Cause of Salt-Dependent Hypertension.

    Science.gov (United States)

    Ueda, Kohei; Nishimoto, Mitsuhiro; Hirohama, Daigoro; Ayuzawa, Nobuhiro; Kawarazaki, Wakako; Watanabe, Atsushi; Shimosawa, Tatsuo; Loffing, Johannes; Zhang, Ming-Zhi; Marumo, Takeshi; Fujita, Toshiro

    2017-07-01

    Genome-wide analysis of renal sodium-transporting system has identified specific variations of Mendelian hypertensive disorders, including HSD11B2 gene variants in apparent mineralocorticoid excess. However, these genetic variations in extrarenal tissue can be involved in developing hypertension, as demonstrated in former studies using global and brain-specific Hsd11b2 knockout rodents. To re-examine the importance of renal dysfunction on developing hypertension, we generated kidney-specific Hsd11b2 knockout mice. The knockout mice exhibited systemic hypertension, which was abolished by reducing salt intake, suggesting its salt-dependency. In addition, we detected an increase in renal membrane expressions of cleaved epithelial sodium channel-α and T53-phosphorylated Na + -Cl - cotransporter in the knockout mice. Acute intraperitoneal administration of amiloride-induced natriuresis and increased urinary sodium/potassium ratio more in the knockout mice compared with those in the wild-type control mice. Chronic administration of amiloride and high-KCl diet significantly decreased mean blood pressure in the knockout mice, which was accompanied with the correction of hypokalemia and the resultant decrease in Na + -Cl - cotransporter phosphorylation. Accordingly, a Na + -Cl - cotransporter blocker hydrochlorothiazide significantly decreased mean blood pressure in the knockout mice. Chronic administration of mineralocorticoid receptor antagonist spironolactone significantly decreased mean blood pressure of the knockout mice along with downregulation of cleaved epithelial sodium channel-α and phosphorylated Na + -Cl - cotransporter expression in the knockout kidney. Our data suggest that kidney-specific deficiency of 11β-HSD2 leads to salt-dependent hypertension, which is attributed to mineralocorticoid receptor-epithelial sodium channel-Na + -Cl - cotransporter activation in the kidney, and provides evidence that renal dysfunction is essential for developing the

  4. Association of the UCP2 45-bp insertion/deletion polymorphism with ...

    African Journals Online (AJOL)

    Essam Hussain Jiffri

    2012-05-19

    May 19, 2012 ... fected their weights (e.g. Cushing disease, hypothyroidism) and the female volunteers who had polycystic ovarian syn- drome (PCOS) were also excluded. The average of ages and. BMI of T2D, and obese patients, besides the healthy control group of the Saudi subjects ± standard deviations (SDs) are.

  5. Association of a Chromosomal Rearrangement Event with Mouse Posterior Polymorphous Corneal Dystrophy and Alterations in Csrp2bp, Dzank1, and Ovol2 Gene Expression.

    Directory of Open Access Journals (Sweden)

    Anna L Shen

    Full Text Available We have previously described a mouse model of human posterior polymorphous corneal dystrophy (PPCD and localized the causative mutation to a 6.2 Mbp region of chromosome 2, termed Ppcd1. We now show that the gene rearrangement linked to mouse Ppcd1 is a 3.9 Mbp chromosomal inversion flanked by 81 Kbp and 542 bp deletions. This recombination event leads to deletion of Csrp2bp Exons 8 through 11, Dzank1 Exons 20 and 21, and the pseudogene Znf133. In addition, we identified translocation of novel downstream sequences to positions adjacent to Csrp2bp Exon 7 and Dzank1 Exon 20. Twelve novel fusion transcripts involving Csrp2bp or Dzank1 linked to downstream sequences have been identified. Eight are expressed at detectable levels in PPCD1 but not wildtype eyes. Upregulation of two Csrp2bp fusion transcripts, as well as upregulation of the adjacent gene, Ovol2, was observed. Absence of the PPCD1 phenotype in animals haploinsufficient for Csrp2bp or both Csrp2bp and Dzank1 rules out haploinsufficiency of these genes as a cause of mouse PPCD1. Complementation experiments confirm that PPCD1 embryonic lethality is due to disruption of Csrp2bp expression. The ocular expression pattern of Csrp2bp is consistent with a role for this protein in corneal development and pathogenesis of PPCD1.

  6. Redefined genomic architecture in 15q24 directed by patient deletion/duplication breakpoint mapping.

    Science.gov (United States)

    El-Hattab, Ayman W; Smolarek, Teresa A; Walker, Martha E; Schorry, Elizabeth K; Immken, LaDonna L; Patel, Gayle; Abbott, Mary-Alice; Lanpher, Brendan C; Ou, Zhishuo; Kang, Sung-Hae L; Patel, Ankita; Scaglia, Fernando; Lupski, James R; Cheung, Sau Wai; Stankiewicz, Pawel

    2009-10-01

    We report four new patients with a submicroscopic deletion in 15q24 manifesting developmental delay, short stature, hypotonia, digital abnormalities, joint laxity, genital abnormalities, and characteristic facial features. These clinical features are shared with six recently reported patients with a 15q24 microdeletion, supporting the notion that this is a recognizable syndrome. We describe a case of an ~2.6 Mb microduplication involving a portion of the minimal deletion critical region in a 15-year-old male with short stature, mild mental retardation, attention deficit hyperactivity disorder, Asperger syndrome, decreased joint mobility, digital abnormalities, and characteristic facial features. Some of these features are shared with a recently reported case with a 15q24 microduplication involving the minimal deletion critical region. We also report two siblings and their mother with duplication adjacent and distal to this region exhibiting mild developmental delay, hypotonia, tapering fingers, characteristic facial features, and prominent ears. The deletion and duplication breakpoints were mapped by array comparative genomic hybridization and the genomic structure in 15q24 was analyzed further. Surprisingly, in addition to the previously recognized three low-copy repeat clusters (BP1, BP2, and BP3), we identified two other paralogous low-copy repeat clusters that likely mediated the formation of alternative sized 15q24 genomic rearrangements via non-allelic homologous recombination.

  7. Home blood pressure (BP) monitoring in kidney transplant recipients is more adequate to monitor BP than office BP.

    Science.gov (United States)

    Agena, Fabiana; Prado, Elisangela dos Santos; Souza, Patricia Soares; da Silva, Giovanio Vieira; Lemos, Francine Brambate Carvalhinho; Mion, Decio; Nahas, William Carlos; David-Neto, Elias

    2011-11-01

    Hypertension is highly prevalent among kidney transplantation recipients and considered as an important cardiovascular risk factor influencing patient survival and kidney graft survival. Aim. Compare the blood pressure (BP) control in kidney transplant patients through the use of home blood pressure monitoring (HBPM) is more comparable with the results of ambulatory blood pressure monitoring compared to the measurement of office blood pressure. From March 2008 to April 2009 prospectively were evaluated 183 kidney transplant recipients with time after transplantation between 1 and 10 years. Patients underwent three methods for measuring BP: office blood pressure measurement (oBP), HBPM and ambulatory blood pressure monitoring (ABPM). In total, 183 patients were evaluated, among them 94 were men (54%) and 89 women (46%). The average age was 50 ± 11 years. The average time of transplant was 57 ± 32 months. Ninety-nine patients received grafts from deceased donors (54%) and 84 were recipients of living donors (46%). When assessed using oBP, 56.3% presented with uncontrolled and 43.7% with adequate control of BP with an average of 138.9/82.3 ± 17.8/12.1 mmHg. However, when measured by HBPM, 55.2% of subjects were controlled and 44.8% presented with uncontrolled BP with an average of 131.1/78.5 ± 17.4/8.9 mmHg. Using the ABPM, we observed that 63.9% of subjects were controlled and 36.1% of patients presented uncontrolled BP with an average 128.8/80.5 ± 12.5/8.1 mmHg. We found that the two methods (oBP and HBPM) have a significant agreement, but the HBPM has a higher agreement that oBP, confirmed P = 0.026. We found that there is no symmetry in the data for both methods with McNemar test. The correlation index of Pearson linear methods for the ABPM with the other two methods were 0.494 for office measurement and 0.768 for HBPM, best value of HBPM with ABPM. Comparing the errors of the two methods by paired t-test, we obtained the descriptive level of 0.837. Looking

  8. The interferon-induced gene Ifi27l2a is active in lung macrophages and lymphocytes after influenza A infection but deletion of Ifi27l2a in mice does not increase susceptibility to infection.

    Science.gov (United States)

    Tantawy, Mohamed A; Hatesuer, Bastian; Wilk, Esther; Dengler, Leonie; Kasnitz, Nadine; Weiß, Siegfried; Schughart, Klaus

    2014-01-01

    Interferons represent one of the first and essential host defense mechanisms after infection, and the activation of the IFN-pathway results in the transcriptional activation of hundreds of interferon-stimulated genes. The alpha-inducible protein 27 like 2A (Ifi27l2a) gene (human synonym: ISG12) is strongly up-regulated in the lung after influenza A infection in mice and has been shown in gene expression studies to be highly correlated to other activated genes. Therefore, we investigated the role of Ifi27l2a for the host defense to influenza A infections in more detail. RT-PCR analyses in non-infected mice demonstrated that Ifi27l2a was expressed in several tissues, including the lung. Detailed analyses of reporter gene expression in lungs from Ifi27l2a-LacZ mice revealed that Ifi27l2a was expressed in macrophages and lymphocytes but not in alveolar cells or bronchiolar epithelium cells. The number of macrophages and lymphocyte strongly increased in the lung after infection, but no significant increase in expression levels of the LacZ reporter gene was found within individual immune cells. Also, no reporter gene expression was found in bronchiolar epithelial cells, alveolar cells or infiltrating neutrophils after infection. Thus, up-regulation of Ifi27l2a in infected lungs is mainly due to the infiltration of macrophages and lymphocytes. Most surprisingly, deletion of Ifi27l2a in mouse knock-out lines did not result in increased susceptibility to infections with H1N1 or H7N7 influenza A virus compared to wild type C57BL/6N mice, suggesting a less important role of the gene for the host response to influenza infections than for bacterial infections.

  9. Functional Characterization of TaSnRK2.8 Promoter in Response to Abiotic Stresses by Deletion Analysis in Transgenic Arabidopsis

    Directory of Open Access Journals (Sweden)

    Hongying Zhang

    2017-07-01

    Full Text Available Drought, salinity, and cold are the major factors limiting wheat quality and productivity; it is thus highly desirable to characterize the abiotic-stress-inducible promoters suitable for the genetic improvement of plant resistance. The sucrose non-fermenting 1-related protein kinase 2 (SnRK2 family genes show distinct regulatory properties in response to abiotic stresses. The present study characterized the approximately 3000-bp upstream sequence (the 313 bp upstream of the ATG was the transcription start site of the Triticum aestivum TaSnRK2.8 promoter under abscisic acid (ABA and abiotic stresses. Four different-length 5′ deletion fragments of TaSnRK2.8 promoter were fused with the GUS reporter gene and transformed into Arabidopsis. Tissue expression analysis showed that the TaSnRK2.8 promoter region from position -1481 to -821 contained the stalk-specific elements, and the region from position -2631 to -1481 contained the leaf- and root-specific elements. In the ABA-treated seedlings, the deletion analysis showed that the TaSnRK2.8 promoter region from position -821 to -2631 contained ABA response elements. The abiotic stress responses of the TaSnRK2.8 promoter derivatives demonstrated that they harbored abiotic-stress response elements: the region from position -821 to -408 harbored the osmotic-stress response elements, whereas the region from position -2631 to -1481 contained the positive regulatory motifs and the region from position -1481 to -821 contained the leaf- and stalk-specific enhancers. Further deletion analysis of the promoter region from position -821 to -408 indicated that a 125-bp region from position -693 to -568 was required to induce an osmotic-stress response. These results contribute to a better understanding of the molecular mechanisms of TaSnRK2.8 in response to abiotic stresses, and the TaSnRK2.8 promoter seems to be a candidate for regulating the expression of abiotic stress response genes in transgenic plants.

  10. CacyBP/SIP promotes the proliferation of colon cancer cells.

    Directory of Open Access Journals (Sweden)

    Huihong Zhai

    Full Text Available CacyBP/SIP is a component of the ubiquitin pathway and is overexpressed in several transformed tumor tissues, including colon cancer, which is one of the most common cancers worldwide. It is unknown whether CacyBP/SIP promotes the proliferation of colon cancer cells. This study examined the expression level, subcellular localization, and binding activity of CacyBP/SIP in human colon cancer cells in the presence and absence of the hormone gastrin. We found that CacyBP/SIP was expressed in a high percentage of colon cancer cells, but not in normal colonic surface epithelium. CacyBP/SIP promoted the cell proliferation of colon cancer cells under both basal and gastrin stimulated conditions as shown by knockdown studies. Gastrin stimulation triggered the translocation of CacyBP/SIP to the nucleus, and enhanced interaction between CacyBP/SIP and SKP1, a key component of ubiquitination pathway which further mediated the proteasome-dependent degradation of p27kip1 protein. The gastrin induced reduction in p27kip1 was prevented when cells were treated with the proteasome inhibitor MG132. These results suggest that CacyBP/SIP may be promoting growth of colon cancer cells by enhancing ubiquitin-mediated degradation of p27kip1.

  11. Protein Phosphatase 2A Dephosphorylates CaBP4 and Regulates CaBP4 Function

    Science.gov (United States)

    Haeseleer, Françoise; Sokal, Izabela; Gregory, Frederick D.; Lee, Amy

    2013-01-01

    Purpose. CaBP4 is a neuronal Ca2+-binding protein that is expressed in the retina and in the cochlea, and is essential for normal photoreceptor synaptic function. CaBP4 is phosphorylated by protein kinase C zeta (PKCζ) in the retina at serine 37, which affects its interaction with and modulation of voltage-gated Cav1 Ca2+ channels. In this study, we investigated the potential role and functional significance of protein phosphatase 2A (PP2A) in CaBP4 dephosphorylation. Methods. The effect of protein phosphatase inhibitors, light, and overexpression of PP2A subunits on CaBP4 dephosphorylation was measured in in vitro assays. Pull-down experiments using retinal or transfected HEK293 cell lysates were used to investigate the association between CaBP4 and PP2A subunits. Electrophysiologic recordings of cotransfected HEK293 cells were performed to analyze the effect of CaBP4 dephosphorylation in modulating Cav1.3 currents. Results. PP2A inhibitors, okadaic acid (OA), and fostriecin, but not PP1 selective inhibitors, NIPP-1, and inhibitor 2, block CaBP4 dephosphorylation in retinal lysates. Increased phosphatase activity in light-dependent conditions reverses phosphorylation of CaBP4 by PKCζ. In HEK293 cells, overexpression of PP2A enhances the rate of dephosphorylation of CaBP4. In addition, inhibition of protein phosphatase activity by OA increases CaBP4 phosphorylation and potentiates the modulatory effect of CaBP4 on Cav1.3 Ca2+ channels in HEK293T cells. Conclusions. This study provides evidence that CaBP4 is dephosphorylated by PP2A in the retina. Our findings reveal a novel role for protein phosphatases in regulating CaBP4 function in the retina, which may fine tune presynaptic Ca2+ signals at the photoreceptor synapse. PMID:23341017

  12. Integration of BpMADS4 on various linkage groups improves the utilization of the rapid cycle breeding system in apple.

    Science.gov (United States)

    Weigl, Kathleen; Wenzel, Stephanie; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola

    2015-02-01

    Rapid cycle breeding in apple is a new approach for the rapid introgression of agronomically relevant traits (e.g. disease resistances) from wild apple species into domestic apple cultivars (Malus × domestica Borkh.). This technique drastically shortens the long-lasting juvenile phase of apple. The utilization of early-flowering apple lines overexpressing the BpMADS4 gene of the European silver birch (Betula pendula Roth.) in hybridization resulted in one breeding cycle per year. Aiming for the selection of non-transgenic null segregants at the end of the breeding process, the flower-inducing transgene and the gene of interest (e.g. resistance gene) that will be introgressed by hybridization need to be located on different chromosomes. To improve the flexibility of the existing approach in apple, this study was focused on the development and characterization of eleven additional BpMADS4 overexpressing lines of four different apple cultivars. In nine lines, the flowering gene was mapped to different linkage groups. The differences in introgressed T-DNA sequences and plant genome deletions post-transformation highlighted the unique molecular character of each line. However, transgenic lines demonstrated no significant differences in flower organ development and pollen functionality compared with non-transgenic plants. Hybridization studies using pollen from the fire blight-resistant wild species accession Malus fusca MAL0045 and the apple scab-resistant cultivar 'Regia' indicated that BpMADS4 introgression had no significant effect on the breeding value of each transgenic line. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Cockayne Syndrome due to a maternally-inherited whole gene deletion of ERCC8 and a paternally-inherited ERCC8 exon 4 deletion.

    Science.gov (United States)

    Ting, T W; Brett, M S; Tan, E S; Shen, Y; Lee, S P; Lim, E C; Vasanwala, R F; Lek, N; Thomas, T; Lim, K W; Tan, E C

    2015-11-10

    Cockayne Syndrome (CS) is an autosomal recessive disorder that causes neurological regression, growth failure and dysmorphic features. We describe a Chinese female child with CS caused by deletions of exon 4 of ERCC8 on one chromosome and exons 1-12 on the other chromosome. By using chromosomal microarray, multiplex ligation-dependant probe analysis and long range PCR, we showed that she inherited a 277 kb deletion affecting the whole ERCC8 gene from the mother and a complex rearrangement resulting in deletion of exon 4 together with a 1,656 bp inversion of intron 4 from the father. A similar complex rearrangement has been reported in four unrelated Japanese CS patients. Analysis of the deletion involving exon 4 identified LINE and other repeat elements that may predispose the region to deletions, insertions and inversions. The patient also had insulin-dependent diabetes mellitus, a rare co-existing feature in patients with CS. More research will be needed to further understand the endocrine manifestations in CS patients. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

    Science.gov (United States)

    Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

    2018-02-13

    Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

  15. Mitochondrial DNA deletion in a patient with combined features of Leigh and Pearson syndromes

    Energy Technology Data Exchange (ETDEWEB)

    Blok, R.B.; Thorburn, D.R.; Danks, D.M. [Royal Children`s Hospital, Melbourne (Australia)] [and others

    1994-09-01

    We describe a heteroplasmic 4237 bp mitochondrial DNA (mtDNA) deletion in an 11 year old girl who has suffered from progressive illness since birth. She has some features of Leigh syndrome (global developmental delay with regression, brainstem dysfunction and lactic acidosis), together with other features suggestive of Pearson syndrome (history of pancytopenia and failure to thrive). The deletion was present at a level greater than 50% in skeletal muscle, but barely detectable in skin fibroblasts following Southern blot analysis, and only observed in blood following PCR analysis. The deletion spanned nt 9498 to nt 13734, and was flanked by a 12 bp direct repeat. Genes for cytochrome c oxidase subunit III, NADH dehydrogenase subunits 3, 4L, 4 and 5, and tRNAs for glycine, arginine, histidine, serine({sup AGY}) and leucine({sup CUN}) were deleted. Southern blotting also revealed an altered Apa I restriction site which was shown by sequence analysis to be caused by G{r_arrow}A nucleotide substitution at nt 1462 in the 12S rRNA gene. This was presumed to be a polymorphism. No abnormalities of mitochondrial ultrastructure, distribution or of respiratory chain enzyme complexes I-IV in skeletal muscle were observed. Mitochondrial disorders with clinical features overlapping more than one syndrome have been reported previously. This case further demonstrates the difficulty in correlating observed clinical features with a specific mitochondrial DNA mutation.

  16. Mitochondrial myopathy associated with high levels of mitochondrial DNA harboring a 260 bp tandem duplication in the D-loop region

    Energy Technology Data Exchange (ETDEWEB)

    Manfredi, G.; Shanske, S.; Schon, E.A. [Columbia Univ., NY (United States)] [and others

    1994-09-01

    Low levels of a 260 bp duplication in the D-loop of the mitochondrial DNA (mtDNA) were reported in some patients with mitochondrial disorders harboring large-scale mtDNA deletions. Because the same duplication was observed in unaffected mothers of these patients, it was suggested that the 260 bp duplication predispose mtDNA to deletion. More recently, PCR-levels of this duplication were also observed in a subgroup of normal Caucasions. To test the hypothesis that this genetic abnormality may be prevalent in patients with large-scale deletions of the mitochondrial genome, we used a semi-quantitative PCR protocol to search for the 260 by duplication in 34 patients with, and 35 without mtDNA deletions. Our results do not support the hypothesis that the 260 bp duplication precedes large-scale deletions of mtDNA. They suggest, however, that the duplication may be pathogenic per se, if its level reaches a specific threshold. We are presently trying to test this hypothesis, as well as the stability of the duplication, in a cell culture system.

  17. Non Random Distribution of DMD Deletion Breakpoints and Implication of Double Strand Breaks Repair and Replication Error Repair Mechanisms.

    Science.gov (United States)

    Marey, Isabelle; Ben Yaou, Rabah; Deburgrave, Nathalie; Vasson, Aurélie; Nectoux, Juliette; Leturcq, France; Eymard, Bruno; Laforet, Pascal; Behin, Anthony; Stojkovic, Tanya; Mayer, Michèle; Tiffreau, Vincent; Desguerre, Isabelle; Boyer, François Constant; Nadaj-Pakleza, Aleksandra; Ferrer, Xavier; Wahbi, Karim; Becane, Henri-Marc; Claustres, Mireille; Chelly, Jamel; Cossee, Mireille

    2016-05-27

    Dystrophinopathies are mostly caused by copy number variations, especially deletions, in the dystrophin gene (DMD). Despite the large size of the gene, deletions do not occur randomly but mainly in two hot spots, the main one involving exons 45 to 55. The underlying mechanisms are complex and implicate two main mechanisms: Non-homologous end joining (NHEJ) and micro-homology mediated replication-dependent recombination (MMRDR). Our goals were to assess the distribution of intronic breakpoints (BPs) in the genomic sequence of the main hot spot of deletions within DMD gene and to search for specific sequences at or near to BPs that might promote BP occurrence or be associated with DNA break repair. Using comparative genomic hybridization microarray, 57 deletions within the intron 44 to 55 region were mapped. Moreover, 21 junction fragments were sequenced to search for specific sequences. Non-randomly distributed BPs were found in introns 44, 47, 48, 49 and 53 and 50% of BPs clustered within genomic regions of less than 700bp. Repeated elements (REs), known to promote gene rearrangement via several mechanisms, were present in the vicinity of 90% of clustered BPs and less frequently (72%) close to scattered BPs, illustrating the important role of such elements in the occurrence of DMD deletions. Palindromic and TTTAAA sequences, which also promote DNA instability, were identified at fragment junctions in 20% and 5% of cases, respectively. Micro-homologies (76%) and insertions or deletions of small sequences were frequently found at BP junctions. Our results illustrate, in a large series of patients, the important role of RE and other genomic features in DNA breaks, and the involvement of different mechanisms in DMD gene deletions: Mainly replication error repair mechanisms, but also NHEJ and potentially aberrant firing of replication origins. A combination of these mechanisms may also be possible.

  18. Exon deletions and intragenic insertions are not rare in ataxia with oculomotor apraxia 2

    Directory of Open Access Journals (Sweden)

    Kreuz Friedmar

    2009-09-01

    Full Text Available Abstract Background The autosomal recessively inherited ataxia with oculomotor apraxia 2 (AOA2 is a neurodegenerative disorder characterized by juvenile or adolescent age of onset, gait ataxia, cerebellar atrophy, axonal sensorimotor neuropathy, oculomotor apraxia, and elevated serum AFP levels. AOA2 is caused by mutations within the senataxin gene (SETX. The majority of known mutations are nonsense, missense, and splice site mutations, as well as small deletions and insertions. Methods To detect mutations in patients showing a clinical phenotype consistent with AOA2, the coding region including splice sites of the SETX gene was sequenced and dosage analyses for all exons were performed on genomic DNA. The sequence of cDNA fragments of alternative transcripts isolated after RT-PCR was determined. Results Sequence analyses of the SETX gene in four patients revealed a heterozygous nonsense mutation or a 4 bp deletion in three cases. In another patient, PCR amplification of exon 11 to 15 dropped out. Dosage analyses and breakpoint localisation yielded a 1.3 kb LINE1 insertion in exon 12 (patient P1 and a 6.1 kb deletion between intron 11 and intron 14 (patient P2 in addition to the heterozygous nonsense mutation R1606X. Patient P3 was compound heterozygous for a 4 bp deletion in exon 10 and a 20.7 kb deletion between intron 10 and 15. This deletion was present in a homozygous state in patient P4. Conclusion Our findings indicate that gross mutations seem to be a frequent cause of AOA2 and reveal the importance of additional copy number analysis for routine diagnostics.

  19. Plk1-mediated stabilization of 53BP1 through USP7 regulates centrosome positioning to maintain bipolarity.

    Science.gov (United States)

    Yim, H; Shin, S-B; Woo, S U; Lee, P C-W; Erikson, R L

    2017-02-16

    Although 53BP1 has been established well as a mediator in DNA damage response, its function in mitosis is not clearly understood. We found that 53BP1 is a mitotic-binding partner of the kinases Plk1 and AuroraA, and that the binding with Plk1 increases the stability of 53BP1 by accelerating its interaction with the deubiquitinase USP7. Depletion of 53BP1 induces mitotic defects such as chromosomal missegregation, misorientation of spindle poles and the generation of extra centrosomes, which is similar phenotype to USP7-knockdown cells. In addition, 53BP1 depletion reduces the levels of p53 and centromere protein F (CENPF), interacting proteins of 53BP1. These phenotypes induced by 53BP1 depletion were rescued by expression of wild-type or phosphomimic mutant 53BP1 but not by expression of a dephosphomimic mutant. We propose that phosphorylation of 53BP1 at S380 accelerates complex formation with USP7 and CENPF to regulate their stability, thus having a crucial role in proper centrosome positioning, chromosomal alignment, and centrosome number.

  20. Alpha thalassemia deletions found in suspected cases of beta thalassemia major in Pakistani population.

    Science.gov (United States)

    Shahid, Saba; Nadeem, Muhammad; Zahid, Danish; Hassan, Jawad; Ansari, Saqib; Shamsi, Tahir

    2017-01-01

    Alpha (α) thalassemia is a hereditary disorder and is caused by deletions or mutations in globin genes. It is present in two clinically significant forms: hemoglobin Bart hydrops fetalis (Hb Bart) syndrome and hemoglobin H (HbH) disease. It is highly prevalent in South-East Asia or Mediterranean countries. The most common deletion reported in alpha thalassemia in Pakistani population was -α3.7 with a frequency of 8.3%, and the rare forms were -α4.2 (0.2%) and αααanti3.7 (0.9%). In our study, diagnosis of severe anemia cases without any α and β mutations or deletions were made by using extended alpha thalassemia deletions panel. The main objective of this study was to determine the prevalence and to study the spectra of alpha thalassemia gene deletions in beta thalassemia patients with the use of an extended panel including --SEA, --FIL, --MED, --20.5, --THAI in addition to -α3.7, -α4.2 & -αααanti3.7. The samples were collected in ethylenediaminetetraacetic acid (EDTA) vacutainers. A total of 156 samples were analyzed for alpha thalassemia mutations. This cohort included 121 samples of beta thalassemia major, nine samples of beta thalassemia minor and 26 without any evidence of beta thalassemia mutations. DNA was extracted with Qiagen extraction kit. The primers for determination of different subsets of alpha thalassemia deletions were included. PCR amplification was performed and result interpreted on agarose gel. Co-inheritance of alpha thalassemia (-α3.7, -α4.2) with homozygous beta thalassemia was detected in 30% cases of studied cohort (37 out of 121). The most common found was -α3.7 deletion (35/37) as single/double deletions or in combination with -αααanti3.7. In undiagnosed cases screened for beta thalassemia major, we found Mediterranean (-αMED) deletion at specifically 875 bp on agarose gel. This is distinctive finding in case of detecting -αMED instead of any other deletion from Pakistan. Alpha thalassemia deletions (-α3.7, -α4

  1. IGF2BP3 Modulates the Interaction of Invasion-Associated Transcripts with RISC

    Directory of Open Access Journals (Sweden)

    Hanane Ennajdaoui

    2016-05-01

    Full Text Available Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3 expression correlates with malignancy, but its role(s in pathogenesis remains enigmatic. We interrogated the IGF2BP3-RNA interaction network in pancreatic ductal adenocarcinoma (PDAC cells. Using a combination of genome-wide approaches, we have identified 164 direct mRNA targets of IGF2BP3. These transcripts encode proteins enriched for functions such as cell migration, proliferation, and adhesion. Loss of IGF2BP3 reduced PDAC cell invasiveness and remodeled focal adhesion junctions. Individual nucleotide resolution crosslinking immunoprecipitation (iCLIP revealed significant overlap of IGF2BP3 and microRNA (miRNA binding sites. IGF2BP3 promotes association of the RNA-induced silencing complex (RISC with specific transcripts. Our results show that IGF2BP3 influences a malignancy-associated RNA regulon by modulating miRNA-mRNA interactions.

  2. Role of phosphatase and tensin homolog deleted on chromosome ten in a rat model of carbon tetrachloride-induced liver fibrosis and the effect of qi-tonifying and blood-activating prescription

    Directory of Open Access Journals (Sweden)

    NIU Xuemin

    2018-01-01

    Full Text Available Objective To investigate the role of phosphatase and tensin homology deleted on chromosome ten (PTEN in a rat model of carbon tetrachloride (CCl4-induced liver fibrosis and the molecular mechanism of action of qi-tonifying and blood-activating prescription in regulating PTEN and inhibiting liver fibrosis. Methods A total of 27 male Wistar rats were randomly divided into three groups, with 9 rats in each group. The rats in liver fibrosis group were treated with CCl4 to establish a model of liver fibrosis, and those in qi-tonifying and blood-activating prescription group were also treated with CCl4 to establish a model and then given a self-made qi-tonifying and blood-activating prescription containing Astragalus membranaceus, Salvia miltiorrhiza, and poria. The rats in the control group were given intraperitoneally injected olive oil. HE staining, Masson staining, and immunohistochemical staining of collagen type I alpha 1 (Col1A1 and collagen type Ⅳ (Col4 were performed to observe the degree of liver fibrosis and collagen deposition; qRT-PCR, immunohistochemistry, and Western blot were used to measure the expression of transforming growth factor-β1 (TGF-β1, PTEN, and downstream genes AKT, mTOR, and p70S6K. A one-way analysis of variance was used for comparison of continuous data between multiple groups and the least significant difference t-test was used for further comparison between any two groups. Results In the liver fibrosis group, liver pathology showed perisinusoidal fibrosis and fibrous tissue proliferation, collagen deposition, and formation of fibrous septum in the portal area; compared with the control group, the liver fibrosis group had significant increases in the mRNA and protein expression of TGF-β1, a significant reduction in the expression of PTEN, and significant increases in the mRNA and phosphorylated protein expression of AKT, mTOR, and p70S6K (all P<0.01. The qi-tonifying and blood-activating prescription group had a

  3. A Deletion in the Canine POMC Gene Is Associated with Weight and Appetite in Obesity-Prone Labrador Retriever Dogs.

    Science.gov (United States)

    Raffan, Eleanor; Dennis, Rowena J; O'Donovan, Conor J; Becker, Julia M; Scott, Robert A; Smith, Stephen P; Withers, David J; Wood, Claire J; Conci, Elena; Clements, Dylan N; Summers, Kim M; German, Alexander J; Mellersh, Cathryn S; Arendt, Maja L; Iyemere, Valentine P; Withers, Elaine; Söder, Josefin; Wernersson, Sara; Andersson, Göran; Lindblad-Toh, Kerstin; Yeo, Giles S H; O'Rahilly, Stephen

    2016-05-10

    Sequencing of candidate genes for obesity in Labrador retriever dogs identified a 14 bp deletion in pro-opiomelanocortin (POMC) with an allele frequency of 12%. The deletion disrupts the β-MSH and β-endorphin coding sequences and is associated with body weight (per allele effect of 0.33 SD), adiposity, and greater food motivation. Among other dog breeds, the deletion was only found in the closely related flat-coat retriever (FCR), where it is similarly associated with body weight and food motivation. The mutation is significantly more common in Labrador retrievers selected to become assistance dogs than pets. In conclusion, the deletion in POMC is a significant modifier of weight and appetite in Labrador retrievers and FCRs and may influence other behavioral traits. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Confirmation that a deletion in the POMC gene is associated with body weight of Labrador Retriever dogs.

    Science.gov (United States)

    Mankowska, M; Krzeminska, P; Graczyk, M; Switonski, M

    2017-06-01

    A 14-bp deletion present in the proopiomelanocortin (POMC) gene of Labrador and Flat Coat Retrievers (FCR), but absent in POMC of other breeds, disrupts the β-MSH and β-endorphin coding sequences. This deletion was recently reported as strongly associated with increased body weight and obesity. We searched for this mutation in a cohort of 272 dogs, representing four breeds with a known predisposition to obesity (Labrador and Golden Retrievers, Beagle, and Cocker Spaniel) and, as expected, we found it only in Labradors. Further, we confirmed the association between the deletion variant and body weight of Labradors but not with a 5-point body condition score (BCS). We suspect that the deletion variant in our cohort may act as a recessive allele, unlike the previous study, which suggested its additive effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Improving the MVA vaccine potential by deleting the viral gene coding for the IL-18 binding protein.

    Directory of Open Access Journals (Sweden)

    Juliana Falivene

    Full Text Available BACKGROUND: Modified Vaccinia Ankara (MVA is an attenuated strain of Vaccinia virus (VACV currently employed in many clinical trials against HIV/AIDS and other diseases. MVA still retains genes involved in host immune response evasion, enabling its optimization by removing some of them. The aim of this study was to evaluate cellular immune responses (CIR induced by an IL-18 binding protein gene (C12L deleted vector (MVAΔC12L. METHODOLOGY/PRINCIPAL FINDINGS: BALB/c and C57BL/6 mice were immunized with different doses of MVAΔC12L or MVA wild type (MVAwt, then CIR to VACV epitopes in immunogenic proteins were evaluated in spleen and draining lymph nodes at acute and memory phases (7 and 40 days post-immunization respectively. Compared with parental MVAwt, MVAΔC12L immunization induced a significant increase of two to three-fold in CD8(+ and CD4(+ T-cell responses to different VACV epitopes, with increased percentage of anti-VACV cytotoxic CD8(+ T-cells (CD107a/b(+ during the acute phase of the response. Importantly, the immunogenicity enhancement was also observed after MVAΔC12L inoculation with different viral doses and by distinct routes (systemic and mucosal. Potentiation of MVA's CIR was also observed during the memory phase, in correlation with a higher protection against an intranasal challenge with VACV WR. Of note, we could also show a significant increase in the CIR against HIV antigens such as Env, Gag, Pol and Nef from different subtypes expressed from two recombinants of MVAΔC12L during heterologous DNA prime/MVA boost vaccination regimens. CONCLUSIONS/SIGNIFICANCE: This study demonstrates the relevance of IL-18 bp contribution in the immune response evasion during MVA infection. Our findings clearly show that the deletion of the viral IL-18 bp gene is an effective approach to increase MVA vaccine efficacy, as immunogenicity improvements were observed against vector antigens and more importantly to HIV antigens.

  6. The Functional Role of TopBP1 in DNA Maintenance at Mitosis

    DEFF Research Database (Denmark)

    Pedersen, Rune Troelsgaard

    . This active processing was found to be an underlying mechanism of CFS expression. A final advance was the description of how DNA damage, arising as a consequence of replication stress in S-phase, was shielded in 53BP1 nuclear bodies (NBs), preventing untimely DNA repair during the subsequent G1-phase. We...... of active DNA synthesis at the G2/M transition where TopBP1 promotes DNA synthesis. (ii) TopBP1 colocalizes with the scaffold protein and structure-selective nuclease subunit SLX4, and is required for SLX4 recruitment to chromatin in mitosis. Depletion of TopBP1 at mitosis greatly induces formation...... of unreplicated DNA and DNA-repair intermediates. These loci can manifest themselves as breaks and gaps on metaphase chromosomes, which often coincide with specific chromosome loci termed common fragile sites (CFSs). Additionally, underreplicated loci function as physical links between sister chromatids, which...

  7. Based on BP Neural Network Stock Prediction

    Science.gov (United States)

    Liu, Xiangwei; Ma, Xin

    2012-01-01

    The stock market has a high profit and high risk features, on the stock market analysis and prediction research has been paid attention to by people. Stock price trend is a complex nonlinear function, so the price has certain predictability. This article mainly with improved BP neural network (BPNN) to set up the stock market prediction model, and…

  8. 2000 Johnston Site 2B-P

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Underwater Site 2B-P was established at Johnston Atoll by Dr. James Maragos, U.S. Fish & Wildlife Service, on June 30, 2000. With a start point (meter 0) at...

  9. 2000 Johnston Site 1B-P

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Underwater Site 1B-P was established at Johnston Atoll by Dr. James Maragos, U.S. Fish & Wildlife Service, on June 29, 2000. With a start point (meter 0) at...

  10. 2000 Johnston Site 3B-P

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Underwater Site 3B-P was established at Johnston Atoll by Dr. James Maragos, U.S. Fish & Wildlife Service, on July 3, 2000. With a start point (meter 0) at...

  11. AcEST: BP917025 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000094_H07 471 Adiantum capillus-veneris mRNA. clone: YMU001_000094_H07. BP917025 - Show BP917025...is mRNA. clone: YMU001_000094_H07. Accession BP917025 Tissue type prothallium Developmental stage - Contig I... programs, Nucleic Acids Res. 25:3389-3402. Query= BP917025|Adiantum capillus-ven...ation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917025

  12. AcEST: BP919150 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000121_G08 485 Adiantum capillus-veneris mRNA. clone: YMU001_000121_G08. BP919150 - Show BP91...is mRNA. clone: YMU001_000121_G08. Accession BP919150 Tissue type prothallium Developmental stage - Contig I...n of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91... of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91

  13. AcEST: BP919955 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000131_B09 462 Adiantum capillus-veneris mRNA. clone: YMU001_000131_B09. BP919955 - Show BP91995...is mRNA. clone: YMU001_000131_B09. Accession BP919955 Tissue type prothallium Developmental stage - Contig I...search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919955|Adiantum capill... new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91995

  14. AcEST: BP918406 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_B06 468 Adiantum capillus-veneris mRNA. clone: YMU001_000113_B06. BP918406 - Show BP9184...is mRNA. clone: YMU001_000113_B06. Accession BP918406 Tissue type prothallium Developmental stage - Contig I...programs, Nucleic Acids Res. 25:3389-3402. Query= BP918406|Adiantum capillus-vene...ams, Nucleic Acids Res. 25:3389-3402. Query= BP918406|Adiantum capillus-veneris m

  15. AcEST: BP911840 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000009_G07 495 Adiantum capillus-veneris mRNA. clone: YMU001_000009_G07. BP911840 - Show BP91184...is mRNA. clone: YMU001_000009_G07. Accession BP911840 Tissue type prothallium Developmental stage - Contig I...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91184...earch programs, Nucleic Acids Res. 25:3389-3402. Query= BP911840|Adiantum capillu

  16. AcEST: BP920154 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_F09 487 Adiantum capillus-veneris mRNA. clone: YMU001_000133_F09. BP920154 - Show BP92015...is mRNA. clone: YMU001_000133_F09. Accession BP920154 Tissue type prothallium Developmental stage - Contig I...n database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920154|Adia...abase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920154|Adiantum

  17. AcEST: BP920186 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000134_A11 504 Adiantum capillus-veneris mRNA. clone: YMU001_000134_A11. BP920186 - Show BP92018...is mRNA. clone: YMU001_000134_A11. Accession BP920186 Tissue type prothallium Developmental stage - Contig I...ew generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92018...atabase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920186|Adiantu

  18. AcEST: BP918011 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000108_E11 519 Adiantum capillus-veneris mRNA. clone: YMU001_000108_E11. BP918011 - Show BP91801...is mRNA. clone: YMU001_000108_E11. Accession BP918011 Tissue type prothallium Developmental stage - Contig I...database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918011|Adiant...se search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918011|Adiantum cap

  19. AcEST: BP919841 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000129_G06 496 Adiantum capillus-veneris mRNA. clone: YMU001_000129_G06. BP919841 - Show BP91984...is mRNA. clone: YMU001_000129_G06. Accession BP919841 Tissue type prothallium Developmental stage - Contig I...ase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919841|Adiantum ca...e search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919841|Adiantum capi

  20. AcEST: BP919856 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_A02 514 Adiantum capillus-veneris mRNA. clone: YMU001_000130_A02. BP919856 - Show BP91985...is mRNA. clone: YMU001_000130_A02. Accession BP919856 Tissue type prothallium Developmental stage - Contig I...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91985... generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919856|Adiantum c

  1. AcEST: BP914001 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000038_G04 493 Adiantum capillus-veneris mRNA. clone: YMU001_000038_G04. BP914001 - Show BP91400...is mRNA. clone: YMU001_000038_G04. Accession BP914001 Tissue type prothallium Developmental stage - Contig I...otein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914001|...ic Acids Res. 25:3389-3402. Query= BP914001|Adiantum capillus-veneris mRNA, clone

  2. Oral Administration of Lactobacillus rhamnosus GG Ameliorates Salmonella Infantis-Induced Inflammation in a Pig Model via Activation of the IL-22BP/IL-22/STAT3 Pathway.

    Science.gov (United States)

    Yang, Gui-Yan; Yu, Jiao; Su, Jin-Hui; Jiao, Lian-Guo; Liu, Xiao; Zhu, Yao-Hong

    2017-01-01

    The high rate of Salmonella enterica serovar Infantis (S. Infantis) infection poses significant risk for the development of non-typhoidal Salmonella gastroenteritis. However, efficient strategies to prevent or treat the infection remain elusive. Here, we explored the effect of the probiotic Lactobacillus rhamnosus GG (LGG) administration in preventing S. Infantis infection in a pig model. Probiotic LGG (1.0 × 10(10) CFU/day) was orally administered to newly weaned piglets for 1 week before S. Infantis challenge. LGG pretreatment reduced the severity of diarrhea and alleviated intestinal inflammation caused by S. Infantis. Pre-administration of LGG excluded Salmonella from colonization of the jejunal mucosa but increased the abundance of Bifidobacterium in the feces. LGG promoted the expansion of CD4(+) T-bet(+) IFNγ(+) T cells but attenuated S. Infantis-induced increases in the percentage of CD4(+) IFNγ(+) T cells and serum interleukin (IL)-22 levels in peripheral blood after S. Infantis challenge. In the small intestine, LGG pretreatment upregulated expression of the transcription factor T-bet but downregulated the S. Infantis-induced increase of CD4(+) IFNγ(+) T cells in Peyer's patches and IL-7Rα expression in the jejunum. Notably, LGG-treated pigs had enhanced expression of IL-22 and activated STAT3 in the ileum in response to S. Infantis infection. Pretreatment of pigs with LGG also elevated intestinal IL-22-binding protein production in response to S. Infantis challenge. In contrast, LGG consumption reduced the S. Infantis-induced increase in the number of CCL20-expressing cells in the jejunum. Our results suggest that the mechanism by which LGG ameliorates the intestinal inflammation caused by S. Infantis involves the upregulation of T-bet, activation of STAT3, and downregulation of CCL20.

  3. Phosphorylation of CtBP1 by cAMP-dependent Protein Kinase Modulates Induction of CYP17 by Stimulating Partnering of CtBP1 and 2*s

    Science.gov (United States)

    Dammer, Eric B.; Sewer, Marion B.

    2009-01-01

    In the human adrenal cortex, the peptide hormone adrenocorticotropin (ACTH) directs cortisol and adrenal androgen biosynthesis by activating a cAMP/cAMP-dependent protein kinase (PKA) pathway. Carboxyl-terminal binding protein 1 (CtBP1) is a corepressor that regulates transcription of the CYP17 gene by periodically interacting with steroidogenic factor-1 in response to ACTH signaling. Given that CtBP1 function is regulated by NADH binding, we hypothesized that ACTH-stimulated changes in cellular pyridine nucleotide concentrations modulate the ability of CtBP1 to repress CYP17 transcription. Further, we postulated that PKA evokes changes in the phosphorylation status of CtBP1 that control the ability of the protein to bind to steroidogenic factor-1 and the coactivator GCN5 (general control nonderepressed 5) and repress CYP17 gene expression. We show that ACTH alters pyridine nucleotide redox state and identify amino acid residues in CtBP1 that are targeted by PKA and PAK6. Both ACTH/cAMP signaling and NADH/NAD+ ratio stimulate nuclear-cytoplasmic oscillation of both CtBP proteins. We provide evidence that PKA 1) induces metabolic changes in the adrenal cortex and 2) phosphorylates CtBP proteins, particularly CtBP1 at T144, resulting in CtBP protein partnering and ACTH-dependent CYP17 transcription. PMID:18184656

  4. Identical mitochondrial DNA deletion in a woman with ocular myopathy and in her son with pearson syndrome.

    Science.gov (United States)

    Shanske, Sara; Tang, Yingying; Hirano, Michio; Nishigaki, Yutaka; Tanji, Kurenai; Bonilla, Eduardo; Sue, Carolyn; Krishna, Sindu; Carlo, Jose R; Willner, Judith; Schon, Eric A; DiMauro, Salvatore

    2002-09-01

    Single deletions of mitochondrial DNA (mtDNA) are associated with three major clinical conditions: Kearns-Sayre syndrome, a multisystem disorder; Pearson syndrome (PS), a disorder of the hematopoietic system; and progressive external ophthalmoplegia (PEO), primarily affecting the ocular muscles. Typically, single mtDNA deletions are sporadic events, since the mothers, siblings, and offspring of affected individuals are unaffected. We studied a woman who presented with PEO, ptosis, and weakness of pharyngeal, facial, neck, and limb muscles. She had two unaffected children, but another of her children, an infant son, had sideroblastic anemia, was diagnosed with PS, and died at age 1 year. Morphological analysis of a muscle biopsy sample from the mother showed cytochrome c oxidase-negative ragged-red fibers-a typical pattern in patients with mtDNA deletions. Southern blot analysis using multiple restriction endonucleases and probed with multiple mtDNA fragments showed that both the mother and her infant son harbored an identical 5,355-bp single deletion in mtDNA, without flanking direct repeats. The deletion was the only abnormal species of mtDNA identified in both patients, and there was no evidence for duplications. We conclude that, although the vast majority of single large-scale deletions in mtDNA are sporadic, in rare cases, single deletions can be transmitted through the germline.

  5. TopBP1 is required at mitosis to reduce transmission of DNA damage to G1 daughter cells

    Science.gov (United States)

    Pedersen, Rune Troelsgaard; Kruse, Thomas; Nilsson, Jakob

    2015-01-01

    Genome integrity is critically dependent on timely DNA replication and accurate chromosome segregation. Replication stress delays replication into G2/M, which in turn impairs proper chromosome segregation and inflicts DNA damage on the daughter cells. Here we show that TopBP1 forms foci upon mitotic entry. In early mitosis, TopBP1 marks sites of and promotes unscheduled DNA synthesis. Moreover, TopBP1 is required for focus formation of the structure-selective nuclease and scaffold protein SLX4 in mitosis. Persistent TopBP1 foci transition into 53BP1 nuclear bodies (NBs) in G1 and precise temporal depletion of TopBP1 just before mitotic entry induced formation of 53BP1 NBs in the next cell cycle, showing that TopBP1 acts to reduce transmission of DNA damage to G1 daughter cells. Based on these results, we propose that TopBP1 maintains genome integrity in mitosis by controlling chromatin recruitment of SLX4 and by facilitating unscheduled DNA synthesis. PMID:26283799

  6. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    Energy Technology Data Exchange (ETDEWEB)

    Solera, J. (Unidades de Genetica Molecular, Madrid (Spain)); Magallon, M.; Martin-Villar, J. (Hemofilia Hospital, Madrid (Spain)); Coloma, A. (Departamento deBioquimica de la Facultad de Medicina de la Universidad Autonoma, Madrid (Spain))

    1992-02-01

    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment.

  7. Novel deletions in MYH7 and MYBPC3 identified in Indian families with familial hypertrophic cardiomyopathy.

    Science.gov (United States)

    Waldmüller, Stephan; Sakthivel, Sadayappan; Saadi, Abdul Vahab; Selignow, Carmen; Rakesh, Pareppally Gopal; Golubenko, Maria; Joseph, Pulavelli Kurian; Padmakumar, Ramachandran; Richard, Pascale; Schwartz, Ketty; Tharakan, Jagan Mohan; Rajamanickam, Chellam; Vosberg, Hans Peter

    2003-06-01

    Mutations causing familial hypertrophic cardiomyopathy (HCM) have been described in at least 11 genes encoding cardiac sarcomeric proteins. In this study, three previously unknown deletions have been identified in the human cardiac genes coding for beta-myosin heavy chain (MYH7 on chromosome 14) and myosin-binding protein-C (MYBPC3 on chromosome 11). In family MM, a 3-bp deletion in MYH7 was detected to be associated with loss of glutamic acid in position 927 (DeltaE927) of the myosin rod. In two other families (HH and NP, related by a common founder) a 2-bp loss in codon 453 (exon 16) of MYBPC3 was identified as the presumable cause of a translation reading frame shift. Taken together 15 living mutation carriers were investigated. Six deceased family members (with five cases of premature sudden cardiac death (SCD) in families MM and NP) were either obligate or suspected mutation carriers. In addition to these mutations a 25-bp deletion in intron 32 of MYBPC3 was identified in family MM (five carriers) and in a fourth family (MiR, one HCM patient, three deletion carriers). In agreement with the loss of the regular splicing branch point in the altered intron 32, a splicing deficiency was observed in an exon trapping experiment using MYBPC3 exon 33 as a test substrate. Varying disease profiles assessed using standard clinical, ECG and echocardiographic procedures in conjunction with mutation analysis led to the following conclusions: (1) In family MM the DeltaE927 deletion in MYH7 was assumed to be associated with complete penetrance. Two cases of reported SCD might have been related to this mutation. (2) The two families, HH and NP, distantly related by a common founder, and both suffering from a 2-bp deletion in exon 16 of MYBPC3 differed in their average phenotypes. In family NP, four cases of cardiac death were documented, whereas no cardiac-related death was reported from family HH. These results support the notion that mutations in HCM genes may directly

  8. The first Dutch SDHB founder deletion in paraganglioma – pheochromocytoma patients

    Directory of Open Access Journals (Sweden)

    Devilee Peter

    2009-04-01

    Full Text Available Abstract Background Germline mutations of the tumor suppressor genes SDHB, SDHC and SDHD play a major role in hereditary paraganglioma and pheochromocytoma. These three genes encode subunits of succinate dehydrogenase (SDH, the mitochondrial tricarboxylic acid cycle enzyme and complex II component of the electron transport chain. The majority of variants of the SDH genes are missense and nonsense mutations. To date few large deletions of the SDH genes have been described. Methods We carried out gene deletion scanning using MLPA in 126 patients negative for point mutations in the SDH genes. We then proceeded to the molecular characterization of deletions, mapping breakpoints in each patient and used haplotype analysis to determine whether the deletions are due to a mutation hotspot or if a common haplotype indicated a single founder mutation. Results A novel deletion of exon 3 of the SDHB gene was identified in nine apparently unrelated Dutch patients. An identical 7905 bp deletion, c.201-4429_287-933del, was found in all patients, resulting in a frameshift and a predicted truncated protein, p.Cys68HisfsX21. Haplotype analysis demonstrated a common haplotype at the SDHB locus. Index patients presented with pheochromocytoma, extra-adrenal PGL and HN-PGL. A lack of family history was seen in seven of the nine cases. Conclusion The identical exon 3 deletions and common haplotype in nine patients indicates that this mutation is the first Dutch SDHB founder mutation. The predominantly non-familial presentation of these patients strongly suggests reduced penetrance. In this small series HN-PGL occurs as frequently as pheochromocytoma and extra-adrenal PGL.

  9. Bullous Pemphigoid Induced by Vildagliptin

    OpenAIRE

    Bengür Taşkıran Bahattin; Erdoğan Canan Solak; Şişman Güven; Barış Cansu

    2016-01-01

    Bullous pemphigoid (BP) is an uncommon chronic, autoimmune, and subepidermal disease. Tense blisters occur on normal or erythematous skin. It can be induced by medications. There is a number of reports on BP induced by dipeptidyl peptidase 4 (DPP-4) inhibitors (vildagliptin, sitagliptin, saxagliptin). DPP-4 (CD26), present as a cell surface molecule on immune cells, also plays an important costimulatory role in immune activation. BP more commonly affects elderly men. We present a case of BP i...

  10. 1p36 deletion syndrome: an update

    Directory of Open Access Journals (Sweden)

    Jordan VK

    2015-08-01

    Full Text Available Valerie K Jordan,1 Hitisha P Zaveri,2 Daryl A Scott1,2 1Department of Molecular Physiology and Biophysics, Baylor College of Medicine, Houston, TX, USA; 2Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA Abstract: Deletions of chromosome 1p36 affect approximately 1 in 5,000 newborns and are the most common terminal deletions in humans. Medical problems commonly caused by terminal deletions of 1p36 include developmental delay, intellectual disability, seizures, vision problems, hearing loss, short stature, distinctive facial features, brain anomalies, orofacial clefting, congenital heart defects, cardiomyopathy, and renal anomalies. Although 1p36 deletion syndrome is considered clinically recognizable, there is significant phenotypic variation among affected individuals. This variation is due, at least in part, to the genetic heterogeneity seen in 1p36 deletions which include terminal and interstitial deletions of varying lengths located throughout the 30 Mb of DNA that comprise chromosome 1p36. Array-based copy number variant analysis can easily identify genomic regions of 1p36 that are deleted in an affected individual. However, predicting the phenotype of an individual based solely on the location and extent of their 1p36 deletion remains a challenge since most of the genes that contribute to 1p36-related phenotypes have yet to be identified. In addition, haploinsufficiency of more than one gene may contribute to some phenotypes. In this article, we review recent successes in the effort to map and identify the genes and genomic regions that contribute to specific 1p36-related phenotypes. In particular, we highlight evidence implicating MMP23B, GABRD, SKI, PRDM16, KCNAB2, RERE, UBE4B, CASZ1, PDPN, SPEN, ECE1, HSPG2, and LUZP1 in various 1p36 deletion phenotypes. Keywords: chromosome 1p36, chromosome deletion, 1p36 deletion syndrome, monosomy 1p36

  11. Coat protein deletion mutants elicit more severe symptoms than wild-type virus in multiple cereal hosts

    Science.gov (United States)

    The coat protein (CP) of Wheat streak mosaic virus (WSMV; genus Tritimovirus, family Potyviridae) tolerates deletion of amino acids 36 to 84 for efficient systemic infection of wheat. This study demonstrates that deletion of CP amino acids 58 to 84, but not 36 to 57, from WSMV genome induced severe ...

  12. Parental somatic and germ-line mosaicism for a multiexon deletion with unusual endpoints in a type III collagen (COL3Al) allele produces ehlers-danlos syndrome type IV in the heterozygous offspring

    Energy Technology Data Exchange (ETDEWEB)

    McGookey Milewicz, D.; Witz, A.M.; Byers, P.H. (Univ of Washington, Seattle (United States)); Smith, A.C.M.; Manchester, D.K.; Waldstein, G. (Children' s Hospital, Denver, CO (United States))

    1993-07-01

    Ehlers-Danlos syndrome (EDS) type IV is a dominantly inherited disorder that results from mutation in the type III collagen gene (COL3A1). The authors studied the structure of the COL3A1 gene of an individual with EDS type IV and that of her phenotypically normal parents. The proband was heterozygous for a 2-kb deletion in COL3A1, while her father was mosaic for the same deletion in somatic and germ cells. In fibroblasts from the father, approximately two-fifths of the COL3A1 alleles carried the deletion, but only 10% of the COL3A1 alleles in white blood cells were of the mutant species. The deletion in the mutant allele extended from intron 7 into intron 11. There was a 12-bp direct repeat in intron 7 and intron 11, the latter about 60 bp 5' to the junction. At the breakpoint there was a duplication of 10 bp from intron 11 separated by an insertion of 4 bp contained within the duplicated sequence. The father was mosaic for the deletion so that the gene rearrangement occurred during his early embryonic development prior to lineage allocation. These findings suggest that at least some of the deletions seen in human genes may occur during replication, rather than as a consequence of meiotic crossing-over, and that they thus have a risk for recurrence when observed de novo. 71 refs., 4 figs., 2 tabs.

  13. Tyrosine phosphorylation of 3BP2 is indispensable for the interaction with VAV3 in chicken DT40 cells

    Energy Technology Data Exchange (ETDEWEB)

    Chihara, Kazuyasu [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Organization for Life Science Advancement Programs, University of Fukui, Fukui 910-1193 (Japan); Kimura, Yukihiro [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Division of Otorhinolaryngology Head and Neck Surgery, Department of Sensory and Locomotor Medicine, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Honjoh, Chisato [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Third Department of Internal Medicine, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Yamauchi, Shota; Takeuchi, Kenji [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Organization for Life Science Advancement Programs, University of Fukui, Fukui 910-1193 (Japan); Sada, Kiyonao, E-mail: ksada@u-fukui.ac.jp [Division of Genome Science and Microbiology, Department of Pathological Sciences, Faculty of Medical Sciences, Fukui 910-1193 (Japan); Organization for Life Science Advancement Programs, University of Fukui, Fukui 910-1193 (Japan)

    2014-03-10

    Adaptor protein c-Abl SH3 domain-binding protein-2 (3BP2) is known to play regulatory roles in immunoreceptor-mediated signal transduction. We have previously demonstrated that Tyr{sup 174}, Tyr{sup 183} and Tyr{sup 446} in mouse 3BP2 are predominantly phosphorylated by Syk, and the phosphorylation of Tyr{sup 183} and the Src homology 2 (SH2) domain of mouse 3BP2 are critical for B cell receptor (BCR)-induced activation of nuclear factor of activated T cells (NFAT) in human B cells. In this report, we have shown that Syk, but not Abl family protein-tyrosine kinases, is critical for BCR-mediated tyrosine phosphorylation of 3BP2 in chicken DT40 cells. Mutational analysis showed that Tyr{sup 174}, Tyr{sup 183} and Tyr{sup 426} of chicken 3BP2 are the major phosphorylation sites by Syk and the SH2 domain of 3BP2 is critical for tyrosine phosphorylation. In addition, phosphorylation of Tyr{sup 426} is required for the inducible interaction with the SH2 domain of Vav3. Moreover, the expression of the mutant form of 3BP2 in which Tyr{sup 426} was substituted to Phe resulted in the reduction in BCR-mediated Rac1 activation, when compared with the case of wild-type. Altogether, these data suggest that 3BP2 is involved in the activation of Rac1 through the regulation of Vav3 by Syk-dependent phosphorylation of Tyr{sup 426} following BCR stimulation. - Highlights: • 3BP2 is phosphorylated by Syk, but not Abl family kinases in BCR signaling. • Tyr183 and Tyr426 in chicken 3BP2 are the major phosphorylation sites by Syk. • The SH2 domain of 3BP2 is critical for tyrosine phosphorylation of 3BP2. • Phosphorylation of Tyr426 in 3BP2 is required for the inducible binding with Vav3. • 3BP2 is involved in the regulation of BCR-mediated Rac1 activation.

  14. 76 FR 22680 - Procurement List; Deletions

    Science.gov (United States)

    2011-04-22

    ... impact on a substantial number of small entities. The major factors considered for this certification... PEOPLE WHO ARE BLIND OR SEVERELY DISABLED Procurement List; Deletions AGENCY: Committee for Purchase From People Who Are Blind or Severely Disabled. ACTION: Deletions from the Procurement List. SUMMARY: This...

  15. The chromosome 9q subtelomere deletion syndrome

    NARCIS (Netherlands)

    Stewart, D.R.; Kleefstra, T.

    2007-01-01

    The chromosome 9q subtelomere deletion syndrome (9qSTDS) is among the first and most common clinically recognizable syndromes to arise from widespread testing by fluorescent in situ hybridization (FISH) of subtelomere deletions. There are about 50 reported cases worldwide. Affected individuals

  16. Central 22q11.2 Deletions

    NARCIS (Netherlands)

    Rump, Patrick; de Leeuw, Nicole; van Essen, Anthonie J.; Verschuuren - Bemelmans, Corien C.; Veenstra-Knol, Hermine E.; Swinkels, Marielle E. M.; Oostdijk, Wilma; Ruivenkamp, Claudia; Reardon, Willie; de Munnik, Sonja; Ruiter, Mariken; Frumkin, Ayala; Lev, Dorit; Evers, Christina; Sikkema-Raddatz, Birgit; Dijkhuizen, Trijnie; van Ravenswaaij-Arts, Conny M.

    2014-01-01

    22q11.2 deletion syndrome is one of the most common microdeletion syndromes. Most patients have a deletion resulting from a recombination of low copy repeat blocks LCR22-A and LCR22-D. Loss of the TBX1 gene is considered the most important cause of the phenotype. A limited number of patients with

  17. Telithromycin resistance in Streptococcus pneumoniae is conferred by a deletion in the leader sequence of erm(B) that increases rRNA methylation

    DEFF Research Database (Denmark)

    Wolter, Nicole; Smith, Anthony M; Farrell, David J

    2008-01-01

    A telithromycin-resistant clinical isolate of Streptococcus pneumoniae (strain P1501016) has been found to contain a version of erm(B) that is altered by a 136-bp deletion in the leader sequence. By allele replacement mutagenesis, a second strain of S. pneumoniae (PC13) with a wild-type erm(B) ge...

  18. Mechanistic insights into the role of prenyl-binding protein PrBP/δ in membrane dissociation of phosphodiesterase 6

    KAUST Repository

    Qureshi, Bilal M.

    2018-01-02

    Isoprenylated proteins are associated with membranes and their inter-compartmental distribution is regulated by solubilization factors, which incorporate lipid moieties in hydrophobic cavities and thereby facilitate free diffusion during trafficking. Here we report the crystal structure of a solubilization factor, the prenyl-binding protein (PrBP/δ), at 1.81 Å resolution in its ligand-free apo-form. Apo-PrBP/δ harbors a preshaped, deep hydrophobic cavity, capacitating apo-PrBP/δ to readily bind its prenylated cargo. To investigate the molecular mechanism of cargo solubilization we analyzed the PrBP/δ-induced membrane dissociation of rod photoreceptor phosphodiesterase (PDE6). The results suggest that PrBP/δ exclusively interacts with the soluble fraction of PDE6. Depletion of soluble species in turn leads to dissociation of membrane-bound PDE6, as both are in equilibrium. This

  19. Air Monitoring Data for BP Spill/Deepwater Horizon

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following...

  20. Waste Sampling Data for BP Spill/Deepwater Horizon

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following...

  1. Surface Water Sampling Data for BP Spill/Deepwater Horizon

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following...

  2. Air Sampling Data for BP Spill/Deepwater Horizon

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following...

  3. Water Sampling Data for BP Spill/Deepwater Horizon

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following...

  4. Sediment Sampling Data for BP Spill/Deepwater Horizon

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Deepwater Horizon oil spill (also referred to as the BP oil spill) began on 20 April 2010 in the Gulf of Mexico on the BP-operated Macondo Prospect. Following...

  5. Regulation of 53BP1 protein stability by RNF8 and RNF168 is important for efficient DNA double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Yiheng Hu

    Full Text Available 53BP1 regulates DNA double-strand break (DSB repair. In functional assays for specific DSB repair pathways, we found that 53BP1 was important in the conservative non-homologous end-joining (C-NHEJ pathway, and this activity was dependent upon RNF8 and RNF168. We observed that 53BP1 protein was diffusely abundant in nuclei, and upon ionizing radiation, 53BP1 was everywhere degraded except at DNA damage sites. Depletion of RNF8 or RNF168 blocked the degradation of the diffusely localized nuclear 53BP1, and ionizing radiation induced foci (IRIF did not form. Furthermore, when 53BP1 degradation was inhibited, a subset of 53BP1 was bound to DNA damage sites but bulk, unbound 53BP1 remained in the nucleoplasm, and localization of its downstream effector RIF1 at DSBs was abolished. Our data suggest a novel mechanism for responding to DSB that upon ionizing radiation, 53BP1 was divided into two populations, ensuring functional DSB repair: damage site-bound 53BP1 whose binding signal is known to be generated by RNF8 and RNF168; and unbound bulk 53BP1 whose ensuing degradation is regulated by RNF8 and RNF168.

  6. AcEST: BP916227 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000084_G08 97 Adiantum capillus-veneris mRNA. clone: YMU001_000084_G08. BP916227 - Show BP91... mRNA. clone: YMU001_000084_G08. Accession BP916227 Tissue type prothallium Developmental stage - Contig ID

  7. AcEST: BP920020 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000132_B05 91 Adiantum capillus-veneris mRNA. clone: YMU001_000132_B05. BP920020 - Show BP920020... mRNA. clone: YMU001_000132_B05. Accession BP920020 Tissue type prothallium Developmental stage - Contig ID

  8. AcEST: BP911846 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000009_H02 62 Adiantum capillus-veneris mRNA. clone: YMU001_000009_H02. BP911846 - Show BP91184... mRNA. clone: YMU001_000009_H02. Accession BP911846 Tissue type prothallium Developmental stage - Contig ID

  9. AcEST: BP918019 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000108_F08 47 Adiantum capillus-veneris mRNA. clone: YMU001_000108_F08. BP918019 - Show BP91801... mRNA. clone: YMU001_000108_F08. Accession BP918019 Tissue type prothallium Developmental stage - Contig ID

  10. AcEST: BP919947 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000131_A11 35 Adiantum capillus-veneris mRNA. clone: YMU001_000131_A11. BP919947 - Show BP91994... mRNA. clone: YMU001_000131_A11. Accession BP919947 Tissue type prothallium Developmental stage - Contig ID

  11. Prenatal diagnosis of terminal 11q deletion

    OpenAIRE

    Simão, Laurentino; Brito, Filomena; Silva, Marisa; Marques, Bárbara; Furtado, José; Ventura, Catarina; Caetano, Paula; Dias, Ivone; Correia, Hildeberto

    2011-01-01

    The majority of 11q deletion cases described may be included in the “distal 11q deletion syndrome”, or Jacobsen syndrome. This is a rare but clinically recognizable condition with an incidence of 1/ 100,000 births. The most common clinical features are psychomotor delay, characteristic facial dysmorphism and malformations of the heart, kidney, genitalia, central nervous system and skeleton. Patients usually have visible deletions of chromosomal bands 11q23, 11q24, and/or 11q25. Approximately ...

  12. AcEST: BP917117 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000096_B11 125 Adiantum capillus-veneris mRNA. clone: YMU001_000096_B11. BP917117... CL2704Contig1 Show BP917117 Clone id YMU001_000096_B11 Library YMU01 Length 125 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000096_B11. Accession BP917117 Tissue type prothallium Developmental stag...T: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917117...w generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917117

  13. AcEST: BP917177 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000097_C05 471 Adiantum capillus-veneris mRNA. clone: YMU001_000097_C05. BP917177 - Show BP91717...is mRNA. clone: YMU001_000097_C05. Accession BP917177 Tissue type prothallium Developmental stage - Contig I...search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917177|Adiantum capillus-veneris mRNA, clone: YMU...97), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917

  14. AcEST: BP919878 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_C01 531 Adiantum capillus-veneris mRNA. clone: YMU001_000130_C01. BP919878 - Show BP91987...is mRNA. clone: YMU001_000130_C01. Accession BP919878 Tissue type prothallium Developmental stage - Contig I...cids Res. 25:3389-3402. Query= BP919878|Adiantum capillus-veneris mRNA, clone: YMU001_000130_C01. (505 lette...w generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919878|Adiantum

  15. AcEST: BP919872 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_B06 364 Adiantum capillus-veneris mRNA. clone: YMU001_000130_B06. BP919872 - Show BP91987...is mRNA. clone: YMU001_000130_B06. Accession BP919872 Tissue type prothallium Developmental stage - Contig I... 25:3389-3402. Query= BP919872|Adiantum capillus-veneris mRNA, clone: YMU001_000130_B06. (364 letters) Datab...n database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919872|Adiantum capillus-veneris mRNA,

  16. AcEST: BP919870 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_B04 458 Adiantum capillus-veneris mRNA. clone: YMU001_000130_B04. BP91987...0 CL4204Contig1 Show BP919870 Clone id YMU001_000130_B04 Library YMU01 Length 458 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000130_B04. Accession BP919870 Tissue type prothallium Developmental stag...on of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91987...-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91987

  17. AcEST: BP919871 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_B05 455 Adiantum capillus-veneris mRNA. clone: YMU001_000130_B05. BP91987...1 CL1328Contig1 Show BP919871 Clone id YMU001_000130_B05 Library YMU01 Length 455 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000130_B05. Accession BP919871 Tissue type prothallium Developmental stag...tein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919871|A...on of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919871|Adiantum capillus-v

  18. AcEST: BP919875 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_B10 534 Adiantum capillus-veneris mRNA. clone: YMU001_000130_B10. BP919875 - Show BP91987...is mRNA. clone: YMU001_000130_B10. Accession BP919875 Tissue type prothallium Developmental stage - Contig I...eic Acids Res. 25:3389-3402. Query= BP919875|Adiantum capillus-veneris mRNA, clone: YMU001_000130_B10. (534 ...ew generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919875|Adiantum

  19. AcEST: BP919877 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_B12 476 Adiantum capillus-veneris mRNA. clone: YMU001_000130_B12. BP91987...7 CL1479Contig1 Show BP919877 Clone id YMU001_000130_B12 Library YMU01 Length 476 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000130_B12. Accession BP919877 Tissue type prothallium Developmental stag...T: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91987...eneration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91987

  20. AcEST: BP919876 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_B11 550 Adiantum capillus-veneris mRNA. clone: YMU001_000130_B11. BP919876 - Show BP91987...is mRNA. clone: YMU001_000130_B11. Accession BP919876 Tissue type prothallium Developmental stage - Contig I...ase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919876|Adiantum capillus-veneris mRNA, clone:...tion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91987

  1. AcEST: BP919874 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_B09 480 Adiantum capillus-veneris mRNA. clone: YMU001_000130_B09. BP919874 - Show BP91987...is mRNA. clone: YMU001_000130_B09. Accession BP919874 Tissue type prothallium Developmental stage - Contig I... database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919874|Adian...se search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919874|Adiantum capillus-veneris mRNA, clone:

  2. AcEST: BP919879 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_C02 534 Adiantum capillus-veneris mRNA. clone: YMU001_000130_C02. BP919879 - Show BP91987...is mRNA. clone: YMU001_000130_C02. Accession BP919879 Tissue type prothallium Developmental stage - Contig I...apped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91987...neration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919879|Adiantum capi

  3. AcEST: BP912760 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000022_E11 589 Adiantum capillus-veneris mRNA. clone: YMU001_000022_E11. BP912760 - Show BP912760...is mRNA. clone: YMU001_000022_E11. Accession BP912760 Tissue type prothallium Developmental stage - Contig I...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912760|Adiantum capillus-veneris...AST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91276

  4. AcEST: BP919294 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000123_D08 374 Adiantum capillus-veneris mRNA. clone: YMU001_000123_D08. BP919294 - Show BP91929...is mRNA. clone: YMU001_000123_D08. Accession BP919294 Tissue type prothallium Developmental stage - Contig I...programs, Nucleic Acids Res. 25:3389-3402. Query= BP919294|Adiantum capillus-veneris mRNA, clone: YMU001_000...Res. 25:3389-3402. Query= BP919294|Adiantum capillus-veneris mRNA, clone: YMU001_000123_D08. (374 letters) D

  5. AcEST: BP919290 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000123_D04 586 Adiantum capillus-veneris mRNA. clone: YMU001_000123_D04. BP91929...0 CL1106Contig1 Show BP919290 Clone id YMU001_000123_D04 Library YMU01 Length 586 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000123_D04. Accession BP919290 Tissue type prothallium Developmental stag...of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919290|Adiantum capillus-vene...w generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91929

  6. AcEST: BP911929 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000010_H05 433 Adiantum capillus-veneris mRNA. clone: YMU001_000010_H05. BP911929 - Show BP911929...is mRNA. clone: YMU001_000010_H05. Accession BP911929 Tissue type prothallium Developmental stage - Contig I...BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911929... programs, Nucleic Acids Res. 25:3389-3402. Query= BP911929|Adiantum capillus-ven

  7. AcEST: BP919299 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000123_E01 548 Adiantum capillus-veneris mRNA. clone: YMU001_000123_E01. BP919299 - Show BP91929...is mRNA. clone: YMU001_000123_E01. Accession BP919299 Tissue type prothallium Developmental stage - Contig I...s Res. 25:3389-3402. Query= BP919299|Adiantum capillus-veneris mRNA, clone: YMU00...d BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91929

  8. AcEST: BP919296 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000123_D10 448 Adiantum capillus-veneris mRNA. clone: YMU001_000123_D10. BP919296 - Show BP91929...is mRNA. clone: YMU001_000123_D10. Accession BP919296 Tissue type prothallium Developmental stage - Contig I...c Acids Res. 25:3389-3402. Query= BP919296|Adiantum capillus-veneris mRNA, clone: YMU001_000123_D10. (448 le...AST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91929

  9. AcEST: BP919293 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000123_D07 518 Adiantum capillus-veneris mRNA. clone: YMU001_000123_D07. BP919293 - Show BP91929...is mRNA. clone: YMU001_000123_D07. Accession BP919293 Tissue type prothallium Developmental stage - Contig I... 25:3389-3402. Query= BP919293|Adiantum capillus-veneris mRNA, clone: YMU001_000123_D07. (518 letters) Datab.... 25:3389-3402. Query= BP919293|Adiantum capillus-veneris mRNA, clone: YMU001_000

  10. AcEST: BP919291 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000123_D05 502 Adiantum capillus-veneris mRNA. clone: YMU001_000123_D05. BP919291 - Show BP91929...is mRNA. clone: YMU001_000123_D05. Accession BP919291 Tissue type prothallium Developmental stage - Contig I...tein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919291|A...database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919291|Adiantum capillus-veneris mRNA, c

  11. AcEST: BP915155 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000067_B08 468 Adiantum capillus-veneris mRNA. clone: YMU001_000067_B08. BP91515...5 CL2592Contig1 Show BP915155 Clone id YMU001_000067_B08 Library YMU01 Length 468 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000067_B08. Accession BP915155 Tissue type prothallium Developmental stag... of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915155|Adiantum capillus-ven...AST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915

  12. AcEST: BP915815 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000077_C11 552 Adiantum capillus-veneris mRNA. clone: YMU001_000077_C11. BP915815... CL3742Contig1 Show BP915815 Clone id YMU001_000077_C11 Library YMU01 Length 552 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000077_C11. Accession BP915815 Tissue type prothallium Developmental stag...rch programs, Nucleic Acids Res. 25:3389-3402. Query= BP915815|Adiantum capillus-veneris mRNA, clone: YMU001... new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915815|Adiant

  13. AcEST: BP915615 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000073_F08 475 Adiantum capillus-veneris mRNA. clone: YMU001_000073_F08. BP915615... CL3512Contig1 Show BP915615 Clone id YMU001_000073_F08 Library YMU01 Length 475 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000073_F08. Accession BP915615 Tissue type prothallium Developmental stag...search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915615|Adiantum capill...abase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915615|Adiantum capillus-veneris mRNA, clon

  14. AcEST: BP913607 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000032_B07 628 Adiantum capillus-veneris mRNA. clone: YMU001_000032_B07. BP913607 - Show BP91360...is mRNA. clone: YMU001_000032_B07. Accession BP913607 Tissue type prothallium Developmental stage - Contig I...BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91360...ed BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91360

  15. AcEST: BP918360 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000112_F01 506 Adiantum capillus-veneris mRNA. clone: YMU001_000112_F01. BP918360... CL1181Contig1 Show BP918360 Clone id YMU001_000112_F01 Library YMU01 Length 506 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000112_F01. Accession BP918360 Tissue type prothallium Developmental stag...s. 25:3389-3402. Query= BP918360|Adiantum capillus-veneris mRNA, clone: YMU001_000112_F01. (506 letters) Dat...ation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918360

  16. AcEST: BP913606 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000032_B05 546 Adiantum capillus-veneris mRNA. clone: YMU001_000032_B05. BP913606 - Show BP91360...is mRNA. clone: YMU001_000032_B05. Accession BP913606 Tissue type prothallium Developmental stage - Contig I...tabase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913606|Adiantum capillus-veneris mRNA, clo...n of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913606|Adiantum capillus-ve

  17. AcEST: BP919360 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000124_B12 514 Adiantum capillus-veneris mRNA. clone: YMU001_000124_B12. BP919360 - Show BP919360...is mRNA. clone: YMU001_000124_B12. Accession BP919360 Tissue type prothallium Developmental stage - Contig I...tabase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919360|Adiantum...HG +D+ Sbjct: 301 ADIKIKSEPQTAPQPQQSPHGSSHSSRSGSGSGSHSSMASDGSLRRKSSDSLDSHGAQDD 360 Query: 310 LQNLDRLDANPYRS... database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919360|Adiantum capillus-veneris mRNA,

  18. AcEST: BP913605 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000032_B03 520 Adiantum capillus-veneris mRNA. clone: YMU001_000032_B03. BP913605 - Show BP91360...is mRNA. clone: YMU001_000032_B03. Accession BP913605 Tissue type prothallium Developmental stage - Contig I...w generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91360...7), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91360

  19. AcEST: BP913604 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000032_B02 433 Adiantum capillus-veneris mRNA. clone: YMU001_000032_B02. BP913604 - Show BP91360...is mRNA. clone: YMU001_000032_B02. Accession BP913604 Tissue type prothallium Developmental stage - Contig I.... 25:3389-3402. Query= BP913604|Adiantum capillus-veneris mRNA, clone: YMU001_000...and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91360

  20. AcEST: BP914360 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000058_A08 544 Adiantum capillus-veneris mRNA. clone: YMU001_000058_A08. BP914360... CL3111Contig1 Show BP914360 Clone id YMU001_000058_A08 Library YMU01 Length 544 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000058_A08. Accession BP914360 Tissue type prothallium Developmental stag...f protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914360|Adiantum capillus-vener...BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914360

  1. AcEST: BP913603 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000032_B01 528 Adiantum capillus-veneris mRNA. clone: YMU001_000032_B01. BP913603 - Show BP91360...is mRNA. clone: YMU001_000032_B01. Accession BP913603 Tissue type prothallium Developmental stage - Contig I... search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913603|Adiantum capillus-veneris mRNA, clone: YM...ds Res. 25:3389-3402. Query= BP913603|Adiantum capillus-veneris mRNA, clone: YMU0

  2. AcEST: BP913608 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000032_B08 199 Adiantum capillus-veneris mRNA. clone: YMU001_000032_B08. BP91360...8 CL2399Contig1 Show BP913608 Clone id YMU001_000032_B08 Library YMU01 Length 199 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000032_B08. Accession BP913608 Tissue type prothallium Developmental stag...new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913608|Adiantu... search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913608|Adiantum capillus-veneris mRNA, clone: YM

  3. AcEST: BP920360 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000136_B12 571 Adiantum capillus-veneris mRNA. clone: YMU001_000136_B12. BP920360... CL4062Contig1 Show BP920360 Clone id YMU001_000136_B12 Library YMU01 Length 571 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000136_B12. Accession BP920360 Tissue type prothallium Developmental stag... protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920360...arch programs, Nucleic Acids Res. 25:3389-3402. Query= BP920360|Adiantum capillus-veneris mRNA, clone: YMU00

  4. AcEST: BP915360 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000070_F03 255 Adiantum capillus-veneris mRNA. clone: YMU001_000070_F03. BP915360 - Show BP915360...is mRNA. clone: YMU001_000070_F03. Accession BP915360 Tissue type prothallium Developmental stage - Contig I...rch programs, Nucleic Acids Res. 25:3389-3402. Query= BP915360|Adiantum capillus-veneris mRNA, clone: YMU001...T: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915360

  5. AcEST: BP913360 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000029_D06 508 Adiantum capillus-veneris mRNA. clone: YMU001_000029_D06. BP913360 - Show BP913360...is mRNA. clone: YMU001_000029_D06. Accession BP913360 Tissue type prothallium Developmental stage - Contig I...ch programs, Nucleic Acids Res. 25:3389-3402. Query= BP913360|Adiantum capillus-v...grams, Nucleic Acids Res. 25:3389-3402. Query= BP913360|Adiantum capillus-veneris mRNA, clone: YMU001_000029

  6. AcEST: BP917360 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000099_H03 153 Adiantum capillus-veneris mRNA. clone: YMU001_000099_H03. BP917360 - Show BP917360...is mRNA. clone: YMU001_000099_H03. Accession BP917360 Tissue type prothallium Developmental stage - Contig I...ograms, Nucleic Acids Res. 25:3389-3402. Query= BP917360|Adiantum capillus-veneris mRNA, clone: YMU001_00009... generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917360|Adiantum c

  7. AcEST: BP913600 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000032_A10 231 Adiantum capillus-veneris mRNA. clone: YMU001_000032_A10. BP913600 - Show BP91360...is mRNA. clone: YMU001_000032_A10. Accession BP913600 Tissue type prothallium Developmental stage - Contig I... and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91360...LAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913600

  8. AcEST: BP916360 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000086_G10 437 Adiantum capillus-veneris mRNA. clone: YMU001_000086_G10. BP916360... CL1975Contig1 Show BP916360 Clone id YMU001_000086_G10 Library YMU01 Length 437 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000086_G10. Accession BP916360 Tissue type prothallium Developmental stag...cleic Acids Res. 25:3389-3402. Query= BP916360|Adiantum capillus-veneris mRNA, cl...rch programs, Nucleic Acids Res. 25:3389-3402. Query= BP916360|Adiantum capillus-veneris mRNA, clone: YMU001

  9. AcEST: BP913848 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000037_A10 537 Adiantum capillus-veneris mRNA. clone: YMU001_000037_A10. BP91...3848 CL119Contig2 Show BP913848 Clone id YMU001_000037_A10 Library YMU01 Length 537 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000037_A10. Accession BP913848 Tissue type prothallium Developmental stage...arch programs, Nucleic Acids Res. 25:3389-3402. Query= BP913848|Adiantum capillus-veneris mRNA, clone: YMU00... protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9138

  10. AcEST: BP914836 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000063_D09 466 Adiantum capillus-veneris mRNA. clone: YMU001_000063_D09. BP914836 - Show BP91...is mRNA. clone: YMU001_000063_D09. Accession BP914836 Tissue type prothallium Developmental stage - Contig I...e search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914836|Adiantum capi...tein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914836|Adiantum capillus-veneris mR

  11. AcEST: BP917633 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000103_D11 126 Adiantum capillus-veneris mRNA. clone: YMU001_000103_D11. BP917633 - Show BP91...is mRNA. clone: YMU001_000103_D11. Accession BP917633 Tissue type prothallium Developmental stage - Contig I...ST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917633|Adiantum capillus-veneris

  12. AcEST: BP914018 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000038_H10 551 Adiantum capillus-veneris mRNA. clone: YMU001_000038_H10. BP91...4018 CL2047Contig1 Show BP914018 Clone id YMU001_000038_H10 Library YMU01 Length 551 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000038_H10. Accession BP914018 Tissue type prothallium Developmental stag...in database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914018|Adiantum capillus-veneris mRNA...ration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914018|Adiantum capill

  13. AcEST: BP918209 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000110_G08 518 Adiantum capillus-veneris mRNA. clone: YMU001_000110_G08. BP918209 - Show BP91...is mRNA. clone: YMU001_000110_G08. Accession BP918209 Tissue type prothallium Developmental stage - Contig I...eration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...base search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918209|Adiantum capillus-veneris mRNA, clone

  14. AcEST: BP918186 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000110_E07 514 Adiantum capillus-veneris mRNA. clone: YMU001_000110_E07. BP918186 - Show BP91...is mRNA. clone: YMU001_000110_E07. Accession BP918186 Tissue type prothallium Developmental stage - Contig I... generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...ST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918186|A

  15. AcEST: BP911679 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000007_H05 467 Adiantum capillus-veneris mRNA. clone: YMU001_000007_H05. BP911679 - Show BP91...is mRNA. clone: YMU001_000007_H05. Accession BP911679 Tissue type prothallium Developmental stage - Contig I...cleic Acids Res. 25:3389-3402. Query= BP911679|Adiantum capillus-veneris mRNA, cl...I-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911

  16. AcEST: BP916203 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000084_E04 493 Adiantum capillus-veneris mRNA. clone: YMU001_000084_E04. BP916203 - Show BP91...is mRNA. clone: YMU001_000084_E04. Accession BP916203 Tissue type prothallium Developmental stage - Contig I...cids Res. 25:3389-3402. Query= BP916203|Adiantum capillus-veneris mRNA, clone: YMU001_000084_E04. (493 lette...search programs, Nucleic Acids Res. 25:3389-3402. Query= BP916203|Adiantum capillus-veneris mRNA, clone: YMU

  17. AcEST: BP913152 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000027_A11 442 Adiantum capillus-veneris mRNA. clone: YMU001_000027_A11. BP91...3152 CL3267Contig1 Show BP913152 Clone id YMU001_000027_A11 Library YMU01 Length 442 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000027_A11. Accession BP913152 Tissue type prothallium Developmental stag...Nucleic Acids Res. 25:3389-3402. Query= BP913152|Adiantum capillus-veneris mRNA, ...generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913152|Adiantum ca

  18. AcEST: BP917884 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000106_G10 288 Adiantum capillus-veneris mRNA. clone: YMU001_000106_G10. BP917884 - Show BP91...is mRNA. clone: YMU001_000106_G10. Accession BP917884 Tissue type prothallium Developmental stage - Contig I...e search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917884|Adiantum capillus-veneris mRNA, clone: Y...h programs, Nucleic Acids Res. 25:3389-3402. Query= BP917884|Adiantum capillus-veneris mRNA, clone: YMU001_0

  19. AcEST: BP913824 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000035_G03 382 Adiantum capillus-veneris mRNA. clone: YMU001_000035_G03. BP913824 - Show BP91...is mRNA. clone: YMU001_000035_G03. Accession BP913824 Tissue type prothallium Developmental stage - Contig I... of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913824|Adiantum capillus-ven...eration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913824|Adiantum capil

  20. AcEST: BP914395 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000058_D09 492 Adiantum capillus-veneris mRNA. clone: YMU001_000058_D09. BP914395 - Show BP91...is mRNA. clone: YMU001_000058_D09. Accession BP914395 Tissue type prothallium Developmental stage - Contig I...abase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914395|Adiantum ...ed BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91

  1. AcEST: BP912582 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000020_E12 502 Adiantum capillus-veneris mRNA. clone: YMU001_000020_E12. BP91...2582 CL3877Contig1 Show BP912582 Clone id YMU001_000020_E12 Library YMU01 Length 502 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000020_E12. Accession BP912582 Tissue type prothallium Developmental stag...ST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...grams, Nucleic Acids Res. 25:3389-3402. Query= BP912582|Adiantum capillus-veneris

  2. AcEST: BP916834 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000092_C07 418 Adiantum capillus-veneris mRNA. clone: YMU001_000092_C07. BP916834 - Show BP91...is mRNA. clone: YMU001_000092_C07. Accession BP916834 Tissue type prothallium Developmental stage - Contig I...and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91

  3. AcEST: BP919190 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000122_C07 508 Adiantum capillus-veneris mRNA. clone: YMU001_000122_C07. BP91...llus-veneris mRNA. clone: YMU001_000122_C07. Accession BP919190 Tissue type prothallium Developmental stage ...: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...ams, Nucleic Acids Res. 25:3389-3402. Query= BP919190|Adiantum capillus-veneris m...9190 CL10Contig1 Show BP919190 Clone id YMU001_000122_C07 Library YMU01 Length 508 Definition Adiantum capi

  4. AcEST: BP912371 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000018_C10 541 Adiantum capillus-veneris mRNA. clone: YMU001_000018_C10. BP912371 - Show BP91...is mRNA. clone: YMU001_000018_C10. Accession BP912371 Tissue type prothallium Developmental stage - Contig I...Acids Res. 25:3389-3402. Query= BP912371|Adiantum capillus-veneris mRNA, clone: YMU001_000018_C10. (541 lett...neration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912371|Adiantum capi

  5. AcEST: BP919170 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000122_A09 536 Adiantum capillus-veneris mRNA. clone: YMU001_000122_A09. BP91...9170 CL1421Contig1 Show BP919170 Clone id YMU001_000122_A09 Library YMU01 Length 536 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000122_A09. Accession BP919170 Tissue type prothallium Developmental stag...ucleic Acids Res. 25:3389-3402. Query= BP919170|Adiantum capillus-veneris mRNA, c... new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919170|Adiant

  6. AcEST: BP917190 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000097_D09 473 Adiantum capillus-veneris mRNA. clone: YMU001_000097_D09. BP917190 - Show BP91...is mRNA. clone: YMU001_000097_D09. Accession BP917190 Tissue type prothallium Developmental stage - Contig I...eic Acids Res. 25:3389-3402. Query= BP917190|Adiantum capillus-veneris mRNA, clon...leic Acids Res. 25:3389-3402. Query= BP917190|Adiantum capillus-veneris mRNA, clo

  7. AcEST: BP918649 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000115_H08 525 Adiantum capillus-veneris mRNA. clone: YMU001_000115_H08. BP918649 - Show BP91...is mRNA. clone: YMU001_000115_H08. Accession BP918649 Tissue type prothallium Developmental stage - Contig I...eneration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91... database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918649|Adiantum capillus-veneris mRNA,

  8. AcEST: BP918180 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000110_E01 492 Adiantum capillus-veneris mRNA. clone: YMU001_000110_E01. BP91...8180 CL642Contig1 Show BP918180 Clone id YMU001_000110_E01 Library YMU01 Length 492 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000110_E01. Accession BP918180 Tissue type prothallium Developmental stage... search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918180|Adiantum capil... and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91

  9. AcEST: BP915008 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000065_D10 581 Adiantum capillus-veneris mRNA. clone: YMU001_000065_D10. BP915008 - Show BP91...is mRNA. clone: YMU001_000065_D10. Accession BP915008 Tissue type prothallium Developmental stage - Contig I...rograms, Nucleic Acids Res. 25:3389-3402. Query= BP915008|Adiantum capillus-veneris mRNA, clone: YMU001_0000...database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915008|Adiant

  10. AcEST: BP916391 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000087_B10 517 Adiantum capillus-veneris mRNA. clone: YMU001_000087_B10. BP91...6391 CL3244Contig1 Show BP916391 Clone id YMU001_000087_B10 Library YMU01 Length 517 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000087_B10. Accession BP916391 Tissue type prothallium Developmental stag...ch programs, Nucleic Acids Res. 25:3389-3402. Query= BP916391|Adiantum capillus-veneris mRNA, clone: YMU001_... generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP916391|Adiantum c

  11. AcEST: BP918225 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000111_A03 454 Adiantum capillus-veneris mRNA. clone: YMU001_000111_A03. BP91...8225 CL1144Contig1 Show BP918225 Clone id YMU001_000111_A03 Library YMU01 Length 454 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000111_A03. Accession BP918225 Tissue type prothallium Developmental stag...cleic Acids Res. 25:3389-3402. Query= BP918225|Adiantum capillus-veneris mRNA, cl...tabase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918225|Adiantum capillus-veneris mRNA, clo

  12. AcEST: BP914418 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000058_F10 558 Adiantum capillus-veneris mRNA. clone: YMU001_000058_F10. BP914418 - Show BP91...is mRNA. clone: YMU001_000058_F10. Accession BP914418 Tissue type prothallium Developmental stage - Contig I...otein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914418|Adiantum capillus-veneris m...ase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914418|Adiantum capillus-veneris mRNA, clone:

  13. AcEST: BP917820 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000105_H03 480 Adiantum capillus-veneris mRNA. clone: YMU001_000105_H03. BP91...7820 CL2138Contig1 Show BP917820 Clone id YMU001_000105_H03 Library YMU01 Length 480 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000105_H03. Accession BP917820 Tissue type prothallium Developmental stag...rotein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917820...BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91782

  14. AcEST: BP919866 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_A12 529 Adiantum capillus-veneris mRNA. clone: YMU001_000130_A12. BP91...9866 CL2968Contig1 Show BP919866 Clone id YMU001_000130_A12 Library YMU01 Length 529 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000130_A12. Accession BP919866 Tissue type prothallium Developmental stag...ch programs, Nucleic Acids Res. 25:3389-3402. Query= BP919866|Adiantum capillus-veneris mRNA, clone: YMU001_...rams, Nucleic Acids Res. 25:3389-3402. Query= BP919866|Adiantum capillus-veneris

  15. AcEST: BP917824 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000105_H08 518 Adiantum capillus-veneris mRNA. clone: YMU001_000105_H08. BP917824 - Show BP91...is mRNA. clone: YMU001_000105_H08. Accession BP917824 Tissue type prothallium Developmental stage - Contig I...n of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9178

  16. AcEST: BP912667 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000021_E06 654 Adiantum capillus-veneris mRNA. clone: YMU001_000021_E06. BP912667 - Show BP91...is mRNA. clone: YMU001_000021_E06. Accession BP912667 Tissue type prothallium Developmental stage - Contig I...s. 25:3389-3402. Query= BP912667|Adiantum capillus-veneris mRNA, clone: YMU001_000021_E06. (654 letters) Dat...: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912667|Adi

  17. AcEST: BP916878 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000093_B03 521 Adiantum capillus-veneris mRNA. clone: YMU001_000093_B03. BP916878 - Show BP91...is mRNA. clone: YMU001_000093_B03. Accession BP916878 Tissue type prothallium Developmental stage - Contig I... a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...ST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP916878|A

  18. AcEST: BP918623 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000115_F04 410 Adiantum capillus-veneris mRNA. clone: YMU001_000115_F04. BP918623 - Show BP91...is mRNA. clone: YMU001_000115_F04. Accession BP918623 Tissue type prothallium Developmental stage - Contig I... PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91... search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918623|Adiantum capillus-veneris mRNA, clone: YM

  19. AcEST: BP919444 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000125_B09 425 Adiantum capillus-veneris mRNA. clone: YMU001_000125_B09. BP91...9444 CL1131Contig1 Show BP919444 Clone id YMU001_000125_B09 Library YMU01 Length 425 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000125_B09. Accession BP919444 Tissue type prothallium Developmental stag...LAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919444...rograms, Nucleic Acids Res. 25:3389-3402. Query= BP919444|Adiantum capillus-vener

  20. AcEST: BP918160 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000110_C05 370 Adiantum capillus-veneris mRNA. clone: YMU001_000110_C05. BP91...8160 CL598Contig1 Show BP918160 Clone id YMU001_000110_C05 Library YMU01 Length 370 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000110_C05. Accession BP918160 Tissue type prothallium Developmental stage...n of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918160|Adiantum capillus-ve... generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918160|Adiantum c

  1. AcEST: BP914580 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000060_F02 476 Adiantum capillus-veneris mRNA. clone: YMU001_000060_F02. BP91...4580 CL2282Contig1 Show BP914580 Clone id YMU001_000060_F02 Library YMU01 Length 476 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000060_F02. Accession BP914580 Tissue type prothallium Developmental stag... database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914580|Adian...ids Res. 25:3389-3402. Query= BP914580|Adiantum capillus-veneris mRNA, clone: YMU001_000060_F02. (457 letter

  2. AcEST: BP917631 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000103_D09 348 Adiantum capillus-veneris mRNA. clone: YMU001_000103_D09. BP917631 - Show BP91...is mRNA. clone: YMU001_000103_D09. Accession BP917631 Tissue type prothallium Developmental stage - Contig I...997), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...eic Acids Res. 25:3389-3402. Query= BP917631|Adiantum capillus-veneris mRNA, clone: YMU001_000103_D09. (348

  3. AcEST: BP919820 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000129_E07 516 Adiantum capillus-veneris mRNA. clone: YMU001_000129_E07. BP919820 - Show BP91...is mRNA. clone: YMU001_000129_E07. Accession BP919820 Tissue type prothallium Developmental stage - Contig I...ew generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...ST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919820|A

  4. AcEST: BP912140 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000015_E11 481 Adiantum capillus-veneris mRNA. clone: YMU001_000015_E11. BP912140 - Show BP91...is mRNA. clone: YMU001_000015_E11. Accession BP912140 Tissue type prothallium Developmental stage - Contig I...of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9121

  5. AcEST: BP913383 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000029_F06 535 Adiantum capillus-veneris mRNA. clone: YMU001_000029_F06. BP913383 - Show BP91...is mRNA. clone: YMU001_000029_F06. Accession BP913383 Tissue type prothallium Developmental stage - Contig I... Acids Res. 25:3389-3402. Query= BP913383|Adiantum capillus-veneris mRNA, clone: YMU001_000029_F06. (535 let...Res. 25:3389-3402. Query= BP913383|Adiantum capillus-veneris mRNA, clone: YMU001_

  6. AcEST: BP914140 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000042_D03 527 Adiantum capillus-veneris mRNA. clone: YMU001_000042_D03. BP914140 - Show BP91...is mRNA. clone: YMU001_000042_D03. Accession BP914140 Tissue type prothallium Developmental stage - Contig I...ion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...ion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914140|Adiantum capillus-

  7. AcEST: BP919383 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000124_E04 492 Adiantum capillus-veneris mRNA. clone: YMU001_000124_E04. BP91...9383 CL225Contig1 Show BP919383 Clone id YMU001_000124_E04 Library YMU01 Length 492 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000124_E04. Accession BP919383 Tissue type prothallium Developmental stage... a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91

  8. AcEST: BP919468 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000125_D10 525 Adiantum capillus-veneris mRNA. clone: YMU001_000125_D10. BP919468 - Show BP91...is mRNA. clone: YMU001_000125_D10. Accession BP919468 Tissue type prothallium Developmental stage - Contig I...AST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919468|Adiantum capillus-veneris

  9. AcEST: BP919679 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000127_H04 521 Adiantum capillus-veneris mRNA. clone: YMU001_000127_H04. BP919679 - Show BP91...is mRNA. clone: YMU001_000127_H04. Accession BP919679 Tissue type prothallium Developmental stage - Contig I...s, Nucleic Acids Res. 25:3389-3402. Query= BP919679|Adiantum capillus-veneris mRNA, clone: YMU001_000127_H04... generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919679|Adiantum c

  10. AcEST: BP913446 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000030_D01 119 Adiantum capillus-veneris mRNA. clone: YMU001_000030_D01. BP913446 - Show BP91...is mRNA. clone: YMU001_000030_D01. Accession BP913446 Tissue type prothallium Developmental stage - Contig I...a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...1997), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91

  11. AcEST: BP918227 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000111_A05 484 Adiantum capillus-veneris mRNA. clone: YMU001_000111_A05. BP918227 - Show BP91...is mRNA. clone: YMU001_000111_A05. Accession BP918227 Tissue type prothallium Developmental stage - Contig I...ST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...otein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918227|Adiantum capillus-veneris m

  12. AcEST: BP914810 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000063_B04 529 Adiantum capillus-veneris mRNA. clone: YMU001_000063_B04. BP914810 - Show BP91...is mRNA. clone: YMU001_000063_B04. Accession BP914810 Tissue type prothallium Developmental stage - Contig I...a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914810|Adiantum capillus-vene

  13. AcEST: BP916458 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000087_H07 567 Adiantum capillus-veneris mRNA. clone: YMU001_000087_H07. BP91...6458 CL1357Contig1 Show BP916458 Clone id YMU001_000087_H07 Library YMU01 Length 567 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000087_H07. Accession BP916458 Tissue type prothallium Developmental stag...f protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP916458|Adiantum capillus-vener...ams, Nucleic Acids Res. 25:3389-3402. Query= BP916458|Adiantum capillus-veneris m

  14. AcEST: BP913846 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000037_A07 572 Adiantum capillus-veneris mRNA. clone: YMU001_000037_A07. BP91...3846 CL1384Contig1 Show BP913846 Clone id YMU001_000037_A07 Library YMU01 Length 572 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000037_A07. Accession BP913846 Tissue type prothallium Developmental stag...AST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913846|...ein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913846|Adiantum capillus-veneris mRN

  15. AcEST: BP914434 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000058_H02 510 Adiantum capillus-veneris mRNA. clone: YMU001_000058_H02. BP914434 - Show BP91...is mRNA. clone: YMU001_000058_H02. Accession BP914434 Tissue type prothallium Developmental stage - Contig I...base search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914434|Adiantum c...eic Acids Res. 25:3389-3402. Query= BP914434|Adiantum capillus-veneris mRNA, clone: YMU001_000058_H02. (510

  16. AcEST: BP915468 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000071_H11 539 Adiantum capillus-veneris mRNA. clone: YMU001_000071_H11. BP915468 - Show BP91...is mRNA. clone: YMU001_000071_H11. Accession BP915468 Tissue type prothallium Developmental stage - Contig I...h programs, Nucleic Acids Res. 25:3389-3402. Query= BP915468|Adiantum capillus-veneris mRNA, clone: YMU001_0...Nucleic Acids Res. 25:3389-3402. Query= BP915468|Adiantum capillus-veneris mRNA, clone: YMU001_000071_H11. (

  17. AcEST: BP912351 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000018_B01 572 Adiantum capillus-veneris mRNA. clone: YMU001_000018_B01. BP912351 - Show BP91...is mRNA. clone: YMU001_000018_B01. Accession BP912351 Tissue type prothallium Developmental stage - Contig I...abase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912351|Adiantum capillus-veneris mRNA, clon...Res. 25:3389-3402. Query= BP912351|Adiantum capillus-veneris mRNA, clone: YMU001_000018_B01. (572 letters) D

  18. AcEST: BP914391 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000058_D05 573 Adiantum capillus-veneris mRNA. clone: YMU001_000058_D05. BP914391 - Show BP91...is mRNA. clone: YMU001_000058_D05. Accession BP914391 Tissue type prothallium Developmental stage - Contig I... a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914391|Adia...se search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914391|Adiantum capillus-veneris mRNA, clone:

  19. AcEST: BP912601 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000020_G08 479 Adiantum capillus-veneris mRNA. clone: YMU001_000020_G08. BP912601 - Show BP91...is mRNA. clone: YMU001_000020_G08. Accession BP912601 Tissue type prothallium Developmental stage - Contig I...ams, Nucleic Acids Res. 25:3389-3402. Query= BP912601|Adiantum capillus-veneris m...ids Res. 25:3389-3402. Query= BP912601|Adiantum capillus-veneris mRNA, clone: YMU

  20. AcEST: BP917239 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000098_B01 229 Adiantum capillus-veneris mRNA. clone: YMU001_000098_B01. BP917239 - Show BP91...is mRNA. clone: YMU001_000098_B01. Accession BP917239 Tissue type prothallium Developmental stage - Contig I...s Res. 25:3389-3402. Query= BP917239|Adiantum capillus-veneris mRNA, clone: YMU001_000098_B01. (229 letters)...Acids Res. 25:3389-3402. Query= BP917239|Adiantum capillus-veneris mRNA, clone: YMU001_000098_B01. (229 lett

  1. AcEST: BP916371 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000087_A02 468 Adiantum capillus-veneris mRNA. clone: YMU001_000087_A02. BP91...6371 CL738Contig1 Show BP916371 Clone id YMU001_000087_A02 Library YMU01 Length 468 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000087_A02. Accession BP916371 Tissue type prothallium Developmental stage...f protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP916371|Adiantum capillus-vener...search programs, Nucleic Acids Res. 25:3389-3402. Query= BP916371|Adiantum capillus-veneris mRNA, clone: YMU

  2. AcEST: BP919424 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000125_A01 525 Adiantum capillus-veneris mRNA. clone: YMU001_000125_A01. BP91...llus-veneris mRNA. clone: YMU001_000125_A01. Accession BP919424 Tissue type prothallium Developmental stage ...rograms, Nucleic Acids Res. 25:3389-3402. Query= BP919424|Adiantum capillus-veneris mRNA, clone: YMU001_0001... protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919424|Adiantum capillus-veneri...9424 CL92Contig1 Show BP919424 Clone id YMU001_000125_A01 Library YMU01 Length 525 Definition Adiantum capi

  3. AcEST: BP919699 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000128_B05 619 Adiantum capillus-veneris mRNA. clone: YMU001_000128_B05. BP919699 - Show BP91...is mRNA. clone: YMU001_000128_B05. Accession BP919699 Tissue type prothallium Developmental stage - Contig I...AST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...LAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919699

  4. AcEST: BP919217 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000122_E10 547 Adiantum capillus-veneris mRNA. clone: YMU001_000122_E10. BP91...9217 CL1907Contig1 Show BP919217 Clone id YMU001_000122_E10 Library YMU01 Length 547 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000122_E10. Accession BP919217 Tissue type prothallium Developmental stag... programs, Nucleic Acids Res. 25:3389-3402. Query= BP919217|Adiantum capillus-ven...ds Res. 25:3389-3402. Query= BP919217|Adiantum capillus-veneris mRNA, clone: YMU001_000122_E10. (547 letters

  5. AcEST: BP915196 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000067_F07 504 Adiantum capillus-veneris mRNA. clone: YMU001_000067_F07. BP915196 - Show BP91...is mRNA. clone: YMU001_000067_F07. Accession BP915196 Tissue type prothallium Developmental stage - Contig I...cleic Acids Res. 25:3389-3402. Query= BP915196|Adiantum capillus-veneris mRNA, cl...ation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91

  6. AcEST: BP919428 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000125_A05 258 Adiantum capillus-veneris mRNA. clone: YMU001_000125_A05. BP919428 - Show BP91...is mRNA. clone: YMU001_000125_A05. Accession BP919428 Tissue type prothallium Developmental stage - Contig I...ds Res. 25:3389-3402. Query= BP919428|Adiantum capillus-veneris mRNA, clone: YMU001_000125_A05. (258 letters... database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919428|Adiantum capillus-veneris mRNA,

  7. AcEST: BP915866 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000078_E10 396 Adiantum capillus-veneris mRNA. clone: YMU001_000078_E10. BP915866 - Show BP91...is mRNA. clone: YMU001_000078_E10. Accession BP915866 Tissue type prothallium Developmental stage - Contig I...base search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915866|Adiantum capillus-veneris mRNA, clone...eic Acids Res. 25:3389-3402. Query= BP915866|Adiantum capillus-veneris mRNA, clone: YMU001_000078_E10. (396

  8. AcEST: BP915840 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000077_G04 452 Adiantum capillus-veneris mRNA. clone: YMU001_000077_G04. BP915840 - Show BP91...is mRNA. clone: YMU001_000077_G04. Accession BP915840 Tissue type prothallium Developmental stage - Contig I...ids Res. 25:3389-3402. Query= BP915840|Adiantum capillus-veneris mRNA, clone: YMU...1997), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91

  9. AcEST: BP919907 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000130_E10 478 Adiantum capillus-veneris mRNA. clone: YMU001_000130_E10. BP919907 - Show BP91...is mRNA. clone: YMU001_000130_E10. Accession BP919907 Tissue type prothallium Developmental stage - Contig I...ams, Nucleic Acids Res. 25:3389-3402. Query= BP919907|Adiantum capillus-veneris m...7), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91

  10. AcEST: BP913868 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000037_C06 506 Adiantum capillus-veneris mRNA. clone: YMU001_000037_C06. BP913868 - Show BP91...is mRNA. clone: YMU001_000037_C06. Accession BP913868 Tissue type prothallium Developmental stage - Contig I...ation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...leic Acids Res. 25:3389-3402. Query= BP913868|Adiantum capillus-veneris mRNA, clone: YMU001_000037_C06. (506

  11. AcEST: BP912814 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000023_B10 584 Adiantum capillus-veneris mRNA. clone: YMU001_000023_B10. BP912814 - Show BP91...is mRNA. clone: YMU001_000023_B10. Accession BP912814 Tissue type prothallium Developmental stage - Contig I...eneration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912814|Adiantum cap...neration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912814|Adiantum capi

  12. AcEST: BP916018 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000082_A07 337 Adiantum capillus-veneris mRNA. clone: YMU001_000082_A07. BP916018 - Show BP91...is mRNA. clone: YMU001_000082_A07. Accession BP916018 Tissue type prothallium Developmental stage - Contig I...1997), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...s Res. 25:3389-3402. Query= BP916018|Adiantum capillus-veneris mRNA, clone: YMU00

  13. AcEST: BP917402 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000100_D05 495 Adiantum capillus-veneris mRNA. clone: YMU001_000100_D05. BP91...7402 CL4144Contig1 Show BP917402 Clone id YMU001_000100_D05 Library YMU01 Length 495 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000100_D05. Accession BP917402 Tissue type prothallium Developmental stag... PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91...n database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917402|Adia

  14. AcEST: BP916186 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000084_C10 463 Adiantum capillus-veneris mRNA. clone: YMU001_000084_C10. BP91...llus-veneris mRNA. clone: YMU001_000084_C10. Accession BP916186 Tissue type prothallium Developmental stage ...programs, Nucleic Acids Res. 25:3389-3402. Query= BP916186|Adiantum capillus-vene...programs, Nucleic Acids Res. 25:3389-3402. Query= BP916186|Adiantum capillus-veneris mRNA, clone: YMU001_000...6186 CL10Contig1 Show BP916186 Clone id YMU001_000084_C10 Library YMU01 Length 463 Definition Adiantum capi

  15. AcEST: BP916854 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000092_F04 355 Adiantum capillus-veneris mRNA. clone: YMU001_000092_F04. BP91...6854 CL1927Contig1 Show BP916854 Clone id YMU001_000092_F04 Library YMU01 Length 355 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000092_F04. Accession BP916854 Tissue type prothallium Developmental stag...ew generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP916854|Adiantum... and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91

  16. AcEST: BP913366 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000029_D12 523 Adiantum capillus-veneris mRNA. clone: YMU001_000029_D12. BP91336...6 CL3662Contig1 Show BP913366 Clone id YMU001_000029_D12 Library YMU01 Length 523 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000029_D12. Accession BP913366 Tissue type prothallium Developmental stag...ST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91336...rotein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913366|Adiantum capillus-veneris

  17. AcEST: BP912336 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000017_H08 357 Adiantum capillus-veneris mRNA. clone: YMU001_000017_H08. BP912336 - Show BP912336...is mRNA. clone: YMU001_000017_H08. Accession BP912336 Tissue type prothallium Developmental stage - Contig I... Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912336...h programs, Nucleic Acids Res. 25:3389-3402. Query= BP912336|Adiantum capillus-veneris mRNA, clone: YMU001_0

  18. AcEST: BP917336 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000099_E08 168 Adiantum capillus-veneris mRNA. clone: YMU001_000099_E08. BP917336 - Show BP917336...is mRNA. clone: YMU001_000099_E08. Accession BP917336 Tissue type prothallium Developmental stage - Contig I...cleic Acids Res. 25:3389-3402. Query= BP917336|Adiantum capillus-veneris mRNA, clone: YMU001_000099_E08. (16...ms, Nucleic Acids Res. 25:3389-3402. Query= BP917336|Adiantum capillus-veneris mRNA, clone: YMU001_000099_E0

  19. AcEST: BP921336 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000148_F04 482 Adiantum capillus-veneris mRNA. clone: YMU001_000148_F04. BP921336... CL35Contig1 Show BP921336 Clone id YMU001_000148_F04 Library YMU01 Length 482 Definition Adiantum capi...llus-veneris mRNA. clone: YMU001_000148_F04. Accession BP921336 Tissue type prothallium Developmental stage ... generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP921336|Adiantum c...rams, Nucleic Acids Res. 25:3389-3402. Query= BP921336|Adiantum capillus-veneris mRNA, clone: YMU001_000148_

  20. AcEST: BP913368 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000029_E02 560 Adiantum capillus-veneris mRNA. clone: YMU001_000029_E02. BP91336...8 CL2735Contig1 Show BP913368 Clone id YMU001_000029_E02 Library YMU01 Length 560 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000029_E02. Accession BP913368 Tissue type prothallium Developmental stag...ion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913368|Adiantum capillus-...base search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913368|Adiantum capillus-veneris mRNA, clone

  1. AcEST: BP913365 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000029_D11 571 Adiantum capillus-veneris mRNA. clone: YMU001_000029_D11. BP91336...5 CL3850Contig1 Show BP913365 Clone id YMU001_000029_D11 Library YMU01 Length 571 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000029_D11. Accession BP913365 Tissue type prothallium Developmental stag...and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91336...eneration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913365|Adiantum cap

  2. AcEST: BP916336 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000086_E08 286 Adiantum capillus-veneris mRNA. clone: YMU001_000086_E08. BP916336 - Show BP916336...is mRNA. clone: YMU001_000086_E08. Accession BP916336 Tissue type prothallium Developmental stage - Contig I...e search programs, Nucleic Acids Res. 25:3389-3402. Query= BP916336|Adiantum capillus-veneris mRNA, clone: Y...tein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP916336|A

  3. AcEST: BP915336 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000070_C12 256 Adiantum capillus-veneris mRNA. clone: YMU001_000070_C12. BP915336... CL2234Contig1 Show BP915336 Clone id YMU001_000070_C12 Library YMU01 Length 256 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000070_C12. Accession BP915336 Tissue type prothallium Developmental stag...se search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915336|Adiantum capillus-veneris mRNA, clone: ...of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915336|Adiantum capillus-vene

  4. AcEST: BP913361 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000029_D07 385 Adiantum capillus-veneris mRNA. clone: YMU001_000029_D07. BP913361 - Show BP91336...is mRNA. clone: YMU001_000029_D07. Accession BP913361 Tissue type prothallium Developmental stage - Contig I...new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913361|Adiantu...rotein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913361|Adiantum capillus-veneris ...17 PE=4 SV=1 Length = 592 Score = 134 bits (336), Expect = 3e-30 Identities = 61/97 (62%), Positives = 75/97

  5. AcEST: BP911838 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000009_G05 504 Adiantum capillus-veneris mRNA. clone: YMU001_000009_G05. BP911838 - Show BP9...is mRNA. clone: YMU001_000009_G05. Accession BP911838 Tissue type prothallium Developmental stage - Contig I...otein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911838|...generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911838|Adiantum ca... (Hsp70/Hs... 65 2e-09 tr|P90647|P90647_ACACA Transformation-sensitive protein homolog ... 64 4e-09 tr|B0JN3

  6. AcEST: BP921694 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000153_A09 574 Adiantum capillus-veneris mRNA. clone: YMU001_000153_A09. BP9...21694 CL1093Contig1 Show BP921694 Clone id YMU001_000153_A09 Library YMU01 Length 574 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000153_A09. Accession BP921694 Tissue type prothallium Developmental stag...neration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP921694|Adiantum capi... generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP921694|Adiantum c

  7. AcEST: BP918933 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000119_C01 478 Adiantum capillus-veneris mRNA. clone: YMU001_000119_C01. BP9...18933 CL1533Contig1 Show BP918933 Clone id YMU001_000119_C01 Library YMU01 Length 478 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000119_C01. Accession BP918933 Tissue type prothallium Developmental stag...ew generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9...ation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918933|Adiantum capillu

  8. AcEST: BP921220 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000147_B06 550 Adiantum capillus-veneris mRNA. clone: YMU001_000147_B06. BP921220 - Show BP921220...is mRNA. clone: YMU001_000147_B06. Accession BP921220 Tissue type prothallium Developmental stage - Contig I...base search programs, Nucleic Acids Res. 25:3389-3402. Query= BP921220|Adiantum capillus-veneris mRNA, clone...database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP921220|Adiantum capillus-veneris mRNA, c

  9. AcEST: BP915220 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000067_H10 510 Adiantum capillus-veneris mRNA. clone: YMU001_000067_H10. BP915220 - Show BP915220...is mRNA. clone: YMU001_000067_H10. Accession BP915220 Tissue type prothallium Developmental stage - Contig I...tion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915220...search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915220|Adiantum capillus-veneris mRNA, clone: YMU

  10. AcEST: BP917220 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000097_G09 125 Adiantum capillus-veneris mRNA. clone: YMU001_000097_G09. BP917220 - Show BP917220...is mRNA. clone: YMU001_000097_G09. Accession BP917220 Tissue type prothallium Developmental stage - Contig I...T and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917220...rotein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917220|Adiantum capillus-veneris

  11. AcEST: BP912209 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000016_D06 540 Adiantum capillus-veneris mRNA. clone: YMU001_000016_D06. BP912209 - Show BP91220...is mRNA. clone: YMU001_000016_D06. Accession BP912209 Tissue type prothallium Developmental stage - Contig I...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912209|Adiantum capillus-veneris... programs, Nucleic Acids Res. 25:3389-3402. Query= BP912209|Adiantum capillus-veneris mRNA, clone: YMU001_00

  12. AcEST: BP912207 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000016_D04 249 Adiantum capillus-veneris mRNA. clone: YMU001_000016_D04. BP912207 - Show BP91220...is mRNA. clone: YMU001_000016_D04. Accession BP912207 Tissue type prothallium Developmental stage - Contig I...I-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91220...SI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91220

  13. AcEST: BP913220 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000027_G12 489 Adiantum capillus-veneris mRNA. clone: YMU001_000027_G12. BP913220 - Show BP913220...is mRNA. clone: YMU001_000027_G12. Accession BP913220 Tissue type prothallium Developmental stage - Contig I...grams, Nucleic Acids Res. 25:3389-3402. Query= BP913220|Adiantum capillus-veneris...LAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913220

  14. AcEST: BP912220 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000016_E08 357 Adiantum capillus-veneris mRNA. clone: YMU001_000016_E08. BP912220 - Show BP912220...is mRNA. clone: YMU001_000016_E08. Accession BP912220 Tissue type prothallium Developmental stage - Contig I...), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912220...PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912220

  15. AcEST: BP912200 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000016_C08 572 Adiantum capillus-veneris mRNA. clone: YMU001_000016_C08. BP91220...0 CL3270Contig1 Show BP912200 Clone id YMU001_000016_C08 Library YMU01 Length 572 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000016_C08. Accession BP912200 Tissue type prothallium Developmental stag...tabase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912200|Adiantum capillus-veneris mRNA, clo...rograms, Nucleic Acids Res. 25:3389-3402. Query= BP912200|Adiantum capillus-vener

  16. AcEST: BP912206 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000016_D03 484 Adiantum capillus-veneris mRNA. clone: YMU001_000016_D03. BP912206 - Show BP91220...is mRNA. clone: YMU001_000016_D03. Accession BP912206 Tissue type prothallium Developmental stage - Contig I...e search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912206|Adiantum capi...-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91220

  17. AcEST: BP919675 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000127_G12 532 Adiantum capillus-veneris mRNA. clone: YMU001_000127_G12. BP919675 - Show BP91967...is mRNA. clone: YMU001_000127_G12. Accession BP919675 Tissue type prothallium Developmental stage - Contig I...ration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91967...ase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919675|Adiantum capillus-veneris mRNA, clone:

  18. AcEST: BP919671 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000127_G08 312 Adiantum capillus-veneris mRNA. clone: YMU001_000127_G08. BP91967...1 CL2222Contig1 Show BP919671 Clone id YMU001_000127_G08 Library YMU01 Length 312 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000127_G08. Accession BP919671 Tissue type prothallium Developmental stag...a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919671|Adian...w generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91967

  19. AcEST: BP911967 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000011_D07 567 Adiantum capillus-veneris mRNA. clone: YMU001_000011_D07. BP911967 - Show BP911967...is mRNA. clone: YMU001_000011_D07. Accession BP911967 Tissue type prothallium Developmental stage - Contig I...ase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911967|Adiantum capillus-veneris mRNA, clone:...eneration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911967|Adiantum cap

  20. AcEST: BP919676 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000127_H01 519 Adiantum capillus-veneris mRNA. clone: YMU001_000127_H01. BP919676 - Show BP91967...is mRNA. clone: YMU001_000127_H01. Accession BP919676 Tissue type prothallium Developmental stage - Contig I...tion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91967...d BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91967

  1. AcEST: BP919678 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000127_H03 321 Adiantum capillus-veneris mRNA. clone: YMU001_000127_H03. BP919678 - Show BP91967...is mRNA. clone: YMU001_000127_H03. Accession BP919678 Tissue type prothallium Developmental stage - Contig I...of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919678|Adiantum capillus-vene...PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91967

  2. AcEST: BP919670 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000127_G07 482 Adiantum capillus-veneris mRNA. clone: YMU001_000127_G07. BP919670 - Show BP91967...is mRNA. clone: YMU001_000127_G07. Accession BP919670 Tissue type prothallium Developmental stage - Contig I...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91967...ed BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91967

  3. AcEST: BP919677 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000127_H02 601 Adiantum capillus-veneris mRNA. clone: YMU001_000127_H02. BP919677 - Show BP91967...is mRNA. clone: YMU001_000127_H02. Accession BP919677 Tissue type prothallium Developmental stage - Contig I...ed BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91967...ucleic Acids Res. 25:3389-3402. Query= BP919677|Adiantum capillus-veneris mRNA, clone: YMU001_000127_H02. (5

  4. AcEST: BP919958 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000131_C03 356 Adiantum capillus-veneris mRNA. clone: YMU001_000131_C03. BP919958 - Show BP91995...is mRNA. clone: YMU001_000131_C03. Accession BP919958 Tissue type prothallium Developmental stage - Contig I...Acids Res. 25:3389-3402. Query= BP919958|Adiantum capillus-veneris mRNA, clone: YMU001_000131_C03. (356 lett...d PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91995

  5. AcEST: BP911995 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000011_G09 447 Adiantum capillus-veneris mRNA. clone: YMU001_000011_G09. BP911995... CL245Contig1 Show BP911995 Clone id YMU001_000011_G09 Library YMU01 Length 447 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000011_G09. Accession BP911995 Tissue type prothallium Developmental stage...grams, Nucleic Acids Res. 25:3389-3402. Query= BP911995|Adiantum capillus-veneris..., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911995

  6. AcEST: BP919959 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000131_C04 203 Adiantum capillus-veneris mRNA. clone: YMU001_000131_C04. BP91995...9 CL3464Contig1 Show BP919959 Clone id YMU001_000131_C04 Library YMU01 Length 203 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000131_C04. Accession BP919959 Tissue type prothallium Developmental stag...-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91995...tabase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919959|Adiantum

  7. AcEST: BP919957 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000131_B12 562 Adiantum capillus-veneris mRNA. clone: YMU001_000131_B12. BP919957 - Show BP91995...is mRNA. clone: YMU001_000131_B12. Accession BP919957 Tissue type prothallium Developmental stage - Contig I...earch programs, Nucleic Acids Res. 25:3389-3402. Query= BP919957|Adiantum capillus-veneris mRNA, clone: YMU0... Res. 25:3389-3402. Query= BP919957|Adiantum capillus-veneris mRNA, clone: YMU001

  8. AcEST: BP919952 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000131_B06 424 Adiantum capillus-veneris mRNA. clone: YMU001_000131_B06. BP919952 - Show BP91995...is mRNA. clone: YMU001_000131_B06. Accession BP919952 Tissue type prothallium Developmental stage - Contig I...ew generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919952|Adiantum...se search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919952|Adiantum capillus-veneris mRNA, clone:

  9. AcEST: BP919950 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000131_B03 423 Adiantum capillus-veneris mRNA. clone: YMU001_000131_B03. BP919950 - Show BP91995...is mRNA. clone: YMU001_000131_B03. Accession BP919950 Tissue type prothallium Developmental stage - Contig I...new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919950|Adiantu...cleic Acids Res. 25:3389-3402. Query= BP919950|Adiantum capillus-veneris mRNA, clone: YMU001_000131_B03. (42

  10. AcEST: BP919954 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000131_B08 462 Adiantum capillus-veneris mRNA. clone: YMU001_000131_B08. BP91995...4 CL3148Contig1 Show BP919954 Clone id YMU001_000131_B08 Library YMU01 Length 462 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000131_B08. Accession BP919954 Tissue type prothallium Developmental stag...programs, Nucleic Acids Res. 25:3389-3402. Query= BP919954|Adiantum capillus-vene...tabase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919954|Adiantum capillus-veneris mRNA, clo

  11. AcEST: BP919956 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000131_B11 358 Adiantum capillus-veneris mRNA. clone: YMU001_000131_B11. BP919956 - Show BP91995...is mRNA. clone: YMU001_000131_B11. Accession BP919956 Tissue type prothallium Developmental stage - Contig I...Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91995...BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91995

  12. AcEST: BP921010 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000144_E04 526 Adiantum capillus-veneris mRNA. clone: YMU001_000144_E04. BP921010 - Show BP921010...is mRNA. clone: YMU001_000144_E04. Accession BP921010 Tissue type prothallium Developmental stage - Contig I...in database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP921010|Adiantum capillus-veneris mRNA...programs, Nucleic Acids Res. 25:3389-3402. Query= BP921010|Adiantum capillus-veneris mRNA, clone: YMU001_000...002030-PA (Fragment) OS=Anopheles gambiae GN=AGAP002030 PE=4 SV=4 Length = 2210 S

  13. AcEST: BP918489 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000114_B02 201 Adiantum capillus-veneris mRNA. clone: YMU001_000114_B02. BP918489 - Show BP9184...is mRNA. clone: YMU001_000114_B02. Accession BP918489 Tissue type prothallium Developmental stage - Contig I...pped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184...otein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918489|Adiantum capillus-veneris m

  14. AcEST: BP918402 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_B01 496 Adiantum capillus-veneris mRNA. clone: YMU001_000113_B01. BP9184...02 CL402Contig1 Show BP918402 Clone id YMU001_000113_B01 Library YMU01 Length 496 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000113_B01. Accession BP918402 Tissue type prothallium Developmental stage...T: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184...ST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918402|A

  15. AcEST: BP918412 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_B12 606 Adiantum capillus-veneris mRNA. clone: YMU001_000113_B12. BP918412 - Show BP9184...is mRNA. clone: YMU001_000113_B12. Accession BP918412 Tissue type prothallium Developmental stage - Contig I...eneration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184...earch programs, Nucleic Acids Res. 25:3389-3402. Query= BP918412|Adiantum capillus-veneris mRNA, clone: YMU0

  16. AcEST: BP913184 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000027_D12 485 Adiantum capillus-veneris mRNA. clone: YMU001_000027_D12. BP913184... CL748Contig1 Show BP913184 Clone id YMU001_000027_D12 Library YMU01 Length 485 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000027_D12. Accession BP913184 Tissue type prothallium Developmental stage...ein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913184|Ad...h programs, Nucleic Acids Res. 25:3389-3402. Query= BP913184|Adiantum capillus-ve

  17. AcEST: BP918421 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_C09 541 Adiantum capillus-veneris mRNA. clone: YMU001_000113_C09. BP9184...21 CL2140Contig1 Show BP918421 Clone id YMU001_000113_C09 Library YMU01 Length 541 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000113_C09. Accession BP918421 Tissue type prothallium Developmental stag...I-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184...n of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918421|Adiantum capillus-ve

  18. AcEST: BP915184 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000067_E05 573 Adiantum capillus-veneris mRNA. clone: YMU001_000067_E05. BP915184 - Show BP915184...is mRNA. clone: YMU001_000067_E05. Accession BP915184 Tissue type prothallium Developmental stage - Contig I...ein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915184|Adiantum capillus-veneris mRN...earch programs, Nucleic Acids Res. 25:3389-3402. Query= BP915184|Adiantum capillus-veneris mRNA, clone: YMU0

  19. AcEST: BP918451 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_F06 261 Adiantum capillus-veneris mRNA. clone: YMU001_000113_F06. BP918451 - Show BP9184...is mRNA. clone: YMU001_000113_F06. Accession BP918451 Tissue type prothallium Developmental stage - Contig I...ch programs, Nucleic Acids Res. 25:3389-3402. Query= BP918451|Adiantum capillus-veneris mRNA, clone: YMU001_...tabase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918451|Adiantum capillus-veneris mRNA, clo

  20. AcEST: BP918444 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_E11 570 Adiantum capillus-veneris mRNA. clone: YMU001_000113_E11. BP918444 - Show BP9184...is mRNA. clone: YMU001_000113_E11. Accession BP918444 Tissue type prothallium Developmental stage - Contig I...tion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918444|Adiantum capillus...base search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918444|Adiantum capillus-veneris mRNA, clone

  1. AcEST: BP918475 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_H07 490 Adiantum capillus-veneris mRNA. clone: YMU001_000113_H07. BP918475 - Show BP9184...is mRNA. clone: YMU001_000113_H07. Accession BP918475 Tissue type prothallium Developmental stage - Contig I...of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918475|Adiantum capillus-vene...ew generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184

  2. AcEST: BP918435 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_E01 558 Adiantum capillus-veneris mRNA. clone: YMU001_000113_E01. BP918435 - Show BP9184...is mRNA. clone: YMU001_000113_E01. Accession BP918435 Tissue type prothallium Developmental stage - Contig I...h programs, Nucleic Acids Res. 25:3389-3402. Query= BP918435|Adiantum capillus-veneris mRNA, clone: YMU001_0... BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184

  3. AcEST: BP918479 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000114_A04 521 Adiantum capillus-veneris mRNA. clone: YMU001_000114_A04. BP918479 - Show BP9184...is mRNA. clone: YMU001_000114_A04. Accession BP918479 Tissue type prothallium Developmental stage - Contig I...w generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184... BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184

  4. AcEST: BP911848 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000009_H04 372 Adiantum capillus-veneris mRNA. clone: YMU001_000009_H04. BP911848 - Show BP91184...is mRNA. clone: YMU001_000009_H04. Accession BP911848 Tissue type prothallium Developmental stage - Contig I...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911848|Adiantum capillus-veneris...n of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911848|Adiantum capillus-ve

  5. AcEST: BP918425 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_D02 396 Adiantum capillus-veneris mRNA. clone: YMU001_000113_D02. BP9184...25 CL2176Contig1 Show BP918425 Clone id YMU001_000113_D02 Library YMU01 Length 396 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000113_D02. Accession BP918425 Tissue type prothallium Developmental stag...T: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918425|Ad...ic Acids Res. 25:3389-3402. Query= BP918425|Adiantum capillus-veneris mRNA, clone

  6. AcEST: BP918468 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_G12 202 Adiantum capillus-veneris mRNA. clone: YMU001_000113_G12. BP918468 - Show BP9184...is mRNA. clone: YMU001_000113_G12. Accession BP918468 Tissue type prothallium Developmental stage - Contig I...T: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918468|Ad...tion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918468|Adiantum capillus

  7. AcEST: BP918411 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_B11 488 Adiantum capillus-veneris mRNA. clone: YMU001_000113_B11. BP9184...11 CL3724Contig1 Show BP918411 Clone id YMU001_000113_B11 Library YMU01 Length 488 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000113_B11. Accession BP918411 Tissue type prothallium Developmental stag...rch programs, Nucleic Acids Res. 25:3389-3402. Query= BP918411|Adiantum capillus-...), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184

  8. AcEST: BP918431 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_D08 339 Adiantum capillus-veneris mRNA. clone: YMU001_000113_D08. BP9184...31 CL1749Contig1 Show BP918431 Clone id YMU001_000113_D08 Library YMU01 Length 339 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000113_D08. Accession BP918431 Tissue type prothallium Developmental stag...on of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918431|Adiantum capillus-v...eneration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184

  9. AcEST: BP918449 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_F04 232 Adiantum capillus-veneris mRNA. clone: YMU001_000113_F04. BP918449 - Show BP9184...is mRNA. clone: YMU001_000113_F04. Accession BP918449 Tissue type prothallium Developmental stage - Contig I...eneration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918449|Adiantum cap...s. 25:3389-3402. Query= BP918449|Adiantum capillus-veneris mRNA, clone: YMU001_000113_F04. (232 letters) Dat

  10. AcEST: BP918459 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_G02 467 Adiantum capillus-veneris mRNA. clone: YMU001_000113_G02. BP918459 - Show BP9184...is mRNA. clone: YMU001_000113_G02. Accession BP918459 Tissue type prothallium Developmental stage - Contig I...base search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918459|Adiantum c..., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184

  11. AcEST: BP911842 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000009_G09 574 Adiantum capillus-veneris mRNA. clone: YMU001_000009_G09. BP91184...2 CL578Contig1 Show BP911842 Clone id YMU001_000009_G09 Library YMU01 Length 574 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000009_G09. Accession BP911842 Tissue type prothallium Developmental stage...AST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911842|...: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91184

  12. AcEST: BP918184 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000110_E05 469 Adiantum capillus-veneris mRNA. clone: YMU001_000110_E05. BP918184... CL72Contig1 Show BP918184 Clone id YMU001_000110_E05 Library YMU01 Length 469 Definition Adiantum capi...llus-veneris mRNA. clone: YMU001_000110_E05. Accession BP918184 Tissue type prothallium Developmental stage ...ic Acids Res. 25:3389-3402. Query= BP918184|Adiantum capillus-veneris mRNA, clone... search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918184|Adiantum capillus-veneris mRNA, clone: YM

  13. AcEST: BP911843 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000009_G10 434 Adiantum capillus-veneris mRNA. clone: YMU001_000009_G10. BP911843 - Show BP91184...is mRNA. clone: YMU001_000009_G10. Accession BP911843 Tissue type prothallium Developmental stage - Contig I...SI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91184...earch programs, Nucleic Acids Res. 25:3389-3402. Query= BP911843|Adiantum capillus-veneris mRNA, clone: YMU0

  14. AcEST: BP911847 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000009_H03 495 Adiantum capillus-veneris mRNA. clone: YMU001_000009_H03. BP911847 - Show BP91184...is mRNA. clone: YMU001_000009_H03. Accession BP911847 Tissue type prothallium Developmental stage - Contig I...otein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911847|...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911847|Adiantum capillus-veneris...ogen synthase kinase-3 beta OS=Homo sa... 80 7e-15 sp|P51136|GSK3_DICDI Glycogen synthase kinase-3 OS=Dictyo

  15. AcEST: BP917184 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000097_D02 514 Adiantum capillus-veneris mRNA. clone: YMU001_000097_D02. BP917184 - Show BP917184...is mRNA. clone: YMU001_000097_D02. Accession BP917184 Tissue type prothallium Developmental stage - Contig I...of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917184...e search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917184|Adiantum capillus-veneris mRNA, clone: Y

  16. AcEST: BP912184 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000016_B04 515 Adiantum capillus-veneris mRNA. clone: YMU001_000016_B04. BP912184... CL719Contig1 Show BP912184 Clone id YMU001_000016_B04 Library YMU01 Length 515 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000016_B04. Accession BP912184 Tissue type prothallium Developmental stage...ion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912184...SI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912184

  17. AcEST: BP918416 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_C04 557 Adiantum capillus-veneris mRNA. clone: YMU001_000113_C04. BP918416 - Show BP9184...is mRNA. clone: YMU001_000113_C04. Accession BP918416 Tissue type prothallium Developmental stage - Contig I...ms, Nucleic Acids Res. 25:3389-3402. Query= BP918416|Adiantum capillus-veneris mRNA, clone: YMU001_000113_C0...PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9184

  18. AcEST: BP918458 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_G01 479 Adiantum capillus-veneris mRNA. clone: YMU001_000113_G01. BP9184...58 CL2714Contig1 Show BP918458 Clone id YMU001_000113_G01 Library YMU01 Length 479 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000113_G01. Accession BP918458 Tissue type prothallium Developmental stag... database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918458|Adian...on of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918458|Adiantum capillus-v

  19. AcEST: BP919184 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000122_B11 566 Adiantum capillus-veneris mRNA. clone: YMU001_000122_B11. BP919184 - Show BP919184...is mRNA. clone: YMU001_000122_B11. Accession BP919184 Tissue type prothallium Developmental stage - Contig I...eic Acids Res. 25:3389-3402. Query= BP919184|Adiantum capillus-veneris mRNA, clone: YMU001_000122_B11. (566 ...ation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919184|Adiantum capillu

  20. AcEST: BP918441 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000113_E08 487 Adiantum capillus-veneris mRNA. clone: YMU001_000113_E08. BP9184...41 CL3521Contig1 Show BP918441 Clone id YMU001_000113_E08 Library YMU01 Length 487 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000113_E08. Accession BP918441 Tissue type prothallium Developmental stag...database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918441|Adiant...f protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918441|Adiantum capillus-vener

  1. AcEST: BP912065 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000012_F05 374 Adiantum capillus-veneris mRNA. clone: YMU001_000012_F05. BP912065 - Show BP912065...is mRNA. clone: YMU001_000012_F05. Accession BP912065 Tissue type prothallium Developmental stage - Contig I...search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912065|Adiantum capillus-veneris mRNA, clone: YMU...programs, Nucleic Acids Res. 25:3389-3402. Query= BP912065|Adiantum capillus-vene

  2. AcEST: BP920655 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000139_G12 534 Adiantum capillus-veneris mRNA. clone: YMU001_000139_G12. BP92065...5 CL2395Contig1 Show BP920655 Clone id YMU001_000139_G12 Library YMU01 Length 534 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000139_G12. Accession BP920655 Tissue type prothallium Developmental stag...rograms, Nucleic Acids Res. 25:3389-3402. Query= BP920655|Adiantum capillus-veneris mRNA, clone: YMU001_0001...ase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920655|Adiantum ca

  3. AcEST: BP920657 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000139_H02 176 Adiantum capillus-veneris mRNA. clone: YMU001_000139_H02. BP92065...7 CL2700Contig1 Show BP920657 Clone id YMU001_000139_H02 Library YMU01 Length 176 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000139_H02. Accession BP920657 Tissue type prothallium Developmental stag... of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92065...in database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920657|Adiantum capillus-veneris mRNA

  4. AcEST: BP920656 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000139_H01 499 Adiantum capillus-veneris mRNA. clone: YMU001_000139_H01. BP920656 - Show BP92065...is mRNA. clone: YMU001_000139_H01. Accession BP920656 Tissue type prothallium Developmental stage - Contig I... search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920656|Adiantum capil...LAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92065

  5. AcEST: BP920654 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000139_G11 329 Adiantum capillus-veneris mRNA. clone: YMU001_000139_G11. BP920654 - Show BP92065...is mRNA. clone: YMU001_000139_G11. Accession BP920654 Tissue type prothallium Developmental stage - Contig I...Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92065...grams, Nucleic Acids Res. 25:3389-3402. Query= BP920654|Adiantum capillus-veneris mRNA, clone: YMU001_000139

  6. AcEST: BP920659 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000139_H05 537 Adiantum capillus-veneris mRNA. clone: YMU001_000139_H05. BP92065...9 CL3578Contig1 Show BP920659 Clone id YMU001_000139_H05 Library YMU01 Length 537 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000139_H05. Accession BP920659 Tissue type prothallium Developmental stag...Nucleic Acids Res. 25:3389-3402. Query= BP920659|Adiantum capillus-veneris mRNA, ...AST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920659|

  7. AcEST: BP920652 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000139_G07 435 Adiantum capillus-veneris mRNA. clone: YMU001_000139_G07. BP920652 - Show BP92065...is mRNA. clone: YMU001_000139_G07. Accession BP920652 Tissue type prothallium Developmental stage - Contig I...-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92065... database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920652|Adian

  8. AcEST: BP915489 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000072_C03 508 Adiantum capillus-veneris mRNA. clone: YMU001_000072_C03. BP915489 - Show BP915489...is mRNA. clone: YMU001_000072_C03. Accession BP915489 Tissue type prothallium Developmental stage - Contig I...ic Acids Res. 25:3389-3402. Query= BP915489|Adiantum capillus-veneris mRNA, clone: YMU001_000072_C03. (508 l...Nucleic Acids Res. 25:3389-3402. Query= BP915489|Adiantum capillus-veneris mRNA, clone: YMU001_000072_C03. (

  9. AcEST: BP920158 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_G02 530 Adiantum capillus-veneris mRNA. clone: YMU001_000133_G02. BP92015...8 CL188Contig1 Show BP920158 Clone id YMU001_000133_G02 Library YMU01 Length 530 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000133_G02. Accession BP920158 Tissue type prothallium Developmental stage.... 25:3389-3402. Query= BP920158|Adiantum capillus-veneris mRNA, clone: YMU001_000133_G02. (530 letters) Data... programs, Nucleic Acids Res. 25:3389-3402. Query= BP920158|Adiantum capillus-ven

  10. AcEST: BP920150 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_F04 550 Adiantum capillus-veneris mRNA. clone: YMU001_000133_F04. BP920150 - Show BP92015...is mRNA. clone: YMU001_000133_F04. Accession BP920150 Tissue type prothallium Developmental stage - Contig I...cids Res. 25:3389-3402. Query= BP920150|Adiantum capillus-veneris mRNA, clone: YMU001_000133_F04. (550 lette...c Acids Res. 25:3389-3402. Query= BP920150|Adiantum capillus-veneris mRNA, clone: YMU001_000133_F04. (550 le

  11. AcEST: BP920157 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_G01 550 Adiantum capillus-veneris mRNA. clone: YMU001_000133_G01. BP92015...7 CL541Contig1 Show BP920157 Clone id YMU001_000133_G01 Library YMU01 Length 550 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000133_G01. Accession BP920157 Tissue type prothallium Developmental stage...n database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920157|Adiantum capillus-veneris mRNA,...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920157|Adiantum capillus-veneris

  12. AcEST: BP920153 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_F08 540 Adiantum capillus-veneris mRNA. clone: YMU001_000133_F08. BP920153 - Show BP92015...is mRNA. clone: YMU001_000133_F08. Accession BP920153 Tissue type prothallium Developmental stage - Contig I...search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920153|Adiantum capillus-veneris mRNA, clone: YMU...n of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920153|Adiantum capillus-ve

  13. AcEST: BP920152 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_F06 457 Adiantum capillus-veneris mRNA. clone: YMU001_000133_F06. BP920152 - Show BP92015...is mRNA. clone: YMU001_000133_F06. Accession BP920152 Tissue type prothallium Developmental stage - Contig I...atabase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920152|Adiantu...Res. 25:3389-3402. Query= BP920152|Adiantum capillus-veneris mRNA, clone: YMU001_

  14. AcEST: BP920156 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_F12 587 Adiantum capillus-veneris mRNA. clone: YMU001_000133_F12. BP92015...6 CL200Contig1 Show BP920156 Clone id YMU001_000133_F12 Library YMU01 Length 587 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000133_F12. Accession BP920156 Tissue type prothallium Developmental stage...LAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920156...w generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920156|Adiantum

  15. AcEST: BP920159 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_G03 420 Adiantum capillus-veneris mRNA. clone: YMU001_000133_G03. BP920159 - Show BP92015...is mRNA. clone: YMU001_000133_G03. Accession BP920159 Tissue type prothallium Developmental stage - Contig I... Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92015... BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92015

  16. AcEST: BP920163 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_G08 372 Adiantum capillus-veneris mRNA. clone: YMU001_000133_G08. BP92016...3 CL2472Contig1 Show BP920163 Clone id YMU001_000133_G08 Library YMU01 Length 372 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000133_G08. Accession BP920163 Tissue type prothallium Developmental stag...eneration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920163|Adiantum cap... search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920163|Adiantum capillus-veneris mRNA, clone: YM

  17. AcEST: BP920167 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_H01 152 Adiantum capillus-veneris mRNA. clone: YMU001_000133_H01. BP920167 - Show BP92016...is mRNA. clone: YMU001_000133_H01. Accession BP920167 Tissue type prothallium Developmental stage - Contig I...ids Res. 25:3389-3402. Query= BP920167|Adiantum capillus-veneris mRNA, clone: YMU...LAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920167

  18. AcEST: BP920168 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_H02 390 Adiantum capillus-veneris mRNA. clone: YMU001_000133_H02. BP920168 - Show BP92016...is mRNA. clone: YMU001_000133_H02. Accession BP920168 Tissue type prothallium Developmental stage - Contig I...n database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920168|Adiantum capillus-veneris mRNA,...c Acids Res. 25:3389-3402. Query= BP920168|Adiantum capillus-veneris mRNA, clone: YMU001_000133_H02. (390 le

  19. AcEST: BP920161 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_G06 542 Adiantum capillus-veneris mRNA. clone: YMU001_000133_G06. BP920161 - Show BP92016...is mRNA. clone: YMU001_000133_G06. Accession BP920161 Tissue type prothallium Developmental stage - Contig I...LAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP9201...ped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92016

  20. AcEST: BP920166 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_G12 149 Adiantum capillus-veneris mRNA. clone: YMU001_000133_G12. BP920166 - Show BP92016...is mRNA. clone: YMU001_000133_G12. Accession BP920166 Tissue type prothallium Developmental stage - Contig I...w generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92016...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920166|Adiantum capillus-veneris

  1. AcEST: BP920164 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_G09 447 Adiantum capillus-veneris mRNA. clone: YMU001_000133_G09. BP920164 - Show BP92016...is mRNA. clone: YMU001_000133_G09. Accession BP920164 Tissue type prothallium Developmental stage - Contig I...ST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920164|A...se search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920164|Adiantum cap

  2. AcEST: BP920165 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_G11 301 Adiantum capillus-veneris mRNA. clone: YMU001_000133_G11. BP920165 - Show BP92016...is mRNA. clone: YMU001_000133_G11. Accession BP920165 Tissue type prothallium Developmental stage - Contig I...LAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920165...and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92016

  3. AcEST: BP920169 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000133_H03 505 Adiantum capillus-veneris mRNA. clone: YMU001_000133_H03. BP920169 - Show BP92016...is mRNA. clone: YMU001_000133_H03. Accession BP920169 Tissue type prothallium Developmental stage - Contig I...eration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92016...eneration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920169|Adiantum cap

  4. AcEST: BP917100 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000095_H06 514 Adiantum capillus-veneris mRNA. clone: YMU001_000095_H06. BP917100 - Show BP917100...is mRNA. clone: YMU001_000095_H06. Accession BP917100 Tissue type prothallium Developmental stage - Contig I...otein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917100|... BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP917100

  5. AcEST: BP914100 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000039_H03 542 Adiantum capillus-veneris mRNA. clone: YMU001_000039_H03. BP914100 - Show BP914100...is mRNA. clone: YMU001_000039_H03. Accession BP914100 Tissue type prothallium Developmental stage - Contig I...ams, Nucleic Acids Res. 25:3389-3402. Query= BP914100|Adiantum capillus-veneris mRNA, clone: YMU001_000039_H...ped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP914100

  6. AcEST: BP912100 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000015_B06 447 Adiantum capillus-veneris mRNA. clone: YMU001_000015_B06. BP912100 - Show BP912100...is mRNA. clone: YMU001_000015_B06. Accession BP912100 Tissue type prothallium Developmental stage - Contig I...s. 25:3389-3402. Query= BP912100|Adiantum capillus-veneris mRNA, clone: YMU001_00...e search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912100|Adiantum capi

  7. AcEST: BP919100 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000121_C03 561 Adiantum capillus-veneris mRNA. clone: YMU001_000121_C03. BP919100 - Show BP919100...is mRNA. clone: YMU001_000121_C03. Accession BP919100 Tissue type prothallium Developmental stage - Contig I...ucleic Acids Res. 25:3389-3402. Query= BP919100|Adiantum capillus-veneris mRNA, clone: YMU001_000121_C03. (5...LAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919100

  8. AcEST: BP916100 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000083_B04 427 Adiantum capillus-veneris mRNA. clone: YMU001_000083_B04. BP916100... CL115Contig1 Show BP916100 Clone id YMU001_000083_B04 Library YMU01 Length 427 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000083_B04. Accession BP916100 Tissue type prothallium Developmental stage...s, Nucleic Acids Res. 25:3389-3402. Query= BP916100|Adiantum capillus-veneris mRN... PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP916100

  9. AcEST: BP921006 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000144_D12 494 Adiantum capillus-veneris mRNA. clone: YMU001_000144_D12. BP921006 - Show BP92100...is mRNA. clone: YMU001_000144_D12. Accession BP921006 Tissue type prothallium Developmental stage - Contig I...ion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP921006|Adiantum capillus-...ch programs, Nucleic Acids Res. 25:3389-3402. Query= BP921006|Adiantum capillus-veneris mRNA, clone: YMU001_

  10. AcEST: BP920183 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000134_A07 427 Adiantum capillus-veneris mRNA. clone: YMU001_000134_A07. BP920183 - Show BP92018...is mRNA. clone: YMU001_000134_A07. Accession BP920183 Tissue type prothallium Developmental stage - Contig I...LAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920183...programs, Nucleic Acids Res. 25:3389-3402. Query= BP920183|Adiantum capillus-veneris mRNA, clone: YMU001_000

  11. AcEST: BP920180 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000134_A04 428 Adiantum capillus-veneris mRNA. clone: YMU001_000134_A04. BP920180 - Show BP92018...is mRNA. clone: YMU001_000134_A04. Accession BP920180 Tissue type prothallium Developmental stage - Contig I... a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920180|Adia... Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92018

  12. AcEST: BP920184 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000134_A08 470 Adiantum capillus-veneris mRNA. clone: YMU001_000134_A08. BP920184 - Show BP92018...is mRNA. clone: YMU001_000134_A08. Accession BP920184 Tissue type prothallium Developmental stage - Contig I...ograms, Nucleic Acids Res. 25:3389-3402. Query= BP920184|Adiantum capillus-veneri...ration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920184|Adiantum capill

  13. AcEST: BP912018 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000012_B01 519 Adiantum capillus-veneris mRNA. clone: YMU001_000012_B01. BP912018 - Show BP912018...is mRNA. clone: YMU001_000012_B01. Accession BP912018 Tissue type prothallium Developmental stage - Contig I... new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912018.... 25:3389-3402. Query= BP912018|Adiantum capillus-veneris mRNA, clone: YMU001_000012_B01. (519 letters) Data

  14. AcEST: BP920187 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000134_A12 506 Adiantum capillus-veneris mRNA. clone: YMU001_000134_A12. BP920187 - Show BP92018...is mRNA. clone: YMU001_000134_A12. Accession BP920187 Tissue type prothallium Developmental stage - Contig I...programs, Nucleic Acids Res. 25:3389-3402. Query= BP920187|Adiantum capillus-vene...ograms, Nucleic Acids Res. 25:3389-3402. Query= BP920187|Adiantum capillus-veneris mRNA, clone: YMU001_00013

  15. AcEST: BP913801 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000035_D11 562 Adiantum capillus-veneris mRNA. clone: YMU001_000035_D11. BP913801... CL482Contig1 Show BP913801 Clone id YMU001_000035_D11 Library YMU01 Length 562 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000035_D11. Accession BP913801 Tissue type prothallium Developmental stage...tabase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP913801|Adiantum...earch programs, Nucleic Acids Res. 25:3389-3402. Query= BP913801|Adiantum capillus-veneris mRNA, clone: YMU0

  16. AcEST: BP918013 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000108_F01 490 Adiantum capillus-veneris mRNA. clone: YMU001_000108_F01. BP918013 - Show BP91801...is mRNA. clone: YMU001_000108_F01. Accession BP918013 Tissue type prothallium Developmental stage - Contig I...protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91801...idylinositol-4-phosphate 5-kinase 1 OS=Oryza sativa subsp. japonica GN=PIPK1 PE=2 SV=2 Length = 801 Score = ..., Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91801

  17. AcEST: BP920801 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000141_G10 454 Adiantum capillus-veneris mRNA. clone: YMU001_000141_G10. BP920801... CL819Contig1 Show BP920801 Clone id YMU001_000141_G10 Library YMU01 Length 454 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000141_G10. Accession BP920801 Tissue type prothallium Developmental stage... Acids Res. 25:3389-3402. Query= BP920801|Adiantum capillus-veneris mRNA, clone: ...ion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920801|Adiantum capillus-

  18. AcEST: BP918017 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000108_F05 267 Adiantum capillus-veneris mRNA. clone: YMU001_000108_F05. BP918017 - Show BP91801...is mRNA. clone: YMU001_000108_F05. Accession BP918017 Tissue type prothallium Developmental stage - Contig I...otein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918017|Adiantum capillus-veneris m...cleic Acids Res. 25:3389-3402. Query= BP918017|Adiantum capillus-veneris mRNA, clone: YMU001_000108_F05. (26

  19. AcEST: BP918018 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000108_F06 436 Adiantum capillus-veneris mRNA. clone: YMU001_000108_F06. BP918018 - Show BP91801...is mRNA. clone: YMU001_000108_F06. Accession BP918018 Tissue type prothallium Developmental stage - Contig I...cids Res. 25:3389-3402. Query= BP918018|Adiantum capillus-veneris mRNA, clone: YM...and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91801

  20. AcEST: BP912801 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000023_A07 527 Adiantum capillus-veneris mRNA. clone: YMU001_000023_A07. BP912801 - Show BP912801...is mRNA. clone: YMU001_000023_A07. Accession BP912801 Tissue type prothallium Developmental stage - Contig I...w generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912801...es. 25:3389-3402. Query= BP912801|Adiantum capillus-veneris mRNA, clone: YMU001_0

  1. AcEST: BP918012 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000108_E12 547 Adiantum capillus-veneris mRNA. clone: YMU001_000108_E12. BP918012 - Show BP91801...is mRNA. clone: YMU001_000108_E12. Accession BP918012 Tissue type prothallium Developmental stage - Contig I...grams, Nucleic Acids Res. 25:3389-3402. Query= BP918012|Adiantum capillus-veneris mRNA, clone: YMU001_000108...ms, Nucleic Acids Res. 25:3389-3402. Query= BP918012|Adiantum capillus-veneris mRNA, clone: YMU001_000108_E1

  2. AcEST: BP911801 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000009_C12 487 Adiantum capillus-veneris mRNA. clone: YMU001_000009_C12. BP911801 - Show BP911801...is mRNA. clone: YMU001_000009_C12. Accession BP911801 Tissue type prothallium Developmental stage - Contig I...generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911801.... 25:3389-3402. Query= BP911801|Adiantum capillus-veneris mRNA, clone: YMU001_000

  3. AcEST: BP918801 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000117_F03 542 Adiantum capillus-veneris mRNA. clone: YMU001_000117_F03. BP918801 - Show BP918801...is mRNA. clone: YMU001_000117_F03. Accession BP918801 Tissue type prothallium Developmental stage - Contig I...earch programs, Nucleic Acids Res. 25:3389-3402. Query= BP918801|Adiantum capillus-veneris mRNA, clone: YMU0...generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP918801|Adiantum ca

  4. AcEST: BP916801 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000091_G06 127 Adiantum capillus-veneris mRNA. clone: YMU001_000091_G06. BP916801... CL2168Contig1 Show BP916801 Clone id YMU001_000091_G06 Library YMU01 Length 127 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000091_G06. Accession BP916801 Tissue type prothallium Developmental stag...ds Res. 25:3389-3402. Query= BP916801|Adiantum capillus-veneris mRNA, clone: YMU0...a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP916801

  5. AcEST: BP915801 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000077_B02 555 Adiantum capillus-veneris mRNA. clone: YMU001_000077_B02. BP915801 - Show BP915801...is mRNA. clone: YMU001_000077_B02. Accession BP915801 Tissue type prothallium Developmental stage - Contig I... Nucleic Acids Res. 25:3389-3402. Query= BP915801|Adiantum capillus-veneris mRNA, clone: YMU001_000077_B02. ...ST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP915801|A

  6. AcEST: BP918015 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000108_F03 437 Adiantum capillus-veneris mRNA. clone: YMU001_000108_F03. BP918015 - Show BP91801...is mRNA. clone: YMU001_000108_F03. Accession BP918015 Tissue type prothallium Developmental stage - Contig I.... 25:3389-3402. Query= BP918015|Adiantum capillus-veneris mRNA, clone: YMU001_000108_F03. (437 letters) Data...eration of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91801

  7. AcEST: BP921801 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000154_C09 317 Adiantum capillus-veneris mRNA. clone: YMU001_000154_C09. BP921801 - Show BP921801...is mRNA. clone: YMU001_000154_C09. Accession BP921801 Tissue type prothallium Developmental stage - Contig I...T: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP921801|Ad...c Acids Res. 25:3389-3402. Query= BP921801|Adiantum capillus-veneris mRNA, clone: YMU001_000154_C09. (317 le

  8. AcEST: BP911984 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000011_F07 566 Adiantum capillus-veneris mRNA. clone: YMU001_000011_F07. BP911984... CL2332Contig1 Show BP911984 Clone id YMU001_000011_F07 Library YMU01 Length 566 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000011_F07. Accession BP911984 Tissue type prothallium Developmental stag...tein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911984|Adiantum capillus-veneris mR...I-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP911984

  9. AcEST: BP919847 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000129_H01 512 Adiantum capillus-veneris mRNA. clone: YMU001_000129_H01. BP919847 - Show BP91984...is mRNA. clone: YMU001_000129_H01. Accession BP919847 Tissue type prothallium Developmental stage - Contig I... new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP91984...earch programs, Nucleic Acids Res. 25:3389-3402. Query= BP919847|Adiantum capillus-veneris mRNA, clone: YMU0

  10. AcEST: BP919842 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000129_G07 567 Adiantum capillus-veneris mRNA. clone: YMU001_000129_G07. BP919842 - Show BP91984...is mRNA. clone: YMU001_000129_G07. Accession BP919842 Tissue type prothallium Developmental stage - Contig I...otein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919842|Adiantum capillus-veneris m...c Acids Res. 25:3389-3402. Query= BP919842|Adiantum capillus-veneris mRNA, clone: YMU001_000129_G07. (567 le

  11. AcEST: BP919849 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000129_H04 454 Adiantum capillus-veneris mRNA. clone: YMU001_000129_H04. BP919849 - Show BP91984...is mRNA. clone: YMU001_000129_H04. Accession BP919849 Tissue type prothallium Developmental stage - Contig I...s. 25:3389-3402. Query= BP919849|Adiantum capillus-veneris mRNA, clone: YMU001_00...rograms, Nucleic Acids Res. 25:3389-3402. Query= BP919849|Adiantum capillus-veneris mRNA, clone: YMU001_0001

  12. AcEST: BP919845 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000129_G11 376 Adiantum capillus-veneris mRNA. clone: YMU001_000129_G11. BP919845 - Show BP91984...is mRNA. clone: YMU001_000129_G11. Accession BP919845 Tissue type prothallium Developmental stage - Contig I...ms, Nucleic Acids Res. 25:3389-3402. Query= BP919845|Adiantum capillus-veneris mRNA, clone: YMU001_000129_G1...tion of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919845|Adiantum capillus

  13. AcEST: BP919843 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000129_G09 473 Adiantum capillus-veneris mRNA. clone: YMU001_000129_G09. BP91984...3 CL2697Contig1 Show BP919843 Clone id YMU001_000129_G09 Library YMU01 Length 473 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000129_G09. Accession BP919843 Tissue type prothallium Developmental stag...ein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919843|Ad...rotein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919843|Adiantum capillus-veneris

  14. AcEST: BP919840 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000129_G05 476 Adiantum capillus-veneris mRNA. clone: YMU001_000129_G05. BP919840 - Show BP91984...is mRNA. clone: YMU001_000129_G05. Accession BP919840 Tissue type prothallium Developmental stage - Contig I...Res. 25:3389-3402. Query= BP919840|Adiantum capillus-veneris mRNA, clone: YMU001_...es. 25:3389-3402. Query= BP919840|Adiantum capillus-veneris mRNA, clone: YMU001_0

  15. AcEST: BP920064 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000132_F03 528 Adiantum capillus-veneris mRNA. clone: YMU001_000132_F03. BP920064 - Show BP92006...is mRNA. clone: YMU001_000132_F03. Accession BP920064 Tissue type prothallium Developmental stage - Contig I...AST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92006...abase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920064|Adiantum capillus-veneris mRNA, clon

  16. AcEST: BP920063 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000132_F02 447 Adiantum capillus-veneris mRNA. clone: YMU001_000132_F02. BP92006...3 CL3872Contig1 Show BP920063 Clone id YMU001_000132_F02 Library YMU01 Length 447 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000132_F02. Accession BP920063 Tissue type prothallium Developmental stag... Acids Res. 25:3389-3402. Query= BP920063|Adiantum capillus-veneris mRNA, clone: ...T: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP920063|Ad

  17. AcEST: BP920060 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000132_E11 498 Adiantum capillus-veneris mRNA. clone: YMU001_000132_E11. BP92006...0 CL3922Contig1 Show BP920060 Clone id YMU001_000132_E11 Library YMU01 Length 498 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000132_E11. Accession BP920060 Tissue type prothallium Developmental stag...ation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92006...s Res. 25:3389-3402. Query= BP920060|Adiantum capillus-veneris mRNA, clone: YMU00

  18. AcEST: BP912006 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000011_H11 529 Adiantum capillus-veneris mRNA. clone: YMU001_000011_H11. BP912006... CL1611Contig1 Show BP912006 Clone id YMU001_000011_H11 Library YMU01 Length 529 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000011_H11. Accession BP912006 Tissue type prothallium Developmental stag... Res. 25:3389-3402. Query= BP912006|Adiantum capillus-veneris mRNA, clone: YMU001_000011_H11. (529 letters) ...BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912006

  19. AcEST: BP920069 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000132_F08 472 Adiantum capillus-veneris mRNA. clone: YMU001_000132_F08. BP920069 - Show BP92006...is mRNA. clone: YMU001_000132_F08. Accession BP920069 Tissue type prothallium Developmental stage - Contig I...ch programs, Nucleic Acids Res. 25:3389-3402. Query= BP920069|Adiantum capillus-v... Nucleic Acids Res. 25:3389-3402. Query= BP920069|Adiantum capillus-veneris mRNA, clone: YMU001_000132_F08.

  20. AcEST: BP920065 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000132_F04 467 Adiantum capillus-veneris mRNA. clone: YMU001_000132_F04. BP92006...5 CL2488Contig1 Show BP920065 Clone id YMU001_000132_F04 Library YMU01 Length 467 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000132_F04. Accession BP920065 Tissue type prothallium Developmental stag...arch programs, Nucleic Acids Res. 25:3389-3402. Query= BP920065|Adiantum capillus...LAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP92006