
Sample records for bozemanii primer reporte

  1. Simultaneous detection of Legionella species and L. anisa, L. bozemanii, L. longbeachae and L. micdadei using conserved primers and multiple probes in a multiplex real-time PCR assay. (United States)

    Cross, Kristen E; Mercante, Jeffrey W; Benitez, Alvaro J; Brown, Ellen W; Diaz, Maureen H; Winchell, Jonas M


    Legionnaires' disease is a severe respiratory disease that is estimated to cause between 8,000 and 18,000 hospitalizations each year, though the exact burden is unknown due to under-utilization of diagnostic testing. Although Legionella pneumophila is the most common species detected in clinical cases (80-90%), other species have also been reported to cause disease. However, little is known about Legionnaires' disease caused by these non-pneumophila species. We designed a multiplex real-time PCR assay for detection of all Legionella spp. and simultaneous specific identification of four clinically-relevant Legionella species, L. anisa, L. bozemanii, L. longbeachae, and L. micdadei, using 5'-hydrolysis probe real-time PCR. The analytical sensitivity for detection of nucleic acid from each target species was ≤50fg per reaction. We demonstrated the utility of this assay in spiked human sputum specimens. This assay could serve as a tool for understanding the scope and impact of non-pneumophila Legionella species in human disease.


    Directory of Open Access Journals (Sweden)

    Jorge Alexander QUIRÓS-RODRÍGUEZ


    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin- Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito, Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.


    Directory of Open Access Journals (Sweden)

    Jorge Alexander QUIROZ-RODRÍGUEZ


    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin-Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito en el departamento de Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.First Report of Family Cheiridiidae (Arachnida: Pseudoscorpionida in ColombiaDuring a study of the arthropod fauna associated with mounds of detritus produced by Atta colombica (Hymenoptera: Formicidae in the Santa Isabel estate, locality of Patio Bonito, Department of Córdoba, were found representatives of the family Cheiridiidae. Therefore, these pseudoscorpions becomes in the first report of the family to Colombia and for the first time is recorded its presence in ant detritus. Also, this report extends its known distribution range in South America.   

  4. DNA sequencing technology, walking with modular primers. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Ulanovsky, L.


    The success of the Human Genome Project depends on the development of adequate technology for rapid and inexpensive DNA sequencing, which will also benefit biomedical research in general. The authors are working on DNA technologies that eliminate primer synthesis, the main bottleneck in sequencing by primer walking. They have developed modular primers that are assembled from three 5-mer, 6-mer or 7-mer modules selected from a presynthesized library of as few as 1,000 oligonucleotides ({double_bond}4, {double_bond}5, {double_bond}7). The three modules anneal contiguously at the selected template site and prime there uniquely, even though each is not unique for the most part when used alone. This technique is expected to speed up primer walking 30 to 50 fold, and reduce the sequencing cost by a factor of 5 to 15. Time and expensive will be saved on primer synthesis itself and even more so due to closed-loop automation of primer walking, made possible by the instant availability of primers. Apart from saving time and cost, closed-loop automation would also minimize the errors and complications associated with human intervention between the walks. The author has also developed two additional approaches to primer-library based sequencing. One involves a branched structure of modular primers which has a distinctly different mechanism of achieving priming specificity. The other introduces the concept of ``Differential Extension with Nucleotide Subsets`` as an approach increasing priming specificity, priming strength and allowing cycle sequencing. These approaches are expected to be more robust than the original version of the modular primer technique.

  5. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.


    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  6. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  7. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza


    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  8. Detection of cell-associated or soluble antigens of Legionella pneumophila serogroups 1 to 6, Legionella bozemanii, Legionella dumoffii, Legionella gormanii, and Legionella micdadei by staphylococcal coagglutination tests.


    Wilkinson, H W; Fikes, B J


    Current methods used for the detection of whole-cell isolates of Legionella or for the detection of Legionella soluble antigens are technically impractical for many clinical laboratories. The purpose of this study was to explore practical alternatives. The results showed that whole cell isolates of Legionella pneumophila serogroups 1 to 6, Legionella bozemanii, Legionella dumoffii, Legionella gormanii, and Legionella micdadei were identified specifically by a simple slide agglutination test o...

  9. Clorhidrorrea congénita:: primer reporte en Cuba Congenital chlorhydria:: first report in Cuba

    Directory of Open Access Journals (Sweden)

    Carlos Ramírez Pérez


    Full Text Available En el presente trabajo se exponen los antecedentes prenatales, perinatales y posnatales de un lactante de 6 meses de edad, del sexo masculino, con clorhidrorrea congénita, así como el cuadro clínico, diagnóstico y tratamiento utilizado. Un elemento significativo lo constituyó la expulsión anal de abundante líquido no meconial desde las primeras horas de nacido, así como alcalosis metabólica grave y la presencia de desnutrición rápidamente progresiva. En los exámenes complementarios se constató hipocloremia de un 50 % con respecto a las cifras de referencia y un pH sanguíneo mayor de 7,50. El diagnóstico confirmatorio se obtuvo al comprobar concentraciones de cloro en heces fecales superiores a las de la suma de sodio y potasio. Se proponen indicadores diagnósticos prenatales entre los que tienen gran valor la consanguinidad, el polihidramnios y los resultados del ultrasonido en el tercer trimestre del embarazo. El diagnóstico precoz permitió establecer el tratamiento y evitó el frecuente desenlace fatal. Es el primer caso de esta enfermedad que se informa en el país.In present paper are showed the prenatal, perinatal and postnatal backgrounds from a male breast-fed baby aged 6 months presenting with congenital chlorhydria, as well as the clinical picture, diagnosis and treatment applied. A significant element was the anal expulsion of non-meconium abundant fluid from the first hours of born, as well as a severe metabolic alkalosis and the presence of a quickly progressive malnutrition. In complementary examinations was confirmed a 50% hypochloremia regarding the reference figures and a blood pH over 7,50. Confirmatory diagnosis was achieved verifying the chlorine concentrations in feces higher to that of the sum of sodium and potassium. Prenatal diagnostic indicators are proposed those with higher value including the consanguinity, polyhydramnios and the US results during the third trimester of pregnancy. Early diagnosis

  10. Measuring reporting verifying. A primer on MRV for nationally appropriate mitigation actions

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (ed.); Luetken, S.; Holm Olsen, K. (Technical Univ. of Denmark. UNEP Risoe Centre, Roskilde (Denmark)); Aalders, E.; Pretlove, B.; Peters, N. (Det Norske Veritas, Hellerup (Denmark))


    The requirements for measurement, reporting and verification (MRV) of nationally appropriate mitigation actions (NAMAs) are one of the crucial topics on the agenda of international negotiations to address climate change mitigation. According to agreements so far, the general guidelines for domestic MRV are to be developed by Subsidiary Body for Scientific and Technological Advice (SBSTA)1. Further, the Subsidiary Body for Implementation (SBI) will be conducting international consultations and analysis (ICA) of biennial update reports (BUR) to improve transparency of mitigation actions, which should be measured, reported and verified. 2. What is clear from undergoing discussions both at SBSTA and at SBI is that MRV for NAMAs should not be a burden for controlling greenhouse gas (GHG) emissions connected to economic activities. Instead, the MRV process should facilitate mitigation actions; encourage the redirection of investments and address concerns regarding carbon content of emission intensive operations of private and public companies and enterprises worldwide. While MRV requirements are being shaped within the Convention, there are a number of initiatives supporting developing countries moving forward with NAMA development and demonstration activities. How these actions shall be measured, reported and verified, however, remain unanswered. MRV is not new. It is present in most existing policies and frameworks related to climate change mitigation. With an aim to contribute to international debate and capacity building on this crucial issue, the UNEP Risoe Centre in cooperation with UNDP, are pleased to present this publication that through the direct collaboration with Det Norske Veritas (DNV) builds on existing MRV practices in current carbon markets; provides insights on how MRV for NAMAs can be performed and identifies elements and drivers to be considered when designing adequate MRV systems for NAMAs in developing countries. This primer is the second

  11. Primer reporte del empleo de marcadores ISTR en Cactaceae (Pilosocereus sp

    Directory of Open Access Journals (Sweden)

    Grecia Montalvo Fernández


    Full Text Available Título en inglés: First report of the employment of ISTR markers in Cactaceae (Pilosocereus sp Resumen Pilosocereus sp es una especie en peligro crítico de extinción, la única población conocida se encuentra en una mina de mármol verde, hoy abandonada, en la que su explotación produjo la disminución del 80% de la población en 3 años; en la actualidad quedan 28 ejemplares, de ellos unos pocos son adultos, de los cuales solo dos producen frutos. Una de las etapas necesaria para su recuperación es la producción de plántulas para realizar el reforzamiento de la población natural. Como las plantas obtenidas serán plantadas en condiciones naturales, donde se enfrentarán a diversas situaciones ambientales, es conveniente realizar un estudio de diversidad genética. El objetivo de este trabajo fue estimar la variabilidad genética de plántulas de Pilosocereus sp empleando la técnica Inverse Sequence Tagged Repeat (ISTR. Se realizó la germinación in vitro de semillas y se determinó la variabilidad genética de las plántulas obtenidas. Con el análisis molecular se detectaron un total de 97 bandas, de ellas el 62,8% fueron polimórficas. El mayor porcentaje de bandas polimórficas (85,7% se obtuvo con la combinación de oligonucleótidos F6/B6. Con las combinaciones de oligonucleótidos empleados se detectaron de 4 a 6 patrones de banda diferentes. La heterocigosidad media esperada fue de 0,39. Palabras clave: Cactaceae; variabilidad; extinción; polimorfismo. Abstract Pilosocereus sp is a species in critical extinction danger, the only known population is in a mine of green marble, abandoned today, but it exploitation produced the decrease of the population's 80% in 3 years, at the present time they are 28 individuals, of them some few ones are mature, of those which alone two produce fruits. One of the necessary stages for their recovery is the seedlings production to carry out the natural population's reinforcement. As the

  12. Primer reporte de empleo de marcadores AFLP en Asteraceae en Cuba

    Directory of Open Access Journals (Sweden)

    Grecia Montalvo Fernández


    Full Text Available Título en ingles: First report of the employment of AFLP markers in Asteraceae in Cuba. Resumen: Rhodogeron coronopifolius Griseb., es una especie vegetal de la familia Asteraceae, que se encuentra en peligro crítico de extinción. Es endémico de la provincia Villa Clara en la región central de Cuba. Habita en el matorral xeromorfo sub espinoso sobre serpentina. Existen solo cinco poblaciones naturales dentro de un área protegida, la principal causa de amenaza es la fragmentación de su hábitat por acciones antrópicas. Debido a su situación de conservación, se hace necesario realizar estudios de la diversidad genética de las poblaciones naturales para así generar información básica y diseñar una estrategia de conservación. El objetivo de este trabajo fue analizar de manera preliminar la diversidad genética de cuatro poblaciones de esta especie utilizando marcadores AFLP (Polimorfismo de Longitud de Fragmentos Amplificados. Se emplearon dos combinaciones de iniciadores y se evaluó el porcentaje de polimorfismo así como la similitud entre los individuos.  Se obtuvieron 165 loci de los cuales el 78,7 % fueron polimórficos. La población de mayor polimorfismo fue Corojito con 85,2%, de manera general el polimorfismo fue alto con valores entre 75 y  87%. La similitud entre los individuos también fue alta con un promedio de 0,74. El agrupamiento genético fue independiente a la población de procedencia, lo que sugiere que existe intercambio genético entre las poblaciones y que estas comparten más del 80 % de los alelos que fueron analizados. Los resultados obtenidos son importantes para el mantenimiento in situ de la especie y para tomar decisiones en aras de su conservación. Palabras clave: Rhodogeron coronopifolius, peligro de extinción, polimorfismo, conservación. Abstract: Rhodogeron coronopifolius Griseb., is a specie of Asteraceae family, in critical danger of extinction. It is an endemic of Villa Clara city in the

  13. Primer reporte de miasis hospitalaria por Lucilia cuprina (Diptera: Calliphoridae en Costa Rica

    Directory of Open Access Journals (Sweden)

    Lucía Quesada-Lobo


    Full Text Available Introducción. Las miasis hospitalarias son entidades con una importancia manifiesta en salud pública. La documentación de este tipo de casos es escasa en la literatura biomédica regional y mundial. Objetivo. Informar un caso de miasis hospitalaria en Costa Rica, donde el agente etiológico implicado fue Lucilia cuprina (Diptera: Calliphoridae. Este caso de miasis hospitalaria figura como el primer informe para Latinoamérica asociado con este agente etiológico. Presentación del caso. Una paciente de 91 años de edad, con signos de inmunosupresión, afectación grave de la función pulmonar y asistencia respiratoria mecánica, presentó larvas en ambas fosas nasales al séptimo día después del ingreso hospitalario. Varios ejemplares fueron recolectados y procesados para su identificación. La identificación taxonómica de los ejemplares recolectados estableció que la especie de los muscomorfos correspondía a L. cuprina. Conclusión. El presente constituye el primer caso de miasis hospitalaria por L. cuprina en la literatura biomédica de Costa Rica y el primero registrado en Latinoamérica.   doi:


    Energy Technology Data Exchange (ETDEWEB)

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine


    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  15. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  16. VGRAF primer

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, G.C.; Thompson, S.L.


    VGRAF is a powerful FORTRAN program which is designed to produce professional-quality color slides, viewgraphs, posters, and data plots for presentations or reports. The program is easy to use and requires no a priori knowledge of a programming language and little or no previous programming experience. This report describes a subset of the VGRAF commands which will enable the user to make very simple plots. For enhanced plotting, the user is referred to SAND79-2147.

  17. Infección pulmonar por Mycobacterium avium en paciente VIH/SIDA: Primer reporte en Perú

    Directory of Open Access Journals (Sweden)

    Juan Carrasco

    Full Text Available El complejo Mycobacterium avium (MAC es un patógeno que se encuentra en el medioambiente y causa infecciones tanto en pacientes inmunocompetentes como inmunocomprometidos. Se presenta el caso de un paciente VIH positivo varón de 38 años infectado por P. jirovecii y aparentemente infectado por Mycobacterium tuberculosis desde el año 2009, el cual fue tratado con antibioticoterapia para pneumocistosis y terapia antituberculosis (TB logrando mejoría parcial. En el año 2012 se le realizó nuevamente examen de cultivo y un nuevo tratamiento anti TB, frente a la sospecha de estar en presencia de una cepa de TB multidrogorresistente se recomienda realizar la identificación micobacteriana. El examen de cultivo fue positivo y el resultado genotípico resultó positivo para MAC. Se reporta el primer caso de un paciente VIH/SIDA con infección pulmonar por MAC en el Perú, así como una breve revisión de los aspectos epidemiológicos, clínicos y de tratamiento

  18. Infección pulmonar por Mycobacterium avium en paciente VIH/SIDA: Primer reporte en Perú

    Directory of Open Access Journals (Sweden)

    Juan Carrasco


    Full Text Available El complejo Mycobacterium avium (MAC es un patógeno que se encuentra en el medioambiente y causa infecciones tanto en pacientes inmunocompetentes como inmunocomprometidos. Se presenta el caso de un paciente VIH positivo varón de 38 años infectado por P. jirovecii y aparentemente infectado por Mycobacterium tuberculosis desde el año 2009, el cual fue tratado con antibioticoterapia para pneumocistosis y terapia antituberculosis (TB logrando mejoría parcial. En el año 2012 se le realizó nuevamente examen de cultivo y un nuevo tratamiento anti TB, frente a la sospecha de estar en presencia de una cepa de TB multidrogorresistente se recomienda realizar la identificación micobacteriana. El examen de cultivo fue positivo y el resultado genotípico resultó positivo para MAC. Se reporta el primer caso de un paciente VIH/SIDA con infección pulmonar por MAC en el Perú, así como una breve revisión de los aspectos epidemiológicos, clínicos y de tratamiento

  19. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation. (United States)

    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades


    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  20. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.


    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  1. PRISE (PRImer SElector): software for designing sequence-selective PCR primers. (United States)

    Fu, Qi; Ruegger, Paul; Bent, Elizabeth; Chrobak, Marek; Borneman, James


    This report presents PRImer Selector (PRISE), a new software package that implements several features that improve and streamline the design of sequence-selective PCR primers. The PRISE design process involves two main steps. In the first step, target and non-target DNA sequences are identified. In the second step, primers are designed to amplify target (but not non-target) sequences. One important feature of PRISE is that it automates the task of placing primer-template mismatches at the 3' end of the primers - a property that is crucial for sequence selectivity. Once a list of candidate primers has been produced, sorting tools in PRISE speed up the selection process by allowing a user to sort the primers by properties such as amplicon length, GC content and sequence selectivity. PRISE can be used to design primers with a range of specificities, targeting individual sequences as well as diverse assemblages of genes. PRISE also allows user-defined primers to be analyzed, enabling their properties to be examined in relation to target and non-target sequences. The utility of PRISE was demonstrated by using it to design sequence-selective PCR primers for an rRNA gene from the fungus Pochonia chlamydosporia.

  2. Polymerase chain reaction with nearby primers. (United States)

    Garafutdinov, Ravil R; Galimova, Aizilya A; Sakhabutdinova, Assol R


    DNA analysis of biological specimens containing degraded nucleic acids such as mortal remains, archaeological artefacts, forensic samples etc. has gained more attention in recent years. DNA extracted from these samples is often inapplicable for conventional polymerase chain reaction (PCR), so for its amplification the nearby primers are commonly used. Here we report the data that clarify the features of PCR with nearby and abutting primers. We have shown that the proximity of primers leads to significant reduction of the reaction time and ensures the successful performance of DNA amplification even in the presence of PCR inhibitors. The PCR with abutting primers is usually characterized by the absence of nonspecific amplification products that causes extreme sensitivity with limit of detection on single copy level. The feasibility of PCR with abutting primers was demonstrated on species identification of 100 years old rotten wood. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Aluminum Rich Epoxy Primer for Ground and Air Vehicles (United States)


    UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements... Epoxy Primers in order to afford a lower initial viscosity allowing for better application properties; lower VOC; and the incorporation of various

  4. SBE primer : multiplexing minisequencing-based genotyping

    Energy Technology Data Exchange (ETDEWEB)

    Kaderali, L. (Lars); Deshpande, A. (Alina); Uribe-Romeo, F. J. (Francisco J.); Schliep, A.; Torney, D. C. (David C.)


    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  5. Primer reporte de susceptibilidad del clon de caucho natural FX-3864 a Microcyclus ulei en la altillanura colombiana

    Directory of Open Access Journals (Sweden)

    Ibonne Aidee García


    Full Text Available First report of susceptibility of natural rubber clone FX-3864 a Microcyclus ulei en la altillanuera colombiana ResumenEl mal suramericano de las hojas (SALB, enfermedad endémica del caucho (Hevea brasiliensis, es causado por Microcyclus ulei (forma imperfecta Fusicladium macrosporum y constituye el principal limitante del cultivo en América, área donde el microorganismo patógeno es endémico. En forma semejante al de otros cultivos agrícolas, el manejo de esta enfermedad está condicionado a la disponibilidad de resistencia genética en el hospedero. En razón de su productividad y condición de resistencia genética, el clon FX 3864 ha sido ampliamente plantado en zonas con diferente potencialidad epidémica a la incidencia del SALB en Colombia, particularmente las denominadas de “no escape” a la enfermedad. Durante el 2010, plantaciones con el clon FX 3864 en fase productiva presentaron síntomas de SALB en zonas de escape ubicadas en la altillanura colombiana (departamento del Meta. En parcelas trampa ubicadas en áreas aledañas a los cultivos se estableció que la severidad promedio de la enfermedad alcanzó niveles de 5,78% en este clon. Verificada la causalidad de la enfermedad mediante observaciones al microscopio se procedió a confirmar el origen del material sobre el cual se desarrollaban las lesiones, utilizando marcadores moleculares (4 microsatélites específicos. Los resultados de la prueba permitieron confirmar la susceptibilidad del hasta hace poco resistente clon FX 3864 al SALB en Colombia. Se sugiere tomar en consideración la nueva condición de este clon y, en concordancia, reorientar los programas de fomento del cultivo advirtiendo a los agricultores sobre los riesgos potenciales de ocurrencia de la enfermedad en las nuevas áreas programadas. Palabras clave: SALB, Hevea brasiliensis, Fusicladium macrosporum, cultivo de caucho. AbstractSouth American Leaf Blight (SALB, caused by Microcyclus ulei (anamorph

  6. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun


    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  7. An SAT® Validity Primer (United States)

    Shaw, Emily J.


    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  8. A Primer on Data Logging to Support Extraction of Meaningful Information from Educational Games: An Example from Save Patch. CRESST Report 814 (United States)

    Chung, Gregory K. W. K.; Kerr, Deirdre S.


    In this primer we briefly describe our perspective and experience in using data logging to support measurement of student learning in a game testbed ("Save Patch") we developed for research purposes. The goal of data logging is to support the derivation of cognitively meaningful measures and affectively meaningful measures from a combination of…

  9. EasyExonPrimer: automated primer design for exon sequences. (United States)

    Wu, Xiaolin; Munroe, David J


    EasyExonPrimer is a web-based software that automates the design of PCR primers to amplify exon sequences from genomic DNA. EasyExonPrimer is written in Perl and uses Primer3 to design PCR primers based on the genome builds and annotation databases available at the University of California, Santa Cruz (UCSC) Genome Browser database ( It masks repeats and known single nucleotide polymorphism (SNP) sites in the genome and designs standardised primers using optimised conditions. Users can input genes by RefSeq mRNA ID, gene name or keyword. The primer design is optimised for large-scale resequencing of exons. For exons larger than 1 kb, the user has the option of breaking the exon sequence down into overlapping smaller fragments. All primer pairs are then verified using the In-Silico PCR software to test for uniqueness in the genome. We have designed >1000 pairs of primers for 90 genes; 95% of the primer pairs successfully amplified exon sequences under standard PCR conditions without requiring further optimisation. EasyExonPrimer is available from The source code is also available upon request. Xiaolin Wu (

  10. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins


    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  11. Lead Free Electric Primer (United States)


    comply with a collection of information if it does not display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE...D-1 4 ACRONYMS AB Acetylene Black ADN Ammonium dinitramide Al Aluminum ATK...electrical conductivity of the MIC material used in the primer mix significantly changed over a relatively short interval of time. The initiation of MIC

  12. Reporte del primer caso de implante exitoso de asistencia ventricular izquierda HeartMate II como terapia de destino en Suramérica

    Directory of Open Access Journals (Sweden)

    Antonio Figueredo


    Full Text Available Se describe el caso de una paciente de sexo femenino de 55 años de edad, con insuficiencia cardiaca congestiva descompensada secundaria a cardiopatía dilatada idiopática y con contraindicación para trasplante cardiaco, en quien se implanta de manera exitosa el primer dispositivo de asistencia ventricular izquierda HeartMate II en Suramérica.

  13. Reporte del primer caso de enfermedad de Chagas transplacentaria analizado por AP-PCR en Moniquirá, Boyacá

    Directory of Open Access Journals (Sweden)

    Concepción Judith Puerta


    Conclusiones. Éste es el primer caso de enfermedad de Chagas transplacentaria reportado en el municipio de Moniquirá, que demuestra que esta forma de transmisión ocurre en el país. La presencia de infección mixta por ambos grupos de T. cruzi en las muestras del recién nacido, sugiere infección mixta en la madre, con mayor prevalencia de T. cruzi I, al menos en el hemocultivo.

  14. Math primer for engineers

    CERN Document Server

    Cryer, CW


    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  15. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn


    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  16. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto


    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  17. Maduración in vitro de ovocitos humanos: una opción para preservar la fertilidad de las mujeres. Reporte del primer caso realizado en Chile


    Ortega-Hrepich, Carolina; Guzmán M,Luis; Argüello,Begoña; Pommer T,Ricardo


    La maduración in vitro (MIV) de ovocitos humanos es parte de las técnicas de fecundación in vitro, que consiste en la aspiración de ovocitos inmaduros. Es ofrecida principalmente a pacientes con alto riesgo de desarrollar un síndrome de hiperestimulación ovárica, especialmente pacientes con síndrome de ovario poliquístico. Adicionalmente, es un método ofrecido a las pacientes oncológicas para preservar su fertilidad. Presentamos el primer caso de MIV realizado en Chile, en la Unidad de Medici...

  18. Reporte de primer caso humano de aislamiento y tipificación de Brucella abortus RB 51: first report in Chile Isolation and identification of Brucella abortus RB 51 in human

    Directory of Open Access Journals (Sweden)

    M. Villarroel


    Full Text Available En el Laboratorio de Microbiología del Hospital Base de Osorno, se aisló una cepa de Brucella sp, que posteriormente se tipificó en el Laboratorio Regional de Diagnósticos del Servicio Agrícola y Ganadero, SAG Osorno. Esta cepa fue aislada de un hemocultivo realizado a un paciente con sintomatología clínica compatible con Brucelosis. El resultado de la tipificación fue Brucella abortus RB 51, cepa vaccinal que se presumía apatógena para el hombre. Este es el primer reporte a nivel mundial de un aislamiento de B. abortus RB 51 en humanosA Brucella strain was isolated from a haemoculture of a clinically ill veterinarian practitioner, at the Laboratory of Microbiology, Hospital Base Osorno, Chile. This strain was identified as Brucella abortus RB 51 at Laboratorio de Diagnósticos from the Servicio Agrícola y Ganadero (SAG, Osorno, based mainly in the following characteristics: resistence to Rifampicin, aerobic growth and the production of only rough colonies. The strain RB 51 was confirmed by PCR analysis

  19. Neuraminidase subtyping of avian influenza viruses with PrimerHunter-designed primers and quadruplicate primer pools. (United States)

    Huang, Yanyan; Khan, Mazhar I; Khan, Mazhar; Măndoiu, Ion; Măndoiu, Ion I


    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers.

  20. Explanatory chapter: PCR primer design. (United States)

    Álvarez-Fernández, Rubén


    This chapter is intended as a guide on polymerase chain reaction (PCR) primer design (for information on PCR, see General PCR and Explanatory Chapter: Troubleshooting PCR). In the next section, general guidelines will be provided, followed by a discussion on primer design for specific applications. A list of recommended software tools is shown at the end. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. BatchPrimer3: a high throughput web application for PCR and sequencing primer design. (United States)

    You, Frank M; Huo, Naxin; Gu, Yong Qiang; Luo, Ming-Cheng; Ma, Yaqin; Hane, Dave; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D


    Microsatellite (simple sequence repeat - SSR) and single nucleotide polymorphism (SNP) markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR), as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated in several laboratories. BatchPrimer3 is a

  2. A physicists guide to The Los Alamos Primer (United States)

    Reed, B. Cameron


    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  3. A Defense Budget Primer (United States)


    budget practices. See Appendix D for the actual timetable of congressional action on the FY1999 budget.65 See James V. Saturno , The Appropriations...details, see James V. Saturno , The Appropriations Process and the Congressional69 Budget Act, CRS Report 97-947. Table 6. Milestone Votes on the Defense...James V. Saturno , The74 Appropriations Process and the Congressional Budget Act, CRS Report 97-947. The Budget Enforcement Act of 1990 and subsequent

  4. Universal COI primers for DNA barcoding amphibians. (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping


    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  5. A Cobit primer.

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, Philip LaRoche


    COBIT is a set of documents that provides guidance for computer security. This report introduces COBIT by answering the following questions, after first defining acronyms and presenting definitions: 1. Why is COBIT valuable? 2. What is COBIT?, and 3. What documents are related to COBIT? (The answer to the last question constitutes the bulk of this report.) This report also provides more detailed review of three documents. The first two documents--COBIT Security Baseline{trademark} and COBIT Quickstart{trademark}--are initial documents, designed to get people started. The third document-Control Practices-is a ''final'' document, so to speak, designed to take people all the way down into the details. Control Practices is the detail.

  6. Cerebral aspergillosis due to Aspergillus fumigatus in AIDS patient: first culture - proven case reported in Brazil Aspergilosis cerebral causada por Aspergillus fumigatus en paciente con SIDA: primer reporte de caso demostrado por cultivo en Brasil

    Directory of Open Access Journals (Sweden)

    José E. Vidal


    Full Text Available Cerebral aspergillosis is a rare cause of brain expansive lesion in AIDS patients. We report the first culture-proven case of brain abscess due to Aspergillus fumigatus in a Brazilian AIDS patient. The patient, a 26 year-old male with human immunodeficiency virus (HIV infection and history of pulmonary tuberculosis and cerebral toxoplasmosis, had fever, cough, dyspnea, and two episodes of seizures. The brain computerized tomography (CT showed a bi-parietal and parasagittal hypodense lesion with peripheral enhancement, and significant mass effect. There was started anti-Toxoplasma treatment. Three weeks later, the patient presented mental confusion, and a new brain CT evidenced increase in the lesion. He underwent brain biopsy, draining 10 mL of purulent material. The direct mycological examination revealed septated and hyaline hyphae. There was started amphotericin B deoxycholate. The culture of the material demonstrated presence of the Aspergillus fumigatus. The following two months, the patient was submitted to three surgeries, with insertion of drainage catheter and administration of amphotericin B intralesional. Three months after hospital admission, his neurological condition suffered discrete changes. However, he died due to intrahospital pneumonia. Brain abscess caused by Aspergillus fumigatus must be considered in the differential diagnosis of the brain expansive lesions in AIDS patients in Brazil.La aspergilosis cerebral es una causa rara de lesión expansiva cerebral en pacientes con SIDA. Presentamos el primer reporte de un absceso cerebral causado por Aspergillus fumigatus en un paciente brasileño con SIDA. El paciente, de 26 años de edad, presentaba antecedentes de infección por el virus de la inmunodeficiencia humana (VIH, tuberculosis pulmonar y toxoplasmosis cerebral. Manifestó fiebre, tos, disnea y dos episódios de convulsiones. La tomografía computadorizada (TC demostró una lesión hipodensa parasagital y bi-parietal con

  7. Vygotsky on Education Primer. Peter Lang Primer. Volume 30 (United States)

    Lake, Robert


    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  8. Vygotsky on Education Primer. Peter Lang Primer. Volume 30 (United States)

    Lake, Robert


    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  9. Selection and development of representative simple sequence repeat primers and multiplex SSR sets for high throughput automated genotyping in maize

    Institute of Scientific and Technical Information of China (English)

    WANG FengGe; ZHAO JiuRan; DAI JingRui; YI HongMei; KUANG Meng; SUN YanMei; YU XinYan; GUO JingLun; WANG Lu


    In the current study, 1900 maize simple sequence repeat (SSR) primers published in MaizeGDB were screened utilizing reference literature, 15 representative Chinese maize inbred lines and 15 Chinese maize hybrids from national regional testing. In total, 500 highly polymorphic primers were identified and used to construct a genetic map. 100 evenly distributed primers, 10 primers per chromosome, were further selected as a set of universal SSR core primers, recommended as preferred primers for general studies. These core primers were then redesigned and used to construct a high throughput multiplex PCR system based on a five-color fluorescence capillary detection system. We report here that two sets of ten-plex PCR combinations have been constructed, each consisting of 10 primers, with one primer per chromosome.

  10. Freshwater Wetlands: A Citizen's Primer. (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  11. Freshwater Wetlands: A Citizen's Primer. (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  12. A Hearing Aid Primer 1 (United States)

    Yetter, Carol J.


    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  13. Alternative Teacher Compensation: A Primer (United States)

    Koppich, Julia E.; Rigby, Jessica


    This policy primer is designed to provide base-line information about new forms of teacher pay that are emerging around the country, to support the local conversations and negotiations that will lead to the development of innovative compensation systems. It identifies reasons why teacher compensation is high on local, state, and federal policy…

  14. Freshwater Wetlands: A Citizen's Primer. (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  15. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  16. Primer on statistical interpretation or methods report card on propensity-score matching in the cardiology literature from 2004 to 2006: a systematic review. (United States)

    Austin, Peter C


    Propensity-score matching is frequently used in the cardiology literature. Recent systematic reviews have found that this method is, in general, poorly implemented in the medical literature. The study objective was to examine the quality of the implementation of propensity-score matching in the general cardiology literature. A total of 44 articles published in the American Heart Journal, the American Journal of Cardiology, Circulation, the European Heart Journal, Heart, the International Journal of Cardiology, and the Journal of the American College of Cardiology between January 1, 2004, and December 31, 2006, were examined. Twenty of the 44 studies did not provide adequate information on how the propensity-score-matched pairs were formed. Fourteen studies did not report whether matching on the propensity score balanced baseline characteristics between treated and untreated subjects in the matched sample. Only 4 studies explicitly used statistical methods appropriate for matched studies to compare baseline characteristics between treated and untreated subjects. Only 11 (25%) of the 44 studies explicitly used statistical methods appropriate for the analysis of matched data when estimating the effect of treatment on the outcomes. Only 2 studies described the matching method used, assessed balance in baseline covariates by appropriate methods, and used appropriate statistical methods to estimate the treatment effect and its significance. Application of propensity-score matching was poor in the cardiology literature. Suggestions for improving the reporting and analysis of studies that use propensity-score matching are provided.

  17. Primer reporte de parasitismo de una garrapata blanda del género Ornithodoros (Ixodida: Argasidae sobre Rhinella arenarum (Anura: Bufonidae en el departamento de Valle Fértil, San Juan, Argentina

    Directory of Open Access Journals (Sweden)

    Acosta, Juan Carlos


    Full Text Available El objetivo de la presente comunicación es reportar por primera vez un caso de parasitismo en Rhinella arenarum y a la vez mencionar el primer registro del género Ornithodoros en el departamento de Valle Fértil, San Juan, Argentina. Siendo el primer registro de parasitismo de anfibios por Ornithodoros en la Argentina y el segundo para el neotrópico.

  18. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs. (United States)

    Housley, Donna J E; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J


    Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6-8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC > or = 50%, 56.9% amplified; GCprimer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the

  19. First report of nematode parasites of Physalaemus santafecinus (Anura: Leiuperidae from Corrientes, Argentina Primer registro de nematodos parásitos de Physalaemus santafecinus (Anura: Leiuperidae de Corrientes, Argentina

    Directory of Open Access Journals (Sweden)

    Cynthya Elizabeth González


    Full Text Available One hundred and eighty-three nematodes were recovered from 81 adults of leiuperid Physalaemus santafecinus examined from Corrientes, Argentina captured between January 2002 and December 2003. A total of 3 adults nematode species (Cosmocerca podicipinus, Cosmocerca parva, Aplectana hylambatis and 1 larval species (Physaloptera sp. were obtained. We present morphological characters, metric information and range for these nematode species and compared these with other specimens collected from different hosts of the Neotropical Realm. This is the first report of nematode parasites of P. santafecinus from Argentina.Ciento ochenta y tres nematodos fueron recolectados de 81 adultos del leiupérido Physalaemus santafecinus examinados en Corrientes, Argentina y capturados entre enero del 2002 y diciembre del 2003. Estos nematodos pertenecen a un total de 4 especies, 3 en estado adulto: Cosmocerca podicipinus, Cosmocerca parva, Aplectana hylambatis, y 1 especie en estado larval, Physaloptera sp. Se presentan características morfológicas, información métrica e intervalos de medidas de estas especies de nematodos, comparándolas con ejemplares recolectados de diferentes hospederos de la región neotropical. Éste es el primer registro de nematodos parásitos para P. santafecinus de Argentina.

  20. Chondromyxoid fibroma of C1: first case report Fibroma condromixoide de C1: primer caso Fibroma condromixóide de C1: primeiro relato de caso

    Directory of Open Access Journals (Sweden)

    Ericson Sfreddo


    Full Text Available BACKGROUND: Chondromyxoid fibroma (CMF is a rare, benign primary bone tumor. The cervical spine is an uncommon site for this tumor, with only 10 reported cases to date and none involving the first cervical vertebra (C1. CASE REPORT: Female patient, 25-year-old monozygotic female twin, presented with cervical pain. Radiographic imaging demonstrated a contrast-enhanced, right-sided lytic lesion of the insufflated type in C1, with a punched-out appearance and extending to the anterior arch. A postero-lateral and a posterior approach were performed in two steps to resect the tumor followed by occipitocervical fixation. Pathology confirmed the diagnosis of CMF. At one year, the patient remains disease free with excellent spinal stability. CONCLUSION: Spinal surgeons may need to treat rare spinal tumors. Despite the proximity to neural and vascular structures, the goal of surgery is always a radical resection due to high recurrence rates.REVISIÓN: El fibroma condromixoide (FCM es un tumor óseo primario, benigno y raro. La columna cervical es un lugar raro de este tumor, con solamente 10 casos relatados, siendo que ninguno involucra a la primera vértebra cervical (C1. RELATO DEL CASO: Paciente del sexo femenino, 25 años, gemela monozigótica, presentando dolor cervical. La imagen radiográfica demostró una lesión contrastada, predominantemente en la masa lateral de C1 con extensión hacia el arco posterior y anterior. La resección del tumor se realizó en dos tiempos, inicialmente una aproximación posterolateral, seguida por la vía posterior. En esta última, se realizó una fijación occipitocervical. El análisis anatomopatológico fue compatible con FCM. Pasado un año de los procedimientos, la paciente permanecía sin enfermedad y con estabilidad cranio-cervical. CONCLUSIÓN: Especialistas de columna deben tener el conocimiento de que estos tumores raros pueden acometer a la columna vertebral y, a pesar de su proximidad con el tejido

  1. El primer congreso constituyente mexicano


    José Luis Soberanes Fernández


    En el presente trabajo se describe uno de los momentos más difíciles de la historia constitucional de México, por no decir el más difícil, que va desde la Consumación de la Independencia Nacional del 27 de septiembre de 1821 al 30 de noviembre de 1823 en que clausuró sus sesiones el Primer Congreso Constituyente. Fue cuando se erigió el Imperio de Iturbide y su ocaso, en consecuencia triunfó la república y se planteó seriamente el federalismo. Se eligió ese primer constituyente, se clausuró, ...

  2. Environmental Acceptable Medium Caliber Ammunition Percussion Primers (United States)


    percussion primers typically consist of lead styphnate and antimony sulfide. Although highly effective, these heavy material compounds were identified under...Percussion primers, including those used in medium caliber ammunition, typically contain lead styphnate and antimony sulfide along with other constituents...Furthermore, current percussion primer compositions also contain barium nitrate. Although not negatively categorized by the Environmental Protection

  3. Rapid and simple method of qPCR primer design. (United States)

    Thornton, Brenda; Basu, Chhandak


    Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool for analysis and quantification of gene expression. It is advantageous compared to traditional gel-based method of PCR, as gene expression can be visualized "real-time" using a computer. In qPCR, a reporter dye system is used which intercalates with DNA's region of interest and detects DNA amplification. Some of the popular reporter systems used in qPCR are the following: Molecular Beacon(®), SYBR Green(®), and Taqman(®). However, success of qPCR depends on the optimal primers used. Some of the considerations for primer design are the following: GC content, primer self-dimer, or secondary structure formation. Freely available software could be used for ideal qPCR primer design. Here we have shown how to use some freely available web-based software programs (such as Primerquest(®), Unafold(®), and Beacon designer(®)) to design qPCR primers.

  4. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei


    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  5. Friction Stir Welding of Shipbuilding Steel with Primer

    Directory of Open Access Journals (Sweden)

    José Azevedo


    Full Text Available Abstract Friction Stir Welding has proven its merits for welding of aluminium alloys and is focused in expanding its material database to steel and titanium and also to assess new joint configurations. The use of welded structures in shipbuilding industry has a long tradition and continuously seeks for innovation in terms of materials and processes maintaining, or even, reducing costs. Several studies have been performed in the past years on FSW of steel. However, just recently were reported defect-free welds, free of martensite with stable parameters in steel without Primer. FSW of steel with primer has not been addressed. This work aims to fulfil a knowledge gap related to the use of friction stir for welding shipbuilding steel by analysing the effect of welding parameters on the metallurgical characteristics and mechanical properties of welds obtained with an innovative FSW tool in joining steel plates with a primer. Welds were performed in 4mm thick GL-A36 steel plates painted with a zinc based primer followed by a detailed microscopic, chemical and mechanical analysis. The results that matching fatigue properties are obtained using this technique, in FSW of shipbuilding steel with Primer.

  6. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S


    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  7. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J


    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  8. Loop quantum geometry: a primer

    Energy Technology Data Exchange (ETDEWEB)

    Corichi, Alejandro [Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, A. Postal 70-543, Mexico D.F. 04510 (Mexico)


    This is the written version of a lecture given at the 'VI Mexican School of Gravitation and Mathematical Physics' (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-experts interested in learning the basics of the subject.

  9. A primer of special relativity

    CERN Document Server

    Sardesai, PL


    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  10. Loop Quantum Geometry: A primer


    Corichi, Alejandro


    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-expert...

  11. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. (United States)

    Ye, Jian; Coulouris, George; Zaretskaya, Irena; Cutcutache, Ioana; Rozen, Steve; Madden, Thomas L


    Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR

  12. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam


    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  13. CODEHOP PCR and CODEHOP PCR primer design. (United States)

    Staheli, Jeannette P; Boyce, Richard; Kovarik, Dina; Rose, Timothy M


    While PCR primer design for the amplification of known sequences is usually quite straightforward, the design, and successful application of primers aimed at the detection of as yet unknown genes is often not. The search for genes that are presumed to be distantly related to a known gene sequence, such as homologous genes in different species, paralogs in the same genome, or novel pathogens in diverse hosts, often turns into the proverbial search for the needle in the haystack. PCR-based methods commonly used to address this issue involve the use of either consensus primers or degenerate primers, both of which have significant shortcomings regarding sensitivity and specificity. We have developed a novel primer design approach that diminishes these shortcomings and instead takes advantage of the strengths of both consensus and degenerate primer designs, by combining the two concepts into a Consensus-Degenerate Hybrid Oligonucleotide Primer (CODEHOP) approach. CODEHOP PCR primers contain a relatively short degenerate 3' core and a 5' nondegenerate clamp. The 3' degenerate core consists of a pool of primers containing all possible codons for a 3-4 aminoacid motif that is highly conserved in multiply aligned sequences from known members of a protein family. Each primer in the pool also contains a single 5' nondegenerate nucleotide sequence derived from a codon consensus across the aligned aminoacid sequences flanking the conserved motif. During the initial PCR amplification cycles, the degenerate core is responsible for specific binding to sequences encoding the conserved aminoacid motif. The longer consensus clamp region serves to stabilize the primer and allows the participation of all primers in the pool in the efficient amplification of products during later PCR cycles. We have developed an interactive web site and algorithm (iCODEHOP) for designing CODEHOP PCR primers from multiply aligned protein sequences, which is freely available online. Here, we describe the

  14. Single-primer fluorescent sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.; Grone, D.L.; Brumbaugh, J.A.


    Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal and temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.

  15. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N


    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  16. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes


    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  17. Degenerate primer design for highly variable genomes. (United States)

    Li, Kelvin; Shrivastava, Susmita; Stockwell, Timothy B


    The application of degenerate PCR primers towards target amplification and sequencing is a useful technique when a population of organisms under investigation is evolving rapidly, or is highly diverse. Degenerate bases in these primers are specified with ambiguity codes that represent alternative nucleotide configurations. Degenerate PCR primers allow the simultaneous amplification of a heterogeneous population by providing a mixture of PCR primers each of which anneal to an alternative genotype found in the isolated sample. However, as the number of degenerate bases specified in a pair of primers rises, the likelihood of amplifying unwanted alternative products also increases. These alternative products may confound downstream data analyses if their levels begin to obfuscate the desired PCR products. This chapter describes a set of computational methodologies that may be used to minimize the degeneracy of designed primers, while still maximizing the proportion of genotypes assayed in the targeted population.

  18. In silico PCR primer designing and validation. (United States)

    Kumar, Anil; Chordia, Nikita


    Polymerase chain reaction (PCR) is an enzymatic reaction whose efficiency and sensitivity largely depend on the efficiency of the primers that are used for the amplification of a concerned gene/DNA fragment. Selective amplification of nucleic acid molecules initially present in minute quantities provides a powerful tool for analyzing nucleic acids. In silico method helps in designing primers. There are various programs available for PCR primer design. Here we described designing of primers using web-based tools like "Primer3" and "Web Primer". For designing the primer, DNA template sequence is required that can be taken from any of the available sequence databases, e.g., RefSeq database. The in silico validation can be carried out using BLAST tool and Gene Runner software, which check their efficiency and specificity. Thereafter, the primers designed in silico can be validated in the wet lab. After that, these validated primers can be synthesized for use in the amplification of concerned gene/DNA fragment.

  19. A High Temperature Hermetic Primer and a Variable Spring Tester

    Energy Technology Data Exchange (ETDEWEB)

    Begeal, D.R.


    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  20. A Practical Primer on Geostatistics (United States)

    Olea, Ricardo A.


    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  1. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo


    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  2. Primer on Molecular Genetics; DOE Human Genome Program (United States)


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  3. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  4. URPD: a specific product primer design tool. (United States)

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong


    Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at

  5. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection. (United States)

    O'Halloran, Damien M


    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  6. A Phylogenetic Index for Cichlid Microsatellite Primers

    Directory of Open Access Journals (Sweden)

    Robert D. Kunkle


    Full Text Available Microsatellites abound in most organisms and have proven useful for a range of genetic and genomic studies. Once primers have been created, they can be applied to populations or taxa that have diverged from the source taxon. We use PCR amplification, in a 96-well format, to determine the presence and absence of 46 microsatellite loci in 13 cichlid species. At least one primer set amplified a product in each species tested, and some products were present in nearly all species. These results are compared to the known phylogenetic relationships among cichlids. While we do not address intraspecies variation, our results present a phylogenetic index for the success of microsatellite PCR primer product amplification, thus providing information regarding a collection of primers that are applicable to wide range of species. Through the use of such a uniform primer panel, the potential impact for cross species would be increased.

  7. A practical primer on geostatistics (United States)

    Olea, Ricardo A.


    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main


    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati


    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  9. STITCHER 2.0: primer design for overlapping PCR applications (United States)

    O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin


    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: PMID:28358011

  10. STITCHER 2.0: primer design for overlapping PCR applications. (United States)

    O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin


    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage:

  11. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads


    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software......, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  12. Climate change primer for respirologists. (United States)

    Takaro, Tim K; Henderson, Sarah B


    Climate change is already affecting the cardiorespiratory health of populations around the world, and these impacts are expected to increase. The present overview serves as a primer for respirologists who are concerned about how these profound environmental changes may affect their patients. The authors consider recent peer-reviewed literature with a focus on climate interactions with air pollution. They do not discuss in detail cardiorespiratory health effects for which the potential link to climate change is poorly understood. For example, pneumonia and influenza, which affect >500 million people per year, are not addressed, although clear seasonal variation suggests climate-related effects. Additionally, large global health impacts in low-resource countries, including migration precipitated by environmental change, are omitted. The major cardiorespiratory health impacts addressed are due to heat, air pollution and wildfires, shifts in allergens and infectious diseases along with respiratory impacts from flooding. Personal and societal choices about carbon use and fossil energy infrastructure should be informed by their impacts on health, and respirologists can play an important role in this discussion.

  13. A thermodynamic approach to PCR primer design. (United States)

    Mann, Tobias; Humbert, Richard; Dorschner, Michael; Stamatoyannopoulos, John; Noble, William Stafford


    We developed a primer design method, Pythia, in which state of the art DNA binding affinity computations are directly integrated into the primer design process. We use chemical reaction equilibrium analysis to integrate multiple binding energy calculations into a conservative measure of polymerase chain reaction (PCR) efficiency, and a precomputed index on genomic sequences to evaluate primer specificity. We show that Pythia can design primers with success rates comparable with those of current methods, but yields much higher coverage in difficult genomic regions. For example, in RepeatMasked sequences in the human genome, Pythia achieved a median coverage of 89% as compared with a median coverage of 51% for Primer3. For parameter settings yielding sensitivities of 81%, our method has a recall of 97%, compared with the Primer3 recall of 48%. Because our primer design approach is based on the chemistry of DNA interactions, it has fewer and more physically meaningful parameters than current methods, and is therefore easier to adjust to specific experimental requirements. Our software is freely available at

  14. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.


    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  15. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)


    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  16. Quantitative Microbial Risk Assessment Tutorial - Primer (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  17. Menopause 101: A Primer for the Perimenopausal (United States)

    ... in the News Press Room Assistance Society Overview Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  18. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W


    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  19. First report of a human case of polycystic echinococcosis due to Echinococcus vogeli from neotropical area of Peru, South America Primer reporte de un caso humano de echinococcosis poliquística causada por E. vogeli procedente del área neotropical del Perú, America del Sur

    Directory of Open Access Journals (Sweden)

    José R. Somocurcio


    Full Text Available We report a human case of polycystic hidatidosis due to Echinococcus vogeli from Contamana (Department of Loreto village located in the central jungle of Peru. The patient is a 44 year-old lady, teacher, who carried a painless liver mass since a year ago. She was submitted to abdominal surgery and the liver mass was removed and showed multiple cysts containing colorless liquid as is showed in the polycystic hidatidosis. The morphology and measure of the hooks obtained from the liquid contained in the cysts are from Echinococcus vogeli. It is the first report of this parasitism in Perú.Reportamos un caso humano de hidatidosis poliquística debido a Echinococcus vogeli procedente de Contamana (Departamento de Loreto, localidad ubicada en la selva central del Perú. La paciente es una mujer de 44 años de edad, profesora, quien portaba una hepatomegalia no dolorosa de un año de evolución. Sometida a intervención quirúrgica, se removió la masa hepática que macroscópicamente mostró múltiples quistes conteniendo líquido incoloro. El examen microscópico correspondió a una hidatidosis poliquística. El examen y medida de los ganchos obtenidos del contenido de los quistes correspondieron a Echinococcus vogeli. Es el primer reporte de este parasitismo en el Perú.

  20. Design and evaluation of a specific primer pair for the diagnosis and identification of Acanthamoeba polyphaga. (United States)

    Ortega-Rivas, Antonio; Lorenzo-Morales, Jacob; Martinez-Carretero, Enrique; Villa Lloberas, Mercedes; Valladares Hernández, Basilio; del Castillo-Remiro, Antonio


    Random amplified polymorphism DNA (RAPD) is a useful tool for species identification. The obtained band patterns can be used for specific primer pair design that may be useful for species diagnosis. In this study, a distinctive a 962-bp band in A. polyphaga band patterns was found, by using the OPC20 primer (ACTTCGCCAC). The DNA fragment was used to design a specific primer pair that was useful for the identification of different isolates as A. polyphaga species. A case of A. polyphaga in disseminated acanthamoebiasis affecting mesenteric nodes is also reported.

  1. DNA sequencing by synthesis with degenerate primers

    Institute of Scientific and Technical Information of China (English)


    The degenerate primer-based sequencing Was developed by a synthesis method(DP-SBS)for high-throughput DNA sequencing,in which a set of degenerate primers are hybridized on the arrayed DNA templates and extended by DNA polymerase on microarrays.In this method,adifferent set of degenerate primers containing a give nnumber(n)of degenerate nucleotides at the 3'-ends were annealed to the sequenced templates that were immobilized on the solid surface.The nucleotides(n+1)on the template sequences were determined by detecting the incorporation of fluorescent labeled nucleotides.The fluorescent labeled nucleotide was incorporated into the primer in a base-specific manner after the enzymatic primer extension reactions and nine-base length were read out accurately.The main advanmge of the DP-SBS is that the method only uses very conventional biochemical reagents and avoids the complicated special chemical reagents for removing the labeled nucleotides and reactivating the primer for further extension.From the present study,it is found that the DP-SBS method is reliable,simple,and cost-effective for laboratory-sequencing a large amount of short DNA fragments.

  2. Human infection by Angiostrongylus costaricensis in Venezuela: first report of a confirmed case Infección humana por Angiostrongylus costaricensis en Venezuela: primer reporte de un caso confirmado

    Directory of Open Access Journals (Sweden)

    Renzo Nino Incani


    Full Text Available A proven case of human infection caused by Angiostrongylus costaricensis is reported for the first time in Venezuela. The patient was a 57-year-old female surgically operated because of signs of peritonitis with a palpable mass at the lower right quadrant of the abdomen. WBC count reported 16,600 cells/mm³, with 46% eosinophils. The tumoral aspect of ileocolic area and peritoneal lymph nodes prompted the resection of a large area of the terminal ileum, cecum, part of the ascending colon and a small part of the jejunum, where a small lesion was found. The pathology showed thickened areas of the intestinal wall with areas of hemorrhage and a perforation of the cecum. Histology showed intense eosinophil infiltration of the whole intestinal wall, granulomas with giant cells and eosinophils. Some of the granuloma surrounded round or oval eggs with content characterized by a large empty area, cells or embryo in the center, and sometimes nematode larvae. A cross section of an adult nematode worm was observed inside a branch of mesenteric artery. The intestinal affected area, the characteristics of the lesions, the presence of eggs in the submucosa with nematode larvae inside, and the observation of a nematode inside a mesenteric artery, makes sufficient criteria for the diagnosis of an infection by Angiostrongylus costaricensis.Un caso comprobado de infección humana por Angiostrongylus costaricensis es reportado para la literatura por vez primera en Venezuela. El paciente fue una mujer de 57 años de edad intervenida quirúrgicamente debido a signos de peritonitis, con una masa palpable en la fosa ilíaca derecha del abdomen. El recuento de leucocitos reportó 16.600 células/mm³ con 46% eosinófilos. El aspecto tumoral del área íleocólica y las adenopatías peritoneales encontradas motivó la resección de un área grande del ileon terminal, ciego, parte del colon ascendente y una pequeña parte del yeyuno donde se encontró una pequeña lesi

  3. Primer reporte de aislamiento de Staphylococcus schleiferi subespecie coagulans en perros con pioderma y otitis externa en Chile First report of isolation of Staphylococcus schleiferi subspecies coagulans from dogs with pyoderma and external otitis in Chile

    Directory of Open Access Journals (Sweden)

    L Muñoz


    Full Text Available Staphylococcus schleiferi subesp. coagulans fue identificado y descrito por primera vez por Igimi y col (1990 en perros con otitis. El objetivo de este reporte fue determinar la frecuencia de aislamiento de S. schleiferi subesp. coagulans en muestras de perros con pioderma y/u otitis externa en Chile y establecer los perfiles de resistencia frente a antimicrobianos de uso habitual y caracterizar molecularmente la resistencia a quinolonas. Se obtuvieron muestras de 237 caninos adultos diagnosticados con pioderma y/u otitis externa, en el Hospital Veterinario de la Universidad de Chile. La identificación de Staphylococcus schleiferi subesp. coagulans se realizó con BBL™ Crystal GP. La concentración mínima inhibitoria se determinó mediante el método de dilución en agar. El panel de antimicrobianos utilizado fue oxacilina, amoxicilina, cefradina, mupirocina, clindamicina, enrofloxacino, doxiciclina, tetraciclina, kanamicina y sulfametoxazol / trimetoprim. De 237 muestras analizadas, 135 fueron aisladas de pioderma y 102 de otitis. Staphylococcus spp. se identificó en 117 y 52 de las muestras respectivamente. S. schleiferi subesp. coagulans se identificó en 8 cepas aisladas desde pioderma (6,8% y en 11 cepas de otitis (21,2%. Todas las cepas de S. schleiferi subesp. coagulans de pioderma y el 54,5% de otitis resultaron sensibles a todos los antimicrobianos. La susceptibilidad fue de un 90,9% mupirocina, enrofloxacino y sulfametoxazol/trimetoprim; 81,8% a amoxicilina y kanamicina y el 72,7% a clindamicina. Solo una cepa aislada de otitis presentó multirresistencia. La cepa de Staphylococcus schleiferi subesp. coagulans que evidenció resistencia fenotípica a quinolonas presentó mutación en los genes gyrA y grlA.Staphylococcus schleiferi subsp. coagulans was identified and described for the first time in 1990 by Igimi et al (1990 in dogs with otitis. The objective of this report was to determine the frequency of isolation of S

  4. VizPrimer: a web server for visualized PCR primer design based on known gene structure. (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang


    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0).;

  5. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design. (United States)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus


    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at

  6. PCR primers for metazoan nuclear 18S and 28S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. METHODOLOGY/PRINCIPAL FINDINGS: Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. CONCLUSIONS/SIGNIFICANCE: The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other

  7. Abridged adapter primers increase the target scope of Hi-Plex. (United States)

    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Pope, Bernard J; Giles, Graham G; Hopper, John L; Southey, Melissa C; Park, Daniel J


    Previously, we reported Hi-Plex, an amplicon-based method for targeted massively parallel sequencing capable of generating 60 amplicons simultaneously. In further experiments, however, we found our approach did not scale to higher amplicon numbers. Here, we report a modification to the original Hi-Plex protocol that includes the use of abridged adapter oligonucleotides as universal primers (bridge primers) in the initial PCR mixture. Full-length adapter primers (indexing primers) are included only during latter stages of thermal cycling with concomitant application of elevated annealing temperatures. Using this approach, we demonstrate the application of Hi-Plex across a broad range of amplicon numbers (16-plex, 62-plex, 250-plex, and 1003-plex) while preserving the low amount (25 ng) of input DNA required.

  8. Design and evaluation of reverse transcription nested PCR primers for the detection of betanodavirus in finfish. (United States)

    Rajan, J Joseph Sahaya; Praveena, P Ezhil; Bhuvaneswari, T; Jithendran, K P


    Viral encephalopathy and retinopathy otherwise known as viral nervous necrosis (VNN) is a neuropathological condition affecting more than 50 fish species worldwide, mostly marine. Different PCR protocols with specific primers were reported from many countries for confirmation of VNN in fishes. In the present study, two pairs of primers were designed and evaluated for the diagnosis of clinical and subclinical cases of infections from field. These primers designated as BARL-F1/BARL-R1 amplified a 902 bp product in the variable region (T4) of the coat protein gene by first step PCR. Nested PCR primers BARL-F2/BARL-R2 amplified a fragment of 313 bp. The results were comparable with other commonly used primer sets such as F2/R3 and RG668f/RG919r primers. These new primers could detect betanodavirus in standard reference samples containing low, moderate and high viral load. Known positive and negative control samples of fish also revealed a predictive value of 100 % by RT-PCR diagnosis.

  9. Selective control of primer usage in multiplex one-step reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Paul Natasha


    Full Text Available Abstract Background Multiplex RT-PCR is a valuable technique used for pathogen identification, disease detection and relative quantification of gene expression. The simplification of this protocol into a one-step procedure saves time and reagents. However, intensive PCR optimization is often required to overcome competing undesired PCR primer extension during the RT step. Results Herein, we report multiplex one-step RT-PCR experiments in which the PCR primers contain thermolabile phosphotriester modification groups. The presence of these groups minimizes PCR primer extension during the RT step and allows for control of PCR primer extension until the more stringent, elevated temperatures of PCR are reached. Results reveal that the use of primers whose extension can be controlled in a temperature-mediated way provides improved one-step RT-PCR specificity in both singleplex and multiplex reaction formats. Conclusions The need for an accurate and sensitive technique to quantify mRNA expression levels makes the described modified primer technology a promising tool for use in multiplex one-step RT-PCR. A more accurate representation of the abundances in initial template sample is feasible with modified primers, as artifacts of biased PCR are reduced because of greater improvements in reaction specificity.

  10. Eighteen SSR-primers for tetraploid Adansonia digitata and its relatives


    Larsen, Anders Søndergaard; Vaillant, Alexandre; Verhaegen, Daniel; Kjær, Erik Dahl


    International audience; Co-dominant markers suitable for molecular ecological studies in the genus Adansonia are highly desirable in order to be able to address a number of interesting research questions related to the special life history traits, gene flow, and distribution dynamics of the Adansonia species. This note presents a set of 18 SSR- primers developed for Adansonia digitata, and tested for cross-amplification on all members of the Adansonia genus. All reported primers were found to a...

  11. Beam shaping for laser initiated optical primers (United States)

    Lizotte, Todd E.


    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  12. Specific primer design for the polymerase chain reaction. (United States)

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong


    The design of primers has a major impact on the success of PCR in relation to the specificity and yield of the amplified product. Here, we introduce the applications of PCR as well as the definition and characteristics for PCR primer design. Recent primer design tools based on Primer3, along with several computational intelligence-based primer design methods which have been applied in primer design, are also reviewed. In addition, characteristics of population-based methods used in primer design are discussed in detail.

  13. Climate Change, Health, and Communication: A Primer. (United States)

    Chadwick, Amy E


    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  14. CEMAsuite: open source degenerate PCR primer design. (United States)

    Lane, Courtney E; Hulgan, Daniel; O'Quinn, Kelly; Benton, Michael G


    The codon-equivalent multiple alignment suite begins conservational analysis for polymerase chain reaction primer design at the protein level, allowing the user to design consensus primers capable of detecting homologous coding sequences even when low-to-moderate sequence information is available. This package also condenses the wealth of information associated with multiple sequence alignments and presents them in an intuitive manner, allowing the user to quickly and effectively address degenerate primer design considerations. or Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  15. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome. (United States)

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H


    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs.

  16. Rapid DNA extraction methods and new primers for randomly amplified polymorphic DNA analysis of Giardia duodenalis. (United States)

    Deng, M Q; Cliver, D O


    A randomly amplified polymorphic DNA (RAPD) procedure using simple genomic DNA preparation methods and newly designed primers was optimized for analyzing Giardia duodenalis strains. Genomic DNA was extracted from in vitro cultivated trophozoites by five freezing-thawing cycles or by sonic treatment. Compared to a conventional method involving proteinase K digestion and phenol extraction, both freezing-thawing and sonication were equally efficient, yet with the advantage of being much less time- and labor-intensive. Five of the 10 tested RAPD primers produced reproducible polymorphisms among five human origin G. duodenalis strains, and grouping of these strains based on RAPD profiles was in agreement among these primers. The consistent classification of two standard laboratory reference strains, Portland-1 and WB, in the same group confirmed previous results using other fingerprinting methods, indicating that the reported simple DNA extraction methods and the selected primers are useful in RAPD for molecular characterization of G. duodenalis strains.

  17. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ


    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  18. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)


    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  19. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)


    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  20. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ


    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  1. Primer design versus PCR bias in methylation independent PCR amplifications. (United States)

    Wojdacz, Tomasz K; Borgbo, Tanni; Hansen, Lise Lotte


    Many protocols in methylation studies utilize one primer set to generate a PCR product from bisulfite modified template regardless of its methylation status (methylation independent amplification MIP). However, proportional amplification of methylated and unmethylated alleles is hard to achieve due to PCR bias favoring amplification of unmethylated relatively GC poor sequence. Two primer design systems have been proposed to overcome PCR bias in methylation independent amplifications. The first advises against including any CpG dinucleoteides into the primer sequence (CpG-free primers) and the second, recently published by us, is based on inclusion of a limited number of CpG sites into the primer sequence. Here we used the Methylation Sensitive High Resolution Melting (MS-HRM) technology to investigate the ability of primers designed according to both of the above mentioned primer design systems to proportionally amplify methylated and unmethylated templates. Ten "CpG-free" primer pairs and twenty primers containing limited number of CpGs were tested. In reconstruction experiments the "CpG-free" primers showed primer specific sensitivity and allowed us to detect methylation levels in the range from 5 to 50%. Whereas while using primers containing limited number of CpG sites we were able to consistently detect 1-0.1% methylation levels and effectively control PCR amplification bias. In conclusion, the primers with limited number of CpG sites are able to effectively reverse PCR bias and therefore detect methylated templates with significantly higher sensitivity than CpG free primers.

  2. A Primer on Policies for Jobs


    Nallari, Raj; Griffith, Breda; Wang, Yidan; Andriamananjara, Soamiely; Derek H. C. Chen; Bhattacharya, Rwitwika


    A primer on policies for jobs is based on materials and input provided during the labor market courses conducted during the past 10 years. Its objective is to provide government policy makers, researchers, and labor market practitioners and other specialists with a practical guide on how to strengthen labor market institutions, especially in light of the global financial crisis. This prime...

  3. Environmentally Acceptable Medium Caliber Ammunition Percussion Primers (United States)


    typically contain lead styphnate and antimony sulfide along with other constituents. Although highly effective, these heavy metal compounds have been...contain barium nitrate. Although not negatively categorized by the EPA itself, barium compounds are generally regarded as toxic and likewise should...contains the lead styphnate based FA956 composition2 which is a typical formulation of conventional military ammunition percussion primers. The

  4. Issues Primer. EEE708 Negotiated Study Program. (United States)

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  5. Internet Primer: Workshop Design and Objectives. (United States)

    Laverty, Corinne Y. C.


    Outlines the design, objectives, and evaluation of an introductory Internet workshop offered with library instruction classes in an electronic classroom at Queens University (Kingston, Ontario, Canada). Presents teaching tips and frequently-asked questions. The Internet primer handouts are appended. (AEF)

  6. PrimerDesign-M: a multiple-alignment based multiple-primer design tool for walking across variable genomes. (United States)

    Yoon, Hyejin; Leitner, Thomas


    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. Furthermore, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions. PrimerDesign-M is available as a webtool at or Published by Oxford University Press 2014. This work is written by US Government employees and is in the public domain in the US.

  7. New primers for the class Actinobacteria: application to marine and terrestrial environments. (United States)

    Stach, James E M; Maldonado, Luis A; Ward, Alan C; Goodfellow, Michael; Bull, Alan T


    In this study, we redesigned and evaluated primers for the class Actinobacteria. In silico testing showed that the primers had a perfect match with 82% of genera in the class Actinobacteria, representing a 26-213% improvement over previously reported primers. Only 4% of genera that displayed mismatches did so in the terminal three bases of the 3' end, which is most critical for polymerase chain reaction success. The primers, designated S-C-Act-0235-a-S-20 and S-C-Act-0878-a-A-19, amplified an approximately 640 bp stretch of the 16S rRNA gene from all actinobacteria tested (except Rubrobacter radiotolerans) up to an annealing temperature of 72 degrees C. An Actinobacteria Amplification Resource ( was generated to provide a visual guide to aid the amplification of actinobacterial 16S rDNA. Application of the primers to DNA extracted from marine and terrestrial samples revealed the presence of actinobacteria that have not been described previously. The use of 16S rDNA similarity and DNA-DNA pairing correlations showed that almost every actinomycete clone represented either a new species or a novel genus. The results of this study reinforce the proposition that current culture-based techniques drastically underestimate the diversity of Actinobacteria in the environment and highlight the need to evaluate taxon-specific primers regularly in line with improvements in databases holding 16S rDNA sequences.

  8. Primer design using Primer Express® for SYBR Green-based quantitative PCR. (United States)

    Singh, Amarjeet; Pandey, Girdhar K


    To quantitate the gene expression, real-time RT-PCR or quantitative PCR (qPCR) is one of the most sensitive, reliable, and commonly used methods in molecular biology. The reliability and success of a real-time PCR assay depend on the optimal experiment design. Primers are the most important constituents of real-time PCR experiments such as in SYBR Green-based detection assays. Designing of an appropriate and specific primer pair is extremely crucial for correct estimation of transcript abundance of any gene in a given sample. Here, we are presenting a quick, easy, and reliable method for designing target-specific primers using Primer Express(®) software for real-time PCR (qPCR) experiments.

  9. Logistic regression: a brief primer. (United States)

    Stoltzfus, Jill C


    's overall fit to the sample data is assessed using various goodness-of-fit measures, with better fit characterized by a smaller difference between observed and model-predicted values. Use of diagnostic statistics is also recommended to further assess the adequacy of the model. Finally, results for independent variables are typically reported as odds ratios (ORs) with 95% confidence intervals (CIs).

  10. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong


    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  11. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies. (United States)

    Wang, Yong; Qian, Pei-Yuan


    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  12. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Bacterial 16S ribosomal DNA (rDNA amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90% were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  13. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR. (United States)

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt


    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (

  14. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR (United States)

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-lin; Korbie, Darren; Trau, Matt


    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website ( PMID:28117430

  15. Genetics and health communication: a primer. (United States)

    Greenberg, Marisa S


    The progress of genetic knowledge has been swift and steadfast. As we move forward in the genomic era, post Human Genome Project, and continue to explore how one's genes interact with one's environment, it becomes increasingly important for all audiences to have a firm grasp of the vocabulary used in this health context. This primer is intended to be used as a reference and to introduce and/or make more clear concepts related to genetics to increase understanding.

  16. Status of NC Primer Demonstration & Transition (United States)


    skid coating – Navy facilities- plan to assess as alternative to zinc -rich primers – General: internal funding in place through at least 2019 to...anodized aluminum, magnesium, high-strength steel with cadmium, aluminum and zinc - nickel , composites • Stress corrosion cracking and corrosion...this data, NAVAIR authorizes the use of PPG, Inc. – Deft 02-GN-084 over conversion coatings qualified to MIL-DTL-81706, Type I, Class 1A when used

  17. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments. (United States)

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo


    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. CRISPR Primer Designer:Design primers for knockout and chromosome imaging CRISPR-Cas system

    Institute of Scientific and Technical Information of China (English)

    Meng Yan; Shi-Rong Zhou; Hong-Wei Xue


    The clustered regularly interspaced short palin-dromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especial y the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran local y and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were stil no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs local y and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  19. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system. (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei


    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  20. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.


    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  1. High-speed measurement of rifle primer blast waves

    CERN Document Server

    Courtney, Michael


    This article describes a method and results for direct high-speed measurements of rifle primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Our key findings are: 1) Most of the primer models tested show 5-12% standard deviation in the magnitudes of their peak pressure. 2) For most primer types tested, peak pressure magnitudes are well correlated with measured primer masses so that significant reductions in standard deviation are expected to result from sorting primers by mass. 3) A range of peak pressures from below 200 psi to above 500 psi is available in different primer types.

  2. MPprimer: a program for reliable multiplex PCR primer design. (United States)

    Shen, Zhiyong; Qu, Wubin; Wang, Wen; Lu, Yiming; Wu, Yonghong; Li, Zhifeng; Hang, Xingyi; Wang, Xiaolei; Zhao, Dongsheng; Zhang, Chenggang


    Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs) for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2x to 5x plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy), which has 79 exons, for 20x, 20x, 20x, 14x, and 5x plex PCR reactions in five tubes to detect underlying exon deletions. MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  3. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei


    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  4. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin


    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  5. Spectrophotometric determination of tetrazene in primers and primer mixes by use of resorcinol. (United States)

    Norwitz, G; Keliher, P N


    A spectrophotometric method is proposed for the determination of tetrazene (tetracene) in primers and primer mixes that involves treatment of the tetrazene with resorcinol solution and measurement of the intensity of the yellow colour of the diazo-dye produced. In the application of the method, lead styphnate and barium nitrate are first removed by extraction with ammonium acetate solution and then nitrocellulose and PETN are removed by extraction with acetone. The insoluble matter containing the tetrazene is boiled with resorcinol reagent, the solution filtered, and the absorbance measured at 400 nm. Conditions for optimum colour development are studied and the nature of the reaction is considered.

  6. Molecular characterization of Macrophomina phaseolina and Fusarium species by a single primer RAPD technique. (United States)

    Jana, Tarakanta; Sharma, Tilak R; Prasad, Ravulpalli D; Arora, Dilip K


    Charcoal root rot and wilt, are two economically important diseases of many crop plants in North and South America, Asia and Africa and some parts of Europe. Genetic variation in 43 isolates of Macrophomina phaseolina and 22 isolates of Fusarium species, collected from geographically distinct regions over a range of hosts, was studied using random amplified polymorphic DNA (RAPD) markers. Initially, 210 arbitrary nucleotide (10-mer) primers were tested for amplification of genomic DNA of one M. phaseolina isolate, 70 primers amplified the genomic DNA of M. phaseolina. One primer OPA-13 (5'-CAGCACCCAC-3') produced fingerprint profiles, which clearly distinguished between the different isolates of M. phaseolina. UPGMA analysis classified these isolates into five major groups. By primer OPA-13, 22 isolates of pathogenic and non-pathogenic Fusarium species of different formae-speciales and races, were also distinguished from M. phaseolina. This marker is useful for distinguishing between these two important plant pathogens irrespective of hosts, virulence spectrum and races. This is the first report of reliable diagnosis of two soilborne pathogens (root/collar rot and wilt causing pathogens) at the level of isolates, formae-speciales and races by a single primer RAPD procedure with uniform PCR conditions.

  7. Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas. (United States)

    Taylor, D Lee; McCormick, Melissa K


    Despite advances owing to molecular approaches, several hurdles still obstruct the identification of fungi forming orchid mycorrhizas. The Tulasnellaceae exhibit accelerated evolution of the nuclear ribosomal operon, causing most standard primers to fail in polymerase chain reaction (PCR) trials. Insufficient sequences are available from well characterized isolates and fruitbodies. Lastly, taxon-specific PCR primers are needed in order to explore the ecology of the fungi outside of the orchid root. Here, progress in overcoming these hurdles is reported. Broad-spectrum basidiomycete internal transcribed spacer (ITS) primers that do not exclude most known Tulasnellaceae are presented. blast searches and empirical PCR tests support their wide utility within the Basidiomycota. Taxon-specific ITS primers are presented targeted to orchid-associated Tulasnella, and a core component of the Thelephora-Tomentella complex. The efficiency and selectivity of these primer sets are again supported by blast searches and empirical tests. Lastly, ITS DNA sequences are presented from several strains of Epulorhiza, Ceratorhiza, Ceratobasidium, Sistotrema, Thanatephorus and Tulasnella that were originally described in the landmark mycorrhizal studies of Currah and Warcup. Detailed phylogenetic analyses reveal some inconsistencies in species concepts in these taxonomically challenging resupinate basidiomycetes, but also help to place several sequences from environmental samples.

  8. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera


    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka


    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera , including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera . We feel that a PCR-based approach still has its place in m...

  9. An engineering primer on extreme value statistics

    Energy Technology Data Exchange (ETDEWEB)

    Novog, D.R.; Hoppe, F. [McMaster Univ., Hamilton, Ontario (Canada); Nainer, O. [Bruce Power, Tiverton, Ontario (Canada); Phan, B. [Ontario Power Generation, Toronto, Ontario (Canada)


    This primer is intended for individuals interested in gaining an understanding of Extreme Value Statistics (EVS). This work provides an explanation of EVS at a level that can be accessible to most people with an engineering or science background. While this work represents a simplification of the discussions from Reference 1, it is hoped that the authors will forgive any liberties taken in this paper. Some of the simplifications presented here may not be rigorous in all aspects, but the sacrifice in rigour is intended to aid the fundamental understanding of the EVS formulation and basic application. (author)

  10. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral


    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  11. Precedentes musulmanes y primer arte cristiano


    Cabañero Subiza, Bernabé


    La comarca de las Cinco Villas en la que en los siglos X y XI no existió ningún centro artístico de primer orden en el que se crearan concepciones espaciales y soluciones formales propias. Por eso los monumentos de esta comarca pertenecientes a dichas centurias constituyen en casi todos los casos manifestaciones periféricas de corrientes artísticas creadas y desarrolladas fuera de sus confines. Esta llegada de soluciones formales foráneas a las Cinco Villas es tanto más explicable si...

  12. Lógica de Primer Orden


    Castel De Haro, María Jesús; Llorens Largo, Faraón


    Estos papeles que ahora tenéis en vuestras manos, nacieron con la idea de servir de material de apoyo a las clases de la asignatura “Lógica de Primer Orden”, que forma parte del programa de los estudios de Ingeniería Informática impartidos en la Escuela Politécnica Superior de la Universidad de Alicante. No se trata, por tanto, de un libro de texto sobre Lógica, ya que existen excelentes libros que cubren este objetivo y es una pérdida de tiempo volverlos a escribir. En ningún momento ha sido...

  13. Emulsion primers, their contribution to bonding


    González Sburlati, Rubén Osmar; Sapei, José


    Asphalt irrigation in its various types, performs specific functions in the structure of a road during the construction phase or their service life. In particular, the so-called "Irrigation Primer " is used in underlying layers, in order to generate a transition surface with the new asphalt layer; thus the tack or prime coat will be placed on a surface to ensure a good bond with the overlying layer. For a long time Diluted Asphalts (Cut Back mediums) where used, but have been discontinued for...

  14. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson


    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  15. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D


    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  16. Dogmatismo en estudiantes de primer semestre


    Beltrán Montero, María Gladys


    Rokeach, (1960). Postula el dogmatismo como una teoría psicológica de la personalidad y plantea una escala para su evaluación. Este trabajo analiza la estructura factorial de esta escala, en su forma E, y compara los resultados de una muestra de 1320 estudiantes de primer semestre de carrera de la Universidad Nacional de Colombia, con los obtenidos por Rokeach y sus colaboradores en sus investigaciones. Analiza, además, el nivel de dogmatismo de esta muestra en relación con el ...

  17. Sequence alignment status and amplicon size difference affecting EST-SSR primer performance and polymorphism (United States)

    Little attention has been given to failed, poorly-performing, and non-polymorphic expressed sequence tag (EST) simple sequence repeat (SSR) primers. This is due in part to a lack of interest and value in reporting them but also because of the difficulty in addressing the causes of failure on a prime...

  18. TM7 detection in human microbiome: are PCR primers and FISH probes specific enough? (United States)

    Sizova, Maria V.; Doerfert, Sebastian N.; Gavrish, Ekaterina; Epstein, Slava S.


    TM7 appears important and omnipresent because it is repeatedly detected by molecular techniques in diverse environments. Here we report that most of primers and FISH probes thought to be TM7-specific do hybridize with multiple species from oral and vaginal cavity. This calls for re-examination of TM7 distribution and abundance. PMID:25957511

  19. Development of TRAP primers for Ricinus communis L. (United States)

    Simões, K S; Silva, S A; Machado, E L; Brasileiro, H S


    The objective of this article was to develop TRAP (target region amplification polymorphism) primers for castor bean, with the goal of making functional markers available for genetic studies about the species. To do this, oligonucleotides were designed based on ESTs, obtained from the NCBI (National Center for Biotechnology Information) databank, which code enzymes involved in metabolic routes of fatty acid synthesis, ricin synthesis, and resistance to castor bean pathogens. The forward primers were designed with the help of the Primer3 software and, for the reverse, six arbitrary primers were used. To standardize the amplification reactions, the following criteria were used to select the primers: sizes between 18 and 20 bp, guanine/cytosine (GC) in the range of 40 to 60%, and average annealing temperature between 55° and 62°C. The design quality of the primers was verified using the Net Primer application. Fifty-six primers were designed, which had an average GC percentage of 53.2%. A total of 336 combinations were obtained using the 56 fixed and 6 arbitrary primers. Based on polymerase chain reaction, 330 combinations (89%) presented good amplification patterns for the genomic DNA of castor bean. The size of the fragments amplified varied between 50 and 2072 bp. The TRAP primers designed and validated in this study are the first for castor bean and represent a significant increase in the molecular markers for this species.

  20. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)


    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  1. Specific PCR product primer design using memetic algorithm. (United States)

    Yang, Cheng-Hong; Cheng, Yu-Huei; Chuang, Li-Yeh; Chang, Hsueh-Wei


    To provide feasible primer sets for performing a polymerase chain reaction (PCR) experiment, many primer design methods have been proposed. However, the majority of these methods require a relatively long time to obtain an optimal solution since large quantities of template DNA need to be analyzed. Furthermore, the designed primer sets usually do not provide a specific PCR product size. In recent years, evolutionary computation has been applied to PCR primer design and yielded promising results. In this article, a memetic algorithm (MA) is proposed to solve primer design problems associated with providing a specific product size for PCR experiments. The MA is compared with a genetic algorithm (GA) using an accuracy formula to estimate the quality of the primer design and test the running time. Overall, 50 accession nucleotide sequences were sampled for the comparison of the accuracy of the GA and MA for primer design. Five hundred runs of the GA and MA primer design were performed with PCR product lengths of 150-300 bps and 500-800 bps, and two different methods of calculating T(m) for each accession nucleotide sequence were tested. A comparison of the accuracy results for the GA and MA primer design showed that the MA primer design yielded better results than the GA primer design. The results further indicate that the proposed method finds optimal or near-optimal primer sets and effective PCR products in a dry dock experiment. Related materials are available online at 2009 American Institute of Chemical Engineers

  2. Chaotic Inertia Weight Particle Swarm Optimization for PCR Primer Design

    Directory of Open Access Journals (Sweden)

    Cheng-Huei Yang


    Full Text Available In order to provide feasible primer sets for performing a polymerase chain reaction (PCR experiment, many primer design methods have been proposed. However, the majority of these methods require a long time to obtain an optimal solution since large quantities of template DNA need to be analyzed, and the designed primer sets usually do not provide a specific PCR product size. In recent years, particle swarm optimization (PSO has been applied to solve many problems and yielded good results. In this paper, a logistic map is proposed to determine the value of inertia weight of PSO (CIWPSO to design feasible primers. Accuracies for the primer design of the Homo sapiens RNA binding motif protein 11 (RBM11, mRNA (NM_144770, and the Homo sapiens G protein-coupled receptor 78 (GPR78, mRNA (NM_080819 were calculated. Five hundred runs of PSO and the CIWPSO primer design method were performed on different PCR product lengths and the different methods of calculating the melting temperature. A comparison of the accuracy results for PSO and CIWPSO primer design showed that CIWPSO is superior to the PSO for primer design. The proposed method could effectively find optimal or near-optimal primer sets.

  3. High universality of matK primers for barcoding gymnosperms

    Institute of Scientific and Technical Information of China (English)

    Yan LI; Lian-Ming GAO; RAM C.POUDEL; De-Zhu Li; Alan FORREST


    DNA barcoding is a tool to provide rapid and accurate taxonomic identification using a standard DNA region. A two-marker combination of rnatK+rbcL was formally proposed as the core barcode for land plants by the Consortium for the Barcode of Life Plant Working Group. However, there are currently no barcoding primers for matK showing high universality in gymnosperms. We used 57 gymnosperm species representing 40 genera, 11families and four subclasses to evaluate the universality of nine candidate matK primers and one rbcL primer in this study. Primer (1F/724R) of rbcL is proposed here as a universal primer for gymnosperms due to high universality. One of the nine candidate matK primers (Gym_F1A/Gym_R1A) is proposed as the best "universal" matK primer for gynnosperms because of high polymerase chain reaction success and routine generation of high quality bidirectional sequences. A specific matK primer for Ephedra was newly designed in this study, which performed well on the sampled species. The primers proposed here for rbcL and matK can be easily and successfully amplified for most gymnosperms.

  4. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  5. Homolog-specific PCR primer design for profiling splice variants. (United States)

    Srivastava, Gyan Prakash; Hanumappa, Mamatha; Kushwaha, Garima; Nguyen, Henry T; Xu, Dong


    To study functional diversity of proteins encoded from a single gene, it is important to distinguish the expression levels among the alternatively spliced variants. A variant-specific primer pair is required to amplify each alternatively spliced variant individually. For this purpose, we developed a new feature, homolog-specific primer design (HSPD), in our high-throughput primer and probe design software tool, PRIMEGENS-v2. The algorithm uses a de novo approach to design primers without any prior information of splice variants or close homologs for an input query sequence. It not only designs primer pairs but also finds potential isoforms and homologs of the input sequence. Efficiency of this algorithm was tested for several gene families in soybean. A total of 187 primer pairs were tested under five different abiotic stress conditions with three replications at three time points. Results indicate a high success rate of primer design. Some primer pairs designed were able to amplify all splice variants of a gene. Furthermore, by utilizing combinations within the same multiplex pool, we were able to uniquely amplify a specific variant or duplicate gene. Our method can also be used to design PCR primers to specifically amplify homologs in the same gene family. PRIMEGENS-v2 is available at:

  6. GENOMEMASKER package for designing unique genomic PCR primers

    Directory of Open Access Journals (Sweden)

    Kaplinski Lauris


    Full Text Available Abstract Background The design of oligonucleotides and PCR primers for studying large genomes is complicated by the redundancy of sequences. The eukaryotic genomes are particularly difficult to study due to abundant repeats. The speed of most existing primer evaluation programs is not sufficient for large-scale experiments. Results In order to improve the efficiency and success rate of automatic primer/oligo design, we created a novel method which allows rapid masking of repeats in large sequence files, for example in eukaryotic genomes. It also allows the detection of all alternative binding sites of PCR primers and the prediction of PCR products. The new method was implemented in a collection of efficient programs, the GENOMEMASKER package. The performance of the programs was compared to other similar programs. We also modified the PRIMER3 program, to be able to design primers from lowercase-masked sequences. Conclusion The GENOMEMASKER package is able to mask the entire human genome for non-unique primers within 6 hours and find locations of all binding sites for 10 000 designed primer pairs within 10 minutes. Additionally, it predicts all alternative PCR products from large genomes for given primer pairs.

  7. Great Lakes rivermouths: a primer for managers (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul


    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  8. Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia.

    Directory of Open Access Journals (Sweden)

    Luisa W Hugerth

    Full Text Available High-throughput sequencing of ribosomal RNA gene (rDNA amplicons has opened up the door to large-scale comparative studies of microbial community structures. The short reads currently produced by massively parallel sequencing technologies make the choice of sequencing region crucial for accurate phylogenetic assignments. While for 16S rDNA, relevant regions have been well described, no truly systematic design of 18S rDNA primers aimed at resolving eukaryotic diversity has yet been reported. Here we used 31,862 18S rDNA sequences to design a set of broad-taxonomic range degenerate PCR primers. We simulated the phylogenetic information that each candidate primer pair would retrieve using paired- or single-end reads of various lengths, representing different sequencing technologies. Primer pairs targeting the V4 region performed best, allowing discrimination with paired-end reads as short as 150 bp (with 75% accuracy at genus level. The conditions for PCR amplification were optimised for one of these primer pairs and this was used to amplify 18S rDNA sequences from isolates as well as from a range of environmental samples which were then Illumina sequenced and analysed, revealing good concordance between expected and observed results. In summary, the reported primer sets will allow minimally biased assessment of eukaryotic diversity in different microbial ecosystems.

  9. Systematic design of 18S rRNA gene primers for determining eukaryotic diversity in microbial consortia. (United States)

    Hugerth, Luisa W; Muller, Emilie E L; Hu, Yue O O; Lebrun, Laura A M; Roume, Hugo; Lundin, Daniel; Wilmes, Paul; Andersson, Anders F


    High-throughput sequencing of ribosomal RNA gene (rDNA) amplicons has opened up the door to large-scale comparative studies of microbial community structures. The short reads currently produced by massively parallel sequencing technologies make the choice of sequencing region crucial for accurate phylogenetic assignments. While for 16S rDNA, relevant regions have been well described, no truly systematic design of 18S rDNA primers aimed at resolving eukaryotic diversity has yet been reported. Here we used 31,862 18S rDNA sequences to design a set of broad-taxonomic range degenerate PCR primers. We simulated the phylogenetic information that each candidate primer pair would retrieve using paired- or single-end reads of various lengths, representing different sequencing technologies. Primer pairs targeting the V4 region performed best, allowing discrimination with paired-end reads as short as 150 bp (with 75% accuracy at genus level). The conditions for PCR amplification were optimised for one of these primer pairs and this was used to amplify 18S rDNA sequences from isolates as well as from a range of environmental samples which were then Illumina sequenced and analysed, revealing good concordance between expected and observed results. In summary, the reported primer sets will allow minimally biased assessment of eukaryotic diversity in different microbial ecosystems.

  10. Disección traumática de la arteria carótida interna y embolismo cerebral en un jugador de fútbol: Reporte del primer caso

    Directory of Open Access Journals (Sweden)

    Luisa S. Talledo Paredes


    Full Text Available Reportamos el caso de un varón de 18 años quien sufrió contusión cervical por impacto con balón de fútbol. Tres días después fue hospitalizado con hemiplejia derecha directa y afasia de expresión. La resonancia magnética cerebral mostró lesión isquémica izquierda en ganglios basales. El doppler carotideo evidenció trombo desde el origen de la arteria carótida común izquierda extendida a la arteria carótida interna izquierda (CII y la angiotomografía documentó disección de CII (lesión traumática carotídea tipo IV. Se optó por anticoagulación con warfarina y fisioterapia de rehabilitación; con evolución favorable. La incidencia de la injuria traumática carotídea es muy rara, más aún en futbolistas; el tratamiento es aún controversial, por lo que consideramos de interés el reporte de este caso.

  11. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius


    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  12. Primer on tritium safe handling practices

    Energy Technology Data Exchange (ETDEWEB)


    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  13. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius


    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  14. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius


    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  15. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius


    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  16. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats. (United States)

    Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I


    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.

  17. Vitrificacion de blastocitos bovinos producidos in vitro con el método Open Pulled Straw (OPS: Primer reporte* Succesfull vitrification with the Open Pulled Straw method (OPS of bovine blastocysts produced in vitro: Preliminary results

    Directory of Open Access Journals (Sweden)

    M. E. Silva


    matured. Even though our results are slightly lower to those reported in the literature, they show that it is possible to successfully vitrify bovine blastocysts produced in vitro using the OPS method

  18. Gestación exitosa después de exposición inadvertida a ciclofosfamida durante el primer trimestre en una paciente con lupus activo. Reporte de caso = Successful pregnancy after inadvertent exposure to cyclophosphamide in the first trimester in a patient with active lupus. Case report

    Directory of Open Access Journals (Sweden)

    Restrepo Escobar, Mauricio


    Full Text Available La ciclofosfamida se debe evitar durante el embarazo por sus efectos teratogénicos reconocidos. Los embriones o fetos de madres que requieren el uso de ciclofosfamida, o que se exponen inadvertidamente a la misma, tienen usualmente un desenlace adverso. En muy raras ocasiones se han informado gestaciones exitosas a pesar del uso de este medicamento durante el embarazo. Presentamos un nuevo caso de gestación exitosa en una mujer con lupus activo renal y neurosiquiátrico quien tuvo exposición a la ciclofosfamida durante el primer trimestre de su gestación.

  19. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix]. (United States)

    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh


    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  20. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers. (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  1. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang


    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  2. Uncoupling primer and releaser responses to pheromone in honey bees (United States)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.


    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  3. High-speed measurement of firearm primer blast waves

    CERN Document Server

    Courtney, Michael; Eng, Jonathan; Courtney, Amy


    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast pressure of 8.2-25.0%. 3) Combined with smaller blast waves, these large variations in peak blast pressure of DDNP-based primers led to delayed ignition and failure to fire in brief field tests.

  4. PolyMarker: A fast polyploid primer design pipeline. (United States)

    Ramirez-Gonzalez, Ricardo H; Uauy, Cristobal; Caccamo, Mario


    The design of genetic markers is of particular relevance in crop breeding programs. Despite many economically important crops being polyploid organisms, the current primer design tools are tailored for diploid species. Bread wheat, for instance, is a hexaploid comprising of three related genomes and the performance of genetic markers is diminished if the primers are not genome specific. PolyMarker is a pipeline that generates SNP markers by selecting candidate primers for a specified genome using local alignments and standard primer design tools to test the viability of the primers. A command line tool and a web interface are available to the community. PolyMarker is available as a ruby BioGem: bio-polyploid-tools. Web interface: © The Author 2015. Published by Oxford University Press.

  5. Validated primer set that prevents nuclear DNA sequences of mitochondrial origin co-amplification: a revision based on the New Human Genome Reference Sequence (GRCh37). (United States)

    Ramos, Amanda; Santos, Cristina; Barbena, Elena; Mateiu, Ligia; Alvarez, Luis; Nogués, Ramon; Aluja, Maria Pilar


    A new human genome reference sequence--GRCh37--was recently generated and made available by the Genome Reference Consortium. Since the prior disposable human reference sequence--hg18--was previously used for the mitochondrial DNA primer BLAST validation, a revision of those previously published primer pairs is required. Thus, the aim of this Short Communication is to perform an in silico BLAST test of the published disposable nine primer pairs using the new human reference sequence and to report the pertinent modifications. The new analysis showed that one of the tested primer pairs requires a revision. Therefore, a new validated primer pair, which specifically amplifies the mitochondrial region located between positions 6520 and 9184, is presented.

  6. PrimerSeq:Design and Visualization of RT-PCR Primers for Alternative Splicing Using RNA-seq Data

    Institute of Scientific and Technical Information of China (English)

    Collin Tokheim; Juw Won Park; Yi Xing


    The vast majority of multi-exon genes in higher eukaryotes are alternatively spliced and changes in alternative splicing (AS) can impact gene function or cause disease. High-throughput RNA sequencing (RNA-seq) has become a powerful technology for transcriptome-wide analysis of AS, but RT-PCR still remains the gold-standard approach for quantifying and validating exon splicing levels. We have developed PrimerSeq, a user-friendly software for systematic design and visualization of RT-PCR primers using RNA-seq data. PrimerSeq incorporates user-provided tran-scriptome profiles (i.e., RNA-seq data) in the design process, and is particularly useful for large-scale quantitative analysis of AS events discovered from RNA-seq experiments. PrimerSeq features a graphical user interface (GUI) that displays the RNA-seq data juxtaposed with the expected RT-PCR results. To enable primer design and visualization on user-provided RNA-seq data and transcript annotations, we have developed PrimerSeq as a stand-alone software that runs on local computers. PrimerSeq is freely available for Windows and Mac OS X along with source code at With the growing popularity of RNA-seq for transcriptome stud-ies, we expect PrimerSeq to help bridge the gap between high-throughput RNA-seq discovery of AS events and molecular analysis of candidate events by RT-PCR.

  7. A novel quantitative real-time PCR assay using self-reporting duplex mutation primers for detection of Chlamydia trachomatis%新型二聚体突变荧光引物定量检测沙眼衣原体

    Institute of Scientific and Technical Information of China (English)

    夏乾峰; 覃西; 钱士匀; 涂植光


    目的 以二聚体突变荧光引物技术为基础建立对沙眼衣原体进行定量检测的新方法.方法 以沙眼衣原体主要外膜蛋白(MOMP)基因构建重组质粒作为DNA标准品,设计二聚体突变荧光引物,优化定量PCR体系并进行性能评价;同时对148例临床生殖道标本进行检测.结果 建立的二聚体突变荧光引物的定量PCR方法,其线性范围为101~109copies/μL,灵敏度为10 copies/μL;低浓度样品的批内变异系数(CV)为4.71%,批间CV为5.57%;高浓度样品的批内CV为3.20%,批间CV为3.66%;常见生殖道病原菌检测结果均为阴性;对确诊的148例患者标本检测准确率为90.32%.结论 建立的沙眼衣原体定量PCR检测方法具有快速、准确、结果可靠等特点,可为沙眼衣原体感染的诊断、治疗监测和流行病学调查提供较好的技术支持.%Objective To establish a novel real-time fluorescence PCR method to detect Chlamydia trachomatis (CT) using self-reporting duplex mutation primers. Methods The recombinant vector was constructed with major outer membrane protein ( MOMP) gene of CT and was used as the standard template. The self-reporting duplex mutation primers were designed according to the cloned gene sequence. The quantitative PCR reaction system was optimized and the experimental performance of real-time PCR was evaluated. A total of 148 clinical samples from tractus genitalis were detected. Results The developed method showed a wide range of linearity from 101 to 109 copies/μL and high sensitivity (10 copies/μL). The intra-assay and inter-assay coefficient of variation (CV) in the low concentration of samples were 4.71% and 5.57% respectively, while they were 3.20% and 3. 66% in the high concentration of samples. The results of common pathogenic bacteria in tractus genitalis detected by the established method were all negative, while 99.32% were positive in 148 clinical samples which were identified as Chlamydia trachomatis infection

  8. PD5: a general purpose library for primer design software. (United States)

    Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda


    Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples:

  9. Detection of Clostridium tetani in human clinical samples using tetX specific primers targeting the neurotoxin. (United States)

    Ganesh, Madhu; Sheikh, Nasira K; Shah, Pooja; Mehetre, Gajanan; Dharne, Mahesh S; Nagoba, Basavraj S


    Tetanus resulting from ear injury remains an important health problem, particularly in the developing world. We report the successful detection of Clostridium tetani using tetX specific primers targeting the Cl. tetani neurotoxin. The sample was obtained from an ear discharge of a case of otogenic tetanus in a 2-year-old male child. Based on the culture results of the ear discharge, Gram staining and virulence testing by genotyping, a diagnosis of tetanus was confirmed. This is the first report from India on the successful detection of Cl. tetani in a human clinical sample using tetX specific primers targeting the Cl. tetani neurotoxin.

  10. Real‐time PCR (qPCR) primer design using free online software

    National Research Council Canada - National Science Library

    Thornton, Brenda; Basu, Chhandak


    ...‐stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green‐based qPCR primers...

  11. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J


    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  12. Study on gene sensor based on primer extension

    Institute of Scientific and Technical Information of China (English)

    陈誉华; 宋今丹; 李大为


    Based on the fact that the resonant frequency of a piezoelectric crystal is the function of its surface deposit, and that the primer extends after it hybridizes with the template, the primer extension gene sensor technique was developed. The prominent feature of the technique is that fast and sensitive frequency signals are used as the monitoring system of gene hybridization and primer strand extension. Results show that this technique may be used in homologous analysis of nucleic acid, trace DNA detection, and determining the integration of DNA. It may also be used for isolation of target gene, gene mutation analysis, and predicting the location of a gene in its genome.

  13. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini


    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  14. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    Energy Technology Data Exchange (ETDEWEB)


    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  15. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande


    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  16. Combination Primer Polymerase Chain Reaction for Multi-Site Mutagenesis of Close Proximity Sites


    Jensen, Pia Hønnerup; Weilguny, Dietmar


    We describe a rapid and efficient polymerase chain reaction procedure for multi-site-directed mutagenesis for cases in which the sites to be mutated are in close proximity. The combination primer polymer chain reaction method is based on a multi-site directed mutagenesis protocol together with a splicing by overlapping extension polymerase chain reaction protocol. several different combinations of multiple mutations were successfully performed with this method and are reported in this study.

  17. Comprehensive Evaluation and Transition of Non-Chromate Primers within DoD (United States)


    Materials Engineering Division ASETS Defense 2012 NAVAIR Distribution Statement – Distribution A Report Documentation Page Form...Primers : Akzo Nobel MgO 2111 PPG CA 7236 PPG CA 7211 PPG CA 7222 PPG CA 7233 Topcoat Deft ELT Corrosion tests: ASTM B117 (x2) ASTM...control. • Compare & correlate NAVAIR and AFRL galvanic panel test methods 10 NAVAIR/USAF Statement of Need 0 . 5 1.5 3 0 .5 1

  18. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine


    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  19. Quantitative PCR measurements of the effects of introducing inosines into primers provides guidelines for improved degenerate primer design. (United States)

    Zheng, Linda; Gibbs, Mark J; Rodoni, Brendan C


    Polymerase chain reaction (PCR) is used to detect groups of viruses with the use of group-specific degenerate primers. Inosine residues are sometimes used in the primers to match variable positions within the complementary target sequences, but there is little data on their effects on cDNA synthesis and amplification. A quantitative reverse-transcription PCR was used to measure the rate of amplification with primers containing inosine residues substituted at different positions and in increasing numbers. Experiments were conducted using standard quantities of cloned DNA copied from Potato virus Y genomic RNA and RNA (cRNA) transcribed from the cloned DNA. Single inosine residues had no affect on the amplification rate in the forward primer, except at one position close to the 3' terminus. Conversely, single inosine residues significantly reduced the amplification rate when placed at three out of four positions in the reverse primer. Four or five inosine substitutions could be tolerated with some decline in rates, but amplification often failed from cRNA templates with primers containing larger numbers of inosines. Greater declines in the rate of amplification were observed with RNA templates, suggesting that reverse transcription suffers more than PCR amplification when inosine is included in the reverse primer.

  20. Electrocoat Process for Non-Chromate Primers in DOD Manufacturing (United States)


    Performance Benefits of Electrocoat Environmental, Health, and Safety Considerations • Aqueous based • Minimal waste discharge- closed loop...Electrocoat has larger area of blistering ; all surface corrosion • Spray primers have more localized, but deeper corrosion Scribe near fastener

  1. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatic tools and guideline for PCR primer design. ... AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING AJOL · RESOURCES ... Bioinformatics has become an essential tool not only for basic research but also ...

  2. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim


    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  3. Primer effects of a brood pheromone on honeybee behavioural development

    National Research Council Canada - National Science Library

    Yves Le Conte; Arezki Mohammedi; Gene E. Robinson


    ..., also act as a primer pheromone in the regulation of division of labour among adult workers. Bees in colonies receiving brood pheromone initiated foraging at significantly older ages than did bees in control colonies in five out of five trials...

  4. MultiPLX: automatic grouping and evaluation of PCR primers. (United States)

    Kaplinski, Lauris; Remm, Maido


    In this chapter we describe MultiPLX-a tool for automatic grouping of PCR primers for multiplexed PCR. Both generic working principle and step-by-step practical procedures with examples are presented. MultiPLX performs grouping by calculating many important interaction levels between the different primer pairs and then distributes primer pairs to groups so that the strength of unwanted interactions is kept below user-defined compatibility level. In addition it can be used to select optimal primer pairs for multiplexing from list of candidates. MultiPLX can be downloaded from Graphical web-based interface to most functions of MultiPLX is available at

  5. A Pollen Primer | NIH MedlinePlus the Magazine (United States)

    ... please turn Javascript on. Feature: Managing Allergies A Pollen Primer Past Issues / Summer 2011 Table of Contents ... National Institute of Environmental Health Sciences (NIEHS) . Plant Pollen Ragweed and other weeds, such as curly dock, ...

  6. USER-derived cloning methods and their primer design. (United States)

    Salomonsen, Bo; Mortensen, Uffe H; Halkier, Barbara A


    Uracil excision-based cloning through USER™ (Uracil-Specific Excision Reagent) is an efficient ligase-free cloning technique that comprises USER cloning, USER fusion, and USER cassette-free (UCF) USER fusion. These USER-derived cloning techniques enable seamless assembly of multiple DNA fragments in one construct. Though governed by a few simple rules primer design for USER-based fusion of PCR fragments can prove time-consuming for inexperienced users. The Primer Help for USER (PHUSER) software is an easy-to-use primer design tool for USER-based methods. In this chapter, we present a PHUSER software protocol for designing primers for USER-derived cloning techniques.

  7. Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L. as examples

    Directory of Open Access Journals (Sweden)

    Brûlé-Babel Anita


    Full Text Available Abstract Background In allopolypoid crops, homoeologous genes in different genomes exhibit a very high sequence similarity, especially in the coding regions of genes. This makes it difficult to design genome-specific primers to amplify individual genes from different genomes. Development of genome-specific primers for agronomically important genes in allopolypoid crops is very important and useful not only for the study of sequence diversity and association mapping of genes in natural populations, but also for the development of gene-based functional markers for marker-assisted breeding. Here we report on a useful approach for the development of genome-specific primers in allohexaploid wheat. Findings In the present study, three genome-specific primer sets for the waxy (Wx genes and four genome-specific primer sets for the starch synthase II (SSII genes were developed mainly from single nucleotide polymorphisms (SNPs and/or insertions or deletions (Indels in introns and intron-exon junctions. The size of a single PCR product ranged from 750 bp to 1657 bp. The total length of amplified PCR products by these genome-specific primer sets accounted for 72.6%-87.0% of the Wx genes and 59.5%-61.6% of the SSII genes. Five genome-specific primer sets for the Wx genes (one for Wx-7A, three for Wx-4A and one for Wx-7D could distinguish the wild type wheat and partial waxy wheat lines. These genome-specific primer sets for the Wx and SSII genes produced amplifications in hexaploid wheat, cultivated durum wheat, and Aegilops tauschii accessions, but failed to generate amplification in the majority of wild diploid and tetraploid accessions. Conclusions For the first time, we report on the development of genome-specific primers from three homoeologous Wx and SSII genes covering the majority of the genes in allohexaploid wheat. These genome-specific primers are being used for the study of sequence diversity and association mapping of the three homoeologous Wx

  8. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling. (United States)

    Pauthenier, Cyrille; Faulon, Jean-Loup


    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T


    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  10. New universal matK primers for DNA barcoding angiosperms

    Institute of Scientific and Technical Information of China (English)

    Jing YU; Jian-Hua XUE; Shi-Liang ZHOU


    The chloroplast maturase K gene (matK) is one of the most variable coding genes of angiosperms and has been suggested to be a "barcode" for land plants. However, matK exhibits low amplification and sequencing rates due to low universality of currently available primers and mononucleotide repeats. To resolve these technical problems, we evaluated the entire matK region to find a region of 600-800 bp that is highly variable, represents the best of all matK regions with priming sites conservative enough to design universal primers, and avoids the mononucleotide repeats. After careful evaluation, a region in the middle was chosen and a pair of primers named natK472F and matK1248R was designed to amplify and sequence the matK fragment of approximately 776 bp. This region encompasses the most variable sites, represents the entire matK region best, and also exhibits high amplification rates and quality of sequences. The universality of this primer pair was tested using 58 species from 47 families of angiosperm plants. The primers showed a strong amplification (93.1%) and sequencing (92.6%)successes in the species tested. We propose that the new primers will solve, in part, the problems encountered when using matK and promote the adoption of matK as a DNA barcode for angiosperms.

  11. Application of Single—labelled Probe—primer in PCR Amplification to the Detection of Hepatitis B Virus DNA

    Institute of Scientific and Technical Information of China (English)

    KONG,De-Ming; SHEN,Han-Xi


    A new method based on the incorporation of a single-lablled probe-primer into polymerase chain reaction(PCR) for the detection of PCR-amplified DNA in a closed system is reported.The probeprimerc consists of a specific probe sequence on the 5''''''''-end and a primer sequence on the 3''''''''-end.A flurophore is located at the 5''''''''end.The primeR-quencher is an oligonucleotide,which is complementary to the probe sequence of probe-primer and labelled with a quencher at the 3''''''''-end.In the duplex formed by probe-primer and primer-quencher.the fluorophore and quencher are kept in close proximity to each other.Therefore the fluorescence is quenched.During PCR amplificatio,the specific probe sequence of probeprimer binds to its complement within the same strand of DNA,and is cleaved by Taq DNA polymerase,resulting in the restoration of fluorescence.This system has the same energy transfer mechanism as molecular beacons,and a good quenching effciency can be ensured.Following optimization of PCR conditions,this method was used to detect hepatitis b virus(HBV) dna in patient sera.This technology eliminates the risk of carry-over contamination,simplifies the amplification assay and opens up new possibilities for the real-time detection of the amplified DNA.

  12. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms. (United States)

    David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart


    GETPrime ( is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    Energy Technology Data Exchange (ETDEWEB)

    Rearden, Bradley T [ORNL; Mueller, Don [ORNL; Bowman, Stephen M [ORNL; Busch, Robert D. [University of New Mexico, Albuquerque; Emerson, Scott [University of New Mexico, Albuquerque


    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  14. A novel three primers PCR (TP-PCR) method to obtain recombinant DNA molecule independent of restriction enzyme

    Institute of Scientific and Technical Information of China (English)


    In this note, we report a novel and efficient three primers PCR (TP-PCR) method to rapidly generate recombinant DNA molecule at precise junction between two arbitrary DNA fragments. TP-PCR method is characterized by its reaction system with two templates and three primers, which can produce a recombinant DNA molecule in one PCR reaction. The main advantages of this method are the independence of sequences at the recombination site, the rapidness, and the easy establishment of adequate conditions. This method has been successfully applied to constructing a fusion protein gene, sck gene.

  15. Hypervariable spacer regions are good sites for developing specific PCR-RFLP markers and PCR primers for screening actinorhizal symbionts

    Indian Academy of Sciences (India)

    Rajani Varghese; Vineeta S Chauhan; Arvind K Misra


    While the ribosomal RNA like highly conserved genes are good molecular chronometers for establishing phylogenetic relationships, they can also be useful in securing the amplification of adjoining hyper-variable regions. These regions can then be used for developing specific PCR primers or PCR-RFL profiles to be used as molecular markers. We report here the use of ITS region of rrn operon of Frankia for developing PCR-RFL profiles capable of discriminating between closely related frankiae. We have also made use of the ITS1 region of the nuclear rrn operon of Alnus nepalensis (D Don) for designing a PCR primer for specific amplification of nuclear DNA of this tree.

  16. Linear-After-The-Exponential (LATE)-PCR: Primer design criteria for high yields of specific single-stranded DNA and improved real-time detection (United States)

    Pierce, Kenneth E.; Sanchez, J. Aquiles; Rice, John E.; Wangh, Lawrence J.


    Traditional asymmetric PCR uses conventional PCR primers at unequal concentrations to generate single-stranded DNA. This method, however, is difficult to optimize, often inefficient, and tends to promote nonspecific amplification. An alternative approach, Linear-After-The-Exponential (LATE)-PCR, solves these problems by using primer pairs deliberately designed for use at unequal concentrations. The present report systematically examines the primer design parameters that affect the exponential and linear phases of LATE-PCR amplification. In particular, we investigated how altering the concentration-adjusted melting temperature (Tm) of the limiting primer (TmL) relative to that of the excess primer (TmX) affects both amplification efficiency and specificity during the exponential phase of LATE-PCR. The highest reaction efficiency and specificity were observed when TmL - TmX ≥ 5°C. We also investigated how altering TmX relative to the higher Tm of the double-stranded amplicon (TmA) affects the rate and extent of linear amplification. Excess primers with TmX closer to TmA yielded higher rates of linear amplification and stronger signals from a hybridization probe. These design criteria maximize the yield of specific single-stranded DNA products and make LATE-PCR more robust and easier to implement. The conclusions were validated by using primer pairs that amplify sequences within the cystic fibrosis transmembrane regulator (CFTR) gene, mutations of which are responsible for cystic fibrosis. PMID:15937116

  17. PrimerSNP: a web tool for whole-genome selection of allele-specific and common primers of phylogenetically-related bacterial genomic sequences

    Directory of Open Access Journals (Sweden)

    Lemos Eliana


    Full Text Available Abstract Background The increasing number of genomic sequences of bacteria makes it possible to select unique SNPs of a particular strain/species at the whole genome level and thus design specific primers based on the SNPs. The high similarity of genomic sequences among phylogenetically-related bacteria requires the identification of the few loci in the genome that can serve as unique markers for strain differentiation. PrimerSNP attempts to identify reliable strain-specific markers, on which specific primers are designed for pathogen detection purpose. Results PrimerSNP is an online tool to design primers based on strain specific SNPs for multiple strains/species of microorganisms at the whole genome level. The allele-specific primers could distinguish query sequences of one strain from other homologous sequences by standard PCR reaction. Additionally, PrimerSNP provides a feature for designing common primers that can amplify all the homologous sequences of multiple strains/species of microorganisms. PrimerSNP is freely available at Conclusion PrimerSNP is a high-throughput specific primer generation tool for the differentiation of phylogenetically-related strains/species. Experimental validation showed that this software had a successful prediction rate of 80.4 – 100% for strain specific primer design.

  18. MPD: multiplex primer design for next-generation targeted sequencing. (United States)

    Wingo, Thomas S; Kotlar, Alex; Cutler, David J


    Targeted resequencing offers a cost-effective alternative to whole-genome and whole-exome sequencing when investigating regions known to be associated with a trait or disease. There are a number of approaches to targeted resequencing, including microfluidic PCR amplification, which may be enhanced by multiplex PCR. Currently, there is no open-source software that can design next-generation multiplex PCR experiments that ensures primers are unique at a genome-level and efficiently pools compatible primers. We present MPD, a software package that automates the design of multiplex PCR primers for next-generation sequencing. The core of MPD is implemented in C for speed and uses a hashed genome to ensure primer uniqueness, avoids placing primers over sites of known variation, and efficiently pools compatible primers. A JavaScript web application ( ) utilizing the MPD Perl package provides a convenient platform for users to make designs. Using a realistic set of genes identified by genome-wide association studies (GWAS), we achieve 90% coverage of all exonic regions using stringent design criteria. Using the first 47 primer pools for wet-lab validation, we sequenced ~25Kb at 99.7% completeness with a mean coverage of 300X among 313 samples simultaneously and identified 224 variants. The number and nature of variants we observe are consistent with high quality sequencing. MPD can successfully design multiplex PCR experiments suitable for next-generation sequencing, and simplifies retooling targeted resequencing pipelines to focus on new targets as new genetic evidence emerges.

  19. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven


    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  20. Rice8987Corresponding Table(f_g_primer) - RMOS | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us RMOS Rice8987Corresponding Table(f_g_primer) Data detail Data name Rice8987Corresponding Table(f_g_primer...) DOI 10.18908/lsdba.nbdc00194-009 Description of data contents List of primer information of Rice8987Array (f_g_primer...). Data file File name: File URL: File size: 636 KB Simple... search URL Data acquisition method - Da

  1. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J


    can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site.......Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...

  2. Studies on the Primers Screening for AFLP Fingerprints of Rice Cultivars

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun-qing; JIA Ji-zeng


    AFLP(amplified fragment length polymorphism) is a very powerful fingerprinting technology.The key of making variety fingerprints is to select specific powerful primers for each crop. A quick and effective procedure for selecting AFLP primers for rice variety fingerprinting was established as the following: (1)Choose 3 or more group materials that have close genetic relations. (2) Select potential polymorphic primers from primer pairs that are 2 + 2 primer crosses and same at two ends. (3) Recombine the selected potential polymorphic primers and choosing more polymorphic primers. (4) Add one selecting base at one end to become 2 + 3 or 3 + 2primers and further selecting more polymorphic primers. Some primers were selected with this procedure, such as M21Ps7 and M73P17, with which the fingerprints had more polymorphism and high quality.

  3. Novel multiple 5'-amino-modified primer for DNA microarrays. (United States)

    Han, Jing; Lee, Hin; Nguyen, Nga Yen; Beaucage, Serge L; Puri, Raj K


    For DNA microarray analysis, total RNA is reverse-transcribed, labeled by incorporating fluorescent dye into the cDNA, and used to hybridize microarray. This protocol requires a minimum of 20 microg of total RNA. To overcome the sample limitation, an RNA amplification technique has been developed. Although it needs less RNA, this amplification technique is relatively expensive, time consuming, and, unfortunately, has been found to introduce bias. In this study, we designed a novel 5'-amino-modified primer and used it for priming cDNA synthesis. The novel primer has a special structure that contains four Uni-Link molecules with two nucleotide (thymine) residues inserted between them as spacers. This novel primer is used in the reverse-transcription reaction for cDNA synthesis. Using the novel 5'-modified primer combined with indirect labeling method, cDNA probes can be prepared with much less total RNA (5 microg or less) without amplification producing optimal results after hybridization of arrays. This primer can also be used to label nucleotides for other purposes.

  4. PCR primers for metazoan mitochondrial 12S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. METHODOLOGY/PRINCIPAL FINDINGS: A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. CONCLUSIONS/SIGNIFICANCE: Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans.

  5. Primer design for PCR reactions in forensic biology. (United States)

    Elkins, Kelly M


    The polymerase chain reaction (PCR) is a popular method to copy DNA in vitro. Its invention revolutionized fields ranging from clinical medicine to anthropology, molecular biology, and forensic biology. The method employs one of many available heat-stable DNA polymerases in a reaction that is repeated many times in situ. The DNA polymerase reads a template DNA strand and using the components of the reaction mix, catalyzes the addition of free 2'-deoxynucleotide triphosphate nitrogenous bases to short segment of DNA that forms a complement with the template via Watson-Crick base pairing. This short segment of DNA is referred to as a PCR primer and it is essential to the success of the reaction. The most widely used application of PCR in forensic labs is the amplification of short tandem repeat (STR) loci used in DNA typing. The STRs are routinely evaluated in concert with 16 or more reactions, a multiplex, run in one test tube simultaneously. In a multiplex, it is essential that the primers work specifically and accurately on the intended reactions without hindering the other reactions. The primers, which are very specific, also can be used to probe single nucleotide polymorphisms (SNPs) in a DNA sequence of interest by single base extension. Primers are often designed using one of many available automated software packages. Here the process of manually designing PCR primers for forensic biology using no-cost software is described.

  6. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L


    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  7. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling. (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G


    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  8. Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones. (United States)

    Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis


    Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements.

  9. Crystal structure of complete rhinovirus RNA polymerase suggests front loading of protein primer. (United States)

    Appleby, Todd C; Luecke, Hartmut; Shim, Jae Hoon; Wu, Jim Z; Cheney, I Wayne; Zhong, Weidong; Vogeley, Lutz; Hong, Zhi; Yao, Nanhua


    Picornaviruses utilize virally encoded RNA polymerase and a uridylylated protein primer to ensure replication of the entire viral genome. The molecular details of this mechanism are not well understood due to the lack of structural information. We report the crystal structure of human rhinovirus 16 3D RNA-dependent RNA polymerase (HRV16 3Dpol) at a 2.4-A resolution, representing the first complete polymerase structure from the Picornaviridae family. HRV16 3Dpol shares the canonical features of other known polymerase structures and contains an N-terminal region that tethers the fingers and thumb subdomains, forming a completely encircled active site cavity which is accessible through a small tunnel on the backside of the molecule. The small thumb subdomain contributes to the formation of a large cleft on the front face of the polymerase which also leads to the active site. The cleft appears large enough to accommodate a template:primer duplex during RNA elongation or a protein primer during the uridylylation stage of replication initiation. Based on the structural features of HRV16 3Dpo1 and the catalytic mechanism known for all polymerases, a front-loading model for uridylylation is proposed.

  10. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus). (United States)

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B; Wu, Hong; Johnson, Nicholas S; Li, Weiming


    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1h exposure. After 2h exposure, 3kACA increased lGnRH-I and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  11. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus) (United States)

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming


    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  12. Reporte histórico: Primer Aislamiento de Vibrio cholera serogrupo O1 biovar El Tor serovar Inaba durante la epidemia de cólera en el Perú ‑ 1991 Historical report: first isolation of Vibrio cholera serogroup O1 biovar El Tor serovar Inaba during the cholerae epidemic in Perú ‑ 1991

    Directory of Open Access Journals (Sweden)

    Nora Bravo Cruz


    Full Text Available Hace 20 años apareció una enfermedad diarreica nueva en el Perú y el Laboratorio de Referencia de Enteropatógenos del Instituto Nacional de Salud, cumplió una labor destacada en el aislamiento e identificación rápida y oportuna del Vibrio cholerae. La enfermedad del cólera no se había presentado anteriormente, pero en la última semana de enero de 1991 se detectó un brote epidémico de diarrea aguda con deshidratación intensa y algunos casos de fallecidos. La epidemia afectó, al comienzo, varias localidades del litoral peruano. Equipos de trabajo de la Oficina General de Epidemiología y de los laboratorios del Instituto Nacional de Salud obtuvieron muestras fecales de pacientes con diarrea aguda procedentes de las ciudades de Chancay, Chimbote, Piura y algunos hospitales de Lima. Las muestras colectadas en el medio de transporte de Cary y Blair fueron procesadas en el Laboratorio Nacional de Referencia de Enteropatógenos (LANARE del Instituto Nacional de Salud. De todas las muestras se aisló e identificó Vibrio cholerae serogrupo O1 biovar El Tor serovar Inaba que mostró ser sensible a la tetraciclina y a otros antibióticos. Esta investigación confirmó el primer brote epidémico de cólera en el Perú.20 years ago, a new diarrheal disease was introduced in Peru and the Enteropathogens Reference Laboratory of the Instituto Nacional de Salud had an outstanding role in the isolation and rapid and timely identification of Vibrio cholerae. Cholera had not been seen before, but during the last week of January 1991 an outbreak of acute diarrhea was detected, presenting intense dehydration and some deaths. The epidemic affected, in the beginning, many locations of the peruvian coast. Some working teams of the General Office of Epidemiology and of the Instituto Nacional de Salud obtained fecal samples from patients with acute diarrhea coming from the cities of Chancay, Chimbote, Piura and some hospitals in Lima. The collected samples

  13. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL


    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  14. New cyt b gene universal primer set for forensic analysis. (United States)

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M


    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  15. Primer on gas integrated resource planning

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, C.; Comnes, G.A.; Busch, J.; Wiel, S. [Lawrence Berkeley Lab., CA (United States)


    This report discusses the following topics: gas resource planning: need for IRP; gas integrated resource planning: methods and models; supply and capacity planning for gas utilities; methods for estimating gas avoided costs; economic analysis of gas utility DSM programs: benefit-cost tests; gas DSM technologies and programs; end-use fuel substitution; and financial aspects of gas demand-side management programs.

  16. Design Primer for Reed-Solomon Encoders (United States)

    Perlman, M.; Lee, J. J.


    Design and operation of Reed-Solomon (RS) encoders discussed in document prepared as instruction manual for computer designers and others in dataprocessing field. Conventional and Berlekamp architectures compared. Engineers who equip computer memory chips with burst-error and dropout detection and correction find report especially useful.

  17. Robust SNP genotyping by multiplex PCR and arrayed primer extension

    Directory of Open Access Journals (Sweden)

    Podder Mohua


    Full Text Available Abstract Background Arrayed primer extension (APEX is a microarray-based rapid minisequencing methodology that may have utility in 'personalized medicine' applications that involve genetic diagnostics of single nucleotide polymorphisms (SNPs. However, to date there have been few reports that objectively evaluate the assay completion rate, call rate and accuracy of APEX. We have further developed robust assay design, chemistry and analysis methodologies, and have sought to determine how effective APEX is in comparison to leading 'gold-standard' genotyping platforms. Our methods have been tested against industry-leading technologies in two blinded experiments based on Coriell DNA samples and SNP genotype data from the International HapMap Project. Results In the first experiment, we genotyped 50 SNPs across the entire 270 HapMap Coriell DNA sample set. For each Coriell sample, DNA template was amplified in a total of 7 multiplex PCRs prior to genotyping. We obtained good results for 41 of the SNPs, with 99.8% genotype concordance with HapMap data, at an automated call rate of 94.9% (not including the 9 failed SNPs. In the second experiment, involving modifications to the initial DNA amplification so that a single 50-plex PCR could be achieved, genotyping of the same 50 SNPs across each of 49 randomly chosen Coriell DNA samples allowed extremely robust 50-plex genotyping from as little as 5 ng of DNA, with 100% assay completion rate, 100% call rate and >99.9% accuracy. Conclusion We have shown our methods to be effective for robust multiplex SNP genotyping using APEX, with 100% call rate and >99.9% accuracy. We believe that such methodology may be useful in future point-of-care clinical diagnostic applications where accuracy and call rate are both paramount.

  18. A primer on wavelets and their scientific applications

    CERN Document Server

    Walker, James S


    In the first edition of his seminal introduction to wavelets, James S. Walker informed us that the potential applications for wavelets were virtually unlimited. Since that time thousands of published papers have proven him true, while also necessitating the creation of a new edition of his bestselling primer. Updated and fully revised to include the latest developments, this second edition of A Primer on Wavelets and Their Scientific Applications guides readers through the main ideas of wavelet analysis in order to develop a thorough appreciation of wavelet applications. Ingeniously relying o

  19. Primers role in plastering systems on concrete surfaces (United States)

    Fischer, H. B.


    A drastic reduction in time frames between the manufacturing process of concrete units and the rendering phase (including prior priming) does not allow the concrete to dry well. This fact is also underlined by changes in concrete technology (denser concrete and denser concrete surfaces). The tests showed that the reduction of drying time (storage time) had a significant influence on the bonding properties of gypsum plaster on concrete surfaces. In such cases it is absolutely necessary to use an appropriate primer no matter what the processing temperature (2 °C to 20 °C) might be. In this publication the varying primer quality is shown.

  20. Novel nuclear intron-spanning primers for Arecaceae evolutionary biology. (United States)

    Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan


    In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera.

  1. ConservedPrimers 2.0: a high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery. (United States)

    You, Frank M; Huo, Naxin; Gu, Yong Q; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D


    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they are located in exonic sequences which are usually conserved between related species, "conserved primers". They are useful for large-scale single nucleotide polymorphism (SNP) discovery and marker development, especially in species, such as wheat, for which a large number of ESTs are available but for which genome sequences and intron/exon boundaries are not available. To date, no suitable high-throughput tool is available for this purpose. We have developed, the ConservedPrimers 2.0 pipeline, for designing intron-flanking primers for large-scale SNP discovery and marker development, and demonstrated its utility in wheat. This tool uses non-redundant wheat EST sequences, such as wheat contigs and singleton ESTs, and related genomic sequences, such as those of rice, as inputs. It aligns the ESTs to the genomic sequences to identify unique colinear exon blocks and predicts intron lengths. Intron-flanking primers are then designed based on the intron/exon information using the Primer3 core program or BatchPrimer3. Finally, a tab-delimited file containing intron-flanking primer pair sequences and their primer properties is generated for primer ordering and their PCR applications. Using this tool, 1,922 bin-mapped wheat ESTs (31.8% of the 6,045 in total) were found to have unique colinear exon blocks suitable for primer design and 1,821 primer pairs were designed from these single- or low-copy genes for PCR amplification and SNP discovery. With these primers and subsequently designed genome-specific primers, a total of 1,527 loci were found to contain one or more genome-specific SNPs. The ConservedPrimers 2.0 pipeline for designing intron-flanking primers was developed and its

  2. Primer on client-side web security

    CERN Document Server

    De Ryck, Philippe; Piessens, Frank; Johns, Martin


    This volume illustrates the continuous arms race between attackers and defenders of the Web ecosystem by discussing a wide variety of attacks. In the first part of the book, the foundation of the Web ecosystem is briefly recapped and discussed. Based on this model, the assets of the Web ecosystem are identified, and the set of capabilities an attacker may have are enumerated. In the second part, an overview of the web security vulnerability landscape is constructed. Included are selections of the most representative attack techniques reported in great detail. In addition to descriptions of the

  3. Allele dropout caused by a non-primer-site SNV affecting PCR amplification--a call for next-generation primer design algorithm. (United States)

    Lam, Ching-wan; Mak, Chloe Miu


    PCR-based technology is indispensable for genetic diagnosis. On the other hand, allele dropout is one significant cause of genotyping errors. Most allele dropout mechanisms are related to annealing failure caused by single nucleotide variant (SNV) situated inside the primer sequences. Here, we demonstrate a novel allele dropout mechanism caused by a non-primer-binding-site SNV. We demonstrate that the apparent homozygosity of NM_000137.1(FAH):c.1035_1037del was caused by allele dropout. The non-primer-binding-site SNV causes a strong secondary hairpin structure formation of the PCR products and leads to amplification failure. SNV check of the primer sequences per se during primer design is not adequate to avoid allele dropout. The next-generation primer design software should analyze the secondary structure of primers and template sequence taking SNV in both sequences into account in order to avoid genotyping errors. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Detecting Lesch-Nyhan syndrome by solid phase primer extension

    Energy Technology Data Exchange (ETDEWEB)

    Shumaker, J.M.; Caskey, C.T. [Baylor College of Medicine, Houston, TX (United States); Metspalu, A.


    A mutation detection method based upon the wild type human HPRT sequence is presented for identification of Lesch Nyhan syndrome. The technique consists of performing a biotinlyated PCR amplification of the region of interest, followed by isolation and purification of single stranded template using magnetic separation. Allele-specific primers are annealed adjacent to the potential mutation site on the template. A terminal fluorescent deoxynucleotide addition is performed with a DNA template-dependent polymerase to distinguish between the mutant and wild-type sequence. The products are purified from unincorporated ddNTPs, eluted and finally analyzed on an ABI 373 to identify the mutation. The length of an extension primer is used as a position signature for mutations. The fidelity of nucleotide incorporation provides an excellent signal-to-noise ratio for the detection of nine HPRT mutations within eight cell lines. This method should detect all types of mutations except for repeated sequences that are longer than the primers. Moreover, the method is being extended to a solid support assay, whereby the extension primers are attached to a two-dimensional glass surface. Following extension, the solid support is analyzed for radioactive incorporation. We have shown the sequence determination of a five base region of a wild-type sequence and two different HPRT mutations. As more dense oligonucleotide arrays are produced, this method could be extended to sequence the complete coding region of HPRT.

  5. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.


    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  6. The development, characterization and testing of magnesium-rich primers (United States)

    Battocchi, Dante

    Aluminum alloys are widely used in aircraft industry for their strength and light weight. Those alloys that are hardened by precipitation, especially the Copper-rich of the 2000 series, are prone to corrosion and are protected against it using chromate containing coatings. The primary component of these coating systems is Chromium 6+ (CrVI) that has been found to be very toxic in the environment and carcinogenic, toxic and mutagenic in humans. The Mg-rich primer development is the result of a successful multi-year project funded by the US Air-force with its objective the replacement of coatings based on CrVI with a class of coatings less toxic and with comparable protective performances. The Mg rich primer fulfilled the USAF requirements and it is currently undergoing commercial and military qualifications testing. The use of Mg as one of the active pigments in coatings allows the primer to protect the underlying Al sacrificially, not considered possible for this substrate until now. Mg is anodic to most of the other structural metals and when particulate Mg became available commercially, the concept of the primer was first developed by analogy to Zn-rich coatings for steel. When Mg and Al are in contact and immersed in a corrosive environment, magnesium corrodes preferentially and protects the aluminum.

  7. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya


    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  8. Barcoded Primers Used in Multiplex Amplicon Pyrosequencing Bias Amplification



    “Barcode-tagged” PCR primers used for multiplex amplicon sequencing generate a thus-far-overlooked amplification bias that produces variable terminal restriction fragment length polymorphism (T-RFLP) and pyrosequencing data from the same environmental DNA template. We propose a simple two-step PCR approach that increases reproducibility and consistently recovers higher genetic diversity in pyrosequencing libraries.

  9. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)



    Jan 5, 2012 ... Detection of Fusarium solani causal agent of wilt and rots in many .... visualized using UV gel documentation system (Bio-Rad, Hercules, ... Profile of F. solani specific marker obtained using primer TEF-Fs4. Lane M is 100 bp ...

  10. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River (United States)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.


    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  11. Vaccine supply, demand, and policy: a primer. (United States)

    Muzumdar, Jagannath M; Cline, Richard R


    To provide an overview of supply and demand issues in the vaccine industry and the policy options that have been implemented to resolve these issues. Medline, Policy File, and International Pharmaceutical Abstracts were searched to locate academic journal articles. Other sources reviewed included texts on the topics of vaccine history and policy, government agency reports, and reports from independent think tanks. Keywords included vaccines, immunizations, supply, demand, and policy. Search criteria were limited to English language and human studies. Articles pertaining to vaccine demand, supply, and public policy were selected and reviewed for inclusion. By the authors. Vaccines are biologic medications, therefore making their development and production more difficult and costly compared with "small-molecule" drugs. Research and development costs for vaccines can exceed $800 million, and development may require 10 years or more. Strict manufacturing regulations and facility upgrades add to these costs. Policy options to increase and stabilize the supply of vaccines include those aimed at increasing supply, such as government subsidies for basic vaccine research, liability protection for manufacturers, and fast-track approval for new vaccines. Options to increase vaccine demand include advance purchase commitments, government stockpiles, and government financing for select populations. High development costs and multiple barriers to entry have led to a decline in the number of vaccine manufacturers. Although a number of vaccine policies have met with mixed success in increasing the supply of and demand for vaccines, a variety of concerns remain, including developing vaccines for complex pathogens and increasing immunization rates with available vaccines. New policy innovations such as advance market commitments and Medicare Part D vaccine coverage have been implemented and may aid in resolving some of the problems in the vaccine industry.

  12. Primer caso de hemoglobina Köln (codon98 GTG>ATG en Costa Rica

    Directory of Open Access Journals (Sweden)

    Walter Cartín


    Full Text Available La exposición a ciertos medicamentos puede provocar anemia hemolítica con presencia de cuerpos de Heinz en sangre periférica. Esta anemia puede presentarse por sobredosis de medicamentos, tanto en individuos sanos como en personas con deficiencias enzimáticas como la glucosa-6-fosfato deshidrogenasa, o en presencia de hemoglobinas inestables. Este reporte muestra un caso de anemia hemolítica con cuerpos de Heinz, debido a la presencia de una hemoglobina inestable, cuyos estudios moleculares y HPLC confirmaron el primer caso descrito de hemoglobina Köln (Val98Met en Costa Rica.

  13. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)


    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  14. Agriculture emergencies: a primer for first responders. (United States)

    Gilpen, Johnnie L; Carabin, Hélène; Regens, James L; Burden, Ray W


    Over the past several years, the primary focus of emergency preparedness has been on terrorism, and how a CBRNE event would directly affect human health. Limited emphasis has been placed on the direct (eg, zoonotic infections) and indirect (eg, mental health, financial loss) effects that an agricultural emergency event can have on human health outcomes, and how they relate to emergency preparedness. We critically reviewed the resources and information readily accessible to our target audience, emergency responders; the resources included military and civilian books, personal communications, internet sites, GAO reports, and peer-reviewed journals. Among more than 2,000 bioterrorism-related articles, we found 51 that addressed either agroterrorism and/or veterinary public health: 2 cross-sectional studies, 28 review papers, and 21 commentary papers. In order to properly respond to future agriculture emergencies, emergency response professionals need to understand the nature and implications of the event as well as their roles and responsibilities, but the availability of educational and training opportunities is limited. The results of our review are consistent with the hypothesis that more resources, education, and training opportunities should be available to responders as well as to producers, importers and shippers, international travelers, and the general public. Increased education and training will raise awareness among these groups of the relationship between animal and human health.

  15. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. (United States)

    Kalendar, Ruslan; Khassenov, Bekbolat; Ramankulov, Yerlan; Samuilova, Olga; Ivanov, Konstantin I


    Polymerase chain reaction (PCR) is one of the most important laboratory techniques used in molecular biology, genetics and molecular diagnostics. The success of a PCR-based method largely depends on the correct nucleic acid sequence analysis in silico prior to a wet-bench experiment. Here, we report the development of an online Java-based software for virtual PCR on linear or circular DNA templates and multiple primer or probe search from large or small databases. Primer or probe sensitivity and specificity are predicted by searching a database to find sequences with an optimal number of mismatches, similarity and stability. The software determines primer location, orientation, efficiency of binding and calculates primer melting temperatures for standard and degenerate oligonucleotides. The software is suitable for batch file processing, which is essential for automation when working with large amounts of data. The online Java software is available for download at Accession numbers for the sequences resulting from this study: EU140956 EU177767 EU867815 EU882730 FJ975775-FJ975780 HM481419 HM481420 KC686837-KC686839 KM262797. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Primer informe del género Gambierdiscus (Dinophyceae y otros dinoflagelados bentónicos en el Parque Nacional Isla del Coco, Costa Rica, Pacífico Tropical Oriental First report of the genus Gambierdiscus (Dinophyceae and other benthic dinoflagellates from Isla del Coco National Park, Costa Rica, Eastern Tropical Pacific

    Directory of Open Access Journals (Sweden)

    Maribelle Vargas-Montero


    Full Text Available El Pacífico Tropical Oriental se ha indicado como una región de los océanos libre de ciguatera, una intoxicación que causa serios trastornos gastrointestinales, neurológicos y cardiovasculares, en casos extremos, la muerte. Pero con el presente estudio hemos encontrado una incidencia alta de microalgas bénticas involucradas en la producción de ciguatera en el Parque Nacional Isla del Coco (PNIC, Costa Rica. En campañas oceanográficas realizadas entre el 2006 y el 2011 al PNIC se recolectaron 420 muestras de fitoplancton con el interés de encontrar especies de dinoflagelados bentónicos implicados en la producción de ciguatera. Las muestras se tomaron con red de fitoplancton o mediante buceos, entre los 5 y 30 m de profundidad en zonas de arrecife y por extracción directa de macroalgas. Se encontró a los dinoflagelados Gambierdiscus spp., Coolia tropicales, Coolia cf. areolota, Prorocentrum concavum, Prorocentrum compressum, Amphidinium carterae y Ostreopsis siamensis. Se determinó que la cantidad de dinoflagelados por peso de macroalga era elevada, principalmente para el género Gambierdiscus. Los géneros Ostreopsis y Prorocentrum mostraron tener la mayor distribución en los sitios de colecta. Gambierdiscus es un género productor de ciguatera. Se encontraron dos tamaños diferentes de individuos de Gambierdiscus, Comparando los especímenes de Gambierdiscus encontradas con otros estudios, se concluye que son diferentes a las descritas anteriormente, por lo que podría tratarse de especies nuevas, lo que se confirmará con cultivos y análisis moleculares. Al ser la Isla del Coco un sitio oceánico aislado y en estado de conservación, es un sitio ideal para el estudio de la evolución de especies de fitoplancton marino. Además, el monitoreo a largo plazo es muy importante debido a la variedad de dinoflagelados bentónicos potencialmente tóxicos que habitan en este ecosistema marino. Este es el primer estudio donde se da a

  17. Mercury in the environment : a primer

    Energy Technology Data Exchange (ETDEWEB)

    Lourie, B.; Glenn, W. (ed.); Ogilvie, K.; Everhardus, E.; Friesen, K.; Rae, S.


    This report provides an overview of the occurrence and effects of mercury in the environment and its impacts on human health. Low levels of mercury occur naturally everywhere in the environment in plants, animals, rocks and air. Incidental emissions occur when natural mercury is released to the environment through human activity. In Canada, coal burning and metal processing are the two largest point sources of atmospheric mercury emissions. Energy facilities have the option to invest in expensive control technologies for coal plants, or they can generate electricity from alternative energy sources. Energy conservation, however, offers the greatest overall benefits for the environment and the public. Mercury can also be released when products containing mercury (such as electrical switches, thermostats, dental amalgam, and thermometers) are broken while in use, or when they are crushed in garbage trucks and dumped in landfills. Source separation is the best way to reduce waste-related emissions. Once mercury is released to the natural environment, it can be transported long distances through air or watercourses. It is volatile, therefore evaporates readily to the atmosphere where it may do one of three things: it may fall out near the point where it was emitted; it may be transported long distances to some point downwind; or, it may enter the global atmospheric mercury pool where it will circle the globe for a year or more within the Earth's major weather systems before being deposited. Data from Canada's National Pollutant Release Inventory indicates that mercury releases and transfers total 28,674 kg per year. The most critical component of the mercury cycle is the conversion of inorganic forms of mercury to the organic compound methylmercury which is more toxic to humans. Most concern about mercury focuses on lakes and other aquatic ecosystems. Fish in hydroelectric reservoirs have been found to contain elevated methylmercury levels because natural

  18. White primer permits a corrosion-resistant coating of minimum weight (United States)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.


    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  19. Generation of polymerase chain reaction-specific probes for library screening using single degenerate primers. (United States)

    Hommes, N G; Arp, D J; Sayavedra-Soto, L A


    Degenerate oligonucleotide primers were made to peptide sequences from hydroxylamine oxidoreductase (HAO) from Nitrosomonas europaea. The primers were used singly in PCR reactions to amplify portions of the gene for HAO from genomic DNA. Southern hybridizations using fragments amplified with each primer showed that they labeled the same genomic DNA fragments. The PCR-amplified fragments were successfully used to screen a gene library for clones containing the HAO gene. The method of isolating genes by PCR with single primers has general utility.

  20. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  1. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  2. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  3. Microsatellite Primers for the Pacific Northwest Conifer Callitropsis nootkatensis (Cupressaceae

    Directory of Open Access Journals (Sweden)

    Tara N. Jennings


    Full Text Available Premise of the study: Microsatellite primers were developed for Nootka cypress (Callitropsis nootkatensis to provide quantitative measures for gene conservation that can assist in guiding management decisions for a species experiencing climate-induced decline. Methods and Results: Using multiplexed massively parallel sequencing, we identified 136,785 microsatellite-containing sequences from 489,625 Illumina paired-end 80-bp reads. After stringent filtering, we selected 144 primer pairs and screened variation at these loci in five populations of C. nootkatensis. Loci show between three and 36 dinucleotide repeats per locus, with an average of 13. Screening of these markers in the Pacific Northwest relative Chamaecyparis lawsoniana demonstrated no marker transferability. This finding highlights the narrow taxonomic utility of microsatellite markers in Callitropsis. Conclusions: These microsatellites show high polymorphism and can be used for routine screening of natural variation in Callitropsis nootkatensis, and will be particularly helpful in identifying clones and inbred relatives at the stand-level.

  4. Two generic PCR primer sets for the detection of members of the genus Torradovirus

    NARCIS (Netherlands)

    Verbeek, M.; Tang, J.; Ward, L.


    Two degenerate primer pairs were designed for the universal detection of members of the genus Torradovirus. Primer pair Torrado-1F/Torrado-1R was designed based on the RNA-dependent RNA polymerase region located in RNA1 and primer pair Torrado-2F/Torrado-2R based on a region overlapping the two firs

  5. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    Basin (CIB) at approx 5,000 m depth, we amplified sediment DNA with four different primer sets. These were fungal-specific primer pair ITS1F/ ITS4 (internal transcribed spacers), universal 18S rDNA primers NS1/NS2, Euk18S-42F/Euk18S-1492R and Euk18S-555F...

  6. Design of primers and probes for quantitative real-time PCR methods. (United States)

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J


    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  7. Alanylated lipoteichoic acid primer in Bacillus subtilis [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Yu Luo


    Full Text Available Lipoteichoic acid is a major lipid-anchored polymer in Gram-positive bacteria such as Bacillus subtilis. This polymer typically consists of repeating phosphate-containing units and therefore has a predominant negative charge. The repeating units are attached to a glycolipid anchor which has a diacylglycerol (DAG moiety attached to a dihexopyranose head group. D-alanylation is known as the major modification of type I and type IV lipoteichoic acids, which partially neutralizes the polymer and plays important roles in bacterial survival and resistance to the host immune system. The biosynthesis pathways of the glycolipid anchor and lipoteichoic acid have been fully characterized. However, the exact mechanism of D-alanyl transfer from the cytosol to cell surface lipoteichoic acid remains unclear. Here I report the use of mass spectrometry in the identification of possible intermediate species in the biosynthesis and D-alanylation of lipoteichoic acid: the glycolipid anchor, nascent lipoteichoic acid primer with one phosphoglycerol unit, as well as mono- and di-alanylated forms of the lipoteichoic acid primer. Monitoring these species as well as the recently reported D-alanyl-phosphatidyl glycerol should aid in shedding light on the mechanism of the D-alanylation pathway of lipoteichoic acid.

  8. Development of a Nonchromate Structural Adhesive Bond Primer (United States)


    Prevent corrosion of base metal • Applied to porous anodized surface • Overcoated with non- inhibited epoxy adhesive • High adhesive bond strength...primers •Long-running surveillance of chromate-free alternatives by UTC companies shows weak corrosion inhibition • (A) strontium chromate... corrosion inhibiter achieved Electrokinetic Confirmation of Active Inhibition in Coatings 7 Schematic of defect production and samples for salt

  9. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas


    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  10. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .


    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  11. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas


    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at

  12. Sensory reception of the primer pheromone ethyl oleate (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang


    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  13. Heterologous microsatellite primer pairs informative for the whole genus Arachis

    Directory of Open Access Journals (Sweden)

    Andrea Akemi Hoshino


    Full Text Available The genus Arachis currently comprises 69 described species, some of which have potential and real value as human and animal foods. These Arachis species have been collected and maintained in germplasm banks to provide material that can be used as sources of genes in breeding programs and for the selection of new cultivars. One of the principal objectives of germplasm conservation is the evaluation of genetic variability, which is best conducted using molecular markers. We investigated the use of heterologous primers to amplify microsatellite loci that could be used to evaluate genetic variability in Arachis germplasm. Fifteen microsatellite primer pairs were tested in 76 accessions of 34 species from the nine Arachis sections. The data indicated that heterologous primers were very useful in Arachis since they had high transferability among the species (91% and allowed the amplification of very polymorphic putative loci, which allowed both the characterization of most accessions and to make inferences about the mating systems of some species analyzed. Our data also revealed that the germplasm analyzed showed high variability, even when represented by few accessions.

  14. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés


    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  15. Wash Primer Replacement Based on the Superprimer Technology (United States)


    DoD­P­15328D wash primer. Figure 51. FTIR  spectra  of ECO­008 and ECO5­1. viii Figure 52. FTIR  spectra  of ECO5­1 with different drying conditions. Figure 53...MIL­ PRF­85582 primers, in which  strontium  chromate is used as the major corrosion inhibitor.  The MIL­DTL­53030B primer contains zinc phosphate obtained through the use of the silane. 5.2.5. FTIR characterization FTIR  spectra  of DoD­P­15328D, ECO­008 and ECO5­1 are shown in Figures 50­52

  16. Preliminary Evaluation of the Acute Toxicity of Desensitized Primer Compounds and Primer Waste Effluents to Representative Aquatic Organisims (United States)


    daphnids, with 48-hour LC50 values for these two materials being several orders of magnitude lower than those observed for lead styphnate , PETN and... styphnate (PoTNR), tetracene (= tetrazene), pentaerythritol tetranitrate (PETN), .and FA 956 priming mixture. The FA 956 mixture is composed of: 37...PbTNR, 4% tetracene, 5% PETN, 32% barium nitrate, 15% antimony sulfide and 7% aluminum (Small and Rosenblatt, 1974). Each of these primer components was

  17. Detection of Brucella abortus by alkB and IS711 based primers

    Directory of Open Access Journals (Sweden)

    Seyed Reza Hosseini Doust


    Full Text Available

    BACKGROUND: Brucellosis is a zoonotic disease, which involves both animals and human. Although the conventional methods have been widely used for its laboratory diagnosis, the PCR techniques have proved to be useful due to specificity, sensitivity and the rapidness. Various target sequences of brucella bacterium such as OMP2, 16s RNA and IS711 have been used for the primer designing.. All primer sets have shown different sensitivities and specificities. In present investigation, PCR protocol and primer designated based on IS711 and a fragment of chromosomal DNA all were optimized with standard genome and clinical samples.

    METHODS: Numerous tissue samples (liver, kidney, lymph node, and uterus were prepared and were cultured by the bacteriological standard methods along with the serology positive human samples. PCR protocol was optimized and the primer's sensitivity and the specificity were checked using pure genome of B. abortus. All samples were tested by the standard bacteriological methods. The samples were then subject to PCR amplification and the PCR product was confirmed using the RFLP technique.

    RESULTS: The culture results indicated a poor sensitivity as it was previously reported. The PCR product 157 bp was observed on the agarose gel indicating that significant number of clinical samples (human brucellosis cases were positive by PCR but not by the

  18. Allele-specific PCR detection of sweet cherry self-incompatibility (S) alleles S1 to S16 using consensus and allele-specific primers. (United States)

    Sonneveld, T; Tobutt, K R; Robbins, T P


    PCR-based identification of all 13 known self-incompatibility (S) alleles of sweet cherry is reported. Two pairs of consensus primers were designed from our previously published cDNA sequences of S(1) to S(6) S-RNases, the stylar components of self-incompatibility, to reveal length variation of the first and the second introns. With the exception of the first intron of S(13), these also amplified S(7) to S(14) and an allele previously referred to as S(x), which we now label S(16). The genomic PCR products were cloned and sequenced. The partial sequence of S(11) matched that of S(7) and the alleles were shown to have the same functional specificity. Allele-specific primers were designed for S(7) to S(16), so that allele-specific primers are now available for all 13 S alleles of cherry (S(8), S(11) and S(15) are duplicates). These can be used to distinguish between S alleles with introns of similar size and to confirm genotypes determined with consensus primers. The reliability of the PCR with allele-specific primers was improved by the inclusion of an internal control. The use of the consensus and allele-specific primers was demonstrated by resolving conflicting genotypes that have been published recently and by determining genotypes of 18 new cherry cultivars. Two new groups are proposed, Group XXIII (S(3) S(16)), comprising 'Rodmersham Seedling' and 'Strawberry Heart', and Group XXIV (S(6) S(12)), comprising 'Aida' and 'Flamentiner'. Four new self-compatibility genotypes, S(3) S(3)', S(4)' S(6), S(4)' S(9) and S(4)' S(13), were found. The potential use of the consensus primers to reveal incompatibility alleles in other cherry species is also demonstrated.

  19. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    Directory of Open Access Journals (Sweden)

    Oh Hyun-Woo


    Full Text Available Abstract Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1 to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups.

  20. Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies.

    Directory of Open Access Journals (Sweden)

    Michiel Op De Beeck

    Full Text Available Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS region in the ribosomal RNA (rRNA operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4 and a primer pair (ITS86F/ITS4 that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding.

  1. New primer for specific amplification of the CAG repeat in Huntington disease alleles

    Energy Technology Data Exchange (ETDEWEB)

    Bond, C.E.; Hodes, M.E. [Indiana Univ. School of Medicine, Indianapolis (United States)


    Huntington disease is an autosomal dominant neurodegenerative disorder caused by an expansion of a CAG trinucleotide repeat near the 5{prime} end of the gene for Huntington disease (IT15). The CAG repeat is flanked by a variable-length CCG repeat that is included in the amplification product obtained with most currently used primer sets and PCR protocols. Inclusion of this adjacent CCG repeat complicates the accurate assessment of CAG repeat length and interferes with the genotype determination of those individuals carrying alleles in the intermediate range between normal and expanded sized. Due to the GC-rich nature of this region, attempts at designing a protocol for amplification of only the CAG repeat have proved unreliable and difficult to execute. We report here the development of a compatible primer set and PCR protocol that yields consistent amplification of the CAG-repeat region. PCR products can be visualized in ethidium bromide-stained agarose gels for rapid screening or in 6% polyacrylamide gels for determination of exact repeat length. This assay produces bands that can be sized accurately, while eliminating most nonspecific products. Fifty-five specimens examined showed consistency with another well-known method, but one that amplifies the CCG repeats as well. The results we obtained also matched the known carrier status of the donors.

  2. Primer hallazgo de Aedes albopictus Skuse en el Gran Área Metropolitana de Costa Rica

    Directory of Open Access Journals (Sweden)

    Rodrigo Marín Rodríguez


    Full Text Available Objetivo: Informar sobre el primer hallazgo de Aedes albopictus en el Gran Área Metropolitana de Costa Rica. Métodos: Formas inmaduras de mosquitos colectadas en la Ciudadela La Carpio, Distrito Uruca, San José, como parte de una barrida epidemiológica fueron diagnosticadas preliminarmente como Ae. albopictus. Dicho material se fijó en alcohol al 70 %, se aclaró en lactofenol y se evaluó taxonómicamente mediante claves dicotómicas especializadas. Resultados: Las formas inmaduras evaluadas procedieron de dos criaderos, un tarro y un balde. Las características de las larvas y pupas permitieron identificarlas taxonómicamente como Ae. albopictus. Este es el primer reporte sobre la presencia de dicho vector en Costa Rica. Discusión: La presencia de Ae. albopictus en la Gran Área Metropolitana ocurre como parte del proceso de expansión que está teniendo dicho vector por el territorio nacional. Su presencia debe ser motivo de estudio para determinar su eventual papel en la transmisión del dengue. Por otro lado la presencia de este vector complica la gestión de la vigilancia entomológica de dengue que ha estado dirigida fundamentalmente a la identificación y control del Aedes aegypti.

  3. Simple Heat Treatment of Zirconia Ceramic Pre-Treated with Silane Primer to Improve Resin Bonding. (United States)

    Ha, Jung-Yun; Son, Jun Sik; Kim, Kyo-Han; Kwon, Tae-Yub


    Establishing a strong resin bond to dental zirconia ceramic remains difficult. Previous studies have shown that the conventional application of silane does not work well with zirconia. This paper reports that a silane pre-treatment of dental zirconia ceramic combined with subsequent heat treatment has potential as an adhesive cementation protocol for improving zirconia-resin bonding. Among the various concentrations (0.1 to 16 vol%) of experimental γ-methacryloxypropyltrimethoxysilane (γ-MPTS) primers assessed, the 1% solution was found to be the most effective in terms of the shear bond strength of the resin cement to dental zirconia ceramic. A high shear bond strength (approx. 30 MPa) was obtained when zirconia specimens were pre-treated with this primer and then heat-treated in a furnace for 60 min at 150 degrees C. Heat treatment appeared to remove the hydrophilic constituents from the silane film formed on the zirconia ceramic surface and accelerate the condensation reactions between the silanol groups of the hydrolyzed silane molecules at the zirconia/resin interface, finally making a more desirable surface for bonding with resin. This estimation was supported by Fourier transform infrared spectroscopy of the silanes prepared in this study.

  4. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.


    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  5. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers. (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M


    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

  6. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    Directory of Open Access Journals (Sweden)

    Martin Andrew P


    Full Text Available Abstract Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of

  7. Status of corrosions protection primers for the automotive industry

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann-Loeser, P. [Adam Opel AG, Ruesselsheim (Germany); Schnell, A. [DaimlerChrysler, Werk Sindelfingen (Germany); Stellnberger, K.H.; Androsch, F.M. [voestalpine Stahl, Linz (Austria); Reier, T. [SZMF, Salzgitter (Germany); Lewandowski, J. [ThyssenKrupp Stahl, Duisburg (Germany); Filthaut, C. [DOC Dortmunder OberflaechenCentrum, Dortmund (Germany); Besseyrias, A. [Arcelor / R and D LEDEPP, Florange (France); Dane, C. [Corus, Ijmuiden (Netherlands); Steinbeck, G. [Steel Institute VDEh, Duesseldorf (Germany)


    In Europe, 2.5 - 4 {mu}m Zn-pigmented corrosion protection primers (CPP) are being used by the automotive industry. A short introduction describing the development steps leading up to the state of the art will be given and also the reasons for using it in practice. For some applications it became necessary to try to achieve a significantly higher level of corrosion resistance than this ''first generation'' type coating can offer. It was also important to lower the curing temperature of the paint considerably in order to be able to supply bake-hardening grade steels. This type of corrosion protection primer is now called the ''second generation''. The Opel-production of the Astra-family started using 2{sup nd} generation CPP (4-6 {mu}m) on chromate-free pre-treatment and EG for hood and crash box in 2004. The newest developments show a high potential to lower the coating thickness even further and thus make cost savings possible. The development process is still ongoing and for effective progress, a good mutual basis for laboratory evaluation of properties is of valuable support. In a Steel Institute VDEh working group (Arcelor, Corus, Salzgitter, ThyssenKrupp, voestalpine), test procedures are being generated in order to be able to correctly assess properties such as corrosion resistance, adhesion, peeling-off behavior, etc. An overview of the procedures will be given together with correlations between laboratory results and reality. To round up the paper, corrosion protection primers have a number of potentials which can be utilized by the automotive industry to justify the additional cost. Examples highlighted with results giving evidence of these potentials will be shown. (orig.)

  8. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers (United States)


    Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in

  9. Plan de negocio de una escuela infantil (primer ciclo)


    San Román Gómez, Ana de


    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  10. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per


    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  11. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.


    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  12. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter


    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  13. Cribado de aneuploidias de primer trimestre en las gestaciones gemelares


    Prats Rodríguez, Pilar


    Esta tesis está basada en dos artículos: Articulo 1: Early first-trimester free-β-hCG and PAPP-A serum distributions in monochorionic and dichorionic twins Objetivo: Examinar la distritución en primer trimestre de los marcadores bioquímicos de aneuploidias en gestaciones gemelares dependiendo de su corionicidad. Métodos: La free-β-human chorionic gonadotropin (hCG) en sangre materna y la pregnancy-associated plasma protein A (PAPP-A) fueron analizadas entre las semanas 8–13 + de ...

  14. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D


    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  15. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.


    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  16. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W


    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  17. Shining On: A primer on solar radiation data

    Energy Technology Data Exchange (ETDEWEB)

    Dunlap, M.A.; Cook, G. (eds.); Marion, B.; Riordan, C.; Renne, D.


    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  18. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I


    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  19. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F


    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  20. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli


    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  1. Primers and polymerase chain reaction conditions for DNA barcoding teleost fish based on the mitochondrial cytochrome b and nuclear rhodopsin genes

    NARCIS (Netherlands)

    Sevilla, R.G.; Diez, A.; Noren, M.; Mouchel, O.; Jerome, M.; Verrez-Bagnis, V.; Pelt-Heerschap, van H.M.L.


    This report describes a set of 21 polymerase chain reaction primers and amplification conditions developed to barcode practically any teleost fish species according to their mitochondrial cytochrome b and nuclear rhodopsin gene sequences. The method was successfully tested in more than 200 marine

  2. Primers and polymerase chain reaction conditions for DNA barcoding teleost fish based on the mitochondrial cytochrome b and nuclear rhodopsin genes

    NARCIS (Netherlands)

    Sevilla, R.G.; Diez, A.; Noren, M.; Mouchel, O.; Jerome, M.; Verrez-Bagnis, V.; Pelt-Heerschap, van H.M.L.


    This report describes a set of 21 polymerase chain reaction primers and amplification conditions developed to barcode practically any teleost fish species according to their mitochondrial cytochrome b and nuclear rhodopsin gene sequences. The method was successfully tested in more than 200 marine fi

  3. A Primer for Analyzing Nested Data: Multilevel Modeling in SPSS Using an Example from a REL Study. REL 2015-046 (United States)

    O'Dwyer, Laura M.; Parker, Caroline E.


    Analyzing data that possess some form of nesting is often challenging for applied researchers or district staff who are involved in or in charge of conducting data analyses. This report provides a description of the challenges for analyzing nested data and provides a primer of how multilevel regression modeling may be used to resolve these…

  4. A primer design strategy for PCR amplification of GC-rich DNA sequences. (United States)

    Li, Li-Yan; Li, Qiang; Yu, Yan-Hong; Zhong, Mei; Yang, Lei; Wu, Qing-Hong; Qiu, Yu-Rong; Luo, Shen-Qiu


    To establish a primer design method for amplification of GC-rich DNA sequences. A group of 15 pairs of primers with higher T(m) (>79.7°C) and lower level ΔT(m) (designed to amplify GC-rich sequences (66.0%-84.0%). The statistical analysis of primer parameters and GC content of PCR products was performed and compared with literatures. Other control experiments were conducted using shortened primers for GC-rich PCR amplifications in this study, and the statistical analysis of shortened primer parameters and GC content of PCR products was performed compared with primers not shortened. A group of 26 pairs of primers were designed to test the applicability of this primer designing strategy in amplifications of non-GC-rich sequences (35.2%-53.5%). All the DNA sequences in this study were successfully amplified. Statistical analyses show that the T(m) and ΔT(m) were the main factors influencing amplifications. This primer designing strategy offered a perfect tool for amplification of GC-rich sequences. It proves that the secondary structures cannot be formed at higher annealing temperature conditions (>65°C), and we can overcome this difficulty easily by designing primers and using higher annealing temperature. Crown Copyright © 2011. Published by Elsevier Inc. All rights reserved.

  5. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz


    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  6. FullSSR: Microsatellite Finder and Primer Designer (United States)

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia


    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  7. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti


    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  8. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    CERN Document Server

    Courtney, Elya; Summer, Peter David; Courtney, Michael


    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blast waves, muzzle velocities, and ignition delay are presented after environmental conditioning (150 days) for two lead based and two DDNP based primers under cold and dry (-25 deg C,0% relative humidity), ambient (20 deg C, 50% relative humidity), and hot & humid (50 deg C, 100% relative humidity) conditions in 5.56 mm NATO. Taken together, these results indicate that DDNP based primers are not sufficiently reliable for service use.

  9. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.


    be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...... settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...

  10. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera, Susanna; Busk, Peter Kamp


    be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... settings. Results We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  11. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Pedersen, F S


    . While most of the selected primer binding sites are complementary to the 3'-end of tRNA((Pro)), we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNA(Arg(CCU)), tRNA(Phe(GAA))and a hitherto unknown......Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNA(Pro)molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian...... retro-viruses have revealed evidence of molecular adapt-ation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites...

  12. Early Detection and Serotyping of Dengue Viruses Clinical Isolates Using Reverse Transcription Polymerase Chain Reaction (RT-PCR 2 Primers

    Directory of Open Access Journals (Sweden)

    Abdul Rahman Siregar


    Full Text Available Recently several methods for confirming Dengue Virus have been developed involve virus isolation, detection of virus antigen, and nucleic acid using PCR. It has been reported that rapid detection method for confirming DHF by Multiplex RT-PCR had been successfully developed. It was more effective than the other methods with a high sensitivity and specivicity were 100% at the early phase (day 1-3. This study was designed to develop rapid detection and serotyping methods for Dengue Virus using RT-PCR 2 primers (Dcon and preM with annealing temperature was 57oC. The whole blood samples were collected from suspected dengue fever patients that had been confirmed with NS1 kit from R.S. Persahabatan DKI Jakarta and R.S. Prof. Dr. Sardjito DI Yogyakarta during Februari-August 2009. The PCR products showed that in 12 samples, 100 % were postitive with different pattern among the serotypes especially for DEN1 and DEN2, but not for DEN3 and Den4.  This method was also able to confirm the double infection DEN2-DEN3, but not for the other ones because of the unspecific pattern. From the results, it indicated that the 2 primers can be a promising early detection and serotyping method of Dengue Virus which infected the DHF patients. Key words: Dengue Virus, DHF, early detection, serotyping, RT-PCR 2 primers.

  13. The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program

    Directory of Open Access Journals (Sweden)

    Urba Walter J


    Full Text Available Abstract The Society for Immunotherapy of Cancer, SITC (formerly the International Society for Biological Therapy of Cancer, iSBTc, aims to improve cancer patient outcomes by advancing the science, development and application of biological therapy and immunotherapy. The society and its educational programs have become premier destinations for interaction and innovation in the cancer biologics community. For over a decade, the society has offered the Primer on Tumor Immunology and Biological Therapy of Cancer™ in conjunction with its Annual Scientific Meeting. This report summarizes the 2010 Primer that took place October 1, 2010 in Washington, D.C. as part of the educational offerings associated with the society's 25th anniversary. The target audience was basic and clinical investigators from academia, industry and regulatory agencies, and included clinicians, post-doctoral fellows, students, and allied health professionals. Attendees were provided a review of basic immunology and educated on the current status and most recent advances in tumor immunology and clinical/translational caner immunology. Ten prominent investigators presented on the following topics: innate immunity and inflammation; an overview of adaptive immunity; dendritic cells; tumor microenvironment; regulatory immune cells; immune monitoring; cytokines in cancer immunotherapy; immune modulating antibodies; cancer vaccines; and adoptive T cell therapy. Presentation slides, a Primer webinar and additional program information are available online on the society's website.

  14. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology (United States)

    Galkiewicz, J.P.; Kellogg, C.A.


    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  15. Genus-specific primers for study of Fusarium communities in field samples



    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium- specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+...

  16. Design of a Percussion and Electric Primer Gun Firing Power Supply (United States)


    to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...gun, percussion, electric primer, capacitor 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT UU 18. NUMBER OF PAGES 30 19a. NAME...initial pull of the solenoid, which can be over 50 A. The old linear power supply has large filter capacitors on its output, which does provide the surge

  17. PRISE2: software for designing sequence-selective PCR primers and probes. (United States)

    Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James


    PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

  18. Use of self-quenched, fluorogenic LUX primers for gene expression profiling. (United States)

    Kusser, Wolfgang


    Application of a real-time detection system based on a novel primer design in gene expression profiling is described. In this system, called LUX (Light Upon eXtension), the generation of signal is based on a single fluorescent dye molecule that is attached to an oligonucleotide close to the 3'-end. A primer design software is available that identifies LUX primer pairs based on a set of rules for optimum signal development. The use of LUX fluorogenic primers to determine the expression patterns of various transcripts during differentiation in the P-19 mouse neuronal model is described.

  19. A Comprehensive Evaluation of PCR Primers to Amplify the nifH Gene of Nitrogenase


    John Christian Gaby; Buckley, Daniel H.


    The nifH gene is the most widely sequenced marker gene used to identify nitrogen-fixing Bacteria and Archaea. Numerous PCR primers have been designed to amplify nifH, but a comprehensive evaluation of nifH PCR primers has not been performed. We performed an in silico analysis of the specificity and coverage of 51 universal and 35 group-specific nifH primers by using an aligned database of 23,847 nifH sequences. We found that there are 15 universal nifH primers that target 90% or more of nitro...

  20. Design and in vitro evaluation of new rpoB-DGGE primers for ruminants. (United States)

    Perumbakkam, Sudeep; Craig, A Morrie


    Two new primer sets based on the rpoB gene were designed and evaluated with bovine and ovine rumen samples. The newly developed rpoB-DGGE primer set was used along with the 16S rRNA gene-V3, and another (old) rpoB-DGGE-based primer set from a previous study to in vitro compare the bovine and ovine rumen ecosystems. The results indicate a significant (Pprimers used in the analysis. Qualitative comparison of the data provides evidence for the presence of similar phyla profiles between the 16S rRNA gene and the newly developed rpoB primers. A comparison between the two rpoB-based primer sets (old and new) showed that the old rpoB-based primers failed to amplify phylum Bacteroidetes (a common phylum in the rumen) in both bovine and ovine rumen samples. The old and new rpoB-DGGE-based primers amplified a large number of clones belonging to phylum Proteobacteria, providing a useful insight into the microbial structure of the rumen. ChaoI, ACE, Simpson, and Shannon-Weaver index analysis estimated the bovine rumen to be more diverse than the ovine rumen for all three primer sets. These results provide a new insight into the community structure among ruminants using the newly developed primers in this study. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  1. Microsatellite primers for the rare sedge Lepidosperma bungalbin (Cyperaceae)1 (United States)

    Nevill, Paul G.; Wardell-Johnson, Grant


    Premise of the study: Microsatellite markers were developed for the rare sedge Lepidosperma bungalbin (Cyperaceae) to assess genetic variation and its spatial structuring. Methods and Results: We conducted shotgun sequencing on an Illumina MiSeq and produced 6,215,872 sequence reads. The QDD pipeline was used to design 60 primer pairs that were screened using PCR. We developed 17 loci, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. We then screened these loci for variation in individuals from three populations. The number of alleles observed for these 12 loci across the three populations ranged from nine to 19 and expected heterozygosity ranged from 0.41 to 0.89. Conclusions: These markers will enable the quantification of the potential impact of mining on genetic variation within L. bungalbin and establish a baseline for future management of genetic variation of the rare sedge. PMID:27843727

  2. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria


    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  3. Soft solids a primer to the theoretical mechanics of materials

    CERN Document Server

    Freed, Alan D


    This textbook presents the physical principles pertinent to the mathematical modeling of soft materials used in engineering practice, including both man-made materials and biological tissues. It is intended for seniors and masters-level graduate students in engineering, physics, or applied mathematics. It will also be a valuable resource for researchers working in mechanics, biomechanics, and other fields where the mechanical response of soft solids is relevant.   Soft Solids: A Primer to the Theoretical Mechanics of Materials is divided into two parts. Part I introduces the basic concepts needed to give both Eulerian and Lagrangian descriptions of the mechanical response of soft solids. Part II presents two distinct theories of elasticity and their associated theories of viscoelasticity. Seven boundary-value problems are studied over the course of the book, each pertaining to an experiment used to characterize materials. These problems are discussed at the end of each chapter, giving students the opportunit...

  4. Prader-Willi syndrome: A primer for clinicians

    Directory of Open Access Journals (Sweden)

    Hertz Gila


    Full Text Available Abstract The advent of sensitive genetic testing modalities for the diagnosis of Prader-Willi syndrome has helped to define not only the phenotypic features of the syndrome associated with the various genotypes but also to anticipate clinical and psychological problems that occur at each stage during the life span. With advances in hormone replacement therapy, particularly growth hormone children born in circumstances where therapy is available are expected to have an improved quality of life as compared to those born prior to growth hormone. This manuscript was prepared as a primer for clinicians-to serve as a resource for those of you who care for children and adults with Prader-Willi syndrome on a daily basis in your practices. Appropriate and anticipatory interventions can make a difference.

  5. Antibiotic resistance: a primer and call to action. (United States)

    Smith, Rachel A; M'ikanatha, Nkuchia M; Read, Andrew F


    During the past century, discoveries of microorganisms as causes of infections and antibiotics as effective therapeutic agents have contributed to significant gains in public health in many parts of the world. Health agencies worldwide are galvanizing attention toward antibiotic resistance, which is a major threat to public health (Centers for Disease Control and Prevention, 2013; World Health Organization, 2014). Some life scientists believe that we are approaching the post-antibiotic age (Davies & Davies, 2010). The growing threat of antimicrobial resistance is fueled by complex factors with biological, behavioral, and societal aspects. This primer provides an overview of antibiotic resistance and its growing burden on public health, the biological and behavioral mechanisms that increase antibiotic resistance, and examples of where health communication scholars can contribute to efforts to make our current antibiotic drugs last as long as possible. In addition, we identify compelling challenges for current communication theories and practices.

  6. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín


    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  7. Postpositivism and Accounting Research : A (Personal Primer on Critical Realism

    Directory of Open Access Journals (Sweden)

    Jayne Bisman


    Full Text Available This paper presents an overview and primer on the postpositivist philosophy of critical realism. Theexamination of this research paradigm commences with the identification of the underlying motivations thatprompted a personal exploration of critical realism. A brief review of ontology, epistemology andmethodology and the research philosophies and methods popularly applied in accounting is then provided.The meta-theoretical basis of critical realism and the ontological and epistemological assumptions that gotowards establishing the ‘truth’ and validity criteria underpinning this paradigm are detailed, and therelevance and potential applications of critical realism to accounting research are also discussed. The purposeof this discussion is to make a call to diversify the approaches to accounting research, and – specifically – toassist researchers to realise the potential for postpositivist multiple method research designs in accounting.This is aided through an illustration that functions to highlight how and why this approach was applied in areal-world accounting research study.

  8. Primer Part 1-The building blocks of epilepsy genetics. (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C


    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  9. Universal Primers Used for Detection of Bacterial Meningitis

    Directory of Open Access Journals (Sweden)

    MohammadReza Pourmand


    Full Text Available Background: Acute bacterial meningitis is among serious infections of the central nervous system (CNS. The early diagnosis and empiric antibiotic treatments have led to a reduction in morbidity and mortality rates. PCR and the enzymatic digestion of 16S rDNA fragment following the PCR by universal primers led up fast and sensitive determination. The aims of the present study was to improve our previous method for rapid and specific detection of common bacteria causing acute meningitis.Methods: According to the gene encoding 16S rDNA found in all bacteria, a set of primers was designed. Then the universal PCR was performed for bacterial agents of meningitis by employing broad-range DNA extraction method. The amplicons were digested with restriction enzymes to identify bacterial species.Results:  By the  enzymatic  digestion  of  the  amplicons  of  each  standard strain, specific patterns were achieved. These specific patterns may be usedfor comparison in CSF examination. The analytical sensitivity of the assay was  approximately 1.5×102   CFU/ml  of  CSF  even in  samples with  high amount of proteins.Conclusion: The universal PCR coupled with enzymatic digestion can be used to detect and identify bacterial pathogens in clinical specimens rapidly and accurately. Molecular diagnostic of bacterial meningitis, though expensive and labor-intensive, but is valuable and critical in patient management.

  10. [Influence of primers ' chemical composition on shear bond strength of resin cement to zirconia ceramic]. (United States)

    Łagodzińska, Paulina; Bociong, Kinga; Dejak, Beata


    Resin cements establish a strong durable bond between zirconia ceramic and hard tissues of teeth. It is essential to use primers with proper chemical composition before cementation. The aim of this study was to assess the influence of primer's chemical composition on the shear bond strength of zirconia ceramic to resin cements. 132 zirconia specimens were randomly assigned to four groups. There were four resin systems used. They included resin cement and respective primer, dedicated to zirconia: Clearfil Ceramic Primer/Panavia F2.0, Monobond Plus/Multilink Automix, AZ - Primer/ResiCem, Z - Prime Plus/Duo-Link. In each group the protocol of cementation was as follows: application of primer to the zirconia surface and application of the respective resin cement in cylindric mold (dimensions: 3.0 mm height and 3.0 mm diameter). Then, the shear bond strength was evaluated and the failure type was assessed in lupes (×2.5 magnification), also random specimens under SEM. The Wilcoxon test was used to analyze the data, the level of significance was α = 0.05. Finally, the known chemical composition of each primer was analysed in reference to probable chemical bonds, which may occure between primers and zirconia. The mean shear bond strength between resin cements and zirconia was the highest for Z-Prime Plus/Duo-Link (8.24 ± 3,21 MPa) and lowest for Clearfil Ceramic Primer/Panavia F 2.0 (4.60 ± 2.21 MPa). The analysis revealed significant difference between all groups, except pair Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem. The failure type in groups of Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem was mainly adhesive, in groups Monobond Plus/ /Multilink Automix and Z-Prime Plus/Duo-Link mainly mixed. The chemical composition of primers affects different bond mechanisms between resin cements and zirconia. The highest shear bond strength of resin cement to zirconia can be obtained for the primer composed of 10-Methacryloyloxydecyl dihydrogen

  11. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin


    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  12. Development of a ceramic primer with higher bond durability for resin cement. (United States)

    Li, Rui


    To increase the bond durability of resin to the CAD/CAM ceramic surface, two types of two-bottle type ceramic primers, consisting of Primer A1 or A2 and Primer B, were designed. Primer A1 was prepared by dissolving 25, 50, or 100 mg of gamma-methacryloxypropyltrimethoxysilane in 1 mL of ethanol. Primer A2 was prepared by dissolving 50 mg of mixed silanes, consisting of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane, in 1 mL of ethanol. Mole fractions of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane were 0, 10, 20, 30, 40 and 50 mol%. Primer B was prepared after dissolving 0.01, 0.05 or 0.1 mol L(-1) hydrochloric acid in ethanol by 50 vol%. Ceramic surface was silanated with a mixture of Primers A1 and B or Primers A2 and B for 1 min, and then air-dried. Commercial GC ceramic primer and Porcelain Liner M were utilized. Thereafter, dual-curing type resin cement was bonded to silanated ceramic surface through visible-light irradiation. Shear bond strength of resin to the ceramic surface was measured, before and after thermo-cycling. Addition of 0.01 or 0.05 mol L(-1) hydrochloric acid to the gamma-methacryloxypropyltrimethoxysilane allowed for significant increases in the bond strength. However, thermo-cycling resulted in significant decreases of approximately 5 MPa in the bond strength. Conversely, when the mixed silane, where 30 mol% of 1,2-bis(trimethoxysilyl)ethane dissolved in gamma-methacryloxypropyltrimethoxysilane, was utilized with 0.05 mol L(-1) hydrochloric acid, the reduction in the bond strength decreased to approximately 2 MPa. The designed ceramic primers exhibited higher ceramic bond durability than commercial ceramic primers.

  13. A tool for design of primers for microRNA-specific quantitative RT-qPCR. (United States)

    Busk, Peter K


    MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

  14. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing. (United States)

    Li, Kelvin; Shrivastava, Susmita; Brownley, Anushka; Katzel, Dan; Bera, Jayati; Nguyen, Anh Thu; Thovarai, Vishal; Halpin, Rebecca; Stockwell, Timothy B


    In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute's (JCVI) high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus sequence that encapsulates the allelic variation of the targeted

  15. Los paisajes de Carlos V : primer viaje a España (1517-1518

    Directory of Open Access Journals (Sweden)

    Pilar Bosqued Lacambra


    Full Text Available Laurent Vital escribió la Relación del primer viaje de Carlos V a España, que inició en 1517 cuando salió de Gante para embarcar en Flesinga y emprender por mar la travesía hasta España, donde llegó a Asturias. Durante el verano de aquel año Carlos V disfrutó del paisaje de su tierra natal y recorrió durante el primer mes del otoño una parte de la cornisa cantábrica, desde Villaviciosa hasta San Vicente de la Barquera. Siguiendo el relato, se analizan y describen los paisajes que recorrió y las situaciones y sensaciones que vivió a lo largo del mencionado trayecto, tanto en sus territorios flamencos como en tierras españolas, a las que vino para ser proclamado como rey.Laurent Vital wrote the report of the first journey of Carlos V to Spain, that started in 1517 when he departed from Ghent to embark in Vlissingen and undertake through sea the crossing until Spain, arriving in Asturias. During that year’s summer, Carlos V enjoyed the landscape of his native land and roamed part of the Cantabric coast during the first month of that year’s Autumn , from Villaviciosa to San Vicente de la Barquera. In the story, the landscapes that he travelled through were analysed and described as well as the situations and feelings that he lived during the mentioned travel through his Flemish territories and Spanish grounds to which he became appointed as king.

  16. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners. (United States)

    Summerfield, Marc R; Feemster, Agnes Ann


    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail's ability to meet language standards, enhance the writer's image, and successfully transmit information.

  17. Changes of 5' Terminal Nucleotides of PCR Primers Causing Variable T-A Cloning Efficiency

    Institute of Scientific and Technical Information of China (English)

    Mei-Qin Liu; Xin Shen; Wei-Lun Yin; Cun-Fu Lu


    T-A cloning takes advantage of the unpaired adenosyl residue added to the 3' terminus of amplified DNAs by Taq and other thermostable DNA polymerase and uses a linearized plasmid vector with a protruding 3' thymidylate residue at each of its 3' termini to clone polymerase chain reaction (PCR)-derived DNA fragments. It is a simple,reliable, and efficient ligation-dependent cloning method for PCR products, but the drawback of variable cloning efficiency occurs during application. In the present work, the relationship between variable T-A cloning efficiency and the different 5' end nucleotide base of primers used in PCR amplification was studied. The results showed that different cloning efficiency was obtained with different primer pairs containing A, T, C and G at the 5' terminus respectively. The data shows that when the 5' end base of primer pair was adenosyl, more white colonies could be obtained in cloning the corresponding PCR product in comparison with other bases. And the least white colonies were formed when using the primer pair with 5' cytidylate end. The gluanylate end primers resulted in almost the same cloning efficiency in the white colonies amount as the thymidylate end primer did, and this efficiency was much lower than that of adenosyl end primers. This presumably is a consequence of variability in 3'dA addition to PCR products mediated by Taq polymerase. Our results offer instructions for primer design for researchers who choose T-A cloning to clone PCR products.

  18. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.


    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  19. A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For? (United States)

    Pine, Daniel S.


    This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

  20. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S;


    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...

  1. New primers for methylation-specific polymerase chain reaction enhance specificity of detecting STAT1 methylation

    Directory of Open Access Journals (Sweden)

    Ming-Cheng Chang


    Conclusion: Specific primers for methylation-specific PCR are mandatory for the accurate detection of STAT1 gene methylation. Besides, specific primers can generate correct interpretation of STAT1 gene methylation, and its correlation with the clinicopathological characteristics and outcome of cancer patients.

  2. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej;


    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  3. Mutagenic primer design for mismatch PCR-RFLP SNP genotyping using a genetic algorithm. (United States)

    Yang, Cheng-Hong; Cheng, Yu-Huei; Yang, Cheng-Huei; Chuang, Li-Yeh


    Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) is useful in small-scale basic research studies of complex genetic diseases that are associated with single nucleotide polymorphism (SNP). Designing a feasible primer pair is an important work before performing PCR-RFLP for SNP genotyping. However, in many cases, restriction enzymes to discriminate the target SNP resulting in the primer design is not applicable. A mutagenic primer is introduced to solve this problem. GA-based Mismatch PCR-RFLP Primers Design (GAMPD) provides a method that uses a genetic algorithm to search for optimal mutagenic primers and available restriction enzymes from REBASE. In order to improve the efficiency of the proposed method, a mutagenic matrix is employed to judge whether a hypothetical mutagenic primer can discriminate the target SNP by digestion with available restriction enzymes. The available restriction enzymes for the target SNP are mined by the updated core of SNP-RFLPing. GAMPD has been used to simulate the SNPs in the human SLC6A4 gene under different parameter settings and compared with SNP Cutter for mismatch PCR-RFLP primer design. The in silico simulation of the proposed GAMPD program showed that it designs mismatch PCR-RFLP primers. The GAMPD program is implemented in JAVA and is freely available at

  4. A multiple-alignment based primer design algorithm for genetically highly variable DNA targets. (United States)

    Brodin, Johanna; Krishnamoorthy, Mohan; Athreya, Gayathri; Fischer, Will; Hraber, Peter; Gleasner, Cheryl; Green, Lance; Korber, Bette; Leitner, Thomas


    Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples.

  5. Primer caso de resistencia al amitraz en la garrapata del ganado Boophilus microplus en México


    Noé Soberanes Céspedes; Minerva Santamaría Vargas; Hugo Fragoso Sánchez; Zeferino García Vázquez


    El objetivo de este estudio fue documentar el primer caso de la resistencia de la garrapata B. microplus al Amitraz, en México. Se obtuvo una muestra de garrapatas B. microplus del municipio de Emiliano Zapata, Tabasco, con reportes de fallas de control con este acaricida. La cepa de garrapatas fue denominada “San Alfonso” y se utilizaron larvas (F1) provenientes de la generación parental de hembras repletas, éstas se probaron con dosis discriminate de Amitraz 0.0002 %, (Taktic®) en formulaci...

  6. Novel computational methods for increasing PCR primer design effectiveness in directed sequencing

    Directory of Open Access Journals (Sweden)

    Busam Dana


    Full Text Available Abstract Background Polymerase chain reaction (PCR is used in directed sequencing for the discovery of novel polymorphisms. As the first step in PCR directed sequencing, effective PCR primer design is crucial for obtaining high-quality sequence data for target regions. Since current computational primer design tools are not fully tuned with stable underlying laboratory protocols, researchers may still be forced to iteratively optimize protocols for failed amplifications after the primers have been ordered. Furthermore, potentially identifiable factors which contribute to PCR failures have yet to be elucidated. This inefficient approach to primer design is further intensified in a high-throughput laboratory, where hundreds of genes may be targeted in one experiment. Results We have developed a fully integrated computational PCR primer design pipeline that plays a key role in our high-throughput directed sequencing pipeline. Investigators may specify target regions defined through a rich set of descriptors, such as Ensembl accessions and arbitrary genomic coordinates. Primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the specified target regions. As part of the tiling process, primer pairs are computationally screened to meet the criteria for success with one of two PCR amplification protocols. In the process of improving our sequencing success rate, which currently exceeds 95% for exons, we have discovered novel and accurate computational methods capable of identifying primers that may lead to PCR failures. We reveal the laboratory protocols and their associated, empirically determined computational parameters, as well as describe the novel computational methods which may benefit others in future primer design research. Conclusion The high-throughput PCR primer design pipeline has been very successful in providing the basis for high-quality directed sequencing results and for minimizing

  7. A new approach to primer design for the control of PCR bias in methylation studies

    Directory of Open Access Journals (Sweden)

    Hansen Lise


    Full Text Available Abstract Primer design for PCR-based methylation analysis following bisulfite conversion of DNA is considerably more complex than primer design for regular PCR. The choice of the optimal primer set is critical to the performance and correct interpretation of the results. Most methodologies in methylation analysis utilize primers that theoretically amplify methylated and unmethylated templates at the same time. The proportional amplification of all templates is critical but difficult to achieve due to PCR bias favouring the amplification of the unmethylated template. The focus of this brief communication is to point out the important criteria needed for the successful choice of primers that will enable the control of PCR bias in bisulfite based methylation-screening protocols.

  8. Multi-primer target PCR for rapid identification of bovine DRB3 alleles. (United States)

    Ledwidge, S A; Mallard, B A; Gibson, J P; Jansen, G B; Jiang, Z H


    Multi-primer target polymerase chain reaction (MPT-PCR) is a rapid method for the identification of specific BoLA-DRB3 alleles. In a single PCR reaction, the presence of two alleles associated with increased risk, DRB3.2*23 (DRB3*2701-2703, 2705-2707) and decreased risk, DRB3.2*16 (DRB3*1501, 1502), of mastitis in Canadian Holstein can be detected. Two outer primers amplify exon 2 of DRB3. Simultaneously, two inner, allele-specific primers amplify individual alleles. Initially, 40 cows previously typed by PCR-restriction fragment length polymorphism (PCR-RFLP) were genotyped using the multi-primer approach. An additional 30 cows were first genotyped by multi-primer target PCR, then by PCR-RFLP. All animals were correctly identified and there were no false positives. This technique can readily be modified to identify other BoLA alleles of interest.

  9. Degenerative primer design and gene sequencing validation for select turkey genes. (United States)

    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald


    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. © 2016 Poultry Science Association Inc.

  10. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers. (United States)

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer


    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  11. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Directory of Open Access Journals (Sweden)

    Kenan Hadziavdic

    Full Text Available High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  12. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers (United States)

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer


    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  13. Establishment and Validation of a Non-Radioactive Method for In Vitro Transcription Assay Using Primer Extension and Quantitative Real Time PCR. (United States)

    Wang, Juan; Zhao, Shasha; Zhou, Ying; Wei, Yun; Deng, Wensheng


    Primer extension-dependent in vitro transcription assay is one of the most important approaches in the research field of gene transcription. However, conventional in vitro transcription assays incorporates radioactive isotopes that cause environmental and health concerns and restricts its scope of application. Here we report a novel non-radioactive method for in vitro transcription analysis by combining primer extension with quantitative real time PCR (qPCR). We show that the DNA template within the transcription system can be effectively eliminated to a very low level by our specially designed approach, and that the primers uniquely designed for primer extension and qPCR can specifically recognize the RNA transcripts. Quantitative PCR data demonstrate that the novel method has successfully been applied to in vitro transcription analyses using the adenovirus E4 and major late promoters. Furthermore, we show that the TFIIB recognition element inhibits transcription of TATA-less promoters using both conventional and nonradioactive in vitro transcription assays. Our method will benefit the laboratories that need to perform in vitro transcription but either lack of or choose to avoid radioactive facilities.

  14. Mitochondrial D-loop {open_quotes}signatures{close_quotes} produced by low-stringency single specific primer PCR constitute a simple comparative human identity test

    Energy Technology Data Exchange (ETDEWEB)

    Barreto, G.; Vago, A.R.; Pena, S.D.J. [and others


    We have developed a technique called {open_quotes}LSSP-PCR{close_quotes} (low-stringency single specific primer PCR) that detects single or multiple mutations in DNA. A purified DNA fragment is submitted to PCR by using a single primer specific for one of the extremities of the fragment, under conditions of very low stringency. The primer hybridizes specifically to its complementary extremity and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner. A complex set of reaction products is thus created that, when separated by electrophoresis, constitutes a unique {open_quotes}gene signature.{close_quotes} We here report the application of LSSP-PCR to the detection of sequence variation in the control (D-loop) region of human mtDNA, which is known to differ significantly between unrelated individuals. We prepared human DNA samples from blood and amplified a 1,024-bp portion of the mtDNA control region, using primers L15996 and H408. The amplified mtDNA fragments were then reamplified under LSSP-PCR conditions by using L15996 or H408 as drivers to produce complex signatures that always differed between unrelated individuals and yet were highly reproducible. In contrast, all mother-child pairs tested were identical, as expected from the matrilineal inheritance of mtDNA. Thus, the use of LSSP-PCR to produce D-loop signatures constitutes a powerful new technique for mtDNA-based comparative identity testing. 18 refs., 7 figs.

  15. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts

    Directory of Open Access Journals (Sweden)

    Rygiewicz Paul T


    Full Text Available Abstract Background The Internal Transcribed Spacer (ITS regions of fungal ribosomal DNA (rDNA are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmental samples provide varying degrees of success at discriminating against plant DNA while maintaining a broad range of compatibility. Typically, it has been necessary to use multiple primer sets to accommodate the range of fungi under study, potentially creating artificial distinctions for fungal sequences that amplify with more than one primer set. Results Numerous sequences for PCR primers were tested to develop PCR assays with a wide range of fungal compatibility and high discrimination from plant DNA. A nested set of 4 primers was developed that reflected these criteria and performed well amplifying ITS regions of fungal rDNA. Primers in the 5.8S sequence were also developed that would permit separate amplifications of ITS1 and ITS2. A range of basidiomycete fruiting bodies and ascomycete cultures were analyzed with the nested set of primers and Restriction Fragment Length Polymorphism (RFLP fingerprinting to demonstrate the specificity of the assay. Single ectomycorrhizal root tips were similarly analyzed. These primers have also been successfully applied to Quantitative PCR (QPCR, Length Heterogeneity PCR (LH-PCR and Terminal Restriction Fragment Length Polymorphism (T-RFLP analyses of fungi. A set of wide-range plant-specific primers were developed at positions corresponding to one pair of the fungal primers. These were used to verify that the host plant DNA was not being amplified with the fungal primers. Conclusion These plant primers have been successfully applied to PCR-RFLP analyses of forest plant tissues from above- and below-ground samples and work well at distinguishing a selection of plants to the species level. The complete set of primers was

  16. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez


    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  17. An ASIC Low Power Primer Analysis, Techniques and Specification

    CERN Document Server

    Chadha, Rakesh


    This book provides an invaluable primer on the techniques utilized in the design of low power digital semiconductor devices.  Readers will benefit from the hands-on approach which starts form the ground-up, explaining with basic examples what power is, how it is measured and how it impacts on the design process of application-specific integrated circuits (ASICs).  The authors use both the Unified Power Format (UPF) and Common Power Format (CPF) to describe in detail the power intent for an ASIC and then guide readers through a variety of architectural and implementation techniques that will help meet the power intent.  From analyzing system power consumption, to techniques that can employed in a low power design, to a detailed description of two alternate standards for capturing the power directives at various phases of the design, this book is filled with information that will give ASIC designers a competitive edge in low-power design. Starts from the ground-up and explains what power is, how it is measur...

  18. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido


    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  19. Primer of statistics in dental research: Part II. (United States)

    Shintani, Ayumi


    The Part I of Primer of Statistics in Dental Research covered five topics that are often mentioned in statistical check list of many peer-review journals including (1) statistical graph, (2) how to deal with outliers, (3) p-value and confidence interval, (4) testing equivalence, and (5) multiplicity Adjustment. The Part II of the series covers another set of important topics in dental statistics including (1) selecting the proper statistical tests, (2) repeated measures analysis, (3) epidemiological consideration for causal association, and (4) analysis of agreement. First, a guide in selecting the proper statistical tests based on the research question will be laid out in text and with a table so that researchers choose the univariable statistical test by answering five simple questions. Second, the importance of utilizing repeated measures analysis will be illustrated. This is a key component of data analysis as in many dental studies, observations are considered repeated in a single patient (several teeth are measured in a single patient). Third, concepts of confounding and the use of regression analysis are explained by going over a famous observational cohort study. Lastly, the use of proper agreement analysis vs. correlation for study of agreement will be discussed to avoid a common pitfall in dental research.

  20. Genetic analysis of presbycusis by arrayed primer extension. (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris


    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  1. Annealing to sequences within the primer binding site loop promotes an HIV-1 RNA conformation favoring RNA dimerization and packaging


    Seif, Elias; Niu, Meijuan; Kleiman, Lawrence


    Experiments are presented which suggest that the binding of the primer tRNA to the primer binding site of the HIV-1 5′ UTR is involved in the dimerization of the genome, as part of the packaging process.

  2. In vitro short-term bonding performance of zirconia treated with hot acid etching and primer conditioning etching and primer conditioning. (United States)

    Xie, Haifeng; Chen, Chen; Dai, Wenyong; Chen, Gang; Zhang, Feimin


    This study aimed to investigate and compare the resin bond strengths of zirconia conditioned as follows: alumina sandblasting; alumina sandblasting+application of 10-MDP-containing primer; alumina sandblasting+application of Z-Prime Plus or Metal/Zirconia Primer (new zirconia primers); tribochemical silica coating+silanization; hot acid etching in three different combinations [H2SO4/(NH4)2SO4, HF/HNO3, H2SO4/HF/HNO3]+application of 10-MDP-containing primer. Shear bond strengths (SBS) after water storage for 24 h and 40 days were measured to assess resin bonding performance. Surface and chemical properties of conditioned zirconia surfaces and primers were characterized using scanning electron microscopy, energy dispersive X-ray spectrometry, Fourier transform infrared spectroscopy, and atomic force microscopy. Surface roughness ranked in descending order was: hot acid etching > tribochemical silica coating > alumina sandblasting. Combination of tribochemical silica coating and silanization showed the highest initial SBS (12.46±2.13 MPa) (P<0.01). Etching with H2SO4/(NH4)2SO4 (13.15±3.24 MPa) and HF/HNO3 (13.48±2.15 MPa) showed significantly better bond durability (P<0.01). Hot acid etching seemed to be a promising surface roughening treatment to improve resin-zirconia bonding.

  3. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    Directory of Open Access Journals (Sweden)

    Shea N. Gardner


    Full Text Available Background. Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results. A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions. This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.

  4. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  5. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing. (United States)

    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter


    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow.

  6. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing. (United States)

    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar


    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  7. Comprehensive primer design for analysis of population genetics in non-sequenced organisms.

    Directory of Open Access Journals (Sweden)

    Ayumi Tezuka

    Full Text Available Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris, anole lizard (Anolis sagrei, guppy (Poecilia reticulata, and fruit fly (Drosophila melanogaster, for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation.

  8. MRPrimerV: a database of PCR primers for RNA virus detection (United States)

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo


    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database ( contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  9. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV (United States)

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.


    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  10. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu


    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  11. Primer containing dimethylaminododecyl methacrylate kills bacteria impregnated in human dentin blocks (United States)

    Chen, Chen; Cheng, Lei; Weir, Michael D; Lin, Nancy J; Lin-Gibson, Sheng; Zhou, Xue-Dong; Xu, Hockin HK


    Antibacterial dimethylaminododecyl methacrylate (DMADDM) was recently synthesized. The objectives of this study were to: (1) investigate antibacterial activity of DMADDM-containing primer on Streptococcus mutans impregnated into dentin blocks for the first time, and (2) compare the antibacterial efficacy of DMADDM with a previous quaternary ammonium dimethacrylate (QADM). Scotchbond Multi-Purpose (SBMP) bonding agent was used. DMADDM and QADM were mixed into SBMP primer. Six primers were tested: SBMP control primer P, P+2.5% DMADDM, P+5% DMADDM, P+7.5% DMADDM, P+10% DMADDM, and P+10% QADM. S. mutans were impregnated into human dentin blocks, and each primer was applied to dentin to test its ability to kill bacteria in dentinal tubules. Bacteria in dentin were collected via a sonication method, and the colony-forming units (CFU) and inhibition zones were measured. The bacterial inhibition zone of P+10% DMADDM was 10 times that of control primer (P0.1). In conclusion, antibacterial DMADDM-containing primer was validated to kill bacteria inside dentin blocks, possessing a much stronger antibacterial potency than the previous QADM. DMADDM-containing bonding agent was effective in eradicating bacteria in dentin, and its efficacy was directly proportional to DMADDM mass fraction. Therefore, DMADDM may be promising for use in bonding agents as well as in other restorative and preventive materials to inhibit bacteria. PMID:27811846

  12. Comprehensive primer design for analysis of population genetics in non-sequenced organisms. (United States)

    Tezuka, Ayumi; Matsushima, Noe; Nemoto, Yoriko; Akashi, Hiroshi D; Kawata, Masakado; Makino, Takashi


    Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris), anole lizard (Anolis sagrei), guppy (Poecilia reticulata), and fruit fly (Drosophila melanogaster), for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation.

  13. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation. (United States)

    Cheng, Yu-Huei


    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  14. Estimation of teaching-learning-based optimization primer design using regression analysis for different melting temperature calculations. (United States)

    Cheng, Yu-Huei


    Primers plays important role in polymerase chain reaction (PCR) experiments, thus it is necessary to select characteristic primers. Unfortunately, manual primer design manners are time-consuming and easy to get human negligence because many PCR constraints must be considered simultaneously. Automatic programs for primer design were developed urgently. In this study, the teaching-learning-based optimization (TLBO), a robust and free of algorithm-specific parameters method, is applied to screen primers conformed primer constraints. The optimal primer frequency (OPF) based on three known melting temperature formulas is estimated by 500 runs for primer design in each different number of generations. We selected optimal primers from fifty random nucleotide sequences of Homo sapiens at NCBI. The results indicate that the SantaLucia's formula is better coupled with the method to get higher optimal primer frequency and shorter CPU-time than the Wallace's formula and the Bolton and McCarthy's formula. Through the regression analysis, we also find the generations are significantly associated with the optimal primer frequency. The results are helpful for developing the novel TLBO-based computational method to design feasible primers.

  15. The Influence of No-Primer Adhesives and Anchor Pylons Bracket Bases on Shear Bond Strength of Orthodontic Brackets

    Directory of Open Access Journals (Sweden)

    Andrea Scribante


    Full Text Available Objective. The aim of this study was to compare the shear bond strength (SBS and adhesive remnant index (ARI scores of no-primer adhesives tested with two different bracket bases. Materials and Methods. 120 bovine permanent mandibular incisors were divided into 6 groups of 20 specimens. Two brackets (ODP with different bracket bases (anchor pylons and 80-gauge mesh were bonded to the teeth using a conventional adhesive (Transbond XT and two different no-primer adhesive (Ortho Cem; Heliosit systems. Groups were tested using an instron universal testing machine. SBS values were recorded. ARI scores were measured. SEM microphotographs were taken to evaluate the pattern of bracket bases. Statistical analysis was performed. ANOVA and Tukey tests were carried out for SBS values, whereas a chi-squared test was applied for ARI scores. Results. Highest bond strength values were reported with Transbond XT (with both pad designs, Ortho Cem bonded on anchor pylons and Heliosit on 80-gauge mesh. A higher frequency of ARI score of “3” was reported for Transbond XT groups. Other groups showed a higher frequency of ARI score “2” and “1.” Conclusion. Transbond XT showed the highest shear bond strength values with both pad designs.

  16. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection. (United States)

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann


    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.

  17. Sensitive and specific detection of miRNA using an isothermal exponential amplification method using fluorescence-labeled LNA/DNA chimera primers. (United States)

    Huang, Jun-Fu; Zhao, Na; Xu, Han-Qing; Xia, Han; Wei, Kun; Fu, Wei-Ling; Huang, Qing


    MicroRNAs (miRNAs) are currently considered as potential biomarkers for various human diseases. In the present study, miRNA-triggered real-time fluorescent isothermal reaction with exponential amplification (ReFIRE) with or without Thermus aquaticus MutS (Taq MutS) was developed to analyze miRNAs using DNA polymerase, a nicking endonuclease, and fluorescently labeled primers. In the absence of Taq MutS, the ReFIRE system permitted the detection of 100 ymol of targeted miRNA in 80 min. However, this system enabled limited differentiation between homologous miRNA family members. Upon addition of Taq MutS to the ReFIRE system, non-specific amplification generated from the mishybridization between primers and primer dimers or primers and the template duplex was eliminated. The addition of Taq MutS enabled the ultrasensitive detection of as little as 10 ymol of targeted miRNAs in 50 min, which corresponds to less than 10 copies of miRNAs in a total volume of 20 μl. Additionally, the assay exhibited a dynamic range of up to 12 orders of magnitude. The ReFIRE system also showed high specificity, enabling differentiation between homologous miRNA family members exhibiting only single-base differences. The sensitivity, specificity, and dynamic range associated with this system were greater than most currently available miRNA isothermal amplification assays. Moreover, when target-specific primers were labeled with different fluorescent reporters, multiplex analysis was easily performed in a single tube, permitting accurate normalization of miRNA expression. This simple, fast, ultrasensitive, highly specific, and easy-to-multiplex method could significantly contribute to research investigations pertaining to the biological roles of miRNA, as well as clinical diagnosis of various diseases that involve miRNA disruptions. Graphical Abstract The principle of ReFIRE system.

  18. Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection (United States)

    Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann


    A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

  19. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen


    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  20. Improved COI barcoding primers for Southeast Asian perching birds (Aves: Passeriformes). (United States)

    Lohman, David J; Prawiradilaga, Dewi M; Meier, Rudolf


    The All Birds Barcoding Initiative aims to assemble a DNA barcode database for all bird species, but the 648-bp 'barcoding' region of cytochrome c oxidase subunit I (COI) can be difficult to amplify in Southeast Asian perching birds (Aves: Passeriformes). Using COI sequences from complete mitochondrial genomes, we designed a primer pair that more reliably amplifies and sequences the COI barcoding region of Southeast Asian passerine birds. The 655-bp region amplified with these primers overlaps the COI region amplified with other barcoding primer pairs, enabling direct comparison of sequences with previously published DNA barcodes.

  1. Desenvolvimento de Primer universal de SBE para codificação espectral de SNP


    Cordeiro, Mílton Jorge Santos


    Dissertação para obtenção do Grau de Mestre em Biotecnologia Na presente dissertação é apresentado o desenvolvimento de um primer universal para codificação espectral de SNP. A utilização deste primer universal permite que o mesmo oligonucleótido marcado com um doador (D1) possa ser utilizado na análise de múltiplos SNPs de forma universal. Para o desenvolvimento deste primer universal foi necessário verificar se o doador utilizado e os aceitantes (que marcam os ddNTPs) permitiam a o...


    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani


    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  3. Detection of Hepatitis B Virus DNA by Duplex Scorpion Primer-based PCR Assay

    Institute of Scientific and Technical Information of China (English)

    KONG De-Ming孔德明; SHEN Han-Xi沈含熙; MI Huai-Feng宓怀风


    The application of a new fiuorogenic probe-based PCR assay (PCR duplex scorpion primer assay) to the detection of Hepatitis B virus (HBV) DNA in human sera was described. Duplex scorpion primer is a modified variant of duplex Amplifluor, and the incorporation of a PCR stopper between probe and primer sequences improve the detection specificity and sensitivity. Combined with PCR amplification, this probe can give unambiguous positive results for the reactions initiated with more than 20 HBV molecules. In addition, the particular unimolecular probing mechanism of this probe makes the use of short target-specific probe sequence possible, which will render this probe applicable in some specific systems.

  4. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere


    to investigate the potential failure mechanism of a primer applied prior to an intumescent coating. The analysis was carried out using; (1) gas-fired test furnace, (2) a specially designed electrically heated oven, and (3) thermo gravimetric analysis. When tested below an acrylic intumescent coating, exposed...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen...

  5. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.


    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  6. A primer on incentive regulation for electric utilities

    Energy Technology Data Exchange (ETDEWEB)

    Hill, L.J.


    In contemplating a regulatory approach, the challenge for regulators is to develop a model that provides incentives for utilities to engage in socially desirable behavior. In this primer, we provide guidance on this process by discussing (1) various models of economic regulation, (2) problems implementing these models, and (3) the types of incentives that various models of regulation provide electric utilities. We address five regulatory models in depth. They include cost-of-service regulation in which prudently incurred costs are reflected dollar-for-dollar in rates and four performance-based models: (1) price-cap regulation, in which ceilings are placed on the average price that a utility can charge its customers; (2) revenue-cap regulation, in which a ceiling is placed on revenues; (3) rate-of-return bandwidth regulation, in which a utility`s rates are adjusted if earnings fall outside a {open_quotes}band{close_quotes} around equity returns; and (4) targeted incentives, in which a utility is given incentives to improve specific components of its operations. The primary difference between cost-of-service and performance-based approaches is the latter sever the tie between costs and prices. A sixth, {open_quotes}mixed approach{close_quotes} combines two or more of the five basic ones. In the recent past, a common mixed approach has been to combine targeted incentives with cost-of-service regulation. A common example is utilities that are subject to cost-of-service regulation are given added incentives to increase the efficiency of troubled electric-generating units.

  7. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García


    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  8. Viral reverse transcriptases show selective high affinity binding to DNA-DNA primer-templates that resemble the polypurine tract.

    Directory of Open Access Journals (Sweden)

    Gauri R Nair

    Full Text Available Previous results using a SELEX (Systematic Evolution of Ligands by Exponential Enrichment-based approach that selected DNA primer-template duplexes binding with high affinity to HIV reverse transcriptase (RT showed that primers mimicking the 3' end, and in particular the six nt terminal G tract, of the RNA polypurine tract (PPT; HIV PPT: 5'-AAAAGAAAAGGGGGG-3' were preferentially selected. In this report, two viral (Moloney murine leukemia virus (MuLV and avian myeloblastosis virus (AMV and one retrotransposon (Ty3 RTs were used for selection. Like HIV RT, both viral RTs selected duplexes with primer strands mimicking the G tract at the PPT 3' end (AMV PPT: 5'-AGGGAGGGGGA-3'; MuLV PPT: 5'-AGAAAAAGGGGGG-3'. In contrast, Ty3, whose PPT lacks a G tract (5'-GAGAGAGAGGAA-3' showed no selective binding to any duplex sequences. Experiments were also conducted with DNA duplexes (termed DNA PPTs mimicking the RNA PPT-DNA duplex of each virus and a control duplex with a random DNA sequence. Retroviral RTs bound with high affinity to all viral DNA PPT constructs, with HIV and MuLV RTs showing comparable binding to the counterpart DNA PPT duplexes and reduced affinity to the AMV DNA PPT. AMV RT showed similar behavior with a modest preference for its own DNA PPT. Ty3 RT showed no preferential binding for its own or any other DNA PPT and viral RTs bound the Ty3 DNA PPT with relatively low affinity. In contrast, binding affinity of HIV RT to duplexes containing the HIV RNA PPT was less dependent on the G tract, which is known to be pivotal for efficient extension. We hypothesize that the G tract on the RNA PPT helps shift the binding orientation of RT to the 3' end of the PPT where extension can occur.

  9. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C


    by cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus......RNA primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...

  10. Paralog-specific primers for the amplification of nuclear Loci in tetraploid barbels (barbus: cypriniformes). (United States)

    Gante, Hugo F; Alves, Maria Judite; Dowling, Thomas E


    Thirty paralog-specific primers were developed, following an intron-primed exon-crossing strategy, for S7 and growth hormone genes in Barbus (subgenera Barbus and Luciobarbus). We found that paralog-specific amplification requires the use of only one paralog-specific primer, allowing their simultaneous use with universal exon-primed intron-crossing primers of broad taxonomic applicability. This hybrid annealing strategy guarantees both specificity and generality of amplification reactions and represents a step forward in the amplification of duplicated nuclear loci in polyploid organisms and members of multigene families. Assays of several representative taxa identified high levels of segregating single nucleotide polymorphisms (SNPs) and nucleotide diversity within each of these subgenera. Additionally, several insertions-deletions (indels) that are diagnostic across species are found in intronic regions. Therefore, these primers provide a reliable source of valuable nuclear SNP and indel data for population and species level studies of barbels, such as applied conservation and basic evolutionary studies.

  11. Mega primer-mediated molecular cloning strategy for chimaeragenesis and long DNA fragment insertion. (United States)

    Zhang, Hui; Liu, Chang-Jun; Jiang, Hui; Zhou, Lu; Li, Wen-Ying; Zhu, Ling-Yun; Wu, Lei; Meng, Er; Zhang, Dong-Yi


    Molecular cloning methods based on primer and overlap-extension PCR are widely used due to their simplicity, reliability, low cost and high efficiency. In this article, an efficient mega primer-mediated (MP) cloning strategy for chimaeragenesis and long DNA fragment insertion is presented. MP cloning is a seamless, restriction/ligation-independent method that requires only three steps: (i) the first PCR for mega primer generation; (ii) the second PCR for exponential amplification mediated by the mega primers and (iii) DpnI digestion and transformation. Most importantly, for chimaeragenesis, genes can be assembled and constructed into the plasmid vector in a single PCR step. By employing this strategy, we successfully inserted four DNA fragments (approximately 500 bp each) into the same vector simultaneously. In conclusion, the strategy proved to be a simple and efficient tool for seamless cloning.

  12. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo


    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  13. Use of tannin anticorrosive reaction primer to improve traditional coating systems

    Energy Technology Data Exchange (ETDEWEB)

    Matamala, G.; Droguett, G. (Universidad de Concepcion (Chile)); Smeltzer, W. (McMaster Univ., Hamilton, Ontario (Canada). Inst. for Materials Research)


    Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showed the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.

  14. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)



    Jan 22, 2014 ... powerful tool for the detection and quantification of GMO despite its high expense .... primers pairs have been tested for the HVA1 gene amplification by qualitative PCR and those ..... commodities and food. Department of ...

  15. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication. (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J


    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  16. Influence of RT-qPCR primer position on EGFR interference efficacy in lung cancer cells

    Directory of Open Access Journals (Sweden)

    Chen Gang


    Full Text Available Abstract Background Real-time quantitative RT-PCR (RT-qPCR is a "gold" standard for measuring steady state mRNA levels in RNA interference assays. The knockdown of the epidermal growth factor receptor (EGFR gene with eight individual EGFR small interfering RNAs (siRNAs was estimated by RT-qPCR using three different RT-qPCR primer sets. Results Our results indicate that accurate measurement of siRNA efficacy by RT-qPCR requires careful attention for the selection of the primers used to amplify the target EGFR mRNA. Conclusions We conclude that when assessing siRNA efficacy with RT-qPCR, more than one primer set targeting different regions of the mRNA should be evaluated and at least one of these primer sets should amplify a region encompassing the siRNA recognition sequence.

  17. New Primers for Denaturing Gradient Gel Electrophoresis Analysis of Nitrate-Reducing Bacterial Community in Soil

    Institute of Scientific and Technical Information of China (English)



    The narG gene is frequently used as a molecular marker for bacterial nitrate-reducing community analysis.In this study,a new set of primers targeting the narG gene was designed and applied to semi-nested polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) assay.The potential of the new primers was verified on DNA directly extracted from soils from five different experimental sites distributed in Central and Southern Italy.Specificity of the primers was determined by excision,amplification,and sequencing of bands resolved by DGGE.A phylogenetic analysis showed the correlation between the sequences retrieved from the soils studied and the narG sequences from β and γ-Proteobacteria.These primers expanded the existing molecular tools for ecological study on the size and diversity of nitrate-reducing bacterial community in soil.

  18. QuantPrime--a flexible tool for reliable high-throughput primer design for quantitative PCR

    National Research Council Canada - National Science Library

    Arvidsson, Samuel; Kwasniewski, Miroslaw; Riaño-Pachón, Diego Mauricio; Mueller-Roeber, Bernd


    ...) assays are becoming increasingly important in genomics research. A major bottleneck in experiment preparation is the design of specific primer pairs, where researchers have to make several informed choices, often outside their area of expertise...

  19. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray


    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  20. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Directory of Open Access Journals (Sweden)

    Nina Vidergar

    Full Text Available BACKGROUND: DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1 improving an automated DNA extraction protocol, (2 testing the performance of commonly used primer combinations, and (3 developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. METHODOLOGY: We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. RESULTS: The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198 that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93% matched that of C1-J-2183. CONCLUSIONS: The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  1. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. (United States)

    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R


    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  2. Primers for low-copy nuclear genes in the Melastomataceae 1


    Reginato,Marcelo; Michelangeli, Fabián A.


    Premise of the study: Low-copy nuclear gene primers were developed for phylogenetic studies across the Melastomataceae. Methods and Results: Total genomic libraries from eight species in the Melastomataceae along with one transcriptome were used for marker identification and primer design. Eight exon-primed intron-crossing markers were amplified with success in taxa of nine tribes in the Melastomataceae. The new markers were directly sequenced for eight samples of closely related species of M...

  3. Effects of acidic primer/adhesives on primary and permanent dentin



    Purpose: To evaluate the quality of primary and permanent dentin by Fourier transformed Raman spectroscopy (FT-Raman), and scanning electron microscopy/energy-dispersive spectroscopy (SEM/EDS). Methods: The middle dentin of crowns was reached by carbide bur abrading providing a uniform smear layer. Self-etching primers were applied in order to simulate the etching of self-etching adhesive systems. The groups were (n = 6): G1 (primary dentin smear layer); G2 (primary dentin etched by primer of...

  4. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer


    Wawan Abdullah Setiawan; Utut Widyastuti; Munti Yuhana


    Whiteleg shrimp (Litopenaeus vannamei) is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ64...

  5. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool (United States)

    Zhou, Quan


    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  6. Fullerene Derivatives and Aluminum-based Nanothermites as Potential New Ammunition Primers (United States)


    and the possibility to ignite such a primer by low energy laser irradiation. Traditional primers contain lead compounds such as lead azide and lead...the specifications of the supplier. Among the different types of metal oxide nanopowders available, copper oxide (CuO), molybdenum oxide (MoO3) and...electricity given the sensitivity of nanothermites to ESD. In a glass tube was placed copper oxide (250 mg). Then was added hexane 6.2 mL and the

  7. Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture (United States)


    ARL-MR-0896 ●AUG 2015 US Army Research Laboratory Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture...SUBTITLE Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT...Contents List of Figures iv Acknowledgments v 1. Introduction 1 2. Background 1 3. Technical Approach 4 3.1 Hardware Design 4 3.2 Experimental Setup

  8. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp


    Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity...... of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed...

  9. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design. (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong


    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  10. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    Directory of Open Access Journals (Sweden)

    Wawan Abdullah Setiawan


    Full Text Available Whiteleg shrimp (Litopenaeus vannamei is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ640264, flanking the position 133 to 756. This primer pairs were used to identify haemolysin gene in both V. harveyi MR5339 and V. harveyi 275 strain. Sequencing results from each sample showed 99% similarity with haemolysin gene sequence in Genebank. Furthermore, the sequence of V. harveyi MR5339 haemolysin gene was used to design the nested PCR primers. The first primer pairs of nested PCR have successfully amplified the haemolysin gene fragment of all V. harveyi strains samples from position 52 to 405. The second primer pairs of nested PCR have amplified position 204 to 405 where it can detect all of V. harveyi strains used as sample sources in this study. The application of nested PCR technique in this study was able to identify V. harveyi strains at serial dilution of cells density as low as 100 cfu/mL, which is equal to a single cell or at DNA concentration up to 101 fg/µL.

  11. Morphological categorization of acid-base resistant zones with self-etching primer adhesive systems. (United States)

    Inoue, Go; Nikaido, Toru; Sadr, Alireza; Tagami, Junji


    This study investigated the influence of the composition of self-etching primer adhesive systems on the morphology of acid-base resistant zones (ABRZs). One-step self-etching primer systems (Clearfil Tri-S Bond, G-Bond, and One-Up Bond F Plus) and two-step self-etching primer systems (Clearfil SE Bond, Clearfil Protect Bond, UniFil Bond, and Mac Bond II) were used in this study. Each adhesive was applied on prepared dentin disk surfaces, and a resin composite was placed between two dentin disks. All resin-bonded specimens were subjected to acid-base challenge. Observation under a scanning electron microscope (SEM) revealed the creation of an ABRZ adjacent to the hybrid layer for all the self-etch primer adhesive systems, even when non-fluoride releasing adhesives were used. The presence of fluoride in two-step self-etching adhesive significantly increased the thickness of ABRZ created. Results suggested that an ABRZ was created with the use of self-etching primer adhesive systems, but its morphology differed between one-and two-step self-etching primer adhesive systems and was influenced by fluoride release activity.

  12. UniPrime2: a web service providing easier Universal Primer design. (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C


    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  13. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul


    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  14. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G.J.; Bekeris, P.A. [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry


    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  15. New mitochondrial and nuclear primers for the Mediterranean marine bivalve Pinna nobilis

    Directory of Open Access Journals (Sweden)

    D. SANNA


    Full Text Available Pinna nobilis is the largest endemic Mediterranean marine bivalve. During past centuries, various human activities led to the regression of its populations. As a consequence of stringent standards of protection, demographic expansions are currently reported in many sites. We designed a set of four mitochondrial- and two nuclear- specific PCR-primers with the aim to provide molecular tools to gather new insights into the genetic variability of this species. A total of 54 specimens were sampled from 25 Mediterranean localities in order to evaluate the level of polymorphism of these markers in P. nobilis. The most variable molecular markers identified were the mitochondrial Cytochrome c Oxidase subunit I (COI, NADH dehydrogenase subunit 3 (nad3, and 16S ribosomal DNA (16S. Positive results, in terms of good amplifications and scorable sequences, were also obtained in the co-generic Pinna rudis. The molecular markers identified in this study, and the PCR-protocols provided, represent a useful tool for future researches devoted to infer the genetic variability of P. nobilis populations thus allowing the development of effective conservation measures.

  16. Primer on Durability of Nuclear Power Plant Reinforced Concrete Structures - A Review of Pertinent Factors

    Energy Technology Data Exchange (ETDEWEB)

    Naus, Dan J [ORNL


    The objective of this study was to provide a primer on the environmental effects that can affect the durability of nuclear power plant concrete structures. As concrete ages, changes in its properties will occur as a result of continuing microstructural changes (i.e., slow hydration, crystallization of amorphous constituents, and reactions between cement paste and aggregates), as well as environmental influences. These changes do not have to be detrimental to the point that concrete will not be able to meet its performance requirements. Concrete, however, can suffer undesirable changes with time because of improper specifications, a violation of specifications, or adverse performance of its cement paste matrix or aggregate constituents under either physical or chemical attack. Contained in this report is a discussion on concrete durability and the relationship between durability and performance, a review of the historical perspective related to concrete and longevity, a description of the basic materials that comprise reinforced concrete, and information on the environmental factors that can affect the performance of nuclear power plant concrete structures. Commentary is provided on the importance of an aging management program.

  17. New mitochondrial and nuclear primers for the Mediterranean marine bivalve Pinna nobilis

    Directory of Open Access Journals (Sweden)

    D. SANNA


    Full Text Available Pinna nobilis is the largest endemic Mediterranean marine bivalve. During past centuries, various human activities led to the regression of its populations. As a consequence of stringent standards of protection, demographic expansions are currently reported in many sites. We designed a set of four mitochondrial- and two nuclear- specific PCR-primers with the aim to provide molecular tools to gather new insights into the genetic variability of this species. A total of 54 specimens were sampled from 25 Mediterranean localities in order to evaluate the level of polymorphism of these markers in P. nobilis. The most variable molecular markers identified were the mitochondrial Cytochrome c Oxidase subunit I (COI, NADH dehydrogenase subunit 3 (nad3, and 16S ribosomal DNA (16S. Positive results, in terms of good amplifications and scorable sequences, were also obtained in the co-generic Pinna rudis. The molecular markers identified in this study, and the PCR-protocols provided, represent a useful tool for future researches devoted to infer the genetic variability of P. nobilis populations thus allowing the development of effective conservation measures.

  18. The Caenorhabditis elegans lipidome: A primer for lipid analysis in Caenorhabditis elegans. (United States)

    Witting, Michael; Schmitt-Kopplin, Philippe


    Lipids play important roles in biology, ranging from building blocks of membranes to signaling lipids. The nematode and model organism Caenorhabditis elegans has been used to explore lipid metabolism and several techniques for their analysis have been employed. These techniques include different possibilities ranging from visualization of lipid droplets, analysis of total fatty acids to analysis of complex lipids using lipidomics approaches. Lipidomics evolved from metabolomics, the latest off-spring of the "omics"-technologies and aims to characterize the lipid content of a given organism or system. Although being an extensively studied model organism, only a few applications of lipidomics to C. elegans have been reported to far, but the number is steadily increasing with more applications expected in the near future. This review gives an overview on the C. elegans lipidome, lipid classes it contains and ways to analyze them. It serves as primer for scientists interested in studying lipids in this model organism and list methods used so far and what information can be derived from them. Lastly, challenges and future (methodological) research directions, together with new methods potentially useful for C. elegans lipid research are discussed.

  19. Sliding over the blocks in enzyme-free RNA copying--one-pot primer extension in ice.

    Directory of Open Access Journals (Sweden)

    Philipp M G Löffler

    Full Text Available Template-directed polymerization of RNA in the absence of enzymes is the basis for an information transfer in the 'RNA-world' hypothesis and in novel nucleic acid based technology. Previous investigations established that only cytidine rich strands are efficient templates in bulk aqueous solutions while a few specific sequences completely block the extension of hybridized primers. We show that a eutectic water/ice system can support Pb(2+/Mg(2+-ion catalyzed extension of a primer across such sequences, i.e. AA, AU and AG, in a one-pot synthesis. Using mixtures of imidazole activated nucleotide 5'-monophosphates, the two first "blocking" residues could be passed during template-directed polymerization, i.e., formation of triply extended products containing a high fraction of faithful copies was demonstrated. Across the AG sequence, a mismatch sequence was formed in similar amounts to the correct product due to U·G wobble pairing. Thus, the template-directed extension occurs both across pyrimidine and purine rich sequences and insertions of pyrimidines did not inhibit the subsequent insertions. Products were mainly formed with 2'-5'-phosphodiester linkages, however, the abundance of 3'-5'-linkages was higher than previously reported for pyrimidine insertions. When enzyme-free, template-directed RNA polymerization is performed in a eutectic water ice environment, various intrinsic reaction limitations observed in bulk solution can then be overcome.

  20. Development of catechol 2,3-dioxygenase-specific primers for monitoring bioremediation by competitive quantitative PCR

    Energy Technology Data Exchange (ETDEWEB)

    Mesarch, M.B.; Nakatsu, C.H.; Nies, L.


    Benzene, toluene, xylenes, phenol, naphthalene, and biphenyl are among a group of compounds that have at least one reported pathway for biodegradation involving catechol 2,3-dioxygenase enzymes. Thus, detection of the corresponding catechol 2,3-dioxygenase genes can serve as a basis for identifying and quantifying bacteria that have these catabolic abilities. Primes that can successfully amplify a 238-bp catechol 2,3-dioxygenase gene fragment from eight different bacteria are described. The identities of the amplicons were confirmed by hybridization with a 238-bp catechol 2,3-dioxygenase probe. The detection limit was 10{sup 2} to 10{sup 3} gene copies, which was lowered to 10{sup 0} to 10{sup 1} gene copies of hybridization. Using the dioxygenase-specific primers, an increase in catechol 2,3-dioxygenase genes was detected in petroleum-amended soils. The dioxygenase genes were enumerated by competitive quantitative PCR and a 163-bp competitor that was amplified using the same primers. Target and competitor sequences had identical amplification kinetics. Potential PCR inhibitors that could coextract with DNA, nonamplifying DNA, soil factors (humics), and soil pollutants (toluene) did not impact enumeration. Therefore, this technique can be used to accurately and reproducibly quantify catechol 2,3-dioxygenase genes in complex environments such as petroleum-contaminated soil. Direct, non-cultivation-based molecular techniques for detecting and enumerating microbial pollutant-biodegrading genes in environmental samples are powerful tools for monitoring bioremediation and developing field evidence in support of natural attenuation.

  1. Primer-Dependent and Primer-Independent Initiation of Double Stranded RNA Synthesis by Purified Arabidopsis RNA-Dependent RNA Polymerases RDR2 and RDR6 (United States)

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice


    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  2. Influence of acid-etching and ceramic primers on the repair of a glass ceramic. (United States)

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A


    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength.

  3. FEMA’s Disaster Declaration Process: A Primer (United States)


    to comply with a collection of information if it does not display a currently valid OMB control number. 1. REPORT DATE 23 JAN 2009 2. REPORT TYPE...Elizabeth B. Bazan . 25 42 U.S.C. §5191. The importance of

  4. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen


    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  5. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton


    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  6. Primer containing dimethylaminododecyl methacrylate kills bacteria impregnated in human dentin blocks

    Institute of Scientific and Technical Information of China (English)

    Chen Chen; Lei Cheng; Michael D Weir; Nancy J Lin; Sheng Lin-Gibson; Xue-Dong Zhou; Hockin HK Xu


    Antibacterial dimethylaminododecyl methacrylate (DMADDM) was recently synthesized. The objectives of this study were to:(1) investigate antibacterial activity of DMADDM-containing primer on Streptococcus mutans impregnated into dentin blocks for the first time, and (2) compare the antibacterial efficacy of DMADDM with a previous quaternary ammonium dimethacrylate (QADM). Scotchbond Multi-Purpose (SBMP) bonding agent was used. DMADDM and QADM were mixed into SBMP primer. Six primers were tested:SBMP control primer P, P+2.5%DMADDM, P+5%DMADDM, P+7.5%DMADDM, P+10%DMADDM, and P+10%QADM. S. mutans were impregnated into human dentin blocks, and each primer was applied to dentin to test its ability to kill bacteria in dentinal tubules. Bacteria in dentin were collected via a sonication method, and the colony-forming units (CFU) and inhibition zones were measured. The bacterial inhibition zone of P+10%DMADDM was 10 times that of control primer (Po0.05). CFU in dentin with P+10%DMADDM was reduced by three orders of magnitude, compared with control. DMADDM had a much stronger antibacterial effect than QADM, and antibacterial efficacy increased with increasing DMADDM concentration. Dentin shear bond strengths were similar among all groups (P40.1). In conclusion, antibacterial DMADDM-containing primer was validated to kill bacteria inside dentin blocks, possessing a much stronger antibacterial potency than the previous QADM. DMADDM-containing bonding agent was effective in eradicating bacteria in dentin, and its efficacy was directly proportional to DMADDM mass fraction. Therefore, DMADDM may be promising for use in bonding agents as well as in other restorative and preventive materials to inhibit bacteria.

  7. Circulating primers enhance platelet function and induce resistance to antiplatelet therapy (United States)

    Blair, T A; Moore, S F; Hers, I


    Background Aspirin and P2Y12 antagonists are antiplatelet compounds that are used clinically in patients with thrombosis. However, some patients are ‘resistant’ to antiplatelet therapy, which increases their risk of developing acute coronary syndromes. These patients often present with an underlying condition that is associated with altered levels of circulating platelet primers and platelet hyperactivity. Platelet primers cannot stimulate platelet activation, but, in combination with physiologic stimuli, significantly enhance platelet function. Objectives To explore the role of platelet primers in resistance to antiplatelet therapy, and to evaluate whether phosphoinositide 3-kinase (PI3K) contributes to this process. Methods and Results We used platelet aggregation, thromboxane A2 production and ex vivo thrombus formation as functional readouts of platelet activity. Platelets were treated with the potent P2Y12 inhibitor AR-C66096, aspirin, or a combination of both, in the presence or absence of the platelet primers insulin-like growth factor-1 (IGF-1) and thrombopoietin (TPO), or the Gz-coupled receptor ligand epinephrine. We found that platelet primers largely overcame the inhibitory effects of antiplatelet compounds on platelet functional responses. IGF-1-mediated and TPO-mediated, but not epinephrine-mediated, enhancements in the presence of antiplatelet drugs were blocked by the PI3K inhibitors wortmannin and LY294002. Conclusions These results demonstrate that platelet primers can contribute to antiplatelet resistance. Furthermore, our data demonstrate that there are PI3K-dependent and PI3K-independent mechanisms driving primer-mediated resistance to antiplatelet therapy. PMID:26039631

  8. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp


    at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...... design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity...... of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed...

  9. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR. (United States)

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo


    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Comparative assessment of 5' A/T-rich overhang sequences with optimal and sub-optimal primers to increase PCR yields and sensitivity. (United States)

    Arif, M; Ochoa-Corona, F M


    Efficient PCR amplifications require precisely designed and optimized oligonucleotide primers, components, and cycling conditions. Despite recent software development and reaction improvement, primer design can still be enhanced. The aims of this research are to understand (1) the effect on PCR efficiency and DNA yields of primer thermodynamics parameters, and (2) the incorporation of 5' A/T-rich overhanging sequences (flaps) during primer design. Two primer sets, one optimal (ΔG = 0) and one sub-optimal (ΔG = 0.9), were designed using web interface software Primer3, BLASTn, and mFold to target a movement protein gene of Tobacco mosaic virus. The optimal primer set amplifies a product of 195 bp and supports higher PCR sensitivity and yields compared to the sub-optimal primer set, which amplifies a product of 192 bp. Greater fluorescence was obtained using optimal primers compared to that with sub-optimal primers. Primers designed with sub-optimal thermodynamics can be substantially improved by adding 5' flaps. Results indicate that even if the performance of some primers can be improved substantially by 5' flap addition, not all primers will be similarly improved. Optimal 5' flap sequences are dependent on the primer sequences, and alter the primer's T m value. The manipulation of this feature may enhance primer's efficiency to increase the PCR sensitivity and DNA yield.

  11. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;


    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted of ...

  12. Annealing to sequences within the primer binding site loop promotes an HIV-1 RNA conformation favoring RNA dimerization and packaging. (United States)

    Seif, Elias; Niu, Meijuan; Kleiman, Lawrence


    The 5' untranslated region (5' UTR) of HIV-1 genomic RNA (gRNA) includes structural elements that regulate reverse transcription, transcription, translation, tRNA(Lys3) annealing to the gRNA, and gRNA dimerization and packaging into viruses. It has been reported that gRNA dimerization and packaging are regulated by changes in the conformation of the 5'-UTR RNA. In this study, we show that annealing of tRNA(Lys3) or a DNA oligomer complementary to sequences within the primer binding site (PBS) loop of the 5' UTR enhances its dimerization in vitro. Structural analysis of the 5'-UTR RNA using selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) shows that the annealing promotes a conformational change of the 5' UTR that has been previously reported to favor gRNA dimerization and packaging into virus. The model predicted by SHAPE analysis is supported by antisense experiments designed to test which annealed sequences will promote or inhibit gRNA dimerization. Based on reports showing that the gRNA dimerization favors its incorporation into viruses, we tested the ability of a mutant gRNA unable to anneal to tRNA(Lys3) to be incorporated into virions. We found a ∼60% decrease in mutant gRNA packaging compared with wild-type gRNA. Together, these data further support a model for viral assembly in which the initial annealing of tRNA(Lys3) to gRNA is cytoplasmic, which in turn aids in the promotion of gRNA dimerization and its incorporation into virions.

  13. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  14. Medium Caliber Lead-Free Electric Primer. Version 2 (United States)


    OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE (DD-MM-YYYY 25-09-2012 2. REPORT TYPE Final...ii List of Acronyms and Symbols ADN Ammonium Dinitramide Al Aluminum Alex® Trademark name for Argonide’s Exploded Aluminum AN Ammonium...Department of Energy DTRA Defense Threat Reduction Agency E Energy ECP Engineering Change Proposal EHS Environmental Health and Safety EMPI

  15. Report

    Directory of Open Access Journals (Sweden)

    Akin Aydogan


    Full Text Available Introduction. Gossypiboma (GP is a term used to express the mass resulting from forgotten cotton sponge in operations. Rarely, a transmural migration may occur into the gastrointestinal lumen without creating any defect by GP. Laparotomy or endoscopic removal may be required, by the way it can be taken out of the body itself by intestinal ways. In this study, we reported a case of mechanical intestinal obstruction causing GP. Case. The fifty-one-year-old female patient admitted to the emergency department with the complaints of mechanical intestinal obstruction and had a history of open cholecystectomy 20 years ago. There were the findings of intestinal obstruction in abdominal plain radiography and computerized tomography. The sponge that obstructed the lumen completely 40 cm proximal to the ileocecal valve was identified in the laparotomy with the diagnosis of brid ileus. The small intestine was closed over double-fold after removal of sponge. Transmural migration of abdominal-remained sponge was thought to be occurred without creating a defect after cholecystectomy. Postoperatively, the patient was discharged without having any problems at 4th day of hospitalization. Conclusion. Although it is a rare situation in routine clinical practice, GP should be considered as a differential diagnosis in the patients who had a diagnosis of mechanical intestinal obstruction, and laparotomy was applied before. As GP may lead to situations which cause mortality, all precautions should be taken to prevent it.

  16. Effect of 4-MET- and 10-MDP-based primers on resin bonding to titanium. (United States)

    Tsuchimoto, Youhei; Yoshida, Yasuhiro; Mine, Atsushi; Nakamura, Mariko; Nishiyama, Norihiro; Van Meerbeek, Bart; Suzuki, Kazuomi; Kuboki, Takuo


    The purpose of this study was to investigate the effect of a 4-MET- and 10-MDP-based primer on the bond strength of two resin cements (SuperBond C&B, Sun Medical; Panavia Fluoro Cement, Kuraray) to titanium (Ti). Ti plates were treated with six experimental primers consisting of, respectively, 10-MDP and 4-MET in concentrations of 0.1, 1 and 10wt%, or were kept untreated (control). The highest tensile bond strength of Panavia Fluoro Cement to Ti was obtained when the Ti surface was pre-treated with 10wt% 10-MDP and was significantly higher than that when a lower concentrated 10-MDP-based primer or any 4-MET-based primer was used. On the contrary, no significant difference in tensile bond strength of SuperBond C&B was found for the untreated and six pre-treated Ti surfaces, although pre-treatment with each 10-MDP-based primer resulted in a higher tensile bond strength as compared to any 4-MET pre-treatment. Altogether, the data obtained strongly suggest that 10-MDP is effective to improve the adhesive performance of resin to titanium.

  17. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J


    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  18. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode. (United States)

    Françoso, E; Arias, M C


    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode.

  19. Genus-Specific Primers for Study of Fusarium Communities in Field Samples. (United States)

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna


    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  20. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo


    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  1. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans. (United States)

    Lobo, Jorge; Costa, Pedro M; Teixeira, Marcos A L; Ferreira, Maria S G; Costa, Maria H; Costa, Filipe O


    Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g. single class or single order). DNA barcoding marine communities have been comparatively harder to accomplish due to the broad taxonomic diversity and lack of consistently efficient primers. Although some of the so-called "universal" primers have been relatively successful, they still fail to amplify COI-5P of many marine animal groups, while displaying random success even among species within each group. Here we propose a new pair of primers designed to enhance amplification of the COI-5P region in a wide range of marine organisms. Amplification tests conducted on a wide range of marine animal taxa, rendered possible the first-time sequencing of DNA barcodes from eight separated phyla (Annelida, Arthropoda, Chordata, Cnidaria, Echinodermata, Mollusca, Nemertea and Platyhelminthes), comprising a total of 14 classes, 28 orders, 57 families, 68 genus and 76 species. These primers demonstrated to be highly cost-effective, which is of key importance for DNA barcoding procedures, such as for building comprehensive DNA barcode libraries of marine communities, where the processing of a large numbers of specimens from a wide variety of marine taxa is compulsory.

  2. Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality. (United States)

    Lee, Elvina; Khurana, Maninder S; Whiteley, Andrew S; Monis, Paul T; Bath, Andrew; Gordon, Cameron; Ryan, Una M; Paparini, Andrea


    Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination.

  3. Multiplex PCR based on a universal biotinylated primer to generate templates for pyrosequencing. (United States)

    Chen, Zhiyao; Liu, Yunlong; Duan, Wenbang; Ye, Hui; Wu, Haiping; Li, Jinheng; Zhou, Guohua


    Pyrosequencing is a powerful tool widely used in genetic analysis, however template preparation prior to pyrosequencing is still costly and time-consuming. To achieve an inexpensive and labor-saving template preparation for pyrosequencing, we have successfully developed a single-tube multiplex PCR including a pre-amplification and a universal amplification. In the process of pre-amplification, a low concentration of target-specific primers tagged with universal ends introduced universal priming regions into amplicons. In the process of universal amplification, a high concentration of universal primers was used for yielding amplicons with various SNPs of interest. As only a universal biotinylated primer and one step of single-stranded DNA preparation were required for typing multiple SNPs located on different sequences, pyrosequencing-based genotyping became time-saving, labor-saving, sample-saving, and cost-saving. By a simple optimization of multiplex PCR condition, only a 4-plex and a 3-plex PCR were required for typing 7 SNPs related to tamoxifen metabolism. Further study showed that pyrosequencing coupled with an improved multiplex PCR protocol allowed around 30% decrease of either typing cost or typing labor. Considering the biotinylated primer and the optimized condition of the multiplex PCR are independent of SNP locus, it is easy to use the same condition and the identical biotinylated primer for typing other SNPs. The preliminary typing results of the 7 SNPs in 11 samples demonstrated that multiplex PCR-based pyrosequencing could be promising in personalized medicine at a low cost.

  4. The effect of various primers on shear bond strength of zirconia ceramic and resin composite

    Directory of Open Access Journals (Sweden)

    Sasiwimol Sanohkan


    Full Text Available Aims: To determine the in vitro shear bond strengths (SBS of zirconia ceramic to resin composite after various primer treatments. Materials and Methods: Forty zirconia ceramic (Zeno, Wieland Dental specimens (10 mm in diameter and 2 mm thick were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10. Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE, AP (Alloy Primer, Kuraray Medical, and MP (Monobond Plus, Ivoclar Vivadent AG. One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa were analyzed with one-way analysis of variance (ANOVA and the Tukey′s Honestly Significant Difference (HSD test (α = 0.05. Results: Group AP yielded the highest mean and standard deviation (SD value of SBS (16.8 ± 2.5 MPa and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa. The SBS did not differ significantly among the groups (P = 0.079. Conclusions: Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  5. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim


    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online

  6. Evaluation of genotypic diversity of Streptococcus mutans using distinct arbitrary primers

    Directory of Open Access Journals (Sweden)

    Cínthia Pereira Machado Tabchoury


    Full Text Available Streptococcus mutans has been considered one of the main etiological agents of dental caries and the genotypic diversity rather than its salivary counts may be considered as a virulence factor of this bacterium. For genotyping with polymerase chain reaction (PCR with arbitrary primers, several primers have been used in order to improve complexity and specificity of amplicon patterns. Thus, the aim of this study was to evaluate the degree of agreement of genotypic identification among AP-PCR reactions performed with 5 distinct arbitrary primers of S. mutans isolated from saliva. Stimulated saliva was collected from 11 adult volunteers for isolation of S. mutans, and a total of 88 isolates were genotyped with arbitrary primers OPA 02, 03, 05, 13 and 18. Fourteen distinct genotypes were identified in the saliva samples. Most volunteers (9 out of 11 presented only one genotype. The results of the present study suggest that primers OPA 02, 03, 05 and 13 were suitable for genotypic identification of S. mutans isolates of saliva from adult volunteers.

  7. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A


    delayed relative to that of the wild-type virus, molecular tumor analysis indicated that all the primer binding site-modified viruses induce T-cell lymphomas similar to those induced by the wild-type virus in terms of frequencies of genomic rearrangements within the T-cell receptor beta......) in undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary...... to findings from cell culture studies of primer binding site-modified human immunodeficiency virus type 1 and avian retroviruses, our findings were that SL3-3 MLV may stably and efficiently replicate with tRNA primers other than tRNAPro. Although lymphoma induction of the SL3-3 Lys3 mutant was significantly...

  8. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin (United States)

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra


    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. RESULTS Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (Pveneer resin to Co-Cr and Au-Ag-Pd alloys. PMID:26576256

  9. CloneAssistant 1.0: a stand-alone software for automated cloning primer design. (United States)

    Shao, Chaogang; Meng, Yijun; Lv, Shaolei; Zhong, Wei; Wang, Zheyu; Chen, Ming


    "CloneAssistant 1.0" is a stand-alone software compatible with the current Windows operating systems, which can automatically design cloning primers with full consideration of the sequence information of vectors and genes, cloning strategies, the principles of primer design, reading frames, position effects, and enzymatic reaction conditions for users. Five internal XML (extensible markup language) databases [restriction enzymes, plasmids, universal buffers, PCR (polymerase chain reaction) protection bases, and an MCS (multiple cloning site) double digest interference database] were established to serve as the basic support for "CloneAssistant 1.0". The primer pairs designed are sorted according to the difficulty of the follow-up experiments. Once a primer pair is selected by the user, detailed experimental guidance for this primer pair will be provided. In addition, "CloneAssistant 1.0" can be used for restriction map analysis, ORF (open reading frame) finding, sequence alignment and complementary analysis, translation, restriction enzyme and universal buffer queries, and isocaudamer analysis. "CloneAssistant 1.0" makes gene clone design much easier, and it can be freely downloaded from Copyright © 2010 Elsevier B.V. All rights reserved.

  10. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments. (United States)

    Villard, Pierre; Malausa, Thibaut


    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from © 2013 John Wiley & Sons Ltd.

  11. 类群特异性PCR引物设计与评估%Design and evaluation of group-targeted PCR primers

    Institute of Scientific and Technical Information of China (English)

    董声; 俞志明; 宋秀贤; 韩笑天; 曹西华


    本文以真核藻类18S rDNA类群特异性PCR引物的设计与评估为例,详细介绍了如何利用Primrose等一系列程序设计类群特异性PCR引物并评估其敏感性与特异性,并对这一方法的优势与应用类群特异性PCR引物进行群落多样性分析需要注意的问题进行了讨论.%We take the design and evaluation of eukaryotic algae-targeted 18S rDNA PCR primers as an example,to give a step-by-step illustration of how to design and assess group-targeted PCR primers using Primrose and other programs.Then we summarize the advantages of the design & evaluation pipeline by comparing the amplification efficiency of newly designed and previously reported 18S rDNA universal primers.Cautions are also emphasized on using PCR-based strategies to assess community diversity.

  12. Loop-Mediated Isothermal Amplification Test for Trypanosoma gambiense Group 1 with Stem Primers: A Molecular Xenomonitoring Test for Sleeping Sickness (United States)

    Mburugu, Gitonga N.


    The World Health Organization has targeted Human African Trypanosomiasis (HAT) for elimination by 2020 with zero incidence by 2030. To achieve and sustain this goal, accurate and easy-to-deploy diagnostic tests for Gambian trypanosomiasis which accounts for over 98% of reported cases will play a crucial role. Most needed will be tools for surveillance of pathogen in vectors (xenomonitoring) since population screening tests are readily available. The development of new tests is expensive and takes a long time while incremental improvement of existing technologies that have potential for xenomonitoring may offer a shorter pathway to tools for HAT surveillance. We have investigated the effect of including a second set of reaction accelerating primers (stem primers) to the standard T. brucei gambiense LAMP test format. The new test format was analyzed with and without outer primers. Amplification was carried out using Rotorgene 6000 and the portable ESE Quant amplification unit capable of real-time data output. The stem LAMP formats indicated shorter time to results (~8 min), were 10–100-fold more sensitive, and indicated higher diagnostic sensitivity and accuracy compared to the standard LAMP test. It was possible to confirm the predicted product using ESE melt curves demonstrating the potential of combining LAMP and real-time technologies as possible tool for HAT molecular xenomonitoring.

  13. Loop-Mediated Isothermal Amplification Test for Trypanosoma gambiense Group 1 with Stem Primers: A Molecular Xenomonitoring Test for Sleeping Sickness

    Directory of Open Access Journals (Sweden)

    Zablon K. Njiru


    Full Text Available The World Health Organization has targeted Human African Trypanosomiasis (HAT for elimination by 2020 with zero incidence by 2030. To achieve and sustain this goal, accurate and easy-to-deploy diagnostic tests for Gambian trypanosomiasis which accounts for over 98% of reported cases will play a crucial role. Most needed will be tools for surveillance of pathogen in vectors (xenomonitoring since population screening tests are readily available. The development of new tests is expensive and takes a long time while incremental improvement of existing technologies that have potential for xenomonitoring may offer a shorter pathway to tools for HAT surveillance. We have investigated the effect of including a second set of reaction accelerating primers (stem primers to the standard T. brucei gambiense LAMP test format. The new test format was analyzed with and without outer primers. Amplification was carried out using Rotorgene 6000 and the portable ESE Quant amplification unit capable of real-time data output. The stem LAMP formats indicated shorter time to results (~8 min, were 10–100-fold more sensitive, and indicated higher diagnostic sensitivity and accuracy compared to the standard LAMP test. It was possible to confirm the predicted product using ESE melt curves demonstrating the potential of combining LAMP and real-time technologies as possible tool for HAT molecular xenomonitoring.

  14. Mutations in the Primer Grip of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Impair Proviral DNA Synthesis and Virion Maturation (United States)

    Yu, Qiang; Ottmann, Michele; Pechoux, Christine; Le Grice, Stuart; Darlix, Jean-Luc


    This report describes the effects of mutating highly conserved residues in the primer grip domain of human immunodeficiency virus type 1 reverse transcriptase (RT) on virus formation and infectivity. Among a series of RT mutant viruses, three (M230A, L234D, and W239A) were found to be noninfectious or very poorly infectious. Our data indicate that these mutations in RT caused severe defects in proviral DNA synthesis. Interestingly, assembly and maturation of mutant virus M230A were similar to those of the wild type, while mutants L234D and W239A showed impaired maturation. The immature morphology of RT mutants L234D and W239A is due at least in part to premature cleavage of the gag-pol precursor, prior to virion budding, indicating that intracellular stability of Pr160gag-pol is of key importance during virus assembly. PMID:9696874

  15. Novel acsF Gene Primers Revealed a Diverse Phototrophic Bacterial Population, Including Gemmatimonadetes, in Lake Taihu (China)

    DEFF Research Database (Denmark)

    Huang, Yili; Zeng, Yanhua; Lu, Hang


    UNLABELLED: Anoxygenic phototrophs represent an environmentally important and phylogenetically diverse group of organisms. They harvest light using bacteriochlorophyll-containing reaction centers. Recently, a novel phototrophic bacterium, Gemmatimonas phototrophica, belonging to a rarely studied...... a diverse community of phototrophic Gemmatimonadetes forming 30 operational taxonomic units. These species represented 10.5 and 17.3% of the acsF reads in the upper semiaerobic sediment and anoxic sediment, whereas their abundance in the water column was Photosynthesis is one of the most...... fundamental biological processes on Earth. Recently, the presence of photosynthetic reaction centers has been reported from a rarely studied bacterial phylum, Gemmatimonadetes, but almost nothing is known about the diversity and environmental distribution of these organisms. The newly designed acsF primers...

  16. Endocarditis por Brucella abortus: Reporte del primer caso en C.R


    Manuel Antonio Villalobos-Zúñiga; Edith Barrantes-Valverde; Patricia Monge-Ortega


    Paciente masculino de 36 años de edad, proveniente de la zona rural de Costa Rica, con un cuadro clínico de 8 meses de evolución de fiebre, mialgias, artralgias, pérdida de peso y lumbalgia; referido por la detección de un soplo de insuficiencia aórtica. El ecocardiograma reveló endocarditis de la válvula aórtica, y se obtuvieron 4 hemocultivos positivos por Brucella abortus biotipo 3, con serologías negativas por brucelosis. Se inició tratamiento con antibióticos y luego se le realizó un ree...


    Directory of Open Access Journals (Sweden)

    Kenneth Retana-S\\u00E1nchez


    Full Text Available El objetivo del presente trabajo fue brindar información de Panicum repens como potencial maleza en Costa Rica y la taxonomía asociada a esta especie para su correcta identificación. En abril del año 2012 se recibieron en el Laboratorio de Arvenses de la Universidad de Costa Rica y en la Universidad EARTH muestras de una poácea no identificada, procedentes de una orilla de camino frente a una finca ganadera del cantón de San Carlos, Alajuela, Costa Rica. Al analizar las características taxonómicas de las espiguillas y del sistema radical, no concordaban con las especies registradas en el país. Se identificó la especie como Panicum repens L., la cual no se encuentra registrada en Costa Rica, como lo hace constar la ausencia de especímenes en el Herbario Nacional y en el Herbario de la Escuela de Biología de la Universidad de Costa Rica, así como en la literatura especializada en el tema. Se detallan las características taxonómicas de Panicum repens para su identificación.

  18. Building Information Modeling (BIM) Primer. Report 1: Facility Life-Cycle Process and Technology Innovation (United States)


    there plans to maintain the delivered BIM c. What format are the BIM in (Revit, AutoCAD , Bentley) d. What standards are in place for BIM...tively. The solution is to integrate design Web format (DWF) capabilities with AutoCAD software to give customers access to spatial information contained...Structure, Autodesk Revit MEP, Autodesk Navisworks Manage, AutoCAD MEP, Autodesk Civil 3D Project Budget Reasonable, able to achieve by using student

  19. Measuring, Reporting, Verifying. A Primer on MRV for Nationally Appropriate Mitigation Actions

    DEFF Research Database (Denmark)

    Lütken, Søren; Aalders, Edwin; Pretlove, Bente

    discusses institutional arrangements, under the Convention, for providing financing to develop and implement NAMAs. The chapter also briefly discusses the different financial sources for implementing NAMAs, and concludes by explaining the concept of incremental cost in this specific context.......This publication is intended to enable national policy makers and other stakeholders, such as the private sector and technical experts, to acquaint themselves with the concept of NAMA. It aims to provide a comprehensive overview of the Nationally Appropriate Mitigation Action (NAMA) concept...... and enhance the understanding of NAMAs by explaining the underlying decisions of the Conference of the Parties in layman’s terms. The first chapter describes how the concept of NAMA emerged in the context of the negotiations on climate change. The chapter gives an overview of how the concepts of NAMA...

  20. Endocarditis por Brucella abortus: Reporte del primer caso en C.R Brucella abortus Endocarditis

    Directory of Open Access Journals (Sweden)

    Manuel Antonio Villalobos-Zúñiga


    Full Text Available Paciente masculino de 36 años de edad, proveniente de la zona rural de Costa Rica, con un cuadro clínico de 8 meses de evolución de fiebre, mialgias, artralgias, pérdida de peso y lumbalgia; referido por la detección de un soplo de insuficiencia aórtica. El ecocardiograma reveló endocarditis de la válvula aórtica, y se obtuvieron 4 hemocultivos positivos por Brucella abortus biotipo 3, con serologías negativas por brucelosis. Se inició tratamiento con antibióticos y luego se le realizó un reemplazo valvular aórtico; 4 meses después ingresó con dolor torácico que se atribuyó a una oclusión de la arteria descendente anterior, demostrada angiográficamente, por posible embolismo. En la actualidad cursa clínicamente estable con manejo médico para su cardiopatía, sin recaída infecciosa.The case of a 36-year-old patient from a rural area is presented. He came with an 8 month history of fever, myalgias, arthralgias, weight loss and lower back pain; who also had an aortic insufficiency murmur detected. The diagnosis of aortic valve endocarditis was made by echocardiography, and had 4 positive blood cultures for Brucella abortus biotype 3, and negative serologic test for brucellosis. He was started on antibiotics and later on underwent aortic valve replacement, with a late coronary cardioembolism as a complication.

  1. Endocarditis por Brucella abortus: Reporte del primer caso en C.R

    Directory of Open Access Journals (Sweden)

    Manuel Antonio Villalobos-Zúñiga


    Full Text Available Paciente masculino de 36 años de edad, proveniente de la zona rural de Costa Rica, con un cuadro clínico de 8 meses de evolución de fiebre, mialgias, artralgias, pérdida de peso y lumbalgia; referido por la detección de un soplo de insuficiencia aórtica. El ecocardiograma reveló endocarditis de la válvula aórtica, y se obtuvieron 4 hemocultivos positivos por Brucella abortus biotipo 3, con serologías negativas por brucelosis. Se inició tratamiento con antibióticos y luego se le realizó un reemplazo valvular aórtico; 4 meses después ingresó con dolor torácico que se atribuyó a una oclusión de la arteria descendente anterior, demostrada angiográficamente, por posible embolismo. En la actualidad cursa clínicamente estable con manejo médico para su cardiopatía, sin recaída infecciosa.

  2. Primer reporte de Phoneutrismo en el Perú: Presentación de dos casos

    Directory of Open Access Journals (Sweden)

    Ciro Maguiña Vargas


    Full Text Available Se presentan dos casos de mordedura de la araña Phoneutria spp. atendidos en el Hospital Nacional Cayetano Heredia (HNCH en los años 2005 y 2008. En ambos casos la mordedura fue de sintomatología leve y de buena evolución, y se debió a un accidente laboral en personas que trabajan en mercados de venta de fruta al extraer plátanos de cajas procedentes de Tingo María (Selva central. El phoneutrismo es un accidente por arácnidos poco común; sin embargo, sería un problema importante de salud pública sobretodo en las zonas rurales en donde el comercio de plátanos es una de las principales fuente de ingresos de la población. El personal médico no conoce del todo a esta araña, así como la clínica de sus mordeduras, por ello presentamos estos casos que permitirán reconocer estos accidentes para su adecuado manejo y control. (Rev. Med Hered. 2008;19:128-133

  3. Mixoploidía Diploide - Tetraploide: Primer Reporte en Nuestro Medio

    Directory of Open Access Journals (Sweden)

    Héctor Pimentel Benítez


    Full Text Available Se presenta un caso de mixoploidía diploide-tetraploide, con ligeros signos clínicos pertenecientes a esta condición de la poliploidía en humanos. Estudios citogenéticos a partir de cultivos de sangre periférica y fibroblastos de piel permitieron establecer la fórmula cromosómica 46,XX/92XXXX en la paciente. Se realiza correlación fenotipocariotipo, así como su presentación clínica. Este estudio de casos ayuda a enriquecer el conocimiento sobre esta condición, contribuye a su mejor diagnóstico y a dilucidar la etiología de síndromes malformativos inespecíficos.A case of diploid-tetraploid mixoploidy with mild clinical signs correspondoing to this condition of polyploidy in humans is presented. Cytogenetic studies based on cultures of peripheral blood and fibroblasts of skin allowed to obtain the 46,XX/92XXXX chromosomic formula in the patient. The phenotype-kariotype correlation was stablished and its clinical presentation was made. This study of cases helps to improve the knowledge about this condition, and it also contributes to have a better diagnosis and to dilucidate the etiology of unspecific syndromes of malformation.

  4. New Primers Targeting Full-Length Ciliate 18S rRNA Genes and Evaluation of Dietary Effect on Rumen Ciliate Diversity in Dairy Cows. (United States)

    Zhang, Jun; Zhao, Shengguo; Zhang, Yangdong; Sun, Peng; Bu, Dengpan; Wang, Jiaqi


    Analysis of the full-length 18S rRNA gene sequences of rumen ciliates is more reliable for taxonomical classification and diversity assessment than the analysis of partial hypervariable regions only. The objective of this study was to develop new oligonucleotide primers targeting the full-length 18S rRNA genes of rumen ciliates, and to evaluate the effect of different sources of dietary fiber (corn stover or a mixture of alfalfa hay and corn silage) and protein (mixed rapeseed, cottonseed, and/or soybean meals) on rumen ciliate diversity in dairy cows. Primers were designed based on a total of 137 previously reported ciliate 18S rRNA gene sequences. The 3'-terminal sequences of the newly designed primers, P.1747r_2, P.324f, and P.1651r, demonstrated >99% base coverage. Primer pair D (P.324f and P.1747r_2) was selected for the cloning and sequencing of ciliate 18S rRNA genes because it produced a 1423-bp amplicon, and did not amply the sequences of other eukaryotic species, such as yeast. The optimal species-level cutoff value for distinguishing between the operational taxonomic units of different ciliate species was 0.015. The phylogenetic analysis of full-length ciliate 18S rRNA gene sequences showed that distinct ciliate profiles were induced by the different sources of dietary fiber and protein. Dasytricha and Entodinium were the predominant genera in the ruminal fluid of dairy cattle, and Dasytricha was significantly more abundant in cows fed with corn stover than in cows fed with alfalfa hay and corn silage.

  5. Temas de Física para Ingeniería: Primer principio de la termodinámica


    Beléndez Vázquez, Augusto


    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  6. Demonstration and Validation of a Replacement Alternative to the Chromate Wash Primer DOD-P-15328D (United States)


    system. The current wash primer is a low-solids, solvent-based polyvinyl butyral that contains phosphoric acid and zinc chromate that promotes adhesion...prior to the application of an epoxy primer/polyurethane topcoat CARC system. The current wash primer is a low-solids, solvent-based polyvinyl ... butyral that contains phosphoric acid and zinc chromate that promotes adhesion and minimizes corrosion. This coating contains large amounts of volatile

  7. Temas de Física para Ingeniería: Primer principio de la termodinámica


    Beléndez Vázquez, Augusto


    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  8. Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.


    Pena, S D; Barreto, G.; Vago, A. R.; De Marco, L; Reinach,F. C.; Dias Neto, E; Simpson, A J


    Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites wi...

  9. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine


    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer......-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new...

  10. Guidelines A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Word, Charlotte J.; Bilyard, Gordon R.


    The purpose of this report is to help scientists communicate with stakeholders and the public (primarily nonscientists) about fundamental science research. The primary audience for this report is scientists involved in the Natural and Accelerated Bioremediation Research (NABIR) program of the U.S. Department of Energy. However, the information and insights in the report that are not program-specific should be helpful to scientists in other fundamental science research programs. The report first discusses why scientists should talk to stakeholders and the public, and the challenges associated with discussing the NABIR program. It is observed that communication initiatives can be characterized by three factors: relationships in the social environment, views of what constitutes communication, and accepted forms of communication practices and products. With a focus on informal science communication, recent efforts to gauge public understanding of science and the factors that affect public trust of science institutions are discussed. The social bases for scientist-nonscientist interactions are then examined, including possible sources of distrust and difficulties in transferring discussions of fundamental science from classrooms (where most of the public first learns about science) to public forums. Finally, the report contains specific suggestions for preparing, meeting, and following up on public interactions with stakeholders and the public, including themes common to public discussions of NABIR science and features of scientist-nonscientist interactions observed in interpersonal, small group, and large group interactions between NABIR scientists and stakeholders. A Quick Preparation Guide for Meeting NABIR Stakeholders is provided immediately following the Summary. It condenses some of the information and advice found in the text of the report.

  11. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers. (United States)

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin


    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  12. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia. (United States)

    Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed


    Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  13. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan


    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  14. Kisspeptin: a new neuronal target of primer pheromones in the control of reproductive function in mammals. (United States)

    Jouhanneau, Mélanie; Szymanski, Laura; Martini, Mariangela; Ella, Arsène; Keller, Matthieu


    Pheromones are known to trigger either short-term behavioral responses, usually referred to as "releaser effects", or more long-term physiological changes, known as "primer effects", which especially affect reproductive function at the level of the gonadotrope axis. The precise mechanisms through which pheromones interact with the gonadotrope axis in the hypothalamus is not fully known. We propose that the neuropeptide Kisspeptin, could be a specific target of primer pheromones, allowing these pheromones to modulate the gonadotrope axis and GnRH activity. This emerging hypothesis is discussed in the context of puberty acceleration in female mice and the male effect in female ungulates (sheep or goat). These examples have been chosen to illustrate the diversity of the reproductive contexts in mammals and potential mechanisms affected by primer effects at the level of the gonadotrope axis. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Novel Primers From Informative Nuclear Loci for Louse Molecular Phylogenetics (Insecta: Phthiraptera). (United States)

    Sweet, Andrew D; Allen, Julie M; Johnson, Kevin P


    While parasitic lice (Insecta: Phthiraptera) have historically been an important model taxon for understanding host-parasite coevolution, very few molecular markers have been developed for phylogenetic analysis. The current markers are insufficient to resolve many of the deeper nodes in this group; therefore, sequences from additional genetic loci are necessary. Here, we design primers targeting several nuclear protein coding genes based on a complete genome and transcriptome of Pediculus humanus L. plus transcriptomes and modest coverage genomic data from five genera of avian feather lice. These primers were tested on 32 genera of avian feather lice (Ischnocera), including multiple species within some genera. All of the new primer combinations produced sequences for the majority of the genera and had similar or higher divergences than the most widely used nuclear protein-coding gene in lice, EF-1α. These results indicate that these new loci will be useful in resolving phylogenetic relationships among parasitic lice.

  16. Analysis of Two Chinese Yak(Bos grunniens) Population Using Bovine Microsatellite Primers

    Institute of Scientific and Technical Information of China (English)

    Wang Minqiang; S.Weigend; A.Barre-Dirie; J.W.Carnwath; Lou Zhonglin; H.Niemann


    Two Chinese domestic yak populations representing the Plateau type and the Huanhu Alpine type were analysed with 12 bovine microsatellite primers. All primer pairs functioned in the yak genome and polymorphism was found at all loci. The allele size ranges and frequencies of the two yak populations were similar and there was considerable overlap with the allele size ranges observed in cattle. Data for European cattle breeds was obtained from the Cattle Diversity Database(CaDBase)to interpret the heterozygosity and genetic distance estimates in yak populations. Heterozygosity estimated for the two yak populations was comparable to that of European cattle while Nei's Genetic Distance DA between the two yak populations was less than distances between the most closely related German cattle breeds. Bovine microsatellite primers proved to be a valuable tool for characterization of yak populations.

  17. Efficient newly designed primers for the amplification and sequencing of bird mitochondrial genomes. (United States)

    Amer, Sayed A M; Ahmed, Mohamed Mohamed; Shobrak, Mohammed


    In the present study, 27 mitochondrial genomes of diverse avian supra-orders were collected from the Genbank database and their genes were aligned separately. From the alignments, the conserved sequences were selected to design novel conserved primers for amplification and sequencing of the different mitochondrial genes. The reproducibility of these primers was tested in the amplification and sequencing of diverse avian supra-order mitochondrial genomes and was confirmed. This method helped in designing a new set of primers to accelerate both the amplification and the sequencing of bird mitogenomes. It also aids in building mitogenome markers in studying the genetic framework of endemic birds as a preliminary strategy for conservation management of them.

  18. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing. (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo


    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  19. Effect of primers containing copper salts on bonding of TBB resin to enamel. (United States)

    Taira, Y; Imai, Y


    The effect of primers containing copper salts on adhesion between enamel and stainless steel was studied in a trial to improve durability of TBB type resin cements. Bovine enamel surfaces were treated with 10% phosphoric acid, then with acetone primers containing copper salts, and finally bonded with TBB resins. Tensile strengths of the bonded specimens were measured after thermocycling testing in water and compared with those obtained for commercial composite type resin cements. A combination of a primer containing copper (II) methacryloyloxyethyl succinate and 4-META/MMA-TBB resin was most effective in improving the durability, and superior to the commercial resin cements. The mean and lowest bond strength values of 21 MPa and about 12 MPa, respectively, were retained after 2,000 thermocycles.

  20. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;


    One of the most promising techniques for typing of multiple single-nucleotide polymorphism (SNP) is detection of single base extension primers (SBE) by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). We present a new MALDI-TOF MS protocol for typing...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal......, and the potential use of MALDI-TOF MS for SNP typing is discussed....

  1. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik


    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  2. Phosphatizing of Mg particles to improve the protective performance of Mg-rich primer on A2024 Al alloy (United States)

    Wang, Jianguo; Zuo, Yu; Tang, Yuming; Lu, Xiangyu


    Mg-rich primer as a new type protective coating provides cathodic protection for Al alloy. In this paper, a kind of phosphatizing surface treatment on Mg particles was studied in order to improve the protective performance of Mg-rich primer. After treated with phosphoric acid, a protective magnesium phosphate layer was formed on the surface of Mg particles, which had no negative influence on the cathodic protection of the Mg-rich primer for Al alloy. The coating resistance of the treated Mg-rich primer was bigger than that of untreated primer, meanwhile the coating capacitance of the treated Mg-rich primer was smaller than that of untreated primer, suggesting that the barrier effect of the primer was improved and the lifetime was extended. The magnesium phosphate layer could reduce the consumption rate of Mg particles. Meanwhile, the phosphate radicals transported to Al alloy substrate to form a product layer composed of magnesium phosphate and aluminum phosphate on the substrate surface, which decreased the corrosion rate of Al alloy and improved the protective performance of the primer.

  3. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers (United States)

    Danford, M. D.; Mendrek, M. J.


    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  4. Confronting two-pair primer design for enzyme-free SNP genotyping based on a genetic algorithm

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh


    Full Text Available Abstract Background Polymerase chain reaction with confronting two-pair primers (PCR-CTPP method produces allele-specific DNA bands of different lengths by adding four designed primers and it achieves the single nucleotide polymorphism (SNP genotyping by electrophoresis without further steps. It is a time- and cost-effective SNP genotyping method that has the advantage of simplicity. However, computation of feasible CTPP primers is still challenging. Results In this study, we propose a GA (genetic algorithm-based method to design a feasible CTPP primer set to perform a reliable PCR experiment. The SLC6A4 gene was tested with 288 SNPs for dry dock experiments which indicated that the proposed algorithm provides CTPP primers satisfied most primer constraints. One SNP rs12449783 in the SLC6A4 gene was taken as an example for the genotyping experiments using electrophoresis which validated the GA-based design method as providing reliable CTPP primer sets for SNP genotyping. Conclusions The GA-based CTPP primer design method provides all forms of estimation for the common primer constraints of PCR-CTPP. The GA-CTPP program is implemented in JAVA and a user-friendly input interface is freely available at

  5. Confronting two-pair primer design for enzyme-free SNP genotyping based on a genetic algorithm. (United States)

    Yang, Cheng-Hong; Cheng, Yu-Huei; Chuang, Li-Yeh; Chang, Hsueh-Wei


    Polymerase chain reaction with confronting two-pair primers (PCR-CTPP) method produces allele-specific DNA bands of different lengths by adding four designed primers and it achieves the single nucleotide polymorphism (SNP) genotyping by electrophoresis without further steps. It is a time- and cost-effective SNP genotyping method that has the advantage of simplicity. However, computation of feasible CTPP primers is still challenging. In this study, we propose a GA (genetic algorithm)-based method to design a feasible CTPP primer set to perform a reliable PCR experiment. The SLC6A4 gene was tested with 288 SNPs for dry dock experiments which indicated that the proposed algorithm provides CTPP primers satisfied most primer constraints. One SNP rs12449783 in the SLC6A4 gene was taken as an example for the genotyping experiments using electrophoresis which validated the GA-based design method as providing reliable CTPP primer sets for SNP genotyping. The GA-based CTPP primer design method provides all forms of estimation for the common primer constraints of PCR-CTPP. The GA-CTPP program is implemented in JAVA and a user-friendly input interface is freely available at

  6. Design and implementation of degenerate microsatellite primers for the mammalian clade.

    Directory of Open Access Journals (Sweden)

    Emmanuel Buschiazzo

    Full Text Available Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1 identify conserved microsatellite loci from a multiple genome alignments, (2 design degenerate primer pairs, with (3 a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ~1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120-160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced.

  7. Oligonucleotide primers for targeted amplification of single-copy nuclear genes in apocritan Hymenoptera.

    Directory of Open Access Journals (Sweden)

    Gerrit Hartig

    Full Text Available BACKGROUND: Published nucleotide sequence data from the mega-diverse insect order Hymenoptera (sawflies, bees, wasps, and ants are taxonomically scattered and still inadequate for reconstructing a well-supported phylogenetic tree for the order. The analysis of comprehensive multiple gene data sets obtained via targeted PCR could provide a cost-effective solution to this problem. However, oligonucleotide primers for PCR amplification of nuclear genes across a wide range of hymenopteran species are still scarce. FINDINGS: Here we present a suite of degenerate oligonucleotide primer pairs for PCR amplification of 154 single-copy nuclear protein-coding genes from Hymenoptera. These primers were inferred from genome sequence data from nine Hymenoptera (seven species of ants, the honeybee, and the parasitoid wasp Nasonia vitripennis. We empirically tested a randomly chosen subset of these primer pairs for amplifying target genes from six Hymenoptera, representing the families Chrysididae, Crabronidae, Gasteruptiidae, Leucospidae, Pompilidae, and Stephanidae. Based on our results, we estimate that these primers are suitable for studying a large number of nuclear genes across a wide range of apocritan Hymenoptera (i.e., all hymenopterans with a wasp-waist and of aculeate Hymenoptera in particular (i.e., apocritan wasps with stingers. CONCLUSIONS: The amplified nucleotide sequences are (a with high probability from single-copy genes, (b easily generated at low financial costs, especially when compared to phylogenomic approaches, (c easily sequenced by means of an additionally provided set of sequencing primers, and (d suitable to address a wide range of phylogenetic questions and to aid rapid species identification via barcoding, as many amplicons contain both exonic and fast-evolving intronic nucleotides.

  8. Establishment of Quantitative Analysis Method for Genetically Modified Maize Using a Reference Plasmid and Novel Primers (United States)

    Moon, Gi-Seong; Shin, Weon-Sun


    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×101~105 copies of pGMmaize and the R2 values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods. PMID:24471096

  9. Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs. (United States)

    Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao


    Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

  10. The U.S. Militarys Force Structure: A Primer (United States)


    nuclear weapons, and they are deployed in dispersed, hardened silos that would require an adversary to use a relatively large number of nuclear...recommendations. Adam Talaber of CBO’s National Security Division prepared the report with guidance from David Mosher and Matthew Goldberg. David Arthur

  11. A primer on rapid prototyping of genomic databases in Prolog

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Kaoru; Smith, C.L. [Lawrence Berkeley Lab., CA (United States); Overbeek, R. [Argonne National Lab., IL (United States). Mathematics and Computer Science Div.


    This report presents a tutorial on how one might create an integrated database of genomic information. We outline the required steps for implementation, give a brief introduction to Prolog, and discuss the query facility supported by our system. Our goal is to enable researchers to being constructing their own biological information system.

  12. Alteraciones del primer radio en el plano sagital. Tratamiento ortopodológico


    Prats Climent, Baldiri; Alcorisa Rodero, Olga; Verdaguer Sanmartí, Josefina; Vázquez Amela, F. Xavier (Francesc Xavier); Vergés Salas, Carles; Vila Espinalt, Rosa M.


    Las alteraciones posicionales del primer radio en un plano sagital, dorsiflexionado o plantarflexionado, son causas de alteraciones en el funcionamiento de la articulación subastragalina y en consecuencia de la posición resultado del retropié. Esta relación causa-efecto depende de la movilidad (flexible, semiflexible o rígido) y de la adaptación del primer radio al suelo en la fase de apoyo total durante la marcha. Dependiendo de ello el tratamiento ortopodólogico será diferente, ...

  13. El arte de cozina de Diego Granado (1599), primer libro de cocina en lengua castellana


    Redondo Buey, Patricia


    El Siglo de Oro es un periodo histórico que abarca desde el Renacimiento del siglo XVI hasta el Barroco del siglo XVII, durante el cual se publicó el primer tratado gastronómico de España. En este trabajo científico haremos un estudio meticuloso y minucioso sobre lo que se considera el primer recetario del Siglo de Oro español y así analizar las fuentes primarias de la cocina española, cosa que nunca se había hecho.

  14. Chrome-Free Paint Primer for Zn/Ni Plated High-Strength Steel (Briefing Charts) (United States)


    Chrome -Free Paint Primer for Zn/Ni Plated High- Strength Steel 11-19-14 Presentation at ASETSDefense 2014 George Zafiris Team: Mark Jaworowski, Mike...AND SUBTITLE Chrome -Free Paint Primer for Zn/Ni Plated High-Strength Steel 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6...AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) United Technologies Research

  15. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.;


    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted...

  16. El arte de cozina de Diego Granado (1599), primer libro de cocina en lengua castellana


    Redondo Buey, Patricia


    El Siglo de Oro es un periodo histórico que abarca desde el Renacimiento del siglo XVI hasta el Barroco del siglo XVII, durante el cual se publicó el primer tratado gastronómico de España. En este trabajo científico haremos un estudio meticuloso y minucioso sobre lo que se considera el primer recetario del Siglo de Oro español y así analizar las fuentes primarias de la cocina española, cosa que nunca se había hecho.

  17. Development of species-specific primers for detection of Streptococcus mutans in mixed bacterial samples


    Chen, Zhou; Saxena, Deepak; Caufield, Page W.; Ge, Yao; Wang, Minqi; Li, Yihong


    Streptococcus mutans is the major microbial pathogen associated with dental caries in children. The objectives of this study were to design and evaluate species-specific primers for the identification of S. mutans. Validation of the best primer set, Sm479F/R, was performed using 7 S. mutans reference strains, 48 ATCC non-S. mutans strains, 92 S. mutans clinical isolates, DNA samples of S. mutans-S. sobrinus or S. mutans-S. sanguinis, and mixed bacterial DNA of saliva samples from 33 18-month-...

  18. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti


    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  19. Selection strategy and the design of hybrid oligonucleotide primers for RACE-PCR: cloning a family of toxin-like sequences from Agelena orientalis

    Directory of Open Access Journals (Sweden)

    Lipkin Alexey


    Full Text Available Abstract Background the use of specific but partially degenerate primers for nucleic acid hybridisations and PCRs amplification of known or unknown gene families was first reported well over a decade ago and the technique has been used widely since then. Results here we report a novel and successful selection strategy for the design of hybrid partially degenerate primers for use with RT-PCR and RACE-PCR for the identification of unknown gene families. The technique (named PaBaLiS has proven very effective as it allowed us to identify and clone a large group of mRNAs encoding neurotoxin-like polypeptide pools from the venom of Agelena orientalis species of spider. Our approach differs radically from the generally accepted CODEHOP principle first reported in 1998. Most importantly, our method has proven very efficient by performing better than an independently generated high throughput EST cloning programme. Our method yielded nearly 130 non-identical sequences from Agelena orientalis, whilst the EST cloning technique yielded only 48 non-identical sequences from 2100 clones obtained from the same Agelena material. In addition to the primer design approach reported here, which is almost universally applicable to any PCR cloning application, our results also indicate that venom of Agelena orientalis spider contains a much larger family of related toxin-like sequences than previously thought. Conclusion with upwards of 100,000 species of spider thought to exist, and a propensity for producing diverse peptide pools, many more peptides of pharmacological importance await discovery. We envisage that some of these peptides and their recombinant derivatives will provide a new range of tools for neuroscience research and could also facilitate the development of a new generation of analgesic drugs and insecticides.

  20. The promotion of wellbeing: A primer for policymakers


    Rablen, MD


    There is growing international interest among policymakers in the promotion of wellbeing as an objective of public policy. Recent advances in the definition and measurement of wellbeing are giving rise to an increasingly detailed picture of the factors that determine how people think and feel about their lives. Patterns in reported wellbeing show markedly different development over time to measures of GDP per capita and life expectancy often used as proxies for wellbeing by policymaker...