WorldWideScience

Sample records for bovine vaccinia outbreaks

  1. One more piece in the VACV ecological puzzle: could peridomestic rodents be the link between wildlife and bovine vaccinia outbreaks in Brazil?

    Directory of Open Access Journals (Sweden)

    Jônatas S Abrahão

    Full Text Available BACKGROUND: Despite the fact that smallpox eradication was declared by the World Health Organization (WHO in 1980, other poxviruses have emerged and re-emerged, with significant public health and economic impacts. Vaccinia virus (VACV, a poxvirus used during the WHO smallpox vaccination campaign, has been involved in zoonotic infections in Brazilian rural areas (Bovine Vaccinia outbreaks - BV, affecting dairy cattle and milkers. Little is known about VACV's natural hosts and its epidemiological and ecological characteristics. Although VACV was isolated and/or serologically detected in Brazilian wild animals, the link between wildlife and farms has not yet been elucidated. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we describe for the first time, to our knowledge, the isolation of a VACV (Mariana virus - MARV from a mouse during a BV outbreak. Genetic data, in association with biological assays, showed that this isolate was the same etiological agent causing exanthematic lesions observed in the cattle and human inhabitants of a particular BV-affected area. Phylogenetic analysis grouped MARV with other VACV isolated during BV outbreaks. CONCLUSION/SIGNIFICANCE: These data provide new biological and epidemiological information on VACV and lead to an interesting question: could peridomestic rodents be the link between wildlife and BV outbreaks?

  2. Evaluating anti-Orthopoxvirus antibodies in individuals from Brazilian rural areas prior to the bovine vaccinia era.

    Science.gov (United States)

    Figueiredo, Poliana de Oliveira; Silva-Fernandes, André Tavares da; Mota, Bruno Eduardo Fernandes; Costa, Galileu Barbosa; Borges, Iara Apolinário; Ferreira, Paulo César Peregrino; Abrahão, Jônatas Santos; Braga, Erika Martins; Kroon, Erna Geessien; Trindade, Giliane de Souza

    2015-09-01

    Vaccinia virus naturally circulates in Brazil and is the causative agent of a zoonotic disease known as bovine vaccinia (BV). We retrospectively evaluated two populations from the Amazon and Southeast Regions. BV outbreaks had not been reported in these regions before sample collection. Neutralising antibodies were found in 13 individuals (n = 132) with titres ranging from 100 ≥ 6,400 neutralising units/mL. Univariate analysis identified age and vaccination as statistically significant risk factors in individuals from the Southeast Region. The absence of detectable antibodies in vaccinated individuals raises questions about the protection of smallpox vaccine years after vaccination and reinforces the need for surveillance of Orthopoxvirus in Brazilian populations without evidence of previous outbreaks.

  3. Evaluating anti-Orthopoxvirus antibodies in individuals from Brazilian rural areas prior to the bovine vaccinia era

    Directory of Open Access Journals (Sweden)

    Poliana de Oliveira Figueiredo

    2015-09-01

    Full Text Available Vaccinia virus naturally circulates in Brazil and is the causative agent of a zoonotic disease known as bovine vaccinia (BV. We retrospectively evaluated two populations from the Amazon and Southeast Regions. BV outbreaks had not been reported in these regions before sample collection. Neutralising antibodies were found in 13 individuals (n = 132 with titres ranging from 100 ≥ 6,400 neutralising units/mL. Univariate analysis identified age and vaccination as statistically significant risk factors in individuals from the Southeast Region. The absence of detectable antibodies in vaccinated individuals raises questions about the protection of smallpox vaccine years after vaccination and reinforces the need for surveillance of Orthopoxvirus in Brazilian populations without evidence of previous outbreaks.

  4. Outbreaks of vesicular disease caused by Vaccinia virus in dairy cattle from Goiás State, Brazil (2010-2012

    Directory of Open Access Journals (Sweden)

    Fabiano J.F. de Sant'Ana

    2013-07-01

    Full Text Available Cases of vesicular and exanthematic disease by Vaccinia virus (VACV have been reported in dairy herds of several Brazilian regions, occasionally also affecting humans. The present article describes eight outbreaks of vesicular disease caused by VACV in dairy herds of six counties of Goiás state, Midwestern Brazil (2010-2012, involving a total of 122 cows, 12 calves and 11 people. Dairy cows (3 to 9 years old were affected in all cases and calves (2 to 9 months old were affected in five outbreaks, presenting oral lesions. The morbidity ranged between 8 and 100% in cows, and 1.5 to 31% in calves. In the cows, the clinical signs started with vesicles (2-7mm, painful and coalescent papules (3-8 mm, which resulted in ulcers (5-25mm and scabs in teats, and, occasionally, in the muzzle. The clinical course lasted from 16 to 26 days. The histopathology of bovine skin samples revealed superficial perivascular inflammatory infiltrate of lymphocytes, plasma cells, neutrophils, macrophages and multifocal areas of acanthosis, spongiosis, hipergranulosis and parakeratotic or orthokeratotic hyperkeratosis with adjacent focally extensive ulcers. Eosinophilic inclusion bodies were noted in the cytoplasm of the keratinocytes. PCR to vgf gene of Orthopoxvirus was positive in samples collected from all outbreaks, and in some cases, genomic VACV sequences were identified by nucleotide sequencing of the PCR amplicons. Infectious virus was isolated in cell culture from scabs from one outbreak. Antibodies to Orthopoxvirus were detected in at least 3 or 4 animals in most outbreaks, by ELISA (outbreaks 1, 2, 3, 4, 5 and 7 or virus-neutralization (outbreak 6. Neutralizing titers ranging from 8 to 64 in outbreak 6. In all outbreaks, VACV infection was suspected based on the clinical and pathological findings and it was confirmed by laboratory tests. Upon the etiological confirmation, other agents associated with vesicular disease were discarded. In all outbreaks, at least

  5. Dairy production practices and associated risks for bovine vaccinia exposure in cattle, Brazil

    Directory of Open Access Journals (Sweden)

    I.A. Borges

    2017-11-01

    Full Text Available A cross-sectional serosurvey was performed to identify environmental features or practices of dairy farms associated with risk for exposure to vaccinia-like viruses in dairy cattle in Brazil. Sera from 103 cows from 18 farms in Minas Gerais state were examined for Orthopoxvirus-neutralizing antibodies. A database of 243 binary or multiple-selection categorical variables regarding the physical features and surrounding ecology of each property was obtained. Thirteen of 46 presumptive predictor variables were found to be significantly associated with Orthopoxvirus serostatus by univariate logistic regression methods. Use of teat sanitizer and having felids on the property were independently associated with virus exposure by multivariable analysis. Rodents have long been suspected of serving as maintenance reservoirs for vaccinia-like viruses in Brazil. Therefore, domestic felids are not only effective predators of small rodent pests, but also their urine can serve as a deterrent to rodent habitation in buildings such as stables and barns. These results corroborate previous evidence of the high significance of rodents in the Vaccinia virus transmission cycle, and they also raise questions regarding the common use of teat sanitizers in dairy production areas.

  6. Horizontal study of vaccinia virus infections in an endemic area: epidemiologic, phylogenetic and economic aspects.

    Science.gov (United States)

    Assis, Felipe L; Franco-Luiz, Ana Paula M; Paim, Luis M; Oliveira, Graziele P; Pereira, Alexandre F; de Almeida, Gabriel M F; Figueiredo, Leandra B; Tanus, Adriano; Trindade, Giliane S; Ferreira, Paulo P; Kroon, Erna G; Abrahão, Jônatas S

    2015-11-01

    Vaccinia virus (VACV), the etiological agent of bovine vaccinia (BV), is widespread in Brazil and present in most of the milk-producing regions. We conducted a horizontal study of BV in Bahia, a state of Brazil in which the production of milk is increasing. During 2011, human and bovine clinical samples were collected during outbreaks for BV diagnosis, virus isolation and molecular analysis. We collected data for epidemiological inferences. Vaccinia virus was detected in 87.7% of the analyzed outbreaks, highlighting the effective circulation of VACV in Bahia. The molecular data showed the spreading of group 1 Brazilian VACV to Bahia. We observed a seasonal profile of BV, with its peak in the drier and cooler season. Manual milking was observed in 96 % of the visited properties, showing its importance to viral spread in herds. Under-notification of BV, ineffective animal trade surveillance, and bad milking practices have contributed to the spread of VACV in Brazil.

  7. Extensive sequence divergence among bovine respiratory syncytial viruses isolated during recurrent outbreaks in closed herds

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Tjørnehøj, Kirsten; Viuff, B.

    2000-01-01

    The nucleotides coding for the extracellular part of the G glycoprotein and the full SH protein of bovine respiratory syncytial virus (BRSV) were sequenced from viruses isolated from numerous outbreaks of BRSV infection. The isolates included viruses isolated from the same herd (closed dairy farms......, however, the most likely explanation was that BRSV was (re)introduced into the herd prior to each new outbreak These findings are highly relevant for the understanding of the transmission patterns of BRSV among calves and human respiratory syncytial virus among humans....... and veal calf production units) in different years and from all confirmed outbreaks in Denmark within a short period. The results showed that identical viruses were isolated within a herd during outbreaks and that viruses from recurrent infections varied by up to 11% in sequence even in closed herds...

  8. Occurrence and phylogenetic analysis of bovine respiratory syncytial virus in outbreaks of respiratory disease in Norway.

    Science.gov (United States)

    Klem, Thea B; Rimstad, Espen; Stokstad, Maria

    2014-01-14

    Bovine respiratory syncytial virus (BRSV) is one of the major pathogens involved in the bovine respiratory disease (BRD) complex. The seroprevalence to BRSV in Norwegian cattle herds is high, but its role in epidemics of respiratory disease is unclear. The aims of the study were to investigate the etiological role of BRSV and other respiratory viruses in epidemics of BRD and to perform phylogenetic analysis of Norwegian BRSV strains. BRSV infection was detected either serologically and/or virologically in 18 (86%) of 21 outbreaks and in most cases as a single viral agent. When serology indicated that bovine coronavirus and/or bovine parainfluenza virus 3 were present, the number of BRSV positive animals in the herd was always higher, supporting the view of BRSV as the main pathogen. Sequencing of the G gene of BRSV positive samples showed that the current circulating Norwegian BRSVs belong to genetic subgroup II, along with other North European isolates. One isolate from an outbreak in Norway in 1976 was also investigated. This strain formed a separate branch in subgroup II, clearly different from the current Scandinavian sequences. The currently circulating BRSV could be divided into two different strains that were present in the same geographical area at the same time. The sequence variations between the two strains were in an antigenic important part of the G protein. The results demonstrated that BRSV is the most important etiological agent of epidemics of BRD in Norway and that it often acts as the only viral agent. The phylogenetic analysis of the Norwegian strains of BRSV and several previously published isolates supported the theory of geographical and temporal clustering of BRSV.

  9. An outbreak of bovine trypanosomiasis in the Blue Nile State, Sudan

    Directory of Open Access Journals (Sweden)

    Nakamura Ichiro

    2011-05-01

    Full Text Available Abstract Background In this paper, we report an outbreak of bovine trypanosomiasis in Kurmuk District, Blue Nile State, Sudan that involved an infection with four Trypanosoma species in cattle. The outbreak occurred in June 2010 when indigenous cattle, mainly Kenana and Fulani breed types, crossed the national Sudanese border to Ethiopia and returned. A veterinarian was notified of massive deaths in the cattle populations that recently came from Ethiopia. All animals involved in the outbreak were from the nomadic Fulani group and resident local cattle were not infected and no death has been reported among them. A total of 210 blood samples were collected from the ear vein of cattle. A few samples were also collected from other domestic animals species. Parasitological examinations including hematocrit centrifugation techniques (HCT and Giemsa-stained thin blood films were carried out. ITS1-PCR, which provides a multi-species-specific diagnosis in a single PCR, was performed. Findings Parasitological examinations revealed that 43% (91/210 of the affected cattle population was infected with two morphologically distinct trypanosomes. Seventy animals (33.3% were infected with T. vivax and twenty one (10% with T. congolense. In contrast, ITS1-PCR was able to identify four Trypanosoma species namely T. vivax, T. congolense, T. simiae and T. brucei in 56.7% (80/141. T. brucei showed the highest prevalence of 36.9% (52/141 and the lowest 19% (27/141 was displayed by T. congolense. Furthermore, and because ITS1-PCR could not differentiate between T. brucei subspecies, serum resistance-associated (SRA gene based PCR was used to detect the human T. brucei rhodesiense in T. brucei positive samples. None of the samples was shown positive for T. b. rhodesiense. The identity of the 400 bp PCR product originating from T. simiae, was further confirmed by sequencing and subsequent phylogenetic analysis. Conclusions The outbreak of bovine trypanosomiasis occurred

  10. Human vaccinia-like virus outbreaks in São Paulo and Goiás States, Brazil: virus detection, isolation and identification Surtos de vírus Vaccinia-like nos Estados de São Paulo e Goiás, Brasil: detecção, isolamento e identificação viral

    Directory of Open Access Journals (Sweden)

    Teresa Keico Nagasse-Sugahara

    2004-04-01

    Full Text Available Since October 2001, the Adolfo Lutz Institute has been receiving vesicular fluids and scab specimens of patients from Paraíba Valley region in the São Paulo and Minas Gerais States and from São Patricio Valley, in the Goiás State. Epidemiological data suggested that the outbreaks were caused by Cowpox virus or Vaccinia virus. Most of the patients are dairy milkers that had vesiculo-pustular lesions on the hands, arms, forearms, and some of them, on the face. Virus particles with orthopoxvirus morphology were detected by direct electron microscopy (DEM in samples of 49 (66.21% patients of a total of 74 analyzed. Viruses were isolated in Vero cell culture and on chorioallantoic membrane (CAM of embryonated chicken eggs. Among 21 samples submitted to PCR using primers for hemagglutinin (HA gene, 19 were positive. Restriction digestion with TaqI resulted in four characteristic Vaccinia virus fragments. HA nucleotide sequences showed 99.9% similarity with Cantagalo virus, described as a strain of Vaccinia virus. The only difference observed was the substitution of one nucleotide in the position 616 leading to change in one amino acid of the protein in the position 206. The phylogenetic analysis showed that the isolates clustered together with Cantagalo virus, other Vaccinia strains and Rabbitpox virus.A partir de outubro de 2001, o Instituto Adolfo Lutz tem recebido amostras de líquido vesicular e crostas de lesões de pele de pacientes das regiões do Vale do Paraíba, Estado de São Paulo e do Vale do São Patricio, Estado de Goiás. Os dados clínicos e epidemiológicos sugeriam que os surtos poderiam ser causados por Cowpox virus ou Vaccinia virus. A maioria dos pacientes era ordenhadores que tinham lesões vesicopustulares nas mãos, braços, antebraços e alguns na face. A análise por microscopia eletrônica direta (MED detectou partículas com morfologia de vírus do gênero Orthopoxvirus em amostras de 49 (66,21% pacientes dos 74

  11. Surto de varíola bovina causada pelo vírus Vaccinia na região da Zona da Mata Mineira Outbreak of exantemal disease caused by Vaccinia virus in human and cattle in Zona da Mata region, Minas Gerais

    Directory of Open Access Journals (Sweden)

    Z.I.P. Lobato

    2005-08-01

    Full Text Available Relata-se um surto de doença exantemática, caracterizada como varíola bovina, acometendo bovinos e seres humanos na Zona da Mata Mineira. Setenta e duas propriedades, distribuídas em 20 municípios localizados na região, foram visitadas para se levantar os aspectos clínicos e epidemiológicos da doença. Detectaram-se 1020 vacas doentes durante a investigação, quando houve queda na produção do leite associada a infecções bacterianas secundárias. Casos humanos foram registrados em 83% das propriedades visitadas. Espécimes clínicos e amostras de soro foram coletados dos animais doentes ou convalescentes. O diagnóstico de laboratório mostrou o envolvimento de um ortopoxvírus, precisamente o Vaccinia virus como agente etiológico do surto.It was investigated an outbreak of exantemal disease in human and cattle in Zona da Mata region, Minas Gerais's State, Brazil. Seventy two farms located in 20 counties locating in this region were visited and disease pattern was studied. 1020 cows got sick in the visited herds and in 83% of them human cases occurred together with disease in animals. Drop in milk production and secondary infection were frequently observed. The disease occurred mainly from may to September. Serum and scars from sick and convalescent animals were collected and laboratory diagnostic showed that an orthopoxvirus, more precisely vaccinia virus was involved in the outbreak.

  12. Epidemiological investigation of bovine tuberculosis outbreaks in Uruguay (2011-2013).

    Science.gov (United States)

    Picasso, Catalina; Alvarez, Julio; VanderWaal, Kimberly L; Fernandez, Federico; Gil, Andres; Wells, Scott J; Perez, Andres

    2017-03-01

    Bovine tuberculosis (bTB) is a chronic disease of cattle caused by infection with the Mycobacterium bovis. While bTB prevalence in Uruguay has been low (<11 outbreaks/year) for the past 50 years as a consequence of a national control program, annual incidence increased in 2011 through 2013-15, 26 and 16 infected herds each year, raising concerns from livestock stakeholders and the government. The goal of this study was to assess the spatial dynamics of bTB in Uruguay from 2011 to 2013 and the association between bTB and potential demographic and movement risk factors at the herd level using data provided by the Uruguayan Ministry of Livestock, Agriculture, and Fisheries. Clustering of incident outbreaks was assessed using the Cuzick-Edwards' test and the Bernoulli model of the spatial scan statistic, and a conditional multivariable logistic regression model was used to assess risk factors associated with bTB in a subset of Uruguayan dairy farms. Significant (P<0.05) global clustering was detected in 2012, while high-risk local clusters were detected in southwestern (2011, 2012, 2013), northwestern (2012), and southeastern (2012) Uruguay. Increased risk of bTB in different regions of Uruguay suggests a potential role of animal movements in disease dissemination. Larger herds, higher numbers of animals purchased, and incoming steers to the farm were associated with increased odds of breaking with bTB, in agreement with previous studies but also suggesting other additional sources of risk. These results will contribute to enhanced effectiveness of bTB control programs in Uruguay with the ultimate objective of preventing or mitigating the impact of the disease in the human and animal populations of the country. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Outbreak Control and Clinical, Pathological, and Epidemiological Aspects and Molecular Characterization of a Bovine Herpesvirus Type 5 on a Feedlot Farm in São Paulo State

    Directory of Open Access Journals (Sweden)

    Jane Megid

    2015-01-01

    Full Text Available This paper describes the control, epidemiological, pathological, and molecular aspects of an outbreak of meningoencephalitis in calves due to bovine herpesvirus 5 at a feedlot with 540 animals in São Paulo State, Brazil. The introduction of new animals and contact between the resident animals and the introduced ones were most likely responsible for virus transmission. Bovine herpesvirus 1 vaccine was used, resulting in the efficacy of the outbreak control, although two bovine herpesvirus 1 positive animals, vaccinated and revaccinated, presented meningoencephalitis, thereby characterizing vaccinal failure.

  14. Investigation of bovine tuberculosis outbreaks using the trace-back system and molecular typing in Korean Hanwoo beef cattle.

    Science.gov (United States)

    Ku, Bok Kyung; Jeon, Bo-Young; Kim, Jae Myung; Jang, Young-Boo; Lee, Hyeyoung; Choi, Jae Young; Jung, Suk Chan; Nam, Hyang-Mi; Park, Hun; Cho, Sang-Nae

    2017-07-10

    Bovine tuberculosis is a chronic contagious disease responsible for major agricultural economic losses. Abattoir monitoring and trace-back systems are an appropriate method to control bovine tuberculosis, particularly in beef cattle. In the present study, a trace-back system was applied to bovine tuberculosis outbreaks of Korean native Hanwoo beef cattle. Bovine tuberculosis was detected in three index beef cattle during abattoir monitoring in Jeonbuk Province, Korea, and the original herds were traced back from each index cattle. All cattle in the original herds were subjected to tuberculin skin test. The positive rates of the tuberculin skin test were 64.2% (62 of 96), 2.4% (2 of 42) and 8.1% (3 of 37) at farms A, B and C, respectively. In the post-mortem examination of 56 tuberculin-positive cattle, 62% had granulomatous lesions, and Mycobacterium bovis was cultured from 40 (71.4%) cattle. Molecular typing by spoligotyping and the mycobacterial interspersed repetitive unit-variable number tandem repeat assay revealed the genotype of the M. bovis strains from the index cattle were same as the M. bovis genotype in each original herd. These results suggest that tracing back from the index cattle to the original herd is an effective method to control bovine tuberculosis in beef cattle.

  15. A Report on Bovine Ephemeral Fever Virus in Turkey: Antigenic Variations of Different Strains of EFV in the 1985 and 2012 Outbreaks Using Partial Glycoprotein Gene Sequences.

    Science.gov (United States)

    Oğuzoğlu, T Ç; Ertürk, A; Çizmeci, Ş G; Koç, B T; Akça, Y

    2015-10-01

    We described the aetiological agents of outbreaks of bovine ephemeral fever (BEF) that occurred in 1985 and 2012 in Turkey, and identify mutations in the viruses from both outbreaks. Outbreaks have emerged periodically every 4-5 years in the same regions in Turkey. Because these regions are located in a subtropical climatic zone, good conditions for vector populations exist. The results of this study show that the BEFVs from outbreaks in Turkey vary significantly. Effective prevention will require a vaccine that contains BEFVs from different genetic clusters. © 2013 Blackwell Verlag GmbH.

  16. Characterization of a new Vaccinia virus isolate reveals the C23L gene as a putative genetic marker for autochthonous Group 1 Brazilian Vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Felipe L Assis

    Full Text Available Since 1999, several Vaccinia virus (VACV isolates, the etiological agents of bovine vaccinia (BV, have been frequently isolated and characterized with various biological and molecular methods. The results from these approaches have grouped these VACV isolates into two different clusters. This dichotomy has elicited debates surrounding the origin of the Brazilian VACV and its epidemiological significance. To ascertain vital information to settle these debates, we and other research groups have made efforts to identify molecular markers to discriminate VACV from other viruses of the genus Orthopoxvirus (OPV and other VACV-BR groups. In this way, some genes have been identified as useful markers to discriminate between the VACV-BR groups. However, new markers are needed to infer ancestry and to correlate each sample or group with its unique epidemiological and biological features. The aims of this work were to characterize a new VACV isolate (VACV DMTV-2005 molecularly and biologically using conserved and non-conserved gene analyses for phylogenetic inference and to search for new genes that would elucidate the VACV-BR dichotomy. The VACV DMTV-2005 isolate reported in this study is biologically and phylogenetically clustered with other strains of Group 1 VACV-BR, the most prevalent VACV group that was isolated during the bovine vaccinia outbreaks in Brazil. Sequence analysis of C23L, the gene that encodes for the CC-chemokine-binding protein, revealed a ten-nucleotide deletion, which is a new Group 1 Brazilian VACV genetic marker. This deletion in the C23L open reading frame produces a premature stop-codon that is shared by all Group 1 VACV-BR strains and may also reflect the VACV-BR dichotomy; the deletion can also be considered to be a putative genetic marker for non-virulent Brazilian VACV isolates and may be used for the detection and molecular characterization of new isolates.

  17. Vaccinia Virus Infections in a Martial Arts Gym

    Centers for Disease Control (CDC) Podcasts

    2011-04-04

    This podcast discusses an outbreak of vaccinia virus in Maryland in 2008. Christine Hughes, a health scientist with the Poxvirus and Rabies Branch at CDC, and co-author of a paper in the April 2011 issue of CDC's journal, discusses vaccinia virus infections in a martial arts gym.  Created: 4/4/2011 by National Center for Emerging Zoonotic and Infectious Diseases (NCEZID).   Date Released: 4/5/2011.

  18. Vaccinia Virus Natural Infections in Brazil: The Good, the Bad, and the Ugly

    Directory of Open Access Journals (Sweden)

    Jaqueline Silva de Oliveira

    2017-11-01

    Full Text Available The orthopoxviruses (OPV comprise several emerging viruses with great importance to human and veterinary medicine, including vaccinia virus (VACV, which causes outbreaks of bovine vaccinia (BV in South America. Historically, VACV is the most comprehensively studied virus, however, its origin and natural hosts remain unknown. VACV was the primary component of the smallpox vaccine, largely used during the smallpox eradication campaign. After smallpox was declared eradicated, the vaccination that conferred immunity to OPV was discontinued, favoring a new contingent of susceptible individuals to OPV. VACV infections occur naturally after direct contact with infected dairy cattle, in recently vaccinated individuals, or through alternative routes of exposure. In Brazil, VACV outbreaks are frequently reported in rural areas, affecting mainly farm animals and humans. Recent studies have shown the role of wildlife in the VACV transmission chain, exploring the role of wild rodents as reservoirs that facilitate VACV spread throughout rural areas. Furthermore, VACV circulation in urban environments and the significance of this with respect to public health, have also been explored. In this review, we discuss the history, epidemiological, ecological and clinical aspects of natural VACV infections in Brazil, also highlighting alternative routes of VACV transmission, the factors involved in susceptibility to infection, and the natural history of the disease in humans and animals, and the potential for dissemination to urban environments.

  19. Susceptibility of Vaccinia Virus to Chemical Disinfectants

    Science.gov (United States)

    de Oliveira, Tércia Moreira Ludolfo; Rehfeld, Izabelle Silva; Coelho Guedes, Maria Isabel Maldonado; Ferreira, Jaqueline Maria Siqueira; Kroon, Erna Geessien; Lobato, Zélia Inês Portela

    2011-01-01

    Vaccinia virus (VACV) is the cause of bovine vaccinia (BV), an emerging zoonotic disease that affects dairy cows and milkers. Some chemical disinfectants have been used on farms affected by BV to disinfect cow teats and milkers' hands. To date, there is no information about the efficacy of disinfectants against VACV. Therefore, this study aimed to assess the virucidal activity of some active disinfectants commonly used in the field. Sodium hypochlorite, quaternary ammonium combined with chlorhexidine, and quaternary ammonium combined with glutaraldehyde were effective in inactivating the virus at all concentrations tested. Iodine and quaternary ammonium as the only active component were partially effective. The presence of bovine feces as organic matter and light decreased the effectiveness of sodium hypochlorite. These results show that an appropriated disinfection and asepsis of teats and hands may be helpful in the control and prevention of BV and other infections with VACV. PMID:21734141

  20. An Outbreak of Late-Term Abortions, Premature Births, and Congenital Deformities Associated with a Bovine Viral Diarrhea Virus 1 Subtype b that Induces Thrombocytopenia

    Science.gov (United States)

    Bovine viral diarrhea virus (BVDV) genotype 1 subtype b caused an outbreak of premature births, late term abortions, brachygnathism, growth retardation, brain deformities and rare other skeletal deformities in Holstein calves born to first calf heifers on one dairy. Experimental challenge of three,...

  1. Vaccination with recombinant modified vaccinia virus Ankara expressing bovine respiratory syncytial virus (bRSV) proteins protects calves against RSV challenge

    NARCIS (Netherlands)

    Antonis, A.F.G.; Most, van der R.G.; Suezer, Y.; Stockhofe-Zurwieden, N.; Daus, F.J.; Sutter, G.; Schrijver, R.S.

    2007-01-01

    Respiratory syncytial virus (RSV) is a major cause of severe respiratory disease in infants and calves. Bovine RSV (bRSV) is a natural pathogen for cattle, and bRSV infection in calves shares many features with the human infection. Thus, bRSV infection in cattle provides the ideal setting to

  2. An outbreak of teat papillomatosis in cattle caused by bovine papilloma virus (BPV) type 6 and unclassified BPVs.

    Science.gov (United States)

    Maeda, Yukiko; Shibahara, Tomoyuki; Wada, Yoshihiro; Kadota, Koichi; Kanno, Toru; Uchida, Ikuo; Hatama, Shinichi

    2007-04-15

    Out of 700 heifers at a local farm in Hokkaido, the Northern island of Japan, 560 (80%) were found to have benign teat tumors. All of the analyzed tumors were macroscopically of the flat-and-round type, and no other types such as rice-grain or frond epithelial type were found. The lesions were characterized by epithelial hyperplasia, acanthosis and hyperkeratosis. Unlike in typical fibropapilloma, fibroplasia of the underlying dermis was not observed. Bovine papilloma virus (BPV) capsid antigen and virus particles were found in basophilic intranuclear inclusions of the stratum granulosum of the epidermis by immunohistochemistry and electron microscopy, respectively. BPV-specific DNA was also detected in the lesions. By means of the polymerase chain reaction (PCR) and DNA sequencing of the PCR products, the viruses causing this outbreak were identified mainly as BPV-6 (64%), partly as unclassified BPVs (14%) and their co-infections (21%). Our findings suggest that this outbreak of benign teat tumors was associated with several BPV types.

  3. An outbreak of acute bovine mastitis caused by Klebsiella pneumoniae in a dairy herd

    Directory of Open Access Journals (Sweden)

    Silva N.

    2001-01-01

    Full Text Available An outbreak of coliform mastitis is described in a dairy herd from the State of Rio de Janeiro, Brazil. During a four-month period 14 fatal cases of Klebsiella pneumoniae-related mastitis were observed in a herd of 104 lactating cows. The symptoms included peracute enterotoxemia in which the cows died 6 to 12 h after the detection of mastitis by CMT. Staphylococcus aureus and Streptococcus agalactiae Streptococcus agalactiae were also isolated although could not be associated with cases of acute fatal mastitis. Milking practices were also evaluated. The milking machine was being used correctly and adequate precautions for hygiene and pre-milking and post-milking teat dipping were used. The organism was sensitive to gentamicin. Therapy for acute toxic mastitis required early action for the treatment of infections, involving corticosteroids and fluid therapy. The use of a Klebsiella vaccine produced from the microorganisms isolated from the herd, associated with hygiene measures, resulted in the control of the outbreak.

  4. bovine

    African Journals Online (AJOL)

    of various breeds under local conditions of management. (Hale, 1974b). AdditionaIly, this procedure has been used to assess the production of LH by the bovine anterior pituitary in vitro and to study the relationships between this production and the activity of the pineal- hypothalamic axis (Hayes, Knight & Symington, 1974;.

  5. Molecular and epidemiological characterization of a respiratory disease outbreak in pre-weaned beef calves associated with bovine coronavirus

    Science.gov (United States)

    Bovine coronavirus (BCV) is associated with respiratory tract infections in cattle of all ages; however, a temporal study to evaluate the effect of BCV immunity on virus shedding and bovine respiratory disease (BRD) incidence in pre-weaned beef calves has not been reported. Thus, we report here a pr...

  6. Severe diarrhea outbreak in beef calves (Bos indicus caused by G6P[11], an emergent genotype of bovine rotavirus group A

    Directory of Open Access Journals (Sweden)

    Thais N.S. Medeiros

    2014-08-01

    Full Text Available The episodes of diarrhea caused by neonatal bovine rotavirus group A (BoRVA constitute one of the major health problems in the calf rearing worldwide. The main G (VP7 and P (VP4 genotypes of BoRVA strains involved in the etiology of diarrhea in calves are G6P[1], G10P[11], G6P[5], and G8P[1]. However, less frequently, other G and P genotypes have been described in BoRVA strains identified in diarrheic fecal samples of calves. This study describes the identification and molecular characterization of an emerging genotype (G6P[11] in BoRVA strains involved in the etiology of a diarrhea outbreak in beef calves in a cattle herd of high production in extensive management system. The diarrhea outbreak, which showed high morbidity (60% and lethality (7% rates, occurred in calves (n= 384 Nelore (Bos indicus up to 30-day-old from the State of Mato Grosso do Sul, Brazil. BoRVA was identified in 80% (16/20 of the fecal samples analyzed by polyacrylamide gel electrophoresis (PAGE technique. In all PAGE-positive fecal samples were amplified products with 1,062-bp and 876-bp in the RT-PCR assays for VP7 (G type and VP4 (VP8* (P type of BoRVA, respectively. The nucleotide sequence analysis of VP7 and VP4 genes of four wild-type BoRVA strains showed G6-III P[11]-III genotype/lineage. The G6P[11] genotype has been described in RVA strains of human and animal hosts, however, in calves this genotype was only identified in some cross-sectional studies and not as a single cause of diarrhea outbreaks in calves with high morbidity and lethality rates as described in this study. The monitoring of the G and P genotypes of BoRVA strains involved in diarrhea outbreaks in calves is important for both animal and public health by allowing the identification of the most frequent genotypes, the characterization of novel genotypes and to identify reassortments with genotypes described in animal and human hosts. The results of this study show the importance of the monitoring of

  7. Glycoprotein-G-gene-based molecular and phylogenetic analysis of rabies viruses associated with a large outbreak of bovine rabies in southern Brazil.

    Science.gov (United States)

    Cargnelutti, Juliana F; de Quadros, João M; Martins, Mathias; Batista, Helena B C R; Weiblen, Rudi; Flores, Eduardo F

    2017-12-01

    A large outbreak of hematophagous-bat-associated bovine rabies has been occurring in Rio Grande do Sul (RS), the southernmost Brazilian state, since 2011, with official estimates exceeding 50,000 cattle deaths. The present article describes a genetic characterization of rabies virus (RABV) recovered from 59 affected cattle and two sheep, from 56 herds in 16 municipalities (2012-2016). Molecular analysis was performed using the nucleotide (nt) and predicted amino acid (aa) sequences of RABV glycoprotein G (G). A high level of nt and aa sequence identity was observed among the examined G sequences, ranging from 98.4 to 100%, and from 97.3 to 100%, respectively. Likewise, high levels of nt and aa sequence identity were observed with bovine (nt, 99.8%; aa, 99.8%) and hematophagous bat (nt, 99.5%; aa, 99.4%) RABV sequences from GenBank, and lower levels were observed with carnivore RABV sequences (nt, 92.8%; aa, 88.1%). Some random mutations were observed in the analyzed sequences, and a few consistent mutations were observed in some sequences belonging to cluster 2, subcluster 2b. The clustering of the sequences was observed in a phylogenetic tree, where two distinct clusters were evident. Cluster 1 comprised RABV sequences covering the entire study period (2012 to 2016), but subclusters corresponding to different years could be identified, indicating virus evolution and/or introduction of new viruses into the population. In some cases, viruses from the same location obtained within a short period grouped into different subclusters, suggesting co-circulation of viruses of different origins. Subcluster segregation was also observed in sequences obtained in the same region during different periods, indicating the involvement of different viruses in the cases at different times. In summary, our results indicate that the outbreaks occurring in RS (2012 to 2016) probably involved RABV of different origins, in addition to a possible evolution of RABV isolates within this

  8. Geo-spatial distribution of serologically detected bovine Foot and Mouth Disease (FMD serotype outbreaks in Ilesha Baruba, Kwara State-Nigeria

    Directory of Open Access Journals (Sweden)

    Hamza Olatunde Olabode

    2014-09-01

    Full Text Available The study was aimed at assessing the prevalence and distribution of bovine Foot and Mouth Disease (FMD serotypes in Ilesha Baruba, Kwara state-Nigeria. To identify the source of epidemics, geo-spatial analysis was done on the FMD outbreak locations (n=15 using Global Positioning Service (GPS device (EtrexR. Randomly sampled bovine sera (n=64 from herd representatives were subjected to FMD 3ABC enzyme-linked immunosorbent assay (FMD 3ABC ELISA and solid-phase competitive ELISA (SP-cELISA, for the screening and serotyping of FMD virus, respectively. Through ELISA, the FMD serotypes detected in this study were- serotype O (83%; n=53/64, serotype A (7.8%; n=5/64, serotype vaccine O (1.6%; n=1/64, and serotype vaccine SAT2 (1.6%; n=1/64. Multiple serotypes were observed in two different combinations; these were O and A (4.7%; n=3/64, and O and SAT2 (1.6%; n=1/64. FMD multiple serotype infections were associated with absence of cross-immunity between serotypes and cross reactivity enhanced by clustered herds, highland study area topography, road and river interconnectivity, possible human settlements, activities and traffic. This study provides baseline information on geo-spatial distribution, and identification of prevalent FMD serotypes in Ilesha Baruba, Kwara state-Nigeria.

  9. Viral infections and bovine mastitis: a review.

    Science.gov (United States)

    Wellenberg, G J; van der Poel, W H M; Van Oirschot, J T

    2002-08-02

    This review deals with the role of viruses in the aetiology of bovine mastitis. Bovine herpesvirus 1, bovine herpesvirus 4, foot-and-mouth disease virus, and parainfluenza 3 virus have been isolated from milk from cows with clinical mastitis. Intramammary inoculations of bovine herpesvirus 1 or parainfluenza 3 virus-induced clinical mastitis, while an intramammary inoculation of foot-and-mouth disease virus resulted in necrosis of the mammary gland. Subclinical mastitis has been induced after a simultaneous intramammary and intranasal inoculation of lactating cows with bovine herpesvirus 4. Bovine leukaemia virus has been detected in mammary tissue of cows with subclinical mastitis, but whether this virus was able to induce bovine mastitis has not been reported. Bovine herpesvirus 2, vaccinia, cowpox, pseudocowpox, vesicular stomatitis, foot-and-mouth disease viruses, and bovine papillomaviruses can play an indirect role in the aetiology of bovine mastitis. These viruses can induce teat lesions, for instance in the ductus papillaris, which result in a reduction of the natural defence mechanisms of the udder and indirectly in bovine mastitis due to bacterial pathogens. Bovine herpesvirus 1, bovine viral diarrhoea virus, bovine immunodeficiency virus, and bovine leukaemia virus infections may play an indirect role in bovine mastitis, due to their immunosuppressive properties. But, more research is warranted to underline their indirect role in bovine mastitis. We conclude that viral infections can play a direct or indirect role in the aetiology of bovine mastitis; therefore, their importance in the aetiology of bovine mastitis and their economical impact needs further attention.

  10. Descriptive Epidemiology and Whole Genome Sequencing Analysis for an Outbreak of Bovine Tuberculosis in Beef Cattle and White-Tailed Deer in Northwestern Minnesota.

    Directory of Open Access Journals (Sweden)

    Linda Glaser

    Full Text Available Bovine tuberculosis (bTB was discovered in a Minnesota cow through routine slaughter surveillance in 2005 and the resulting epidemiological investigation led to the discovery of infection in both cattle and white-tailed deer in the state. From 2005 through 2009, a total of 12 beef cattle herds and 27 free-ranging white-tailed deer (Odocoileus virginianus were found infected in a small geographic region of northwestern Minnesota. Genotyping of isolates determined both cattle and deer shared the same strain of bTB, and it was similar to types found in cattle in the southwestern United States and Mexico. Whole genomic sequencing confirmed the introduction of this infection into Minnesota was recent, with little genetic divergence. Aggressive surveillance and management efforts in both cattle and deer continued from 2010-2012; no additional infections were discovered. Over 10,000 deer were tested and 705 whole herd cattle tests performed in the investigation of this outbreak.

  11. Immune Modulation in Primary Vaccinia virus Zoonotic Human Infections

    Directory of Open Access Journals (Sweden)

    Juliana Assis Silva Gomes

    2012-01-01

    Full Text Available In 2010, the WHO celebrated the 30th anniversary of the smallpox eradication. Ironically, infections caused by viruses related to smallpox are being increasingly reported worldwide, including Monkeypox, Cowpox, and Vaccinia virus (VACV. Little is known about the human immunological responses elicited during acute infections caused by orthopoxviruses. We have followed VACV zoonotic outbreaks taking place in Brazil and analyzed cellular immune responses in patients acutely infected by VACV. Results indicated that these patients show a biased immune modulation when compared to noninfected controls. Amounts of B cells are low and less activated in infected patients. Although present, T CD4+ cells are also less activated when compared to noninfected individuals, and so are monocytes/macrophages. Similar results were obtained when Balb/C mice were experimentally infected with a VACV sample isolated during the zoonotic outbreaks. Taking together, the data suggest that zoonotic VACVs modulate specific immune cell compartments during an acute infection in humans.

  12. Frequency of adverse events after vaccination with different vaccinia strains.

    Directory of Open Access Journals (Sweden)

    Mirjam Kretzschmar

    2006-08-01

    Full Text Available BACKGROUND: Large quantities of smallpox vaccine have been stockpiled to protect entire nations against a possible reintroduction of smallpox. Planning for an appropriate use of these stockpiled vaccines in response to a smallpox outbreak requires a rational assessment of the risks of vaccination-related adverse events, compared to the risk of contracting an infection. Although considerable effort has been made to understand the dynamics of smallpox transmission in modern societies, little attention has been paid to estimating the frequency of adverse events due to smallpox vaccination. Studies exploring the consequences of smallpox vaccination strategies have commonly used a frequency of approximately one death per million vaccinations, which is based on a study of vaccination with the New York City Board of Health (NYCBH strain of vaccinia virus. However, a multitude of historical studies of smallpox vaccination with other vaccinia strains suggest that there are strain-related differences in the frequency of adverse events after vaccination. Because many countries have stockpiled vaccine based on the Lister strain of vaccinia virus, a quantitative evaluation of the adverse effects of such vaccines is essential for emergency response planning. We conducted a systematic review and statistical analysis of historical data concerning vaccination against smallpox with different strains of vaccinia virus. METHODS AND FINDINGS: We analyzed historical vaccination data extracted from the literature. We extracted data on the frequency of postvaccinal encephalitis and death with respect to vaccinia strain and age of vaccinees. Using a hierarchical Bayesian approach for meta-analysis, we estimated the expected frequencies of postvaccinal encephalitis and death with respect to age at vaccination for smallpox vaccines based on the NYCBH and Lister vaccinia strains. We found large heterogeneity between findings from different studies and a time-period effect

  13. An outbreak of winter dysentery caused by bovine coronavirus in a high-production dairy cattle herd from a tropical country

    Directory of Open Access Journals (Sweden)

    Elisabete Takiuchi

    2009-11-01

    Full Text Available Bovine coronavirus (BCoV is a known cause of winter dysentery (WD in adult cattle. The morbidity of the disease is high, that results in a significant decrease in milk production and consequently, economic losses. In the present study, we report on a classical outbreak of WD that affected a high-production Holstein dairy herd raised in a tropical country. The lactating batch included 154 cows, and 138 (90% presented diarrhea in a short (nine days period of time. Three (2% cows died. The other batches of animals did not become ill. The evolution of the disease in the herd, including the clinical signs and epidemiological features, strongly suggested a WD case. Semi-nested PCR and RFLP confirmed that BCoV was the cause of the infection. Samples tested negative for all other enteric pathogens. This case report highlights the importance of BCoV in WD even in tropical countries such as Brazil.O coronavirus bovino (BCoV pode causar a diarreia de inverno (WD - Winter Dysentery ao infectar bovinos adultos, particularmente em regiões de clima temperado ou frio. A morbidade da doença é alta, resultando em queda na produção de leite e, consequentemente, perdas econômicas. No presente estudo, é descrito um surto clássico de WD acometendo um rebanho de bovinos leiteiros da raça Holandesa PB, de alta produção, proveniente do estado do Paraná. O lote afetado era composto por 154 vacas em lactação, sendo que 138 (90% apresentaram diarreia em um curto (nove dias período de tempo e 3 (2% vacas morreram em consequência da diarreia, desidratação e desequilíbrio eletrolítico. As outras categorias de animais do rebanho (bezerras, novilhas e vacas secas não apresentaram sinal clínico. A evolução da doença clínica, assim como a epidemiologia da infecção sugeriu um quadro clássico de WD. O diagnóstico foi realizado por meio da identificação do BCoV, pela técnica de semi-nested PCR e confirmação por RFLP, em amostra fecal de uma vaca

  14. Outbreak of bovine viral diarrhoe on Dutch dairy farms induced by a BHV1 marker vaccine contaminated with BDVD type 2

    NARCIS (Netherlands)

    Bartels, CJM; van Wuijckhuise, L; Hesselink, JW; Holzhauer, M; Weber, MF; Franken, P; Kock, PA; Bruschke, CJM; Zimmer, GM; Barkema, H.W.

    2001-01-01

    On 23 February 1999, the Dutch Animal Health Service advised all Dutch veterinary practices to postpone vaccination against bovine herpesvirus 1 (BHV1) immediately. The day before severe disease problems were diagnosed on four dairy farms after vaccination with the same batch of BHV1 marker vaccine.

  15. Identification and preliminary characterization of vaccinia virus (Dryvax) antigens recognized by vaccinia immune globulin

    National Research Council Canada - National Science Library

    Jones-Trower, Agnes; Garcia, Alonzo; Meseda, Clement A; He, Yong; Weiss, Carol; Kumar, Arunima; Weir, Jerry P; Merchlinsky, Michael

    2005-01-01

    Using vaccinia immune globulin (VIG), a high-titer antibody preparation from immunized subjects, we demonstrate that the humoral immune response in humans is directed against numerous antigens in the Dryvax vaccine strain...

  16. Intoxicação de bovinos por aflatoxina B1 presente em polpa cítrica: relato de um surto Aflatoxin B1 poisoning in bovines: an outbreak report

    Directory of Open Access Journals (Sweden)

    M.M. Melo

    1999-12-01

    Full Text Available O presente trabalho relata um surto de intoxicação pela aflatoxina B1 em 150 bovinos machos mestiços, provenientes de um rebanho de 1774 animais, em sistema de confinamento, ingerindo polpa cítrica peletizada comercial, 5kg por animal. Todos os animais foram avaliados clinicamente, e os 18 animais que morreram foram necropsiados e submetidos a exames histopatológicos. A intoxicação foi confirmada pela presença da aflatoxina B1 (5ppm em amostras da polpa cítrica peletizada utilizada na propriedade e em fragmentos de fígado dos animais que morreram.The present work reports an outbreak of intoxication by aflatoxin B1 in 150 adult bovine male, males from a herd of 1774 animals, in confinement system, fed on commercial citrus pellet. All animals were evaluated clinicaly, and ones that died were necropsied and tissues submitted to histopathotology. The intoxication was confirmed by aflatoxin B1 presence in samples of the citrus pellet and in fragments of liver of the animals which died.

  17. Vaccinia virus as an expression vector.

    Science.gov (United States)

    Talavera, A; Rodriguez, J M

    1992-01-01

    Vaccinia virus (Vv) is a member of the genus Orthopoxvirus, one of seven genera included in the family Poxviridae. Most of these viruses infect vertebrates (Orthopoxvirus, Avipoxvirus, Capripoxvirus, Leporipoxvirus, Suipoxvirus, and Parapoxvirus), but one genus, Entomopoxvirus, infects insects. It is interesting to note that the Fibroma and Mixoma viruses of the leporipoxvirus genus cause tumors in their hosts (rabbits), these being the only tumorigenic viruses in the family (1,2).

  18. Brazilian Vaccinia Viruses and Their Origins

    Centers for Disease Control (CDC) Podcasts

    2007-07-30

    Smallpox was eradicated more than 25 years ago, but live viruses used in vaccines may have survived to cause animal and human illness today. Dr. Inger Damon, Acting Branch Chief of the Poxvirus and Rabies Branch at CDC, discusses efforts to determine origins and spread of vaccinia viruses in Brazil.  Created: 7/30/2007 by Emerging Infectious Diseases.   Date Released: 7/30/2007.

  19. Oncolytic vaccinia therapy of squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Yong A

    2009-07-01

    Full Text Available Abstract Background Novel therapies are necessary to improve outcomes for patients with squamous cell carcinomas (SCC of the head and neck. Historically, vaccinia virus was administered widely to humans as a vaccine and led to the eradication of smallpox. We examined the therapeutic effects of an attenuated, replication-competent vaccinia virus (GLV-1h68 as an oncolytic agent against a panel of six human head and neck SCC cell lines. Results All six cell lines supported viral transgene expression (β-galactosidase, green fluorescent protein, and luciferase as early as 6 hours after viral exposure. Efficient transgene expression and viral replication (>150-fold titer increase over 72 hrs were observed in four of the cell lines. At a multiplicity of infection (MOI of 1, GLV-1h68 was highly cytotoxic to the four cell lines, resulting in ≥ 90% cytotoxicity over 6 days, and the remaining two cell lines exhibited >45% cytotoxicity. Even at a very low MOI of 0.01, three cell lines still demonstrated >60% cell death over 6 days. A single injection of GLV-1h68 (5 × 106 pfu intratumorally into MSKQLL2 xenografts in mice exhibited localized intratumoral luciferase activity peaking at days 2–4, with gradual resolution over 10 days and no evidence of spread to normal organs. Treated animals exhibited near-complete tumor regression over a 24-day period without any observed toxicity, while control animals demonstrated rapid tumor progression. Conclusion These results demonstrate significant oncolytic efficacy by an attenuated vaccinia virus for infecting and lysing head and neck SCC both in vitro and in vivo, and support its continued investigation in future clinical trials.

  20. Surto de babesiose cerebral em bovinos no Estado do Rio Grande do Sul Cerebral babesiosis outbreak in bovines in the State of Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Nadia Aline Bobbi Antoniassi

    2009-06-01

    Full Text Available Descreve-se um surto de mortalidade em bovinos por Babesia bovis em abril de 2007, no Município de Picada Café, Rio Grande do Sul. Em um rebanho com 55 novilhas, 28 (50,9% morreram em cinco dias. A doença iniciou vinte dias após o ingresso dos bovinos na propriedade. Os sinais clínicos incluíam febre, incoordenação, agressividade, anemia, petéquias nas mucosas e morte 1 á 2 dias após. Em 4 animais necropsiados, observaram-se palidez de mucosas, hemorragias múltiplas, esplenomegalia, fígado aumentado e alaranjado, vesícula biliar com parede edemaciada e contendo bile grumosa. Os rins estavam vermelho-escuros e a bexiga continha urina cor de vinho tinto. O encéfalo apresentou cor róseo-cereja externamente e ao corte, mais marcado no córtex telencefálico, cerebelo e corpo estriado, contrastando com a cor branca da substância branca. Na histologia havia nefrose hemoglobinúrica, necrose hepática paracentral, bilestase canalicular, congestão esplênica, além de congestão com grande quantidade de eritrócitos parasitados por estruturas compatíveis com Babesia bovis na região cortical do encéfalo, também observadas em esfregaços teciduais dessas regiões. A morte de 28 bovinos em 5 dias deveu-se, provavelmente, à falta de imunidade contra o parasito. O tratamento foi realizado com dipropionato de imidocarb nos demais animais, havendo recuperação dos bovinos que apresentavam sinais iniciais leves e não ocorrência de novos casos durante um período de dois meses, quando foram enviados para abate.An outbreak of cattle mortality due to Babesia bovis infection in the county of Picada Café, Rio Grande do Sul, southern Brazil, in April 2007 is described. Twenty eight heifers (50.9% died, out of a herd of 55 animals, in five days. The disease occurred approximately 20 days after heifers were transferred to this farm. The clinical signs included fever, anemia, aggressiveness, incoordination, petechiae in the mucous membranes

  1. Vulvar vaccinia infection after sexual contact with a smallpox vaccinee.

    Science.gov (United States)

    Muzny, Christina A; King, Heather; Byers, Paul; Currier, Mary; Nolan, Rathel; Mena, Leandro

    2009-04-01

    Vaccinia (smallpox) vaccine is an effective immunizing agent that brought about global eradication of naturally occurring smallpox, as declared by the World Health Organization in 1980. The United States ceased generalized smallpox vaccination in 1972 but reinstated it in 2002 for military personnel and selected healthcare workers (first responders who may be investigating possible cases of smallpox or caring for patients in selected hospitals) after the 2001 bioterrorism attacks. Since reinstitution of the vaccine, reports of transmission of vaccinia virus through contact with military smallpox vaccinees have been published, including four cases of female genital infection. We report a subsequent case of vulvar vaccinia infection acquired during sexual contact with a military vaccinee.

  2. Vaccinia virus, a promising new therapeutic agent for pancreatic cancer.

    Science.gov (United States)

    Al Yaghchi, Chadwan; Zhang, Zhongxian; Alusi, Ghassan; Lemoine, Nicholas R; Wang, Yaohe

    2015-01-01

    The poor prognosis of pancreatic cancer patients signifies a need for radically new therapeutic strategies. Tumor-targeted oncolytic viruses have emerged as attractive therapeutic candidates for cancer treatment due to their inherent ability to specifically target and lyse tumor cells as well as induce antitumor effects by multiple action mechanisms. Vaccinia virus has several inherent features that make it particularly suitable for use as an oncolytic agent. In this review, we will discuss the potential of vaccinia virus in the management of pancreatic cancer in light of our increased understanding of cellular and immunological mechanisms involved in the disease process as well as our extending knowledge in the biology of vaccinia virus.

  3. Vaccinia virus Transmission through Experimentally Contaminated Milk Using a Murine Model.

    Directory of Open Access Journals (Sweden)

    Izabelle Silva Rehfeld

    Full Text Available Bovine vaccinia (BV is a zoonosis caused by Vaccinia virus (VACV, which affects dairy cattle and humans. Previous studies have detected the presence of viable virus particles in bovine milk samples naturally and experimentally contaminated with VACV. However, it is not known whether milk contaminated with VACV could be a route of viral transmission. However, anti-Orthopoxvirus antibodies were detected in humans from BV endemic areas, whom had no contact with affected cows, which suggest that other VACV transmission routes are possible, such as consumption of contaminated milk and dairy products. Therefore, it is important to study the possibility of VACV transmission by contaminated milk. This study aimed to examine VACV transmission, pathogenesis and shedding in mice orally inoculated with experimentally contaminated milk. Thirty mice were orally inoculated with milk containing 107 PFU/ml of VACV, and ten mice were orally inoculated with uncontaminated milk. Clinical examinations were performed for 30 consecutive days, and fecal samples and oral swabs (OSs were collected every other day. Mice were euthanized on predetermined days, and tissue and blood samples were collected. Nested-PCR, plaque reduction neutralization test (PRNT, viral isolation, histopathology, and immunohistochemistry (IHC methods were performed on the collected samples. No clinical changes were observed in the animals. Viral DNA was detected in feces, blood, OSs and tissues, at least in one of the times tested. The lungs displayed moderate to severe interstitial lymphohistiocytic infiltrates, and only the heart, tonsils, tongue, and stomach did not show immunostaining at the IHC analysis. Neutralizing antibodies were detected at the 20th and 30th days post infection in 50% of infected mice. The results revealed that VACV contaminated milk could be a route of viral transmission in mice experimentally infected, showing systemic distribution and shedding through feces and oral

  4. Protective efficacy of a recombinant vaccinia virus in vaccinia-immune mice.

    Science.gov (United States)

    Andrew, M E

    1989-10-01

    Recombinant viral vectors offer a potential means of vaccinating against diseases for which there are no current safe vaccines. One of the criteria on which a viral vaccine vector would be selected is that it either circulates in the human or livestock population without producing overt disease (e.g. adenovirus) or has a history as a safe vaccine (e.g. vaccinia virus). However, this selection criterion also means that the target population is likely to have circulating antibodies that are specific to the vaccine vector. Since a percentage of the world's population has been vaccinated during the World Health Organization's Smallpox Eradication Campaign, such antibody titres, which are likely to lower vaccine efficacy, have been raised as an objection to the use of recombinant vaccinia viruses as vaccines. We have tested the effect of vaccinia-specific immunity on the protective efficacy of a recombinant virus, VV-PR8-HA6 (1) which expresses the haemagglutinin of the influenza virus A/PR/8/34.

  5. Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?

    DEFF Research Database (Denmark)

    Jespersen, Sanne; Hønge, Bo Langhoff; Medina, Candida

    Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?......Vaccination scars in HIV infected patients – does vaccinia vaccination confer protection against HIV?...

  6. Respiratory disease associated with bovine coronavirus infection in cattle herds in Southern Italy.

    Science.gov (United States)

    Decaro, Nicola; Campolo, Marco; Desario, Costantina; Cirone, Francesco; D'Abramo, Maria; Lorusso, Eleonora; Greco, Grazia; Mari, Viviana; Colaianni, Maria Loredana; Elia, Gabriella; Martella, Vito; Buonavoglia, Canio

    2008-01-01

    Four outbreaks of bovine respiratory disease (BRD) associated with bovine coronavirus (BCoV) infection in Italian cattle herds were reported. In 3 outbreaks, BRD was observed only in 2-3-month-old feedlot calves, whereas in the remaining outbreak, lactating cows, heifers, and calves were simultaneously affected. By using reverse transcription polymerase chain reaction (RT-PCR), BCoV RNA was detected in all outbreaks without evidence of concurrent viral pathogens (i.e., bovine respiratory syncytial virus, bovine herpesvirus type 1, bovine viral diarrhea virus, bovine parainfluenza virus). Common bacteria of cattle were recovered only from 2 outbreaks of BRD: Staphylococcus spp. and Proteus mirabilis (outbreak 1) and Mannheimia haemolytica (outbreak 4). A recently established real-time RT-PCR assay showed that viral RNA loads in nasal secretions ranged between 3.10 x 10(2) and 7.50 x 10(7) RNA copies/microl of template. Bovine coronavirus was isolated from respiratory specimens from all outbreaks except outbreak 1, in which real-time RT-PCR found very low viral titers in nasal swabs.

  7. Mucosal Vaccination Overcomes the Barrier to Recombinant Vaccinia Immunization Caused by Preexisting Poxvirus Immunity

    Science.gov (United States)

    Belyakov, Igor M.; Moss, Bernard; Strober, Warren; Berzofsky, Jay A.

    1999-04-01

    Overcoming preexisting immunity to vaccinia virus in the adult population is a key requirement for development of otherwise potent recombinant vaccinia vaccines. Based on our observation that s.c. immunization with vaccinia induces cellular and antibody immunity to vaccinia only in systemic lymphoid tissue and not in mucosal sites, we hypothesized that the mucosal immune system remains naive to vaccinia and therefore amenable to immunization with recombinant vaccinia vectors despite earlier vaccinia exposure. We show that mucosal immunization of vaccinia-immune BALB/c mice with recombinant vaccinia expressing HIV gp160 induced specific serum antibody and strong HIV-specific cytotoxic T lymphocyte responses. These responses occurred not only in mucosal but also in systemic lymphoid tissue, whereas systemic immunization was ineffective under these circumstances. In this context, intrarectal immunization was more effective than intranasal immunization. Boosting with a second dose of recombinant vaccinia was also more effective via the mucosal route. The systemic HIV-specific cytotoxic T lymphocyte response was enhanced by coadministration of IL-12 at the mucosal site. These results also demonstrate the independent compartmentalization of the mucosal versus systemic immune systems and the asymmetric trafficking of lymphocytes between them. This approach to circumvent previous vaccinia immunity may be useful for induction of protective immunity against infectious diseases and cancer in the sizable populations with preexisting immunity to vaccinia from smallpox vaccination.

  8. Disease Outbreak News

    Science.gov (United States)

    ... Diseases Biorisk reduction Disease outbreak news Disease Outbreak News (DONs) Latest DONs Rift Valley fever – Gambia ... Disease outbreaks by country RSS feeds Disease outbreak news Related links Ebola virus disease - website Avian influenza ...

  9. Cryo-electron tomography of vaccinia virus

    Science.gov (United States)

    Cyrklaff, Marek; Risco, Cristina; Fernández, Jose Jesús; Jiménez, Maria Victoria; Estéban, Mariano; Baumeister, Wolfgang; Carrascosa, José L.

    2005-01-01

    The combination of cryo-microscopy and electron tomographic reconstruction has allowed us to determine the structure of one of the more complex viruses, intracellular mature vaccinia virus, at a resolution of 4–6 nm. The tomographic reconstruction allows us to dissect the different structural components of the viral particle, avoiding projection artifacts derived from previous microscopic observations. A surface-rendering representation revealed brick-shaped viral particles with slightly rounded edges and dimensions of ≈360 × 270 × 250 nm. The outer layer was consistent with a lipid membrane (5–6 nm thick), below which usually two lateral bodies were found, built up by a heterogeneous material without apparent ordering or repetitive features. The internal core presented an inner cavity with electron dense coils of presumptive DNA–protein complexes, together with areas of very low density. The core was surrounded by two layers comprising an overall thickness of ≈18–19 nm; the inner layer was consistent with a lipid membrane. The outer layer was discontinuous, formed by a periodic palisade built by the side interaction of T-shaped protein spikes that were anchored in the lower membrane and were arranged into small hexagonal crystallites. It was possible to detect a few pore-like structures that communicated the inner side of the core with the region outside the layer built by the T-shaped spike palisade. PMID:15699328

  10. Membrane remodelling during vaccinia virus morphogenesis.

    Science.gov (United States)

    Chichón, Francisco Javier; Rodríguez, María Josefa; Risco, Cristina; Fraile-Ramos, Alberto; Fernández, José Jesús; Esteban, Mariano; Carrascosa, José L

    2009-07-01

    VACV (vaccinia virus) is one of the most complex viruses, with a size exceeding 300 nm and more than 100 structural proteins. Its assembly involves sequential interactions and important rearrangements of its structural components. We have used electron tomography of sections of VACV-infected cells to follow, in three dimensions, the remodelling of the membrane components of the virus during envelope maturation. The tomograms obtained suggest that a number of independent 'crescents' interact with each other to enclose the volume of an incomplete ellipsoid in the viral factory area, attaining the overall shape and size characteristic of the first immature form of the virus [IV (immature virus)]. The incorporation of the DNA into these forms leads to particles with a nucleoid [IVN (IV with nucleoid)] that results in local disorganization of the envelope in regions near the condensed DNA. These particles suffer the progressive disappearance of the membrane outer spikes with a change in the shape of the membrane, becoming locally curled. The transformation of the IVN into the mature virus involves an extreme rearrangement of the particle envelope, which becomes fragmented and undulated. During this process, we also observed connections between the outer membranes with internal ones, suggesting that the latter originate from internalization of the IV envelope. The main features observed for VACV membrane maturation during morphogenesis resemble the breakdown and reassembly of cellular endomembranes.

  11. Incongruencies in Vaccinia Virus Phylogenetic Trees

    Directory of Open Access Journals (Sweden)

    Chad Smithson

    2014-10-01

    Full Text Available Over the years, as more complete poxvirus genomes have been sequenced, phylogenetic studies of these viruses have become more prevalent. In general, the results show similar relationships between the poxvirus species; however, some inconsistencies are notable. Previous analyses of the viral genomes contained within the vaccinia virus (VACV-Dryvax vaccine revealed that their phylogenetic relationships were sometimes clouded by low bootstrapping confidence. To analyze the VACV-Dryvax genomes in detail, a new tool-set was developed and integrated into the Base-By-Base bioinformatics software package. Analyses showed that fewer unique positions were present in each VACV-Dryvax genome than expected. A series of patterns, each containing several single nucleotide polymorphisms (SNPs were identified that were counter to the results of the phylogenetic analysis. The VACV genomes were found to contain short DNA sequence blocks that matched more distantly related clades. Additionally, similar non-conforming SNP patterns were observed in (1 the variola virus clade; (2 some cowpox clades; and (3 VACV-CVA, the direct ancestor of VACV-MVA. Thus, traces of past recombination events are common in the various orthopoxvirus clades, including those associated with smallpox and cowpox viruses.

  12. Enteric Immunization of Mice Against Influenza with Recombinant Vaccinia

    Science.gov (United States)

    Meitin, Catherine A.; Bender, Bradley S.; Small, Parker A., Jr.

    1994-11-01

    Intrajejunal administration to mice of a recombinant vaccinia virus containing the influenza virus hemagglutinin gene induced IgA antibody in nasal, gut, and vaginal secretions. It also induced IgG antibody in serum and cell-mediated immunity. The immunization provided significant protection against an influenza virus challenge. This work suggests that enteric-coated recombinant vaccinia could be an orally administered, inexpensive, multivalent, temperature-stable, safe, and effective vaccine for children that could be particularly useful in developing nations, where multiple injections are not easily administered. Oral administration of vaccines should also reduce children's fear of shots at the doctor's office.

  13. Immunodomination during peripheral vaccinia virus infection.

    Directory of Open Access Journals (Sweden)

    Leon C W Lin

    Full Text Available Immunodominance is a fundamental property of CD8(+ T cell responses to viruses and vaccines. It had been observed that route of administration alters immunodominance after vaccinia virus (VACV infection, but only a few epitopes were examined and no mechanism was provided. We re-visited this issue, examining a panel of 15 VACV epitopes and four routes, namely intradermal (i.d., subcutaneous (s.c., intraperitoneal (i.p. and intravenous (i.v. injection. We found that immunodominance is sharpened following peripheral routes of infection (i.d. and s.c. compared with those that allow systemic virus dissemination (i.p. and i.v.. This increased immunodominance was demonstrated with native epitopes of VACV and with herpes simplex virus glycoprotein B when expressed from VACV. Responses to some subdominant epitopes were altered by as much as fourfold. Tracking of virus, examination of priming sites, and experiments restricting virus spread showed that priming of CD8(+ T cells in the spleen was necessary, but not sufficient to broaden responses. Further, we directly demonstrated that immunodomination occurs more readily when priming is mainly in lymph nodes. Finally, we were able to reduce immunodominance after i.d., but not i.p. infection, using a VACV expressing the costimulators CD80 (B7-1 and CD86 (B7-2, which is notable because VACV-based vaccines incorporating these molecules are in clinical trials. Taken together, our data indicate that resources for CD8(+ T cell priming are limiting in local draining lymph nodes, leading to greater immunodomination. Further, we provide evidence that costimulation can be a limiting factor that contributes to immunodomination. These results shed light on a possible mechanism of immunodomination and highlight the need to consider multiple epitopes across the spectrum of immunogenicities in studies aimed at understanding CD8(+ T cell immunity to viruses.

  14. Progressive Vaccinia: Case Description and Laboratory-Guided Therapy With Vaccinia Immune Globulin, ST-246, and CMX001

    Science.gov (United States)

    Lederman, Edith R.; Davidson, Whitni; Groff, Harold L.; Smith, Scott K.; Warkentien, Tyler; Li, Yu; Wilkins, Kimberly A.; Karem, Kevin L.; Akondy, Rama S.; Ahmed, Rafi; Frace, Michael; Shieh, Wun-Ju; Zaki, Sherif; Hruby, Dennis E.; Painter, Wendy P.; Bergman, Kimberly L.; Cohen, Jeffrey I.; Damon, Inger K.

    2012-01-01

    Progressive vaccinia (PV) is a rare but potentially lethal complication that develops in smallpox vaccine recipients with severely impaired cellular immunity. We describe a patient with PV who required treatment with vaccinia immune globulin and who received 2 investigational agents, ST-246 and CMX001. We describe the various molecular, pharmacokinetic, and immunologic studies that provided guidance to escalate and then successfully discontinue therapy. Despite development of resistance to ST-246 during treatment, the patient had resolution of PV. This case demonstrates the need for continued development of novel anti-orthopoxvirus pharmaceuticals and the importance of both intensive and timely clinical and laboratory support in management of PV. PMID:22904336

  15. Vaccinia virus as a subhelper for AAV replication and packaging

    Directory of Open Access Journals (Sweden)

    Andrea R Moore

    Full Text Available Adeno-associated virus (AAV has been widely used as a gene therapy vector to treat a variety of disorders. While these vectors are increasingly popular and successful in the clinic, there is still much to learn about the viruses. Understanding the biology of these viruses is essential in engineering better vectors and generating vectors more efficiently for large-scale use. AAV requires a helper for production and replication making this aspect of the viral life cycle crucial. Vaccinia virus (VV has been widely cited as a helper virus for AAV. However, to date, there are no detailed analyses of its helper function. Here, the helper role of VV was studied in detail. In contrast to common belief, we demonstrated that VV was not a sufficient helper virus for AAV replication. Vaccinia failed to produce rAAV and activate AAV promoters. While this virus could not support rAAV production, Vaccinia could initiate AAV replication and packaging when AAV promoter activation is not necessary. This activity is due to the ability of Vaccinia-driven Rep78 to transcribe in the cytoplasm and subsequently translate in the nucleus and undergo typical functions in the AAV life cycle. As such, VV is subhelper for AAV compared to complete helper functions of adenovirus.

  16. Vaccinia virus encodes a polypeptide with DNA ligase activity.

    Science.gov (United States)

    Kerr, S M; Smith, G L

    1989-11-25

    Vaccinia virus gene SalF 15R potentially encodes a polypeptide of 63 kD which shares 30% amino acid identity with S. pombe and S. cerevisiae DNA ligases. DNA ligase proteins can be identified by incubation with alpha-(32P)ATP, resulting in the formation of a covalent DNA ligase-AMP adduct, an intermediate in the enzyme reaction. A novel radio-labelled polypeptide of approximately 61 kD appears in extracts from vaccinia virus infected cells after incubation with alpha-(32P)ATP. This protein is present throughout infection and is a DNA ligase as the radioactivity is discharged in the presence of either DNA substrate or pyrophosphate. DNA ligase assays show an increase in enzyme activity in cell extracts after vaccinia virus infection. A rabbit antiserum, raised against a bacterial fusion protein of beta-galactosidase and a portion of SalF 15R, immune-precipitates polypeptides of 61 and 54 kD from extracts of vaccinia virus-infected cells. This antiserum also immune-precipitates the novel DNA ligase-AMP adduct, thus proving that the observed DNA ligase is encoded by SalF 15R.

  17. Vaccinia virus as a subhelper for AAV replication and packaging.

    Science.gov (United States)

    Moore, Andrea R; Dong, Biao; Chen, Lingxia; Xiao, Weidong

    2015-01-01

    Adeno-associated virus (AAV) has been widely used as a gene therapy vector to treat a variety of disorders. While these vectors are increasingly popular and successful in the clinic, there is still much to learn about the viruses. Understanding the biology of these viruses is essential in engineering better vectors and generating vectors more efficiently for large-scale use. AAV requires a helper for production and replication making this aspect of the viral life cycle crucial. Vaccinia virus (VV) has been widely cited as a helper virus for AAV. However, to date, there are no detailed analyses of its helper function. Here, the helper role of VV was studied in detail. In contrast to common belief, we demonstrated that VV was not a sufficient helper virus for AAV replication. Vaccinia failed to produce rAAV and activate AAV promoters. While this virus could not support rAAV production, Vaccinia could initiate AAV replication and packaging when AAV promoter activation is not necessary. This activity is due to the ability of Vaccinia-driven Rep78 to transcribe in the cytoplasm and subsequently translate in the nucleus and undergo typical functions in the AAV life cycle. As such, VV is subhelper for AAV compared to complete helper functions of adenovirus.

  18. Cytoplasmic ATR Activation Promotes Vaccinia Virus Genome Replication

    Directory of Open Access Journals (Sweden)

    Antonio Postigo

    2017-05-01

    Full Text Available In contrast to most DNA viruses, poxviruses replicate their genomes in the cytoplasm without host involvement. We find that vaccinia virus induces cytoplasmic activation of ATR early during infection, before genome uncoating, which is unexpected because ATR plays a fundamental nuclear role in maintaining host genome integrity. ATR, RPA, INTS7, and Chk1 are recruited to cytoplasmic DNA viral factories, suggesting canonical ATR pathway activation. Consistent with this, pharmacological and RNAi-mediated inhibition of canonical ATR signaling suppresses genome replication. RPA and the sliding clamp PCNA interact with the viral polymerase E9 and are required for DNA replication. Moreover, the ATR activator TOPBP1 promotes genome replication and associates with the viral replisome component H5. Our study suggests that, in contrast to long-held beliefs, vaccinia recruits conserved components of the eukaryote DNA replication and repair machinery to amplify its genome in the host cytoplasm.

  19. Reverse Genetics of SARS-Related Coronavirus Using Vaccinia Virus-Based Recombination

    Science.gov (United States)

    Zevenhoven, Jessika C.; Weber, Friedemann; Züst, Roland; Kuri, Thomas; Dijkman, Ronald; Chang, Guohui; Siddell, Stuart G.; Snijder, Eric J.; Thiel, Volker; Davidson, Andrew D.

    2012-01-01

    Severe acute respiratory syndrome (SARS) is a zoonotic disease caused by SARS-related coronavirus (SARS-CoV) that emerged in 2002 to become a global health concern. Although the original outbreak was controlled by classical public health measures, there is a real risk that another SARS-CoV could re-emerge from its natural reservoir, either in its original form or as a more virulent or pathogenic strain; in which case, the virus would be difficult to control in the absence of any effective antiviral drugs or vaccines. Using the well-studied SARS-CoV isolate HKU-39849, we developed a vaccinia virus-based SARS-CoV reverse genetic system that is both robust and biosafe. The SARS-CoV genome was cloned in separate vaccinia virus vectors, (vSARS-CoV-5prime and vSARS-CoV-3prime) as two cDNAs that were subsequently ligated to create a genome-length SARS-CoV cDNA template for in vitro transcription of SARS-CoV infectious RNA transcripts. Transfection of the RNA transcripts into permissive cells led to the recovery of infectious virus (recSARS-CoV). Characterization of the plaques produced by recSARS-CoV showed that they were similar in size to the parental SARS-CoV isolate HKU-39849 but smaller than the SARS-CoV isolate Frankfurt-1. Comparative analysis of replication kinetics showed that the kinetics of recSARS-CoV replication are similar to those of SARS-CoV Frankfurt-1, although the titers of virus released into the culture supernatant are approximately 10-fold less. The reverse genetic system was finally used to generate a recSARS-CoV reporter virus expressing Renilla luciferase in order to facilitate the analysis of SARS-CoV gene expression in human dendritic cells (hDCs). In parallel, a Renilla luciferase gene was also inserted into the genome of human coronavirus 229E (HCoV-229E). Using this approach, we demonstrate that, in contrast to HCoV-229E, SARS-CoV is not able to mediate efficient heterologous gene expression in hDCs. PMID:22412934

  20. Reverse genetics of SARS-related coronavirus using vaccinia virus-based recombination.

    Directory of Open Access Journals (Sweden)

    Sjoerd H E van den Worm

    Full Text Available Severe acute respiratory syndrome (SARS is a zoonotic disease caused by SARS-related coronavirus (SARS-CoV that emerged in 2002 to become a global health concern. Although the original outbreak was controlled by classical public health measures, there is a real risk that another SARS-CoV could re-emerge from its natural reservoir, either in its original form or as a more virulent or pathogenic strain; in which case, the virus would be difficult to control in the absence of any effective antiviral drugs or vaccines. Using the well-studied SARS-CoV isolate HKU-39849, we developed a vaccinia virus-based SARS-CoV reverse genetic system that is both robust and biosafe. The SARS-CoV genome was cloned in separate vaccinia virus vectors, (vSARS-CoV-5prime and vSARS-CoV-3prime as two cDNAs that were subsequently ligated to create a genome-length SARS-CoV cDNA template for in vitro transcription of SARS-CoV infectious RNA transcripts. Transfection of the RNA transcripts into permissive cells led to the recovery of infectious virus (recSARS-CoV. Characterization of the plaques produced by recSARS-CoV showed that they were similar in size to the parental SARS-CoV isolate HKU-39849 but smaller than the SARS-CoV isolate Frankfurt-1. Comparative analysis of replication kinetics showed that the kinetics of recSARS-CoV replication are similar to those of SARS-CoV Frankfurt-1, although the titers of virus released into the culture supernatant are approximately 10-fold less. The reverse genetic system was finally used to generate a recSARS-CoV reporter virus expressing Renilla luciferase in order to facilitate the analysis of SARS-CoV gene expression in human dendritic cells (hDCs. In parallel, a Renilla luciferase gene was also inserted into the genome of human coronavirus 229E (HCoV-229E. Using this approach, we demonstrate that, in contrast to HCoV-229E, SARS-CoV is not able to mediate efficient heterologous gene expression in hDCs.

  1. Modified vaccinia virus Ankara protects macaques against respiratory challenge with monkeypox virus.

    NARCIS (Netherlands)

    K.J. Stittelaar (Koert); G. van Amerongen (Geert); I. Kondova (Ivanela); R.F. van Lavieren (Rob); F.H. Pistoor (Frank); H.G.M. Niesters (Bert); G.J.J. van Doornum (Gerard); B.A.M. van der Zeijst (Ben); L. Mateo (Luis); P.J. Chaplin (Paul); A.D.M.E. Osterhaus (Albert); T. Kuiken (Thijs)

    2005-01-01

    textabstractThe use of classical smallpox vaccines based on vaccinia virus (VV) is associated with severe complications in both naive and immune individuals. Modified vaccinia virus Ankara (MVA), a highly attenuated replication-deficient strain of VV, has been proven to be safe in humans and

  2. In vitro recognition of an orf virus early promoter in a vaccinia virus extract

    NARCIS (Netherlands)

    Vos, J C; Mercer, R. A.; Fleming, S B; Robinson, A J

    1992-01-01

    DNA fragments containing varying lengths of the 5' end of an orf virus early gene (ORF3) and its associated promoter were introduced into sodium deoxycholate-solubilized vaccinia virus extracts capable of initiating transcription in vitro from vaccinia virus early promoters. After separation of the

  3. Analysis of variola and vaccinia virus neutralization assays for smallpox vaccines.

    Science.gov (United States)

    Hughes, Christine M; Newman, Frances K; Davidson, Whitni B; Olson, Victoria A; Smith, Scott K; Holman, Robert C; Yan, Lihan; Frey, Sharon E; Belshe, Robert B; Karem, Kevin L; Damon, Inger K

    2012-07-01

    Possible smallpox reemergence drives research for third-generation vaccines that effectively neutralize variola virus. A comparison of neutralization assays using different substrates, variola and vaccinia (Dryvax and modified vaccinia Ankara [MVA]), showed significantly different 90% neutralization titers; Dryvax underestimated while MVA overestimated variola neutralization. Third-generation vaccines may rely upon neutralization as a correlate of protection.

  4. In silico-accelerated identification of conserved and immunogenic variola/vaccinia T-cell epitopes

    DEFF Research Database (Denmark)

    Moise, Leonard; McMurry, Julie A; Buus, Søren

    2009-01-01

    Epitopes shared by the vaccinia and variola viruses underlie the protective effect of vaccinia immunization against variola infection. We set out to identify a subset of cross-reactive epitopes using bioinformatics and immunological methods. Putative T-cell epitopes were computationally predicted...

  5. 77 FR 29914 - Bovine Spongiform Encephalopathy; Importation of Bovines and Bovine Products

    Science.gov (United States)

    2012-05-21

    ... RIN 0579-AC68 Bovine Spongiform Encephalopathy; Importation of Bovines and Bovine Products AGENCY... live bovines and products derived from bovines with regard to bovine spongiform encephalopathy. This... products to revise the conditions for the importation of live bovines and products derived from bovines...

  6. Protein Primary Structure of the Vaccinia Virion at Increased Resolution

    Science.gov (United States)

    Ngo, Tuan; Mirzakhanyan, Yeva; Moussatche, Nissin; Gershon, Paul David

    2016-11-01

    Here we examine the protein covalent structure of the vaccinia virus virion. Within two virion preparations, >88% of the theoretical vaccinia virus-encoded proteome was detected with high confidence, including the first detection of products from 27 open reading frames (ORFs) previously designated "predicted," "uncharacterized," "inferred," or "hypothetical" polypeptides containing as few as 39 amino acids (aa) and six proteins whose detection required nontryptic proteolysis. We also detected the expression of four short ORFs, each of which was located within an ORF ("ORF-within-ORF"), including one not previously recognized or known to be expressed. Using quantitative mass spectrometry (MS), between 58 and 74 proteins were determined to be packaged. A total of 63 host proteins were also identified as candidates for packaging. Evidence is provided that some portion of virion proteins are "nicked" via a combination of endoproteolysis and concerted exoproteolysis in a manner, and at sites, independent of virus origin or laboratory procedures. The size of the characterized virion phosphoproteome was doubled from 189 (J. Matson, W. Chou, T. Ngo, and P. D. Gershon, Virology 452-453:310-323, 2014, doi:http://dx.doi.org/10.1016/j.virol.2014.01.012) to 396 confident, unique phosphorylation sites, 268 of which were within the packaged proteome. This included the unambiguous identification of phosphorylation "hot spots" within virion proteins. Using isotopically enriched ATP, 23 sites of intravirion kinase phosphorylation were detected within nine virion proteins, all at sites already partially occupied within the virion preparations. The clear phosphorylation of proteins RAP94 and RP19 was consistent with the roles of these proteins in intravirion early gene transcription. In a blind search for protein modifications, cysteine glutathionylation and O-linked glycosylation featured prominently. We provide evidence for the phosphoglycosylation of vaccinia virus proteins

  7. Evaluation of surveillance strategies for bovine tuberculosis (Mycobacterium bovis) using an individual based epidemiological model

    NARCIS (Netherlands)

    Fischer, E.A.J.; Roermund, van H.J.W.; Hemerik, L.; Asseldonk, van M.A.P.M.; Jong, de M.C.M.

    2005-01-01

    The Netherlands holds the bovine tuberculosis-free (BTB-free) status according to European Union standards, but in recent years small outbreaks of the infection have occurred. After the last outbreak in 1999 with 10 infected herds the question raised if the current surveillance system, visual

  8. Modeling cholera outbreaks

    Science.gov (United States)

    Longini, Ira M.; Morris, J. Glenn

    2014-01-01

    Mathematical modeling can be a valuable tool for studying infectious disease outbreak dynamics and simulating the effects of possible interventions. Here, we describe approaches to modeling cholera outbreaks and how models have been applied to explore intervention strategies, particularly in Haiti. Mathematical models can play an important role in formulating and evaluating complex cholera outbreak response options. Major challenges to cholera modeling are insufficient data for calibrating models and the need to tailor models for different outbreak scenarios. PMID:23412687

  9. Antiviral effects of bovine interferons on bovine respiratory tract viruses.

    OpenAIRE

    Fulton, R W; Downing, M M; Cummins, J M

    1984-01-01

    The antiviral effects of bovine interferons on the replication of bovine respiratory tract viruses were studied. Bovine turbinate monolayer cultures were treated with bovine interferons and challenged with several bovine herpesvirus 1 strains, bovine viral diarrhea virus, parainfluenza type 3 virus, goat respiratory syncytial virus, bovine respiratory syncytial virus, bovine adenovirus type 7, or vesicular stomatitis virus. Treatment with bovine interferons reduced viral yield for each of the...

  10. Isolation and characterization of cidofovir resistant vaccinia viruses

    Directory of Open Access Journals (Sweden)

    Prichard Mark N

    2008-05-01

    Full Text Available Abstract Background The emergence of drug resistant viruses, together with the possibility of increased virulence, is an important concern in the development of new antiviral compounds. Cidofovir (CDV is a phosphonate nucleotide that is approved for use against cytomegalovirus retinitis and for the emergency treatment of smallpox or complications following vaccination. One mode of action for CDV has been demonstrated to be the inhibition of the viral DNA polymerase. Results We have isolated several CDV resistant (CDVR vaccinia viruses through a one step process, two of which have unique single mutations within the DNA polymerase. An additional resistant virus isolate provides evidence of a second site mutation within the genome involved in CDV resistance. The CDVR viruses were 3–7 fold more resistant to the drug than the parental viruses. The virulence of the CDVR viruses was tested in mice inoculated intranasally and all were found to be attenuated. Conclusion Resistance to CDV in vaccinia virus can be conferred individually by at least two different mutations within the DNA polymerase gene. Additional genes may be involved. This one step approach for isolating resistant viruses without serial passage and in the presence of low doses of drug minimizes unintended secondary mutations and is applicable to other potential antiviral agents.

  11. Vaccinia viruses isolated from cutaneous disease in horses are highly virulent for rabbits.

    Science.gov (United States)

    Felipetto Cargnelutti, Juliana; Schmidt, Candice; Masuda, Eduardo Kenji; Braum, Lisiane Danusa; Weiblen, Rudi; Furtado Flores, Eduardo

    2012-03-01

    Two genotypically distinct Vaccinia viruses (VACV), named P1V and P2V, were isolated from an outbreak of cutaneous disease in horses in Southern Brazil. We herein investigated the susceptibility of rabbits, a proposed animal model, to P1V and P2V infection. Groups of weanling rabbits were inoculated intranasally (IN) with P1V or P2V at low (10(2.5) TCID50), medium (10(4.5)TCID50), or high titer (10(6.5)TCID50). Rabbits inoculated with medium and high titers shed virus in nasal secretions and developed serous to hemorrhagic nasal discharge and severe respiratory distress, followed by progressive apathy and high lethality. Clinical signs appeared around days 3-6 post-inoculation (pi) and lasted up to the day of death or euthanasia (around days 5-10). Virus shedding and clinical signs were less frequent in rabbits inoculated with low virus titers. Viremia was detected in all groups, with different frequencies. Viral DNA was detected in the feces of a few animals inoculated with P1V and P2V, low titer, and with P2V at high titer. Gross necropsy findings and histological examination showed diffuse interstitial fibrousing pneumonia with necrosuppurative bronchopneumonia and intestinal liquid content. Neutralizing antibodies were detected in all inoculated animals surviving beyond day 9 pi. These results show that rabbits are highly susceptible to VACV isolated from horses, and develop severe respiratory and systemic disease upon IN inoculation. Thus, rabbits may be used to study selected aspects of VACV infection and disease. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. The detection of Vaccinia virus confirms the high circulation of Orthopoxvirus in buffaloes living in geographical isolation, Marajó Island, Brazilian Amazon.

    Science.gov (United States)

    Franco-Luiz, Ana Paula Moreira; Fagundes Pereira, Alexandre; de Oliveira, Cairo Henrique Sousa; Barbosa, José Diomedes; Oliveira, Danilo Bretas; Bonjardim, Cláudio Antônio; Ferreira, Paulo César Peregrino; de Souza Trindade, Giliane; Abrahão, Jônatas Santos; Kroon, Erna Geessien

    2016-06-01

    In Brazil, serologic evidence of Orthopoxvirus (OPV) circulation showed positivity around 20% in cattle, humans, monkeys and rodents. Although OPV seropositivity has been described in buffalo herds in southeastern Brazil, no Vaccinia virus (VACV) (member of genus OPV) outbreaks in buffalo herds have been described in this country. This study aimed to investigate the detection of anti-OPV antibodies and to study the OPV genome in Brazilian buffalo herds. Our results demonstrated a high OPV seropositivity in buffalo herds on Marajó Island and molecular data confirmed the circulation of VACV. The geographical isolation conditionmight be a sine qua non condition to explain our results. Copyright © 2016. Published by Elsevier Ltd.

  13. The mechanisms of genetically modified vaccinia viruses for the treatment of cancer.

    Science.gov (United States)

    Jefferson, Artrish; Cadet, Valerie E; Hielscher, Abigail

    2015-09-01

    The use of oncolytic viruses for the treatment of cancer is an emerging field of cancer research and therapy. Oncolytic viruses are designed to induce tumor specific immunity while replicating selectively within cancer cells to cause lysis of the tumor cells. While there are several forms of oncolytic viruses, the use of vaccinia viruses for oncolysis may be more beneficial than other forms of oncolytic viruses. For example, vaccinia viruses have been shown to exert their anti-tumor effects through genetic engineering strategies which enhance their therapeutic efficacy. This paper will address some of the most common forms of genetically modified vaccinia viruses and will explore the mechanisms whereby they selectively target, enter and destroy cancer cells. Furthermore, this review will highlight how vaccinia viruses activate host immune responses against cancer cells and will address clinical trials evaluating the tumor-directed and killing efficacy of these viruses against solid tumors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins

    Directory of Open Access Journals (Sweden)

    Vemulapalli Srilakshmi

    2006-03-01

    Full Text Available Abstract Background Although many vaccinia virus proteins have been identified and studied in detail, only a few studies have attempted a comprehensive survey of the protein composition of the vaccinia virion. These projects have identified the major proteins of the vaccinia virion, but little has been accomplished to identify the unknown or less abundant proteins. Obtaining a detailed knowledge of the viral proteome of vaccinia virus will be important for advancing our understanding of orthopoxvirus biology, and should facilitate the development of effective antiviral drugs and formulation of vaccines. Results In order to accomplish this task, purified vaccinia virions were fractionated into a soluble protein enriched fraction (membrane proteins and lateral bodies and an insoluble protein enriched fraction (virion cores. Each of these fractions was subjected to further fractionation by either sodium dodecyl sulfate-polyacrylamide gel electophoresis, or by reverse phase high performance liquid chromatography. The soluble and insoluble fractions were also analyzed directly with no further separation. The samples were prepared for mass spectrometry analysis by digestion with trypsin. Tryptic digests were analyzed by using either a matrix assisted laser desorption ionization time of flight tandem mass spectrometer, a quadrupole ion trap mass spectrometer, or a quadrupole-time of flight mass spectrometer (the latter two instruments were equipped with electrospray ionization sources. Proteins were identified by searching uninterpreted tandem mass spectra against a vaccinia virus protein database created by our lab and a non-redundant protein database. Conclusion Sixty three vaccinia proteins were identified in the virion particle. The total number of peptides found for each protein ranged from 1 to 62, and the sequence coverage of the proteins ranged from 8.2% to 94.9%. Interestingly, two vaccinia open reading frames were confirmed as being expressed

  15. Vaccinia scars associated with better survival for adults. An observational study from Guinea-Bissau

    DEFF Research Database (Denmark)

    Aaby, Peter; Gustafson, Per; Roth, Adam Anders Edvin

    2006-01-01

    Live vaccines including BCG and measles may have non-targeted beneficial effects on childhood survival in areas with high mortality. The authors therefore undertook a survey of vaccinia scars to evaluate subsequent mortality.......Live vaccines including BCG and measles may have non-targeted beneficial effects on childhood survival in areas with high mortality. The authors therefore undertook a survey of vaccinia scars to evaluate subsequent mortality....

  16. Human CD4+ T cell epitopes from vaccinia virus induced by vaccination or infection.

    Directory of Open Access Journals (Sweden)

    J Mauricio Calvo-Calle

    2007-10-01

    Full Text Available Despite the importance of vaccinia virus in basic and applied immunology, our knowledge of the human immune response directed against this virus is very limited. CD4(+ T cell responses are an important component of immunity induced by current vaccinia-based vaccines, and likely will be required for new subunit vaccine approaches, but to date vaccinia-specific CD4(+ T cell responses have been poorly characterized, and CD4(+ T cell epitopes have been reported only recently. Classical approaches used to identify T cell epitopes are not practical for large genomes like vaccinia. We developed and validated a highly efficient computational approach that combines prediction of class II MHC-peptide binding activity with prediction of antigen processing and presentation. Using this approach and screening only 36 peptides, we identified 25 epitopes recognized by T cells from vaccinia-immune individuals. Although the predictions were made for HLA-DR1, eight of the peptides were recognized by donors of multiple haplotypes. T cell responses were observed in samples of peripheral blood obtained many years after primary vaccination, and were amplified after booster immunization. Peptides recognized by multiple donors are highly conserved across the poxvirus family, including variola, the causative agent of smallpox, and may be useful in development of a new generation of smallpox vaccines and in the analysis of the immune response elicited to vaccinia virus. Moreover, the epitope identification approach developed here should find application to other large-genome pathogens.

  17. Human CD4+ T Cell Epitopes from Vaccinia Virus Induced by Vaccination or Infection

    Science.gov (United States)

    Calvo-Calle, J. Mauricio; Strug, Iwona; Nastke, Maria-Dorothea; Baker, Stephen P; Stern, Lawrence J

    2007-01-01

    Despite the importance of vaccinia virus in basic and applied immunology, our knowledge of the human immune response directed against this virus is very limited. CD4+ T cell responses are an important component of immunity induced by current vaccinia-based vaccines, and likely will be required for new subunit vaccine approaches, but to date vaccinia-specific CD4+ T cell responses have been poorly characterized, and CD4+ T cell epitopes have been reported only recently. Classical approaches used to identify T cell epitopes are not practical for large genomes like vaccinia. We developed and validated a highly efficient computational approach that combines prediction of class II MHC-peptide binding activity with prediction of antigen processing and presentation. Using this approach and screening only 36 peptides, we identified 25 epitopes recognized by T cells from vaccinia-immune individuals. Although the predictions were made for HLA-DR1, eight of the peptides were recognized by donors of multiple haplotypes. T cell responses were observed in samples of peripheral blood obtained many years after primary vaccination, and were amplified after booster immunization. Peptides recognized by multiple donors are highly conserved across the poxvirus family, including variola, the causative agent of smallpox, and may be useful in development of a new generation of smallpox vaccines and in the analysis of the immune response elicited to vaccinia virus. Moreover, the epitope identification approach developed here should find application to other large-genome pathogens. PMID:17937498

  18. Low-resolution structure of vaccinia virus DNA replication machinery.

    Science.gov (United States)

    Sèle, Céleste; Gabel, Frank; Gutsche, Irina; Ivanov, Ivan; Burmeister, Wim P; Iseni, Frédéric; Tarbouriech, Nicolas

    2013-02-01

    Smallpox caused by the poxvirus variola virus is a highly lethal disease that marked human history and was eradicated in 1979 thanks to a worldwide mass vaccination campaign. This virus remains a significant threat for public health due to its potential use as a bioterrorism agent and requires further development of antiviral drugs. The viral genome replication machinery appears to be an ideal target, although very little is known about its structure. Vaccinia virus is the prototypic virus of the Orthopoxvirus genus and shares more than 97% amino acid sequence identity with variola virus. Here we studied four essential viral proteins of the replication machinery: the DNA polymerase E9, the processivity factor A20, the uracil-DNA glycosylase D4, and the helicase-primase D5. We present the recombinant expression and biochemical and biophysical characterizations of these proteins and the complexes they form. We show that the A20D4 polymerase cofactor binds to E9 with high affinity, leading to the formation of the A20D4E9 holoenzyme. Small-angle X-ray scattering yielded envelopes for E9, A20D4, and A20D4E9. They showed the elongated shape of the A20D4 cofactor, leading to a 150-Å separation between the polymerase active site of E9 and the DNA-binding site of D4. Electron microscopy showed a 6-fold rotational symmetry of the helicase-primase D5, as observed for other SF3 helicases. These results favor a rolling-circle mechanism of vaccinia virus genome replication similar to the one suggested for tailed bacteriophages.

  19. Immunoprophylaxis of bovine respiratory syndrome

    Directory of Open Access Journals (Sweden)

    Rogan Dragan

    2010-01-01

    Full Text Available Bovine Respiratory Syndrome (BRS is a multifactorial disease caused by the interaction of infective agents, the environment and the individual immunological response of animals in the herd. Despite five decades of research on BRS, no clear understanding of how environmental factors influence pathogenic outcomes of the disease has been defined. As such, the development of immunoprophylaxis and vaccine programmes to prevent outbreaks of BRS in cattle has not been successful. The current paper discusses vaccination programmes for all categories of cattle and presents a review of existing vaccines being used for immunoprophylaxis of respiratory syndrome in cattle and discusses the advantages and disadvantages of the currently used vaccines and vaccination programmes. Lastly, a discussion detailing the design of future perfect vaccines is presented.

  20. Human and animal infections by vaccinia-like viruses in the state of Rio de Janeiro: a novel expanding zoonosis.

    Science.gov (United States)

    Schatzmayr, H G; Costa, R V C; Gonçalves, M C R; D'Andréa, P S; Barth, O M

    2011-12-30

    Since 1999, vesicular infections caused by Orthopoxvirus in humans and animals, mainly in dairy cattle, have been identified in 20 municipalities in the Rio de Janeiro state of Brazil. This paper describes studies conducted in counties of the northwestern, middle-Paraíba Valley and southern regions of the Rio de Janeiro state where 77 human, 346 bovine and 78 rodent samples were collected over the past ten years. Laboratory investigations using virus isolation, electron microscopy, molecular biology (PCR) and serological analysis confirmed Orthopoxvirus infections in 77.9% of human, 49.2% of dairy cattle and 17.9% of rodent samples. The characterisation of the Cantagalo/IOC strain reconfirmed that this virus was a vaccinia-like virus. In other regions of the Rio de Janeiro state, vesicular/pustular infections in animals and humans are suspected but these have not yet been confirmed. A continuous surveillance system has been established to monitor these regions in addition to several other states of the Brazilian Federation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. PREVALENCE OF BOVINE (1)

    African Journals Online (AJOL)

    BACKGROUND: Tuberculosis is caused by a number of Mycobacterium species, of which Mycobacterium bovis, causing 'bovine tuberculosis' is ... KEY WORDS: Mycobacterium bovis, Zoonosis, Holeta, Ethiopia causing 'bovine tuberculosis ..... isolation of infected animals in which communal grazing and watering practiced.

  2. Protection of Mice from Lethal Vaccinia Virus Infection by Vaccinia Virus Protein Subunits with a CpG Adjuvant

    Directory of Open Access Journals (Sweden)

    Sarah Reeman

    2017-12-01

    Full Text Available Smallpox vaccination carries a high risk of adverse events in recipients with a variety of contra-indications for live vaccines. Although alternative non-replicating vaccines have been described in the form of replication-deficient vaccine viruses, DNA vaccines, and subunit vaccines, these are less efficacious than replicating vaccines in animal models. DNA and subunit vaccines in particular have not been shown to give equivalent protection to the traditional replicating smallpox vaccine. We show here that combinations of the orthopoxvirus A27, A33, B5 and L1 proteins give differing levels of protection when administered in different combinations with different adjuvants. In particular, the combination of B5 and A27 proteins adjuvanted with CpG oligodeoxynucleotides (ODN gives a level of protection in mice that is equivalent to the Lister traditional vaccine in a lethal vaccinia virus challenge model.

  3. Great Basin insect outbreaks

    Science.gov (United States)

    Barbara Bentz; Diane Alston; Ted Evans

    2008-01-01

    Outbreaks of native and exotic insects are important drivers of ecosystem dynamics in the Great Basin. The following provides an overview of range, forest, ornamental, and agricultural insect outbreaks occurring in the Great Basin and the associated management issues and research needs.

  4. Application of combined SMRT and long-read pyrosequencing to produce reference genome sequences of bacteria associated with respiratory disease outbreaks in beef cattle

    Science.gov (United States)

    The effectiveness of comparing complete genomes for elucidating mechanisms of virulence in pathogenic organisms has been demonstrated recently in foodborne and waterborne human disease outbreaks. We built upon this concept to investigate virulence mechanisms in bovine respiratory disease complex (B...

  5. Waterborne outbreaks of cryptosporidiosis

    Directory of Open Access Journals (Sweden)

    Rachel M. Chalmers

    2012-12-01

    Full Text Available Water is the most commonly reported vehicle of transmission in Cryptosporidium outbreaks. While mains drinking water quality is highly regulated in industrialised countries, treated recreational water venues remain highly variable and these have emerged as important settings in the transmission of cryptosporidiosis. Epidemiological investigations of outbreaks benefit from supplementary microbiological evidence and, more recently, the application of molecular typing data to link isolates from cases to each other and to suspected sources. This article documents how waterborne Cryptosporidium outbreaks are identified and reported, how such outbreaks have acted as drivers of regulatory change, and some of the recent developments in the detection and investigation of these outbreaks and their spread, especially the application of molecular typing assays.

  6. Recombinant viral vaccines for enzootic bovine leucosis.

    Science.gov (United States)

    Daniel, R C; Gatei, M H; Good, M F; Boyle, D B; Lavin, M F

    1993-10-01

    Recently published studies on the development and use of recombinant vaccinia virus (VV) vaccines incorporating either the complete envelope (env) gene or only a fragment of the env gene consisting of the coding sequence for the env glycoprotein 51 (gp51) and part of gp30 of the bovine leukaemia virus (BLV) are described. It has been reported that vaccination of sheep with recombinant VV vaccines containing the complete env gene appears to protect sheep against challenge infection with BLV. The evidence for this protection is based on the lack of persistence of high titres of anti-gp51 antibodies compared with unvaccinated BLV infected controls, on the enhanced CD4 proliferative responses to specific BLV gp51 synthetic peptides in the vaccinated sheep, and on the inability to detect BLV pro-virus by polymerase chain reaction in the vaccinated sheep after 4 months following challenge infection compared with continual detection in unvaccinated sheep over a 16 month trial period. It has been suggested that cell-mediated immune responses may be an important aspect of protective immunity against BLV infection and it has been reported that large tracts of amino acid sequences within the env and pol genes are highly conserved in different isolates from different countries which is of importance in designing peptide derived vaccines.

  7. Protective effect of Toll-like receptor 4 in pulmonary vaccinia infection.

    Directory of Open Access Journals (Sweden)

    Martha A Hutchens

    2008-09-01

    Full Text Available Innate immune responses are essential for controlling poxvirus infection. The threat of a bioterrorist attack using Variola major, the smallpox virus, or zoonotic transmission of other poxviruses has renewed interest in understanding interactions between these viruses and their hosts. We recently determined that TLR3 regulates a detrimental innate immune response that enhances replication, morbidity, and mortality in mice in response to vaccinia virus, a model pathogen for studies of poxviruses. To further investigate Toll-like receptor signaling in vaccinia infection, we first focused on TRIF, the only known adapter protein for TLR3. Unexpectedly, bioluminescence imaging showed that mice lacking TRIF are more susceptible to vaccinia infection than wild-type mice. We then focused on TLR4, the other Toll-like receptor that signals through TRIF. Following respiratory infection with vaccinia, mice lacking TLR4 signaling had greater viral replication, hypothermia, and mortality than control animals. The mechanism of TLR4-mediated protection was not due to increased release of proinflammatory cytokines or changes in total numbers of immune cells recruited to the lung. Challenge of primary bone marrow macrophages isolated from TLR4 mutant and control mice suggested that TLR4 recognizes a viral ligand rather than an endogenous ligand. These data establish that TLR4 mediates a protective innate immune response against vaccinia virus, which informs development of new vaccines and therapeutic agents targeted against poxviruses.

  8. Non-coding RNAs and heme oxygenase-1 in vaccinia virus infection

    Energy Technology Data Exchange (ETDEWEB)

    Meseda, Clement A. [Division of Viral Products, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Srinivasan, Kumar [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States); Wise, Jasen [Qiagen, Frederick, MD (United States); Catalano, Jennifer [Center for Tobacco Products, Food and Drug Administration, Bethesda, MD (United States); Yamada, Kenneth M. [National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Division of Transfusion Transmitted Diseases, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD (United States)

    2014-11-07

    Highlights: • Heme oxygenase-1 (HO-1) induction inhibited vaccinia virus infection of macrophages. • Reduced infectivity inversely correlated with increased expression of non-coding RNAs. • The regulation of HO-1 and ncRNAs suggests a novel host defense response against vaccinia virus infection. - Abstract: Small nuclear RNAs (snRNAs) are <200 nucleotide non-coding uridylate-rich RNAs. Although the functions of many snRNAs remain undetermined, a population of snRNAs is produced during the early phase of infection of cells by vaccinia virus. In the present study, we demonstrate a direct correlation between expression of the cytoprotective enzyme heme oxygenase-1 (HO-1), suppression of selective snRNA expression, and inhibition of vaccinia virus infection of macrophages. Hemin induced HO-1 expression, completely reversed virus-induced host snRNA expression, and suppressed vaccinia virus infection. This involvement of specific virus-induced snRNAs and associated gene clusters suggests a novel HO-1-dependent host-defense pathway in poxvirus infection.

  9. Assembly of vaccinia virus: Role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks

    NARCIS (Netherlands)

    Sodeik, B.; Doms, R.W.; Ericsson, M.; Hiller, G.; Machamer, C.E.; van 't Hof, W.J.; van Meer, G.|info:eu-repo/dai/nl/068570368; Moss, B.; Griffiths, G.

    1993-01-01

    Vaccinia virus, the prototype of the Poxviridae, is a large DNA virus which replicates in the cytoplasm of the host cell. The assembly pathway of vaccinia virus displays several unique features, such as the production of two structurally distinct, infectious forms. One of these, termed intracellular

  10. In a nutshell: structure and assembly of the vaccinia virion.

    Science.gov (United States)

    Condit, Richard C; Moussatche, Nissin; Traktman, Paula

    2006-01-01

    Poxviruses comprise a large family of viruses characterized by a large, linear dsDNA genome, a cytoplasmic site of replication and a complex virion morphology. The most notorious member of the poxvirus family is variola, the causative agent of smallpox. The laboratory prototype virus used for the study of poxviruses is vaccinia, the virus that was used as a live, naturally attenuated vaccine for the eradication of smallpox. Both the morphogenesis and structure of poxvirus virions are unique among viruses. Poxvirus virions apparently lack any of the symmetry features common to other viruses such as helical or icosahedral capsids or nucleocapsids. Instead poxvirus virions appear as "brick shaped" or "ovoid" membrane-bound particles with a complex internal structure featuring a walled, biconcave core flanked by "lateral bodies." The virion assembly pathway involves a remarkable fabrication of membrane-containing crescents and immature virions, which evolve into mature virions in a process that is unparalleled in virology. As a result of significant advances in poxvirus genetics and molecular biology during the past 15 years, we can now positively identify over 70 specific gene products contained in poxvirus virions, and we can describe the effects of mutations in over 50 specific genes on poxvirus assembly. This review summarizes these advances and attempts to assemble them into a comprehensible and thoughtful picture of poxvirus structure and assembly.

  11. National Outbreak Reporting System

    Data.gov (United States)

    U.S. Department of Health & Human Services — The National Outbreak Reporting System (NORS) is a web-based platform designed to support reporting to CDC by local, state, and territorial health departments in the...

  12. An outbreak of bovine meningoencephalomyelitis with identification of Halicephalobus gingivalis

    DEFF Research Database (Denmark)

    Enemark, Heidi; Hansen, Mette Sif; Jensen, Tim Kåre

    2016-01-01

    , revealing genetic variations of 0.5–4.4% and 0.7–8.6%, respectively, between the H. gingivalis isolated from the Danish calf and published isolates, collected worldwide from free-living and parasitic stages of the nematode. Clinical symptoms and histological changes indicated infection with H. gingivalis...

  13. Frequency of Adverse Events after Vaccination with Different Vaccinia Strains.

    NARCIS (Netherlands)

    Kretzschmar, Mirjam; Wallinga, Jacco; Teunis, Peter F M; Xing, Shuqin; Mikolajczyk, Rafael

    2006-01-01

    BACKGROUND: Large quantities of smallpox vaccine have been stockpiled to protect entire nations against a possible reintroduction of smallpox. Planning for an appropriate use of these stockpiled vaccines in response to a smallpox outbreak requires a rational assessment of the risks of

  14. Doxycycline Inducible Melanogenic Vaccinia Virus as Theranostic Anti-Cancer Agent.

    Science.gov (United States)

    Kirscher, Lorenz; Deán-Ben, Xosé Luis; Scadeng, Miriam; Zaremba, Angelika; Zhang, Qian; Kober, Christina; Fehm, Thomas Felix; Razansky, Daniel; Ntziachristos, Vasilis; Stritzker, Jochen; Szalay, Aladar A

    2015-01-01

    We reported earlier the diagnostic potential of a melanogenic vaccinia virus based system in magnetic resonance (MRI) and optoacoustic deep tissue imaging (MSOT). Since melanin overproduction lead to attenuated virus replication, we constructed a novel recombinant vaccinia virus strain (rVACV), GLV-1h462, which expressed the key enzyme of melanogenesis (tyrosinase) under the control of an inducible promoter-system. In this study melanin production was detected after exogenous addition of doxycycline in two different tumor xenograft mouse models. Furthermore, it was confirmed that this novel vaccinia virus strain still facilitated signal enhancement as detected by MRI and optoacoustic tomography. At the same time we demonstrated an enhanced oncolytic potential compared to the constitutively melanin synthesizing rVACV system.

  15. Bovine respiratory syncytial virus (BRSV) pneumonia in beef calf herds despite vaccination

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Tegtmeier, C.; Pedersen, E.

    2001-01-01

    The present report describes the clinical, pathological, serological and virological findings in calves from 2 larger Danish beef herds experiencing outbreaks of pneumonia. The calves had been vaccinated with an inactivated bovine respiratory syncytial virus (BRSV) vaccine 2 months prior to the o...... beef herds failed to protect the calves against severe or even fatal BRSV mediated respiratory disease 2 months later.......The present report describes the clinical, pathological, serological and virological findings in calves from 2 larger Danish beef herds experiencing outbreaks of pneumonia. The calves had been vaccinated with an inactivated bovine respiratory syncytial virus (BRSV) vaccine 2 months prior...... to the outbreak. The clinical signs comprised nasal discharge, pyrexia, cough and increased respiratory rates. A total of 28 calves died in the 2 herds. The laboratory investigations revealed that BRSV was involved and probably initiated both outbreaks. Furthermore, the serological results suggested...

  16. INTERFERENCE INDUCED AGAINST VACCINIA IN AN ADENOVIRUS-RHF-1 SYSTEM.

    Science.gov (United States)

    KHOOBYARIAN, N

    1964-01-01

    Khoobyarian, Newton (University of Illinois, Chicago). Interference induced against vaccinia in an adenovirus-RHF-1 system. J. Bacteriol. 87:24-32. 1964.-It was observed that a continuous line of rabbit heart cell culture (strain RHF-1), when overlaid with growth medium after infection of cultures with adenovirus types 2, 3, 4, and 7, would develop resistance to vaccinia plaque formation. Data are presented to provide some information on the nature of such resistance observed specifically in an adenovirus 2-RHF-1 system. An analysis of this phenomenon indicated the following. (i) At least 6 hr were required before the start of vaccinia inhibition, and 15 to 18 hr were necessary for the maximal occurrence of inhibition; the degree of interference established varied with the concentration of adenovirus. (ii) The site of interference action was inside rather than outside the cells, since hardly any difference could be shown in the rate of vaccinia adsorption on resistant and susceptible cells. (iii) The interaction of adenovirus with RHF-1 cells not only would inhibit cell infection with vaccinia but would also suppress the 24- to 48-hr yield of virus. (iv) When RHF-1 cells were overlaid with maintenance medium after their infection with a low multiplicity of RHF-1 passaged adenovirus 2 (to establish sublethal infection), an inhibitory substance of varied activity could be detected daily over a period of at least 10 days which, when transferred to normal RHF-1 cultures, would render them resistant to vaccinia infection. (v) Although limited growth of virus appeared to be responsible for the production of the inhibitor, increase in inhibitory activity did not seem to coincide with increase in virus titer. (vi) The inhibitor seemed to resemble interferons in inhibiting virus plaque production, but its exact identity and the mode of action remain to be determined.

  17. Effects of poliovirus 2A(pro) on vaccinia virus gene expression.

    Science.gov (United States)

    Feduchi, E; Aldabe, R; Novoa, I; Carrasco, L

    1995-12-15

    The effects of transient expression of poliovirus 2A(pro) on p220 cleavage in COS cells have been analyzed. When 2A(pro) was cloned in plasmid pTM1 and transiently expressed in COS cells, efficient cleavage of p220 occurred after infection of these cells with a recombinant vaccinia virus bearing phage T7 RNA polymerase. High numbers of COS cells were transfected with pTM1-2A, as judged by p220 cleavage, thereby allowing an analysis of the effects of poliovirus 2A(pro) on vaccinia virus gene expression. A 40-50% cleavage of p220 by transfected poliovirus 2A(pro) was observed ten hours post infection and cleavage was almost complete (80-90%) 20-25 hours post infection with vaccinia virus. Profound inhibition of vaccinia virus protein synthesis was detectable ten hours post infection and was maximal 20-25 hours post infection. This inhibition resulted from neither a blockade of transcription of vaccinia virus nor a lack of translatability of the mRNAs present in cells that synthesize poliovirus 2A(pro). Addition of ara-C inhibited the replication of vaccinia virus and allowed the continued synthesis of cellular proteins. Under these conditions, 2A(pro) is expressed and blocks cellular translation. Finally, p220 cleavage by 2A(pro) did not inhibit the translation of a mRNA encoding poliovirus protein 2C, as directed by the 5' leader sequences of encephalomiocarditis virus. Therefore, these findings show a correlation between p220 cleavage and inhibition of translation from newly made mRNAs. Our results are discussed in the light of present knowledge of p220 function, and new approaches are considered that might provide further insights into the function(s) of initiation factor eIF-4F.

  18. Vaccinia Virus Recombinants: Expression of VSV Genes and Protective Immunization of Mice and Cattle

    Science.gov (United States)

    Mackett, M.; Yilma, T.; Rose, J. K.; Moss, B.

    1985-01-01

    Vesicular stomatitis virus (VSV) causes a contagious disease of horses, cattle, and pigs. When DNA copies of messenger RNA's for the G or N proteins of VSV were linked to a vaccinia virus promoter and inserted into the vaccinia genome, the recombinants retained infectivity and synthesized VSV polypeptides. After intradermal vaccination with live recombinant virus expressing the G protein, mice produced VSV-neutralizing antibodies and were protected against lethal encephalitis upon intravenous challenge with VSV. In cattle, the degree of protection against intradermalingually injected VSV was correlated with the level of neutralizing antibody produced following vaccination.

  19. 78 FR 73993 - Bovine Spongiform Encephalopathy; Importation of Bovines and Bovine Products

    Science.gov (United States)

    2013-12-10

    ... Health Inspection Service 9 CFR Parts 92, 93, 94, 95, 96, and 98 RIN 0579-AC68 Bovine Spongiform Encephalopathy; Importation of Bovines and Bovine Products Corrections In rule document 2013-28228 appearing on...

  20. 77 FR 20319 - Bovine Spongiform Encephalopathy; Importation of Bovines and Bovine Products

    Science.gov (United States)

    2012-04-04

    ...; ] DEPARTMENT OF AGRICULTURE Animal and Plant Health Inspection Service 9 CFR Part 93 RIN 0579-AC68 Bovine Spongiform Encephalopathy; Importation of Bovines and Bovine Products Correction In proposed rule document...

  1. Live-Cell Imaging of Vaccinia Virus Recombination.

    Directory of Open Access Journals (Sweden)

    Patrick Paszkowski

    2016-08-01

    Full Text Available Recombination between co-infecting poxviruses provides an important mechanism for generating the genetic diversity that underpins evolution. However, poxviruses replicate in membrane-bound cytoplasmic structures known as factories or virosomes. These are enclosed structures that could impede DNA mixing between co-infecting viruses, and mixing would seem to be essential for this process. We hypothesize that virosome fusion events would be a prerequisite for recombination between co-infecting poxviruses, and this requirement could delay or limit viral recombination. We have engineered vaccinia virus (VACV to express overlapping portions of mCherry fluorescent protein fused to a cro DNA-binding element. In cells also expressing an EGFP-cro fusion protein, this permits live tracking of virus DNA and genetic recombination using confocal microscopy. Our studies show that different types of recombination events exhibit different timing patterns, depending upon the relative locations of the recombining elements. Recombination between partly duplicated sequences is detected soon after post-replicative genes are expressed, as long as the reporter gene sequences are located in cis within an infecting genome. The same kinetics are also observed when the recombining elements are divided between VACV and transfected DNA. In contrast, recombination is delayed when the recombining sequences are located on different co-infecting viruses, and mature recombinants aren't detected until well after late gene expression is well established. The delay supports the hypothesis that factories impede inter-viral recombination, but even after factories merge there remain further constraints limiting virus DNA mixing and recombinant gene assembly. This delay could be related to the continued presence of ER-derived membranes within the fused virosomes, membranes that may once have wrapped individual factories.

  2. Oncolytic vaccinia virotherapy of anaplastic thyroid cancer in vivo.

    Science.gov (United States)

    Lin, Shu-Fu; Price, Daniel L; Chen, Chun-Hao; Brader, Peter; Li, Sen; Gonzalez, Lorena; Zhang, Qian; Yu, Yong A; Chen, Nanhai; Szalay, Aladar A; Fong, Yuman; Wong, Richard J

    2008-11-01

    Anaplastic thyroid carcinoma (ATC) is a fatal disease with a median survival of only 6 months. Novel therapies are needed to improve dismal outcomes. A mutated, replication-competent, vaccinia virus (GLV-1h68) has oncolytic effects on human ATC cell lines in vitro. We assessed the utility of GLV-1h68 in treating anaplastic thyroid cancer in vivo. Athymic nude mice with xenograft flank tumors of human ATCs (8505C and DRO90-1) were treated with a single intratumoral injection of GLV-1h68 at low dose (5x10(5) plaque-forming unit), high dose (5x10(6) plaque-forming unit), or PBS. Virus-mediated marker gene expression (luciferase, green fluorescent protein, and beta-galactosidase), viral biodistribution, and flank tumor volumes were measured. Luciferase expression was detected 2 d after injection. Continuous viral replication within tumors was reflected by increasing luciferase activity to d 9. At d 10, tumor viral recovery was increased more than 50-fold as compared with the injected dose, and minimal virus was recovered from the lung, liver, brain, heart, spleen, and kidneys. High-dose virus directly injected into normal tissues was undetectable at d 10. The mean volume of control 8505C tumors increased 50.8-fold by d 45, in contrast to 10.5-fold (low dose) and 2.1-fold (high dose; P=0.028) increases for treated tumors. DRO90-1 tumors also showed significant growth inhibition by high-dose virus. No virus-related toxicity was observed throughout the study. GLV-1h68 efficiently infects, expresses transgenes within, and inhibits the growth of ATC in vivo. These promising findings support future clinical trials for patients with ATC.

  3. Myxoma and vaccinia viruses bind differentially to human leukocytes.

    Science.gov (United States)

    Chan, Winnie M; Bartee, Eric C; Moreb, Jan S; Dower, Ken; Connor, John H; McFadden, Grant

    2013-04-01

    Myxoma virus (MYXV) and vaccinia virus (VACV), two distinct members of the family Poxviridae, are both currently being developed as oncolytic virotherapeutic agents. Recent studies have demonstrated that ex vivo treatment with MYXV can selectively recognize and kill contaminating cancerous cells from autologous bone marrow transplants without perturbing the engraftment of normal CD34(+) hematopoietic stem and progenitor cells. However, the mechanism(s) by which MYXV specifically recognizes and eliminates the cancer cells in the autografts is not understood. While little is known about the cellular attachment factor(s) exploited by MYXV for entry into any target cells, VACV has been shown to utilize cell surface glycosaminoglycans such as heparan sulfate (HS), the extracellular matrix protein laminin, and/or integrin β1. We have constructed MYXV and VACV virions tagged with the Venus fluorescent protein and compared their characteristics of binding to various human cancer cell lines as well as to primary human leukocytes. We report that the binding of MYXV or VACV to some adherent cell lines could be partially inhibited by heparin, but laminin blocked only VACV binding. In contrast to cultured fibroblasts, the binding of MYXV and VACV to a wide spectrum of primary human leukocytes could not be competed by either HS or laminin. Additionally, MYXV and VACV exhibited very different binding characteristics against certain select human leukocytes, suggesting that the two poxviruses utilize different cell surface determinants for the attachment to these cells. These results indicate that VACV and MYXV can exhibit very different oncolytic tropisms against some cancerous human leukocytes.

  4. Diagnosis of bovine neosporosis.

    Science.gov (United States)

    Dubey, J P; Schares, G

    2006-08-31

    The protozoan parasite Neospora caninum is a major cause of abortion in cattle. The diagnosis of neosporosis-associated mortality and abortion in cattle is difficult. In the present paper we review histologic, serologic, immunohistochemical, and molecular methods for dignosis of bovine neosporosis. Although not a routine method of diagnosis, methods to isolate viable N. caninum from bovine tissues are also reviewed.

  5. Efficacy and Safety of Doubly-Regulated Vaccinia Virus in a Mouse Xenograft Model of Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Muneyoshi Futami

    2017-09-01

    Full Text Available Multiple myeloma is a malignancy of plasma cells of the bone marrow. Although the prognosis is variable, no curative therapy has been defined. Vaccinia virus infects cancer cells and kills such cells in a variety of ways. These include direct infection, triggering of immunomediated cell death, and vascular collapse. The potential of the vaccinia virus as an anti-tumor therapy has attracted the attention of oncologists. Interestingly, our preliminary experiments revealed that myeloma cells were particularly susceptible to vaccinia virus. To exploit this susceptibility and to render vaccinia more myeloma specific, we generated thymidine-kinase-deleted microRNA (miRNA-regulated vaccinia viruses in which the essential viral gene B5R was regulated by miRNAs of normal human cells. Of the miRNAs examined, let-7a was found to be the most reliable in terms of regulating viral transmission. Exposure to unregulated vaccinia virus killed myeloma-transplanted severe combined immunodeficiency (SCID mice; the animals succumbed to viral toxicity. In contrast, the thymidine-kinase-deleted let-7a-regulated virus remained localized within myeloma cells, triggering tumor regression and improving overall survival. In conclusion, a thymidine-kinase-deleted let-7a-regulated vaccinia virus was safe and effective for mice, warranting clinical trials in humans.

  6. Use of a recombinant vaccinia virus expressing interferon gamma for post-exposure protection against vaccinia and ectromelia viruses.

    Directory of Open Access Journals (Sweden)

    Susan A Holechek

    Full Text Available Post-exposure vaccination with vaccinia virus (VACV has been suggested to be effective in minimizing death if administered within four days of smallpox exposure. While there is anecdotal evidence for efficacy of post-exposure vaccination this has not been definitively studied in humans. In this study, we analyzed post-exposure prophylaxis using several attenuated recombinant VACV in a mouse model. A recombinant VACV expressing murine interferon gamma (IFN-γ was most effective for post-exposure protection of mice infected with VACV and ectromelia virus (ECTV. Untreated animals infected with VACV exhibited severe weight loss and morbidity leading to 100% mortality by 8 to 10 days post-infection. Animals treated one day post-infection had milder symptoms, decreased weight loss and morbidity, and 100% survival. Treatment on days 2 or 3 post-infection resulted in 40% and 20% survival, respectively. Similar results were seen in ECTV-infected mice. Despite the differences in survival rates in the VACV model, the viral load was similar in both treated and untreated mice while treated mice displayed a high level of IFN-γ in the serum. These results suggest that protection provided by IFN-γ expressed by VACV may be mediated by its immunoregulatory activities rather than its antiviral effects. These results highlight the importance of IFN-γ as a modulator of the immune response for post-exposure prophylaxis and could be used potentially as another post-exposure prophylaxis tool to prevent morbidity following infection with smallpox and other orthopoxviruses.

  7. Planning for smallpox outbreaks

    Science.gov (United States)

    Ferguson, Neil M.; Keeling, Matt J.; John Edmunds, W.; Gani, Raymond; Grenfell, Bryan T.; Anderson, Roy M.; Leach, Steve

    2003-10-01

    Mathematical models of viral transmission and control are important tools for assessing the threat posed by deliberate release of the smallpox virus and the best means of containing an outbreak. Models must balance biological realism against limitations of knowledge, and uncertainties need to be accurately communicated to policy-makers. Smallpox poses the particular challenge that key biological, social and spatial factors affecting disease spread in contemporary populations must be elucidated largely from historical studies undertaken before disease eradication in 1979. We review the use of models in smallpox planning within the broader epidemiological context set by recent outbreaks of both novel and re-emerging pathogens.

  8. Derepression of a novel class of vaccinia virus genes upon DNA replication

    NARCIS (Netherlands)

    Vos, J C; Stunnenberg, H.G.

    1988-01-01

    A novel class of vaccinia virus genes, called intermediate, is expressed immediately post-replication and prior to the onset of late gene transcription. Intermediate transcription is dependent on trans-acting factors which are present in an active state in virus-infected cells prior to the onset of

  9. The development of a monolith-based purification process for Orthopoxvirus vaccinia virus Lister strain.

    Science.gov (United States)

    Vincent, David; Kramberger, Petra; Hudej, Rosana; Štrancar, Aleš; Wang, Yaohe; Zhou, Yuhong; Velayudhan, Ajoy

    2017-11-17

    The purification of large viruses remains an important field of research and development. The development of efficient purification trains is restricted by limited analytical methods, as well as by the complexity of large viruses, as well as the high variability in starting material from cell culture. Vaccinia virus holds great potential as an oncolytic and immunotherapeutic vaccine against a broad spectrum of cancers. In this work, monolith-based capture and polishing chromatographic steps for vaccinia virus Lister strain has been developed. Virus produced in CV-1 cells was harvested and passed through a 0.8μm pre-filter before loading onto CIEX, AIEX and HIC CIM monoliths. Without the need for nuclease treatment, up to 99% of the total DNA loaded can be removed from the vaccinia feed stream by the CIM OH monolith, which also reduces the total protein concentration in the product pool to LLOQ levels, and achieves infectious virus recoveries of 90%. Binding capacities of greater than 1×109pfu of vaccinia per mL of matrix were obtained on both CIM SO3 and CIM OH monoliths. Multiple orthogonal analytical methods have been used to develop process knowledge and understanding. Copyright © 2017. Published by Elsevier B.V.

  10. Effective tumor immunotherapy directed against an oncogene-encoded product using a vaccinia virus vector

    NARCIS (Netherlands)

    Bernards, R.A.; Destree, A.; McKenzie, S.; Gordon, E.; Weinberg, R.A.; Panicali, D.

    1987-01-01

    We have constructed a vaccinia virus recombinant that expresses the extracellular domain of the rat neu oncogene-encoded protein, a 185-kDa transmembrane glycoprotein termed p185. Strain NFS mice immunized with this recombinant virus developed a strong antibody response against the neu oncogene

  11. Attenuation of vaccinia virus by the expression of human Flt3 ligand

    Czech Academy of Sciences Publication Activity Database

    Žurková, K.; Hainz, P.; Kryštofová, J.; Kutinová, L.; Šanda, Miloslav; Němečková, Š.

    2010-01-01

    Roč. 7, č. 1 (2010), 109/1-109/15 ISSN 1743-422X Institutional research plan: CEZ:AV0Z40550506 Keywords : vaccinia virus * antibodies * virulence Subject RIV: CE - Biochemistry Impact factor: 2.546, year: 2010

  12. Interactions between Vaccinia Virus IEV Membrane Proteins and Their Roles in IEV Assembly and Actin Tail Formation

    OpenAIRE

    Röttger, Sabine; Frischknecht, Friedrich; Reckmann, Inge; Smith, Geoffrey L.; Way, Michael

    1999-01-01

    The intracellular enveloped form of vaccinia virus (IEV) induces the formation of actin tails that are strikingly similar to those seen in Listeria and Shigella infections. In contrast to the case for Listeria and Shigella, the vaccinia virus protein(s) responsible for directly initiating actin tail formation remains obscure. However, previous studies with recombinant vaccinia virus strains have suggested that the IEV-specific proteins A33R, A34R, A36R, B5R, and F13L play an undefined role in...

  13. Bovine Herpesvirus 4 infections and bovine mastitis

    NARCIS (Netherlands)

    Wellenberg, Gerardus Johannus

    2002-01-01

    Mastitis is an often occurring disease in dairy cattle with an enormous economic impact for milk producers worldwide. Despite intensive research, which is historically based on the detection of bacterial udder pathogens, still around 20-35% of clinical cases of bovine mastitis have an unknown

  14. Lack of efficacy of aurintricarboxylic acid and ethacrynic acid against vaccinia virus respiratory infections in mice.

    Science.gov (United States)

    Smee, Donald F; Hurst, Brett L; Wong, Min-Hui

    2010-04-14

    Aurintricarboxylic acid (ATA) and ethacrynic acid (ECA) have been reported to exhibit antiviral activity against vaccinia virus infections in cell culture by inhibiting early and late gene transcription, respectively. The purpose of this work was to determine if these inhibitors would effectively treat vaccinia virus infections in mice, which has not previously been studied. ECA was investigated by cell culture plaque reduction assay for the inhibition of cowpox and vaccinia virus infections to clarify issues regarding its potency and selectivity. Mice infected intranasally with vaccinia virus were treated by intraperitoneal route twice daily for 5 days with ATA (10 and 30 mg/kg/day) and ECA (15 and 30 mg/kg/day) or once daily for 2 days with cidofovir (100 mg/kg/day). ECA caused 50% inhibition of virus plaque formation at 20-79 muM in four cultured cell lines, with 50% cytotoxicity at 84-173 muM, giving low (1.3-4.2) selectivity index values. Preliminary toxicity tests in uninfected mice indicated that ATA and ECA were both overtly toxic at 100 mg/kg/day. No protection from mortality was afforded by treatment of vaccinia virus infections with ATA or ECA, but 100% survival was achieved in the cidofovir group. ATA- and ECA-treated mice died significantly sooner than placebo-treated animals, indicating that these compounds exacerbated the infection. Both ATA and ECA lack antiviral potency and selectivity in cell culture. The compounds were ineffective in treating mice at intraperitoneal doses of

  15. Responding to Outbreaks

    Centers for Disease Control (CDC) Podcasts

    2009-04-27

    In this podcast, a team of CDC specialists travels to Uganda and tracks the source of an Ebola outbreak where CDC scientists are studying bats for clues to the Ebola mystery.  Created: 4/27/2009 by National Center for Zoonotic, Vector-Borne, and Enteric Diseases (NCZVED).   Date Released: 4/27/2009.

  16. Foodborne Norovirus Outbreaks

    Centers for Disease Control (CDC) Podcasts

    2012-09-17

    Dr. Aron Hall, a CDC epidemiologist specializing in noroviruses, discusses foodborne norovirus outbreaks.  Created: 9/17/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 9/17/2012.

  17. Investigating Listeria Outbreaks

    Centers for Disease Control (CDC) Podcasts

    2013-01-04

    Dr. Emily Cartwright, Infectious Disease fellow at Emory University and former EIS Officer with CDC’s Division of Foodborne, Waterborne, and Environmental Diseases discusses foodborne Listeria outbreaks.  Created: 1/4/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 1/8/2013.

  18. Forecasting rodent outbreaks in Africa

    DEFF Research Database (Denmark)

    Leirs, Herwig; Verhagen, Ron; Verheyen, Walter

    1996-01-01

    1. Rainfall data were collated for years preceding historical outbreaks of Mastomys rats in East Africa in order to test the hypothesis that such outbreaks occur after long dry periods. 2. Rodent outbreaks were generally not preceded by long dry periods. 3. Population dynamics of Mastomys natalen...

  19. Mitigating Infectious Disease Outbreaks

    Science.gov (United States)

    Davey, Victoria

    The emergence of new, transmissible infections poses a significant threat to human populations. As the 2009 novel influenza A/H1N1 pandemic and the 2014-2015 Ebola epidemic demonstrate, we have observed the effects of rapid spread of illness in non-immune populations and experienced disturbing uncertainty about future potential for human suffering and societal disruption. Clinical and epidemiologic characteristics of a newly emerged infectious organism are usually gathered in retrospect as the outbreak evolves and affects populations. Knowledge of potential effects of outbreaks and epidemics and most importantly, mitigation at community, regional, national and global levels is needed to inform policy that will prepare and protect people. Study of possible outcomes of evolving epidemics and application of mitigation strategies is not possible in observational or experimental research designs, but computational modeling allows conduct of `virtual' experiments. Results of well-designed computer simulations can aid in the selection and implementation of strategies that limit illness and death, and maintain systems of healthcare and other critical resources that are vital to public protection. Mitigating Infectious Disease Outbreaks.

  20. Analysis of vaccinia virus temperature-sensitive I7L mutants reveals two potential functional domains

    Directory of Open Access Journals (Sweden)

    Byrd Chelsea M

    2006-08-01

    Full Text Available Abstract As an approach to initiating a structure-function analysis of the vaccinia virus I7L core protein proteinase, a collection of conditional-lethal mutants in which the mutation had been mapped to the I7L locus were subjected to genomic sequencing and phenotypic analyses. Mutations in six vaccinia virus I7L temperature sensitive mutants fall into two groups: changes at three positions at the N-terminal end between amino acids 29 and 37 and two different substitutions at amino acid 344, near the catalytic domain. Regardless of the position of the mutation, mutants at the non-permissive temperature failed to cleave core protein precursors and had their development arrested prior to core condensation. Thus it appears that the two clusters of mutations may affect two different functional domains required for proteinase activity.

  1. Protection from rabies by a vaccinia virus recombinant containing the rabies virus glycoprotein gene.

    OpenAIRE

    Wiktor, T. J.; Macfarlan, R I; Reagan, K J; Dietzschold, B; Curtis, P. J.; Wunner, W. H.; Kieny, M P; Lathe, R; Lecocq, J P; Mackett, M.

    1984-01-01

    Inoculation of rabbits and mice with a vaccinia-rabies glycoprotein recombinant (V-RG) virus resulted in rapid induction of high concentrations of rabies virus-neutralizing antibodies and protection from severe intracerebral challenge with several strains of rabies virus. Protection from virus challenge also was achieved against the rabies-related Duvenhage virus but not against the Mokola virus. Effective immunization by V-RG depended on the expression of a rabies glycoprotein that registere...

  2. Vaccinia virus induces rapid necrosis in keratinocytes by a STAT3-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Yong He

    Full Text Available Humans with a dominant negative mutation in STAT3 are susceptible to severe skin infections, suggesting an essential role for STAT3 signaling in defense against cutaneous pathogens.To focus on innate antiviral defenses in keratinocytes, we used a standard model of cutaneous infection of severe combined immunodeficient mice with the current smallpox vaccine, ACAM-2000. In parallel, early events post-infection with the smallpox vaccine ACAM-2000 were investigated in cultured keratinocytes of human and mouse origin.Mice treated topically with a STAT3 inhibitor (Stattic developed larger vaccinia lesions with higher virus titers and died more rapidly than untreated controls. Cultured human and murine keratinocytes infected with ACAM-2000 underwent rapid necrosis, but when treated with Stattic or with inhibitors of RIP1 kinase or caspase-1, they survived longer, produced higher titers of virus, and showed reduced activation of type I interferon responses and inflammatory cytokines release. Treatment with inhibitors of RIP1 kinase and STAT3, but not caspase-1, also reduced the inflammatory response of keratinocytes to TLR ligands. Vaccinia growth properties in Vero cells, which are known to be defective in some antiviral responses, were unaffected by inhibition of RIP1K, caspase-1, or STAT3.Our findings indicate that keratinocytes suppress the replication and spread of vaccinia virus by undergoing rapid programmed cell death, in a process requiring STAT3. These data offer a new framework for understanding susceptibility to skin infection in patients with STAT3 mutations. Interventions which promote prompt necroptosis/pyroptosis of infected keratinocytes may reduce risks associated with vaccination with live vaccinia virus.

  3. Sequence-Independent Targeting of Transmembrane Proteins Synthesized within Vaccinia Virus Factories to Nascent Viral Membranes▿

    OpenAIRE

    Husain, Matloob; Weisberg, Andrea S.; Moss, Bernard

    2006-01-01

    The primary membrane of vaccinia virus, as well as those of other poxviruses, forms within a discrete cytoplasmic factory region. We recently determined the existence of an operative pathway from the endoplasmic reticulum within the virus factory to nascent viral membranes and demonstrated that a viral protein could be diverted from this pathway to Golgi membranes by the addition of COPII-binding sites (M. Husain, A. S. Weisberg, and B. Moss, Proc. Natl. Acad. Sci. USA, 103:19506-19511, 2006)...

  4. Modulation of the Myxoma Virus Plaque Phenotype by Vaccinia Virus Protein F11

    OpenAIRE

    Irwin, Chad R; Evans, David H.

    2012-01-01

    Vaccinia virus (VACV) produces large plaques consisting of a rapidly expanding ring of infected cells surrounding a lytic core, whereas myxoma virus (MYXV) produces small plaques that resemble a focus of transformed cells. This is odd, because bioinformatics suggests that MYXV carries homologs of nearly all of the genes regulating Orthopoxvirus attachment, entry, and exit. So why does MYXV produce foci? One notable difference is that MYXV-infected cells produce few of the actin microfilaments...

  5. Diagnosis and Control of Bovine Neosporosis.

    Science.gov (United States)

    McAllister, Milton M

    2016-07-01

    Neosporosis is one of the most common and widespread causes of bovine abortion. The causative parasite is transmitted in at least two ways, horizontally from canids, and by endogenous transmission within maternal lines of infected cattle. The prevalence of neosporosis is higher in the dairy industry than in the beef industry because of risk factors associated with intensive feeding. There are no vaccines, but logical management options are discussed that can lower the risk of abortion outbreaks and gradually reduce the prevalence of infection within herds. Steps should be taken to prevent total mixed rations from becoming contaminated by canine feces. If a herd has a high rate of infection that is associated with abortions in heifers, then the rate of reduction of infection prevalence can be speeded by only selecting seronegative replacement heifers to enter the breeding herd. Elimination of all infected cattle is not a recommended goal. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Permissivity of the NCI-60 cancer cell lines to oncolytic Vaccinia Virus GLV-1h68

    Directory of Open Access Journals (Sweden)

    Bedognetti Davide

    2011-10-01

    Full Text Available Abstract Background Oncolytic viral therapy represents an alternative therapeutic strategy for the treatment of cancer. We previously described GLV-1h68, a modified Vaccinia Virus with exclusive tropism for tumor cells, and we observed a cell line-specific relationship between the ability of GLV-1h68 to replicate in vitro and its ability to colonize and eliminate tumor in vivo. Methods In the current study we surveyed the in vitro permissivity to GLV-1h68 replication of the NCI-60 panel of cell lines. Selected cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV strain. In order to identify correlates of permissity to viral infection, we measured transcriptional profiles of the cell lines prior infection. Results We observed highly heterogeneous permissivity to VACV infection amongst the cell lines. The heterogeneity of permissivity was independent of tissue with the exception of B cell derivation. Cell lines were also tested for permissivity to another Vaccinia Virus and a vesicular stomatitis virus (VSV strain and a significant correlation was found suggesting a common permissive phenotype. While no clear transcriptional pattern could be identified as predictor of permissivity to infection, some associations were observed suggesting multifactorial basis permissivity to viral infection. Conclusions Our findings have implications for the design of oncolytic therapies for cancer and offer insights into the nature of permissivity of tumor cells to viral infection.

  7. The vaccinia virus E6 protein influences virion protein localization during virus assembly

    Energy Technology Data Exchange (ETDEWEB)

    Condit, Richard C., E-mail: condit@mgm.ufl.edu; Moussatche, Nissin

    2015-08-15

    Vaccinia virus mutants in which expression of the virion core protein gene E6R is repressed are defective in virion morphogenesis. E6 deficient infections fail to properly package viroplasm into viral membranes, resulting in an accumulation of empty immature virions and large aggregates of viroplasm. We have used immunogold electron microscopy and immunofluorescence confocal microscopy to assess the intracellular localization of several virion structural proteins and enzymes during E6R mutant infections. We find that during E6R mutant infections virion membrane proteins and virion transcription enzymes maintain a normal localization within viral factories while several major core and lateral body proteins accumulate in aggregated virosomes. The results support a model in which vaccinia virions are assembled from at least three substructures, the membrane, the viroplasm and a “pre-nucleocapsid”, and that the E6 protein is essential for maintaining proper localization of the seven-protein complex and the viroplasm during assembly. - Highlights: • Mutation of E6 disrupts association of viral membranes with viral core proteins • Mutation of E6 does not perturb viral membrane biosynthesis • Mutation of E6 does not perturb localization of viral transcription enzymes • Mutation of E6 causes mis-localization and aggregation of viral core proteins • Vaccinia assembly uses three subassemblies: membranes, viroplasm, prenucleocapsid.

  8. Humoral Immunity to Primary Smallpox Vaccination: Impact of Childhood versus Adult Immunization on Vaccinia Vector Vaccine Development in Military Populations.

    Science.gov (United States)

    Slike, Bonnie M; Creegan, Matthew; Marovich, Mary; Ngauy, Viseth

    2017-01-01

    Modified Vaccinia virus has been shown to be a safe and immunogenic vector platform for delivery of HIV vaccines. Use of this vector is of particular importance to the military, with the implementation of a large scale smallpox vaccination campaign in 2002 in active duty and key civilian personnel in response to potential bioterrorist activities. Humoral immunity to smallpox vaccination was previously shown to be long lasting (up to 75 years) and protective. However, using vaccinia-vectored vaccine delivery for other diseases on a background of anti-vector antibodies (i.e. pre-existing immunity) may limit their use as a vaccine platform, especially in the military. In this pilot study, we examined the durability of vaccinia antibody responses in adult primary vaccinees in a healthy military population using a standard ELISA assay and a novel dendritic cell neutralization assay. We found binding and neutralizing antibody (NAb) responses to vaccinia waned after 5-10 years in a group of 475 active duty military, born after 1972, who were vaccinated as adults with Dryvax®. These responses decreased from a geometric mean titer (GMT) of 250 to baseline (vaccination. This contrasted with a comparator group of adults, ages 35-49, who were vaccinated with Dryvax® as children. In the childhood vaccinees, titers persisted for >30 years with a GMT of 210 (range 112-3234). This data suggests limited durability of antibody responses in adult vaccinees compared to those vaccinated in childhood and further that adult vaccinia recipients may benefit similarly from receipt of a vaccinia based vaccine as those who are vaccinia naïve. Our findings may have implications for the smallpox vaccination schedule and support the ongoing development of this promising viral vector in a military vaccination program.

  9. Humoral Immunity to Primary Smallpox Vaccination: Impact of Childhood versus Adult Immunization on Vaccinia Vector Vaccine Development in Military Populations.

    Directory of Open Access Journals (Sweden)

    Bonnie M Slike

    Full Text Available Modified Vaccinia virus has been shown to be a safe and immunogenic vector platform for delivery of HIV vaccines. Use of this vector is of particular importance to the military, with the implementation of a large scale smallpox vaccination campaign in 2002 in active duty and key civilian personnel in response to potential bioterrorist activities. Humoral immunity to smallpox vaccination was previously shown to be long lasting (up to 75 years and protective. However, using vaccinia-vectored vaccine delivery for other diseases on a background of anti-vector antibodies (i.e. pre-existing immunity may limit their use as a vaccine platform, especially in the military. In this pilot study, we examined the durability of vaccinia antibody responses in adult primary vaccinees in a healthy military population using a standard ELISA assay and a novel dendritic cell neutralization assay. We found binding and neutralizing antibody (NAb responses to vaccinia waned after 5-10 years in a group of 475 active duty military, born after 1972, who were vaccinated as adults with Dryvax®. These responses decreased from a geometric mean titer (GMT of 250 to baseline (30 years with a GMT of 210 (range 112-3234. This data suggests limited durability of antibody responses in adult vaccinees compared to those vaccinated in childhood and further that adult vaccinia recipients may benefit similarly from receipt of a vaccinia based vaccine as those who are vaccinia naïve. Our findings may have implications for the smallpox vaccination schedule and support the ongoing development of this promising viral vector in a military vaccination program.

  10. Enzootic bovine leucosis.

    Science.gov (United States)

    Tyler, L

    1978-09-02

    Enzootic bovine leucosis is associated with infection by bovine leucosis virus. The incubation period is measured in years and a minority of infected animals develop clinical signs. The disease is widespread in Europe and elsewhere and can cause significant economic loss. The epidemiology is incompletely understood and findings from one cattle production system may not be directly applicable to another. Major control programmes exist in Denmark and West Germany and control schemes are being developed elsewhere. Eradication of enzootic bovine leucosis has been established as a goal in the EEC and research is revealing the ways in which this goal may be attained. To be effective, control and epidemiological monitoring must be interactive. Recently introduced serological tests, of improved sensitivity, provide a valuable tool.

  11. Incentives for reporting disease outbreaks.

    Directory of Open Access Journals (Sweden)

    Ramanan Laxminarayan

    Full Text Available BACKGROUND: Countries face conflicting incentives to report infectious disease outbreaks. Reports of outbreaks can prompt other countries to impose trade and travel restrictions, which has the potential to discourage reporting. However, reports can also bring medical assistance to contain the outbreak, including access to vaccines. METHODS: We compiled data on reports of meningococcal meningitis to the World Health Organization (WHO from 54 African countries between 1966 and 2002, a period is marked by two events: first, a large outbreak reported from many countries in 1987 associated with the Hajj that resulted in more stringent requirements for meningitis vaccination among pilgrims; and second, another large outbreak in Sub-Saharan Africa in 1996 that led to a new international mechanism to supply vaccines to countries reporting a meningitis outbreak. We used fixed-effects regression modeling to statistically estimate the effect of external forcing events on the number of countries reporting cases of meningitis to WHO. FINDINGS: We find that the Hajj vaccination requirements started in 1988 were associated with reduced reporting, especially among countries with relatively fewer cases reported between 1966 and 1979. After the vaccine provision mechanism was in place in 1996, reporting among countries that had previously not reported meningitis outbreaks increased. INTERPRETATION: These results indicate that countries may respond to changing incentives to report outbreaks when they can do so. In the long term, these incentives are likely to be more important than surveillance assistance in prompt reporting of outbreaks.

  12. Discovery of a bovine enterovirus in alpaca.

    Directory of Open Access Journals (Sweden)

    Shasta D McClenahan

    Full Text Available A cytopathic virus was isolated using Madin-Darby bovine kidney (MDBK cells from lung tissue of alpaca that died of a severe respiratory infection. To identify the virus, the infected cell culture supernatant was enriched for virus particles and a generic, PCR-based method was used to amplify potential viral sequences. Genomic sequence data of the alpaca isolate was obtained and compared with sequences of known viruses. The new alpaca virus sequence was most similar to recently designated Enterovirus species F, previously bovine enterovirus (BEVs, viruses that are globally prevalent in cattle, although they appear not to cause significant disease. Because bovine enteroviruses have not been previously reported in U.S. alpaca, we suspect that this type of infection is fairly rare, and in this case appeared not to spread beyond the original outbreak. The capsid sequence of the detected virus had greatest homology to Enterovirus F type 1 (indicating that the virus should be considered a member of serotype 1, but the virus had greater homology in 2A protease sequence to type 3, suggesting that it may have been a recombinant. Identifying pathogens that infect a new host species for the first time can be challenging. As the disease in a new host species may be quite different from that in the original or natural host, the pathogen may not be suspected based on the clinical presentation, delaying diagnosis. Although this virus replicated in MDBK cells, existing standard culture and molecular methods could not identify it. In this case, a highly sensitive generic PCR-based pathogen-detection method was used to identify this pathogen.

  13. Discovery of a bovine enterovirus in alpaca.

    Science.gov (United States)

    McClenahan, Shasta D; Scherba, Gail; Borst, Luke; Fredrickson, Richard L; Krause, Philip R; Uhlenhaut, Christine

    2013-01-01

    A cytopathic virus was isolated using Madin-Darby bovine kidney (MDBK) cells from lung tissue of alpaca that died of a severe respiratory infection. To identify the virus, the infected cell culture supernatant was enriched for virus particles and a generic, PCR-based method was used to amplify potential viral sequences. Genomic sequence data of the alpaca isolate was obtained and compared with sequences of known viruses. The new alpaca virus sequence was most similar to recently designated Enterovirus species F, previously bovine enterovirus (BEVs), viruses that are globally prevalent in cattle, although they appear not to cause significant disease. Because bovine enteroviruses have not been previously reported in U.S. alpaca, we suspect that this type of infection is fairly rare, and in this case appeared not to spread beyond the original outbreak. The capsid sequence of the detected virus had greatest homology to Enterovirus F type 1 (indicating that the virus should be considered a member of serotype 1), but the virus had greater homology in 2A protease sequence to type 3, suggesting that it may have been a recombinant. Identifying pathogens that infect a new host species for the first time can be challenging. As the disease in a new host species may be quite different from that in the original or natural host, the pathogen may not be suspected based on the clinical presentation, delaying diagnosis. Although this virus replicated in MDBK cells, existing standard culture and molecular methods could not identify it. In this case, a highly sensitive generic PCR-based pathogen-detection method was used to identify this pathogen.

  14. Oncolytic and immunologic cancer therapy with GM-CSF-armed vaccinia virus of Tian Tan strain Guang9.

    Science.gov (United States)

    Deng, Lili; Fan, Jun; Guo, Mingming; Huang, Biao

    2016-03-28

    Targeted oncolytic vaccinia viruses are being developed as a novel strategy in cancer therapy. Arming vaccinia viruses with immunostimulatory cytokines can enhance antitumor efficacy. Such engineered oncolytic viruses, like JX-594, a Wyeth strain vaccinia virus modified with human granulocyte-macrophage colony-stimulating factor (GM-CSF), have shown promising results and have proceeded rapidly in clinical trials. However, the oncolytic potential of the Chinese vaccine strain Tian Tan (VTT) has not been explored. In this study, we constructed a targeted oncolytic vaccinia virus of Tian Tan strain Guang9 (VG9) expressing murine GM-CSF (VG9-GMCSF) and evaluated the antitumor effect of this recombinant vaccinia virus in a murine melanoma model. In vitro, viral replication and cytotoxicity of VG9-GMCSF was as potent as VG9; in vivo, VG9-GMCSF significantly inhibited the growth of subcutaneously implanted melanoma tumors, prolonged the survival of tumor-bearing mice, and produced an antitumor cytotoxic response. Such antitumor effect may be due to the lytic nature of virus as well as the stimulation of immune activity by GM-CSF production. Our results indicate that VG9-GMCSF induces strong tumoricidal activity, providing a potential therapeutic strategy for combating cancer. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Intervet Symposium: bovine neosporosis

    NARCIS (Netherlands)

    Schetters, T.; Dubey, J.P.; Adrianarivo, A.; Frankena, K.; Romero, J.J.; Pérez, E.; Heuer, C.; Nicholson, C.; Russell, D.; Weston, J.

    2004-01-01

    This article summarises the most relevant data of presentations delivered at the 19th International Conference of the World Association for the Advancement of Veterinary Parasitology (WAAVP) held in New Orleans, LA, USA, from 10 to 14 August 2003) in a symposium session on bovine neosporosis. The

  16. Genotyping bovine coronaviruses.

    Science.gov (United States)

    Bovine coronaviruses (BoCV) are enveloped, single-stranded, positive-sense RNA viruses of the Coronaviridae family. Infection is associated with enteritis and pneumonia in calves and Winter Dysentery in adult cattle. Strains, isolated more than 50 years ago, are used in vaccines and as laboratory ...

  17. Synthesis and assembly of infectious bovine papillomavirus particles in vitro.

    Science.gov (United States)

    Zhou, J; Stenzel, D J; Sun, X Y; Frazer, I H

    1993-04-01

    Bovine papillomavirus type 1 (BPV-1) virions were produced in vitro using vaccinia virus (VV) recombinants expressing the BPV-1 L1 and L2 capsid proteins. Particles morphologically resembling papillomaviruses were observed in the nucleus of cells infected with a VV recombinant for the BPV-1 L1 protein, and greater numbers of similar particles were seen in the nuclei of cells infected with a VV double recombinant for L1 and L2. Virus-like particles (VLPs) assembled in cells infected with the VV double recombinant for BPV-1 L1 and L2, and not those assembled in cells infected with the VV recombinant for BPV-1 L1 alone, were able to package BPV-1 DNA. Transcription of the BPV-1 E1 viral open reading frame was observed after a mouse fibroblast cell line was exposed to VLPs produced using a BPV-1 L1/L2 VV recombinant in a cell line containing episomal BPV-1 DNA. E1 transcription was not observed when the VLPs were pre-incubated with antibodies to the capsid protein of BPV-1. This system should allow an in vitro approach to the definition of the BPV-1 cellular receptor.

  18. Cholera outbreaks in Africa.

    Science.gov (United States)

    Mengel, Martin A; Delrieu, Isabelle; Heyerdahl, Leonard; Gessner, Bradford D

    2014-01-01

    During the current seventh cholera pandemic, Africa bore the major brunt of global disease burden. More than 40 years after its resurgence in Africa in 1970, cholera remains a grave public health problem, characterized by large disease burden, frequent outbreaks, persistent endemicity, and high CFRs, particularly in the region of the central African Great Lakes which might act as reservoirs for cholera. There, cases occur year round with a rise in incidence during the rainy season. Elsewhere in sub-Saharan Africa, cholera occurs mostly in outbreaks of varying size with a constant threat of widespread epidemics. Between 1970 and 2011, African countries reported 3,221,050 suspected cholera cases to the World Health Organization, representing 46 % of all cases reported globally. Excluding the Haitian epidemic, sub-Saharan Africa accounted for 86 % of reported cases and 99 % of deaths worldwide in 2011. The number of cholera cases is possibly much higher than what is reported to the WHO due to the variation in modalities, completeness, and case definition of national cholera data. One source on country specific incidence rates for Africa, adjusting for underreporting, estimates 1,341,080 cases and 160,930 deaths (52.6 % of 2,548,227 estimated cases and 79.6 % of 209,216 estimated deaths worldwide). Another estimates 1,411,453 cases and 53,632 deaths per year, respectively (50 % of 2,836,669 estimated cases and 58.6 % of 91,490 estimated deaths worldwide). Within Africa, half of all cases between 1970 and 2011 were notified from only seven countries: Angola, Democratic Republic of the Congo, Mozambique, Nigeria, Somalia, Tanzania, and South Africa. In contrast to a global trend of decreasing case fatality ratios (CFRs), CFRs have remained stable in Africa at approximately 2 %. Early propagation of cholera outbreaks depends largely on the extent of individual bacterial shedding, host and organism characteristics, the likelihood of people coming into contact with

  19. Efficient cleavage of p220 by poliovirus 2Apro expression in mammalian cells: effects on vaccinia virus.

    Science.gov (United States)

    Aldabe, R; Feduchi, E; Novoa, I; Carrasco, L

    1995-10-24

    Poliovirus protease 2A cleaves p220, a component of initiation factor eIF-4F. Polyclonal antibodies that recognize p220 and the cleaved products from different species have been raised. Transfection of several cell lines with poliovirus 2Apro cloned in different plasmids leads to efficient cleavage of p220 upon infection with VT7, a recombinant vaccinia virus that expresses the T7 RNA polymerase. Under these conditions vaccinia virus protein synthesis is severely inhibited, while expression of poliovirus protein 2C from a similar plasmid has no effect. These results show by the first time the effects of p220 cleavage on vaccinia virus translation in the infected cells.

  20. Closed genomes and phenotypes of seven Histophilus somni isolates from beef calves with bovine respiratory disease complex

    Science.gov (United States)

    Background: Histophilus somni is a fastidious gram-negative opportunistic pathogenic Pasteurellacea that affects multiple organ systems and is one of three principle bacterial species contributing to bovine respiratory disease complex (BRDC) in North American feed yard cattle. BRDC outbreaks accoun...

  1. A novel high-throughput vaccinia virus neutralization assay and preexisting immunity in populations from different geographic regions in China.

    Directory of Open Access Journals (Sweden)

    Qiang Liu

    Full Text Available BACKGROUND: Pre-existing immunity to Vaccinia Tian Tan virus (VTT resulting from a large vaccination campaign against smallpox prior to the early 1980s in China, has been a major issue for application of VTT-vector based vaccines. It is essential to establish a sensitive and high-throughput neutralization assay to understand the epidemiology of Vaccinia-specific immunity in current populations in China. METHODOLOGY/PRINCIPAL FINDINGS: A new anti-Vaccinia virus (VACV neutralization assay that used the attenuated replication-competent VTT carrying the firefly luciferase gene of Photinus pyralis (rTV-Fluc was established and standardized for critical parameters that included the choice of cell line, viral infection dose, and the infection time. The current study evaluated the maintenance of virus-specific immunity after smallpox vaccination by conducting a non-randomized, cross-sectional analysis of antiviral antibody-mediated immune responses in volunteers examined 30-55 years after vaccination. The rTV-Fluc neutralization assay was able to detect neutralizing antibodies (NAbs against Vaccinia virus without the ability to differentiate strains of Vaccinia virus. We showed that the neutralizing titers measured by our assay were similar to those obtained by the traditional plaque reduction neutralization test (PRNT. Using this assay, we found a low prevalence of NAb to VTT (7.6% in individuals born before 1980 from Beijing and Anhui provinces in China, and when present, anti-VTT NAb titers were low. No NAbs were detected in all 222 samples from individuals born after 1980. There was no significant difference observed for titer or prevalence by gender, age range and geographic origin. CONCLUSION: A simplified, sensitive, standardized, reproducible, and high-throughput assay was developed for the quantitation of NAbs against different Vaccinia strains. The current study provides useful insights for the future development of VTT-based vaccination in

  2. Attenuation of vaccinia virus by the expression of human Flt3 ligand

    Directory of Open Access Journals (Sweden)

    Sanda Miloslav

    2010-05-01

    Full Text Available Abstract Background Vaccinia virus, one of the best known members of poxvirus family, has a wide host range both in vivo and in vitro. The expression of Flt3 ligand (FL by recombinant vaccinia virus (rVACV highly influenced properties of the virus in dependence on the level of expression. Results High production of FL driven by the strong synthetic promoter decreased the growth of rVACV in macrophage cell line J774.G8 in vitro as well as its multiplication in vivo when inoculated in mice. The inhibition of replication in vivo was mirrored in low levels of antibodies against vaccinia virus (anti-VACV which nearly approached to the negative serum level in non-infected mice. Strong FL expression changed not only the host range of the recombinant but also the basic protein contents of virions. The major proteins - H3L and D8L - which are responsible for the virus binding to the cells, and 28 K protein that serves as a virulence factor, were changed in the membrane portion of P13-E/L-FL viral particles. The core virion fraction contained multiple larger, uncleaved proteins and a higher amount of cellular proteins compared to the control virus. The overexpression of FL also resulted in its incorporation into the viral core of P13-E/L-FL IMV particles. In contrary to the equimolar ratio of glycosylated and nonglycosylated FL forms found in cells transfected with the expression plasmid, the recombinant virus incorporated mainly the smaller, nonglycosylated FL. Conclusions It has been shown that the overexpression of the Flt3L gene in VACV results in the attenuation of the virus in vivo.

  3. Cambios en virus vaccinia durante la síntesis de RNA in vitro

    Directory of Open Access Journals (Sweden)

    Julio Enrique Ospina

    1971-01-01

    Full Text Available Observaciones al microscopio electrónico de virus vaccinia previamente incubados en una mezcla para la reacción de RNA polimerasa in vitro, demuestran características alteraciones morfológicas en los virus. Estructuras similares a vesículas y ocasionalmente túbulos se formaron a partir de la membrana externa del virus. Uno de los sustituyentes de la reacción de RNA polimerasa in vitro, mercaptoetanol 0.007M, es el causante de esta alteración. El cambio morfológico se acompaña de pérdida de la infectividad viral. La presencia de grupos sulfhidrilo en la mezcla de la reacción enzimática es esencial para la ocurrencia de la síntesis de RNA de vaccinia in vitro. Esta condición no se pudo sustituir por choque térmico a 70C. ni por digestión parcial del virus por tripsina. Una gran variedad de compuestos con grupos sulfhidrilo pueden reemplazar el mercaptoetanol con efectividad variable. El más activo de ellos fué el ditiotreitol. Un período de latencia de 8 minutos ocurre entre la adición de vaccinia a la mezcla completa para la reacción de RNA polimerasa y la detección de síntesis de RNA. Los datos recolectados sugieren que cambios dependientes del mercaptoetanol ocurren durante este período.

  4. The role of signalling and the cytoskeleton during Vaccinia Virus egress.

    Science.gov (United States)

    Leite, Flavia; Way, Michael

    2015-11-02

    Viruses are obligate intracellular parasites that are critically dependent on their hosts to replicate and generate new progeny. To achieve this goal, viruses have evolved numerous elegant strategies to subvert and utilise the different cellular machineries and processes of their unwilling hosts. Moreover, they often accomplish this feat with a surprisingly limited number of proteins. Among the different systems of the cell, the cytoskeleton is often one of the first to be hijacked as it provides a convenient transport system for viruses to reach their site of replication with relative ease. At the latter stages of their replication cycle, the cytoskeleton also provides an efficient means for newly assembled viral progeny to reach the plasma membrane and leave the infected cell. In this review we discuss how Vaccinia virus takes advantage of the microtubule and actin cytoskeletons of its host to promote the spread of infection into neighboring cells. In particular, we highlight how analysis of actin-based motility of Vaccinia has provided unprecedented insights into how a phosphotyrosine-based signalling network is assembled and functions to stimulate Arp2/3 complex-dependent actin polymerization. We also suggest that the formin FHOD1 promotes actin-based motility of the virus by capping the fast growing ends of actin filaments rather than directly promoting filament assembly. We have come a long way since 1976, when electron micrographs of vaccinia-infected cells implicated the actin cytoskeleton in promoting viral spread. Nevertheless, there are still many unanswered questions concerning the role of signalling and the host cytoskeleton in promoting viral spread and pathogenesis. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Modified Vaccinia Virus Ankara: History, Value in Basic Research, and Current Perspectives for Vaccine Development.

    Science.gov (United States)

    Volz, A; Sutter, G

    2017-01-01

    Safety tested Modified Vaccinia virus Ankara (MVA) is licensed as third-generation vaccine against smallpox and serves as a potent vector system for development of new candidate vaccines against infectious diseases and cancer. Historically, MVA was developed by serial tissue culture passage in primary chicken cells of vaccinia virus strain Ankara, and clinically used to avoid the undesirable side effects of conventional smallpox vaccination. Adapted to growth in avian cells MVA lost the ability to replicate in mammalian hosts and lacks many of the genes orthopoxviruses use to conquer their host (cell) environment. As a biologically well-characterized mutant virus, MVA facilitates fundamental research to elucidate the functions of poxvirus host-interaction factors. As extremely safe viral vectors MVA vaccines have been found immunogenic and protective in various preclinical infection models. Multiple recombinant MVA currently undergo clinical testing for vaccination against human immunodeficiency viruses, Mycobacterium tuberculosis or Plasmodium falciparum. The versatility of the MVA vector vaccine platform is readily demonstrated by the swift development of experimental vaccines for immunization against emerging infections such as the Middle East Respiratory Syndrome. Recent advances include promising results from the clinical testing of recombinant MVA-producing antigens of highly pathogenic avian influenza virus H5N1 or Ebola virus. This review summarizes our current knowledge about MVA as a unique strain of vaccinia virus, and discusses the prospects of exploiting this virus as research tool in poxvirus biology or as safe viral vector vaccine to challenge existing and future bottlenecks in vaccinology. © 2017 Elsevier Inc. All rights reserved.

  6. Can vaccinia virus be replaced by MVA virus for testing virucidal activity of chemical disinfectants?

    Directory of Open Access Journals (Sweden)

    Rapp Ingrid

    2010-06-01

    Full Text Available Abstract Background Vaccinia virus strain Lister Elstree (VACV is a test virus in the DVV/RKI guidelines as representative of the stable enveloped viruses. Since the potential risk of laboratory-acquired infections with VACV persists and since the adverse effects of vaccination with VACV are described, the replacement of VACV by the modified vaccinia Ankara strain (MVA was studied by testing the activity of different chemical biocides in three German laboratories. Methods The inactivating properties of different chemical biocides (peracetic acid, aldehydes and alcohols were tested in a quantitative suspension test according to the DVV/RKI guideline. All tests were performed with a protein load of 10% fetal calf serum with both viruses in parallel using different concentrations and contact times. Residual virus was determined by endpoint dilution method. Results The chemical biocides exhibited similar virucidal activity against VACV and MVA. In three cases intra-laboratory differences were determined between VACV and MVA - 40% (v/v ethanol and 30% (v/v isopropanol are more active against MVA, whereas MVA seems more stable than VACV when testing with 0.05% glutardialdehyde. Test accuracy across the three participating laboratories was high. Remarkably inter-laboratory differences in the reduction factor were only observed in two cases. Conclusions Our data provide valuable information for the replacement of VACV by MVA for testing chemical biocides and disinfectants. Because MVA does not replicate in humans this would eliminate the potential risk of inadvertent inoculation with vaccinia virus and disease in non-vaccinated laboratory workers.

  7. Bovine parainfluenza-3 virus.

    Science.gov (United States)

    Ellis, John A

    2010-11-01

    Bovine parainfluenza-3 virus (bPI(3)V) is a long-recognized, currently underappreciated, endemic infection in cattle populations. Clinical disease is most common in calves with poor passive transfer or decayed maternal antibodies. It is usually mild, consisting of fever, nasal discharge, and dry cough. Caused at least partly by local immunosuppressive effects, bPI(3)V infection is often complicated by coinfection with other respiratory viruses and bacteria, and is therefore an important component of enzootic pneumonia in calves and bovine respiratory disease complex in feedlot cattle. Active infection can be diagnosed by virus isolation from nasal swabs, or IF testing on smears made from nasal swabs. Timing of sampling is critical in obtaining definitive diagnostic test results. Parenteral and intranasal modified live vaccine combination vaccines are available. Priming early in calfhood with intranasal vaccine, followed by boosting with parenteral vaccine, may be the best immunoprophylactic approach. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. Camel and bovine chymosin

    DEFF Research Database (Denmark)

    Jensen, Jesper Langholm; Mølgaard, Anne; Poulsen, Jens-Christian Navarro

    2013-01-01

    Bovine and camel chymosin are aspartic peptidases that are used industrially in cheese production. They cleave the Phe105-Met106 bond of the milk protein κ-casein, releasing its predominantly negatively charged C-terminus, which leads to the separation of the milk into curds and whey. Despite...... chymosin. Both enzymes possess local positively charged patches on their surface that can play a role in interactions with the overall negatively charged C-terminus of κ-casein. Camel chymosin contains two additional positive patches that favour interaction with the substrate. The improved electrostatic...... interactions arising from variation in the surface charges and the greater malleability both in domain movements and substrate binding contribute to the better milk-clotting activity of camel chymosin towards bovine milk....

  9. Mycotic bovine nasal granuloma

    Directory of Open Access Journals (Sweden)

    Conti Díaz Ismael Alejandro

    2003-01-01

    Full Text Available A case of mycotic bovine nasal granuloma in a 10 year-old Jersey cow, produced by Drechslera halodes is presented. Histopathological sections showed abundant hyaline and pigmented extra and intracellular fungal structures together with a polymorphic cellular granuloma formed by neutrophils, lymphocytes, plasmocytes, histiocytes and giant cells of the Langhans type. It is the first case of mycotic bovine nasal granuloma recognized in Uruguay although this disease seems to be frequent according to the opinion of veterinarian specialists. Another similar clinical case also in a Jersey cow from the same dairy house with an intense cellular infiltrate rich in eosinophils without granulomatous image, together with extracellular hyaline and fuliginous fungal forms, is also referred for comparative purposes. Geotrichum sp. was isolated. The need of an early diagnosis and treatment of the disease is stressed.

  10. An E2?F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection

    OpenAIRE

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael

    2009-01-01

    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 ?m s?1, consistent with...

  11. Vectores recombinantes basados en el virus Vaccinia modificado de Ankara (MVA) como vacunas contra la leishmaniasis

    OpenAIRE

    Pérez Jiménez, Eva; Larraga, Vicente; Esteban, Mariano

    2005-01-01

    Vectores recombinantes basados en el virus vaccinia modificado de Ankara (MVA) como vacunas contra la leishmaniasis. Los vectores de la invención contienen secuencias codificantes de la proteína LACK, preferentemente insertadas en el locus de hemaglutinina del virus y bajo el control de un promotor que permite su expresión a lo largo del ciclo de infección del virus. Son vectores seguros, estables, que dan lugar a una potente respuesta inmune que confiere protección frente a la leishmaniasis,...

  12. CD69 Deficiency Enhances the Host Response to Vaccinia Virus Infection through Altered NK Cell Homeostasis.

    Science.gov (United States)

    Notario, Laura; Alari-Pahissa, Elisenda; de Molina, Antonio; Lauzurica, Pilar

    2016-07-15

    During the host response to viral infection, the transmembrane CD69 protein is highly upregulated in all immune cells. We have studied the role of CD69 in the murine immune response to vaccinia virus (VACV) infection, and we report that the absence of CD69 enhances protection against VACV at both short and long times postinfection in immunocompetent and immunodeficient mice. Natural killer (NK) cells were implicated in the increased infection control, since the differences were greatly diminished when NK cells were depleted. This role of NK cells was not based on an altered NK cell reactivity, since CD69 did not affect the NK cell activation threshold in response to major histocompatibility complex class I NK cell targets or protein kinase C activation. Instead, NK cell numbers were increased in the spleen and peritoneum of CD69-deficient infected mice. That was not just secondary to better infection control in CD69-deficient mice, since NK cell numbers in the spleens and the blood of uninfected CD69(-/-) mice were already augmented. CD69-deficient NK cells from infected mice did not have an altered proliferation capacity. However, a lower spontaneous cell death rate was observed for CD69(-/-) lymphocytes. Thus, our results suggest that CD69 limits the innate immune response to VACV infection at least in part through cell homeostatic survival. We show that increased natural killer (NK) cell numbers augment the host response and survival after infection with vaccinia virus. This phenotype is found in the absence of CD69 in immunocompetent and immunodeficient hosts. As part of the innate immune system, NK lymphocytes are activated and participate in the defense against infection. Several studies have focused on the contribution of NK cells to protection against infection with vaccinia virus. In this study, it was demonstrated that the augmented early NK cell response in the absence of CD69 is responsible for the increased protection seen during infection with

  13. Diagnostic imaging in bovine orthopedics.

    Science.gov (United States)

    Kofler, Johann; Geissbühler, Urs; Steiner, Adrian

    2014-03-01

    Although a radiographic unit is not standard equipment for bovine practitioners in hospital or field situations, ultrasound machines with 7.5-MHz linear transducers have been used in bovine reproduction for many years, and are eminently suitable for evaluation of orthopedic disorders. The goal of this article is to encourage veterinarians to use radiology and ultrasonography for the evaluation of bovine orthopedic disorders. These diagnostic imaging techniques improve the likelihood of a definitive diagnosis in every bovine patient but especially in highly valuable cattle, whose owners demand increasingly more diagnostic and surgical interventions that require high-level specialized techniques. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. VARICELLA OUTBREAK IN A DAYCARE

    Science.gov (United States)

    Daskalaki, Irini; Thermitus, Rodrerica; Perella, Dana; Viner, Kendra; Spells, Niya; Mohanty, Salini; Lopez, Adriana; Johnson, Caroline

    2017-01-01

    As a result of single-dose varicella vaccination, daycare outbreaks have become rare. We investigated a daycare outbreak resulting from a misdiagnosed varicella case in an unvaccinated attendee. Of 25 attendees aged 12–32 months without evidence of immunity, 7 (28%) were unvaccinated due to religious/philosophical opposition or recent 1st birthday. Single-dose vaccination reduced disease by 92% compared with no vaccination. PMID:24136372

  15. Development of a recombinase polymerase amplification combined with lateral-flow dipstick assay for detection of bovine ephemeral fever virus.

    Science.gov (United States)

    Hou, Peili; Zhao, Guimin; Wang, Hongmei; He, Chengqiang; Huan, Yanjun; He, Hongbin

    2017-12-26

    Bovine ephemeral fever virus (BEFV), identified as the causative pathogen of bovine ephemeral fever (BEF), is responsible for increasing numbers of epidemics/outbreaks and has a significant harmful effect on the livestock industry. Therefore, a rapid detection assay is imperative for BEFV diagnosis. In this study, we described the development of lateral-flow dipstick isothermal recombinase polymerase amplification (LFD-RPA) assays for detection of BEFV. RPA primers and LF probes were designed by targeting the specific G gene, and the amplification product can be visualized on a simple lateral flow dipstick with the naked eyes. The amplification reaction was performed at 38 °C for 20 min and LFD incubation time within 5 min. The detection limit of this assay was 8 copies per reaction, and there was no cross-reactivity with other bovine infectious viruses such as bovine viral diarrhea virus, infectious bovine rhinotracheitis virus, bovine respiratory syncytial virus, bovine coronavirus, bovine parainfluenza virus type 3, bovine vesicular stomatitis virus. In addition, the assay was performed with total 128 clinical specimens and the diagnostic results were compared with conventional RT-PCR, real-time quantative(q) PCR. The result showed that the coincidence rate of BEFV LFD-RPA and real-time qPCR was 96.09% (123/128), which was higher than conventional RT-PCR. The RPA combined with LFD assay probably provides a rapid and sensitive alternative for diagnosis of BEFV infections outbreak. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. [Food borne infectious outbreaks, Austria 2005].

    Science.gov (United States)

    Much, Peter; Pichler, Juliane; Allerberger, Franz

    2007-01-01

    In Austria, a total of 606 food borne outbreaks, affecting 1,910 people altogether (including 368 hospitalized patients and 1 fatal outcome) were documented in 2005. Salmonella spp. and Campylobacter spp. accounted for 99% of all reported outbreaks. Fortysix (8%) of the 606 outbreaks were acquired abroad. Bacteria caused all but one of the 560 domestically acquired food borne outbreaks: 427 (76%) were due to Salmonella spp., 128 (23%) due to Campylobacter spp. and two outbreaks each due to enterohaemorrhagic Escherichia coli and Yersinia enterocolitica. Norovirus caused an outbreak affecting 22 persons. The respective hospitalization rate for domestically acquired Salmonella spp. and Campylobacter spp. infections was 20% and 16%. Of those outbreaks where information as to the source was provided, eggs were implicated in 57%, meat products (especially poultry) in 30% and milk or dairy products (especially raw milk) in 4%. The ratio between family outbreaks and general outbreaks was 89% to 11%. For general outbreaks the following locations of exposure were given: commercial food suppliers (incl. restaurants, cafeterias) 34 x, family celebrations 14 x, nursery schools 4 x, festivities (e.g. fairs) 3 x, nursing homes twice and once a mixed outbreak involving commercial food suppliers plus homes (Austria-wide S. Enteritidis PT19 outbreak). In our opinion, the relatively high number of family outbreaks merely reflects the still insufficient quality of epidemiological outbreak investigation in Austria, i.e. lack of consolidating individual clusters into larger food borne outbreaks which exceed district or provincial borders.

  17. Comparative Proteomics of Human Monkeypox and Vaccinia Intracellular Mature and Extracellular Enveloped Virions

    Energy Technology Data Exchange (ETDEWEB)

    Manes, Nathan P.; Estep, Ryan D.; Mottaz, Heather M.; Moore, Ronald J.; Clauss, Therese RW; Monroe, Matthew E.; Du, Xiuxia; Adkins, Joshua N.; Wong, Scott; Smith, Richard D.

    2008-03-07

    Orthopoxviruses are the largest and most complex of the animal viruses. In response to the recent emergence of monkeypox in Africa and the threat of smallpox bioterrorism, virulent (monkeypox virus) and benign (vaccinia virus) orthopoxviruses were proteomically compared with the goal of identifying proteins required for pathogenesis. Orthopoxviruses were grown in HeLa cells to two different viral forms (intracellular mature virus and extracellular enveloped virus), purified by sucrose gradient ultracentrifugation, denatured using RapiGest™ surfactant, and digested with trypsin. Unfractionated samples and strong cation exchange HPLC fractions were analyzed by reversed-phase LC-MS/MS, and analyses of the MS/MS spectra using SEQUEST® and X! Tandem resulted in the identification of hundreds of monkeypox, vaccinia, and copurified host proteins. The unfractionated samples were additionally analyzed by LC-MS on an LTQ-Orbitrap™, and the accurate mass and elution time tag approach was used to perform quantitative comparisons. Possible pathophysiological roles of differentially expressed orthopoxvirus genes are discussed.

  18. Genetically Engineered Vaccinia Viruses As Agents for Cancer Treatment, Imaging, and Transgene Delivery

    Directory of Open Access Journals (Sweden)

    Dana Haddad

    2017-05-01

    Full Text Available Despite advances in technology, the formidable challenge of treating cancer, especially if advanced, still remains with no significant improvement in survival rates, even with the most common forms of cancer. Oncolytic viral therapies have shown great promise for the treatment of various cancers, with the possible advantages of stronger treatment efficacy compared to conventional therapy due to higher tumor selectivity, and less toxicity. They are able to preferentially and selectively propagate in cancer cells, consequently destroying tumor tissue mainly via cell lysis, while leaving non-cancerous tissues unharmed. Several wild-type and genetically engineered vaccinia virus (VACV strains have been tested in both preclinical and clinical trials with promising results. Greater understanding and advancements in molecular biology have enabled the generation of genetically engineered oncolytic viruses for safer and more efficacious treatment, including arming VACVs with cytokines and immunostimulatory molecules, anti-angiogenic agents, and enzyme prodrug therapy, in addition to combining VACVs with conventional external and systemic radiotherapy, chemotherapy, immunotherapy, and other virus strains. Furthermore, novel oncolytic vaccinia virus strains have been generated that express reporter genes for the tracking and imaging of viral therapy and monitoring of therapeutic response. Further study is needed to unlock VACVs’ full potential as part of the future of cancer therapy.

  19. Treatment of Vaccinia and Cowpox Virus Infections in Mice with CMX001 and ST-246

    Directory of Open Access Journals (Sweden)

    Earl R. Kern

    2010-12-01

    Full Text Available Although a large number of compounds have been identified with antiviral activity against orthopoxviruses in tissue culture systems, it is highly preferred that these compounds have activity in vivo before they can be seriously considered for further development. One of the most commonly used animal models for the confirmation of this activity has been the use of mice infected with either vaccinia or cowpox viruses. These model systems have the advantage that they are relatively inexpensive, readily available and do not require any special containment facilities; therefore, relatively large numbers of compounds can be evaluated in vivo for their activity. The two antiviral agents that have progressed from preclinical studies to human safety trials for the treatment of orthopoxvirus infections are the cidofovir analog, CMX001, and an inhibitor of extracellular virus formation, ST-246. These compounds are the ones most likely to be used in the event of a bioterror attack. The purpose of this communication is to review the advantages and disadvantages of using mice infected with vaccinia and cowpox virus as surrogate models for human orthopoxvirus infections and to summarize the activity of CMX001 and ST-246 in these model infections.

  20. Vaccinia virus protein F12 associates with intracellular enveloped virions through an interaction with A36.

    Science.gov (United States)

    Johnston, Sara C; Ward, Brian M

    2009-02-01

    Vaccinia virus is the prototypical member of the family Poxviridae. Three morphologically distinct forms are produced during infection: intracellular mature virions (IMV), intracellular enveloped virions (IEV), and extracellular enveloped virions (EEV). Two viral proteins, F12 and A36, are found exclusively on IEV but not on IMV and EEV. Analysis of membranes from infected cells showed that F12 was only associated with membranes and is not an integral membrane protein. A yeast two-hybrid assay revealed an interaction between amino acids 351 to 458 of F12 and amino acids 91 to 111 of A36. We generated a recombinant vaccinia virus that expresses an F12, which lacks residues 351 to 458. Characterization of this recombinant revealed a small-plaque phenotype and a subsequent defect in virus release similar to a recombinant virus that had F12L deleted. In addition, F12 lacking residues 351 to 458 was unable to associate with membranes in infected cells. These results suggest that F12 associates with IEV through an interaction with A36 and that this interaction is critical for the function of F12 during viral egress.

  1. Genetically Engineered Vaccinia Viruses As Agents for Cancer Treatment, Imaging, and Transgene Delivery

    Science.gov (United States)

    Haddad, Dana

    2017-01-01

    Despite advances in technology, the formidable challenge of treating cancer, especially if advanced, still remains with no significant improvement in survival rates, even with the most common forms of cancer. Oncolytic viral therapies have shown great promise for the treatment of various cancers, with the possible advantages of stronger treatment efficacy compared to conventional therapy due to higher tumor selectivity, and less toxicity. They are able to preferentially and selectively propagate in cancer cells, consequently destroying tumor tissue mainly via cell lysis, while leaving non-cancerous tissues unharmed. Several wild-type and genetically engineered vaccinia virus (VACV) strains have been tested in both preclinical and clinical trials with promising results. Greater understanding and advancements in molecular biology have enabled the generation of genetically engineered oncolytic viruses for safer and more efficacious treatment, including arming VACVs with cytokines and immunostimulatory molecules, anti-angiogenic agents, and enzyme prodrug therapy, in addition to combining VACVs with conventional external and systemic radiotherapy, chemotherapy, immunotherapy, and other virus strains. Furthermore, novel oncolytic vaccinia virus strains have been generated that express reporter genes for the tracking and imaging of viral therapy and monitoring of therapeutic response. Further study is needed to unlock VACVs’ full potential as part of the future of cancer therapy. PMID:28589082

  2. Expression of CCL19 from Oncolytic Vaccinia Enhances Immunotherapeutic Potential while Maintaining Oncolytic Activity

    Directory of Open Access Journals (Sweden)

    Jun Li

    2012-12-01

    Full Text Available Promising phase II clinical results have been reported recently for several oncolytic viral therapeutics, including strains based on vaccinia virus. One reason for this has been an increased appreciation of the critical therapeutic importance of the immune response raised by these viruses. However, the most commonly used approaches to enhance these immunotherapeutic effects in oncolytic viruses, typically though expression of cytokine transgenes, often also result in a reduction in oncolytic activity and premature clearance of the virotherapy from the tumor. Approaches that enhance the immunotherapeutic effects while maintaining oncolytic activity would therefore be beneficial. Here, it is demonstrated that the expression of the chemokine CCL19 (ELC from an oncolytic vaccinia virus (vvCCL19 results in increased antitumor effects in syngeneic mouse tumor models. This corresponded with increased t cell and dendritic cell infiltration into the tumor. However, vvCCL19 persisted in the tumor at equivalent levels to a control virus without CCL19, demonstrating that oncolytic activity was not curtailed. Instead, vvCCL19 was cleared rapidly and selectively from normal tissues and organs, indicating a potentially increased safety profile. The therapeutic activity of vvCCL19 could be further significantly increased through combination with adoptive transfer of therapeutic immune cells expressing CCR7, the receptor for CCL19. This approach therefore represents a means to increase the safety and therapeutic benefit of oncolytic viruses, used alone or in combination with immune cell therapies.

  3. Treatment of Vaccinia and Cowpox Virus Infections in Mice with CMX001 and ST-246.

    Science.gov (United States)

    Quenelle, Debra C; Kern, Earl R

    2010-12-01

    Although a large number of compounds have been identified with antiviral activity against orthopoxviruses in tissue culture systems, it is highly preferred that these compounds have activity in vivo before they can be seriously considered for further development. One of the most commonly used animal models for the confirmation of this activity has been the use of mice infected with either vaccinia or cowpox viruses. These model systems have the advantage that they are relatively inexpensive, readily available and do not require any special containment facilities; therefore, relatively large numbers of compounds can be evaluated in vivo for their activity. The two antiviral agents that have progressed from preclinical studies to human safety trials for the treatment of orthopoxvirus infections are the cidofovir analog, CMX001, and an inhibitor of extracellular virus formation, ST-246. These compounds are the ones most likely to be used in the event of a bioterror attack. The purpose of this communication is to review the advantages and disadvantages of using mice infected with vaccinia and cowpox virus as surrogate models for human orthopoxvirus infections and to summarize the activity of CMX001 and ST-246 in these model infections.

  4. Preclinical evaluation of oncolytic vaccinia virus for therapy of canine soft tissue sarcoma.

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    Full Text Available Virotherapy using oncolytic vaccinia virus (VACV strains is one promising new strategy for canine cancer therapy. In this study we describe the establishment of an in vivo model of canine soft tissue sarcoma (CSTS using the new isolated cell line STSA-1 and the analysis of the virus-mediated oncolytic and immunological effects of two different Lister VACV LIVP1.1.1 and GLV-1h68 strains against CSTS. Cell culture data demonstrated that both tested VACV strains efficiently infected and destroyed cells of the canine soft tissue sarcoma line STSA-1. In addition, in our new canine sarcoma tumor xenograft mouse model, systemic administration of LIVP1.1.1 or GLV-1h68 viruses led to significant inhibition of tumor growth compared to control mice. Furthermore, LIVP1.1.1 mediated therapy resulted in almost complete tumor regression and resulted in long-term survival of sarcoma-bearing mice. The replication of the tested VACV strains in tumor tissues led to strong oncolytic effects accompanied by an intense intratumoral infiltration of host immune cells, mainly neutrophils. These findings suggest that the direct viral oncolysis of tumor cells and the virus-dependent activation of tumor-associated host immune cells could be crucial parts of anti-tumor mechanism in STSA-1 xenografts. In summary, the data showed that both tested vaccinia virus strains and especially LIVP1.1.1 have great potential for effective treatment of CSTS.

  5. Crosstalk between immune cell and oncolytic vaccinia therapy enhances tumor trafficking and antitumor effects.

    Science.gov (United States)

    Sampath, Padma; Li, Jun; Hou, Weizhou; Chen, Hannah; Bartlett, David L; Thorne, Steve H

    2013-03-01

    The combination of an oncolytic virus, that directly destroys tumor cells and mediates an acute immune response, with an immune cell therapy, capable of further enlisting and enhancing the host immune response, has the potential to create a potent therapeutic effect. We have previously developed several strategies for optimizing the delivery of oncolytic vaccinia virus vectors to their tumor targets, including the use of immune cell-based carrier vehicles and the incorporation of mutations that increase production of the enveloped form of vaccinia (extracellular enveloped viral (EEV)) that is better adapted to spread within a host. Here, we initially combine these approaches to create a novel therapeutic, consisting of an immune cell (cytokine-induced killer, CIK) preloaded with an oncolytic virus that is EEV enhanced. This resulted in direct interaction between the viral and immune cell components with each assisting the other in directing the therapy to the tumor and so enhancing the antitumor effects. This effect could be further improved through CCL5 expression from the virus. The resulting multicomponent therapy displays the ability for synergistic crosstalk between components, so significantly enhancing tumor trafficking and antitumor effects.

  6. Whole cell cryo-electron tomography reveals distinct disassembly intermediates of vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Marek Cyrklaff

    Full Text Available At each round of infection, viruses fall apart to release their genome for replication, and then reassemble into stable particles within the same host cell. For most viruses, the structural details that underlie these disassembly and assembly reactions are poorly understood. Cryo-electron tomography (cryo-ET, a unique method to investigate large and asymmetric structures at the near molecular resolution, was previously used to study the complex structure of vaccinia virus (VV. Here we study the disassembly of VV by cryo-ET on intact, rapidly frozen, mammalian cells, infected for up to 60 minutes. Binding to the cell surface induced distinct structural rearrangements of the core, such as a shape change, the rearrangement of its surface spikes and de-condensation of the viral DNA. We propose that the cell surface induced changes, in particular the decondensation of the viral genome, are a prerequisite for the subsequent release of the vaccinia DNA into the cytoplasm, which is followed by its cytoplasmic replication. Generally, this is the first study that employs whole cell cryo-ET to address structural details of pathogen-host cell interaction.

  7. CD40 ligand and tdTomato-armed vaccinia virus for induction of antitumor immune response and tumor imaging.

    Science.gov (United States)

    Parviainen, S; Ahonen, M; Diaconu, I; Hirvinen, M; Karttunen, Å; Vähä-Koskela, M; Hemminki, A; Cerullo, V

    2014-02-01

    Oncolytic vaccinia virus is an attractive platform for immunotherapy. Oncolysis releases tumor antigens and provides co-stimulatory danger signals. However, arming the virus can improve efficacy further. CD40 ligand (CD40L, CD154) can induce apoptosis of tumor cells and it also triggers several immune mechanisms. One of these is a T-helper type 1 (Th1) response that leads to activation of cytotoxic T-cells and reduction of immune suppression. Therefore, we constructed an oncolytic vaccinia virus expressing hCD40L (vvdd-hCD40L-tdTomato), which in addition features a cDNA expressing the tdTomato fluorochrome for detection of virus, potentially important for biosafety evaluation. We show effective expression of functional CD40L both in vitro and in vivo. In a xenograft model of bladder carcinoma sensitive to CD40L treatment, we show that growth of tumors was significantly inhibited by the oncolysis and apoptosis following both intravenous and intratumoral administration. In a CD40-negative model, CD40L expression did not add potency to vaccinia oncolysis. Tumors treated with vvdd-mCD40L-tdtomato showed enhanced efficacy in a syngenic mouse model and induced recruitment of antigen-presenting cells and lymphocytes at the tumor site. In summary, oncolytic vaccinia virus coding for CD40L mediates multiple antitumor effects including oncolysis, apoptosis and induction of Th1 type T-cell responses.

  8. Mutations Conferring Resistance to Viral DNA Polymerase Inhibitors in Camelpox Virus Give Different Drug-Susceptibility Profiles in Vaccinia Virus

    Czech Academy of Sciences Publication Activity Database

    Duraffour, S.; Andrei, G.; Topalis, D.; Krečmerová, Marcela; Crance, J. M.; Garin, D.; Snoeck, R.

    2012-01-01

    Roč. 86, č. 13 (2012), s. 7310-7325 ISSN 0022-538X Institutional support: RVO:61388963 Keywords : camelpox virus * CMLV * vaccinia virus VACV * acyclic nucleoside phosphonates * HPMPDAP * cidofovir * drug resistance Subject RIV: CC - Organic Chemistry Impact factor: 5.076, year: 2012

  9. Safety and immunogenicity of LC16m8, an attenuated smallpox vaccine in vaccinia-naive adults.

    Science.gov (United States)

    Kennedy, Jeffrey S; Gurwith, Marc; Dekker, Cornelia L; Frey, Sharon E; Edwards, Kathryn M; Kenner, Julie; Lock, Michael; Empig, Cyril; Morikawa, Shigeru; Saijo, Masayuki; Yokote, Hiroyuki; Karem, Kevin; Damon, Inger; Perlroth, Mark; Greenberg, Richard N

    2011-11-01

    LC16m8 is an attenuated cell culture-adapted Lister vaccinia smallpox vaccine missing the B5R protein and licensed for use in Japan. We conducted a phase I/II clinical trial that compared the safety and immunogenicity of LC16m8 with Dryvax in vaccinia-naive participants. Adverse events were assessed, as were electrocardiography and laboratory testing for cardiotoxicity and viral culturing of the vaccination sites. Neutralization titers to vaccinia, monkeypox, and variola major were assessed and cell-mediated immune responses were measured by interferon (IFN)-γ enzyme-linked immunosorbent spot and lymphoproliferation assays. Local and systemic reactions after vaccination with LC16m8 were similar to those reported after Dryvax. No clinically significant abnormalities consistent with cardiac toxicity were seen for either vaccine. Both vaccines achieved antivaccinia, antivariola, and antimonkeypox neutralizing antibody titers >1:40, although the mean plaque reduction neutralization titer of LC16m8 at day 30 after vaccination was significantly lower than Dryvax for anti-NYCBH vaccinia (P smallpox. Clinical Trials Registration. NCT00103584.

  10. Chemical inactivation of recombinant vaccinia viruses and the effects on antigenicity and immunogenicity of recombinant simian immunodeficiency virus envelope glycoproteins.

    NARCIS (Netherlands)

    E.G.J. Hulskotte (Ellen); M.E.M. Dings (Marlinda); S.G. Norley (Stephen); A.D.M.E. Osterhaus (Albert)

    1997-01-01

    textabstractThe efficiency of paraformaldehyde (PFA) and binary ethylenimine (BEI) in inactivating recombinant vaccinia virus (rVV), present in baby hamster kidney cells expressing simian immunodeficiency virus envelope glycoproteins (SIV-Env), was measured in a series of inactivation studies. Both

  11. Discontinuous transcription or RNA processing of vaccinia virus late messengers results in a 5' poly(A) leader

    NARCIS (Netherlands)

    Schwer, B; Visca, P.; Vos, J C; Stunnenberg, H.G.

    1987-01-01

    We have demonstrated by primer elongation and cap analysis that mature vaccinia virus late transcripts are discontinuously synthesized. We have shown that RNA transcripts from a translocated 11K and from the authentic 11K and 4b late promoters are extended by approximately 35 nucleotides beyond the

  12. Immunogenicity and protective efficacy of recombinant Modified Vaccinia virus Ankara candidate vaccines delivering West Nile virus envelope antigens

    NARCIS (Netherlands)

    Volz, Asisa; Lim, Stephanie; Kaserer, Martina; Pijlman, Gorben P.

    2016-01-01

    West Nile virus (WNV) cycles between insects and wild birds, and is transmitted via mosquito vectors to horses and humans, potentially causing severe neuroinvasive disease. Modified Vaccinia virus Ankara (MVA) is an advanced viral vector for developing new recombinant vaccines against infectious

  13. Identification of sites phosphorylated by the vaccinia virus B1R kinase in viral protein H5R

    Directory of Open Access Journals (Sweden)

    Hardie Grahame

    2000-09-01

    Full Text Available Abstract Background Vaccinia virus gene B1R encodes a serine/threonine protein kinase. In vitro this protein kinase phosphorylates ribosomal proteins Sa and S2 and vaccinia virus protein H5R, proteins that become phosphorylated during infection. Nothing is known about the sites phosphorylated on these proteins or the general substrate specificity of the kinase. The work described is the first to address these questions. Results Vaccinia virus protein H5R was phosphorylated by the B1R protein kinase in vitro, digested with V8 protease, and phosphopeptides separated by HPLC. The N-terminal sequence of one radioactively labelled phosphopeptide was determined and found to correspond to residues 81-87 of the protein, with Thr-84 and Thr-85 being phosphorylated. A synthetic peptide based on this region of the protein was shown to be a substrate for the B1R protein kinase, and the extent of phosphorylation was substantially decreased if either Thr residue was replaced by an Ala. Conclusions We have identified the first phosphorylation site for the vaccinia virus B1R protein kinase. This gives important information about the substrate-specificity of the enzyme, which differs from that of other known protein kinases. It remains to be seen whether the same site is phosphorylated in vivo.

  14. Concanavalin A-mediated cell agglutinability induced by Vaccinia virions. [Uv radiation, /sup 125/I tracer technique

    Energy Technology Data Exchange (ETDEWEB)

    Mbuy, G.; Bubel, H.C.

    1978-12-01

    The induction of enhanced concanavalin A (Con A)-mediated cellular agglutinability by purified vaccinia virus was examined quantitatively. Increased HEp-2 cell agglutinability by the lectin occurred within the first hour of infection and persisted without further change throughout the virus infectious cycle. Ultraviolet, but not heat-inactivated, virus was as effective as infectious virus in causing increased Con A agglutinability. Inhibition of viral and host cell protein synthesis by Streptovitacin A failed to alter the lectin response to vaccinia virus infection. Fluorescein-labeled Con A was observed to form clusters and large fluorescent patches on the infected cell surface during the earliest stage of infection. Studies with /sup 125/I-labeled Con A revealed an early but minimal increase in lectin binding to infected cells. After the first hour of infection, no further increase in Con A binding was observed. When cells were exposed to purified vaccinia virus surface tubules increased Con A agglutinability comparable to that obtained with native virus was demonstrated. Con A-mediated agglutinability of cells was temperature-dependent and displayed a higher temperature transition in infected cells. These data suggest that upon contact with the host cell, vaccinia virions or surface tubules induce alterations in the plasma membrane which are reflected in an enhanced agglutinability by Con A.

  15. Relationships of bovine ephemeral fever epizootics to population immunity and virus variation.

    Science.gov (United States)

    Ting, Lu-Jen; Lee, Ming-Shiuh; Lee, Shu-Hwae; Tsai, Hsiang-Jung; Lee, Fan

    2014-10-10

    Bovine ephemeral fever is an arthropod-borne bovine viral disease caused by infection with bovine ephemeral fever virus which belongs to genus Ephemerovirus within the family Rhabdoviridae. In this study, serological data and virological information about the disease and the virus, spanning from 2001 to 2013, were employed to analyze the relationships of bovine ephemeral fever epizootics to population immunity and virus variation. National and regional surveillance data indicated that 2 of the 3 major epizootics and 87% regional outbreaks were associated with lower neutralizing antibody titers and immunity coverage, reflecting the importance of population immunity for the control of bovine ephemeral fever. Phylogenetic analysis and sequence comparison demonstrated that Taiwanese bovine ephemeral fever viruses were >96.0% and >97.6% similar to the East Asian isolates in nucleotide and amino acid sequences, respectively. These analyses supported that the Taiwanese viruses shared the same gene pool with the strains of the other East Asian countries, mainly Japan. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Infecções humanas causadas por poxvirus relacionados ao vírus vaccinia no Brasil Human infections caused by vaccinia-like poxviruses in Brazil

    Directory of Open Access Journals (Sweden)

    Hermann G. Schatzmayr

    2009-12-01

    Full Text Available A partir de 1999, infecções humanas por Orthopoxvirus vem sendo observadas em pelo menos oito estados no país, com a formação de vesículas as quais evoluem para pústulas e crostas, principalmente nos membros superiores e face, após contacto com bovinos apresentando lesões semelhantes no úbere. Alem das lesões na pele, foram descritas nos pacientes reações ganglionares axilares por vezes dolorosas, febre, cefaléia, fadiga, desidratação, anorexia, sudorese, artralgia e mialgia, evoluindo o quadro por três a quatro semanas. Lesão vulvar bem como transmissão intrafamiliar foram igualmente descritas. Estudos moleculares demonstraram que os poxvirus identificados são geneticamente relacionados a amostras do vírus vaccinia utilizadas no passado, nas campanhas de vacinação. Especimens clínicos de 80 infecções humanas foram estudados no laboratório e a infecção por orthopoxvirus confirmada em 68 casos. São apresentadas lesões observadas em pacientes bem como discutidas as implicações desta zoonose no Brasil.Since 1999, human infection caused by Orthopoxvirus has been observed in at least eight Brazilian states, with the presence of vesicles that evolve to pustules and crusts, especially on the hands, arms and face, after contact with cows showing comparable lesions on the udder. In addition to the skin lesions, there have been descriptions of patients with axillary ganglionic reactions that are sometimes painful, along with fever, headache, fatigue, dehydration, anorexia, sudoresis, arthralgia and muscle pain. The condition evolves over a three to four-week period. Vulvar lesions and transmission within families have also been described. Molecular studies have shown that the poxviruses identified are genetically related to vaccinia virus samples that were used in vaccination campaigns in the past. Clinical specimens from 80 human infections were studied in the laboratory, and orthopoxvirus infections were confirmed in 68

  17. One-step multiplex real time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3.

    Science.gov (United States)

    Thonur, Leenadevi; Maley, Madeleine; Gilray, Janice; Crook, Tara; Laming, Ellie; Turnbull, Dylan; Nath, Mintu; Willoughby, Kim

    2012-03-28

    Detection of respiratory viruses in veterinary species has traditionally relied on virus detection by isolation or immunofluorescence and/or detection of circulating antibody using ELISA or serum neutralising antibody tests. Multiplex real time PCR is increasingly used to diagnose respiratory viruses in humans and has proved to be superior to traditional methods. Bovine respiratory disease (BRD) is one of the most common causes of morbidity and mortality in housed cattle and virus infections can play a major role. We describe here a one step multiplex reverse transcriptase quantitative polymerase chain reaction (mRT-qPCR) to detect the viruses commonly implicated in BRD. A mRT-qPCR assay was developed and optimised for the simultaneous detection of bovine respiratory syncytial virus (BRSV), bovine herpes virus type 1 (BoHV-1) and bovine parainfluenza virus type 3 (BPI3 i & ii) nucleic acids in clinical samples from cattle. The assay targets the highly conserved glycoprotein B gene of BoHV-1, nucleocapsid gene of BRSV and nucleoprotein gene of BPI3. This mRT-qPCR assay was assessed for sensitivity, specificity and repeatability using in vitro transcribed RNA and recent field isolates. For clinical validation, 541 samples from clinically affected animals were tested and mRT-qPCR result compared to those obtained by conventional testing using virus isolation (VI) and/or indirect fluorescent antibody test (IFAT). The mRT-qPCR assay was rapid, highly repeatable, specific and had a sensitivity of 97% in detecting 102 copies of BRSV, BoHV-1 and BPI3 i & ii. This is the first mRT-qPCR developed to detect the three primary viral agents of BRD and the first multiplex designed using locked nucleic acid (LNA), minor groove binding (MGB) and TaqMan probes in one reaction mix. This test was more sensitive than both VI and IFAT and can replace the aforesaid methods for virus detection during outbreaks of BRD.

  18. Viral infections and bovine mastitis: a review

    NARCIS (Netherlands)

    Wellenberg, G.J.; Poel, van der W.H.M.; Oirschot, van J.T.

    2002-01-01

    This review deals with the role of viruses in the aetiology of bovine mastitis. Bovine herpesvirus 1, bovine herpesvirus 4, foot-and-mouth disease virus, and parainfluenza 3 virus have been isolated from milk from cows with clinical mastitis. Intramammary inoculations of bovine herpesvirus 1 or

  19. Thy1+ Nk Cells from Vaccinia Virus-Primed Mice Confer Protection against Vaccinia Virus Challenge in the Absence of Adaptive Lymphocytes

    Science.gov (United States)

    Gillard, Geoffrey O.; Bivas-Benita, Maytal; Hovav, Avi-Hai; Grandpre, Lauren E.; Panas, Michael W.; Seaman, Michael S.; Haynes, Barton F.; Letvin, Norman L.

    2011-01-01

    While immunological memory has long been considered the province of T- and B- lymphocytes, it has recently been reported that innate cell populations are capable of mediating memory responses. We now show that an innate memory immune response is generated in mice following infection with vaccinia virus, a poxvirus for which no cognate germline-encoded receptor has been identified. This immune response results in viral clearance in the absence of classical adaptive T and B lymphocyte populations, and is mediated by a Thy1+ subset of natural killer (NK) cells. We demonstrate that immune protection against infection from a lethal dose of virus can be adoptively transferred with memory hepatic Thy1+ NK cells that were primed with live virus. Our results also indicate that, like classical immunological memory, stronger innate memory responses form in response to priming with live virus than a highly attenuated vector. These results demonstrate that a defined innate memory cell population alone can provide host protection against a lethal systemic infection through viral clearance. PMID:21829360

  20. Are bark beetle outbreaks less synchronous than forest Lepidoptera outbreaks?

    Science.gov (United States)

    Bjorn Okland; Andrew M. Liebhold; Ottar N. Bjornstad; Nadir Erbilgin; Paal Krokene; Paal Krokene

    2005-01-01

    Comparisons of intraspecific spatial synchrony across multiple epidemic insect species can be useful for generating hypotheses about major determinants of population patterns at larger scales. The present study compares patterns of spatial synchrony in outbreaks of six epidemic bark beetle species in North America and Europe. Spatial synchrony among populations of the...

  1. CDC Vital Signs: Preventing Norovirus Outbreaks

    Science.gov (United States)

    ... Press Kit Read the MMWR Science Clips Preventing Norovirus Outbreaks Food service has a key role. Language: ... and on-call staffing, to support compliance. Problem Norovirus outbreaks from contaminated food are common in food ...

  2. Reporting and Surveillance for Norovirus Outbreaks

    Science.gov (United States)

    ... Health NoroCORE Food Virology Reporting and Surveillance for Norovirus Recommend on Facebook Tweet Share Compartir On this ... identify newly emerging norovirus strains. Definition of a Norovirus Outbreak An outbreak of norovirus is defined as ...

  3. Norovirus: U.S. Trends and Outbreaks

    Science.gov (United States)

    ... a new strain of the virus going around. Norovirus-associated Deaths See also: Norovirus-associated Hospitalizations Norovirus- ... to the Foodborne Outbreak Online Database (FOOD) . Common Norovirus Outbreak Settings Norovirus in Healthcare Facilities Health care ...

  4. Prevalence of antibodies to Vaccinia virus after smallpox vaccination in Italy.

    Science.gov (United States)

    Pütz, Mike M; Alberini, Isabella; Midgley, Claire M; Manini, Ilaria; Montomoli, Emanuele; Smith, Geoffrey L

    2005-11-01

    Decades after smallpox was eradicated and vaccination discontinued, the level of residual immunity in today's population is largely unknown. This study describes an epidemiological assessment in Italians of antibodies against the intracellular mature virus (IMV) and extracellular envelope virus (EEV) forms of Vaccinia virus. Serum samples (n = 642) were taken in 1993 and 2003 from people between 11 and 102 years old. Most citizens >27 years old were positive for antibodies to IMV and EEV. These antibodies were long-lasting and similar titres were present in citizens between 30 and 100 years old. Serum samples from 1993 and 2003 displayed very similar EEV- and IMV-specific antibody titres. By using these data and demographic considerations, it was predicted that, in 2003, 46 % of the Italian population were positive for both IMV and EEV, 42 % were negative for both and 12 % were positive for one antigen.

  5. Successful pseudorabies vaccination in maternally immune piglets using recombinant vaccinia virus vaccines.

    Science.gov (United States)

    Brockmeier, S I; Lager, K M; Mengeling, W L

    1997-01-01

    Three gilts were vaccinated with a NYVAC vaccinia recombinant expressing glycoprotein gD of pseudorabies virus (PRV) (NYVAC/gD). After farrowing, the piglets were allowed to nurse normally to obtain colostral immunity and then were divided into four groups, receiving NYVAC/gD, a NYVAC recombinant expressing glycoprotein gB of PRV (NYVAC/gB), an inactivated PRV vaccine (iPRV), or no vaccine. The piglets were vaccinated twice, three weeks apart beginning at approximately two weeks of age and later challenged with virulent PRV oronasally. Piglets that received NYVAC/gB or iPRV were the best protected based on lack of mortality, lower temperature responses, decreased weight loss and decreased viral shedding after challenge. These results indicate effective strategies for stimulating active immune response while still under the protection of maternal immunity.

  6. Myxoma and vaccinia virus exploit different mechanisms to enter and infect human cancer cells

    Science.gov (United States)

    Villa, Nancy Y.; Bartee, Eric; Mohamed, Mohamed R.; Rahman, Masmudur M.; Barrett, John W.; McFadden, Grant

    2010-01-01

    Myxoma (MYXV) and vaccinia virus (VACV) have recently emerged as potential oncolytic agents that can infect and kill different human cancer cells. Although both are structurally similar, it is unknown whether the pathway(s) used by these poxviruses to enter and cause oncolysis in cancer cells are mechanistically similar. Here, we compared the entry of MYXV and VACV-WR into various human cancer cells and observed significant differences: 1- Low pH treatment accelerates fusion-mediated entry of VACV but not MYXV, 2- The tyrosine kinase inhibitor genistein inhibits entry of VACV, but not MYXV, 3- Knockdown of PAK1 revealed that it is required for a late stage downstream of MYXV entry into cancer cells, whereas PAK1 is required for VACV entry into the same target cells. These results suggest that VACV and MYXV exploit different mechanisms to enter into human cancer cells, thus providing some rationale for their divergent cancer cell tropisms. PMID:20334889

  7. RNAi Screening Reveals Proteasome- and Cullin3-Dependent Stages in Vaccinia Virus Infection

    Directory of Open Access Journals (Sweden)

    Jason Mercer

    2012-10-01

    Full Text Available A two-step, automated, high-throughput RNAi silencing screen was used to identify host cell factors required during vaccinia virus infection. Validation and analysis of clustered hits revealed previously unknown processes during virus entry, including a mechanism for genome uncoating. Viral core proteins were found to be already ubiquitinated during virus assembly. After entering the cytosol of an uninfected cell, the viral DNA was released from the core through the activity of the cell’s proteasomes. Next, a Cullin3-based ubiquitin ligase mediated a further round of ubiquitination and proteasome action. This was needed in order to initiate viral DNA replication. The results accentuate the value of large-scale RNAi screens in providing directions for detailed cell biological investigation of complex pathways. The list of cell functions required during poxvirus infection will, moreover, provide a resource for future virus-host cell interaction studies and for the discovery of antivirals.

  8. Pathogenesis of bovine neosporosis.

    Science.gov (United States)

    Dubey, J P; Buxton, D; Wouda, W

    2006-05-01

    The protozoan parasite Neospora caninum is a major pathogen of cattle and dogs, being a significant cause of abortion in cattle in many countries. It is one of the most efficiently transmitted parasites, with up to 90% of cattle infected in some herds. The pathogenesis of abortion due to Neospora is complex and only partially understood. Losses occur after a primary infection during pregnancy but more commonly as the result of recrudescence of a persistent infection during pregnancy. Parasitaemia is followed by invasion of the placenta and fetus. It is suggested that abortion occurs when primary parasite-induced placental damage jeopardises fetal survival directly or causes release of maternal prostaglandins that in turn cause luteolysis and abortion. Fetal damage may also occur due to primary tissue damage caused by the multiplication of N. caninum in the fetus or due to insufficient oxygen/nutrition, secondary to placental damage. In addition, maternal immune expulsion of the fetus may occur associated with maternal placental inflammation and the release of maternal pro-inflammatory cytokines in the placenta. Thus N. caninum is a primary pathogen capable of causing abortion either through maternal placental inflammation, maternal and fetal placental necrosis, fetal damage, or a combination of all three. The question of how N. caninum kills the fetus exposes the complex and finely balanced biological processes that have evolved to permit bovine and other mammalian pregnancies to occur. Defining these immunological mechanisms will shed light on potential methods of control of bovine neosporosis and enrich our understanding of the continuity of mammalian and protozoal survival.

  9. Vaccinia virus G8R protein: a structural ortholog of proliferating cell nuclear antigen (PCNA.

    Directory of Open Access Journals (Sweden)

    Melissa Da Silva

    Full Text Available BACKGROUND: Eukaryotic DNA replication involves the synthesis of both a DNA leading and lagging strand, the latter requiring several additional proteins including flap endonuclease (FEN-1 and proliferating cell nuclear antigen (PCNA in order to remove RNA primers used in the synthesis of Okazaki fragments. Poxviruses are complex viruses (dsDNA genomes that infect eukaryotes, but surprisingly little is known about the process of DNA replication. Given our previous results that the vaccinia virus (VACV G5R protein may be structurally similar to a FEN-1-like protein and a recent finding that poxviruses encode a primase function, we undertook a series of in silico analyses to identify whether VACV also encodes a PCNA-like protein. RESULTS: An InterProScan of all VACV proteins using the JIPS software package was used to identify any PCNA-like proteins. The VACV G8R protein was identified as the only vaccinia protein that contained a PCNA-like sliding clamp motif. The VACV G8R protein plays a role in poxvirus late transcription and is known to interact with several other poxvirus proteins including itself. The secondary and tertiary structure of the VACV G8R protein was predicted and compared to the secondary and tertiary structure of both human and yeast PCNA proteins, and a high degree of similarity between all three proteins was noted. CONCLUSIONS: The structure of the VACV G8R protein is predicted to closely resemble the eukaryotic PCNA protein; it possesses several other features including a conserved ubiquitylation and SUMOylation site that suggest that, like its counterpart in T4 bacteriophage (gp45, it may function as a sliding clamp ushering transcription factors to RNA polymerase during late transcription.

  10. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA*

    Science.gov (United States)

    Burmeister, Wim P.; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N.; Iseni, Frédéric

    2015-01-01

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201–50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201–50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. PMID:26045555

  11. Crystal Structure of the Vaccinia Virus Uracil-DNA Glycosylase in Complex with DNA.

    Science.gov (United States)

    Burmeister, Wim P; Tarbouriech, Nicolas; Fender, Pascal; Contesto-Richefeu, Céline; Peyrefitte, Christophe N; Iseni, Frédéric

    2015-07-17

    Vaccinia virus polymerase holoenzyme is composed of the DNA polymerase catalytic subunit E9 associated with its heterodimeric co-factor A20·D4 required for processive genome synthesis. Although A20 has no known enzymatic activity, D4 is an active uracil-DNA glycosylase (UNG). The presence of a repair enzyme as a component of the viral replication machinery suggests that, for poxviruses, DNA synthesis and base excision repair is coupled. We present the 2.7 Å crystal structure of the complex formed by D4 and the first 50 amino acids of A20 (D4·A201-50) bound to a 10-mer DNA duplex containing an abasic site resulting from the cleavage of a uracil base. Comparison of the viral complex with its human counterpart revealed major divergences in the contacts between protein and DNA and in the enzyme orientation on the DNA. However, the conformation of the dsDNA within both structures is very similar, suggesting a dominant role of the DNA conformation for UNG function. In contrast to human UNG, D4 appears rigid, and we do not observe a conformational change upon DNA binding. We also studied the interaction of D4·A201-50 with different DNA oligomers by surface plasmon resonance. D4 binds weakly to nonspecific DNA and to uracil-containing substrates but binds abasic sites with a Kd of DNA complex structure of a family I UNG gives new insight into the role of D4 as a co-factor of vaccinia virus DNA polymerase and allows a better understanding of the structural determinants required for UNG action. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Modulation of the myxoma virus plaque phenotype by vaccinia virus protein F11.

    Science.gov (United States)

    Irwin, Chad R; Evans, David H

    2012-07-01

    Vaccinia virus (VACV) produces large plaques consisting of a rapidly expanding ring of infected cells surrounding a lytic core, whereas myxoma virus (MYXV) produces small plaques that resemble a focus of transformed cells. This is odd, because bioinformatics suggests that MYXV carries homologs of nearly all of the genes regulating Orthopoxvirus attachment, entry, and exit. So why does MYXV produce foci? One notable difference is that MYXV-infected cells produce few of the actin microfilaments that promote VACV exit and spread. This suggested that although MYXV carries homologs of the required genes (A33R, A34R, A36R, and B5R), they are dysfunctional. To test this, we produced MYXV recombinants expressing these genes, but we could not enhance actin projectile formation even in cells expressing all four VACV proteins. Another notable difference between these viruses is that MYXV lacks a homolog of the F11L gene. F11 inhibits the RhoA-mDia signaling that maintains the integrity of the cortical actin layer. We constructed an MYXV strain encoding F11L and observed that, unlike wild-type MYXV, the recombinant virus disrupted actin stress fibers and produced plaques up to 4-fold larger than those of controls, and these plaques expanded ∼6-fold faster. These viruses also grew to higher titers in multistep growth conditions, produced higher levels of actin projectiles, and promoted infected cell movement, although neither process was to the extent of that observed in VACV-infected cells. Thus, one reason for why MYXV produces small plaques is that it cannot spread via actin filaments, although the reason for this deficiency remains obscure. A second reason is that leporipoxviruses lack vaccinia's capacity to disrupt cortical actin.

  13. Modulation of gene expression in a human cell line caused by poliovirus, vaccinia virus and interferon

    Directory of Open Access Journals (Sweden)

    Hoddevik Gunnar

    2007-03-01

    Full Text Available Abstract Background The project was initiated to describe the response of a human embryonic fibroblast cell line to the replication of two different viruses, and, more specifically, to look for candidate genes involved in viral defense. For this purpose, the cells were synchronously infected with poliovirus in the absence or presence of interferon-alpha, or with vaccinia virus, a virus that is not inhibited by interferon. By comparing the changes in transcriptosome due to these different challenges, it should be possible to suggest genes that might be involved in defense. Results The viral titers were sufficient to yield productive infection in a majority of the cells. The cells were harvested in triplicate at various time-points, and the transcriptosome compared with mock infected cells using oligo-based, global 35 k microarrays. While there was very limited similarities in the response to the different viruses, a large proportion of the genes up-regulated by interferon-alpha were also up-regulated by poliovirus. Interferon-alpha inhibited poliovirus replication, but there were no signs of any interferons being induced by poliovirus. The observations suggest that the cells do launch an antiviral response to poliovirus in the absence of interferon. Analyses of the data led to a list of candidate antiviral genes. Functional information was limited, or absent, for most of the candidate genes. Conclusion The data are relevant for our understanding of how the cells respond to poliovirus and vaccinia virus infection. More annotations, and more microarray studies with related viruses, are required in order to narrow the list of putative defence-related genes.

  14. Chikungunya Outbreak, South India, 2006

    Science.gov (United States)

    Kaur, Prabhdeep; Ponniah, Manickam; Murhekar, Manoj V.; Ramachandran, Vidya; Ramachandran, Ramakrishnan; Raju, Hari Kishan; Perumal, Vanamail; Mishra, Akhilesh C.

    2008-01-01

    We investigated chikungunya outbreaks in South India and observed a high attack rate, particularly among adults and women. Transmission was facilitated by Aedes aegypti mosquitoes in peridomestic water containers, as indicated by a high Breteau index. We recommended vector control measures and health education to promote safe water storage practices. PMID:18826830

  15. Chikungunya fever outbreak, Bhutan, 2012.

    Science.gov (United States)

    Wangchuk, Sonam; Chinnawirotpisan, Piyawan; Dorji, Tshering; Tobgay, Tashi; Dorji, Tandin; Yoon, In-Kyu; Fernandez, Stefan

    2013-10-01

    In 2012, chikungunya virus (CHIKV) was reported for the first time in Bhutan. IgM ELISA results were positive for 36/210 patient samples; PCR was positive for 32/81. Phylogenetic analyses confirmed that Bhutan CHIKV belongs to the East/Central/South African genotype. Appropriate responses to future outbreaks require a system of surveillance and improved laboratory capacity.

  16. Measles (Rubeola) Cases and Outbreaks

    Science.gov (United States)

    ... the Field: Measles Outbreak at a United States Immigration and Customs Enforcement Facility — Arizona, May–June 2016 MMWR. May 26, ... May 25, 2016, a detainee at a U.S. Immigration and Customs Enforcement (ICE) detention center in Arizona who had been ...

  17. [Water-borne disease outbreaks in Norway].

    Science.gov (United States)

    Nygård, Karin; Gondrosen, Bjørn; Lund, Vidar

    2003-12-04

    The drinking water in Norway has traditionally been considered being of good quality. However, outbreaks related to drinking water are reported every year. We review waterborne outbreaks in Norway over the last 15 years, and describe the aetiology of and contributory factors in these outbreaks. We compiled data on waterborne outbreaks reported to the Norwegian Institute of Public Health and Norwegian Food Control Authority during 1988-2002. We included all events in which two or more people fell ill and water was the suspected source of infection. Over the 15-year period. 72 outbreaks were reported, affecting a total of 10 616 persons. Campylobacter was the cause in 26% (19/72) of the outbreaks, norovirus in 18% (13/72). The causative organism was unknown in 46% (33/72). The water came from public waterworks in 32 of the 54 outbreaks for which this information was available (59%); from a private supply in the remaining 22. For 62% (16/26) of the outbreaks related to waterworks, the water was not disinfected before distribution. None of the private water supplies were disinfected. Over the last five years, there were more outbreaks related to private supplies. The most important contributory factor to waterborne outbreaks in Norway is contamination of the raw water combined with missing or faulty disinfecting procedures. To prevent future outbreaks, a continuous upgrading of small and private water supplies is needed. Reporting of outbreaks is important for the implementation of targeted and effective preventive measures.

  18. Genome sequencing, metabolic and antibiotic resistance phenotyping of diverse nasopharyngeal bacteria isolated from cattle in an epidemiological study of bovine respiratory disease

    Science.gov (United States)

    Problem: Despite over 100 years of research to reduce the incidence and impact of bovine respiratory disease complex (BRDC) in North American feed yard cattle, outbreaks still occur accounting for up to 75% of feed yard cattle morbidity. BRDC is the primary driver of health-related antibiotic trea...

  19. Use of the Capripoxvirus homologue of Vaccinia virus 30 kDa RNA polymerase subunit (RPO30) gene as a novel diagnostic and genotyping target: development of a classical PCR method to differentiate Goat poxvirus from Sheep poxvirus.

    Science.gov (United States)

    Lamien, Charles Euloge; Le Goff, Christian; Silber, Roland; Wallace, David B; Gulyaz, Velý; Tuppurainen, Eeva; Madani, Hafsa; Caufour, Philippe; Adam, Tajelser; El Harrak, Mehdi; Luckins, Antony George; Albina, Emmanuel; Diallo, Adama

    2011-04-21

    Sheep poxvirus (SPPV), Goat poxvirus (GTPV) and Lumpy skin disease virus (LSDV) are Capripoxviruses (CaPVs) responsible for causing severe poxvirus disease in sheep, goats and cattle, respectively. Serological differentiation of CaPVs is not possible and strain identification has relied on the implicitly accepted hypothesis that the viruses show well defined host specificity. However, it is now known that cross infections can occur and authentication of identity based on the host animal species from which the strain was first isolated, is not valid and should be replaced with molecular techniques to allow unequivocal strain differentiation. To identify a diagnostic target for strain genotyping, the CaPV homologue of the Vaccinia virus E4L gene which encodes the 30 kDa DNA-dependent RNA polymerase subunit, RPO30 was analyzed. Forty-six isolates from different hosts and geographical origins were included. Most CaPVs fit into one of the three different groups according to their host origins: the SPPV, the GTPV and the LSDV group. A unique 21-nucleotide deletion was found in all SPPV isolates which was exploited to develop a RPO30-based classical PCR test to differentiate SPPV from GTPV that will allow rapid differential diagnosis of disease during CaPV outbreaks in small ruminants. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Vaccinia virus-mediated melanin production allows MR and optoacoustic deep tissue imaging and laser-induced thermotherapy of cancer.

    Science.gov (United States)

    Stritzker, Jochen; Kirscher, Lorenz; Scadeng, Miriam; Deliolanis, Nikolaos C; Morscher, Stefan; Symvoulidis, Panagiotis; Schaefer, Karin; Zhang, Qian; Buckel, Lisa; Hess, Michael; Donat, Ulrike; Bradley, William G; Ntziachristos, Vasilis; Szalay, Aladar A

    2013-02-26

    We reported earlier the delivery of antiangiogenic single chain antibodies by using oncolytic vaccinia virus strains to enhance their therapeutic efficacy. Here, we provide evidence that gene-evoked production of melanin can be used as a therapeutic and diagnostic mediator, as exemplified by insertion of only one or two genes into the genome of an oncolytic vaccinia virus strain. We found that produced melanin is an excellent reporter for optical imaging without addition of substrate. Melanin production also facilitated deep tissue optoacoustic imaging as well as MRI. In addition, melanin was shown to be a suitable target for laser-induced thermotherapy and enhanced oncolytic viral therapy. In conclusion, melanin as a mediator for thermotherapy and reporter for different imaging modalities may soon become a versatile alternative to replace fluorescent proteins also in other biological systems. After ongoing extensive preclinical studies, melanin overproducing oncolytic virus strains might be used in clinical trials in patients with cancer.

  1. Significant Growth Inhibition of Canine Mammary Carcinoma Xenografts following Treatment with Oncolytic Vaccinia Virus GLV-1h68

    Science.gov (United States)

    Gentschev, Ivaylo; Ehrig, Klaas; Donat, Ulrike; Hess, Michael; Rudolph, Stephan; Chen, Nanhai; Yu, Yong A.; Zhang, Qian; Bullerdiek, Jörn; Nolte, Ingo; Stritzker, Jochen; Szalay, Aladar A.

    2010-01-01

    Canine mammary carcinoma is a highly metastatic tumor that is poorly responsive to available treatment. Therefore, there is an urgent need to identify novel agents for therapy of this disease. Recently, we reported that the oncolytic vaccinia virus GLV-1h68 could be a useful tool for therapy of canine mammary adenoma in vivo. In this study we analyzed the therapeutic effect of GLV-1h68 against canine mammary carcinoma. Cell culture data demonstrated that GLV-1h68 efficiently infected and destroyed cells of the mammary carcinoma cell line MTH52c. Furthermore, after systemic administration, this attenuated vaccinia virus strain primarily replicated in canine tumor xenografts in nude mice. Finally, infection with GLV-1h68 led to strong inflammatory and oncolytic effects resulting in significant growth inhibition of the tumors. In summary, the data showed that the GLV-1h68 virus strain has promising potential for effective treatment of canine mammary carcinoma. PMID:20631910

  2. Origin-independent plasmid replication occurs in vaccinia virus cytoplasmic factories and requires all five known poxvirus replication factors

    Directory of Open Access Journals (Sweden)

    Moss Bernard

    2005-03-01

    Full Text Available Abstract Background Replication of the vaccinia virus genome occurs in cytoplasmic factory areas and is dependent on the virus-encoded DNA polymerase and at least four additional viral proteins. DNA synthesis appears to start near the ends of the genome, but specific origin sequences have not been defined. Surprisingly, transfected circular DNA lacking specific viral sequences is also replicated in poxvirus-infected cells. Origin-independent plasmid replication depends on the viral DNA polymerase, but neither the number of additional viral proteins nor the site of replication has been determined. Results Using a novel real-time polymerase chain reaction assay, we detected a >400-fold increase in newly replicated plasmid in cells infected with vaccinia virus. Studies with conditional lethal mutants of vaccinia virus indicated that each of the five proteins known to be required for viral genome replication was also required for plasmid replication. The intracellular site of replication was determined using a plasmid containing 256 repeats of the Escherichia coli lac operator and staining with an E. coli lac repressor-maltose binding fusion protein followed by an antibody to the maltose binding protein. The lac operator plasmid was localized in cytoplasmic viral factories delineated by DNA staining and binding of antibody to the viral uracil DNA glycosylase, an essential replication protein. In addition, replication of the lac operator plasmid was visualized continuously in living cells infected with a recombinant vaccinia virus that expresses the lac repressor fused to enhanced green fluorescent protein. Discrete cytoplasmic fluorescence was detected in cytoplasmic juxtanuclear sites at 6 h after infection and the area and intensity of fluorescence increased over the next several hours. Conclusion Replication of a circular plasmid lacking specific poxvirus DNA sequences mimics viral genome replication by occurring in cytoplasmic viral factories

  3. Oral immunization and protection of raccoons (Procyon lotor) with a vaccinia-rabies glycoprotein recombinant virus vaccine.

    OpenAIRE

    Rupprecht, C. E.; Wiktor, T. J.; Johnston, D H; Hamir, A. N.; Dietzschold, B; Wunner, W. H.; Glickman, L T; Koprowski, H

    1986-01-01

    Animal rabies control has been frustrated by the existence of multiple wildlife reservoirs and the lack of efficacious oral vaccines. In this investigation, raccoons fed a vaccinia-rabies glycoprotein recombinant virus in a sponge bait developed rabies virus-neutralizing antibody (0.6-54.0 units) and resisted street rabies virus infection 28 and 205 days after feeding. Additional raccoons immunized by oral infusion with attenuated antigenic variants of rabies virus strains CVS-11 and ERA fail...

  4. Prospective surveillance for cardiac adverse events in healthy adults receiving modified vaccinia Ankara vaccines: a systematic review.

    Directory of Open Access Journals (Sweden)

    Marnie L Elizaga

    Full Text Available Vaccinia-associated myo/pericarditis was observed during the US smallpox vaccination (DryVax campaign initiated in 2002. A highly-attenuated vaccinia strain, modified vaccinia Ankara (MVA has been evaluated in clinical trials as a safer alternative to DryVax and as a vector for recombinant vaccines. Due to the lack of prospectively collected cardiac safety data, the US Food and Drug Administration required cardiac screening and surveillance in all clinical trials of MVA since 2004. Here, we report cardiac safety surveillance from 6 phase I trials of MVA vaccines.Four clinical research organizations contributed cardiac safety data using common surveillance methods in trials administering MVA or recombinant MVA vaccines to healthy participants. 'Routine cardiac investigations' (ECGs and cardiac enzymes obtained 2 weeks after injections of MVA or MVA-HIV recombinants, or placebo-controls, and 'Symptom-driven cardiac investigations' are reported. The outcome measure is the number of participants who met the CDC-case definition for vaccinia-related myo/pericarditis or who experienced cardiac adverse events from an MVA vaccine.Four hundred twenty-five study participants had post-vaccination safety data analyzed, 382 received at least one MVA-containing vaccine and 43 received placebo; 717 routine ECGs and 930 cardiac troponin assays were performed. Forty-five MVA recipients (12% had additional cardiac testing performed; 22 for cardiac symptoms, 19 for ECG/laboratory changes, and 4 for cardiac symptoms with an ECG/laboratory change. No participant had evidence of symptomatic or asymptomatic myo/pericarditis meeting the CDC-case definition and judged to be related to an MVA vaccine.Prospective surveillance of MVA recipients for myo/pericarditis did not detect cardiac adverse reactions in 382 study participants.ClinicalTrials.gov NCT00082446 NCT003766090 NCT00252148 NCT00083603 NCT00301184 NCT00428337.

  5. Prospective surveillance for cardiac adverse events in healthy adults receiving modified vaccinia Ankara vaccines: a systematic review.

    Science.gov (United States)

    Elizaga, Marnie L; Vasan, Sandhya; Marovich, Mary A; Sato, Alicia H; Lawrence, Dale N; Chaitman, Bernard R; Frey, Sharon E; Keefer, Michael C

    2013-01-01

    Vaccinia-associated myo/pericarditis was observed during the US smallpox vaccination (DryVax) campaign initiated in 2002. A highly-attenuated vaccinia strain, modified vaccinia Ankara (MVA) has been evaluated in clinical trials as a safer alternative to DryVax and as a vector for recombinant vaccines. Due to the lack of prospectively collected cardiac safety data, the US Food and Drug Administration required cardiac screening and surveillance in all clinical trials of MVA since 2004. Here, we report cardiac safety surveillance from 6 phase I trials of MVA vaccines. Four clinical research organizations contributed cardiac safety data using common surveillance methods in trials administering MVA or recombinant MVA vaccines to healthy participants. 'Routine cardiac investigations' (ECGs and cardiac enzymes obtained 2 weeks after injections of MVA or MVA-HIV recombinants, or placebo-controls), and 'Symptom-driven cardiac investigations' are reported. The outcome measure is the number of participants who met the CDC-case definition for vaccinia-related myo/pericarditis or who experienced cardiac adverse events from an MVA vaccine. Four hundred twenty-five study participants had post-vaccination safety data analyzed, 382 received at least one MVA-containing vaccine and 43 received placebo; 717 routine ECGs and 930 cardiac troponin assays were performed. Forty-five MVA recipients (12%) had additional cardiac testing performed; 22 for cardiac symptoms, 19 for ECG/laboratory changes, and 4 for cardiac symptoms with an ECG/laboratory change. No participant had evidence of symptomatic or asymptomatic myo/pericarditis meeting the CDC-case definition and judged to be related to an MVA vaccine. Prospective surveillance of MVA recipients for myo/pericarditis did not detect cardiac adverse reactions in 382 study participants. ClinicalTrials.gov NCT00082446 NCT003766090 NCT00252148 NCT00083603 NCT00301184 NCT00428337.

  6. [Modified vaccinia virus ankara (MVA)--development as recombinant vaccine and prospects for use in veterinary medicine].

    Science.gov (United States)

    Volz, Asisa; Fux, Robert; Langenmayer, Martin C; Sutter, Gerd

    2015-01-01

    Poxviruses as expression vectors are widely used in medical research for the development of recombinant vaccines and molecular therapies. Here we review recent accomplishments in vaccine research using recombinant modified vaccinia virus ankara (MVA). MVA is a highly attenuated vaccinia virus strain that originated from serial tissue culture passage in chicken embryo fibroblasts more than 40 years ago. Growth adaptation to avian host cells caused deletions and mutations in the viral genome affecting about 15% of the original genetic information. In consequence, MVA is replication-deficient in cells of mammalian origin and fails to produce many of the virulence factors encoded by conventional vaccinia virus. Because of its safety for the general environment MVA can be handled under conditions of biosafety level one. Non-replicating MVA can enter any target cell and activate its molecular life cycle to express all classes of viral and recombinant genes. Therefore, recombinant MVA have been established as an extremely safe and efficient vector system for vaccine development in medical research. By now, various recombinant MVA vaccines have been found safe and immunogenic when used for phase I/II clinical testing in humans, and suitable for industrial scale production following good practice of manufacturing. Thus, there is an obvious usefulness of recombinant MVA vaccines for novel prophylactic and therapeutic approaches also in veterinary medicine. Results from first studies in companion and farm animals are highly promising.

  7. Biosafety aspects of modified vaccinia virus Ankara (MVA)-based vectors used for gene therapy or vaccination.

    Science.gov (United States)

    Verheust, Céline; Goossens, Martine; Pauwels, Katia; Breyer, Didier

    2012-03-30

    The modified vaccinia virus Ankara (MVA) strain is a highly attenuated strain of vaccinia virus that has been demonstrated to be safe for humans. MVA is widely considered as the vaccinia virus strain of choice for clinical investigation because of its high safety profile. It also represents an excellent candidate for use as vector system in recombinant vaccine development for gene delivery or vaccination against infectious diseases or tumours, even in immunocompromised individuals. The use of MVA and recombinant MVA vectors must comply with various regulatory requirements, particularly relating to the assessment of potential risks for human health and the environment. The purpose of the present paper is to highlight some biological characteristics of MVA and MVA-based recombinant vectors and to discuss these from a biosafety point of view in the context of the European regulatory framework for genetically modified organisms with emphasis on the assessment of potential risks associated with environmental release. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Outbreak characteristics associated with identification of contributing factors to foodborne illness outbreaks.

    Science.gov (United States)

    Brown, L G; Hoover, E R; Selman, C A; Coleman, E W; Schurz Rogers, H

    2017-08-01

    Information on the factors that cause or amplify foodborne illness outbreaks (contributing factors), such as ill workers or cross-contamination of food by workers, is critical to outbreak prevention. However, only about half of foodborne illness outbreaks reported to the United States' Centers for Disease Control and Prevention (CDC) have an identified contributing factor, and data on outbreak characteristics that promote contributing factor identification are limited. To address these gaps, we analyzed data from 297 single-setting outbreaks reported to CDC's new outbreak surveillance system, which collects data from the environmental health component of outbreak investigations (often called environmental assessments), to identify outbreak characteristics associated with contributing factor identification. These analyses showed that outbreak contributing factors were more often identified when an outbreak etiologic agent had been identified, when the outbreak establishment prepared all meals on location and served more than 150 meals a day, when investigators contacted the establishment to schedule the environmental assessment within a day of the establishment being linked with an outbreak, and when multiple establishment visits were made to complete the environmental assessment. These findings suggest that contributing factor identification is influenced by multiple outbreak characteristics, and that timely and comprehensive environmental assessments are important to contributing factor identification. They also highlight the need for strong environmental health and food safety programs that have the capacity to complete such environmental assessments during outbreak investigations.

  9. Isolation and properties of reovirus from cattle in an outbreak of acute respiratory disease.

    Science.gov (United States)

    Kurogi, H; Inaba, Y; Tanaka, Y; Ito, Y; Sato, K; Omori, T

    1976-01-01

    A cytopathogenic virus was isolated in the primary culture of bovine kidney cells from a nasal swab of affected calves in an outbreak of acute respiratory disease in Japan in 1971. It agglutinated human type O erythrocytes and produced cytoplasmic inclusion bodies. Viral replication was inhibited by 5-iodo-2'-deoxyuridine, indicating that the viral nucleic acid was RNA. The virus was resistant to ether, chloroform, sodium deoxycholate, and acid, and passed readily through Sartorius' membrane filter 100 nm in pore size, but not through the filter 50 nm in pore size. Electron microscopy showed many spherical particles 60 approximately 75 nm in diameter with a double-layered capsid in a sample taken at a buoyant density of 1.34 produced by CaCl equilibrium centrifugation. The virus suspended in 1M MgCl2 solution was stable against heating at 50 degrees C for 30 minutes, but not against freezing at -20 degrees C for 60 minutes. The virus was resistant to, and increased in infectivity after, treatment with 0.063 approximately 1.0% trypsin. These properties were consistent with those established for the reoviruses. Most affected cattle showed a significant rise of antibody titer against reovirus and bovine respiratory syncytial virus, whereas only a few of them presented a serological evidence for recent infection with parainfluenza virus type 3, bovine adenovirus type 7, and bovine parovirus.

  10. Swine flu - A pandemic outbreak

    Directory of Open Access Journals (Sweden)

    Jini George

    Full Text Available Hippocrates had described influenza like outbreak in 412 B.C. and since then repeated influenza like epidemics and pandemics have been recorded in recent times. One of the greatest killers of all time was the pandemic of swine flu (Spanish flu of 1918-1919, when 230 million people died. Annual influenza epidemics are estimated to affect 5–15% of the global population, resulting in severe illness in 3–5 million patients causing 250,000–500,000 deaths worldwide. Severe illness and deaths occur mainly in the high-risk populations of infants, the elderly and chronically ill patients. The 2009 outbreak of swine flu is thought to be a mutation more specifically a reassortment of four known strains of influenza A virus subtype H1N1; one endemic in humans, one endemic in birds, and two endemic in pigs. WHO officially declared the outbreak to be a pandemic on June 11, 2009, but stressed that the new designation was a result of the global "spread of the virus," not its severity. [Vet World 2009; 2(12.000: 472-474

  11. Detection and Quantification of Norovirus in Raspberries Implicated in Disease Outbreaks

    DEFF Research Database (Denmark)

    Schultz, Anna Charlotte; Vinje, Jan; Böttiger, Blenda

    2012-01-01

    In recent years, raspberries have emerged as high risk foods for norovirus (NoV) outbreaks. However, the lack of robust and standardized methods has limited our understanding of the level of NoV contamination of raspberries correlated to public health risk. We present an optimized and quality...... controlled protocol for the viral RNA extraction using NucliSens and Plant RNA Isolation Aid and detection by RT-qPCR including bovine serum albumin of NoV in 25 g of raspberries. The protocol was applied on raspberries that had been linked epidemiologically to nine NoV outbreaks which had occurred...... in Denmark from 2009-2011. To minimize false negative results, mengovirus and murine norovirus were evaluated as sample process control viruses (SPCVs). Using the median RT-qPCR recovery for either SPCV±2 SD as quality criteria for successful extraction, 98% of samples were approved. The 50% limit...

  12. Retrograde Transport from Early Endosomes to the trans-Golgi Network Enables Membrane Wrapping and Egress of Vaccinia Virus Virions.

    Science.gov (United States)

    Sivan, Gilad; Weisberg, Andrea S; Americo, Jeffrey L; Moss, Bernard

    2016-10-01

    The anterograde pathway, from the endoplasmic reticulum through the trans-Golgi network to the cell surface, is utilized by trans-membrane and secretory proteins. The retrograde pathway, which directs traffic in the opposite direction, is used following endocytosis of exogenous molecules and recycling of membrane proteins. Microbes exploit both routes: viruses typically use the anterograde pathway for envelope formation prior to exiting the cell, whereas ricin and Shiga-like toxins and some nonenveloped viruses use the retrograde pathway for cell entry. Mining a human genome-wide RNA interference (RNAi) screen revealed a need for multiple retrograde pathway components for cell-to-cell spread of vaccinia virus. We confirmed and extended these results while discovering that retrograde trafficking was required for virus egress rather than entry. Retro-2, a specific retrograde trafficking inhibitor of protein toxins, potently prevented spread of vaccinia virus as well as monkeypox virus, a human pathogen. Electron and confocal microscopy studies revealed that Retro-2 prevented wrapping of virions with an additional double-membrane envelope that enables microtubular transport, exocytosis, and actin polymerization. The viral B5 and F13 protein components of this membrane, which are required for wrapping, normally colocalize in the trans-Golgi network. However, only B5 traffics through the secretory pathway, suggesting that F13 uses another route to the trans-Golgi network. The retrograde route was demonstrated by finding that F13 was largely confined to early endosomes and failed to colocalize with B5 in the presence of Retro-2. Thus, vaccinia virus makes novel use of the retrograde transport system for formation of the viral wrapping membrane. Efficient cell-to-cell spread of vaccinia virus and other orthopoxviruses depends on the wrapping of infectious particles with a double membrane that enables microtubular transport, exocytosis, and actin polymerization

  13. Dengue disease outbreak definitions are implicitly variable

    Directory of Open Access Journals (Sweden)

    Oliver J. Brady

    2015-06-01

    Full Text Available Infectious diseases rarely exhibit simple dynamics. Outbreaks (defined as excess cases beyond response capabilities have the potential to cause a disproportionately high burden due to overwhelming health care systems. The recommendations of international policy guidelines and research agendas are based on a perceived standardised definition of an outbreak characterised by a prolonged, high-caseload, extra-seasonal surge. In this analysis we apply multiple candidate outbreak definitions to reported dengue case data from Brazil to test this assumption. The methods identify highly heterogeneous outbreak characteristics in terms of frequency, duration and case burden. All definitions identify outbreaks with characteristics that vary over time and space. Further, definitions differ in their timeliness of outbreak onset, and thus may be more or less suitable for early intervention. This raises concerns about the application of current outbreak guidelines for early warning/identification systems. It is clear that quantitatively defining the characteristics of an outbreak is an essential prerequisite for effective reactive response. More work is needed so that definitions of disease outbreaks can take into account the baseline capacities of treatment, surveillance and control. This is essential if outbreak guidelines are to be effective and generalisable across a range of epidemiologically different settings.

  14. Bovine respiratory disease model based on dual infections with infection with bovine viral diarrhea virus and bovine corona virus

    Science.gov (United States)

    Bovine respiratory disease complex (BRDC) is the leading cause of economic loss in the U.S. cattle industry. BRDC likely results from simultaneous or sequential infections with multiple pathogens including both viruses and bacteria. Bovine viral diarrhea virus (BVDV) and bovine corona virus (BoCV...

  15. Epitope mapping by random peptide phage display reveals essential residues for vaccinia extracellular enveloped virion spread

    Directory of Open Access Journals (Sweden)

    He Yong

    2012-09-01

    Full Text Available Abstract Background A33 is a type II integral membrane protein expressed on the extracellular enveloped form of vaccinia virus (VACV. Passive transfer of A33-directed monoclonal antibodies or vaccination with an A33 subunit vaccine confers protection against lethal poxvirus challenge in animal models. Homologs of A33 are highly conserved among members of the Orthopoxvirus genus and are potential candidates for inclusion in vaccines or assays targeting extracellular enveloped virus activity. One monoclonal antibody directed against VACV A33, MAb-1G10, has been shown to target a conformation-dependent epitope. Interestingly, while it recognizes VACV A33 as well as the corresponding variola homolog, it does not bind to the monkeypox homolog. In this study, we utilized a random phage display library to investigate the epitope recognized by MAb-1G10 that is critical for facilitating cell-to-cell spread of the vaccinia virus. Results By screening with linear or conformational random phage libraries, we found that phages binding to MAb-1G10 display the consensus motif CEPLC, with a disulfide bond formed between two cysteine residues required for MAb-1G10 binding. Although the phage motif contained no linear sequences homologous to VACV A33, structure modeling and analysis suggested that residue D115 is important to form the minimal epitope core. A panel of point mutants expressing the ectodomain of A33 protein was generated and analyzed by either binding assays such as ELISA and immunoprecipitation or a functional assessment by blocking MAb-1G10 mediated comet inhibition in cell culture. Conclusions These results confirm L118 as a component of the MAb-1G10 binding epitope, and further identify D115 as an essential residue. By defining the minimum conformational structure, as well as the conformational arrangement of a short peptide sequence recognized by MAb-1G10, these results introduce the possibility of designing small molecule mimetics that may

  16. Adverse events post smallpox-vaccination: insights from tail scarification infection in mice with Vaccinia virus.

    Science.gov (United States)

    Mota, Bruno E F; Gallardo-Romero, Nadia; Trindade, Giliane; Keckler, M Shannon; Karem, Kevin; Carroll, Darin; Campos, Marco A; Vieira, Leda Q; da Fonseca, Flávio G; Ferreira, Paulo C P; Bonjardim, Cláudio A; Damon, Inger K; Kroon, Erna G

    2011-04-15

    Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV) comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1(-/-)) produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT) produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1(-/-) with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1(-/-), and passive transfer of WT T cells to Rag1(-/-) animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify individuals with

  17. Adverse events post smallpox-vaccination: insights from tail scarification infection in mice with Vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Bruno E F Mota

    Full Text Available Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1(-/- produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1(-/- with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1(-/-, and passive transfer of WT T cells to Rag1(-/- animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify

  18. Adverse Events Post Smallpox-Vaccination: Insights from Tail Scarification Infection in Mice with Vaccinia virus

    Science.gov (United States)

    Mota, Bruno E. F.; Gallardo-Romero, Nadia; Trindade, Giliane; Keckler, M. Shannon; Karem, Kevin; Carroll, Darin; Campos, Marco A.; Vieira, Leda Q.; da Fonseca, Flávio G.; Ferreira, Paulo C. P.; Bonjardim, Cláudio A.; Damon, Inger K.; Kroon, Erna G.

    2011-01-01

    Adverse events upon smallpox vaccination with fully-replicative strains of Vaccinia virus (VACV) comprise an array of clinical manifestations that occur primarily in immunocompromised patients leading to significant host morbidity/mortality. The expansion of immune-suppressed populations and the possible release of Variola virus as a bioterrorist act have given rise to concerns over vaccination complications should more widespread vaccination be reinitiated. Our goal was to evaluate the components of the host immune system that are sufficient to prevent morbidity/mortality in a murine model of tail scarification, which mimics immunological and clinical features of smallpox vaccination in humans. Infection of C57BL/6 wild-type mice led to a strictly localized infection, with complete viral clearance by day 28 p.i. On the other hand, infection of T and B-cell deficient mice (Rag1−/−) produced a severe disease, with uncontrolled viral replication at the inoculation site and dissemination to internal organs. Infection of B-cell deficient animals (µMT) produced no mortality. However, viral clearance in µMT animals was delayed compared to WT animals, with detectable viral titers in tail and internal organs late in infection. Treatment of Rag1−/− with rabbit hyperimmune anti-vaccinia serum had a subtle effect on the morbidity/mortality of this strain, but it was effective in reduce viral titers in ovaries. Finally, NUDE athymic mice showed a similar outcome of infection as Rag1−/−, and passive transfer of WT T cells to Rag1−/− animals proved fully effective in preventing morbidity/mortality. These results strongly suggest that both T and B cells are important in the immune response to primary VACV infection in mice, and that T-cells are required to control the infection at the inoculation site and providing help for B-cells to produce antibodies, which help to prevent viral dissemination. These insights might prove helpful to better identify individuals

  19. Innate immune response of human plasmacytoid dendritic cells to poxvirus infection is subverted by vaccinia E3 via its Z-DNA/RNA binding domain.

    Directory of Open Access Journals (Sweden)

    Hua Cao

    Full Text Available Plasmacytoid dendritic cells (pDCs play important roles in antiviral innate immunity by producing type I interferon (IFN. In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i vaccinia virus, but not myxoma virus, expresses inhibitor(s of the poxvirus sensing pathway(s in pDCs; and (ii Heat-VAC infection fails to produce inhibitor(s but rather produces novel activator(s, likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029 lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating

  20. Innate Immune Response of Human Plasmacytoid Dendritic Cells to Poxvirus Infection Is Subverted by Vaccinia E3 via Its Z-DNA/RNA Binding Domain

    Science.gov (United States)

    Dai, Peihong; Wang, Weiyi; Li, Hao; Yuan, Jianda; Wang, Fangjin; Fang, Chee-Mun; Pitha, Paula M; Liu, Jia; Condit, Richard C; McFadden, Grant; Merghoub, Taha; Houghton, Alan N; Young, James W; Shuman, Stewart; Deng, Liang

    2012-01-01

    Plasmacytoid dendritic cells (pDCs) play important roles in antiviral innate immunity by producing type I interferon (IFN). In this study, we assess the immune responses of primary human pDCs to two poxviruses, vaccinia and myxoma virus. Vaccinia, an orthopoxvirus, was used for immunization against smallpox, a contagious human disease with high mortality. Myxoma virus, a Leporipoxvirus, causes lethal disease in rabbits, but is non-pathogenic in humans. We report that myxoma virus infection of human pDCs induces IFN-α and TNF production, whereas vaccinia infection does not. Co-infection of pDCs with myxoma virus plus vaccinia blocks myxoma induction effects. We find that heat-inactivated vaccinia (Heat-VAC; by incubating the virus at 55°C for 1 h) gains the ability to induce IFN-α and TNF in primary human pDCs. Induction of IFN-α in pDCs by myxoma virus or Heat-VAC is blocked by chloroquine, which inhibits endosomal acidification required for TLR7/9 signaling, and by inhibitors of cellular kinases PI3K and Akt. Using purified pDCs from genetic knockout mice, we demonstrate that Heat-VAC-induced type I IFN production in pDCs requires the endosomal RNA sensor TLR7 and its adaptor MyD88, transcription factor IRF7 and the type I IFN feedback loop mediated by IFNAR1. These results indicate that (i) vaccinia virus, but not myxoma virus, expresses inhibitor(s) of the poxvirus sensing pathway(s) in pDCs; and (ii) Heat-VAC infection fails to produce inhibitor(s) but rather produces novel activator(s), likely viral RNA transcripts that are sensed by the TLR7/MyD88 pathway. Using vaccinia gene deletion mutants, we show that the Z-DNA/RNA binding domain at the N-terminus of the vaccinia immunomodulatory E3 protein is an antagonist of the innate immune response of human pDCs to poxvirus infection and TLR agonists. The myxoma virus ortholog of vaccinia E3 (M029) lacks the N-terminal Z-DNA/RNA binding domain, which might contribute to the immunostimulating properties of

  1. Molecular survey of infectious agents associated with bovine respiratory disease in a beef cattle feedlot in southern Brazil.

    Science.gov (United States)

    Headley, Selwyn A; Okano, Werner; Balbo, Luciana C; Marcasso, Rogério A; Oliveira, Thalita E; Alfieri, Alice F; Negri Filho, Luiz C; Michelazzo, Mariana Z; Rodrigues, Silvio C; Baptista, Anderson L; Saut, João Paulo E; Alfieri, Amauri A

    2018-03-01

    We investigated the occurrence of infectious pathogens during an outbreak of bovine respiratory disease (BRD) in a beef cattle feedlot in southern Brazil that has a high risk of developing BRD. Nasopharyngeal swabs were randomly collected from steers ( n = 23) and assessed for the presence of infectious agents of BRD by PCR and/or RT-PCR assays. These included: Histophilus somni, Mannheimia haemolytica, Pasteurella multocida, Mycoplasma bovis, bovine respiratory syncytial virus (BRSV), bovine coronavirus (BCoV), bovine viral diarrhea virus (BVDV), bovine alphaherpesvirus 1 (BoHV-1), and bovine parainfluenza virus 3 (BPIV-3). Pulmonary sections of one steer that died with clinical BRD were submitted for pathology and molecular testing. The frequencies of the pathogens identified from the nasopharyngeal swabs were: H. somni 39% (9 of 23), BRSV 35% (8 of 23), BCoV 22% (5 of 23), and M. haemolytica 13% (3 of 23). PCR or RT-PCR assays did not identify P. multocida, M. bovis, BoHV-1, BVDV, or BPIV-3 from the nasopharyngeal swabs. Single and concomitant associations of infectious agents of BRD were identified. Fibrinous bronchopneumonia was diagnosed in one steer that died; samples were positive for H. somni and M. haemolytica by PCR. H. somni, BRSV, and BCoV are important disease pathogens of BRD in feedlot cattle in Brazil, but H. somni and BCoV are probably under-reported.

  2. Vaccinia virus, herpes simplex virus, and carcinogens induce DNA amplification in a human cell line and support replication of a helpervirus dependent parvovirus

    Energy Technology Data Exchange (ETDEWEB)

    Schlehofer, J.R.; Ehrbar, M.; zur Hausen, H.

    1986-07-15

    The SV40-transformed human kidney cell line, NB-E, amplifies integrated as well as episomal SV40 DNA upon treatment with chemical (DMBA) or physical (uv irradiation) carcinogens (initiators) as well as after infection with herpes simplex virus (HSV) type 1 or with vaccinia virus. In addition it is shown that vaccinia virus induces SV40 DNA amplification also in the SV40-transformed Chinese hamster embryo cell line, CO631. These findings demonstrate that human cells similar to Chinese hamster cells amplify integrated DNA sequences after treatment with carcinogens or infection with specific viruses. Furthermore, a poxvirus--vaccinia virus--similar to herpes group viruses induces DNA amplification. As reported for other systems, the vaccinia virus-induced DNA amplification in NB-E cells is inhibited by coinfection with adeno-associated virus (AAV) type 5. This is in line with previous studies on inhibition of carcinogen- or HSV-induced DNA amplification in CO631 cells. The experiments also demonstrate that vaccinia virus, in addition to herpes and adenoviruses acts as a helper virus for replication and structural antigen synthesis of AAV-5 in NB-E cells.

  3. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  4. Vaccinia-Related Kinase 2 Modulates the Stress Response to Hypoxia Mediated by TAK1▿

    Science.gov (United States)

    Blanco, Sandra; Santos, Claudio; Lazo, Pedro A.

    2007-01-01

    Hypoxia represents a major stress that requires an immediate cellular response in which different signaling pathways participate. Hypoxia induces an increase in the activity of TAK1, an atypical mitogen-activated protein kinase kinase kinase (MAPKKK), which responds to oxidative stress by triggering cascades leading to the activation of c-Jun N-terminal kinase (JNK). JNK activation by hypoxia requires assembly with the JIP1 scaffold protein, which might also interact with other intracellular proteins that are less well known but that might modulate MAPK signaling. We report that TAK1 is able to form a stable complex with JIP1 and thus regulate the activation of JNK, which in turn determines the cellular stress response to hypoxia. This activation of TAK1-JIP1-JNK is suppressed by vaccinia-related kinase 2 (VRK2). VRK2A is able to interact with TAK1 by its C-terminal region, forming stable complexes. The kinase activity of VRK2 is not necessary for this interaction or the downregulation of AP1-dependent transcription. Furthermore, reduction of the endogenous VRK2 level with short hairpin RNA can increase the response induced by hypoxia, suggesting that the intracellular levels of VRK2 can determine the magnitude of this stress response. PMID:17709393

  5. Comparison of the locations of homologous fowlpox and vaccinia virus genes reveals major genome reorganization.

    Science.gov (United States)

    Mockett, B; Binns, M M; Boursnell, M E; Skinner, M A

    1992-10-01

    We have derived a restriction enzyme map for the fowlpox virus FP9 strain. Sites for BamHI, PvuII, PstI and NcoI have been mapped mainly by Southern blotting. The size of the genome derived from the restriction maps (254 kb) corresponds to the figure of 260 +/- 8 kb determined from analysis of genomic DNA by pulsed-field electrophoresis. The map can be compared with a previously published map for a different strain of fowlpox virus using the PstI digest which is common to both studies. Some 65 kb of fowlpox virus sequence, in 11 blocks, as well as individual M13 clones have been aligned with the map. Where those blocks correspond with blocks of homologous genes in vaccinia virus, it is possible to compare the genomic locations for those genes in the two viruses. This comparison reveals that, whereas there are blocks of sequence within which genes exist in the same relative position in the two viruses, the genomic location of those sequence blocks differs widely between the two viruses.

  6. Study of Vaccinia and Cowpox viruses' replication in Rac1-N17 dominant-negative cells

    Science.gov (United States)

    Salgado, Ana Paula Carneiro; Soares-Martins, Jamária Adriana Pinheiro; Andrade, Luciana Garcia; Albarnaz, Jonas Dutra; Ferreira, Paulo César Peregrino; Kroon, Erna Geessien; Bonjardim, Cláudio Antônio

    2013-01-01

    Interfering with cellular signal transduction pathways is a common strategy used by many viruses to create a propitious intracellular environment for an efficient replication. Our group has been studying cellular signalling pathways activated by the orthopoxviruses Vaccinia (VACV) and Cowpox (CPXV) and their significance to viral replication. In the present study our aim was to investigate whether the GTPase Rac1 was an upstream signal that led to the activation of MEK/ERK1/2, JNK1/2 or Akt pathways upon VACV or CPXV' infections. Therefore, we generated stable murine fibroblasts exhibiting negative dominance to Rac1-N17 to evaluate viral growth and the phosphorylation status of ERK1/2, JNK1/2 and Akt. Our results demonstrated that VACV replication, but not CPXV, was affected in dominant-negative (DN) Rac1-N17 cell lines in which viral yield was reduced in about 10-fold. Viral late gene expression, but not early, was also reduced. Furthermore, our data showed that Akt phosphorylation was diminished upon VACV infection in DN Rac1-N17 cells, suggesting that Rac1 participates in the phosphoinositide-3 kinase pathway leading to the activation of Akt. In conclusion, our results indicate that while Rac1 indeed plays a role in VACV biology, perhaps another GTPase may be involved in CPXV replication. PMID:23903969

  7. Study of Vaccinia and Cowpox viruses' replication in Rac1-N17 dominant-negative cells

    Directory of Open Access Journals (Sweden)

    Ana Paula Carneiro Salgado

    2013-08-01

    Full Text Available Interfering with cellular signal transduction pathways is a common strategy used by many viruses to create a propitious intracellular environment for an efficient replication. Our group has been studying cellular signalling pathways activated by the orthopoxviruses Vaccinia (VACV and Cowpox (CPXV and their significance to viral replication. In the present study our aim was to investigate whether the GTPase Rac1 was an upstream signal that led to the activation of MEK/ERK1/2, JNK1/2 or Akt pathways upon VACV or CPXV' infections. Therefore, we generated stable murine fibroblasts exhibiting negative dominance to Rac1-N17 to evaluate viral growth and the phosphorylation status of ERK1/2, JNK1/2 and Akt. Our results demonstrated that VACV replication, but not CPXV, was affected in dominant-negative (DN Rac1-N17 cell lines in which viral yield was reduced in about 10-fold. Viral late gene expression, but not early, was also reduced. Furthermore, our data showed that Akt phosphorylation was diminished upon VACV infection in DN Rac1-N17 cells, suggesting that Rac1 participates in the phosphoinositide-3 kinase pathway leading to the activation of Akt. In conclusion, our results indicate that while Rac1 indeed plays a role in VACV biology, perhaps another GTPase may be involved in CPXV replication.

  8. Potential effect of prior raccoonpox virus infection in raccoons on vaccinia-based rabies immunization

    Directory of Open Access Journals (Sweden)

    MacCarthy Kathleen A

    2008-10-01

    Full Text Available Abstract Background The USDA, Wildlife Services cooperative oral rabies vaccination (ORV program uses a live vaccinia virus-vectored (genus Orthopoxvirus vaccine, Raboral V-RG® (V-RG, to vaccinate specific wildlife species against rabies virus in several regions of the U.S. Several naturally occurring orthopoxviruses have been found in North America, including one isolated from asymptomatic raccoons (Procyon lotor. The effect of naturally occurring antibodies to orthopoxviruses on successful V-RG vaccination in raccoons is the focus of this study. Results Overall, raccoons pre-immunized (n = 10 with a recombinant raccoonpox virus vaccine (RCN-F1 responded to vaccination with V-RG with lower rabies virus neutralizing antibody (VNA titers than those which were not pre-immunized (n = 10 and some failed to seroconvert for rabies VNA to detectable levels. Conclusion These results suggest that the success of some ORV campaigns may be hindered where raccoonpox virus or possibly other orthopoxvirus antibodies are common in wildlife species targeted for ORV. If these areas are identified, different vaccination strategies may be warranted.

  9. Increased ATP generation in the host cell is required for efficient vaccinia virus production

    Directory of Open Access Journals (Sweden)

    Hsu Che-Fang

    2009-09-01

    Full Text Available Abstract To search for cellular genes up-regulated by vaccinia virus (VV infection, differential display-reverse transcription-polymerase chain reaction (ddRT-PCR assays were used to examine the expression of mRNAs from mock-infected and VV-infected HeLa cells. Two mitochondrial genes for proteins that are part of the electron transport chain that generates ATP, ND4 and CO II, were up-regulated after VV infection. Up-regulation of ND4 level by VV infection was confirmed by Western blotting analysis. Up-regulation of ND4 was reduced by the MAPK inhibitor, apigenin, which has been demonstrated elsewhere to inhibit VV replication. The induction of ND4 expression occurred after viral DNA replication since ara C, an inhibitor of poxviral DNA replication, could block this induction. ATP production was increased in the host cells after VV infection. Moreover, 4.5 μM oligomycin, an inhibitor of ATP production, reduced the ATP level 13 hr after virus infection to that of mock-infected cells and inhibited viral protein expression and virus production, suggesting that increased ATP production is required for efficient VV production. Our results further suggest that induction of ND4 expression is through a Bcl-2 independent pathway.

  10. Genomic identification of human vaccinia virus keratoconjunctivitis and its importance as a laboratory-acquired infection

    Directory of Open Access Journals (Sweden)

    Zahra Movahedi Motlagh

    2016-01-01

    Full Text Available Context: Vaccinia virus (VACV is a member of orthopoxvirus genus of the family Poxviridae. VACVs are enveloped, double-stranded DNA viruses. Several species of this family, for example, molluscum contagiosum, smallpox, deerpox, horsepox, rabbitpox, and VACVs may cause conjunctivitis. Aims: Given the high incidence of keratoconjunctivitis in Iran (approximately 3.6%-53.9% and insufficient clinical diagnostic measures, laboratory tests for detection of its causes and determination of accurate keratoconjunctivitis/conjunctivitis prevalence due to different pathogens are essential. Settings and Design: In this research, conjunctival samples collected from 100 patients with keratoconjunctivitis signs were referred to an eye hospital of Iran. Subjects and Methods: After DNA extraction, polymerase chain reaction (PCR was carried out for detection of VACV. PCR-positive products were further subjected to DNA sequencing. Statistical Analysis Used: The results were analyzed using Chi-square test. Results: In this study, 28% of the samples were positive and a statistically significant relationship obtained between working in medical or research laboratories and VACV prevalence (P < 0.05. Conclusions: This study showed a high rate of VACV keratoconjunctivitis, and therefore, further studies for its prevention and control are necessary.

  11. Hazard Characterization of Modified Vaccinia Virus Ankara Vector: What Are the Knowledge Gaps?

    Directory of Open Access Journals (Sweden)

    Malachy I. Okeke

    2017-10-01

    Full Text Available Modified vaccinia virus Ankara (MVA is the vector of choice for human and veterinary applications due to its strong safety profile and immunogenicity in vivo. The use of MVA and MVA-vectored vaccines against human and animal diseases must comply with regulatory requirements as they pertain to environmental risk assessment, particularly the characterization of potential adverse effects to humans, animals and the environment. MVA and recombinant MVA are widely believed to pose low or negligible risk to ecosystem health. However, key aspects of MVA biology require further research in order to provide data needed to evaluate the potential risks that may occur due to the use of MVA and MVA-vectored vaccines. The purpose of this paper is to identify knowledge gaps in the biology of MVA and recombinant MVA that are of relevance to its hazard characterization and discuss ongoing and future experiments aimed at providing data necessary to fill in the knowledge gaps. In addition, we presented arguments for the inclusion of uncertainty analysis and experimental investigation of verifiable worst-case scenarios in the environmental risk assessment of MVA and recombinant MVA. These will contribute to improved risk assessment of MVA and recombinant MVA vaccines.

  12. Stunned silence: gene expression programs in human cells infected with monkeypox or vaccinia virus.

    Directory of Open Access Journals (Sweden)

    Kathleen H Rubins

    Full Text Available Poxviruses use an arsenal of molecular weapons to evade detection and disarm host immune responses. We used DNA microarrays to investigate the gene expression responses to infection by monkeypox virus (MPV, an emerging human pathogen, and Vaccinia virus (VAC, a widely used model and vaccine organism, in primary human macrophages, primary human fibroblasts and HeLa cells. Even as the overwhelmingly infected cells approached their demise, with extensive cytopathic changes, their gene expression programs appeared almost oblivious to poxvirus infection. Although killed (gamma-irradiated MPV potently induced a transcriptional program characteristic of the interferon response, no such response was observed during infection with either live MPV or VAC. Moreover, while the gene expression response of infected cells to stimulation with ionomycin plus phorbol 12-myristate 13-acetate (PMA, or poly (I-C was largely unimpaired by infection with MPV, a cluster of pro-inflammatory genes were a notable exception. Poly(I-C induction of genes involved in alerting the innate immune system to the infectious threat, including TNF-alpha, IL-1 alpha and beta, CCL5 and IL-6, were suppressed by infection with live MPV. Thus, MPV selectively inhibits expression of genes with critical roles in cell-signaling pathways that activate innate immune responses, as part of its strategy for stealthy infection.

  13. Safety mechanism assisted by the repressor of tetracycline (SMART) vaccinia virus vectors for vaccines and therapeutics.

    Science.gov (United States)

    Grigg, Patricia; Titong, Allison; Jones, Leslie A; Yilma, Tilahun D; Verardi, Paulo H

    2013-09-17

    Replication-competent viruses, such as Vaccinia virus (VACV), are powerful tools for the development of oncolytic viral therapies and elicit superior immune responses when used as vaccine and immunotherapeutic vectors. However, severe complications from uncontrolled viral replication can occur, particularly in immunocompromised individuals or in those with other predisposing conditions. VACVs constitutively expressing interferon-γ (IFN-γ) replicate in cell culture indistinguishably from control viruses; however, they replicate in vivo to low or undetectable levels, and are rapidly cleared even in immunodeficient animals. In an effort to develop safe and highly effective replication-competent VACV vectors, we established a system to inducibly express IFN-γ. Our SMART (safety mechanism assisted by the repressor of tetracycline) vectors are designed to express the tetracycline repressor under a constitutive VACV promoter and IFN-γ under engineered tetracycline-inducible promoters. Immunodeficient SCID mice inoculated with VACVs not expressing IFN-γ demonstrated severe weight loss, whereas those given VACVs expressing IFN-γ under constitutive VACV promoters showed no signs of infection. Most importantly, mice inoculated with a VACV expressing the IFN-γ gene under an inducible promoter remained healthy in the presence of doxycycline, but exhibited severe weight loss in the absence of doxycycline. In this study, we developed a safety mechanism for VACV based on the conditional expression of IFN-γ under a tightly controlled tetracycline-inducible VACV promoter for use in vaccines and oncolytic cancer therapies.

  14. Silver nanoparticles inhibit vaccinia virus infection by preventing viral entry through a macropinocytosis-dependent mechanism.

    Science.gov (United States)

    Trefry, John C; Wooley, Dawn P

    2013-09-01

    Silver nanoparticles have been shown to inhibit viruses. However, very little is known about the mechanism of antiviral activity. This study tested the hypothesis that 25-nm silver nanoparticles inhibited Vaccinia virus replication by preventing viral entry. Plaque reduction, confocal microscopy, and beta-galactosidase reporter gene assays were used to examine viral attachment and entry in the presence and absence of silver nanoparticles. To explore the mechanism of inhibition, viral entry experiments were conducted with silver nanoparticles and small interfering RNAs designed to silence the gene coding for p21-activated kinase 1, a key mediator of macropinocytosis. The silver nanoparticles caused a 4- to 5-log reduction in viral titer at concentrations that were not toxic to cells. Virus was capable of adsorbing to cells but could not enter cells in the presence of silver nanoparticles. Virus particles that had adsorbed to cells in the presence of silver nanoparticles were found to be infectious upon removal from the cells, indicating lack of direct virucidal effect. The half maximal inhibitory concentration for viral entry in the presence of silver nanoparticles was 27.4+/-3.3 microg/ml. When macropinocytosis was blocked, this inhibition was significantly reduced. Thus, macropinocytosis was required for the full antiviral effect. For the first time, this study points to the novel result that a cellular process involved in viral entry is responsible for the antiviral effects of silver nanoparticles.

  15. Oncolytic vaccinia virus as an adjuvant treatment to cytoreductive surgery for malignant peritoneal mesothelioma.

    Science.gov (United States)

    Acuna, Sergio A; Ottolino-Perry, Kathryn; Çako, Besmira; Tang, Nan; Angarita, Fernando A; McCart, J Andrea

    2014-07-01

    Malignant peritoneal mesothelioma (MPM) is an aggressive cancer with a dismal prognosis. Oncolytic viruses are a promising new therapy for cancer because of their ability to kill tumor cells with minimal toxicity to normal tissues. This experimental study aimed to examine the potential of modified vaccinia virus (VV) to treat MPM when administered alone or as an adjuvant treatment to surgery. Two aggressive murine mesothelioma cell lines (AC29, AB12), were used. Cell viability and viral cytopathic effects were assessed using MTS and crystal violet assays. Immunocompetent mice were injected intraperitoneally with MPM cells and treated with intraperitoneal VV. Tumor-bearing mice also underwent cytoreductive surgery (CRS) followed by VV (or control) therapy. The cytotoxic effects of VV on MPM cell lines was significantly increased compared with the control non-cancer cell line. In both orthotopic models, VV induced tumor regression, prolonging median and long-term survival. VV treatment after incomplete CRS was not superior to VV alone; however, when mice with microscopic disease were treated with VV, further prolongation of median and long-term survivals was observed. VV selectively kills MPM cells in vitro and leads to improved survival and cures in immunocompetent murine models. Higher efficacy of the virus in the microscopic disease context suggests the use of the virus as an adjuvant treatment to complete surgical resection. These promising results justify further studies of VV in humans as a novel treatment for MPM.

  16. Brazilian vaccinia virus strains show a classical orthopoxvirus in-fection course and cross-protection

    Institute of Scientific and Technical Information of China (English)

    Betania Paiva Drumond; Jonatas Santos Abraho; Zlia Ins Portela Lobato; Cludio Antonio Bonjardim; Paulo Csar Peregrino Ferreira; Erna Geessien Kroon

    2009-01-01

    Objectives:The purpose of this work was to study the infection course and cross-protection in mice after intra-dermal injection of Vaccinia virus (VACV ) strain Western Reserve and three Brazilian VACV strains:Araatuba,Muriaéand BeAn58058 isolated from cow,human and rodent,respectively.Methods:Balb /c mice were inoculated by footpad and back scarification and daily monitored regarding lesion development and weight loss.To check cross protection after intradermal VACV inoculation,mice were subsequently infected with different VACV strains and monitored to check lesion development.Serum neutralization assays were per-formed to check for the presence of antibodies against Orthopoxvirus.Results:After VACV intradermal inocu-lation the lesion development pattern was similar in mice infected with the different virus strains.By using the footpad scarification model,cross-protection among VACV strains was observed.Moreover,neutralizing anti-bodies against Orthopoxvirus were detected in sera from mice infected with all VACV strains.Conclusion:Al-though it was not possible to observe virulence differences among VACV strains isolated from cow,rodent and human using the murine model,this inoculation route showed to be an appropriated model to study lesions de-velopment since it mimics natural infections by VACV in nature.

  17. Myxoma and vaccinia viruses exploit different mechanisms to enter and infect human cancer cells.

    Science.gov (United States)

    Villa, Nancy Y; Bartee, Eric; Mohamed, Mohamed R; Rahman, Masmudur M; Barrett, John W; McFadden, Grant

    2010-06-05

    Myxoma (MYXV) and vaccinia (VACV) viruses have recently emerged as potential oncolytic agents that can infect and kill different human cancer cells. Although both are structurally similar, it is unknown whether the pathway(s) used by these poxviruses to enter and cause oncolysis in cancer cells are mechanistically similar. Here, we compared the entry of MYXV and VACV-WR into various human cancer cells and observed significant differences: 1--low-pH treatment accelerates fusion-mediated entry of VACV but not MYXV, 2--the tyrosine kinase inhibitor genistein inhibits entry of VACV, but not MYXV, 3--knockdown of PAK1 revealed that it is required for a late stage event downstream of MYXV entry into cancer cells, whereas PAK1 is required for VACV entry into the same target cells. These results suggest that VACV and MYXV exploit different mechanisms to enter into human cancer cells, thus providing some rationale for their divergent cancer cell tropisms. 2010 Elsevier Inc. All rights reserved.

  18. Oncolytic gene therapy with recombinant vaccinia strain GLV-2b372 efficiently kills hepatocellular carcinoma.

    Science.gov (United States)

    Ady, Justin W; Johnsen, Clark; Mojica, Kelly; Heffner, Jacqueline; Love, Damon; Pugalenthi, Amudhan; Belin, Laurence J; Chen, Nanhai G; Yu, Yong A; Szalay, Aladar A; Fong, Yuman

    2015-08-01

    Hepatocellular carcinoma (HCC) commonly presents at a late stage when surgery is no longer a curative option. As such, novel therapies for advanced HCC are needed. Oncolytic viruses are a viable option for cancer therapy owing to their ability to specifically infect, replicate within, and kill cancer cells. In this study, we have investigated the ability of GLV-2b372, a novel light-emitting recombinant vaccinia virus derived from a wild-type Lister strain, to kill HCC. Four human HCC cell lines were assayed in vitro for infectivity and cytotoxicity. Viral replication was quantified via standard viral plaque assays. Flank HCC xenografts generated in athymic nude mice were treated with intratumoral GLV-2b372 to assess for tumor growth inhibition and viral biodistribution. Infectivity occurred in a time- and concentration-dependent manner with 70% cell death in all cell lines by day 5. All cell lines supported efficient viral replication. At 25 days after infection, flank tumor volumes decreased by 50% whereas controls increased by 400%. Tumor tissue demonstrated substantial GLV-2b372 infection at 24 hours, 48 hours, and 2 weeks. We demonstrate that GLV-2b372 efficiently kills human HCC in vitro and in vivo and is a viable treatment option for patients with HCC. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. RAB1A promotes Vaccinia virus replication by facilitating the production of intracellular enveloped virions

    Energy Technology Data Exchange (ETDEWEB)

    Pechenick Jowers, Tali; Featherstone, Rebecca J.; Reynolds, Danielle K.; Brown, Helen K. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); James, John; Prescott, Alan [Division of Cell Signalling and Immunology, College of Life Sciences, University of Dundee, Dundee DD1 5EH, Scotland (United Kingdom); Haga, Ismar R. [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom); Beard, Philippa M., E-mail: pip.beard@roslin.ed.ac.uk [The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, Scotland (United Kingdom)

    2015-01-15

    Vaccinia virus (VACV) is a large double-stranded DNA virus with a complex cytoplasmic replication cycle that exploits numerous cellular proteins. This work characterises the role of a proviral cellular protein, the small GTPase RAB1A, in VACV replication. Using siRNA, we identified RAB1A as required for the production of extracellular enveloped virions (EEVs), but not intracellular mature virions (IMVs). Immunofluorescence and electron microscopy further refined the role of RAB1A as facilitating the wrapping of IMVs to become intracellular enveloped virions (IEVs). This is consistent with the known function of RAB1A in maintenance of ER to Golgi transport. VACV can therefore be added to the growing list of viruses which require RAB1A for optimal replication, highlighting this protein as a broadly proviral host factor. - Highlights: • Characterisation of the role of the small GTPase RAB1A in VACV replication. • RAB1A is not required for production of the primary virion form (IMV). • RAB1A is required for production of processed virion forms (IEVs, CEVs and EEVs). • Consistent with known role of RAB1A in ER to Golgi transport.

  20. Antigen Gene Transfer to Human Plasmacytoid Dendritic Cells Using Recombinant Adenovirus and Vaccinia Virus Vectors

    Directory of Open Access Journals (Sweden)

    Hetty J. Bontkes

    2005-01-01

    Full Text Available Recombinant adenoviruses (RAd and recombinant vaccinia viruses (RVV expressing tumour-associated antigens (TAA are used as anti-tumour vaccines. It is important that these vaccines deliver the TAA to dendritic cells (DC for the induction of a strong immune response. Infection of myeloid DC (MDC with RAd alone is relatively inefficient but CD40 retargeting significantly increases transduction efficiency and DC maturation. Infection with RVV is efficient without DC maturation. Plasmacytoid dendritic cells (PDC play a role in the innate immune response to viral infections through the secretion of IFNα but may also play a role in specific T-cell induction. The aim of our study was to investigate whether PDC are better targets for RAd and RVV based vaccines. RAd alone hardly infected PDC (2% while CD40 retargeting did not improve transduction efficiency, but it did increase PDC maturation (25% CD83 positive cells. Accordingly, specific CTL activation by RAd infected PDC was limited (the number of IFNγ producing CTL was reduced by 75% compared to stimulation with peptide loaded PDC. RVV infected PDC specifically stimulated CTL but PDC were not activated. These Results indicate that PDC are not ideal targets for RAd and RVV based vaccines. However, PDC induced specific CTL activation after pulsing with recombinant protein, indicating that PDC can also cross-present antigens released from surrounding infected cells.

  1. Ebola virus disease: history, epidemiology and outbreaks.

    Science.gov (United States)

    Weyer, Jacqueline; Grobbelaar, Antoinette; Blumberg, Lucille

    2015-05-01

    Over the past 40 years, sporadic Ebola virus disease (EVD) outbreaks have occurred mostly in the central African region. In March 2014, an outbreak of EVD was recognized in Guinea which would become the most significant outbreak of haemorrhagic fever in Africa to date. The outbreak started in Guinea and rapidly spread to Liberia and Sierra Leone, claiming thousands of lives. Many questions still remain regarding the ecology of Ebola viruses, but it is believed that contact with infected bushmeat is an important risk factor for initial spill over of the virus into the human population. At present, there is still no registered prophylaxis or curative biologicals against EVD.

  2. An epidemic outbreak of cryptosporidiosis

    DEFF Research Database (Denmark)

    Mølbak, Kåre; Højlyng, Niels; Ingholt, Liselotte

    1990-01-01

    In the first year of a prospective community study of childhood diarrhea conducted in a semiurban area in the capital of Guinea Bissau, Cryptosporidium sp. was found in 73 (6.0%) of 1216 episodes of diarrhea. The parasite was the second most prevalent intestinal parasite, and the only one...... significantly associated with diarrhea (OR = 2.79, P = 0.0006). The seasonal distribution was striking, with a peak prevalence in the beginning of the rainy season (May 17.6%) when an epidemic outbreak of diarrhea started. The prevalence was highest in children younger than 18 months, an age at which...

  3. One-step multiplex real time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3

    Directory of Open Access Journals (Sweden)

    Thonur Leenadevi

    2012-03-01

    Full Text Available Abstract Background Detection of respiratory viruses in veterinary species has traditionally relied on virus detection by isolation or immunofluorescence and/or detection of circulating antibody using ELISA or serum neutralising antibody tests. Multiplex real time PCR is increasingly used to diagnose respiratory viruses in humans and has proved to be superior to traditional methods. Bovine respiratory disease (BRD is one of the most common causes of morbidity and mortality in housed cattle and virus infections can play a major role. We describe here a one step multiplex reverse transcriptase quantitative polymerase chain reaction (mRT-qPCR to detect the viruses commonly implicated in BRD. Results A mRT-qPCR assay was developed and optimised for the simultaneous detection of bovine respiratory syncytial virus (BRSV, bovine herpes virus type 1 (BoHV-1 and bovine parainfluenza virus type 3 (BPI3 i & ii nucleic acids in clinical samples from cattle. The assay targets the highly conserved glycoprotein B gene of BoHV-1, nucleocapsid gene of BRSV and nucleoprotein gene of BPI3. This mRT-qPCR assay was assessed for sensitivity, specificity and repeatability using in vitro transcribed RNA and recent field isolates. For clinical validation, 541 samples from clinically affected animals were tested and mRT-qPCR result compared to those obtained by conventional testing using virus isolation (VI and/or indirect fluorescent antibody test (IFAT. Conclusions The mRT-qPCR assay was rapid, highly repeatable, specific and had a sensitivity of 97% in detecting 102 copies of BRSV, BoHV-1 and BPI3 i & ii. This is the first mRT-qPCR developed to detect the three primary viral agents of BRD and the first multiplex designed using locked nucleic acid (LNA, minor groove binding (MGB and TaqMan probes in one reaction mix. This test was more sensitive than both VI and IFAT and can replace the aforesaid methods for virus detection during outbreaks of BRD.

  4. Outbreak

    DEFF Research Database (Denmark)

    Dahl, Kristian Aagaard; Agger Nielsen, Jeppe

    Forestillingen om at ledelse er situationsafhængig og varierer alt efter hvilket lederniveau der fokuseres på trækker spor tilbage til en række tidlige ledelsesteoretikere. I de senere år har tilgangen på ny tiltrukket sig opmærksomhed såvel i praksisfeltet som blandt forskere, nok tydeligst illu...

  5. [Construction and identification of non-replication recombinant vaccinia virus co-expressing human papillomavirus type 16 L1/L2/E6/E7 proteins].

    Science.gov (United States)

    Huang, Wei; Tian, Hou-wen; Ren, Jiao; Fan, Jiang-tao; Zhao, Li; Bian, Tao; Lu, Zhen-hua; Ruan, Li

    2005-09-01

    To generate a human papillomavirus (HPV16) prophylactic and therapeutic vaccine candidate for cervical cancer. HPV16 major capsid protein L1 gene/minor capsid protein L2 gene and HPV16 early E6/E7 genes were inserted into a vaccinia virus expression vector. A strain of non-recombinant vaccinia virus containing the sequences was obtained through a homologous recombination and identified. DNA hybridization confirmed that the HPV16L1/L2/E6/E7 genes were integrated into vaccinia virus DNA. Western Blot result showed that full-length L1/L2/E6/E7 proteins were co-expressed in CEF cells infected with the recombinant virus. NTVJE6E7CKL1L2 could be taken as a candidate of prophylactic and therapeutic vaccine for HPV-associated tumors and their precancerous transformations.

  6. Diprosopia em bovino Bovine diprosopus

    Directory of Open Access Journals (Sweden)

    I.T. Rotta

    2008-04-01

    Full Text Available This work describes a malformation in one newborn female bovine, with two faces and two skull fused, showing one single head. Duplications of the nasal and oral structures, tetraofthalmy, two brains, one single cerebellum, and pons were observed. The right thyroid was hypertrophic and the other organs had normal morphology. Every change observed in this case was compatibles with diprosopus.

  7. Bovine spongiform encephalopathy in sheep?

    NARCIS (Netherlands)

    Schreuder, B.E.C.; Somerville, R.A.

    2003-01-01

    Bovine spongiform encephalopathy (BSE) in sheep has not been identified under natural conditions at the time of writing and remains a hypothetical issue. However, rumours about the possible finding of a BSE-like isolate in sheep have led to great unrest within the sheep industry, among the general

  8. Infectious bovine rhinotracheitis in Scotland.

    Science.gov (United States)

    2017-10-14

    A cattle dashboard has recently been developed to share surveillance information gathered from submissions to the Great Britain veterinary diagnostic network. Data relating to Scotland come from the SAC C VS. This article, by Tim Geraghty, relates to cases of infectious bovine rhinotracheitis in Scotland, as summarised on the APHA Cattle Dashboard. British Veterinary Association.

  9. Identification of lactoferrin in bovine tears.

    Science.gov (United States)

    Brown, M H; Brightman, A H; Fenwick, B W; Rider, M A

    1996-09-01

    To determine whether bovine tear film contains the iron-binding glycoprotein, lactoferrin. 40 Adult Hereford, Angus, and Simmental cattle. Protein analysis: pooled bovine tears were used for protein analysis (size exclusion high-performance liquid chromatography [HPLC] fractionation). HPLC was used for tear analysis. A diode array detector was used (215 and 280 microns) for chromatogram analysis and comparisons. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE): protein electrophoresis was performed, using 7.5% running gels with 4% stacking gels. Molecular weight of proteins in the unknown samples was determined as recommended by the manufacturer of the standards. Protein sequencing: amino acid sequencing, using automated Edman degradation of HPLC purified protein, was performed. The sequence obtained was compared with the known protein sequence of bovine lactoferrin. HPLC analysis of whole bovine tears resulted in a consistent chromatogram. Peak collection was performed to recover a protein from the bovine tear film with chromatogram characteristics nearly identical to purified bovine lactoferrin. Silver-stained SDS-PAGE of this peak revealed a band with molecular mass consistent with bovine lactoferrin (estimated mass of 78 kd). The first 13 amino acid residues of this protein were identical to the amino acid sequence of bovine lactoferrin. Analysis of whole bovine tears, using size exclusion HPLC, SDS-PAGE, and amino acid sequencing, provided evidence that bovine tears contain lactoferrin. Lactoferrin probably exerts a bacteriostatic effect in bovine tear film. Locally produced lactoferrin may bathe the ocular surface and sequester iron from potential pathogens.

  10. Effect of the deletion of genes encoding proteins of the extracellular virion form of vaccinia virus on vaccine immunogenicity and protective effectiveness in the mouse model.

    Directory of Open Access Journals (Sweden)

    Clement A Meseda

    Full Text Available Antibodies to both infectious forms of vaccinia virus, the mature virion (MV and the enveloped virion (EV, as well as cell-mediated immune response appear to be important for protection against smallpox. EV virus particles, although more labile and less numerous than MV, are important for dissemination and spread of virus in infected hosts and thus important in virus pathogenesis. The importance of the EV A33 and B5 proteins for vaccine induced immunity and protection in a murine intranasal challenge model was evaluated by deletion of both the A33R and B5R genes in a vaccine-derived strain of vaccinia virus. Deletion of either A33R or B5R resulted in viruses with a small plaque phenotype and reduced virus yields, as reported previously, whereas deletion of both EV protein-encoding genes resulted in a virus that formed small infection foci that were detectable and quantifiable only by immunostaining and an even more dramatic decrease in total virus yield in cell culture. Deletion of B5R, either as a single gene knockout or in the double EV gene knockout virus, resulted in a loss of EV neutralizing activity, but all EV gene knockout viruses still induced a robust neutralizing activity against the vaccinia MV form of the virus. The effect of elimination of A33 and/or B5 on the protection afforded by vaccination was evaluated by intranasal challenge with a lethal dose of either vaccinia virus WR or IHD-J, a strain of vaccinia virus that produces relatively higher amounts of EV virus. The results from multiple experiments, using a range of vaccination doses and virus challenge doses, and using mortality, morbidity, and virus dissemination as endpoints, indicate that the absence of A33 and B5 have little effect on the ability of a vaccinia vaccine virus to provide protection against a lethal intranasal challenge in a mouse model.

  11. Bovine leukemia virus: current perspectives

    Directory of Open Access Journals (Sweden)

    Juliarena MA

    2017-08-01

    Full Text Available Marcela Alicia Juliarena,1 Clarisa Natalia Barrios,1 Claudia María Lützelschwab,1 Eduardo Néstor Esteban,2 Silvina Elena Gutiérrez1 1Department of Animal Health and Preventive Medicine, Veterinary Research Center of Tandil (CIVETAN, CIC-CONICET, Faculty of Veterinary Science, National University of the Center of Buenos Aires Province, Tandil, Argentina; 2BIOALPINA Program (GENIAL/COTANA, Colonia Alpina, Argentina Abstract: Enzootic bovine leukosis, caused by bovine leukemia virus (BLV, is the most common neoplasm of dairy cattle. Although beef and dairy cattle are susceptible to BLV infection and BLV-associated lymphosarcoma, the disease is more commonly detected in dairy herds, mostly because of the management practices in dairy farms. The pathogenicity of BLV in its natural host, the bovine, depends mainly on the resistance/susceptibility genetics of the animal. The majority of infected cattle are asymptomatic, promoting the extremely high dissemination rate of BLV in many bovine populations. The important productive losses caused by the BLV, added to the health risk of maintaining populations with a high prevalence of infection with a retrovirus, generates the need to implement control measures. Different strategies to control the virus have been attempted. The most effective approach is to identify and cull the totality of infected cattle in the herd. However, this approach is not suitable for herds with high prevalence of infection. At present, no treatment or vaccine has proven effective for the control of BLV. Thus far, the genetic selection of resistant animals emerges as a natural strategy for the containment of the BLV dissemination. In natural conditions, most of the infected, resistant cattle can control the infection, and therefore do not pass the virus to other animals, gradually decreasing the prevalence of the herd. Keywords: bovine leukemia virus, control, genetic resistance, BoLA-DRB3

  12. Unintentional transfer of vaccinia virus associated with smallpox vaccines: ACAM2000(®) compared with Dryvax(®).

    Science.gov (United States)

    Tack, Danielle M; Karem, Kevin L; Montgomery, Jay R; Collins, Limone; Bryant-Genevier, Marthe G; Tiernan, Rosemary; Cano, Maria; Lewis, Paige; Engler, Renata J M; Damon, Inger K; Reynolds, Mary G

    2013-07-01

    Routine vaccination against smallpox (variola) ceased in the US in 1976. However, in 2002 limited coverage for military personnel and some healthcare workers was reinstituted. In March 2008, ACAM2000® replaced Dryvax® as the vaccine used in the United States against smallpox. Unintentional transfer of vaccinia virus from a vaccination site by autoinoculation or contact transmission, can have significant public health implications. We summarize unintentional virus transfer AEs associated with ACAM2000® since March 2008 and compare with Dryvax®. We identified 309 reports for ACAM2000® with skin or ocular involvement, of which 93 were autoinoculation cases and 20 were contact transmission cases. The rate for reported cases of autoinoculation was 20.6 per 100,000 vaccinations and for contact transmission was 4.4 per 100,000 vaccinations. Eighteen contact transmission cases could be attributed to contact during a sporting activity (45%) or intimate contact (45%). Of the 113 unintentional transfer cases, 6 met the case definition for ocular vaccinia. The most common locations for all autoinoculation and contact cases were arm/elbow/shoulder (35/113; 31%) and face (24/113; 21%). Methods We reviewed 753 reports associated with smallpox in the Vaccine Adverse Event Reporting System and CDC Poxvirus consultation log, reported from March 2008 to August 2010. Reports were classified into categories based upon standard case definitions. Overall, unintentional transfer events for ACAM2000® and Dryvax® are similar. We recommend continued efforts to prevent transfer events and continuing education for healthcare providers focused on recognition of vaccinia lesions, proper sample collection, and laboratory testing to confirm diagnosis.

  13. Molecular Diagnostic Analysis of Outbreak Scenarios

    Science.gov (United States)

    Morsink, M. C.; Dekter, H. E.; Dirks-Mulder, A.; van Leeuwen, W. B.

    2012-01-01

    In the current laboratory assignment, technical aspects of the polymerase chain reaction (PCR) are integrated in the context of six different bacterial outbreak scenarios. The "Enterobacterial Repetitive Intergenic Consensus Sequence" (ERIC) PCR was used to analyze different outbreak scenarios. First, groups of 2-4 students determined optimal…

  14. the first outbreak of somali piracy

    African Journals Online (AJOL)

    plt

    Ten years ago, Somalia suffered its first outbreak of piracy. In early 2005, pirates began appearing hundreds of nautical miles out at sea, attacking and hijacking vessels off the shores of central Somalia. However, the circumstances of this outbreak remain poorly understood. Why did pirate groups originate from an area with ...

  15. Measles Outbreak among Unvaccinated Children in Bajura

    Directory of Open Access Journals (Sweden)

    S Sitaula

    2010-12-01

    CFR of this outbreak is higher than the national CFR. Vaccine efficacy of 50% points towards the need for investigation of vaccine logistics and cold chain system. Moreover, this laboratory test confirmed an outbreak showing that the measles virus could be imported from an endemic region and rapidly spread through a susceptible population who were previously not immunized.

  16. Molecular Subtyping in Cholera Outbreak, Laos, 2010

    Science.gov (United States)

    Sithivong, Noikaseumsy; Morita-Ishihara, Tomoko; Vongdouangchanh, Arounnapha; Phouthavane, Traykhouane; Chomlasak, Khampheng; Sisavath, Lay; Khamphaphongphane, Bouaphanh; Sengkeopraseuth, Bounthanom; Vongprachanh, Phengta; Keosavanh, Onechanh; Southalack, Kongmany; Jiyoung, Lee; Tsuyuoka, Reiko; Ohnishi, Makoto

    2011-01-01

    A cholera outbreak in Laos in July 2010 involved 237 cases, including 4 deaths. Molecular subtyping indicated relatedness between the Vibrio cholerae isolates in this and in a 2007 outbreak, uncovering a clonal group of V. cholerae circulating in the Mekong basin. Our finding suggests the subtyping methods will affect this relatedness. PMID:22099098

  17. Incentives for Reporting Infectious Disease Outbreaks

    Science.gov (United States)

    Malani, Anup; Laxminarayan, Ramanan

    2011-01-01

    The global spread of diseases such as swine flu and SARS highlights the difficult decision governments face when presented with evidence of a local outbreak. Reporting the outbreak may bring medical assistance but is also likely to trigger trade sanctions by countries hoping to contain the disease. Suppressing the information may avoid trade…

  18. Yellow Fever Outbreak, Southern Sudan, 2003

    Science.gov (United States)

    Onyango, Clayton O.; Grobbelaar, Antoinette A.; Gibson, Georgina V.F.; Sang, Rosemary C.; Sow, Abdourahmane; Swanepoel, Robert

    2004-01-01

    In May 2003, an outbreak of fatal hemorrhagic fever, caused by yellow fever virus, occurred in southern Sudan. Phylogenetic analysis showed that the virus belonged to the East African genotype, which supports the contention that yellow fever is endemic in East Africa with the potential to cause large outbreaks in humans. PMID:15498174

  19. Uncommon mixed outbreak of pneumococcal and meningococcal ...

    African Journals Online (AJOL)

    Objective: The Jirapa District in Ghana falls within the African meningitis belt where over 500 million people are at risk of epidemic meningitis. The district suffered an outbreak of Neisseria meningitides, W (NMW) in 2012 and a mixed outbreak of Streptococcus pneumonia and NMW in early 2016. We investigated the ...

  20. Do microbial interactions and cultivation media decrease the accuracy of Salmonella surveillance systems and outbreak investigations?

    Science.gov (United States)

    Singer, Randall S; Mayer, Anne E; Hanson, Timothy E; Isaacson, Richard E

    2009-04-01

    Cultivation methods are commonly used in Salmonella surveillance systems and outbreak investigations, and consequently, conclusions about Salmonella evolution and transmission are highly dependent on the performance characteristics of these methods. Past studies have shown that Salmonella serotypes can exhibit different growth characteristics in the same enrichment and selective media. This could lead not only to biased conclusions about the dominant strain present in a sample with mixed Salmonella populations, but also to a low sensitivity for detecting a Salmonella strain in a sample with only a single strain present. The objective of this study was to determine whether cultivation media select preferentially for specific strains of Salmonella in heterogeneous cultures. In this study, four different Salmonella strains (one Salmonella Newport, two Salmonella Typhimurium, and one Salmonella Enteritidis) were competed in a broth-based experiment and a bovine fecal experiment with varied combinations and concentrations of each strain. In all experiments, the strain of Salmonella Newport was the most competitive, regardless of the starting concentration and cultivation protocol. One strain of Salmonella Typhimurium was rarely detected in competition, even when it was the only strain present in bovine feces. Overall, the probability of detecting a specific Salmonella strain had little to do with its starting concentration in the sample. The bias introduced by culture could be dramatically biasing Salmonella surveillance systems and hindering traceback investigations during Salmonella outbreaks. Future studies should focus on the microbiological explanations for this Salmonella interstrain variability, approaches for minimizing the bias, and estimations of the public health significance of this bias.

  1. The novel capripoxvirus vector lumpy skin disease virus efficiently boosts modified vaccinia Ankara human immunodeficiency virus responses in rhesus macaques.

    Science.gov (United States)

    Burgers, Wendy A; Ginbot, Zekarias; Shen, Yen-Ju; Chege, Gerald K; Soares, Andreia P; Müller, Tracey L; Bunjun, Rubina; Kiravu, Agano; Munyanduki, Henry; Douglass, Nicola; Williamson, Anna-Lise

    2014-10-01

    Poxvirus vectors represent promising human immunodeficiency virus (HIV) vaccine candidates and were a component of the only successful HIV vaccine efficacy trial to date. We tested the immunogenicity of a novel recombinant capripoxvirus vector, lumpy skin disease virus (LSDV), in combination with modified vaccinia Ankara (MVA), both expressing genes from HIV-1. Here, we demonstrated that the combination regimen was immunogenic in rhesus macaques, inducing high-magnitude, broad and balanced CD4(+) and CD8(+) T-cell responses, and transient activation of the immune response. These studies support further development of LSDV as a vaccine vector. © 2014 The Authors.

  2. Identification of Protective Brucella Antigens and their Expressions in Vaccinia Virus to Prevent Disease in Animals and Humans.

    Science.gov (United States)

    1996-05-01

    selected antigens is through fractionation of Brucella strain RB51 or E.coli recombinants expressing the appropriateBrucella antigen. Briefly, the method...animal species infected with Brucella spp. It is also able to induce the in vitro production of INF-y with lymphocytes of RB51 vaccinated mice (Table...SOD RB51 1IkDa 20 15 x0 0- 10 E 0- Uve Acetone Buffer Void 0-0.1 0.1-0-25 0.25->0.5 0.5-0.75 0.75->1.0 Klled 14 Preparation of new vaccinia/ Brucella

  3. Genomic sequence and virulence of clonal isolates of vaccinia virus Tiantan, the Chinese smallpox vaccine strain.

    Directory of Open Access Journals (Sweden)

    Qicheng Zhang

    Full Text Available Despite the worldwide eradication of smallpox in 1979, the potential bioterrorism threat from variola virus and the ongoing use of vaccinia virus (VACV as a vector for vaccine development argue for continued research on VACV. In China, the VACV Tiantan strain (TT was used in the smallpox eradication campaign. Its progeny strain is currently being used to develop a human immunodeficiency virus (HIV vaccine. Here we sequenced the full genomes of five TT clones isolated by plaque purification from the TT (752-1 viral stock. Phylogenetic analysis with other commonly used VACV strains showed that TT (752-1 and its clones clustered and exhibited higher sequence diversity than that found in Dryvax clones. The ∼190 kbp genomes of TT appeared to encode 273 open reading frames (ORFs. ORFs located in the middle of the genome were more conserved than those located at the two termini, where many virulence and immunomodulation associated genes reside. Several patterns of nucleotide changes including point mutations, insertions and deletions were identified. The polymorphisms in seven virulence-associated proteins and six immunomodulation-related proteins were analyzed. We also investigated the neuro- and skin- virulence of TT clones in mice and rabbits, respectively. The TT clones exhibited significantly less virulence than the New York City Board of Health (NYCBH strain, as evidenced by less extensive weight loss and morbidity in mice as well as produced smaller skin lesions and lower incidence of putrescence in rabbits. The complete genome sequences, ORF annotations, and phenotypic diversity yielded from this study aid our understanding of the Chinese historic TT strain and are useful for HIV vaccine projects employing TT as a vector.

  4. A loss of function analysis of host factors influencing Vaccinia virus replication by RNA interference.

    Directory of Open Access Journals (Sweden)

    Philippa M Beard

    Full Text Available Vaccinia virus (VACV is a large, cytoplasmic, double-stranded DNA virus that requires complex interactions with host proteins in order to replicate. To explore these interactions a functional high throughput small interfering RNA (siRNA screen targeting 6719 druggable cellular genes was undertaken to identify host factors (HF influencing the replication and spread of an eGFP-tagged VACV. The experimental design incorporated a low multiplicity of infection, thereby enhancing detection of cellular proteins involved in cell-to-cell spread of VACV. The screen revealed 153 pro- and 149 anti-viral HFs that strongly influenced VACV replication. These HFs were investigated further by comparisons with transcriptional profiling data sets and HFs identified in RNAi screens of other viruses. In addition, functional and pathway analysis of the entire screen was carried out to highlight cellular mechanisms involved in VACV replication. This revealed, as anticipated, that many pro-viral HFs are involved in translation of mRNA and, unexpectedly, suggested that a range of proteins involved in cellular transcriptional processes and several DNA repair pathways possess anti-viral activity. Multiple components of the AMPK complex were found to act as pro-viral HFs, while several septins, a group of highly conserved GTP binding proteins with a role in sequestering intracellular bacteria, were identified as strong anti-viral VACV HFs. This screen has identified novel and previously unexplored roles for cellular factors in poxvirus replication. This advancement in our understanding of the VACV life cycle provides a reliable knowledge base for the improvement of poxvirus-based vaccine vectors and development of anti-viral theraputics.

  5. Antibody against extracellular vaccinia virus (EV protects mice through complement and Fc receptors.

    Directory of Open Access Journals (Sweden)

    Matthew E Cohen

    Full Text Available Protein-based subunit smallpox vaccines have shown their potential as effective alternatives to live virus vaccines in animal model challenge studies. We vaccinated mice with combinations of three different vaccinia virus (VACV proteins (A33, B5, L1 and examined how the combined antibody responses to these proteins cooperate to effectively neutralize the extracellular virus (EV infectious form of VACV. Antibodies against these targets were generated in the presence or absence of CpG adjuvant so that Th1-biased antibody responses could be compared to Th2-biased responses to the proteins with aluminum hydroxide alone, specifically with interest in looking at the ability of anti-B5 and anti-A33 polyclonal antibodies (pAb to utilize complement-mediated neutralization in vitro. We found that neutralization of EV by anti-A33 or anti-B5 pAb can be enhanced in the presence of complement if Th1-biased antibody (IgG2a is generated. Mechanistic differences found for complement-mediated neutralization showed that anti-A33 antibodies likely result in virolysis, while anti-B5 antibodies with complement can neutralize by opsonization (coating. In vivo studies found that mice lacking the C3 protein of complement were less protected than wild-type mice after passive transfer of anti-B5 pAb or vaccination with B5. Passive transfer of anti-B5 pAb or monoclonal antibody into mice lacking Fc receptors (FcRs found that FcRs were also important in mediating protection. These results demonstrate that both complement and FcRs are important effector mechanisms for antibody-mediated protection from VACV challenge in mice.

  6. Structure of vaccinia virus thymidine kinase in complex with dTTP: insights for drug design

    Directory of Open Access Journals (Sweden)

    Balzarini Jan

    2006-10-01

    Full Text Available Abstract Background Development of countermeasures to bioterrorist threats such as those posed by the smallpox virus (variola, include vaccination and drug development. Selective activation of nucleoside analogues by virus-encoded thymidine (dThd kinases (TK represents one of the most successful strategies for antiviral chemotherapy as demonstrated for anti-herpes drugs. Vaccinia virus TK is a close orthologue of variola TK but also shares a relatively high sequence identity to human type 2 TK (hTK, thus achieving drug selectivity relative to the host enzyme is challenging. Results In order to identify any differences compared to hTK that may be exploitable in drug design, we have determined the crystal structure of VVTK, in complex with thymidine 5'-triphosphate (dTTP. Although most of the active site residues are conserved between hTK and VVTK, we observe a difference in conformation of residues Asp-43 and Arg-45. The equivalent residues in hTK hydrogen bond to dTTP, whereas in subunit D of VVTK, Asp-43 and Arg-45 adopt a different conformation preventing interaction with this nucleotide. Asp-43 and Arg-45 are present in a flexible loop, which is disordered in subunits A, B and C. The observed difference in conformation and flexibility may also explain the ability of VVTK to phosphorylate (South-methanocarbathymine whereas, in contrast, no substrate activity with hTK is reported for this compound. Conclusion The difference in conformation for Asp-43 and Arg-45 could thus be used in drug design to generate VVTK/Variola TK-selective nucleoside analogue substrates and/or inhibitors that have lower affinity for hTK.

  7. A vaccinia virus renaissance: new vaccine and immunotherapeutic uses after smallpox eradication.

    Science.gov (United States)

    Verardi, Paulo H; Titong, Allison; Hagen, Caitlin J

    2012-07-01

    In 1796, Edward Jenner introduced the concept of vaccination with cowpox virus, an Orthopoxvirus within the family Poxviridae that elicits cross protective immunity against related orthopoxviruses, including smallpox virus (variola virus). Over time, vaccinia virus (VACV) replaced cowpox virus as the smallpox vaccine, and vaccination efforts eventually led to the successful global eradication of smallpox in 1979. VACV has many characteristics that make it an excellent vaccine and that were crucial for the successful eradication of smallpox, including (1) its exceptional thermal stability (a very important but uncommon characteristic in live vaccines), (2) its ability to elicit strong humoral and cell-mediated immune responses, (3) the fact that it is easy to propagate, and (4) that it is not oncogenic, given that VACV replication occurs exclusively within the host cell cytoplasm and there is no evidence that the viral genome integrates into the host genome. Since the eradication of smallpox, VACV has experienced a renaissance of interest as a viral vector for the development of recombinant vaccines, immunotherapies, and oncolytic therapies, as well as the development of next-generation smallpox vaccines. This revival is mainly due to the successful use and extensive characterization of VACV as a vaccine during the smallpox eradication campaign, along with the ability to genetically manipulate its large dsDNA genome while retaining infectivity and immunogenicity, its wide mammalian host range, and its natural tropism for tumor cells that allows its use as an oncolytic vector. This review provides an overview of new uses of VACV that are currently being explored for the development of vaccines, immunotherapeutics, and oncolytic virotherapies.

  8. Tagging of the vaccinia virus protein F13 with mCherry causes aberrant virion morphogenesis.

    Science.gov (United States)

    Carpentier, David C J; Hollinshead, Michael S; Ewles, Helen A; Lee, Stacey-Ann; Smith, Geoffrey L

    2017-09-20

    Vaccinia virus produces two distinct infectious virions; the single-enveloped intracellular mature virus (IMV), which remains in the cell until cell lysis, and the double-enveloped extracellular enveloped virus (EEV), which mediates virus spread. The latter is derived from a triple-enveloped intracellular enveloped virus (IEV) precursor, which is transported to the cell periphery by the kinesin-1 motor complex. This transport involves the viral protein A36 as well as F12 and E2. A36 is an integral membrane protein associated with the outer virus envelope and is the only known direct link between virion and kinesin-1 complex. Yet in the absence of A36 virion egress still occurs on microtubules, albeit at reduced efficiency. In this paper double-fluorescent labelling of the capsid protein A5 and outer-envelope protein F13 was exploited to visualize IEV transport by live-cell imaging in the absence of either A36 or F12. During the generation of recombinant viruses expressing both A5-GFP and F13-mCherry a plaque size defect was identified that was particularly severe in viruses lacking A36. Electron microscopy showed that this phenotype was caused by abnormal wrapping of IMV to form IEV, and this resulted in reduced virus egress to the cell surface. The aberrant wrapping phenotype suggests that the fluorescent fusion protein interferes with an interaction of F13 with the IMV surface that is required for tight association between IMVs and wrapping membranes. The severity of this defect suggests that these viruses are imperfect tools for characterizing virus egress.

  9. An E2-F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection.

    Science.gov (United States)

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael

    2009-05-01

    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 μm s(-1) , consistent with microtubule transport. Using a recombinant virus expressing GST-F12, we found that the viral protein E2 interacts directly with F12. In infected cells, GFP-E2 is observed on moving IEV as well as in the Golgi region, but is not associated with actin tails. In the absence of E2L, IEV accumulate in the peri-nuclear region and F12 is not recruited. Conversely, GFP-E2 is not observed on IEV in the absence of F12. Ultra-structural analysis of ΔE2L- and ΔF12L-infected cells reveals that loss of either protein results in defects in membrane wrapping during IEV formation. We suggest that E2 and F12 function as a complex that is necessary for IEV morphogenesis prior to their microtubule-based transport towards the plasma membrane. © 2009 The Authors. Journal compilation © 2009 Blackwell Publishing Ltd.

  10. Crystal structure of vaccinia virus uracil-DNA glycosylase reveals dimeric assembly

    Directory of Open Access Journals (Sweden)

    DeLucas Lawrence

    2007-07-01

    Full Text Available Abstract Background Uracil-DNA glycosylases (UDGs catalyze excision of uracil from DNA. Vaccinia virus, which is the prototype of poxviruses, encodes a UDG (vvUDG that is significantly different from the UDGs of other organisms in primary, secondary and tertiary structure and characteristic motifs. It adopted a novel catalysis-independent role in DNA replication that involves interaction with a viral protein, A20, to form the processivity factor. UDG:A20 association is essential for assembling of the processive DNA polymerase complex. The structure of the protein must have provisions for such interactions with A20. This paper provides the first glimpse into the structure of a poxvirus UDG. Results Results of dynamic light scattering experiments and native size exclusion chromatography showed that vvUDG is a dimer in solution. The dimeric assembly is also maintained in two crystal forms. The core of vvUDG is reasonably well conserved but the structure contains one additional β-sheet at each terminus. A glycerol molecule is found in the active site of the enzyme in both crystal forms. Interaction of this glycerol molecule with the protein possibly mimics the enzyme-substrate (uracil interactions. Conclusion The crystal structures reveal several distinctive features of vvUDG. The new structural features may have evolved for adopting novel functions in the replication machinery of poxviruses. The mode of interaction between the subunits in the dimers suggests a possible model for binding to its partner and the nature of the processivity factor in the polymerase complex.

  11. Cellular expression of a functional nodavirus RNA replicon from vaccinia virus vectors.

    Science.gov (United States)

    Ball, L A

    1992-04-01

    RNA replication provides a powerful means for the amplification of RNA, but to date it has been found to occur naturally only among RNA viruses. In an attempt to harness this process for the amplification of heterologous mRNAs, both an RNA replicase and its corresponding RNA templates have been expressed in functional form, using vaccinia virus-bacteriophage T7 RNA polymerase vectors. Plasmids were constructed which contained in 5'-to-3' order (i) a bacteriophage T7 promoter; (ii) a full-length cDNA encoding either the RNA replicase (RNA 1) or the coat protein (RNA 2) of flock house virus (FHV), (iii) a cDNA sequence that encoded the self-cleaving ribozyme of satellite tobacco ringspot virus, and (iv) a T7 transcriptional terminator. Both in vitro and in vivo, circular plasmids of this structure were transcribed by T7 RNA polymerase to produce RNAs with sizes that closely resembled those of the two authentic FHV genomic RNAs, RNA 1 and RNA 2. In baby hamster kidney cells that expressed authentic FHV RNA replicase, the RNA 2 (coat protein) transcripts were accurately replicated. Moreover, the RNA 1 (replicase) transcripts directed the synthesis of an enzyme that could replicate not only authentic virion-derived FHV RNA but also the plasmid-derived transcripts themselves. Under the latter conditions, replicative amplification of the RNA transcripts ensued and resulted in a high rate of synthesis of the encoded proteins. This successful expression from a DNA vector of the complex biological process of RNA replication will greatly facilitate studies of its mechanism and is a major step towards the goal of harnessing RNA replication for mRNA amplification.

  12. Cleavage of Dicer protein by I7 protease during vaccinia virus infection.

    Directory of Open Access Journals (Sweden)

    Jhih-Si Chen

    Full Text Available Dicer is the key component in the miRNA pathway. Degradation of Dicer protein is facilitated during vaccinia virus (VV infection. A C-terminal cleaved product of Dicer protein was detected in the presence of MG132 during VV infection. Thus, it is possible that Dicer protein is cleaved by a viral protease followed by proteasome degradation of the cleaved product. There is a potential I7 protease cleavage site in the C-terminus of Dicer protein. Indeed, reduction of Dicer protein was detected when Dicer was co-expressed with I7 protease but not with an I7 protease mutant protein lack of the protease activity. Mutation of the potential I7 cleavage site in the C-terminus of Dicer protein resisted its degradation during VV infection. Furthermore, Dicer protein was reduced dramatically by recombinant VV vI7Li after the induction of I7 protease. If VV could facilitate the degradation of Dicer protein, the process of miRNA should be affected by VV infection. Indeed, accumulation of precursor miR122 was detected after VV infection or I7 protease expression. Reduction of miR122 would result in the suppression of HCV sub-genomic RNA replication, and, in turn, the amount of viral proteins. As expected, significant reduction of HCVNS5A protein was detected after VV infection and I7 protease expression. Therefore, our results suggest that VV could cleave Dicer protein through I7 protease to facilitate Dicer degradation, and in turn, suppress the processing of miRNAs. Effect of Dicer protein on VV replication was also studied. Exogenous expression of Dicer protein suppresses VV replication slightly while knockdown of Dicer protein does not affect VV replication significantly.

  13. Apoptosis and necrosis in vaccinia virus-infected HeLa G and BSC-40 cells.

    Science.gov (United States)

    Liskova, Jana; Knitlova, Jarmila; Honner, Richard; Melkova, Zora

    2011-09-01

    In most cells, vaccinia virus (VACV) infection is considered to cause a lytic cell death, an equivalent of necrosis. However, upon infection of the epithelial cell lines HeLa G and BSC-40 with VACV strain Western Reserve (WR), we have previously observed an increased activation of and activity attributable to caspases, a typical sign of apoptosis. In this paper, we have further analyzed the type of cell death in VACV-infected cells HeLa G and BSC-40. In a cell-based flow cytometric assay, we showed a specific activation of caspase-2 and 4 in HeLa G and BSC-40 cells infected with VACV, strain WR, while we did not find any effects of inhibitors of calpain and cathepsin D and E. The actual activity of the two caspases, but also of caspase-3, was then confirmed in lysates of infected HeLa G, but not in BSC-40 cells. Accordingly, poly(ADP)-ribose polymerase (PARP) cleavage was found increased only in infected HeLa G cells. Consequently, we have determined morphological features of apoptosis and/or activity of the executioner caspase-3 in infected HeLa G cells in situ, while only a background apoptosis was observed in infected BSC-40 cells. Finally, vaccination strains Dryvax and Praha were found to induce apoptosis in both HeLa G and BSC-40 cells, as characterized morphologically and by PARP cleavage. These findings may be important for understanding the differences in VACV-host interactions and post-vaccination complications in different individuals. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Use of Vaccinia Virus Smallpox Vaccine in Laboratory and Health Care Personnel at Risk for Occupational Exposure to Orthopoxviruses - Recommendations of the Advisory Committee on Immunization Practices (ACIP), 2015.

    Science.gov (United States)

    Petersen, Brett W; Harms, Tiara J; Reynolds, Mary G; Harrison, Lee H

    2016-03-18

    On June 25, 2015, the Advisory Committee on Immunization Practices (ACIP) recommended routine vaccination with live smallpox (vaccinia) vaccine (ACAM2000) for laboratory personnel who directly handle 1) cultures or 2) animals contaminated or infected with replication-competent vaccinia virus, recombinant vaccinia viruses derived from replication-competent vaccinia strains (i.e., those that are capable of causing clinical infection and producing infectious virus in humans), or other orthopoxviruses that infect humans (e.g., monkeypox, cowpox, and variola) (recommendation category: A, evidence type 2 [Box]). Health care personnel (e.g., physicians and nurses) who currently treat or anticipate treating patients with vaccinia virus infections and whose contact with replication-competent vaccinia viruses is limited to contaminated materials (e.g., dressings) and persons administering ACAM2000 smallpox vaccine who adhere to appropriate infection prevention measures can be offered vaccination with ACAM2000 (recommendation category: B, evidence type 2 [Box]). These revised recommendations update the previous ACIP recommendations for nonemergency use of vaccinia virus smallpox vaccine for laboratory and health care personnel at risk for occupational exposure to orthopoxviruses (1). Since 2001, when the previous ACIP recommendations were developed, ACAM2000 has replaced Dryvax as the only smallpox vaccine licensed by the U.S. Food and Drug Administration (FDA) and available for use in the United States (2). These recommendations contain information on ACAM2000 and its use in laboratory and health care personnel at risk for occupational exposure to orthopoxviruses.

  15. Bovine cysticercosis situation in Brazil

    Directory of Open Access Journals (Sweden)

    Gabriel Augusto Marques Rossi

    2014-02-01

    Full Text Available The taeniasis-cysticercosis complex is a long known zoonotic parasitosis characteristic of underdeveloped countries. In addition to its public health significance, this parasitosis is cause of economic losses to the beef production chain, and synonymous of technical inadequacy in relation to the adoption of Good Agricultural Practices. The occurrences of both human teniasis and bovine cysticercosis could and should be controlled with basic sanitary measures. However, there is much variation in the occurrence of the disease in cattle, characterizing a low rate of technical development as well as problems related to the adoption of basic sanitation measures. This review describes, in details, the causative agent and its epidemiological chain, besides raising current information about the occurrence of bovine cysticercosis in different regions of Brazil, aiming at the adoption of prophylactic measures by different segments responsible.

  16. The Lactococcus genus as a potential emerging mastitis pathogen group: A report on an outbreak investigation.

    Science.gov (United States)

    Rodrigues, M X; Lima, S F; Higgins, C H; Canniatti-Brazaca, S G; Bicalho, R C

    2016-12-01

    The bacterium Lactococcus lactis is widely used in food production and in medical applications, and is considered safe for human and animal use. However, studies have also linked Lactococcus bacteria to infection. For example, certain variants of Lactococcus species have been associated with bovine mastitis (e.g., Lactococcus lactis and Lactococcus garvieae). In this study, we investigated an outbreak of bovine mastitis thought to be associated with Lactococcus bacteria by using microbiological and molecular techniques. We used bacterial isolation, next-generation sequencing, DNA fingerprinting, and other methods to test our hypothesis that Lactococcus microbes were the primary pathogen causing the mastitis outbreak. Twenty-eight Lactococcus isolates were obtained from mastitic milk of 28 dairy cows. The isolates were identified as L. lactis (27 isolates) and L. garvieae (1 isolate). Phylogenetic analysis based on 16S rDNA gene sequence comparison indicated similarity among the L. lactis isolates as well as between the isolates and reference sequences. The DNA fingerprinting analysis based on random amplified polymorphic DNA results of the 27 L. lactis isolates identified different random amplified polymorphic DNA profiles, which suggests they originated from multiple sources. Microbiome analysis determined Lactococcus to be the dominant genus in the majority of the mastitic milk samples, whereas it was found in low relative abundance in healthy milk samples. The Lactococcus genus was detected in all environmental samples tested, and sampling of bulk tank milk corroborated that Lactococcus was not abundant in healthy milk from the same dairy herd. In summary, our findings suggest that Lactococcus bacteria are a potential etiological agent in the mastitis outbreak studied. Further studies should be conducted to understand the importance of Lactococcus, especially L. lactis, as pathogenic microbes in veterinary medicine and food safety. Copyright © 2016 American

  17. Environmental indicators for human norovirus outbreaks.

    Science.gov (United States)

    Shamkhali Chenar, Shima; Deng, Zhiqiang

    2017-02-01

    Norovirus is the most common cause of outbreaks of non-bacterial gastroenteritis in human. While the winter seasonality of norovirus outbreaks has been widely reported, the association between norovirus outbreak epidemics and environmental factors remains not fully understood. This literature review is intended to improve understanding of environmental factors governing norovirus outbreaks and how the factors affect norovirus transmission. To that end, a large number of studies (67) from countries around the world were critically reviewed and discussed. Results of the literature review show that temperature, humidity, and rainfall are the most important environmental variables governing the norovirus epidemic cycle. It was found that low temperature between -6.6 and 20 °C, relative humidity between 10 and 66 %, and rainfall from 1 day to 3 months before an outbreak are effective ranges of the environmental factors, which favor the prevalence of norovirus. Some other environmental factors might have an association with the cycle of norovirus epidemics. However, further investigations are needed to understand effects of the other factors on norovirus incidence. The findings of this literature review improve our understanding of the relationship between norovirus outbreaks and environmental factors and provide the direction for future research on norovirus outbreaks.

  18. Protective Effect of Surfactant Protein D in Pulmonary Vaccinia Virus Infection: Implication of A27 Viral Protein

    Directory of Open Access Journals (Sweden)

    Julien Perino

    2013-03-01

    Full Text Available Vaccinia virus (VACV was used as a surrogate of variola virus (VARV (genus Orthopoxvirus, the causative agent of smallpox, to study Orthopoxvirus infection. VARV is principally transmitted between humans by aerosol droplets. Once inhaled, VARV first infects the respiratory tract where it could encounter surfactant components, such as soluble pattern recognition receptors. Surfactant protein D (SP-D, constitutively present in the lining fluids of the respiratory tract, plays important roles in innate host defense against virus infection. We investigated the role of SP-D in VACV infection and studied the A27 viral protein involvement in the interaction with SP-D. Interaction between SP-D and VACV caused viral inhibition in a lung cell model. Interaction of SP-D with VACV was mediated by the A27 viral protein. Binding required Ca2+ and interactions were blocked in the presence of excess of SP-D saccharide ligands. A27, which lacks glycosylation, directly interacted with SP-D. The interaction between SP-D and the viral particle was also observed using electron microscopy. Infection of mice lacking SP-D (SP-D-/- resulted in increased mortality compared to SP-D+/+ mice. Altogether, our data show that SP-D participates in host defense against the vaccinia virus infection and that the interaction occurs with the viral surface protein A27.

  19. Safety and biodistribution of a double-deleted oncolytic vaccinia virus encoding CD40 ligand in laboratory Beagles

    Directory of Open Access Journals (Sweden)

    Karoliina Autio

    2014-01-01

    Full Text Available We evaluated adverse events, biodistribution and shedding of oncolytic vaccinia virus encoding CD40 ligand in two Beagles, in preparation for a phase 1 trial in canine cancer patients. Dog 1 received one dose of vaccinia virus and was euthanized 24 hours afterwards, while dog 2 received virus four times once weekly and was euthanized 7 days after that. Dogs were monitored for adverse events and underwent a detailed postmortem examination. Blood, saliva, urine, feces, and organs were collected for virus detection. Dog 1 had mild fever and lethargy while dog 2 experienced a possible seizure 5.5 hours after first virus administration. Viral DNA declined quickly in the blood after virus administration in both dogs but was still detectable 1 week later by quantitative polymerase chain reaction. Only samples taken directly after virus infusion contained infectious virus. Small amounts of viral DNA, but no infectious virus, were detected in a few saliva and urine samples. Necropsies did not reveal any relevant pathological changes and virus DNA was detected mainly in the spleen. The dogs in the study did not have cancer, and thus adverse events could be more common and viral load higher in dogs with tumors which allow viral amplification.

  20. Vaccinia Virus Protein F12 Associates with Intracellular Enveloped Virions through an Interaction with A36▿

    Science.gov (United States)

    Johnston, Sara C.; Ward, Brian M.

    2009-01-01

    Vaccinia virus is the prototypical member of the family Poxviridae. Three morphologically distinct forms are produced during infection: intracellular mature virions (IMV), intracellular enveloped virions (IEV), and extracellular enveloped virions (EEV). Two viral proteins, F12 and A36, are found exclusively on IEV but not on IMV and EEV. Analysis of membranes from infected cells showed that F12 was only associated with membranes and is not an integral membrane protein. A yeast two-hybrid assay revealed an interaction between amino acids 351 to 458 of F12 and amino acids 91 to 111 of A36. We generated a recombinant vaccinia virus that expresses an F12, which lacks residues 351 to 458. Characterization of this recombinant revealed a small-plaque phenotype and a subsequent defect in virus release similar to a recombinant virus that had F12L deleted. In addition, F12 lacking residues 351 to 458 was unable to associate with membranes in infected cells. These results suggest that F12 associates with IEV through an interaction with A36 and that this interaction is critical for the function of F12 during viral egress. PMID:19052096

  1. Expression of DAI by an oncolytic vaccinia virus boosts the immunogenicity of the virus and enhances antitumor immunity

    Directory of Open Access Journals (Sweden)

    Mari Hirvinen

    2016-01-01

    Full Text Available In oncolytic virotherapy, the ability of the virus to activate the immune system is a key attribute with regard to long-term antitumor effects. Vaccinia viruses bear one of the strongest oncolytic activities among all oncolytic viruses. However, its capacity for stimulation of antitumor immunity is not optimal, mainly due to its immunosuppressive nature. To overcome this problem, we developed an oncolytic VV that expresses intracellular pattern recognition receptor DNA-dependent activator of IFN-regulatory factors (DAI to boost the innate immune system and to activate adaptive immune cells in the tumor. We showed that infection with DAI-expressing VV increases expression of several genes related to important immunological pathways. Treatment with DAI-armed VV resulted in significant reduction in the size of syngeneic melanoma tumors in mice. When the mice were rechallenged with the same tumor, DAI-VV-treated mice completely rejected growth of the new tumor, which indicates immunity established against the tumor. We also showed enhanced control of growth of human melanoma tumors and elevated levels of human T-cells in DAI-VV-treated mice humanized with human peripheral blood mononuclear cells. We conclude that expression of DAI by an oncolytic VV is a promising way to amplify the vaccine potency of an oncolytic vaccinia virus to trigger the innate—and eventually the long-lasting adaptive immunity against cancer.

  2. A cancer-favoring oncolytic vaccinia virus shows enhanced suppression of stem-cell like colon cancer.

    Science.gov (United States)

    Yoo, So Young; Bang, Seo Young; Jeong, Su-Nam; Kang, Dae Hwan; Heo, Jeong

    2016-03-29

    Stem cell-like colon cancer cells (SCCs) pose a major challenge in colon cancer treatment because of their resistance to chemotherapy and radiotherapy. Oncolytic virus-based therapy has shown promising results in uncured cancer patients; however, its effects on SCCs are not well studied yet. Here, we engineered a cancer-favoring oncolytic vaccinia virus (CVV) as a potent biotherapeutic and investigated its therapeutic efficacy in terms of killing SCCs. CVV is an evolved Wyeth strain vaccinia virus (EVV) lacking the viral thymidine kinase. SCC models were established using human or mouse colon cancer spheres, which continuously expressed stemness markers. The cancer-favoring characteristics and different cytotoxic pathways for killing cancer cells successfully overrode general drug resistance, thereby killing colon cancer cells regardless of the presence of SCCs. Subcutaneously injected HT29 spheres showed lower growth in CVV-treated models than in 5-Fu-treated models. Intraperitoneally injected CT26 spheres induced tumor masses in the abdominal region. CVV-treated groups showed higher survival rates and smaller tumor mass formation, compared to 5-Fu-treated groups. Interestingly, the combined treatment of CVV with 5-Fu showed improved survival rates and complete suppression of tumor mass. The CVV developed in this study, thus, effectively suppresses SCCs, which can be synergistically enhanced by simultaneous treatment with the anticancer drug 5-Fu. Our novel CVV is highly advantageous as a next-generation therapeutic for treating colon cancer.

  3. Modified vaccinia virus Ankara expressing the hemagglutinin of pandemic (H1N1) 2009 virus induces cross-protective immunity against Eurasian 'avian-like' H1N1 swine viruses in mice.

    Science.gov (United States)

    Castrucci, Maria R; Facchini, Marzia; Di Mario, Giuseppina; Garulli, Bruno; Sciaraffia, Ester; Meola, Monica; Fabiani, Concetta; De Marco, Maria A; Cordioli, Paolo; Siccardi, Antonio; Kawaoka, Yoshihiro; Donatelli, Isabella

    2014-05-01

    To examine cross-reactivity between hemagglutinin (HA) derived from A/California/7/09 (CA/09) virus and that derived from representative Eurasian "avian-like" (EA) H1N1 swine viruses isolated in Italy between 1999 and 2008 during virological surveillance in pigs. Modified vaccinia virus Ankara (MVA) expressing the HA gene of CA/09 virus (MVA-HA-CA/09) was used as a vaccine to investigate cross-protective immunity against H1N1 swine viruses in mice. Two classical swine H1N1 (CS) viruses and four representative EA-like H1N1 swine viruses previously isolated during outbreaks of respiratory disease in pigs on farms in Northern Italy were used in this study. Female C57BL/6 mice were vaccinated with MVA/HA/CA/09 and then challenged intranasally with H1N1 swine viruses. Cross-reactive antibody responses were determined by hemagglutination- inhibition (HI) and virus microneutralizing (MN) assays of sera from MVA-vaccinated mice. The extent of protective immunity against infection with H1N1 swine viruses was determined by measuring lung viral load on days 2 and 4 post-challenge. Systemic immunization of mice with CA/09-derived HA, vectored by MVA, elicited cross-protective immunity against recent EA-like swine viruses. This immune protection was related to the levels of cross-reactive HI antibodies in the sera of the immunized mice and was dependent on the similarity of the antigenic site Sa of H1 HAs. Our findings suggest that the herd immunity elicited in humans by the pandemic (H1N1) 2009 virus could limit the transmission of recent EA-like swine HA genes into the influenza A virus gene pool in humans. © 2013 The Authors Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

  4. Modified vaccinia virus Ankara expressing the hemagglutinin of pandemic (H1N1) 2009 virus induces cross-protective immunity against Eurasian ‘avian-like’ H1N1 swine viruses in mice

    Science.gov (United States)

    Castrucci, Maria R; Facchini, Marzia; Di Mario, Giuseppina; Garulli, Bruno; Sciaraffia, Ester; Meola, Monica; Fabiani, Concetta; De Marco, Maria A; Cordioli, Paolo; Siccardi, Antonio; Kawaoka, Yoshihiro; Donatelli, Isabella

    2014-01-01

    Objectives To examine cross-reactivity between hemagglutinin (HA) derived from A/California/7/09 (CA/09) virus and that derived from representative Eurasian “avian-like” (EA) H1N1 swine viruses isolated in Italy between 1999 and 2008 during virological surveillance in pigs. Design Modified vaccinia virus Ankara (MVA) expressing the HA gene of CA/09 virus (MVA-HA-CA/09) was used as a vaccine to investigate cross-protective immunity against H1N1 swine viruses in mice. Sample Two classical swine H1N1 (CS) viruses and four representative EA-like H1N1 swine viruses previously isolated during outbreaks of respiratory disease in pigs on farms in Northern Italy were used in this study. Setting Female C57BL/6 mice were vaccinated with MVA/HA/CA/09 and then challenged intranasally with H1N1 swine viruses. Main outcome measures Cross-reactive antibody responses were determined by hemagglutination- inhibition (HI) and virus microneutralizing (MN) assays of sera from MVA-vaccinated mice. The extent of protective immunity against infection with H1N1 swine viruses was determined by measuring lung viral load on days 2 and 4 post-challenge. Results and Conclusions Systemic immunization of mice with CA/09-derived HA, vectored by MVA, elicited cross-protective immunity against recent EA-like swine viruses. This immune protection was related to the levels of cross-reactive HI antibodies in the sera of the immunized mice and was dependent on the similarity of the antigenic site Sa of H1 HAs. Our findings suggest that the herd immunity elicited in humans by the pandemic (H1N1) 2009 virus could limit the transmission of recent EA-like swine HA genes into the influenza A virus gene pool in humans. PMID:24373385

  5. Analyzing the Foot and Mouth Disease outbreak as from 2008 to 2014 in cattle and buffaloes in Sri Lanka.

    Science.gov (United States)

    Gunasekera, Umanga C; Sivasothy, Arumugumam; Wedasingha, Nihal; Thayaparan, Sivapiragasam; Rotewewa, Bandara; Muralithas, Mahalingam; Baumann, Maximilian P O; Punyapornwithaya, Veerasak

    2017-12-01

    Foot and Mouth Disease (FMD) is a highly contagious disease that affects all cloven hoofed animals and causes considerable economic losses to cattle and buffalo farmers worldwide. FMD is endemic to Sri Lanka. The objective of this study was to analyze the past situation of FMD from 2008 to 2014 in the country and to identify relevant risk factors associated with the 2014 outbreak. Outbreak data from the Department of Animal Production and Health, Sri Lanka from 2008 to 2014 were used to describe the spatial distribution and to determine associations between the frequency of outbreaks across the country (nine provinces) and factors including vaccination coverage and outbreak year. A questionnaire was used to collect the information on potential risk factors for FMD for the 2014 outbreak from case farms (n=83) and control farms (n=161). Seven focus group (FG) discussions with farmers and five in-depth interviews with veterinarians and livestock officers were conducted. A negative binomial regression model was constructed to determine the relationship between frequencies of outbreaks by province, year, vaccine coverage and bovine numbers per province. A logistic regression model was used to determine the association between potential risk factors and disease status of the farm. There was no association between vaccination coverage and outbreak frequencies at province level (Risk Ratio=1.02; 95% CI=0.09, 1.05). Based on our cases-control study there were five variables significantly associated with the FMD spread: cattle/buffalo contact with nearby villages (Odds Ratio=2.88; 95% CI: 1.23-6.72), cattle/buffalo grazing near water tank areas (OR=3.11;95% CI: 1.21-7.97), animals bought or sold during the outbreak (OR=3.3; 95% CI: 1.39-7.83), being near to a road where animal traders travel (OR=3.44 95% CI: 1.10-10.79), and being fed on the floor instead of feed troughs (OR=2.61,1.08-6.31). The major risk factor identified here was cattle/buffalo movement by means of

  6. Biophysical analysis of bacterial and viral systems. A shock tube study of bio-aerosols and a correlated AFM/nanosims investigation of vaccinia virus

    Energy Technology Data Exchange (ETDEWEB)

    Gates, Sean Damien [Stanford Univ., CA (United States)

    2013-05-01

    The work presented herein is concerned with the development of biophysical methodology designed to address pertinent questions regarding the behavior and structure of select pathogenic agents. Two distinct studies are documented: a shock tube analysis of endospore-laden bio-aerosols and a correlated AFM/NanoSIMS study of the structure of vaccinia virus.

  7. Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

    Science.gov (United States)

    Merchlinsky, M

    1990-01-01

    In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera. Images PMID:2398534

  8. High-affinity human leucocyte antigen class I binding variola-derived peptides induce CD4(+) T cell responses more than 30 years post-vaccinia virus vaccination

    DEFF Research Database (Denmark)

    Wang, M.; Tang, Sheila Tuyet; Lund, Ole

    2009-01-01

    Interferon-gamma secreting T lymphocytes against pox virus-derived synthetic 9-mer peptides were tested by enzyme-linked immunospot in peripheral blood of individuals vaccinated with vaccinia virus more than 30 years ago. The peptides were characterized biochemically as high-affinity human...

  9. Molecular network, pathway, and functional analysis of time-dependent gene changes associated with pancreatic cancer susceptibility to oncolytic vaccinia virotherapy

    Directory of Open Access Journals (Sweden)

    Dana Haddad

    2016-01-01

    Conclusions: Our study reveals the ability to assess time-dependent changes in gene expression patterns in pancreatic cancer cells associated with infection and susceptibility to vaccinia viruses. This suggests that molecular assays may be useful to develop safer and more efficacious oncolyticvirotherapies and support the idea that these treatments may target pathways implicated in pancreatic cancer resistance to conventional therapies.

  10. An outbreak of rubella in Chandigarh, India.

    Science.gov (United States)

    Madhanraj, K; Singh, N; Gupta, M; Singh, M P; Ratho, R K

    2014-11-01

    To investigate an outbreak of fever with rash in an urbanized village in Chandigarh, India. Active case search was performed by house-to-house survey. The etiological agent of the outbreak was confirmed by serology. Spot map was done using Geographical Information System (GIS) technology. Out of 7742 persons screened, 12 were serologically confirmed rubella cases and 83 were epidemiologically linked cases. Overall attack rate was 1.1, more among the age group 1-4 years (4.9). An outbreak mimicking measles was investigated only to be confirmed as rubella.

  11. Mycobacterium bovis (Bovine Tuberculosis) in Humans

    Science.gov (United States)

    Mycobacterium bovis (Bovine Tuberculosis) in Humans What is Mycobacterium bovis ? In the United States, the majority of tuberculosis (TB) cases in people are caused by Mycobacterium tuberculosis ( ...

  12. Comparison of host cell gene expression in cowpox, monkeypox or vaccinia virus-infected cells reveals virus-specific regulation of immune response genes.

    Science.gov (United States)

    Bourquain, Daniel; Dabrowski, Piotr Wojtek; Nitsche, Andreas

    2013-02-20

    Animal-borne orthopoxviruses, like monkeypox, vaccinia and the closely related cowpox virus, are all capable of causing zoonotic infections in humans, representing a potential threat to human health. The disease caused by each virus differs in terms of symptoms and severity, but little is yet know about the reasons for these varying phenotypes. They may be explained by the unique repertoire of immune and host cell modulating factors encoded by each virus. In this study, we analysed the specific modulation of the host cell's gene expression profile by cowpox, monkeypox and vaccinia virus infection. We aimed to identify mechanisms that are either common to orthopoxvirus infection or specific to certain orthopoxvirus species, allowing a more detailed description of differences in virus-host cell interactions between individual orthopoxviruses. To this end, we analysed changes in host cell gene expression of HeLa cells in response to infection with cowpox, monkeypox and vaccinia virus, using whole-genome gene expression microarrays, and compared these to each other and to non-infected cells. Despite a dominating non-responsiveness of cellular transcription towards orthopoxvirus infection, we could identify several clusters of infection-modulated genes. These clusters are either commonly regulated by orthopoxvirus infection or are uniquely regulated by infection with a specific orthopoxvirus, with major differences being observed in immune response genes. Most noticeable was an induction of genes involved in leukocyte migration and activation in cowpox and monkeypox virus-infected cells, which was not observed following vaccinia virus infection. Despite their close genetic relationship, the expression profiles induced by infection with different orthopoxviruses vary significantly. It may be speculated that these differences at the cellular level contribute to the individual characteristics of cowpox, monkeypox and vaccinia virus infections in certain host species.

  13. Vaccinia virus-encoded ribonucleotide reductase subunits are differentially required for replication and pathogenesis.

    Directory of Open Access Journals (Sweden)

    Don B Gammon

    2010-07-01

    Full Text Available Ribonucleotide reductases (RRs are evolutionarily-conserved enzymes that catalyze the rate-limiting step during dNTP synthesis in mammals. RR consists of both large (R1 and small (R2 subunits, which are both required for catalysis by the R1(2R2(2 heterotetrameric complex. Poxviruses also encode RR proteins, but while the Orthopoxviruses infecting humans [e.g. vaccinia (VACV, variola, cowpox, and monkeypox viruses] encode both R1 and R2 subunits, the vast majority of Chordopoxviruses encode only R2 subunits. Using plaque morphology, growth curve, and mouse model studies, we investigated the requirement of VACV R1 (I4 and R2 (F4 subunits for replication and pathogenesis using a panel of mutant viruses in which one or more viral RR genes had been inactivated. Surprisingly, VACV F4, but not I4, was required for efficient replication in culture and virulence in mice. The growth defects of VACV strains lacking F4 could be complemented by genes encoding other Chordopoxvirus R2 subunits, suggesting conservation of function between poxvirus R2 proteins. Expression of F4 proteins encoding a point mutation predicted to inactivate RR activity but still allow for interaction with R1 subunits, caused a dominant negative phenotype in growth experiments in the presence or absence of I4. Co-immunoprecipitation studies showed that F4 (as well as other Chordopoxvirus R2 subunits form hybrid complexes with cellular R1 subunits. Mutant F4 proteins that are unable to interact with host R1 subunits failed to rescue the replication defect of strains lacking F4, suggesting that F4-host R1 complex formation is critical for VACV replication. Our results suggest that poxvirus R2 subunits form functional complexes with host R1 subunits to provide sufficient dNTPs for viral replication. Our results also suggest that R2-deficient poxviruses may be selective oncolytic agents and our bioinformatic analyses provide insights into how poxvirus nucleotide metabolism proteins may

  14. Reactions of Cre with methylphosphonate DNA: similarities and contrasts with Flp and vaccinia topoisomerase.

    Directory of Open Access Journals (Sweden)

    Chien-Hui Ma

    2009-09-01

    Full Text Available Reactions of vaccinia topoisomerase and the tyrosine site-specific recombinase Flp with methylphosphonate (MeP substituted DNA substrates, have provided important insights into the electrostatic features of the strand cleavage and strand joining steps catalyzed by them. A conserved arginine residue in the catalytic pentad, Arg-223 in topoisomerase and Arg-308 in Flp, is not essential for stabilizing the MeP transition state. Topoisomerase or its R223A variant promotes cleavage of the MeP bond by the active site nucleophile Tyr-274, followed by the rapid hydrolysis of the MeP-tyrosyl intermediate. Flp(R308A, but not wild type Flp, mediates direct hydrolysis of the activated MeP bond. These findings are consistent with a potential role for phosphate electrostatics and active site electrostatics in protecting DNA relaxation and site-specific recombination, respectively, against abortive hydrolysis.We have examined the effects of DNA containing MeP substitution in the Flp related Cre recombination system. Neutralizing the negative charge at the scissile position does not render the tyrosyl intermediate formed by Cre susceptible to rapid hydrolysis. Furthermore, combining the active site R292A mutation in Cre (equivalent to the R223A and R308A mutations in topoisomerase and Flp, respectively with MeP substitution does not lead to direct hydrolysis of the scissile MeP bond in DNA. Whereas Cre follows the topoisomerase paradigm during the strand cleavage step, it follows the Flp paradigm during the strand joining step.Collectively, the Cre, Flp and topoisomerase results highlight the contribution of conserved electrostatic complementarity between substrate and active site towards transition state stabilization during site-specific recombination and DNA relaxation. They have potential implications for how transesterification reactions in nucleic acids are protected against undesirable abortive side reactions. Such protective mechanisms are significant

  15. Investigation of bovine haemoplasmas and their association with anaemia in New Zealand cattle.

    Science.gov (United States)

    McFadden, Amj; Ha, H J; Donald, J J; Bueno, I M; van Andel, M; Thompson, J C; Tisdall, D J; Pulford, D J

    2016-01-01

    A dairy cow, from a herd in the Waikato region of New Zealand, was reported with regenerative anaemia on 12 September 2014. Testing of blood from the animal using PCR assays for Theileria orientalis produced a negative result for both Chitose and Ikeda types. Using PCR and DNA sequencing, blood from the cow was positive for Candidatus Mycoplasma haemobos. Further testing of another 12 animals from the case herd, 27 days after the affected cow was first reported, showed 11 animals were positive for Candidatus M. haemobos or Mycoplasma wenyonii in the PCR. None of these cattle were clinically anaemic or positive for T. orientalis Ikeda type using PCR. A convenience sample of 47 blood samples from cattle throughout New Zealand, submitted to the Investigation and Diagnostic Centre (Ministry for Primary Industries) for surveillance testing for T. orientalis Ikeda, was selected for further testing for bovine haemoplasmas. Of these samples, 6/47 (13%) and 13/47(28%) were positive for M. wenyonii and Candidatus M. haemobos, respectively. There was no difference in the proportion of samples positive for the bovine haemaplasmas between cattle with anaemia that were negative for T. orientalis (6/20, 33%), or without anaemia or T. orientalis (10/18, 56%), or from cattle herds experiencing anaemia and infection with T. orientalis Ikeda type (3/9, 33%). Bovine haemoplasmosis. The presence of bovine haemoplasmas in blood does not establish causality for anaemia in cattle. Diagnosis of anaemia associated with haemoplasmosis would require exclusion of other causes of regenerative anaemia and an association of the agent with anaemia in affected cattle herds. The data collected in this study did not provide evidence that bovine haemoplasmas were associated with a large number of outbreaks of anaemia in cattle in New Zealand.

  16. Genetic Clues to the 2014 Ebola Outbreak

    Science.gov (United States)

    ... Print this issue Genetic Clues to the 2014 Ebola Outbreak En español Send us your comments Scientists ... organism or virus. of nearly 100 samples of Ebola virus from patients in West Africa. The findings ...

  17. Influenza outbreak in a correctional facility.

    Science.gov (United States)

    Awofeso, N; Fennell, M; Waliuzzaman, Z; O'Connor, C; Pittam, D; Boonwaat, L; de Kantzow, S; Rawlinson, W D

    2001-10-01

    The outbreak of influenza in a corrections facility occurred during August 2000. The outbreak progressed following introduction of the disease by a member of the public to the facility. Rapid diagnosis and typing of the influenza isolates was available, although two prisoners required hospital admission due to the severity of complications at the time of diagnosis. The group demonstrated rapid transmission of the virus by the respiratory route and probably by fomites. The identified infecting virus was A/Moscow-like, an H3N2 subtype typically associated with large outbreaks. Prevention of such outbreaks will involve either achieving high rates of vaccination within the risk groups, or rapid (possibly point of care) diagnosis with the institution of antiviral therapy within 48 hours of symptoms. Influenza control within institutions is feasible using such strategies, although it requires considerable planning to have such approaches in place during winter--a time when institutional staff absenteeism is typically high.

  18. Infection control during filoviral hemorrhagic fever outbreaks

    Directory of Open Access Journals (Sweden)

    N Raabe Vanessa

    2012-01-01

    Full Text Available Breaking the human-to-human transmission cycle remains the cornerstone of infection control during filoviral (Ebola and Marburg hemorrhagic fever outbreaks. This requires effective identification and isolation of cases, timely contact tracing and monitoring, proper usage of barrier personal protection gear by health workers, and safely conducted burials. Solely implementing these measures is insufficient for infection control; control efforts must be culturally sensitive and conducted in a transparent manner to promote the necessary trust between the community and infection control team in order to succeed. This article provides a review of the literature on infection control during filoviral hemorrhagic fever outbreaks focusing on outbreaks in a developing setting and lessons learned from previous outbreaks. The primary search database used to review the literature was PUBMED, the National Library of Medicine website.

  19. Nosocomial outbreak of cryptosporidiosis in AIDS patients.

    OpenAIRE

    Ravn, P; Lundgren, J D; Kjaeldgaard, P; Holten-Anderson, W; Højlyng, N; Nielsen, J O; Gaub, J

    1991-01-01

    OBJECTIVE--To describe a nosocomial outbreak of cryptosporidiosis during four months after June 1989. SETTING--A department of infectious diseases in Copenhagen, seeing about half the patients with AIDS in Denmark. SUBJECTS--73 HIV antibody negative subjects and 60 antibody positive subjects admitted as inpatients during the transmission period of the outbreak (20 June-14 August), of whom 18 (17 with AIDS, one with AIDS related complex), developed cryptosporidiosis. Two further HIV negative s...

  20. Rapid assessment of bovine spongiform encephalopathy prion inactivation by heat treatment in yellow grease produced in the industrial manufacturing process of meat and bone meals

    OpenAIRE

    YOSHIOKA, Miyako; Matsuura, Yuichi; Okada, Hiroyuki; Shimozaki, Noriko; Yamamura, Tomoaki; Murayama, Yuichi; Yokoyama, Takashi; Mohri, Shirou

    2013-01-01

    Background Prions, infectious agents associated with transmissible spongiform encephalopathy, are primarily composed of the misfolded and pathogenic form (PrPSc) of the host-encoded prion protein. Because PrPSc retains infectivity after undergoing routine sterilizing processes, the cause of bovine spongiform encephalopathy (BSE) outbreaks are suspected to be feeding cattle meat and bone meals (MBMs) contaminated with the prion. To assess the validity of prion inactivation by heat treatment in...

  1. Interactions between Vaccinia Virus IEV Membrane Proteins and Their Roles in IEV Assembly and Actin Tail Formation

    Science.gov (United States)

    Röttger, Sabine; Frischknecht, Friedrich; Reckmann, Inge; Smith, Geoffrey L.; Way, Michael

    1999-01-01

    The intracellular enveloped form of vaccinia virus (IEV) induces the formation of actin tails that are strikingly similar to those seen in Listeria and Shigella infections. In contrast to the case for Listeria and Shigella, the vaccinia virus protein(s) responsible for directly initiating actin tail formation remains obscure. However, previous studies with recombinant vaccinia virus strains have suggested that the IEV-specific proteins A33R, A34R, A36R, B5R, and F13L play an undefined role in actin tail formation. In this study we have sought to understand how these proteins, all of which are predicted to have small cytoplasmic domains, are involved in IEV assembly and actin tail formation. Our data reveal that while deletion of A34R, B5R, or F13L resulted in a severe reduction in IEV particle assembly, IEVs formed by the ΔB5R and ΔF13L deletion strains, but not ΔA34R, were still able to induce actin tails. The ΔA36R deletion strain produced normal amounts of IEV particles, although these were unable to induce actin tails. Using several different approaches, we demonstrated that A36R is a type Ib membrane protein with a large, 195-amino-acid cytoplasmic domain exposed on the surface of IEV particles. Finally, coimmunoprecipitation experiments demonstrated that A36R interacts with A33R and A34R but not with B5R and that B5R forms a complex with A34R but not with A33R or A36R. Using extracts from ΔA34R- and ΔA36R-infected cells, we found that the interaction of A36R with A33R and that of A34R with B5R are independent of A34R and A36R, respectively. We conclude from our observations that multiple interactions between IEV membrane proteins exist which have important implications for IEV assembly and actin tail formation. Furthermore, these data suggest that while A34R is involved in IEV assembly and organization, A36R is critical for actin tail formation. PMID:10074134

  2. (Npro) protein of bovine viral d

    Indian Academy of Sciences (India)

    Prakash

    Bovine viral diarrhoea virus (BVDV) is an economically important pathogen of cattle and sheep, and causes significant respiratory and reproductive disease worldwide. Bovine viral diarrhoea virus type 1 (BVDV-1), BVDV-2 along with the border disease virus (BDV) and classical swine fever virus (CSFV) belong to the genus ...

  3. Bovine cysticercosis in the European Union

    DEFF Research Database (Denmark)

    Blagojevic, Bojan; Robertson, Lucy J.; Vieira-Pinto, Madalena

    2017-01-01

    Bovine cysticercosis is caused by the larval stage of Taenia saginata and has a global distribution. This zoonosis usually causes only mild disease in humans, but has an important economic impact on the meat sector as bovine carcasses that are found to be infected are either condemned or undergo ...

  4. Models of bovine babesiosis including juvenile cattle.

    Science.gov (United States)

    Saad-Roy, C M; Shuai, Zhisheng; van den Driessche, P

    2015-03-01

    Bovine Babesiosis in cattle is caused by the transmission of protozoa of Babesia spp. by ticks as vectors. Juvenile cattle (Bovine Babesiosis, rarely show symptoms, and acquire immunity upon recovery. Susceptibility to the disease varies between breeds of cattle. Models of the dynamics of Bovine Babesiosis transmitted by the cattle tick that include these factors are formulated as systems of ordinary differential equations. Basic reproduction numbers are calculated, and it is proved that if these numbers are below the threshold value of one, then Bovine Babesiosis dies out. However, above the threshold number of one, the disease may approach an endemic state. In this case, control measures are suggested by determining target reproduction numbers. The percentage of a particular population (for example, the adult bovine population) needed to be controlled to eradicate the disease is evaluated numerically using Columbia data from the literature.

  5. Measles & rubella outbreaks in Maharashtra State, India.

    Science.gov (United States)

    Vaidya, Sunil R; Kamble, Madhukar B; Chowdhury, Deepika T; Kumbhar, Neelakshi S

    2016-02-01

    Under the outbreak-based measles surveillance in Maharashtra State the National Institute of Virology at Pune receives 3-5 serum samples from each outbreak and samples from the local hospitals in Pune for laboratory diagnosis. This report describes one year data on the measles and rubella serology, virus isolation and genotyping. Maharashtra State Health Agencies investigated 98 suspected outbreaks between January-December 2013 in the 20 districts. Altogether, 491 serum samples were received from 20 districts and 126 suspected cases from local hospitals. Samples were tested for the measles and rubella IgM antibodies by commercial enzyme immunoassay (EIA). To understand the diagnostic utility, a subset of serum samples (n=53) was tested by measles focus reduction neutralization test (FRNT). Further, 37 throat swabs and 32 urine specimens were tested by measles reverse transcription (RT)-PCR and positive products were sequenced. Virus isolation was performed in Vero hSLAM cells. Of the 98 suspected measles outbreaks, 61 were confirmed as measles, 12 as rubella and 21 confirmed as the mixed outbreaks. Four outbreaks remained unconfirmed. Of the 126 cases from the local hospitals, 91 were confirmed for measles and three for rubella. Overall, 93.6 per cent (383/409) confirmed measles cases were in the age group of 0-15 yr. Measles virus was detected in 18 of 38 specimens obtained from the suspected cases. Sequencing of PCR products revealed circulation of D4 (n=9) and D8 (n=9) strains. Four measles viruses (three D4 & one D8) were isolated. Altogether, 94 measles and rubella outbreaks were confirmed in 2013 in the State of Maharasthra indicating the necessity to increase measles vaccine coverage in the State.

  6. Updating of the bovine neosporosis

    Directory of Open Access Journals (Sweden)

    Alexander Martínez Contreras

    2012-06-01

    Full Text Available In the fields of Medicine and bovine production, there is a wide variety of diseases affecting reproduction, in relation to the number of live births, the interval between births and open days, among others. Some of these diseases produce abortions and embryonic death, which explain the alteration of reproductive parameters. Many of these diseases have an infectious origin, such as parasites, bacteria, viruses and fungi, which are transmitted among animals. Besides, some of them have zoonotic features that generate problems to human health. Among these agents, the Neospora caninum, protozoan stands out. Its life cycle is fulfilled in several species of animals like the dog and the coyote. These two act as its definitive hosts and the cattle as its intermediary host. The Neospora caninum causes in the infected animals, reproductive disorders, clinical manifestations and decreased production which affects productivity of small, medium and large producers. Because of this, diagnostic techniques that allow understanding the epidemiological behavior of this disease have been developed. However in spite of being a major agent in the bovine reproductive health, few studies have been undertaken to determine the prevalence of this agent around the world. Therefore, the objective of this review was to collect updated information on the behavior of this parasite, targeting its epidemiology, its symptoms, its impact on production and the methods of its control and prevention.

  7. Bovine papillomavirus isolation by ultracentrifugation.

    Science.gov (United States)

    Araldi, R P; Giovanni, D N S; Melo, T C; Diniz, N; Mazzuchelli-de-Souza, J; Sant'Ana, T A; Carvalho, R F; Beçak, W; Stocco, R C

    2014-11-01

    The bovine papillomavirus (BPV) is the etiological agent of bovine papillomatosis, which causes significant economic losses to livestock, characterized by the presence of papillomas that regress spontaneously or persist and progress to malignancy. Currently, there are 13 types of BPVs described in the literature as well as 32 putative new types. This study aimed to isolate viral particles of BPV from skin papillomas, using a novel viral isolation method. The virus types were previously identified with new primers designed. 77 cutaneous papilloma samples of 27 animals, Simmental breed, were surgically removed. The DNA was extracted and subjected to PCR using Delta-Epsilon and Xi primers. The bands were purified and sequenced. The sequences were analyzed using software and compared to the GenBank database, by BLAST tool. The viral typing showed a prevalence of BPV-2 in 81.81% of samples. It was also detected the presence of the putative new virus type BR/UEL2 in one sample. Virus isolation was performed by ultracentrifugation in a single density of cesium chloride. The method of virus isolation is less laborious than those previously described, allowing the isolation of complete virus particles of BPV-2. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Comparative analysis of viral gene expression programs during poxvirus infection: a transcriptional map of the vaccinia and monkeypox genomes.

    Directory of Open Access Journals (Sweden)

    Kathleen H Rubins

    2008-07-01

    Full Text Available Poxviruses engage in a complex and intricate dialogue with host cells as part of their strategy for replication. However, relatively little molecular detail is available with which to understand the mechanisms behind this dialogue.We designed a specialized microarray that contains probes specific to all predicted ORFs in the Monkeypox Zaire (MPXV and Vaccinia Western Reserve (VACV genomes, as well as >18,000 human genes, and used this tool to characterize MPXV and VACV gene expression responses in vitro during the course of primary infection of human monocytes, primary human fibroblasts and HeLa cells. The two viral transcriptomes show distinct features of temporal regulation and species-specific gene expression, and provide an early foundation for understanding global gene expression responses during poxvirus infection.The results provide a temporal map of the transcriptome of each virus during infection, enabling us to compare viral gene expression across species, and classify expression patterns of previously uncharacterized ORFs.

  9. Protective properties of vaccinia virus-based vaccines: skin scarification promotes a nonspecific immune response that protects against orthopoxvirus disease.

    Science.gov (United States)

    Rice, Amanda D; Adams, Mathew M; Lindsey, Scott F; Swetnam, Daniele M; Manning, Brandi R; Smith, Andrew J; Burrage, Andrew M; Wallace, Greg; MacNeill, Amy L; Moyer, Richard W

    2014-07-01

    The process of vaccination introduced by Jenner generated immunity against smallpox and ultimately led to the eradication of the disease. Procedurally, in modern times, the virus is introduced into patients via a process called scarification, performed with a bifurcated needle containing a small amount of virus. What was unappreciated was the role that scarification itself plays in generating protective immunity. In rabbits, protection from lethal disease is induced by intradermal injection of vaccinia virus, whereas a protective response occurs within the first 2 min after scarification with or without virus, suggesting that the scarification process itself is a major contributor to immunoprotection. importance: These results show the importance of local nonspecific immunity in controlling poxvirus infections and indicate that the process of scarification should be critically considered during the development of vaccination protocols for other infectious agents. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. Vaccinia viruses isolated from skin infection in horses produced cutaneous and systemic disease in experimentally infected rabbits.

    Science.gov (United States)

    Cargnelutti, Juliana Felipetto; Schmidt, Candice; Masuda, Eduardo Kenji; Nogueira, Paula Rochelle Kurrle; Weiblen, Rudi; Flores, Eduardo Furtado

    2012-10-01

    The susceptibility of rabbits to two isolates of Vaccinia virus (VACV) recovered from cutaneous disease in horses in Southern Brazil was investigated. Rabbits were inoculated in the ear skin with both VACV isolates, either in single or mixed infection. All inoculated animals presented local skin lesions characterized by hyperaemia, papules, vesicles, pustules and ulcers. Infectious virus was detected in the lungs and intestine of rabbits that died during acute disease. Histological examination of the skin revealed changes characteristic of those associated with members of the genus Orthopoxvirus. These results demonstrate that rabbits develop skin disease accompanied by systemic signs upon intradermal inoculation of these two equine VACV isolates, either alone or in combination, opening the way for using rabbits to study selected aspects of the biology and pathogenesis of VACV infection. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Myristoylation increases the CD8+T-cell response to a GFP prototype antigen delivered by modified vaccinia virus Ankara.

    Science.gov (United States)

    Marr, Lisa; Lülf, Anna-Theresa; Freudenstein, Astrid; Sutter, Gerd; Volz, Asisa

    2016-04-01

    Activation of CD8(+)T-cells is an essential part of immune responses elicited by recombinant modified vaccinia virus Ankara (MVA). Strategies to enhance T-cell responses to antigens may be particularly necessary for broadly protective immunization against influenza A virus infections or for candidate vaccines targeting chronic infections and cancer. Here, we tested recombinant MVAs that targeted a model antigen, GFP, to different localizations in infected cells. In vitro characterization demonstrated that GFP accumulated in the nucleus (MVA-nls-GFP), associated with cellular membranes (MVA-myr-GFP) or was equally distributed throughout the cell (MVA-GFP). On vaccination, we found significantly higher levels of GFP-specific CD8(+)T-cells in MVA-myr-GFP-vaccinated BALB/c mice than in those immunized with MVA-GFP or MVA-nls-GFP. Thus, myristoyl modification may be a useful strategy to enhance CD8(+)T-cell responses to MVA-delivered target antigens.

  12. Separate worlds set to collide: smallpox, vaccinia virus vaccination, and human immunodeficiency virus and acquired immunodeficiency syndrome.

    Science.gov (United States)

    Amorosa, Valerianna K; Isaacs, Stuart N

    2003-08-01

    Concerns about the possible release of smallpox by bioterrorists has led to policies that recommend smallpox vaccination of some health care providers, and, in the near future, the vaccine may become available to the general population on a voluntary basis. Both smallpox virus (variola virus) and the smallpox vaccine (vaccinia virus) will have a significant impact on people infected with human immunodeficiency virus (HIV). Given that populations with acquired immunodeficiency syndrome and populations with immunosuppressed conditions due to solid organ and bone marrow transplantation were not present in the days when smallpox was prevalent, we will speculate on how smallpox might present in immunodeficient patients, and we will review the adverse events expected from the smallpox vaccine in hosts with HIV infection.

  13. Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA)

    DEFF Research Database (Denmark)

    Cottingham, Matthew G; Andersen, Rikke F; Spencer, Alexandra J

    2008-01-01

    -length, rescuable clones were obtained, which had indistinguishable immunogenicity in mice. One clone was shotgun sequenced and found to be identical to the parent. We employed GalK recombination-mediated genetic engineering (recombineering) of MVA-BAC to delete five selected viral genes. Deletion of C12L, A44L, A...... to infectious virus using a Fowlpox virus helper to supply transcriptional machinery. We apply here a similar approach to the attenuated strain Modified Vaccinia virus Ankara (MVA), now widely used as a safe non-replicating recombinant vaccine vector in mammals, including humans. Four apparently full......-2006). In addition, we found a higher frequency of triple-positive IFN-gamma, TNF-alpha and IL-2 secreting E3-specific CD8+ T-cells 8 weeks after vaccination with MVA lacking B15R. Furthermore, a recombinant vaccine capable of inducing CD8(+) T cells against an epitope from Plasmodium berghei was created using Gal...

  14. Both NK cell-intrinsic and -extrinsic STAT1 signaling are required for NK cell response against vaccinia virus.

    Science.gov (United States)

    Fortin, Carl; Huang, Xiaopei; Yang, Yiping

    2013-07-01

    NK cells play an important role in innate immune control of the infection with vaccinia virus (VV). However, it remains incompletely defined how the activation of NK cells in response to VV is regulated. In this study, we showed that STAT1 was critical for NK cell activation upon VV infection and the subsequent clearance of VV infection in vivo. We further demonstrated that STAT1 signaling in both NK and accessory cells such as dendritic cells was required for efficient NK cell activation upon VV infection. Mechanistically, STAT1 signaling in dendritic cells promoted the expression of NKG2D ligands, which is required for NK cell activation via the NKG2D pathway. Taken together, our data suggest that STAT1 mediates anti-VV effect by promoting NK cell activation through both NK-intrinsic and extrinsic mechanisms and may provide insights into the design of effective NK cell-based therapies for viral infections.

  15. Evaluation of radiation effects against C6 glioma in combination with vaccinia virus-p53 gene therapy

    Science.gov (United States)

    Gridley, D. S.; Andres, M. L.; Li, J.; Timiryasova, T.; Chen, B.; Fodor, I.; Nelson, G. A. (Principal Investigator)

    1998-01-01

    The primary objective of this study was to evaluate the antitumor effects of recombinant vaccinia virus-p53 (rVV-p53) in combination with radiation therapy against the C6 rat glioma, a p53 deficient tumor that is relatively radioresistant. VV-LIVP, the parental virus (Lister strain), was used as a control. Localized treatment of subcutaneous C6 tumors in athymic mice with either rVV-p53 or VV-LIVP together with tumor irradiation resulted in low tumor incidence and significantly slower tumor progression compared to the agents given as single modalities. Assays of blood and spleen indicated that immune system activation may account, at least partly, for the enhance tumor inhibition seen with combined treatment. No overt signs of treatment-related toxicity were noted.

  16. Ribonuclease activity of vaccinia DNA topoisomerase IB: kinetic and high-throughput inhibition studies using a robust continuous fluorescence assay.

    Science.gov (United States)

    Kwon, Keehwan; Nagarajan, Rajesh; Stivers, James T

    2004-11-30

    Vaccinia type I DNA topoisomerase exhibits a strong site-specific ribonuclease activity when provided a DNA substrate that contains a single uridine ribonucleotide within a duplex DNA containing the sequence 5' CCCTU 3'. The reaction involves two steps: attack of the active site tyrosine nucleophile of topo I at the 3' phosphodiester of the uridine nucleotide to generate a covalent enzyme-DNA adduct, followed by nucleophilic attack of the uridine 2'-hydroxyl to release the covalently tethered enzyme. Here we report the first continuous spectroscopic assay for topoisomerase that allows monitoring of the ribonuclease reaction under multiple-turnover conditions. The assay is especially robust for high-throughput screening applications because sensitive molecular beacon technology is utilized, and the topoisomerase is released during the reaction to allow turnover of multiple substrate molecules by a single molecule of enzyme. Direct computer simulation of the fluorescence time courses was used to obtain the rate constants for substrate binding and release, covalent complex formation, and formation of the 2',3'-cyclic phosphodiester product of the ribonuclease reaction. The assay allowed rapid screening of a 500 member chemical library from which several new inhibitors of topo I were identified with IC(50) values in the range of 2-100 microM. Three of the most potent hits from the high-throughput screening were also found to inhibit plasmid supercoil relaxation by the enzyme, establishing the utility of the assay in identifying inhibitors of the biologically relevant DNA relaxation reaction. One of the most potent inhibitors of the vaccinia enzyme, 3-benzo[1,3]dioxol-5-yl-2-oxoproprionic acid, did not inhibit the closely related human enzyme. The inhibitory mechanism of this compound is unique and involves a step required for recycling the enzyme for steady-state turnover.

  17. Unpolarized release of vaccinia virus and HIV antigen by colchicine treatment enhances intranasal HIV antigen expression and mucosal humoral responses.

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    Full Text Available The induction of a strong mucosal immune response is essential to building successful HIV vaccines. Highly attenuated recombinant HIV vaccinia virus can be administered mucosally, but even high doses of immunization have been found unable to induce strong mucosal antibody responses. In order to solve this problem, we studied the interactions of recombinant HIV vaccinia virus Tiantan strain (rVTT-gagpol in mucosal epithelial cells (specifically Caco-2 cell layers and in BALB/c mice. We evaluated the impact of this virus on HIV antigen delivery and specific immune responses. The results demonstrated that rVTT-gagpol was able to infect Caco-2 cell layers and both the nasal and lung epithelia in BALB/c mice. The progeny viruses and expressed p24 were released mainly from apical surfaces. In BALB/c mice, the infection was limited to the respiratory system and was not observed in the blood. This showed that polarized distribution limited antigen delivery into the whole body and thus limited immune response. To see if this could be improved upon, we stimulated unpolarized budding of the virus and HIV antigens by treating both Caco-2 cells and BALB/c mice with colchicine. We found that, in BALB/c mice, the degree of infection and antigen expression in the epithelia went up. As a result, specific immune responses increased correspondingly. Together, these data suggest that polarized budding limits antigen delivery and immune responses, but unpolarized distribution can increase antigen expression and delivery and thus enhance specific immune responses. This conclusion can be used to optimize mucosal HIV vaccine strategies.

  18. HIV-1 vaccines based on replication-competent Tiantan vaccinia protected Chinese rhesus macaques from simian HIV infection.

    Science.gov (United States)

    Liu, Qiang; Li, Yue; Luo, Zhenwu; Yang, Guibo; Liu, Yong; Liu, Ying; Sun, Maosheng; Dai, Jiejie; Li, Qihan; Qin, Chuan; Shao, Yiming

    2015-03-27

    To assess the efficacy of HIV vaccines constructed from replication-competent Tiantan vaccinia virus (rTV) alone or combined with DNA in protecting Chinese rhesus macaques from homologous Simian/Human Immunodeficiency Virus (SHIV)-CN97001 challenge. The nef, gag, pol, and gp140 genes from strain CRF07_BC HIV-1 CN54 were selected to construct an HIV vaccine using the rTV or rTV/DNA vaccine. After vaccination, the vaccine and control groups were intravenously challenged with SHIV-CN97001 (32 MID50). HIV-specific antibodies and neutralizing antibodies, gp70 V1V2 binding antibodies, and cytotoxic T-lymphocyte responses were measured prospectively after vaccination with an ELISA, a virus infectivity assay in TZM-bl cells, and ELISPOT assays, respectively. Viral RNA was quantified after challenge with real-time reverse transcriptase-PCR (RT-PCR), and protection efficacy was determined with an analysis of CD8 lymphocyte depletion in vivo. Both rTV and DNA/rTV vaccine groups developed strong cellular and humoral responses against HIV-1 CN54 antigens, including Gag and Env, and also developed significant and persistent anti-Env antibodies and neutralizing antibodies after immunization. Both the rTV and DNA/rTV groups were significantly protected against SHIV-CN97001 or displayed lower viremia than the controls. After CD8 lymphocyte depletion, no viremia was detectable in the vaccinated monkeys, but rebounded rapidly in the control animals. Protection against infection correlated with vaccine-elicited neutralizing antibodies specific for homologous HIV-1 viruses. An rTV-based HIV-1 vaccine, with or without a DNA primer, provided protection from SHIV challenge in a macaque model. Replication-competent Tiantan vaccinia is a promising vector and should enable advances in HIV-1 vaccine development.

  19. Expanding the repertoire of Modified Vaccinia Ankara-based vaccine vectors via genetic complementation strategies.

    Directory of Open Access Journals (Sweden)

    David A Garber

    Full Text Available Modified Vaccinia virus Ankara (MVA is a safe, highly attenuated orthopoxvirus that is being developed as a recombinant vaccine vector for immunization against a number of infectious diseases and cancers. However, the expression by MVA vectors of large numbers of poxvirus antigens, which display immunodominance over vectored antigens-of-interest for the priming of T cell responses, and the induction of vector-neutralizing antibodies, which curtail the efficacy of subsequent booster immunizations, remain as significant impediments to the overall utility of such vaccines. Thus, genetic approaches that enable the derivation of MVA vectors that are antigenically less complex may allow for rational improvement of MVA-based vaccines.We have developed a genetic complementation system that enables the deletion of essential viral genes from the MVA genome, thereby allowing us to generate MVA vaccine vectors that are antigenically less complex. Using this system, we deleted the essential uracil-DNA-glycosylase (udg gene from MVA and propagated this otherwise replication-defective variant on a complementing cell line that constitutively expresses the poxvirus udg gene and that was derived from a newly identified continuous cell line that is permissive for growth of wild type MVA. The resulting virus, MVADeltaudg, does not replicate its DNA genome or express late viral gene products during infection of non-complementing cells in culture. As proof-of-concept for immunological 'focusing', we demonstrate that immunization of mice with MVADeltaudg elicits CD8+ T cell responses that are directed against a restricted repertoire of vector antigens, as compared to immunization with parental MVA. Immunization of rhesus macaques with MVADeltaudg-gag, a udg(- recombinant virus that expresses an HIV subtype-B consensus gag transgene, elicited significantly higher frequencies of Gag-specific CD8 and CD4 T cells following both primary (2-4-fold and booster (2-fold

  20. 9 CFR 113.309 - Bovine Parainfluenza3 Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Bovine Parainfluenza3 Vaccine. 113.309... Virus Vaccines § 113.309 Bovine Parainfluenza3 Vaccine. Bovine Parainfluenza3 Vaccine shall be produced... virus dose from the lot of Master Seed Virus shall be established as follows: (1) Twenty-five bovine...

  1. 21 CFR 184.1034 - Catalase (bovine liver).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase (bovine liver). 184.1034 Section 184.1034... Listing of Specific Substances Affirmed as GRAS § 184.1034 Catalase (bovine liver). (a) Catalase (bovine liver) (CAS Reg. No. 81457-95-6) is an enzyme preparation obtained from extracts of bovine liver. It is...

  2. Genetic surveillance of endemic bovine Salmonella Infantis infection

    Directory of Open Access Journals (Sweden)

    Pelkonen Sinikka

    2007-05-01

    Full Text Available Abstract Background Salmonella serovar Infantis is endemic in Finnish food-producing animals since the 1970s. The purpose of this study was to describe the molecular epidemiology of the infection in cattle during 1985–2005, to follow the persistence of the feed-related outbreak strain from 1995 in the cattle population, and to analyse the stability of XbaI-banding patterns in individual herds during long-lasting infections. Methods Salmonella Infantis isolates from 478 cattle herds (n = 588, covering 73% of the subclinically or clinically infected herds, were typed by pulsed-field gel electrophoresis (PFGE using XbaI. DNA fragments larger than 125 kb were counted in PFGE types because of high plasmid background. Ribotyping and IS200-typing with BanI-digested DNA were done on 57 selected isolates. Results The isolates associated with the infection consisted of 51 PFGE types with genetic similarity (F value between 0.58 and 0.95. From 1985 to 2003, the major type appeared on 68% of the farms. The three most common types, with F values of 0.90 to 0.95, accounted for 80% of the isolates. Only 17% of the isolates had F values below 0.80, and 1% below 0.70. Ribotyping and IS200-typing classified 89% of the analysed isolates into the major ribotype and IS200 type combination, and the rest fell into closely related types. Analysis of successive isolates from 142 herds revealed changes in XbaI-banding patterns in 21% of the herds with two analysed isolates and in 38% of the herds from which three or more isolates were analysed. The feed-related S. Infantis genotype from the 1995 outbreak had disappeared by 1999, at the time when the incidence of bovine salmonella, and S. Infantis in particular, strongly decreased. Conclusion The study showed how genetic surveillance, as part of salmonella control, provides tools to follow the persistence of particular infections, and to assess the efficacy of control measures. Testing of several isolates from a herd in

  3. Legionnaires’ Disease Outbreak in Murcia, Spain

    Science.gov (United States)

    Navarro, Carmen; Fenoll, Daniel; García, José; González-Diego, Paulino; Jiménez-Buñuales, Teresa; Rodriguez, Miguel; Lopez, Rosa; Pacheco, Francisco; Ruiz, Joaquín; Segovia, Manuel; Baladrón, Beatriz; Pelaz, Carmen

    2003-01-01

    An explosive outbreak of Legionnaires’ disease occurred in Murcia, Spain, in July 2001. More than 800 suspected cases were reported; 449 of these cases were confirmed, which made this the world’s largest outbreak of the disease reported to date. Dates of onset for confirmed cases ranged from June 26 to July 19 , with a case-fatality rate of 1%. The epidemic curve and geographic pattern from the 600 completed epidemiologic questionnaires indicated an outdoor point-source exposure in the northern part of the city. A case-control study matching 85 patients living outside the city of Murcia with two controls each was undertaken to identify the outbreak source; the epidemiologic investigation implicated the cooling towers at a city hospital. An environmental isolate from these towers with an identical molecular pattern as the clinical isolates was subsequently identified and supported that epidemiologic conclusion. PMID:12967487

  4. Pneumonic Plague Outbreak, Northern Madagascar, 2011

    Science.gov (United States)

    Richard, Vincent; Herindrainy, Perlinot; Soanandrasana, Rahelinirina; Ratsitoharina, Maherisoa; Rakotomanana, Fanjasoa; Andrianalimanana, Samuel; Scholz, Holger C.; Rajerison, Minoarisoa

    2015-01-01

    Yersinia pestis, the causative agent of plague, is endemic to Madagascar, particularly to the central highlands. Although plague has not been previously reported in northern Madagascar, an outbreak of pneumonic plague occurred in this remote area in 2011. Over a 27-day period, 17 suspected, 2 presumptive, and 3 confirmed human cases were identified, and all 15 untreated 20 patients died. Molecular typing of Y. pestis isolated from 2 survivors and 5 Rattus rattus rat samples identified the Madagascar-specific 1.ORI3-k single-nucleotide polymorphism genotype and 4 clustered regularly interspaced short palindromic repeat patterns. This outbreak had a case-fatality rate of 100% for nontreated patients. The Y. pestis 1.ORI3-k single-nucleotide polymorphism genotype might cause larger epidemics. Multidrug-resistant strains and persistence of the pathogen in natural foci near human settlements pose severe risks to populations in plague-endemic regions and require outbreak response strategies. PMID:25530466

  5. Ethical issues in occupational disease outbreak investigations.

    Science.gov (United States)

    Cone, Jim

    2002-01-01

    Occupational disease outbreak investigations usually involve rapid, small-scale analysis of reports of diseases with a suspected occupational etiology, usually in a single workplace or among workers of a single employer. Ethical issues are similar to those encountered in epidemiologic studies in the workplace, with the added constraints of the need to respond rapidly, limited numbers of subjects, low statistical power, and the mandate to issue results even when the ability to generalize them is limited. Informed consent, voluntary participation, fairness, and confidentiality are major ethical issues in workplace outbreak investigations. The obligation to publicly report a workplace hazard when a non-disclosure statement has been signed can also present an ethical dilemma for outbreak investigators.

  6. An Outbreak of Foodborne Botulism in Ontario

    Directory of Open Access Journals (Sweden)

    Mona R Loutfy

    2003-01-01

    Full Text Available Botulism is a rare paralytic illness resulting from a potent neurotoxin produced by Clostridium botulinum. Botulism in Canada is predominately due to C botulinum type E and affects mainly the First Nations and Inuit populations. The most recent outbreak of botulism in Ontario was in Ottawa in 1991 and was caused by C botulinum type A. We report an outbreak of foodborne type B botulism in Ontario, which implicated home-canned tomatoes. The outbreak was characterized by mild symptoms in two cases and moderately severe illness in one case. The investigation shows the importance of considering the diagnosis of botulism in patients presenting with cranial nerve and autonomic dysfunction, especially when combined with gastrointestinal complaints; it also highlights the importance of proper home canning technique.

  7. Pneumonic plague outbreak, Northern Madagascar, 2011.

    Science.gov (United States)

    Richard, Vincent; Riehm, Julia M; Herindrainy, Perlinot; Soanandrasana, Rahelinirina; Ratsitoharina, Maherisoa; Rakotomanana, Fanjasoa; Andrianalimanana, Samuel; Scholz, Holger C; Rajerison, Minoarisoa

    2015-01-01

    Yersinia pestis, the causative agent of plague, is endemic to Madagascar, particularly to the central highlands. Although plague has not been previously reported in northern Madagascar, an outbreak of pneumonic plague occurred in this remote area in 2011. Over a 27-day period, 17 suspected, 2 presumptive, and 3 confirmed human cases were identified, and all 15 untreated 20 patients died. Molecular typing of Y. pestis isolated from 2 survivors and 5 Rattus rattus rat samples identified the Madagascar-specific 1.ORI3-k single-nucleotide polymorphism genotype and 4 clustered regularly interspaced short palindromic repeat patterns. This outbreak had a case-fatality rate of 100% for nontreated patients. The Y. pestis 1.ORI3-k single-nucleotide polymorphism genotype might cause larger epidemics. Multidrug-resistant strains and persistence of the pathogen in natural foci near human settlements pose severe risks to populations in plague-endemic regions and require outbreak response strategies.

  8. Nosocomial outbreak of cryptosporidiosis in AIDS patients

    DEFF Research Database (Denmark)

    Ravn, Pernille; Lundgren, Jens Dilling; Kjaeldgaard, P

    1991-01-01

    MEASURES--Cryptosporidia in stool samples, clinical symptoms, CD4 cell count, HIV antigen concentration, chemotherapeutic treatment. RESULTS--The source of the outbreak was identified as ice from an ice machine in the ward, contaminated by an incontinent, psychotic patient with cryptosporidiosis picking......OBJECTIVE--To describe a nosocomial outbreak of cryptosporidiosis during four months after June 1989. SETTING--A department of infectious diseases in Copenhagen, seeing about half the patients with AIDS in Denmark. SUBJECTS--73 HIV antibody negative subjects and 60 antibody positive subjects...... admitted as inpatients during the transmission period of the outbreak (20 June-14 August), of whom 18 (17 with AIDS, one with AIDS related complex), developed cryptosporidiosis. Two further HIV negative subjects (one departmental secretary, one visiting relative) developed cryptosporidiosis. MAIN OUTCOME...

  9. Simple visit behavior unifies complex Zika outbreaks

    Directory of Open Access Journals (Sweden)

    P.D. Manrique

    2017-12-01

    Full Text Available New outbreaks of Zika in the U.S. are imminent. Human nature dictates that many individuals will continue to revisit affected ‘Ground Zero’ patches, whether out of choice, work or family reasons − yet this feature is missing from traditional epidemiological analyses. Here we show that this missing visit-revisit mechanism is by itself capable of explaining quantitatively the 2016 human Zika outbreaks in all three Ground Zero patches. Our findings reveal counterintuitive ways in which this human flow can be managed to tailor any future outbreak’s duration, severity and time-to-peak. Effective public health planning can leverage these results to impact the evolution of future outbreaks via soft control of the overall human flow, as well as to suggest best-practice visitation behavior for local residents.

  10. Evaluation of developmental changes in bovine in vitro produced embryos following exposure to bovine Herpesvirus type 5

    Directory of Open Access Journals (Sweden)

    Brenner Mariana PC

    2012-07-01

    Full Text Available Abstract Background Bovine Herpesvirus type-5 (BoHV-5 is a neurovirulent α-Herpesvirus which is potentially pathogenic for cows and suspected to be associated with reproductive disorders. Interestingly, natural transmission of BoHV-5 by contaminated semen was recently described in Australia. Additionally, BoHV-5 was also isolated from the semen of a healthy bull in the same country and incriminated in a natural outbreak of reproductive disease after artificial insemination. In contrast with BoHV-1, experimental exposure of in vitro produced bovine embryos to BoHV-5 does not affect embryo viability and seems to inhibit some pathways of apoptosis. However, the mechanisms responsible for these phenomena are poorly understood. In this study, we examined mitochondrial activity, antioxidant protection, stress response and developmental rates of in vitro produced bovine embryos that were exposed and unexposed to BoHV-5. Methods For this purpose, bovine embryos produced in vitro were assayed for cell markers after experimental infection of oocytes (n = 30; five repetitions, in vitro fertilization and development. The indirect immunofluorescence was employed to measure the expression of superoxide dismutase 1 (SOD1, anti-oxidant like protein 1 (AOP-1, heat shock protein 70.1 (Hsp 70.1 and also viral antigens in embryos derived from BoHV-5 exposed and unexposed oocytes. The determination of gene transcripts of mitochondrial activity (SOD1, antioxidant protection (AOP-1 and stress response (Hsp70.1 were evaluated using the reverse transcriptase polymerase chain reaction (RT-PCR. MitoTracker Green FM, JC-1 and Hoechst 33342-staining were used to evaluate mitochondrial distribution, segregation patterns and embryos morphology. The intensity of labeling was graded semi-quantitatively and embryos considered intensively marked were used for statistical analysis. Results The quality of the produced embryos was not affected by exposure to BoHV-5. Of the 357

  11. Histopathological and Immunohistochemical Studies on Bovine Ephemeral Fever in Cattle

    Directory of Open Access Journals (Sweden)

    Aziza Amin

    2016-07-01

    Full Text Available Bovine ephemeral fever (BEF is an arthropod-borne viral disease of cattle caused by a single stranded RNA virus that belongs to the rhabdovirus group. The outbreak was diagnosed as BEF on the bases of clinical signs and pathological lesions. In the present study, out of two hundred and fifty cows, fourteen cows are died from BEF by mortality ratio 5.6%. The diseased cows showed viraemia, inappetance, depression, salivation, lacrimation, nasal discharge, lameness, and recumbency followed by death. Formalin-fixed paraffin-embedded samples from naturally infected cows with BEFV were grossly and microscopically evaluated and tested using immunohistochemistry. The main gross findings include grayish-white streaks in the skeletal muscles, congestion and mottling of the lung surface with darkness of the lobar septa, congestion of the tracheal mucosae with the presence of mucous exudate in their lumen. The liver and kidneys were congested with edematous and enlarged lymph nodes. The microscopical examination revealed various pathological changes in different organs. Diffuse hemorrhage and pulmonary emphysema with alveolar atelectasis and catarrhal bronchiolitis were observed in the lung. The skeletal muscle showed severe hyaline degeneration and myomalacia with inter-muscular hemorrhage. Edema with marked lymphoid depletion was observed in the pre-scapular and pre-femoral lymph nodes. Necrotic changes were noticed in the renal and intestinal tissues. Diagnosis was confirmed by detecting viral antigen in the spleen, lung, muscle, kidney, heart and lymph nodes with most of the antigen appearing within macrophages and pericytes using immunohistochemistry.

  12. Antivirals and the control of influenza outbreaks.

    Science.gov (United States)

    Hota, Susy; McGeer, Allison

    2007-11-15

    During annual influenza epidemics, outbreaks of influenza in closed institutions are common. Among healthy children or young adults, such outbreaks are uncommonly associated with serious morbidity or mortality; however, in hospitals and nursing homes, attack rates as high as 60% and case-fatality rates as high as 50% have been reported. Annual influenza vaccination of both patients or residents and hospital and nursing home staff has had a substantial impact on mortality and has reduced the number of outbreaks. Nonpharmacologic interventions (e.g., handwashing and contact isolation of case patients) may reduce the spread of influenza, although evidence for their efficacy is lacking. Nonetheless, long-term care facilities for the elderly population with high vaccination rates and better-than-average infection-control programs have a 25%-50% chance of experiencing an influenza outbreak each year, with an expected resident attack rate of 35%-40%. Thus, antiviral drugs have been increasingly used to mitigate the impact of influenza outbreaks. There are 2 classes of antiviral drugs that are active against influenza: adamantanes and neuraminidase inhibitors. Drugs of the 2 classes appear to be equally effective for the treatment and prophylaxis of susceptible influenza A virus strains. However, adamantanes are not active against influenza B virus, and an increasing proportion of influenza A isolates are resistant to adamantanes. Adamantanes are associated with higher rates of adverse events than are neuraminidase inhibitors. There is substantial evidence that antiviral prophylaxis is effective in terminating outbreaks of seasonal influenza in closed institutions. If stockpiles are adequate, antiviral drugs are likely to be even more important in mitigating the impact of influenza transmission in health care institutions during the next influenza pandemic.

  13. Regression of Human Prostate Tumors and Metastases in Nude Mice following Treatment with the Recombinant Oncolytic Vaccinia Virus GLV-1h68

    Directory of Open Access Journals (Sweden)

    Ivaylo Gentschev

    2010-01-01

    Full Text Available Virotherapy using oncolytic vaccinia virus strains is one of the most promising new strategies for cancer therapy. In the current study, we analyzed the therapeutic efficacy of the oncolytic vaccinia virus GLV-1h68 against two human prostate cancer cell lines DU-145 and PC-3 in cell culture and in tumor xenograft models. By viral proliferation assays and cell survival tests, we demonstrated that GLV-1h68 was able to infect, replicate in, and lyse these prostate cancer cells in culture. In DU-145 and PC-3 tumor xenograft models, a single intravenous injection with GLV-1h68 resulted in a significant reduction of primary tumor size. In addition, the GLV-1h68-infection led to strong inflammatory and oncolytic effects resulting in drastic reduction of regional lymph nodes with PC-3 metastases. Our data documented that the GLV-1h68 virus has a great potential for treatment of human prostate carcinoma.

  14. Bovine Mastitis: Frontiers in Immunogenetics

    Directory of Open Access Journals (Sweden)

    Kathleen eThompson-Crispi

    2014-10-01

    Full Text Available Mastitis is one of the most prevalent and costly diseases in the dairy industry with losses attributable to reduced milk production, discarded milk, early culling, veterinary services, and labor costs. Typically, mastitis is an inflammation of the mammary gland most often, but not limited to, bacterial infection, and is characterized by the movement of leukocytes and serum proteins from the blood to the site of infection. It contributes to compromised milk quality and the potential spread of antimicrobial resistance if antibiotic treatment is not astutely applied. Despite the implementation of management practises and genetic selection approaches, bovine mastitis control continues to be inadequate. However, some novel genetic strategies have recently been demonstrated to reduce mastitis incidence by taking advantage of a cow’s natural ability to make appropriate immune responses against invading pathogens. Specifically, dairy cattle with enhanced and balanced immune responses have a lower occurrence of disease, including mastitis, and they can be identified and selected for using the High Immune Response (HIR technology. Enhanced immune responsiveness is also associated with improved response to vaccination, increased milk and colostrum quality. Since immunity is an important fitness trait, beneficial associations with longevity and reproduction are also often noted. This review highlights the genetic regulation of the bovine immune system and its vital contributions to disease resistance. Genetic selection approaches currently used in the dairy industry to reduce the incidence of disease are reviewed, including the HIR technology, genomics to improve disease resistance or immune response, as well as the Immunity+TM sire line. Improving the overall immune responsiveness of cattle is expected to provide superior disease resistance, increasing animal welfare and food quality while maintaining favourable production levels to feed a growing

  15. Bovine Mastitis: Frontiers in Immunogenetics

    Science.gov (United States)

    Thompson-Crispi, Kathleen; Atalla, Heba; Miglior, Filippo; Mallard, Bonnie A.

    2014-01-01

    Mastitis is one of the most prevalent and costly diseases in the dairy industry with losses attributable to reduced milk production, discarded milk, early culling, veterinary services, and labor costs. Typically, mastitis is an inflammation of the mammary gland most often, but not limited to, bacterial infection, and is characterized by the movement of leukocytes and serum proteins from the blood to the site of infection. It contributes to compromised milk quality and the potential spread of antimicrobial resistance if antibiotic treatment is not astutely applied. Despite the implementation of management practises and genetic selection approaches, bovine mastitis control continues to be inadequate. However, some novel genetic strategies have recently been demonstrated to reduce mastitis incidence by taking advantage of a cow’s natural ability to make appropriate immune responses against invading pathogens. Specifically, dairy cattle with enhanced and balanced immune responses have a lower occurrence of disease, including mastitis, and they can be identified and selected for using the high immune response (HIR) technology. Enhanced immune responsiveness is also associated with improved response to vaccination, increased milk, and colostrum quality. Since immunity is an important fitness trait, beneficial associations with longevity and reproduction are also often noted. This review highlights the genetic regulation of the bovine immune system and its vital contributions to disease resistance. Genetic selection approaches currently used in the dairy industry to reduce the incidence of disease are reviewed, including the HIR technology, genomics to improve disease resistance or immune response, as well as the Immunity+™ sire line. Improving the overall immune responsiveness of cattle is expected to provide superior disease resistance, increasing animal welfare and food quality while maintaining favorable production levels to feed a growing population. PMID

  16. Salmonellosis outbreak due to chicken contact leading to a foodborne outbreak associated with infected delicatessen workers.

    Science.gov (United States)

    Hedican, Erin; Miller, Ben; Ziemer, Brian; LeMaster, Pam; Jawahir, Selina; Leano, Fe; Smith, Kirk

    2010-08-01

    Salmonella is the most common bacterial cause of foodborne outbreaks in the United States. Starting in June 2007, investigation of a cluster of Salmonella Montevideo cases with indistinguishable pulsed-field gel electrophoresis (PFGE) patterns resulted in the identification of an outbreak associated with contact with chickens purchased from a single hatchery. Nine Minnesota cases from May through August 2007 were part of this outbreak. Cases with the outbreak PFGE pattern of Salmonella Montevideo continued to occur in Minnesota after August, but none of these cases reported chicken contact. The majority of these cases resided in the same town in rural Minnesota. Routine interviews revealed that all cases from these counties purchased groceries from the same local grocery store, with two specifically reporting consuming items from the grocery store delicatessen in the week before illness. As a result, an investigation into the delicatessen was initiated. Illness histories and stool samples were collected from all delicatessen employees, and food and environmental samples were collected. None of the employees reported experiencing recent gastrointestinal symptoms, but the outbreak PFGE subtype of Salmonella Montevideo was identified from stool from two food workers. Food and environmental samples collected tested negative for Salmonella. One of the positive employees reported having chickens at home, but the animals did not test positive for Salmonella. The positive food workers were excluded from work until they had two consecutive negative stool cultures for Salmonella. There was no evidence of ongoing transmission thereafter. This was an outbreak of Salmonella Montevideo infections that began as an animal-contact-associated outbreak which subsequently resulted in a foodborne outbreak associated with infected food workers. These outbreaks illustrate the complex epidemiology of salmonellosis.

  17. How outbreaks can contribute to prevention of nosocomial infection: analysis of 1,022 outbreaks.

    Science.gov (United States)

    Gastmeier, Petra; Stamm-Balderjahn, Sabine; Hansen, Sonja; Nitzschke-Tiemann, Frauke; Zuschneid, Irina; Groneberg, Katrin; Rüden, Henning

    2005-04-01

    To describe the epidemiology of nosocomial outbreaks published in the scientific literature. Descriptive information was obtained from a sample of 1,022 published nosocomial outbreaks from 1966 to 2002. Published nosocomial outbreaks of the most important nosocomial pathogens were included in the database. A structured questionnaire was devised to extract information in a systematic manner on nosocomial outbreaks published in the literature. The following items were used: the reference, type of study (case reports or studies applying epidemiologic or fingerprinting methods), type of microorganism, setting, patients and personnel involved, type of infection, source of infection, mode of transmission, risk factors identified, and preventive measures applied. Bloodstream infection was the most frequently identified type of infection (37.0%), followed by gastrointestinal infection (28.5%) and pneumonia (22.9%). In 37% of the outbreaks, the authors were not able to identify the sources. The most frequent sources were patients (25.7%), followed by medical equipment or devices (11.9%), the environment (11.6%), and the staff (10.9%). The mode of transmission remained unclear in 28.3% of the outbreaks. Transmission was by contact in 45.3%, by invasive technique in 16.1%, and through the air in 15.0%. The percentage of outbreaks investigated by case-control studies or cohort studies over the years was small (21% and 9%, respectively, for the whole time period). Outbreak reports in the literature are a valuable resource and should be used for educational purposes as well as for preparing outbreak investigations.

  18. Protective effects of a Modified Vaccinia Ankara-based vaccine candidate against Crimean-Congo Haemorrhagic Fever virus require both cellular and humoral responses

    OpenAIRE

    Dowall, Stuart D.; Graham, Victoria A.; Emma Rayner; Laura Hunter; Robert Watson; Irene Taylor; Antony Rule; Carroll, Miles W.; Roger Hewson

    2016-01-01

    Crimean-Congo Haemorrhagic Fever (CCHF) is a severe tick-borne disease, endemic in many countries in Africa, the Middle East, Eastern Europe and Asia. There is no approved vaccine currently available against CCHF. The most promising candidate, which has previously been shown to confer protection in the small animal model, is a modified Vaccinia Ankara virus vector expressing the CCHF viral glycoprotein (MVA-GP). It has been shown that MVA-GP induces both humoral and cellular immunogenicity. I...

  19. A capripoxvirus detection PCR and antibody ELISA based on the major antigen P32, the homolog of the vaccinia virus H3L gene.

    Science.gov (United States)

    Heine, H G; Stevens, M P; Foord, A J; Boyle, D B

    1999-07-30

    Sheeppoxvirus (SPV), goatpoxvirus (GPV) and lumpy skin disease virus (LSDV) of cattle belong to the Capripoxvirus genus of the Poxviridae family and can cause significant economic losses in countries where they are endemic. Capripox diagnosis by classical virological methods dependent on live capripox virus is not suitable in countries such as Australia where the virus is exotic and live virus is not available. To develop diagnostic tests based on recombinant material, we cloned and sequenced a 3.7 kb viral DNA fragment of SPV that contained open reading frames homologous to the vaccinia virus J6R, H1L, H2R, H3L and H4L genes. A capripoxvirus specific PCR assay was developed that differentiated between SPV and LSDV on the basis of unique restriction sites in the corresponding PCR fragments. The vaccinia virus H3L homolog was identified as the capripoxvirus P32 antigen. The P32 proteins of SPV and LSDV were expressed in Escherichia coli as a fusion protein with a poly-histidine tag and affinity purified on metal binding resin. The full-length P32 protein contained a transmembrane region close to the carboxy terminus and was membrane associated but could be solubilised in detergent and used as trapping antigen in an antibody detection ELISA. The ELISA was specific for capripoxvirus as only sera from sheep infected with capripoxvirus but not orf or vaccinia virus reacted with the capripoxvirus P32 antigen.

  20. Vaccinia virus outperforms a panel of other poxviruses as a potent oncolytic agent for the control of head and neck squamous cell carcinoma cell lines.

    Science.gov (United States)

    Nichols, Anthony C; Yoo, John; Um, Sung; Mundi, Neil; Palma, David A; Fung, Kevin; Macneil, S Danielle; Koropatnick, James; Mymryk, Joe S; Barrett, John W

    2014-01-01

    Head and neck squamous cell carcinoma (HNSCC) is the fifth most common cancer worldwide. Existing therapies for advanced tumors have high failure rates and can have severe consequences in terms of pain, disfigurement, and poor speech and swallowing function. New treatment strategies are needed to improve outcomes for patients suffering with this disease and oncolytic viruses represent a promising approach. We infected six well-characterized HNSCC cell lines (Cal27, Detroit562, FaDu, SCC4, SCC15, SCC25), with increasing doses of a panel of poxviruses (including myxoma, vaccinia, raccoonpox and tanapox viruses) modified to express green fluorescence protein to determine which virus was the most effective oncolytic agent in cell-based assays. While myxoma, raccoonpox and tanapox displayed differing efficacy in the panel of cell lines, vaccinia virus was the most potent of the tested poxviruses and was highly effective in controlling cell growth in all cell lines. Oncolytic poxviruses, particularly vaccinia virus, were effective in killing HNSCC in vitro and hold promise as potential treatments for patients with HNSCC. Copyright © 2013 S. Karger AG, Basel.

  1. Immunogenicity and virulence of attenuated vaccinia virus Tian Tan encoding HIV-1 muti-epitope genes, p24 and cholera toxin B subunit in mice.

    Science.gov (United States)

    Du, Shouwen; Wang, Yuhang; Liu, Cunxia; Wang, Maopeng; Zhu, Yilong; Tan, Peng; Ren, Dayong; Li, Xiao; Tian, Mingyao; Yin, Ronglan; Li, Chang; Jin, Ningyi

    2015-07-01

    No effective prophylactic or therapeutic vaccine against HIV-1 in humans is currently available. This study analyzes the immunogenicity and safety of a recombinant attenuated vaccinia virus. A chimeric gene of HIV-1 multi-epitope genes containing CpG ODN and cholera toxin B subunit (CTB) was inserted into Chinese vaccinia virus Tian Tan strain (VTT) mutant strain. The recombinant virus rddVTT(-CCMp24) was assessed for immunogenicity and safety in mice. Results showed that the protein CCMp24 was expressed stably in BHK-21 infected with rddVTT(-CCMp24). And the recombinant virus induced the production of HIV-1 p24 specific immunoglobulin G (IgG), IL-2 and IL-4. The recombinant vaccine induced γ-interferon secretion against HIV peptides, and elicited a certain levels of immunological memory. Results indicated that the recombinant virus had certain immunogenicity to HIV-1. Additionally, the virulence of the recombinant virus was been attenuated in vivo of mice compared with wild type VTT (wtVTT), and the introduction of CTB and HIV Mp24 did not alter the infectivity and virulence of defective vaccinia virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Recombinant viral vaccines for enzootic bovine leucosis

    National Research Council Canada - National Science Library

    Daniel, R C; Gatei, M H; Good, M F; Boyle, D B; Lavin, M F

    1993-01-01

    ...) and part of gp30 of the bovine leukaemia virus (BLV) are described. It has been reported that vaccination of sheep with recombinant VV vaccines containing the complete env gene appears to protect sheep against challenge infection with BLV...

  3. Virome of US bovine calf serum.

    Science.gov (United States)

    Sadeghi, Mohammadreza; Kapusinszky, Beatrix; Yugo, Danielle M; Phan, Tung Gia; Deng, Xutao; Kanevsky, Isis; Opriessnig, Tanja; Woolums, Amelia R; Hurley, David J; Meng, Xiang-Jin; Delwart, Eric

    2017-03-01

    Using viral metagenomics we analyzed four bovine serum pools assembled from 715 calves in the United States. Two parvoviruses, bovine parvovirus 2 (BPV2) and a previously uncharacterized parvovirus designated as bosavirus (BosaV), were detected in 3 and 4 pools respectively and their complete coding sequences generated. Based on NS1 protein identity, bosavirus qualifies as a member of a new species in the copiparvovirus genus. Also detected were low number of reads matching ungulate tetraparvovirus 2, bovine hepacivirus, and several papillomaviruses. This study further characterizes the diversity of viruses in calf serum with the potential to infect fetuses and through fetal bovine serum contaminate cell cultures. Copyright © 2017 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

  4. Analysis of epidemiological data of foodborne outbreak reported in Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Mehdi Soltan Dallal

    2015-02-01

    Conclusion: The knowledge of bacterial agent of foodborne diseases and determination of antimicrobial resistance pattern are helpful to reduce the rate of foodborne outbreaks, the cost of treatment. The prevention control of outbreaks is also very important.

  5. Metabolism and Calcification of Bovine Tooth Enamel

    OpenAIRE

    高木, 亨; 田上, 順次; 中村, 聡; Tohru, Takagi; Junji, TAGAMI; Satoshi, Nakamura; 東京医科歯科大学歯学部 生化学講座; 東京医科歯科大学歯学部 歯科保存学第1講座; 東京医科歯科大学歯学部 医用器材研究所; Department of Biochemistry, Faculty of Dentistry Tokyo Medical and Dental University; Department of Operative Dentistry, Faculty of Dentistry Tokyo Medical and Dental University; Institute of Medical and Dental Engineering, Faculty of Dentistry Tokyo Medical and Dental University

    1997-01-01

    The purpose of this study was to investigate the mineralization mechanism in developing enamel using pH staining. Unerupted bovine teeth were used for the expriment. The activity of a proteolytic enzyme was evaluated against enamel protein obtainedfrom bovine enamel. Crystals in developing enamel, which were classlfied into neutral zone 1 and 2, acid zone 1 and 2, were investigated using infrared spectroscopy, thermal analysis, and power X-ray diffractometry. Proteolytic enzyme showed the hig...

  6. Interactions between bovine cornea proteoglycans and collagen.

    OpenAIRE

    Speziale, P.; Bardoni, A; Balduini, C.

    1980-01-01

    Two types of proteoglycan subunits were obtained from bovine cornea, the first mainly composed of proteochondroitin sulphate and the second of proteokeratan sulphate. These two fractions can be obtained from the tissue as an aggregate, and are able to recombine each other after separation, to re-form the original structure. In order to investigate collagen-proteoglycan interactions, type-I collagen was isolated from bovine cornea by pepsin digestion followed by 3.5% (w/v) NaCl precipitation, ...

  7. Ground Zero revisits shape outbreaks: Zika and beyond

    CERN Document Server

    Manrique, Pedro D; Johnson, Neil F

    2016-01-01

    During an infection outbreak, many people continue to revisit Ground Zero - such as the one square mile of Miami involved in the current Zika outbreak- for work, family or social reasons. Public health planning must account for the counterintuitive ways in which this human flow affects the outbreak's duration, severity and time-to-peak. Managing this flow of revisits can allow the outbreak's evolution to be tailored.

  8. A description of two outbreaks of capripoxvirus disease in Mongolia

    OpenAIRE

    Beard, P.M.; Sugar, S.; Bazarragchaa, E.; Gerelmaa, U.; Tserendorj, Sh.; Tuppurainen, E.; Sodnomdarjaa, R.

    2010-01-01

    Mongolia had no reported cases of capripoxvirus disease from 1977 until an outbreak of sheeppox in 2006-2007 and then goatpox in 2008. The two outbreaks occurred in geographically distant areas of Mongolia and, most strikingly, were highly species-specific. The 2006-2007 sheeppox outbreak affected no goats and the 2008 goatpox outbreak affected no sheep despite communal herding. The diseases were diagnosed using the polymerase chain reaction and virus neutralisation test. The P32 gene of the ...

  9. Activation of bovine neutrophils by Brucella spp.

    Science.gov (United States)

    Keleher, Lauren L; Skyberg, Jerod A

    2016-09-01

    Brucellosis is a globally important zoonotic infectious disease caused by gram negative bacteria of the genus Brucella. While many species of Brucella exist, Brucella melitensis, Brucella abortus, and Brucella suis are the most common pathogens of humans and livestock. The virulence of Brucella is largely influenced by its ability to evade host factors, including phagocytic killing mechanisms, which are critical for the host response to infection. The aim of this study was to characterize the bovine neutrophil response to virulent Brucella spp. Here, we found that virulent strains of smooth B. abortus, B. melitensis, B. suis, and virulent, rough, strains of Brucella canis possess similar abilities to resist killing by resting, or IFN-γ-activated, bovine neutrophils. Bovine neutrophils responded to infection with a time-dependent oxidative burst that varied little between Brucella spp. Inhibition of TAK1, or SYK kinase blunted the oxidative burst of neutrophils in response to Brucella infection. Interestingly, Brucella spp. did not induce robust death of bovine neutrophils. These results indicate that bovine neutrophils respond similarly to virulent Brucella spp. In addition, virulent Brucella spp., including naturally rough strains of B. canis, have a conserved ability to resist killing by bovine neutrophils. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Eco-Evolutionary Theory and Insect Outbreaks.

    Science.gov (United States)

    Páez, David J; Dukic, Vanja; Dushoff, Jonathan; Fleming-Davies, Arietta; Dwyer, Greg

    2017-06-01

    Eco-evolutionary theory argues that population cycles in consumer-resource interactions are partly driven by natural selection, such that changes in densities and changes in trait values are mutually reinforcing. Evidence that the theory explains cycles in nature, however, is almost nonexistent. Experimental tests of model assumptions are logistically impractical for most organisms, while for others, evidence that population cycles occur in nature is lacking. For insect baculoviruses in contrast, tests of model assumptions are straightforward, and there is strong evidence that baculoviruses help drive population cycles in many insects, including the gypsy moth that we study here. We therefore used field experiments with the gypsy moth baculovirus to test two key assumptions of eco-evolutionary models of host-pathogen population cycles: that reduced host infection risk is heritable and that it is costly. Our experiments confirm both assumptions, and inserting parameters estimated from our data into eco-evolutionary insect-outbreak models gives cycles closely resembling gypsy moth outbreak cycles in North America, whereas standard models predict unrealistic stable equilibria. Our work shows that eco-evolutionary models are useful for explaining outbreaks of forest insect defoliators, while widespread observations of intense selection on defoliators in nature and of heritable and costly resistance in defoliators in the lab together suggest that eco-evolutionary dynamics may play a general role in defoliator outbreaks.

  11. First outbreak of norovirus in Albania.

    Science.gov (United States)

    Donia, D; Kota, M; Leno, L; Ylli, A; Cenko, F; Divizia, M

    2011-09-01

    Noroviruses (NoVs) represent the most important enteric viruses responsible for acute gastroenteritis world-wide. This study objective is to characterize the first outbreak of NoV that occurred in Ballsh, a small city in Albania. Stool specimens were collected from people attending to the hospital. Samples were also collected from the aqueduct for bacteriological and virological tests. Overall 33 stools and five drinking water samples were collected, respectively, from the hospital in Ballsh and from the municipal aqueduct. No water samples were scored positive whereas ten stool samples (30.3%) were scored GGII NoV positive. All the GGII isolates were identified as GGII·4 genotype, and no GGI was identified. The alignment and protein analysis were performed using, respectively, ClustalV and the mega 4 software. This is the first report of NoV GGII·4 in Albania causing an outbreak. The genetic analysis showed several point mutations and amino acid substitutions with respect to the international strains. Over the last decades, Albania has suffered from different outbreaks as cholera, poliomyelitis, hepatitis A and now, for the first time, it has been documented an outbreak of NoV. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  12. Investigation of outbreaks complicated by universal exposure

    NARCIS (Netherlands)

    Tostmann, A.; Bousema, Jan Teun; Oliver, I.

    2012-01-01

    Outbreaks in which most or all persons were exposed to the same suspected source of infection, so-called universal exposure, are common. They represent a challenge for public health specialists because conducting analytical studies in such investigations is complicated by the absence of a nonexposed

  13. October 2012 Multistate Fungal Meningitis Outbreak

    Centers for Disease Control (CDC) Podcasts

    2012-10-17

    This podcast gives an overview of the October 2012 multistate fungal meningitis outbreak, including symptoms to watch for and a website for up-to-date information.  Created: 10/17/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 10/17/2012.

  14. METHODS USED TO ANALYZE A NOROVIRUS OUTBREAK

    Science.gov (United States)

    Project Goals and Objectives:To isolate and identify the viral agents in well water samples associated with two outbreaks of acute gastroenteritis reported to the Wyoming Department of Health in February 2001 and October 2001. To isolate and identify the viral agents in pati...

  15. E. Coli: Preventing Outbreaks at Camp.

    Science.gov (United States)

    McKinney, Mary D.

    1996-01-01

    One strain of E. coli is not usually found in foods, but has been related to consumption of undercooked ground beef. Symptoms are stomach cramps and diarrhea, and 2-7% of infections lead to hemolytic uremic syndrome, which is life threatening. Camps can prevent outbreaks by avoiding uncooked meat on overnight campouts and requiring appropriate…

  16. Preparing for a Pandemic Flu Outbreak

    Science.gov (United States)

    Dittbenner, Richard

    2009-01-01

    This article discusses the things college leaders should know and do in case of a pandemic influenza outbreak. The author talks about four principles that will guide college leaders in developing a pandemic influenza plan and presents the 10 elements of an effective college pandemic planning process.

  17. Fish and Shellfish Associated Disease Outbreaks.

    Science.gov (United States)

    Levin, M.

    1978-01-01

    Presents a literature review of disease outbreaks related to fish and shellfish, covering publications of 1976-77. This review covers the chemical, bacterial, and viral diseases that are transmitted by fish and shellfish. A list of 50 references is also presented. (HM)

  18. How Will Climate Change Impact Cholera Outbreaks?

    Science.gov (United States)

    Nasr Azadani, F.; Jutla, A.; Rahimikolu, J.; Akanda, A. S.; Huq, A.; Colwell, R. R.

    2014-12-01

    Environmental parameters associated with cholera are well documented. However, cholera continues to be a global public health threat. Uncertainty in defining environmental processes affecting growth and multiplication of the cholera bacteria can be affected significantly by changing climate at different temporal and spatial scales, either through amplification of the hydroclimatic cycle or by enhanced variability of large scale geophysical processes. Endemic cholera in the Bengal Delta region of South Asia has a unique pattern of two seasonal peaks and there are associated with asymmetric and episodic variability in river discharge. The first cholera outbreak in spring is related with intrusion of bacteria laden coastal seawater during low river discharge. Cholera occurring during the fall season is hypothesized to be associated with high river discharge related to a cross-contamination of water resources and, therefore, a second wave of disease, a phenomenon characteristic primarily in the inland regions. Because of difficulties in establishing linkage between coarse resolutions of the Global Climate Model (GCM) output and localized disease outbreaks, the impact of climate change on diarrheal disease has not been explored. Here using the downscaling method of Support Vector Machines from HADCM3 and ECHAM models, we show how cholera outbreak patterns are changing in the Bengal Delta. Our preliminary results indicate statistically significant changes in both seasonality and magnitude in the occurrence of cholera over the next century. Endemic cholera is likely to transform into epidemic forms and new geographical areas will be at risk for cholera outbreaks.

  19. First Outbreak of Dengue Hemorrhagic Fever, Bangladesh

    OpenAIRE

    Rahman, Mahbubur; Rahman, Khalilur; Siddque, A. K.; Shoma, Shereen; Kamal, A.H.M.; Ali, K.S.; Nisaluk, Ananda; Robert F Breiman

    2002-01-01

    During the first countrywide outbreak of dengue hemorrhagic fever in Bangladesh, we conducted surveillance for dengue at a hospital in Dhaka. Of 176 patients, primarily adults, found positive for dengue, 60.2% had dengue fever, 39.2% dengue hemorrhagic fever, and 0.6% dengue shock syndrome. The Dengue virus 3 serotype was detected in eight patients.

  20. EPIDEMIOLOGY OF CHOLERA OUTBREAK IN KAMPALA ...

    African Journals Online (AJOL)

    hi-tech

    of immunity against the disease for the population. Those two factors, with the poor sanitary conditions prevailing in the city slums, undoubtedly favoured development of the major outbreak reported here. MATERIALS AND METHODS. Case definition: Clinical case definitions were used. A case of cholera was defined as any ...

  1. Management of Nosocomial Scabies, an Outbreak of Occupational Disease

    NARCIS (Netherlands)

    Jungbauer, Frank H. W.; Veenstra-Kyuchukova, Yanka K.; Koeze, Jacqueline; KruijtSpanjer, Martijn R.; Kardaun, Sylvia H.

    Background The optimal approach to managing institutional scabies outbreaks has yet to be defined. We report on outbreak managements are needed. Methods We report on a large outbreak of scabies in three acute care wards in a tertiary university teaching hospital in the Netherlands. Results The

  2. Timeliness of Nongovernmental versus Governmental Global Outbreak Communications

    Science.gov (United States)

    Mondor, Luke; Brownstein, John S.; Chan, Emily; Madoff, Lawrence C.; Pollack, Marjorie P.; Buckeridge, David L.

    2012-01-01

    To compare the timeliness of nongovernmental and governmental communications of infectious disease outbreaks and evaluate trends for each over time, we investigated the time elapsed from the beginning of an outbreak to public reporting of the event. We found that governmental sources improved the timeliness of public reporting of infectious disease outbreaks during the study period. PMID:22709741

  3. Spatial analysis of harmonic oscillation of gypsy moth outbreak intensity

    Science.gov (United States)

    Kyle J. Haynes; Andrew M. Liebhold; Derek M. Johnson

    2009-01-01

    Outbreaks of many forest-defoliating insects are synchronous over broad geographic areas and occur with a period of approximately 10 years. Within the range of the gypsy moth in North America, however, there is considerable geographic heterogeneity in strength of periodicity and the frequency of outbreaks. Furthermore, gypsy moth outbreaks exhibit two significant...

  4. A study of the 2006 Chikungunya epidemic outbreak in Mauritius ...

    African Journals Online (AJOL)

    Chikungunya epidemic outbreaks have affected more than 1 million people in 2005-2006 in many Indian Ocean islands and in India. Mauritius experienced a major outbreak in February/March 2006 following a minor outbreak in April/May 2005. No cases have been registered on the island since August 2006.

  5. Cholera outbreak in districts around Lake Chilwa, Malawi: Lessons ...

    African Journals Online (AJOL)

    Cholera is endemic in Malawi with seasonal outbreaks during the wet season. People living around Lake Chilwa rely on the lake for their water supply. From May 2009 to May 2010, a cholera outbreak occurred in fishing communities around Lake Chilwa. This paper describes the outbreak response and lessons learned for ...

  6. Epidemiology of the 2016 Cholera Outbreak of Chibombo District ...

    African Journals Online (AJOL)

    World Health Organization, Country office, Lusaka, Zambia. 1. 1. 1. 2. 2. RM Chirambo *, J Mufunda , P Songolo ... cholera outbreaks are at risk and there is need to raise awareness. INTRODUCTION. The first outbreak of ... cholera outbreaks, such as those seen in Haiti, Vietnam and Zimbabwe in recent years, can occur.

  7. Varicella outbreak in a daycare: challenges and opportunities for preventing varicella outbreaks in this setting.

    Science.gov (United States)

    Daskalaki, Irini; Thermitus, Rodrerica; Perella, Dana; Viner, Kendra; Spells, Niya; Mohanty, Salini; Lopez, Adriana; Johnson, Caroline

    2014-04-01

    As a result of single-dose varicella vaccination, daycare outbreaks have become rare. We investigated a daycare outbreak resulting from a misdiagnosed varicella case in an unvaccinated attendee. Of 25 attendees aged 12-32 months without evidence of immunity, 7 (28%) were unvaccinated due to religious/philosophical opposition or recent 1st birthday. Single-dose vaccination reduced disease by 92% compared with no vaccination.

  8. Anti-Bovine Programmed Death-1 Rat-Bovine Chimeric Antibody for Immunotherapy of Bovine Leukemia Virus Infection in Cattle.

    Science.gov (United States)

    Okagawa, Tomohiro; Konnai, Satoru; Nishimori, Asami; Maekawa, Naoya; Ikebuchi, Ryoyo; Goto, Shinya; Nakajima, Chie; Kohara, Junko; Ogasawara, Satoshi; Kato, Yukinari; Suzuki, Yasuhiko; Murata, Shiro; Ohashi, Kazuhiko

    2017-01-01

    Blockade of immunoinhibitory molecules, such as programmed death-1 (PD-1)/PD-ligand 1 (PD-L1), is a promising strategy for reinvigorating exhausted T cells and preventing disease progression in a variety of chronic infections. Application of this therapeutic strategy to cattle requires bovinized chimeric antibody targeting immunoinhibitory molecules. In this study, anti-bovine PD-1 rat-bovine chimeric monoclonal antibody 5D2 (Boch5D2) was constructed with mammalian expression systems, and its biochemical function and antiviral effect were characterized in vitro and in vivo using cattle infected with bovine leukemia virus (BLV). Purified Boch5D2 was capable of detecting bovine PD-1 molecules expressed on cell membranes in flow cytometric analysis. In particular, Biacore analysis determined that the binding affinity of Boch5D2 to bovine PD-1 protein was similar to that of the original anti-bovine PD-1 rat monoclonal antibody 5D2. Boch5D2 was also capable of blocking PD-1/PD-L1 binding at the same level as 5D2. The immunomodulatory and therapeutic effects of Boch5D2 were evaluated by in vivo administration of the antibody to a BLV-infected calf. Inoculated Boch5D2 was sustained in the serum for a longer period. Boch5D2 inoculation resulted in activation of the proliferation of BLV-specific CD4+ T cells and decrease in the proviral load of BLV in the peripheral blood. This study demonstrates that Boch5D2 retains an equivalent biochemical function to that of the original antibody 5D2 and is a candidate therapeutic agent for regulating antiviral immune response in vivo. Clinical efficacy of PD-1/PD-L1 blockade awaits further experimentation with a large number of animals.

  9. Anti-Bovine Programmed Death-1 Rat–Bovine Chimeric Antibody for Immunotherapy of Bovine Leukemia Virus Infection in Cattle

    Science.gov (United States)

    Okagawa, Tomohiro; Konnai, Satoru; Nishimori, Asami; Maekawa, Naoya; Ikebuchi, Ryoyo; Goto, Shinya; Nakajima, Chie; Kohara, Junko; Ogasawara, Satoshi; Kato, Yukinari; Suzuki, Yasuhiko; Murata, Shiro; Ohashi, Kazuhiko

    2017-01-01

    Blockade of immunoinhibitory molecules, such as programmed death-1 (PD-1)/PD-ligand 1 (PD-L1), is a promising strategy for reinvigorating exhausted T cells and preventing disease progression in a variety of chronic infections. Application of this therapeutic strategy to cattle requires bovinized chimeric antibody targeting immunoinhibitory molecules. In this study, anti-bovine PD-1 rat–bovine chimeric monoclonal antibody 5D2 (Boch5D2) was constructed with mammalian expression systems, and its biochemical function and antiviral effect were characterized in vitro and in vivo using cattle infected with bovine leukemia virus (BLV). Purified Boch5D2 was capable of detecting bovine PD-1 molecules expressed on cell membranes in flow cytometric analysis. In particular, Biacore analysis determined that the binding affinity of Boch5D2 to bovine PD-1 protein was similar to that of the original anti-bovine PD-1 rat monoclonal antibody 5D2. Boch5D2 was also capable of blocking PD-1/PD-L1 binding at the same level as 5D2. The immunomodulatory and therapeutic effects of Boch5D2 were evaluated by in vivo administration of the antibody to a BLV-infected calf. Inoculated Boch5D2 was sustained in the serum for a longer period. Boch5D2 inoculation resulted in activation of the proliferation of BLV-specific CD4+ T cells and decrease in the proviral load of BLV in the peripheral blood. This study demonstrates that Boch5D2 retains an equivalent biochemical function to that of the original antibody 5D2 and is a candidate therapeutic agent for regulating antiviral immune response in vivo. Clinical efficacy of PD-1/PD-L1 blockade awaits further experimentation with a large number of animals. PMID:28638381

  10. Anti-Bovine Programmed Death-1 Rat–Bovine Chimeric Antibody for Immunotherapy of Bovine Leukemia Virus Infection in Cattle

    Directory of Open Access Journals (Sweden)

    Tomohiro Okagawa

    2017-06-01

    Full Text Available Blockade of immunoinhibitory molecules, such as programmed death-1 (PD-1/PD-ligand 1 (PD-L1, is a promising strategy for reinvigorating exhausted T cells and preventing disease progression in a variety of chronic infections. Application of this therapeutic strategy to cattle requires bovinized chimeric antibody targeting immunoinhibitory molecules. In this study, anti-bovine PD-1 rat–bovine chimeric monoclonal antibody 5D2 (Boch5D2 was constructed with mammalian expression systems, and its biochemical function and antiviral effect were characterized in vitro and in vivo using cattle infected with bovine leukemia virus (BLV. Purified Boch5D2 was capable of detecting bovine PD-1 molecules expressed on cell membranes in flow cytometric analysis. In particular, Biacore analysis determined that the binding affinity of Boch5D2 to bovine PD-1 protein was similar to that of the original anti-bovine PD-1 rat monoclonal antibody 5D2. Boch5D2 was also capable of blocking PD-1/PD-L1 binding at the same level as 5D2. The immunomodulatory and therapeutic effects of Boch5D2 were evaluated by in vivo administration of the antibody to a BLV-infected calf. Inoculated Boch5D2 was sustained in the serum for a longer period. Boch5D2 inoculation resulted in activation of the proliferation of BLV-specific CD4+ T cells and decrease in the proviral load of BLV in the peripheral blood. This study demonstrates that Boch5D2 retains an equivalent biochemical function to that of the original antibody 5D2 and is a candidate therapeutic agent for regulating antiviral immune response in vivo. Clinical efficacy of PD-1/PD-L1 blockade awaits further experimentation with a large number of animals.

  11. Susceptibility of bovine umbilical cord endothelial cells to bovine herpesviruses and pseudocowpox virus.

    NARCIS (Netherlands)

    Wellenberg, G.J.; Verstraten, E.R.A.M.; Jongejan, F.; Oirschot, van J.T.

    2002-01-01

    The purpose of the study was to determine the susceptibility of bovine umbilical cord endothelial (BUE) cells to bovine herpesvirus (BHV) 1, BHV2, BHV4 and BHV5, and to pseudocowpox virus. the detection limits and growth curves of these viruses in BUE cells were compared with those in Vero,

  12. Antimicrobial activity of bovine NK-lysin-derived peptides on bovine respiratory pathogen Histophilus somni

    Science.gov (United States)

    Bovine NK-lysins, which are functionally and structurally similar to human granulysin and porcine NK-lysin, are predominantly found in the granules of cytotoxic T-lymphocytes and NK-cells. Although antimicrobial activity of bovine NK-lysin has been assessed for several bacterial pathogens, not all t...

  13. Establishing elements of a synthetic biology platform for Vaccinia virus production: BioBrick™ design, serum-free virus production and microcarrier-based cultivation of CV-1 cells

    Directory of Open Access Journals (Sweden)

    Shuchang Liu

    2017-02-01

    Full Text Available Vaccinia virus (VACV is an established vector for vaccination and is beginning to prove effective as an oncolytic agent. Industrial production of VACV stands to benefit in future from advances made by synthetic biology in genome engineering and standardisation. The CV-1 cell line can be used for VACV propagation and has been used extensively with the CRISPR/Cas9 system for making precise edits of the VACV genome. Here we take first steps toward establishing a scalable synthetic biology platform for VACV production with CV-1 cells featuring standardised biological tools and serum free cell cultivation. We propose a new BioBrick™ plasmid backbone format for inserting transgenes into VACV. We then test the performance of CV-1 cells in propagation of a conventional recombinant Lister strain VACV, VACVL-15 RFP, in a serum-free process. CV-1 cells grown in 5% foetal bovine serum (FBS Dulbecco’s Modified Eagle Medium (DMEM were adapted to growth in OptiPRO and VP-SFM brands of serum-free media. Specific growth rates of 0.047 h−1 and 0.044 h−1 were observed for cells adapted to OptiPRO and VP-SFM respectively, compared to 0.035 h−1 in 5% FBS DMEM. Cells adapted to OptiPRO and to 5% FBS DMEM achieved recovery ratios of over 96%, an indication of their robustness to cryopreservation. Cells adapted to VP-SFM showed a recovery ratio of 82%. Virus productivity in static culture, measured as plaque forming units (PFU per propagator cell, was 75 PFU/cell for cells in 5% FBS DMEM. VP-SFM and OptiPRO adaptation increased VACV production to 150 PFU/cell and 350 PFU/cell respectively. Boosted PFU/cell from OptiPRO-adapted cells persisted when 5% FBS DMEM or OptiPRO medium was observed during the infection step and when titre was measured using cells adapted to 5% FBS DMEM or OptiPRO medium. Finally, OptiPRO-adapted CV-1 cells were successfully cultivated using Cytodex-1 microcarriers to inform future scale up studies.

  14. Establishing elements of a synthetic biology platform for Vaccinia virus production: BioBrick™ design, serum-free virus production and microcarrier-based cultivation of CV-1 cells.

    Science.gov (United States)

    Liu, Shuchang; Ruban, Ludmila; Wang, Yaohe; Zhou, Yuhong; Nesbeth, Darren N

    2017-02-01

    Vaccinia virus (VACV) is an established vector for vaccination and is beginning to prove effective as an oncolytic agent. Industrial production of VACV stands to benefit in future from advances made by synthetic biology in genome engineering and standardisation. The CV-1 cell line can be used for VACV propagation and has been used extensively with the CRISPR/Cas9 system for making precise edits of the VACV genome. Here we take first steps toward establishing a scalable synthetic biology platform for VACV production with CV-1 cells featuring standardised biological tools and serum free cell cultivation. We propose a new BioBrick™ plasmid backbone format for inserting transgenes into VACV. We then test the performance of CV-1 cells in propagation of a conventional recombinant Lister strain VACV, VACVL-15 RFP, in a serum-free process. CV-1 cells grown in 5% foetal bovine serum (FBS) Dulbecco's Modified Eagle Medium (DMEM) were adapted to growth in OptiPRO and VP-SFM brands of serum-free media. Specific growth rates of 0.047 h-1 and 0.044 h-1 were observed for cells adapted to OptiPRO and VP-SFM respectively, compared to 0.035 h-1 in 5% FBS DMEM. Cells adapted to OptiPRO and to 5% FBS DMEM achieved recovery ratios of over 96%, an indication of their robustness to cryopreservation. Cells adapted to VP-SFM showed a recovery ratio of 82%. Virus productivity in static culture, measured as plaque forming units (PFU) per propagator cell, was 75 PFU/cell for cells in 5% FBS DMEM. VP-SFM and OptiPRO adaptation increased VACV production to 150 PFU/cell and 350 PFU/cell respectively. Boosted PFU/cell from OptiPRO-adapted cells persisted when 5% FBS DMEM or OptiPRO medium was observed during the infection step and when titre was measured using cells adapted to 5% FBS DMEM or OptiPRO medium. Finally, OptiPRO-adapted CV-1 cells were successfully cultivated using Cytodex-1 microcarriers to inform future scale up studies.

  15. Linear Epitopes in Vaccinia Virus A27 Are Targets of Protective Antibodies Induced by Vaccination against Smallpox.

    Science.gov (United States)

    Kaever, Thomas; Matho, Michael H; Meng, Xiangzhi; Crickard, Lindsay; Schlossman, Andrew; Xiang, Yan; Crotty, Shane; Peters, Bjoern; Zajonc, Dirk M

    2016-05-01

    Vaccinia virus (VACV) A27 is a target for viral neutralization and part of the Dryvax smallpox vaccine. A27 is one of the three glycosaminoglycan (GAG) adhesion molecules and binds to heparan sulfate. To understand the function of anti-A27 antibodies, especially their protective capacity and their interaction with A27, we generated and subsequently characterized 7 murine monoclonal antibodies (MAbs), which fell into 4 distinct epitope groups (groups I to IV). The MAbs in three groups (groups I, III, and IV) bound to linear peptides, while the MAbs in group II bound only to VACV lysate and recombinant A27, suggesting that they recognized a conformational and discontinuous epitope. Only group I antibodies neutralized the mature virion in a complement-dependent manner and protected against VACV challenge, while a group II MAb partially protected against VACV challenge but did not neutralize the mature virion. The epitope for group I MAbs was mapped to a region adjacent to the GAG binding site, a finding which suggests that group I MAbs could potentially interfere with the cellular adhesion of A27. We further determined the crystal structure of the neutralizing group I MAb 1G6, as well as the nonneutralizing group IV MAb 8E3, bound to the corresponding linear epitope-containing peptides. Both the light and the heavy chains of the antibodies are important in binding to their antigens. For both antibodies, the L1 loop seems to dominate the overall polar interactions with the antigen, while for MAb 8E3, the light chain generally appears to make more contacts with the antigen. Vaccinia virus is a powerful model to study antibody responses upon vaccination, since its use as the smallpox vaccine led to the eradication of one of the world's greatest killers. The immunodominant antigens that elicit the protective antibodies are known, yet for many of these antigens, little information about their precise interaction with antibodies is available. In an attempt to better

  16. Recombination-mediated genetic engineering of a bacterial artificial chromosome clone of modified vaccinia virus Ankara (MVA.

    Directory of Open Access Journals (Sweden)

    Matthew G Cottingham

    2008-02-01

    Full Text Available The production, manipulation and rescue of a bacterial artificial chromosome clone of Vaccinia virus (VAC-BAC in order to expedite construction of expression vectors and mutagenesis of the genome has been described (Domi & Moss, 2002, PNAS99 12415-20. The genomic BAC clone was 'rescued' back to infectious virus using a Fowlpox virus helper to supply transcriptional machinery. We apply here a similar approach to the attenuated strain Modified Vaccinia virus Ankara (MVA, now widely used as a safe non-replicating recombinant vaccine vector in mammals, including humans. Four apparently full-length, rescuable clones were obtained, which had indistinguishable immunogenicity in mice. One clone was shotgun sequenced and found to be identical to the parent. We employed GalK recombination-mediated genetic engineering (recombineering of MVA-BAC to delete five selected viral genes. Deletion of C12L, A44L, A46R or B7R did not significantly affect CD8(+ T cell immunogenicity in BALB/c mice, but deletion of B15R enhanced specific CD8(+ T cell responses to one of two endogenous viral epitopes (from the E2 and F2 proteins, in accordance with published work (Staib et al., 2005, J. Gen. Virol.86, 1997-2006. In addition, we found a higher frequency of triple-positive IFN-gamma, TNF-alpha and IL-2 secreting E3-specific CD8+ T-cells 8 weeks after vaccination with MVA lacking B15R. Furthermore, a recombinant vaccine capable of inducing CD8(+ T cells against an epitope from Plasmodium berghei was created using GalK counterselection to insert an antigen expression cassette lacking a tandem marker gene into the traditional thymidine kinase locus of MVA-BAC. MVA continues to feature prominently in clinical trials of recombinant vaccines against diseases such as HIV-AIDS, malaria and tuberculosis. Here we demonstrate in proof-of-concept experiments that MVA-BAC recombineering is a viable route to more rapid and efficient generation of new candidate mutant and recombinant

  17. Surveillance for foodborne disease outbreaks--United States, 2008.

    Science.gov (United States)

    2011-09-09

    Foodborne agents cause an estimated 48 million illnesses annually in the United States, including 9.4 million illnesses from known pathogens. CDC collects data on foodborne disease outbreaks submitted from all states and territories through the Foodborne Disease Outbreak Surveillance System. During 2008, the most recent year for which data are finalized, 1,034 foodborne disease outbreaks were reported, which resulted in 23,152 cases of illness, 1,276 hospitalizations, and 22 deaths. Among the 479 outbreaks with a laboratory-confirmed single etiologic agent reported, norovirus was the most common, accounting for 49% of outbreaks and 46% of illnesses. Salmonella was the second most common, accounting for 23% of outbreaks and 31% of illnesses. Among the 218 outbreaks attributed to a food vehicle with ingredients from only one of 17 defined food commodities, the top commodities to which outbreaks were attributed were poultry (15%), beef (14%), and finfish (14%), whereas the top commodities to which outbreak-related illnesses were attributed were fruits and nuts (24%), vine-stalk vegetables (23%), and beef (13%). Outbreak surveillance provides insights into the agents that cause foodborne illness, types of implicated foods, and settings where transmission occurs. Public health, regulatory, and food industry professionals can use this information to target prevention efforts against pathogens and foods that cause the most foodborne disease outbreaks.

  18. Rubella outbreak and outbreak management in a school setting, China, 2014.

    Science.gov (United States)

    Chang, Caiyun; Ma, Huilai; Liang, Wenjia; Hu, Pei; Mo, Xianghuan; An, Zhijie; Zheng, Huizhen

    2017-04-03

    An active response to a rubella outbreak may interrupt disease transmission, and outbreak response immunization (ORI) can increase immunity among persons who might otherwise not be protected. On March 17, 2014, a rubella outbreak was reported in a middle school in Guangzhou city, China. We conducted an investigation to assess impact of a policy of exclusion of cases from school and of ORI. Active surveillance was used to find cases of rubella. Investigators interviewed teachers and reviewed the absentee records to determine implementation details of school exclusion. ORI was recommended on 2 occasions during the outbreak, one small-scale and one large-scale. Laboratory confirmation tests included serum IgM and IgG measurements to distinguish between acute infection and immunity. A serological survey in 4 classes was used to determine immunity status and identify symptomatic and asymptomatic cases. From February 17 to May 23, 2014, 162 rubella cases (24 laboratory-confirmed and 138 epidemiologically linked) were detected among 1,621 students. Cases ultimately occurred in 27 classes (72.97%) across 37 classes. In 11 classes in which exclusion from school was delayed by 1 or more days, the secondary attack rate was 12.30%, compared with 2.35% in 15 classes with immediate exclusion. ORI increased vaccine coverage from 25.83 % to 86.92%, and the final case of the epidemic was reported one month later. A serological survey of 91 students in 4 classes identified 15 cases, 6 of which were asymptomatic. The outbreak happened in school with low rubella-containing vaccination coverage. Exclusion from school upon rash/fever onset was associated with lowering the secondary attack rate, but school exclusion alone was not able to stop this outbreak - a large ORI was needed. Assuring complete vaccination upon entry to school is likely to be necessary to ensure coverage is above the herd immunity threshold and prevent outbreaks from happening.

  19. [Lessons learned from tuberculosis outbreak cases].

    Science.gov (United States)

    Kato, Seiya; Kuwabara, Katsuhiro

    2014-02-01

    Most TB outbreaks were caused by exposure of many people to tuberculosis bacilli due to delayed detection of initial cases who had long-lasting severe coughs and excretion of massive tuberculosis bacilli. They were also affected by several other factors, such as socio-environmental factors of the initial case; time and place of infection; and host factors of the infected persons such as immune status, infectivity, and/or pathogenicity of the bacilli. In this symposium, we learned the seriousness of infection and disease among immune-suppressed groups, special environmental factors with regard to the spread of infection, disease after treatment of latent tuberculosis infection, diagnostic specification of IGRA, and bacteriological features including genotyping of the bacilli. We reaffirmed that countermeasures for the case are important, but outbreaks can provide excellent opportunities to learn important information about infection, disease progression, etc. 1. Tuberculosis outbreak in a cancer ward: Katsuhiro KUWABARA (Division of Respiratory Diseases, National Hospital Organization Nishi-Niigata Chuo National Hospital) There was an outbreak of tuberculosis in a cancer ward of a highly specialized medical center. Outbreak cases included eight hospitalized patients and two medical staff members over a 1.5-year observation period after initial contact. Three immune-compromised patients including the index patent died of cancer and tuberculosis. Community hospitals and highly specialized medical centers, such as cancer centers, should carefully prepare a proper system to prevent nosocomial transmission of tuberculosis. 2. Sixty-one cases of TB exposures in hospital settings and contact investigations of the hospital staff, with special reference to the application of QFT: Hiroko Yoshikawa NIGORIKAWA (The Division of Infectious Diseases, Tokyo Metropolitan Health and Medical Treatment Corporation, Toshima Hospital; present: Division of Infectious Diseases, Tokyo

  20. Serological responses in calves to vaccines against bovine respiratory syncytial, infectious bovine rhinotracheitis, bovine viral diarrhoea and parainfluenza-3 viruses.

    Science.gov (United States)

    Tollis, M; Di Trani, L; Cordioli, P; Vignolo, E; Di Pasquale, I

    1996-01-01

    The Istituto Superiore di Sanità (ISS), the National Veterinary Services Laboratory in Italy, is in charge of assessing the quality, safety and efficacy of veterinary vaccines before and after licensing. To evaluate the relative potency of several vaccines against bovine respiratory syncytial virus (BRSV), infectious bovine rhinotracheitis virus (IBRV), bovine viral diarrhoea virus (BVDV) and parainfluenza-3 virus (PI3V), the serological responses in vaccinated calves were studied. Vaccination with any of the vaccines under study induced specific antibody titres against the different viral antigens. The differences of the mean antibody titres within and among the test group vaccines were statistically significant. The results confirm and support those obtained by other authors in similar studies, suggesting that serological responses in vaccinated calves can be used as a helpful means of assessing the relative potency of vaccines against viral respiratory diseases of cattle. The criteria allowing such an evaluation are discussed.

  1. Protein and modified vaccinia virus Ankara-based influenza virus nucleoprotein vaccines are differentially immunogenic in BALB/c mice.

    Science.gov (United States)

    Altenburg, A F; Magnusson, S E; Bosman, F; Stertman, L; de Vries, R D; Rimmelzwaan, G F

    2017-10-01

    Because of the high variability of seasonal influenza viruses and the eminent threat of influenza viruses with pandemic potential, there is great interest in the development of vaccines that induce broadly protective immunity. Most probably, broadly protective influenza vaccines are based on conserved proteins, such as nucleoprotein (NP). NP is a vaccine target of interest as it has been shown to induce cross-reactive antibody and T cell responses. Here we tested and compared various NP-based vaccine preparations for their capacity to induce humoral and cellular immune responses to influenza virus NP. The immunogenicity of protein-based vaccine preparations with Matrix-M™ adjuvant as well as recombinant viral vaccine vector modified Vaccinia virus Ankara (MVA) expressing the influenza virus NP gene, with or without modifications that aim at optimization of CD8 + T cell responses, was addressed in BALB/c mice. Addition of Matrix-M™ adjuvant to NP wild-type protein-based vaccines significantly improved T cell responses. Furthermore, recombinant MVA expressing the influenza virus NP induced strong antibody and CD8 + T cell responses, which could not be improved further by modifications of NP to increase antigen processing and presentation. © 2017 British Society for Immunology.

  2. Comparison of the Cowpox Virus and Vaccinia Virus Mature Virion Proteome: Analysis of the Species- and Strain-Specific Proteome.

    Directory of Open Access Journals (Sweden)

    Joerg Doellinger

    Full Text Available Cowpox virus (CPXV causes most zoonotic orthopoxvirus (OPV infections in Europe and Northern as well as Central Asia. The virus has the broadest host range of OPV and is transmitted to humans from rodents and other wild or domestic animals. Increasing numbers of human CPXV infections in a population with declining immunity have raised concerns about the virus' zoonotic potential. While there have been reports on the proteome of other human-pathogenic OPV, namely vaccinia virus (VACV and monkeypox virus (MPXV, the protein composition of the CPXV mature virion (MV is unknown. This study focused on the comparative analysis of the VACV and CPXV MV proteome by label-free single-run proteomics using nano liquid chromatography and high-resolution tandem mass spectrometry (nLC-MS/MS. The presented data reveal that the common VACV and CPXV MV proteome contains most of the known conserved and essential OPV proteins and is associated with cellular proteins known to be essential for viral replication. While the species-specific proteome could be linked mainly to less genetically-conserved gene products, the strain-specific protein abundance was found to be of high variance in proteins associated with entry, host-virus interaction and protein processing.

  3. A marker-free system for highly efficient construction of vaccinia virus vectors using CRISPR Cas9

    Directory of Open Access Journals (Sweden)

    Ming Yuan

    Full Text Available The current method for creation of vaccinia virus (VACV vectors involves using a selection and purification marker, however inclusion of a gene without therapeutic value in the resulting vector is not desirable for clinical use. The Cre-LoxP system has been used to make marker-free Poxviruses, but the efficiency was very low. To obtain a marker-free VACV vector, we developed marker gene excision systems to modify the thymidine kinase (TK region and N1L regions using Cre-Loxp and Flp-FRET systems respectively. CRISPR-Cas9 system significantly resulted in a high efficiency (∼90% in generation of marker gene-positive TK-mutant VACV vector. The marker gene (RFP could be excised from the recombinant virus using Cre recombinase. To make a marker-free VV vector with double gene deletions targeting the TK and N1L gene, we constructed a donor repair vector targeting the N1L gene, which can carry a therapeutic gene and the marker (RFP that could be excised from the recombinant virus using Flp recombinase. The marker-free system developed here can be used to efficiently construct VACV vectors armed with any therapeutic genes in the TK region or N1L region without marker genes. Our marker-free system platform has significant potential for development of new marker-free VACV vectors for clinical application.

  4. An E2–F12 complex is required for intracellular enveloped virus morphogenesis during vaccinia infection

    Science.gov (United States)

    Dodding, Mark P; Newsome, Timothy P; Collinson, Lucy M; Edwards, Ceri; Way, Michael

    2009-01-01

    The vaccinia virus protein, F12, has been suggested to play an important role in microtubule-based transport of intracellular enveloped virus (IEV). We found that GFP-F12 is recruited to IEV moving on microtubules but is released from virus particles when they switch to actin-based motility. In the absence of F12, although the majority of IEV remain close to their peri-nuclear site of assembly, a small number of IEV still move with linear trajectories at speeds of 0.85 μm s−1, consistent with microtubule transport. Using a recombinant virus expressing GST-F12, we found that the viral protein E2 interacts directly with F12. In infected cells, GFP-E2 is observed on moving IEV as well as in the Golgi region, but is not associated with actin tails. In the absence of E2L, IEV accumulate in the peri-nuclear region and F12 is not recruited. Conversely, GFP-E2 is not observed on IEV in the absence of F12. Ultra-structural analysis of ΔE2L- and ΔF12L-infected cells reveals that loss of either protein results in defects in membrane wrapping during IEV formation. We suggest that E2 and F12 function as a complex that is necessary for IEV morphogenesis prior to their microtubule-based transport towards the plasma membrane. PMID:19207726

  5. NK cell-extrinsic IL-18 signaling is required for efficient NK-cell activation by vaccinia virus.

    Science.gov (United States)

    Brandstadter, Joshua D; Huang, Xiaopei; Yang, Yiping

    2014-09-01

    NK cells are important for the control of vaccinia virus (VV) in vivo. Recent studies have shown that multiple pathways are required for effective activation of NK cells. These include both TLR-dependent and -independent pathways, as well as the NKG2D activating receptor that recognizes host stress-induced NKG2D ligands. However, it remains largely unknown what controls the upregulation of NKG2D ligands in response to VV infection. In this study using C57BL/6 mice, we first showed that IL-18 is critical for NK-cell activation and viral clearance. We then demonstrated that IL-18 signaling on both NK cells and DCs is required for efficient NK-cell activation upon VV infection in vitro. We further showed in vivo that efficient NK-cell activation in response to VV is dependent on DCs and IL-18 signaling in non-NK cells, suggesting an essential role for NK cell-extrinsic IL-18 signaling in NK-cell activation. Mechanistically, IL-18 signaling in DCs promotes expression of Rae-1, an NKG2D ligand. Collectively, our data reveal a previously unrecognized role for NK cell-extrinsic IL-18 signaling in NK-cell activation through upregulation of NKG2D ligands. These observations may provide insights into the design of effective NK-cell-based therapies for viral infections and cancer. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Systemic treatment of xenografts with vaccinia virus GLV-1h68 reveals the immunologic facet of oncolytic therapy

    Directory of Open Access Journals (Sweden)

    Liu Hui

    2009-07-01

    Full Text Available Abstract Background GLV-1h68 is an attenuated recombinant vaccinia virus (VACV that selectively colonizes established human xenografts inducing their complete regression. Results Here, we explored xenograft/VACV/host interactions in vivo adopting organism-specific expression arrays and tumor cell/VACV in vitro comparing VACV replication patterns. There were no clear-cut differences in vitro among responding and non-responding tumors, however, tumor rejection was associated in vivo with activation of interferon-stimulated genes (ISGs and innate immune host's effector functions (IEFs correlating with VACV colonization of the xenografts. These signatures precisely reproduce those observed in humans during immune-mediated tissue-specific destruction (TSD that causes tumor or allograft rejection, autoimmunity or clearance of pathogens. We recently defined these common pathways in the "immunologic constant of rejection" hypothesis (ICR. Conclusion This study provides the first prospective validation of a universal mechanism associated with TSD. Thus, xenograft infection by oncolytic VACV, beyond offering a promising therapy of established cancers, may represent a reliable pre-clinical model to test therapeutic strategies aimed at modulating the central pathways leading to TSD; this information may lead to the identification of principles that could refine the treatment of cancer and chronic infection by immune stimulation or autoimmunity and allograft rejection through immune tolerance.

  7. Generation of Recombinant Modified Vaccinia Virus Ankara Encoding VP2, NS1, and VP7 Proteins of Bluetongue Virus.

    Science.gov (United States)

    Marín-López, Alejandro; Ortego, Javier

    2016-01-01

    Modified Vaccinia Virus Ankara (MVA) is employed widely as an experimental vaccine vector for its lack of replication in mammalian cells and high expression level of foreign/heterologous genes. Recombinant MVAs (rMVAs) are used as platforms for protein production as well as vectors to generate vaccines against a high number of infectious diseases and other pathologies. The portrait of the virus combines desirable elements such as high-level biological safety, the ability to activate appropriate innate immune mediators upon vaccination, and the capacity to deliver substantial amounts of heterologous antigens. Recombinant MVAs encoding proteins of bluetongue virus (BTV), an Orbivirus that infects domestic and wild ruminants transmitted by biting midges of the Culicoides species, are excellent vaccine candidates against this virus. In this chapter we describe the methods for the generation of rMVAs encoding VP2, NS1, and VP7 proteins of bluetongue virus as a model example for orbiviruses. The protocols included cover the cloning of VP2, NS1, and VP7 BTV-4 genes in a transfer plasmid, the construction of recombinant MVAs, the titration of virus working stocks and the protein expression analysis by immunofluorescence and radiolabeling of rMVA infected cells as well as virus purification.

  8. RNA-Seq Based Transcriptome Analysis of the Type I Interferon Host Response upon Vaccinia Virus Infection of Mouse Cells

    Directory of Open Access Journals (Sweden)

    Bruno Hernáez

    2017-01-01

    Full Text Available Vaccinia virus (VACV encodes the soluble type I interferon (IFN binding protein B18 that is secreted from infected cells and also attaches to the cell surface, as an immunomodulatory strategy to inhibit the host IFN response. By using next generation sequencing technologies, we performed a detailed RNA-seq study to dissect at the transcriptional level the modulation of the IFN based host response by VACV and B18. Transcriptome profiling of L929 cells after incubation with purified recombinant B18 protein showed that attachment of B18 to the cell surface does not trigger cell signalling leading to transcriptional activation. Consistent with its ability to bind type I IFN, B18 completely inhibited the IFN-mediated modulation of host gene expression. Addition of UV-inactivated virus particles to cell cultures altered the expression of a set of 53 cellular genes, including genes involved in innate immunity. Differential gene expression analyses of cells infected with replication competent VACV identified the activation of a broad range of host genes involved in multiple cellular pathways. Interestingly, we did not detect an IFN-mediated response among the transcriptional changes induced by VACV, even after the addition of IFN to cells infected with a mutant VACV lacking B18. This is consistent with additional viral mechanisms acting at different levels to block IFN responses during VACV infection.

  9. Comparative host-parasite relationships in ovine toxoplasmosis and bovine neosporosis and strategies for vaccination.

    Science.gov (United States)

    Innes, Elisabeth A; Bartley, Paul M; Maley, Stephen W; Wright, Stephen E; Buxton, David

    2007-07-26

    Toxoplasma gondii and Neospora caninum are important causes of reproductive loss in ruminant species worldwide. Both parasites cause disease during pregnancy that may result in foetal death or birth of live congenitally infected offspring. T. gondii is also an important human pathogen with the main risk groups including pregnant women and immuno-compromised individuals, although clinical disease has also been observed in outbreaks among immuno-competent people. While the two parasites are closely related there are distinct differences between the two in their interactions with different host species and subsequent clinical outcome. This paper discusses the respective host-parasite relationships in ovine toxoplasmosis and bovine neosporosis and how the immune response may be host-protective, parasite-protective or contribute to disease pathogenesis, and how this knowledge may help in the development of more effective and targeted vaccination strategies.

  10. Reflexive modernization at the source: local media coverage of bovine spongiform encephalopathy in rural Alberta.

    Science.gov (United States)

    Davidson, Debra J; Bogdan, Eva

    2010-11-01

    The potential for reflexive modernization is defined by multiple factors, but the acknowledgment of risk is crucial, particularly among social groups that play a key role in risk minimization. This study offers an examination of the role of local media in response to the outbreak of bovine spongiform encephalopathy (BSE) in beef-producing communities in rural Alberta. BSE is one of several global risk issues that reflexive modernization theorists argue have the potential to trigger a transformation toward a critically reflexive society in which such risks are minimized. Content analysis of newspapers in beef-producing regions in Alberta, however, shows how local media framed BSE in a manner that maximized community cohesion and protection of local culture. This selective coverage of BSE in rural Alberta is quite likely to have contributed to, or at least reinforced, support for the current institutional structure of Canadian agriculture in beef-producing regions, through the constriction of discourse.

  11. Recent Progress in Cryopreservation of Bovine Oocytes

    Directory of Open Access Journals (Sweden)

    In-Sul Hwang

    2014-01-01

    Full Text Available Principle of oocyte cryoinjury is first overviewed and then research history of cryopreservation using bovine oocytes is summarized for the last two decades with a few special references to recent progresses. Various types of cryodevices have been developed to accelerate the cooling rate and applied to the oocytes from large domestic species enriched with cytoplasmic lipid droplets. Two recent approaches include the qualitative improvement of IVM oocytes prior to the vitrification and the short-term recovery culture of vitrified-warmed oocytes prior to the subsequent IVF. Supplementation of L-carnitine to IVM medium of bovine oocytes has been reported to reduce the amount of cytoplasmic lipid droplets and improve the cryotolerance of the oocytes, but it is still controversial whether the positive effect of L-carnitine is reproducible. Incidence of multiple aster formation, a possible cause for low developmental potential of vitrified-warmed bovine oocytes, was inhibited by a short-term culture of the postwarm oocytes in the presence of Rho-associated coiled-coil kinase (ROCK inhibitor. Use of an antioxidant α-tocopherol, instead of the ROCK inhibitor, also supported the revivability of the postwarm bovine oocytes. Further improvements of the vitrification procedure, combined with pre- and postvitrification chemical treatment, would overcome the high sensitivity of bovine oocytes to cryopreservation.

  12. Severe Dengue Fever Outbreak in Taiwan

    Science.gov (United States)

    Wang, Sheng-Fan; Wang, Wen-Hung; Chang, Ko; Chen, Yen-Hsu; Tseng, Sung-Pin; Yen, Chia-Hung; Wu, Deng-Chyang; Chen, Yi-Ming Arthur

    2016-01-01

    Dengue fever (DF) is a vector-borne disease caused by dengue viruses (DENVs). Epidemic dengue occurs intermittently in Taiwan. In 2014, Taiwan experienced its largest DF outbreak. There were 15,732 DF cases reported. There were a total of 136 dengue hemorrhagic fever (DHF) cases, of which 20 resulted in death. Most DF cases were reported in southern Taiwan. A total of 15,043 (96%) cases were from Kaohsiung, a modern city in southern Taiwan. This report reviews DF epidemics in Taiwan during 2005–2014. The correlation between DF and DHF along with temperature and precipitation were conjointly examined. We conclude that most dengue epidemics in Taiwan resulted from imported DF cases. Results indicate three main factors that may have been associated with this DF outbreak in Kaohsiung: an underground pipeline explosion combined with subsequent rainfall and higher temperature. These factors may have enhanced mosquito breeding activity, facilitating DENV transmission. PMID:26572871

  13. Quasi-neutral theory of epidemic outbreaks.

    Directory of Open Access Journals (Sweden)

    Oscar A Pinto

    Full Text Available Some epidemics have been empirically observed to exhibit outbreaks of all possible sizes, i.e., to be scale-free or scale-invariant. Different explanations for this finding have been put forward; among them there is a model for "accidental pathogens" which leads to power-law distributed outbreaks without apparent need of parameter fine tuning. This model has been claimed to be related to self-organized criticality, and its critical properties have been conjectured to be related to directed percolation. Instead, we show that this is a (quasi neutral model, analogous to those used in Population Genetics and Ecology, with the same critical behavior as the voter-model, i.e. the theory of accidental pathogens is a (quasi-neutral theory. This analogy allows us to explain all the system phenomenology, including generic scale invariance and the associated scaling exponents, in a parsimonious and simple way.

  14. Safe drinking water and waterborne outbreaks.

    Science.gov (United States)

    Moreira, N A; Bondelind, M

    2017-02-01

    The present work compiles a review on drinking waterborne outbreaks, with the perspective of production and distribution of microbiologically safe water, during 2000-2014. The outbreaks are categorised in raw water contamination, treatment deficiencies and distribution network failure. The main causes for contamination were: for groundwater, intrusion of animal faeces or wastewater due to heavy rain; in surface water, discharge of wastewater into the water source and increased turbidity and colour; at treatment plants, malfunctioning of the disinfection equipment; and for distribution systems, cross-connections, pipe breaks and wastewater intrusion into the network. Pathogens causing the largest number of affected consumers were Cryptosporidium, norovirus, Giardia, Campylobacter, and rotavirus. The largest number of different pathogens was found for the treatment works and the distribution network. The largest number of affected consumers with gastrointestinal illness was for contamination events from a surface water source, while the largest number of individual events occurred for the distribution network.

  15. A Short Overview of Ebola Outbreak

    Directory of Open Access Journals (Sweden)

    Masumeh Saeidi

    2014-10-01

    Full Text Available   Ebola virus disease (formerly known as Ebola haemorrhagic fever is a severe, often fatal illness, with a death rate of up to 90%. The illness affects humans and nonhuman primates (monkeys, gorillas, and chimpanzees. Ebola first appeared in 1976 in two simultaneous outbreaks, one in a village near the Ebola River in the Democratic Republic of Congo, and the other in a remote area of Sudan. The origin of the virus is unknown but fruit bats (Pteropodidae are considered the likely host of the Ebola virus, based on available evidence. In the current outbreak in West Africa, the majority of cases in humans have occurred as a result of human-to-human transmission. Infection occurs from direct contact through broken skin or mucous membranes with the blood, or other bodily fluids or secretions (stool, urine, saliva, semen of infected people.

  16. Acute bovine viral diarrhea associated with extensive mucosal lesions, high morbidity, and mortality in a commercial feedlot.

    Science.gov (United States)

    Hessman, Bill E; Sjeklocha, David B; Fulton, Robert W; Ridpath, Julia F; Johnson, Bill J; McElroy, Diana R

    2012-03-01

    In 2008, a northwest Texas feedlot underwent an outbreak of Bovine viral diarrhea virus (BVDV) causing high morbidity and mortality involving 2 lots of calves (lots A and B). Severe mucosal surface lesions were observed grossly in the oral cavity, larynx, and esophagus. Mucosal lesions varied from small (1-3 mm) infrequent mucosal ulcerations to large (5 mm to 1 cm) and coalescing ulcerations. Necrotic debris was present in ulcerations of some mortalities with some having plaque-like debris, but other mortalities presented more proliferative lesions. A calf persistently infected with BVDV arrived with one lot and the isolated virus was genotyped as BVDV-1b. Identical BVDV-1b strains were isolated from 2 other mortalities. A BVDV-2a genotype was also isolated in this outbreak. This genotype was identical to all BVDV-2a strains isolated in both lots. Serum samples were collected from exposed and unexposed animals and tested for antibodies for multiple viral pathogens. Seropositivity ranged from zero percent for calicivirus to 100% positive to Pseudocowpox virusx. At the end of the feeding period, the morbidity and mortality for the 2 lots involved was 76.2% and 30.8%, respectively, for lot A, and 49.0% and 5.6%, respectively, for lot B. Differential diagnoses included vesicular stomatitis viruses, Bovine papular stomatitis virus, and Foot-and-mouth disease virus. Based on the present case, acute BVDV should be considered when mucosal lesions are observed grossly.

  17. Bovine Eimeria species in Austria.

    Science.gov (United States)

    Koutny, H; Joachim, A; Tichy, A; Baumgartner, W

    2012-05-01

    Bovine eimeriosis is considered to be of considerable importance for the productivity and health of cattle worldwide. Despite the importance of cattle farming in Austria, little is known in this country about the abundance and distribution of bovine Eimeria spp. The objective of this study was to obtain detailed information about the occurrence of different Eimeria spp. on Austrian dairy farms. Fecal samples from individual calves (n = 868) from 296 farms all over Austria (82 districts) were collected. Additionally, each farmer was questioned about the occurrence of calf diarrhea, and about the knowledge on coccidiosis and possible control measures. On 97.97% of the investigated farms, calves excreted Eimeria oocysts, and 83.67% of the individual samples were positive. After sporulation of positive samples pooled from each farm, 11 Eimeria species were found, with E. bovis (in 65.54% of the samples and 27.74% of the farms), E.zuernii (63.85%/13.86%), E. auburnensis (56.76%/13.41%) and E. ellipsoidalis (54.05%/14.38%) being the most prevalent, followed by E. alabamensis (45.61%/11.56%), E. subspherica (35.14%/5.5.05%), E. cylindrica (33.11%/7.00%), and E. canadensis (31.08%/7.74%). E. wyomingensis, E. pellita and E. bukidnonensis were only found sporadically (3.04-4.73% of the samples and 0.16-0.59% of the farms). Mixed infections were present on all farms (2-9 Eimeria species/farm). Prevalences by state provinces were high throughout with 77.1-87.9% of the samples and 93.8-100% of the farms. Lower Austria had the highest percentage of positive farms, and Vorarlberg the lowest. Individual OPG (oocysts per gram of feces) values were generally low; 75% of the samples had an OPG of 1,000 or less. The highest detected OPG was 72,400. The mean OPG was 2,525 with above average numbers in Tirol, Carinthia, and Lower Austria. The mean OPG values were significantly positively correlated with the cattle density in the different districts. The majority of the samples were from

  18. Bovine Spongiform Encephalopathy (BSE), or Mad Cow Disease

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search the CDC Bovine Spongiform Encephalopathy (BSE), or Mad Cow Disease Note: ... gov . Recommend on Facebook Tweet Share Compartir BSE (bovine spongiform encephalopathy) is a progressive neurological disorder of ...

  19. Investigation of the prevalence of bovine tuberculosis and risk ...

    African Journals Online (AJOL)

    Investigation of the prevalence of bovine tuberculosis and risk factors for human infection with bovine tuberculosis among dairy and non-dairy farming neighbour households in Dagoretti Division, Nairobi, Kenya.

  20. Pneumonic Plague Outbreak, Northern Madagascar, 2011

    OpenAIRE

    Richard, Vincent; Riehm, Julia M.; Herindrainy, Perlinot; Soanandrasana , Rahelinirina; Ratsitoharina, Maherisoa; Rakotomanana, Fanjasoa; Andrianalimanana, Samuel; Scholz, Holger C; Rajerison, Minoarisoa

    2015-01-01

    International audience; Yersinia pestis, the causative agent of plague, is endemic to Madagascar, particularly to the central highlands. Although plague has not been previously reported in northern Madagascar, an outbreak of pneumonic plague occurred in this remote area in 2011. Over a 27-day period , 17 suspected, 2 presumptive, and 3 confirmed human cases were identified,and all 15 of untreated patients died. Molecular typing of Y. pestis isolated from 2 survivors and 5 Rattus rattus rat sa...

  1. Extreme weather events and infectious disease outbreaks

    OpenAIRE

    McMichael, Anthony J

    2015-01-01

    Human-driven climatic changes will fundamentally influence patterns of human health, including infectious disease clusters and epidemics following extreme weather events. Extreme weather events are projected to increase further with the advance of human-driven climate change. Both recent and historical experiences indicate that infectious disease outbreaks very often follow extreme weather events, as microbes, vectors and reservoir animal hosts exploit the disrupted social and environmental c...

  2. A dynamical model for bark beetle outbreaks.

    Science.gov (United States)

    Křivan, Vlastimil; Lewis, Mark; Bentz, Barbara J; Bewick, Sharon; Lenhart, Suzanne M; Liebhold, Andrew

    2016-10-21

    Tree-killing bark beetles are major disturbance agents affecting coniferous forest ecosystems. The role of environmental conditions on driving beetle outbreaks is becoming increasingly important as global climatic change alters environmental factors, such as drought stress, that, in turn, govern tree resistance. Furthermore, dynamics between beetles and trees are highly nonlinear, due to complex aggregation behaviors exhibited by beetles attacking trees. Models have a role to play in helping unravel the effects of variable tree resistance and beetle aggregation on bark beetle outbreaks. In this article we develop a new mathematical model for bark beetle outbreaks using an analogy with epidemiological models. Because the model operates on several distinct time scales, singular perturbation methods are used to simplify the model. The result is a dynamical system that tracks populations of uninfested and infested trees. A limiting case of the model is a discontinuous function of state variables, leading to solutions in the Filippov sense. The model assumes an extensive seed-bank so that tree recruitment is possible even if trees go extinct. Two scenarios are considered for immigration of new beetles. The first is a single tree stand with beetles immigrating from outside while the second considers two forest stands with beetle dispersal between them. For the seed-bank driven recruitment rate, when beetle immigration is low, the forest stand recovers to a beetle-free state. At high beetle immigration rates beetle populations approach an endemic equilibrium state. At intermediate immigration rates, the model predicts bistability as the forest can be in either of the two equilibrium states: a healthy forest, or a forest with an endemic beetle population. The model bistability leads to hysteresis. Interactions between two stands show how a less resistant stand of trees may provide an initial toe-hold for the invasion, which later leads to a regional beetle outbreak in the

  3. Nosocomial outbreak of cryptosporidiosis in AIDS patients

    DEFF Research Database (Denmark)

    Ravn, Pernille; Lundgren, Jens Dilling; Kjaeldgaard, P

    1991-01-01

    OBJECTIVE--To describe a nosocomial outbreak of cryptosporidiosis during four months after June 1989. SETTING--A department of infectious diseases in Copenhagen, seeing about half the patients with AIDS in Denmark. SUBJECTS--73 HIV antibody negative subjects and 60 antibody positive subjects.......05). CONCLUSIONS--The clinical and epidemiological findings indicate that infection was the consequence of very small inocula. Increased sensitivity to cryptosporidiosis may be an unrecognised side effect of oral sulphonamide treatment in patients with AIDS....

  4. Nosocomial outbreak of Pseudomonas aeruginosa endophthalmitis.

    Science.gov (United States)

    Mateos, I; Valencia, R; Torres, M J; Cantos, A; Conde, M; Aznar, J

    2006-11-01

    We describe an outbreak of nosocomial endophthalmitis due to a common source, which was determined to be trypan blue solution prepared in the hospital's pharmacy service. We assume that viable bacteria probably gained access to the trypan blue stock solution during cooling after autoclaving. The temporal cluster of Pseudomonas aeruginosa endophthalmitis was readily perceived on the basis of clinical and microbiological findings, and an exogenous source of contamination was unequivocally identified by means of DNA fingerprinting.

  5. Metagenomic Detection Methods in Biopreparedness Outbreak Scenarios

    DEFF Research Database (Denmark)

    Karlsson, Oskar Erik; Hansen, Trine; Knutsson, Rickard

    2013-01-01

    of a clinical sample, creating a metagenome, in a single week of laboratory work. As new technologies emerge, their dissemination and capacity building must be facilitated, and criteria for use, as well as guidelines on how to report results, must be established. This article focuses on the use of metagenomics......, gaps in research, and future directions. Examples of metagenomic detection, as well as possible applications of the methods, are described in various biopreparedness outbreak scenarios....

  6. Nosocomial outbreak of cryptosporidiosis in AIDS patients.

    Science.gov (United States)

    Ravn, P; Lundgren, J D; Kjaeldgaard, P; Holten-Anderson, W; Højlyng, N; Nielsen, J O; Gaub, J

    1991-02-02

    To describe a nosocomial outbreak of cryptosporidiosis during four months after June 1989. A department of infectious diseases in Copenhagen, seeing about half the patients with AIDS in Denmark. 73 HIV antibody negative subjects and 60 antibody positive subjects admitted as inpatients during the transmission period of the outbreak (20 June-14 August), of whom 18 (17 with AIDS, one with AIDS related complex), developed cryptosporidiosis. Two further HIV negative subjects (one departmental secretary, one visiting relative) developed cryptosporidiosis. Cryptosporidia in stool samples, clinical symptoms, CD4 cell count, HIV antigen concentration, chemotherapeutic treatment. The source of the outbreak was identified as ice from an ice machine in the ward, contaminated by an incontinent, psychotic patient with cryptosporidiosis picking out ice for cold drinks. The mean incubation time was at least 13 days-that is, twice that in HIV-negative patients. Of the 18 patients with AIDS who developed cryptosporidiosis, five recovered, two were symptomless carriers, three died of unrelated causes, and eight died after prolonged diarrhoea. Among the 57 exposed HIV antibody positive inpatients (excluding two patients and the index case with cryptosporidiosis diagnosed elsewhere), significantly more of those who developed symptomatic cryptosporidiosis received oral sulphonamides than those who did not (91%, 10/11 v 48%, 21/44, p less than 0.05). The clinical and epidemiological findings indicate that infection was the consequence of very small inocula. Increased sensitivity to cryptosporidiosis may be an unrecognised side effect of oral sulphonamide treatment in patients with AIDS.

  7. Outbreak of Enterovirus - 71 Meningitis in Calicut

    Directory of Open Access Journals (Sweden)

    CK Sasidharan

    2016-04-01

    Full Text Available Objective: Enterovirus 71(EV 71 causes wide spectrum of infections ranging from asymptomatic conditions to clinical syndromes like diarrhea, rash, hand-foot-and mouth disease (HFMD, herpangina, aseptic meningitis, encephalitis, myocarditis, acute flaccid paralysis, bulbar and brainstem encephalitis Guillain Barre syndrome, pulmonary haemorrhage. This study deals with an outbreak of aseptic meningitis in children caused by EV 71 virus. Methods: The authors report an outbreak of aseptic meningitis in children in and around Calicut in June 2008. Clinical and laboratory study was done in collaboration with National Centre for Disease Control, New Delhi. 149 children with aseptic meningitis were studied and followed up from June 2008 to May 2009. Result: All children had clinical features suggestive of aseptic meningitis and serology showed the rising antibody titre against EV 71 virus infection. CSF analysis also showed four fold rise in antibodies in one and ≥ 1:2 neutralising antibodies titer against EV- 71 in four samples indicating meningitis due to EV-71. Conclusion: EV 71 was identified as the causative agent of the outbreak of aseptic meningitis in the study and the fact that the EV 71 infection has evolved from minor illness like HFMD to major illness like aseptic meningitis from the same locality is truly alarming.

  8. Methylisothiazolinone outbreak in the European Union.

    Science.gov (United States)

    Latheef, Faheem; Wilkinson, Stephen Mark

    2015-10-01

    The aim of this review was to examine the current outbreak of cases of contact allergy to methylisothiazolinone in Europe, a phenomenon that has also been observed worldwide, despite initial legislative control of the introduction of methylisothiazolinone into the market. Reported allergic contact reactions are primarily eczematous, most commonly in women over 40 from cosmetic use, but there are reports of noneczematous eruptions such as lichen planus-like or lymphomatoid reactions. Methylisothiazolinone in cosmetic, personal care, for example, wet wipe, and household products are the most common exposure. Occupational exposure is represented by workplace use of hygiene (healthcare) and beauty products (hairdressers, beauticians) together with water-based paints and other aqueous solutions such as cutting fluid.Methylisothiazolinone should be patch tested at a concentration of 2000 ppm (0.2% aqueous) to maximize sensitivity of the test.Notwithstanding the recommendation to discontinue the use of methylisothiazolinone in leave-on cosmetics, studies suggest safer use of concentrations should also be determined for rinse-off products. Legislation to improve labelling of industrial materials is also required.Going forward there is a need for collaboration between the cosmetic industry and interested physicians to break the recurrent cycle of sensitization to preservatives as one is replaced with another to maintain the risk of sensitization at an acceptably low level. Methylisothiazolinone is particularly relevant at present as strategies to control the outbreak are yet to be enforced and there is no current evidence of the outbreak abating.

  9. Avalanche outbreaks emerging in cooperative contagions

    Science.gov (United States)

    Cai, Weiran; Chen, Li; Ghanbarnejad, Fakhteh; Grassberger, Peter

    2015-11-01

    The spreading of contagions can exhibit a percolation transition, which separates transitory prevalence from outbreaks that reach a finite fraction of the population. Such transitions are commonly believed to be continuous, but empirical studies have shown more violent spreading modes when the participating agents are not limited to one type. Striking examples include the co-epidemic of the Spanish flu and pneumonia that occurred in 1918 (refs , ), and, more recently, the concurrent prevalence of HIV/AIDS and a host of diseases. It remains unclear to what extent an outbreak in the presence of interacting pathogens differs from that due to an ordinary single-agent process. Here we study a mechanistic model for understanding contagion processes involving inter-agent cooperation. Our stochastic simulations reveal the possible emergence of a massive avalanche-like outbreak right at the threshold, which is manifested as a discontinuous phase transition. Such an abrupt change arises only if the underlying network topology supports a bottleneck for cascaded mutual infections. Surprisingly, all these discontinuous transitions are accompanied by non-trivial critical behaviours, presenting a rare case of hybrid transition. The findings may imply the origin of catastrophic occurrences in many realistic systems, from co-epidemics to financial contagions.

  10. Arachidonate metabolism in bovine gallbladder muscle

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, M.; Hidaka, T.; Ueta, T.; Ogura, R.

    1983-04-01

    Incubation of (1-/sup 14/C)arachidonic acid (AA) with homogenates of bovine gallbladder muscle generated a large amount of radioactive material having the chromatographic mobility of 6-keto-PGF1 alpha (stable product of PGI2) and smaller amounts of products that comigrated with PGF2 alpha PGE2. Formation of these products was inhibited by the cyclooxygenase inhibitor indomethacin. The major radioactive product identified by thin-layer chromatographic mobility and by gas chromatography - mass spectrometric analysis was found to be 6-keto-PGF1 alpha. The quantitative metabolic pattern of (1-/sup 14/C)PGH2 was virtually identical to that of (1-/sup 14/C)AA. Incubation of arachidonic acid with slices of bovine gallbladder muscle released labile anti-aggregatory material in the medium, which was inhibited by aspirin or 15-hydroperoxy-AA. These results indicate that bovine gallbladder muscle has a considerable enzymatic capacity to produce PGI2 from arachidonic acid.

  11. Bovine viral diarrhoea, bovine herpesvirus and parainfluenza-3 virus infection in three cattle herds in Egypt in 2000.

    Science.gov (United States)

    Aly, N M; Shehab, G G; Abd el-Rahim, I H A

    2003-12-01

    This study reported field outbreaks of bovine viral diarrhoea virus (BVDV) infection, either alone or mixed with bovine herpesvirus-1 (BHV-1) and/or parainfluenza-3 virus (PI-3V) in Egypt during 2000. In Lower Egypt, young calves in three cattle herds in El-Minufiya Province, El-Fayoum Province and in governmental quarantine in El-Behira Province, showed symptoms of enteritis, either alone or accompanied by respiratory manifestations. The affected herds were visited and the diseased animals were clinically examined. Many epidemiological aspects, such as morbidities, mortalities and case fatalities, as well as the abortive rate, were calculated. Ethylenediamine tetra-acetic acid-blood samples, sterile nasal swabs and serum samples were obtained for virological and serological diagnosis. The laboratory investigations revealed that the main cause of calf mortalities in the three herds was infection with BVDV, either alone, as on the El-Minufiya farm, or mixed with PI-3V, as on the El-Fayoum farm, or mixed with both BHV-1 and PI-3V, as in the herd in governmental quarantine in El-Behira Province. A total of nine dead calves from the three herds were submitted for thorough post-mortem examination. Tissue samples from recently dead calves were obtained for immunohistochemical and histopathological studies. The most prominent histopathological findings were massive degeneration, necrosis and erosions of the lining epithelium of the alimentary tract. Most of the lymphoreticular organs were depleted of lymphocytes. In pneumonic cases, bronchopneumonia and atypical interstitial pneumonia were evident. The present study suggested that the immunosuppressive effect of BVDV had predisposed the animals to secondary infection with BHV-1 and PI-3V. This study concluded that concurrent infection with BVDV, BHV-1 and PI-3V should be considered as one of the infectious causes of pneumoenteritis and, subsequently, the high morbidities and mortalities among young calves in Egypt

  12. Protection against bovine leukosis virus infection in sheep with the BL 20 bovine lymphoblastoid cell line.

    Science.gov (United States)

    Roberts, D H; Lucas, M H; Sands, J; Wibberley, G

    1982-11-01

    The bovine lymphoblastoid BL 20 cell line derived from a case of sporadic bovine leukosis when inoculated into sheep did not induce an antibody response directed against bovine leukosis virus (BLV) structural proteins. Sheep were inoculated twice with the BL 20 cell line and then challenged with BLV infected lymphocytes. Three out of four sheep challenged four weeks after BL 20 inoculation did not develop BLV antibodies. Of the 12 sheep challenged later, three sheep did not develop BLV antibodies. BLV was isolated from all the seropositive animals and from none of the seronegative animals.

  13. Biology and outbreaks of Microdiprion pallipes (Hymenoptera; Diprionidae) in Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Olofsson, E. (Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Entomology)

    1994-01-01

    During outbreaks, Microdiprion pallipes (Fall.) is the most destructive of the pine sawflies in Sweden. Its distribution includes most provinces, but damaging outbreaks have until recently occurred only in two inland areas in northern Sweden. These areas are characterised by high elevation, a harsh climate, and slow tree growth. The four recorded outbreak periods showed a 10 year periodicity. Outside these areas, a lesser outbreak occurred in 1988 to 1990, on the east coast (province of Uppland). Outbreak patterns, life history variation, and mortality factors were studied. Factors that may explain the distribution of outbreaks and the population patterns were identified.Experimental and observational evidence on the potential of various factors to influence fecundity, dispersal, and survival was evaluated. In the outbreak areas, there were few major population factors. Parasitism by Rhorus substitutor (Thunb.) was the largest cause of larval mortality and the only important density-dependent mortality factor. The different diapause strategies of M. pallipes and R. substitutor may contribute to stabilize this system. Different flight periods of the host and the parasitoid may explain a possible correlation between weather and outbreaks. Elsewhere in Sweden, where low population densities prevail, there may be similarities in population processes between M. pallipes and the other widely distributed diprionids with solitary larvae, which never have attained outbreak densities in Sweden. Interactions with other diprionids through shared natural enemies may be an important population process and may influence the distribution of outbreaks. 37 refs, 4 figs, 11 tabs

  14. Geometrid outbreak waves travel across Europe.

    Science.gov (United States)

    Tenow, Olle; Nilssen, Arne C; Bylund, Helena; Pettersson, Rickard; Battisti, Andrea; Bohn, Udo; Caroulle, Fabien; Ciornei, Constantin; Csóka, György; Delb, Horst; De Prins, Willy; Glavendekić, Milka; Gninenko, Yuri I; Hrašovec, Boris; Matošević, Dinka; Meshkova, Valentyna; Moraal, Leen; Netoiu, Constantin; Pajares, Juan; Rubtsov, Vasily; Tomescu, Romica; Utkina, Irina

    2013-01-01

    We show that the population ecology of the 9- to 10-year cyclic, broadleaf-defoliating winter moth (Operophtera brumata) and other early-season geometrids cannot be fully understood on a local scale unless population behaviour is known on a European scale. Qualitative and quantitative data on O. brumata outbreaks were obtained from published sources and previously unpublished material provided by authors of this article. Data cover six decades from the 1950s to the first decade of twenty-first century and most European countries, giving new information fundamental for the understanding of the population ecology of O. brumata. Analyses on epicentral, regional and continental scales show that in each decade, a wave of O. brumata outbreaks travelled across Europe. On average, the waves moved unidirectionally ESE-WNW, that is, toward the Scandes and the Atlantic. When one wave reached the Atlantic coast after 9-10 years, the next one started in East Europe to travel the same c. 3000 km distance. The average wave speed and wavelength was 330 km year(-1) and 3135 km, respectively, the high speed being incongruous with sedentary geometrid populations. A mapping of the wave of the 1990s revealed that this wave travelled in a straight E-W direction. It therefore passed the Scandes diagonally first in the north on its way westward. Within the frame of the Scandes, this caused the illusion that the wave moved N-S. In analogy, outbreaks described previously as moving S-N or occurring contemporaneously along the Scandes were probably the result of continental-scale waves meeting the Scandes obliquely from the south or in parallel. In the steppe zone of eastern-most and south-east Europe, outbreaks of the winter moth did not participate in the waves. Here, broadleaved stands are small and widely separated. This makes the zone hostile to short-distance dispersal between O. brumata subpopulations and prevents synchronization within meta-populations. We hypothesize that hostile

  15. 21 CFR 522.1125 - Hemoglobin glutamer-200 (bovine).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Hemoglobin glutamer-200 (bovine). 522.1125 Section... § 522.1125 Hemoglobin glutamer-200 (bovine). (a) Specifications. Each 125 milliliter bag contains 13 grams per deciliter of polymerized hemoglobin of bovine origin in modified Lactated Ringer's Solution...

  16. Sexing bovine pre-implantation embryos using the polymerase ...

    African Journals Online (AJOL)

    The paper aims to present a bovine model for human embryo sexing. Cows were super-ovulated, artificially inseminated and embryos were recovered 7 days later. Embryo biopsy was performed; DNA was extracted from blastomeres and amplified using bovine-specific and bovine-Y-chromosomespecific primers, followed ...

  17. 9 CFR 113.216 - Bovine Rhinotracheitis Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... cultures for vaccine production. All serials of vaccine shall be prepared from the first through the fifth... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Bovine Rhinotracheitis Vaccine, Killed... REQUIREMENTS Killed Virus Vaccines § 113.216 Bovine Rhinotracheitis Vaccine, Killed Virus. Infectious Bovine...

  18. 9 CFR 113.311 - Bovine Virus Diarrhea Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Bovine Virus Diarrhea Vaccine. 113.311... Virus Vaccines § 113.311 Bovine Virus Diarrhea Vaccine. Bovine Virus Diarrhea Vaccine shall be prepared..., and immunogenic shall be used for preparing the production seed virus for vaccine production. All...

  19. 9 CFR 113.310 - Bovine Rhinotracheitis Vaccine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Bovine Rhinotracheitis Vaccine. 113... REQUIREMENTS Live Virus Vaccines § 113.310 Bovine Rhinotracheitis Vaccine. Bovine Rhinotracheitis Vaccine shall... as pure, safe, and immunogenic shall be used for preparing the production seed virus for vaccine...

  20. Cloning and sequencing of the bovine gastrin gene

    DEFF Research Database (Denmark)

    Lund, T; Rehfeld, J F; Olsen, Jørgen

    1989-01-01

    In order to deduce the primary structure of bovine preprogastrin we therefore sequenced a gastrin DNA clone isolated from a bovine liver cosmid library. Bovine preprogastrin comprises 104 amino acids and consists of a signal peptide, a 37 amino acid spacer-sequence, the gastrin-34 sequence followed...

  1. Effect of melatonin on in vitro maturation of bovine oocytes ...

    African Journals Online (AJOL)

    ... Vs 17.67, 15.68, 16.53). In conclusion in this experiment, melatonin cannot improve cumulus cell expansion and nuclear maturation of bovine oocytes. When concentrations is high, melatonin may affect bovine oocytes meiotic maturation at metaphase-1 stage, but it is improbable melatonin be toxic for bovine oocytes.

  2. 76 FR 38602 - Bovine Tuberculosis and Brucellosis; Program Framework

    Science.gov (United States)

    2011-07-01

    ... Animal and Plant Health Inspection Service Bovine Tuberculosis and Brucellosis; Program Framework AGENCY... extending the comment period on a new framework being developed for the bovine tuberculosis and brucellosis... bovine brucellosis in the United States. The notice stated that USDA would hold four public meetings...

  3. 76 FR 26239 - Bovine Tuberculosis and Brucellosis; Public Meetings

    Science.gov (United States)

    2011-05-06

    ...; ] DEPARTMENT OF AGRICULTURE Animal and Plant Health Inspection Service Bovine Tuberculosis and Brucellosis... framework being developed for the bovine tuberculosis and brucellosis programs in the United States. The... tuberculosis (TB) and bovine brucellosis in the United States. In keeping with its commitment to partnering...

  4. Epidemiology of foodborne Norovirus outbreaks in Catalonia, Spain

    Science.gov (United States)

    Martinez, Ana; Dominguez, Angela; Torner, Nuria; Ruiz, Laura; Camps, Neus; Barrabeig, Irene; Arias, Cesar; Alvarez, Josep; Godoy, Pere; Balaña, Pilar Jorgina; Pumares, Analia; Bartolome, Rosa; Ferrer, Dolors; Perez, Unai; Pinto, Rosa; Buesa, Javier

    2008-01-01

    Background Noroviruses are one of the principal biological agents associated with the consumption of contaminated food. The objective of this study was to analyse the size and epidemiological characteristics of foodborne outbreaks of gastroenteritis in Catalonia, a region in the northeast of Spain. Methods In all reported outbreaks of gastroenteritis associated with food consumption, faecal samples of persons affected were analysed for bacteria and viruses and selectively for parasites. Study variables included the setting, the number of people exposed, age, sex, clinical signs and hospital admissions. The study was carried out from October 2004 to October 2005. Results Of the 181 outbreaks reported during the study period, 72 were caused by Salmonella and 30 by norovirus (NoV); the incidence rates were 14.5 and 9.9 per 100,000 person-years, respectively. In 50% of the NoV outbreaks and 27% of the bacterial outbreaks (p = 0.03) the number of persons affected was ≥10; 66.7% of NoV outbreaks occurred in restaurants; no differences in the attack rates were observed according to the etiology. Hospitalizations were more common (p = 0.03) in bacterial outbreaks (8.6%) than in NoV outbreaks (0.15%). Secondary cases accounted for 4% of cases in NoV outbreaks compared with 0.3% of cases in bacterial outbreaks (p < 0.001) Conclusion Norovirus outbreaks were larger but less frequent than bacterial outbreaks, suggesting that underreporting is greater for NoV outbreaks. Food handlers should receive training on the transmission of infections in diverse situations. Very strict control measures on handwashing and environmental disinfection should be adopted in closed or partially-closed institutions. PMID:18410687

  5. Epidemiology of foodborne Norovirus outbreaks in Catalonia, Spain

    Directory of Open Access Journals (Sweden)

    Godoy Pere

    2008-04-01

    Full Text Available Abstract Background Noroviruses are one of the principal biological agents associated with the consumption of contaminated food. The objective of this study was to analyse the size and epidemiological characteristics of foodborne outbreaks of gastroenteritis in Catalonia, a region in the northeast of Spain. Methods In all reported outbreaks of gastroenteritis associated with food consumption, faecal samples of persons affected were analysed for bacteria and viruses and selectively for parasites. Study variables included the setting, the number of people exposed, age, sex, clinical signs and hospital admissions. The study was carried out from October 2004 to October 2005. Results Of the 181 outbreaks reported during the study period, 72 were caused by Salmonella and 30 by norovirus (NoV; the incidence rates were 14.5 and 9.9 per 100,000 person-years, respectively. In 50% of the NoV outbreaks and 27% of the bacterial outbreaks (p = 0.03 the number of persons affected was ≥10; 66.7% of NoV outbreaks occurred in restaurants; no differences in the attack rates were observed according to the etiology. Hospitalizations were more common (p = 0.03 in bacterial outbreaks (8.6% than in NoV outbreaks (0.15%. Secondary cases accounted for 4% of cases in NoV outbreaks compared with 0.3% of cases in bacterial outbreaks (p Conclusion Norovirus outbreaks were larger but less frequent than bacterial outbreaks, suggesting that underreporting is greater for NoV outbreaks. Food handlers should receive training on the transmission of infections in diverse situations. Very strict control measures on handwashing and environmental disinfection should be adopted in closed or partially-closed institutions.

  6. Bovine rotavirus pentavalent vaccine development in India.

    Science.gov (United States)

    Zade, Jagdish K; Kulkarni, Prasad S; Desai, Sajjad A; Sabale, Rajendra N; Naik, Sameer P; Dhere, Rajeev M

    2014-08-11

    A bovine rotavirus pentavalent vaccine (BRV-PV) containing rotavirus human-bovine (UK) reassortant strains of serotype G1, G2, G3, G4 and G9 has been developed by the Serum Institute of India Ltd, in collaboration with the National Institute of Allergy and Infectious Diseases (NIAID), USA. The vaccine underwent animal toxicity studies and Phase I and II studies in adults, toddlers and infants. It has been found safe and immunogenic and will undergo a large Phase III study to assess efficacy against severe rotavirus gastroenteritis. Copyright © 2014. Published by Elsevier Ltd.

  7. Clinical applications of bovine colostrum therapy

    DEFF Research Database (Denmark)

    Rathe, Mathias; Müller, Klaus; Sangild, Per Torp

    2014-01-01

    Bovine colostrum, the first milk that cows produce after parturition, contains high levels of growth factors and immunomodulatory components. Some healthy and diseased individuals may gain health benefits by consuming bovine colostrum as a food supplement. This review provides a systematic......, critical evaluation of the current state of knowledge in this area. Fifty-one eligible studies were identified from the following databases: Medline, Embase, Global Health, the Cochrane Library, and the Cumulative Index to Nursing and Allied Health Literature. Studies were heterogeneous with regard...

  8. Heterogeneity of Bovine Peripheral Blood Monocytes

    Directory of Open Access Journals (Sweden)

    Jamal Hussen

    2017-12-01

    Full Text Available Peripheral blood monocytes of several species can be divided into different subpopulations with distinct phenotypic and functional properties. Herein, we aim at reviewing published work regarding the heterogeneity of the recently characterized bovine monocyte subsets. As the heterogeneity of human blood monocytes was widely studied and reviewed, this work focuses on comparing bovine monocyte subsets with their human counterparts regarding their phenotype, adhesion and migration properties, inflammatory and antimicrobial functions, and their ability to interact with neutrophilic granulocytes. In addition, the differentiation of monocyte subsets into functionally polarized macrophages is discussed. Regarding phenotype and distribution in blood, bovine monocyte subsets share similarities with their human counterparts. However, many functional differences exist between monocyte subsets from the two species. In contrast to their pro-inflammatory functions in human, bovine non-classical monocytes show the lowest phagocytosis and reactive oxygen species generation capacity, an absent ability to produce the pro-inflammatory cytokine IL-1β after inflammasome activation, and do not have a role in the early recruitment of neutrophils into inflamed tissues. Classical and intermediate monocytes of both species also differ in their response toward major monocyte-attracting chemokines (CCL2 and CCL5 and neutrophil degranulation products (DGP in vitro. Such differences between homologous monocyte subsets also extend to the development of monocyte-derived macrophages under the influence of chemokines like CCL5 and neutrophil DGP. Whereas the latter induce the differentiation of M1-polarized macrophages in human, bovine monocyte-derived macrophages develop a mixed M1/M2 macrophage phenotype. Although only a few bovine clinical trials analyzed the correlation between changes in monocyte composition and disease, they suggest that functional differences between

  9. Bovine Norovirus: Carbohydrate Ligand, Environmental Contamination, and Potential Cross-Species Transmission via Oysters ▿ †

    Science.gov (United States)

    Zakhour, Maha; Maalouf, Haifa; Di Bartolo, Ilaria; Haugarreau, Larissa; Le Guyader, Françoise S.; Ruvoën-Clouet, Nathalie; Le Saux, Jean-Claude; Ruggeri, Franco Maria; Pommepuy, Monique; Le Pendu, Jacques

    2010-01-01

    Noroviruses (NoV) are major agents of acute gastroenteritis in humans and the primary pathogens of shellfish-related outbreaks. Previous studies showed that some human strains bind to oyster tissues through carbohydrate ligands that are similar to their human receptors. Thus, based on presentation of shared norovirus carbohydrate ligands, oysters could selectively concentrate animal strains with increased ability to overcome species barriers. In comparison with human GI and GII strains, bovine GIII NoV strains, although frequently detected in bovine feces and waters of two estuaries of Brittany, were seldom detected in oysters grown in these estuaries. Characterization of the carbohydrate ligand from a new GIII strain indicated recognition of the alpha-galactosidase (α-Gal) epitope not expressed by humans, similar to the GIII.2 Newbury2 strain. This ligand was not detectable on oyster tissues, suggesting that oysters may not be able to accumulate substantial amounts of GIII strains due to the lack of shared carbohydrate ligand and that they should be unable to contribute to select GIII strains with an increased ability to recognize humans. PMID:20709837

  10. Bovine norovirus: carbohydrate ligand, environmental contamination, and potential cross-species transmission via oysters.

    Science.gov (United States)

    Zakhour, Maha; Maalouf, Haifa; Di Bartolo, Ilaria; Haugarreau, Larissa; Le Guyader, Françoise S; Ruvoën-Clouet, Nathalie; Le Saux, Jean-Claude; Ruggeri, Franco Maria; Pommepuy, Monique; Le Pendu, Jacques

    2010-10-01

    Noroviruses (NoV) are major agents of acute gastroenteritis in humans and the primary pathogens of shellfish-related outbreaks. Previous studies showed that some human strains bind to oyster tissues through carbohydrate ligands that are similar to their human receptors. Thus, based on presentation of shared norovirus carbohydrate ligands, oysters could selectively concentrate animal strains with increased ability to overcome species barriers. In comparison with human GI and GII strains, bovine GIII NoV strains, although frequently detected in bovine feces and waters of two estuaries of Brittany, were seldom detected in oysters grown in these estuaries. Characterization of the carbohydrate ligand from a new GIII strain indicated recognition of the alpha-galactosidase (α-Gal) epitope not expressed by humans, similar to the GIII.2 Newbury2 strain. This ligand was not detectable on oyster tissues, suggesting that oysters may not be able to accumulate substantial amounts of GIII strains due to the lack of shared carbohydrate ligand and that they should be unable to contribute to select GIII strains with an increased ability to recognize humans.

  11. The bovine tuberculosis burden in cattle herds in zones with low dose radiation pollution in Ukraine

    Directory of Open Access Journals (Sweden)

    Svitlana Pozmogova

    2009-06-01

    Full Text Available The authors describe a study of the tuberculosis (TB incidence in cattle exposed to low doses of radiation resulting from the Chernobyl (pronounced ‘Chornobyl’ in Ukrainian nuclear plant catastrophe in 1986. The purpose of the study was to determine if ionising radiation influences the number of outbreaks of bovine TB and their severity on farms in the Kyiv, Cherkasy and Chernigiv regions of Ukraine. These farms are all located within a 200 km radius of Chernobyl and have had low-dose radiation pollution. Pathological and blood samples were taken from cattle in those regions that had positive TB skin tests. Mycobacterium spp. were isolated, differentiated by PCR, analysed and tested in guinea-pigs and rabbits. Species differentiation showed a significant percentage of atypical mycobacteria, which resulted in the allergic reactions to tuberculin antigen in the skin test. Mixed infection of M. bovis and M. avium subsp. hominissuis was found in three cases. The results concluded that low-dose radiation plays a major role in the occurrence of bovine TB in regions affected by the Chernobyl nuclear disaster.

  12. Recombinant vaccinia DIs expressing simian immunodeficiency virus gag and pol in mammalian cells induces efficient cellular immunity as a safe immunodeficiency virus vaccine candidate.

    Science.gov (United States)

    Okamura, Tomotaka; Someya, Kenji; Matsuo, Kazuhiro; Hasegawa, Atsuhiko; Yamamoto, Naoki; Honda, Mitsuo

    2006-01-01

    A highly attenuated vaccinia virus substrain of Dairen-I (DIs) shows promise as a candidate vector for eliciting positive immunity against immune deficiency virus. DIs was randomly obtained by serial 1-day egg passages of a chorioarantoic membrane-adapted Dairen strain (DIE), resulting in substantial genomic deletion, including various genes regulating the virus-host-range. To investigate the impact of that deletion and of the subsequent insertion of a foreign gene into that region of DIs on the ability of the DIs recombinant to induce antigen-specific immunity, we generated a recombinant vaccinia DIs expressing fulllength gag and pol genes of simian immunodeficiency virus (SIV) (rDIsSIV gag/pol) and studied the biological and immunological characteristics of the recombinant natural mutant. The rDIsSIV gag/pol developed a tiny plaque on the chick embryo fibroblast (CEF). Viral particles of rDIsSIV gag/pol as well as SIV Gag-like particles were electromicroscopically detected in the cytoplasm. Interestingly, the recombinant DIs strain grows well in CEF cells but not in mammalian cells. While rDIsSIV gag/pol produces SIV proteins in mammalian HeLa and CV-1 cells, recombinant modified vaccinia Ankara strain (MVA) expressing SIV gag and pol genes (MVA/SIV239 gag/pol) clearly replicates in HeLa and CV-1 cell lines under synchronized growth conditions and produces the SIV protein in all cell lines. Moreover, intradermal administration of rDIsSIV gag/pol or of MVA/SIV239 gag/pol elicited similar levels of IFN-gamma spot-forming cells specific for SIV Gag. If the non-productive infection characteristically induced by recombinant DIs is sufficient to trigger immune induction, as we believe it is, then a human immunodeficiency virus vaccine employing the DIs recombinant would have the twin advantages of being both effective and safe.

  13. The NYCBH vaccinia virus deleted for the innate immune evasion gene, E3L, protects rabbits against lethal challenge by rabbitpox virus

    Science.gov (United States)

    Denzler, Karen L; Rice, Amanda D; MacNeill, Amy L; Fukushima, Nobuko; Lindsey, Scott F; Wallace, Greg; Burrage, Andrew M; Smith, Andrew J; Manning, Brandi R; Swetnam, Daniele M; Gray, Stacey A; Moyer, RW; Jacobs, Bertram L

    2011-01-01

    Vaccinia virus deleted for the innate immune evasion gene, E3L, has been shown to be highly attenuated and yet induces a protective immune response against challenge by homologous virus in a mouse model. In this manuscript the NYCBH vaccinia virus vaccine strain was compared to NYCBH vaccinia virus deleted for E3L (NYCBHΔE3L) in a rabbitpox virus (RPV) challenge model. Upon scarification, both vaccines produced a desired skin lesion, although the lesion produced by NYCBHΔE3L was smaller. Both vaccines fully protected rabbits against lethal challenge by escalating doses of RPV, from 10 LD50 to 1,000 LD50. A single dose of NYCBHΔE3L protected rabbits from weight loss, fever, and clinical symptoms following the lowest dose challenge of 10 LD50, however it allowed a moderate level of RPV replication at the challenge site, some spread to external skin and mucosal surfaces, and increased numbers of secondary lesions as compared to vaccination with NYCBH. Alternately, two doses of NYCBHΔE3L fully protected rabbits from weight loss, fever, and clinical symptoms, following challenge with 100 to 1,000 LD50 RPV, and it prevented development of secondary lesions similar to protection seen with NYCBH. Finally, vaccination with either one or two doses of NYCBHΔE3L resulted in similar neutralizing antibody titers following RPV challenge as compared to titers obtained by vaccination with NYCBH. These results support the efficacy of the attenuated NYCBHΔE3L in protection against an orthologous poxvirus challenge. PMID:21840358

  14. Electronic outbreak surveillance in Germany: a first evaluation for nosocomial norovirus outbreaks.

    Directory of Open Access Journals (Sweden)

    Anja M Hauri

    Full Text Available BACKGROUND: In Germany, surveillance for infectious disease outbreaks is integrated into an electronic surveillance system. For 2007, the national surveillance database contains case-based information on 201,224 norovirus cases, three-quarters of which are linked to outbreaks. We evaluated the data quality of the national database in reflecting nosocomial norovirus outbreak (NNO data available in 19 Hessian local public health authorities (LPHAs and the influence of differences between LPHA's follow-up procedures for laboratory notifications of Norovirus positive stool samples on outbreak underascertainment. METHODS: Data on NNO beginning in 2007 and notified to the 19 LPHAs were extracted from the national database, investigated regarding internal validity and compared to data collected from LPHAs for a study on NNO control. LPHAs were questioned whether they routinely contacted all persons for whom a laboratory diagnosis of norovirus infection was notified. The number of outbreaks per 1,000 hospital beds and the number of cases within NNOs for acute care and rehabilitation hospitals were compared between counties with and without complete follow-up. RESULTS: The national database contained information on 155 NNOs, including 3,115 cases. Cases were missed in the national database in 58 (37% of the outbreaks. Information on hospitalisation was incorrect for an estimated 47% of NNO cases. Information on county of infection was incorrect for 24% (199/820 of cases being forwarded between LPHAs for data entry. Reported NNO incidence and number of NNO cases in acute care hospitals was higher in counties with complete follow-up (incidence-rate ratio (IRR 2.7, 95% CI 1.4-5.7, p-value 0.002 and IRR 2.1, 95% CI 1.9-2.4, p-value 0.001, respectively. CONCLUSIONS: Many NNOs are not notified by hospitals and differences in LPHA procedures have an impact on the number of outbreaks captured in the surveillance system. Forwarding of case-by-case data on

  15. Outbreaks Attributed to Cheese: Differences Between Outbreaks Caused by Unpasteurized and Pasteurized Dairy Products, United States, 1998–2011

    Science.gov (United States)

    Gould, L. Hannah; Mungai, Elisabeth; Behravesh, Casey Barton

    2015-01-01

    Introduction The interstate commerce of unpasteurized fluid milk, also known as raw milk, is illegal in the United States, and intrastate sales are regulated independently by each state. However, U.S. Food and Drug Administration regulations allow the interstate sale of certain types of cheeses made from unpasteurized milk if specific aging requirements are met. We describe characteristics of these outbreaks, including differences between outbreaks linked to cheese made from pasteurized or unpasteurized milk. Methods We reviewed reports of outbreaks submitted to the Foodborne Disease Outbreak Surveillance System during 1998–2011 in which cheese was implicated as the vehicle. We describe characteristics of these outbreaks, including differences between outbreaks linked to cheese made from pasteurized versus unpasteurized milk. Results During 1998–2011, 90 outbreaks attributed to cheese were reported; 38 (42%) were due to cheese made with unpasteurized milk, 44 (49%) to cheese made with pasteurized milk, and the pasteurization status was not reported for the other eight (9%). The most common cheese–pathogen pairs were unpasteurized queso fresco or other Mexican-style cheese and Salmonella (10 outbreaks), and pasteurized queso fresco or other Mexican-style cheese and Listeria (6 outbreaks). The cheese was imported from Mexico in 38% of outbreaks caused by cheese made with unpasteurized milk. In at least five outbreaks, all due to cheese made from unpasteurized milk, the outbreak report noted that the cheese was produced or sold illegally. Outbreaks caused by cheese made from pasteurized milk occurred most commonly (64%) in restaurant, delis, or banquet settings where cross-contamination was the most common contributing factor. Conclusions In addition to using pasteurized milk to make cheese, interventions to improve the safety of cheese include limiting illegal importation of cheese, strict sanitation and microbiologic monitoring in cheese-making facilities, and

  16. Enzootic bovine leukosis: report of eradication and surveillance measures in Italy over an 8-year period (2005-2012).

    Science.gov (United States)

    Maresca, C; Costarelli, S; Dettori, A; Felici, A; Iscaro, C; Feliziani, F

    2015-05-01

    Bovine leukaemia virus (BLV) is associated with enzootic bovine leukosis (EBL). BLV causes malignant lymphoma and lymphosarcoma; however, most BLV infections remain clinically silent in an aleukaemic state. EBL is a notifiable disease, and official control measures include screening or monitoring, precautions at borders, control of movement inside the country, and stamping out. The objective of this study was to evaluate EBL eradication and surveillance measures in Italy from 2005 to 2012. One-hundred twenty-three outbreaks were recorded (1 January 2006 to 31 December 2012) in the National Veterinary Information System (SIMAN) on 7 November 2013. Of these, 101 had occurred in southern Italy. An outbreak usually lasted for a few days, but sometimes lasted for weeks. Some areas were subjected to normal eradication measures, whereas others were subjected to additional eradication measures as a consequence of persisting EBL outbreaks. During the study period, we noted an overall annual decrease from 0.21% in 2005 to 0.08% in 2012 in the herd prevalence rate, from 0.06% in 2005 to 0.04% in 2012 in the herd incidence rate, and from 0.027% in 2005 to 0.015% in 2012 in the animal prevalence rate. Regions officially recognised as EBL-free areas were found to have their own surveillance plans. Differences in their surveillance plans include the type of sample (serum, milk, or both), age at which the animals must be tested (12 or 24 months), and test frequency of herds (annually or every 2, 3, 4, 5, or 6 years). The eradication programme for EBL is difficult to implement in some Italian areas because of several factors such as incomplete herd registry, geographical location and socio-economic conditions of the region. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Development of OMP based indirect ELISA to gauge the antibody titers in bovines against Pasteurella multocida

    Science.gov (United States)

    Dogra, V; Verma, S; Singh, G; Wani, A. H; Chahota, R; Dhar, P; Verma, L; Sharma, M

    2015-01-01

    Pasteurella multocida (P. multocida) is an important pathogen of various domestic animals. The outer membrane proteins (OMPs) play a major role in pathogenesis and immunogenicity of P. multocida. The aim of the study was to develop indirect enzyme linked immuno sorbant assay (ELISA) based on OMPs to ascertain the antibody titers in animals post-infection or to gauge the potency of vaccine. The OMPs were extracted and purified from P. multocida P:52 (vaccine strain) and P. multocida B:2 isolated from natural outbreak of Haemorrhagic septicaemia (HS) and analyzed on SDS PAGE and through western blot. The OMPs profile of the vaccine strain and the isolate from the natural outbreak of HS were found to be similar. Optimization of various components viz. coating antigens, anti-species conjugate, etc. were carried out against both anti-P. multocida hyper immune and pre immune serum. Validation of OMP based indirect ELISA assay to measure immune response against P. multocida in bovine revealed 91% diagnostic sensitivity (DSN) and about 100% diagnostic specificity (DSP) at 25% cut off. OMP based indirect ELISA was found to be more specific, but less sensitive as compared to WCL based assay. PMID:27175202

  18. Sheep as a Potential Source of Bovine TB: Epidemiology, Pathology and Evaluation of Diagnostic Techniques.

    Science.gov (United States)

    Muñoz-Mendoza, M; Romero, B; Del Cerro, A; Gortázar, C; García-Marín, J F; Menéndez, S; Mourelo, J; de Juan, L; Sáez, J L; Delahay, R J; Balseiro, A

    2016-12-01

    Bovine tuberculosis (TB) infection is infrequently diagnosed in sheep. Most reports are from single individual cases or flock outbreaks. However, in Spain several outbreaks have been reported recently, all of which had epidemiological links with TB-infected cattle herds. A total of 897 sheep suspected of being infected with TB and belonging to 23 flocks cohabiting with TB-infected cattle herds and/or goats were tested between 2009 and 2013 in Galicia (north-western Spain), using pathological, immunological and molecular techniques. Of these, 50.44% were positive by culture, 83.23% by histopathology and 24.92%, 4.86% and 59.42% by single intradermal tuberculin test (SITT), interferon-γ and ELISA, respectively. Results suggest that in circumstances akin to those in our study, sheep may be considered as a potential source of TB. We conclude that under similar conditions, serious consideration should be given to TB testing sheep, as they may represent a potential risk to other susceptible co-habiting species. The SITT and ELISA are recommended as the simplest and most cost-effective initial approaches for the diagnosis of TB in sheep under field conditions. However, when possible, interferon-γ should be applied to increase sensitivity. © 2015 Blackwell Verlag GmbH.

  19. High-resolution melting (HRM) for genotyping bovine ephemeral fever virus (BEFV).

    Science.gov (United States)

    Erster, Oran; Stram, Rotem; Menasherow, Shopia; Rubistein-Giuni, Marisol; Sharir, Binyamin; Kchinich, Evgeni; Stram, Yehuda

    2017-02-02

    In recent years there have been several major outbreaks of bovine ephemeral disease in the Middle East, including Israel. Such occurrences raise the need for quick identification of the viruses responsible for the outbreaks, in order to rapidly identify the entry of viruses that do not belong to the Middle-East BEFV lineage. This challenge was met by the development of a high-resolution melt (HRM) assay. The assay is based on the viral G gene sequence and generation of an algorithm that calculates and evaluates the GC content of various fragments. The algorithm was designed to scan 50- to 200-base-long segments in a sliding-window manner, compare and rank them using an Order of Technique of Preference by Similarity to Ideal Solution (TOPSIS) the technique for order preference by similarity to ideal solution technique, according to the differences in GC content of homologous fragments. Two fragments were selected, based on a match to the analysis criteria, in terms of size and GC content. These fragments were successfully used in the analysis to differentiate between different virus lineages, thus facilitating assignment of the viruses' geographical origins. Moreover, the assay could be used for differentiating infected from vaccinated animales (DIVA). The new algorithm may therefore be useful for development of improved genotyping studies for other viruses and possibly other microorganisms. Copyright © 2016. Published by Elsevier B.V.

  20. One Health approach to identify research needs in bovine and human babesioses: workshop report

    Directory of Open Access Journals (Sweden)

    McElwain Terry F

    2010-04-01

    Full Text Available Abstract Background Babesia are emerging health threats to humans and animals in the United States. A collaborative effort of multiple disciplines to attain optimal health for people, animals and our environment, otherwise known as the One Health concept, was taken during a research workshop held in April 2009 to identify gaps in scientific knowledge regarding babesioses. The impetus for this analysis was the increased risk for outbreaks of bovine babesiosis, also known as Texas cattle fever, associated with the re-infestation of the U.S. by cattle fever ticks. Results The involvement of wildlife in the ecology of cattle fever ticks jeopardizes the ability of state and federal agencies to keep the national herd free of Texas cattle fever. Similarly, there has been a progressive increase in the number of cases of human babesiosis over the past 25 years due to an increase in the white-tailed deer population. Human babesiosis due to cattle-associated Babesia divergens and Babesia divergens-like organisms have begun to appear in residents of the United States. Research needs for human and bovine babesioses were identified and are presented herein. Conclusions The translation of this research is expected to provide veterinary and public health systems with the tools to mitigate the impact of bovine and human babesioses. However, economic, political, and social commitments are urgently required, including increased national funding for animal and human Babesia research, to prevent the re-establishment of cattle fever ticks and the increasing problem of human babesiosis in the United States.

  1. Safety, immunogenicity, and efficacy of prime-boost immunization with recombinant poxvirus FP9 and modified vaccinia virus Ankara encoding the full-length Plasmodium falciparum circumsporozoite protein.

    Science.gov (United States)

    Walther, Michael; Thompson, Fiona M; Dunachie, Susanna; Keating, Sheila; Todryk, Stephen; Berthoud, Tamara; Andrews, Laura; Andersen, Rikke F; Moore, Anne; Gilbert, Sarah C; Poulton, Ian; Dubovsky, Filip; Tierney, Eveline; Correa, Simon; Huntcooke, Angela; Butcher, Geoffrey; Williams, Jack; Sinden, Robert E; Hill, Adrian V S

    2006-05-01

    Heterologous prime-boost immunization with DNA and various recombinant poxviruses encoding malaria antigens is capable of inducing strong cell-mediated immune responses and partial protection in human sporozoite challenges. Here we report a series of trials assessing recombinant fowlpox virus and modified vaccinia virus Ankara encoding the Plasmodium falciparum circumsporozoite protein in various prime-boost combinations, doses, and application routes. For the first time, these vaccines were administered intramuscularly and at doses of up to 5 x 10(8) PFU. Vaccines containing this antigen proved safe and induced modest immune responses but showed no evidence of efficacy in a sporozoite challenge.

  2. HIVIS-DNA or HIVISopt-DNA priming followed by CMDR vaccinia-based boosts induce both humoral and cellular murine immune responses to HIV

    Directory of Open Access Journals (Sweden)

    J Hinkula

    2017-06-01

    Conclusions: HIVIS-DNA was modified to obtain HIVISopt-DNA that had fewer plasmids, and additional epitopes. Even with one DNA prime followed by two MVA-CMDR boosts, humoral and cell-mediated immune responses were readily induced by priming with either DNA construct composition. Priming by HIV-DNA augmented neutralizing antibody responses revealed by boosting with the vaccinia-based heterologous sequences. Cellular and antibody responses covered selected strains representing HIV-1 subtypes A, B, C and CRF01_AE. We assume this is related to the inclusion of heterologous full genes in the vaccine schedule.

  3. A selective Seoul-Fluor-based bioprobe, SfBP, for vaccinia H1-related phosphatase--a dual-specific protein tyrosine phosphatase.

    Science.gov (United States)

    Jeong, Myeong Seon; Kim, Eunha; Kang, Hyo Jin; Choi, Eun Joung; Cho, Alvin R; Chung, Sang J; Park, Seung Bum

    2012-07-04

    We report a Seoul-Fluor-based bioprobe, SfBP, for selective monitoring of protein tyrosine phosphatases (PTPs). A rational design based on the structures at the active site of dual-specific PTPs can enable SfBP to selectively monitor the activity of these PTPs with a 93-fold change in brightness. Moreover, screening results of SfBP against 30 classical PTPs and 35 dual-specific PTPs show that it is selective toward vaccinia H1-related (VHR) phosphatase, a dual-specific PTP (DUSP-3).

  4. Infectious disease outbreaks in competitive sports, 2005-2010.

    Science.gov (United States)

    Collins, Cathal James; O'Connell, Brian

    2012-01-01

    Old, evolving, and new infectious agents continually threaten the participation of competitors in sports. To provide an update of the medical literature on infectious disease outbreaks in sport for the last 5 years (May 2005-November 2010). A total of 21 outbreaks or clusters were identified. Methicillin-resistant Staphylococcus aureus (n = 7, 33%; mainly community acquired) and tinea (trichophytosis: n = 6, 29%) were the most common pathogens responsible for outbreaks. Skin and soft tissue was the most common site of infection (n = 15, 71%). The majority of outbreaks reported occurred in close-contact sports, mainly combat sports (ie, wrestling, judo) and American football. Twelve outbreaks (57%) involved high school or collegiate competitors. Common community outbreak pathogens, such as influenza virus and norovirus, have received little attention.

  5. Viruses in recreational water-borne disease outbreaks: a review.

    Science.gov (United States)

    Sinclair, R G; Jones, E L; Gerba, C P

    2009-12-01

    Viruses are believed to be a significant cause of recreationally associated water-borne disease. However, they have been difficult to document because of the wide variety of illnesses that they cause and the limitations in previous detection methods. Noroviruses are believed to be the single largest cause of outbreaks, which have been documented in the published literature 45% (n = 25), followed by adenovirus (24%), echovirus (18%), hepatitis A virus (7%) and coxsackieviruses (5%). Just under half of the outbreaks occurred in swimming pools (49%), while the second largest outbreak occurred in lakes or ponds (40%). The number of reported outbreaks associated with noroviruses has increased significantly in recent years probably because of better methods for virus detection. Inadequate disinfection was related to 69% (n = 18) of swimming pool outbreaks. A lack of required reporting and nonuniform water quality and chlorination/disinfection standards continues to contribute to water-borne recreational disease outbreaks.

  6. Bovine papillomavirus type 2 in reproductive tract and gametes of slaughtered bovine females

    OpenAIRE

    Carvalho,Claudemir de; Freitas,Antonio Carlos de; Brunner,Olga; Góes,Luiz Gustavo Bentim; Cavalcante,Andréa Yaguiu; Beçak,Willy; Santos,Rita de Cassia Stocco dos

    2003-01-01

    Papillomaviruses are described selectively infecting epithelial tissues and are associated with many forms of cancer in different species. Considering the widespread dissemination of papillomatosis in livestock, interest is being centred on possible forms of viral transmission and respective mechanisms. In the present study, we report the detection of bovine papillomavirus (BPV) DNA sequences in female reproductive tract tissues, fluids and oocytes from slaughtered bovines not afflicted by cu...

  7. Prototheca zopfii isolated from bovine mastitis induced oxidative stress and apoptosis in bovine mammary epithelial cells

    OpenAIRE

    Shahid, Muhammad; Gao, Jian; Zhou, Yanan; Liu, Gang; Ali, Tariq; Deng, Youtian; Sabir, Naveed; Su, Jingliang; Han, Bo

    2017-01-01

    Bovine protothecal mastitis results in considerable economic losses worldwide. However, Prototheca zopfii induced morphological alterations and oxidative stress in bovine mammary epithelial cells (bMECs) is not comprehensively studied yet. Therefore, the aim of this current study was to investigate the P. zopfii induced pathomorphological changes, oxidative stress and apoptosis in bMECs. Oxidative stress was assessed by evaluating catalase (CAT), superoxide dismutase (SOD), glutathione peroxi...

  8. Foodborne disease outbreaks in Australia, 1995 to 2000.

    Science.gov (United States)

    Dalton, Craig B; Gregory, Joy; Kirk, Martyn D; Stafford, Russell J; Givney, Rod; Kraa, Ed; Gould, David

    2004-01-01

    Health agencies are increasingly conducting systematic reviews of foodborne disease outbreak investigations to develop strategies to prevent future outbreaks. We surveyed state and territory health departments to summarise the epidemiology of foodborne disease outbreaks in Australia from 1995 to 2000. From 1995 through 2000, 293 outbreaks were identified, with 214 being of foodborne origin. One hundred and seventy-four (81%) had a known aetiology, and accounted for 80 per cent (6,472/8,124) of illnesses. There were 20 deaths attributed to foodborne illness. Of the 214 outbreaks, bacterial disease was responsible for 61 per cent of outbreaks, 64 per cent of cases and 95 per cent of deaths. The most frequent aetiology of outbreaks was Salmonella in 75 (35%) outbreaks, Clostridium perfringens in 30 (14%), ciguatera toxin in 23 (11%), scombrotoxin in 7 (3%) and norovirus in 6 (3%). Salmonellosis was responsible for eight of the 20 (40%) deaths, as was Listeria monocytogenes. Restaurants and commercial caterers were associated with the highest number of outbreak reports and cases. Outbreaks in hospitals and aged care facilities were responsible for 35 per cent of deaths. The most frequently implicated vehicles in the 173 outbreaks with known vehicles were meats 64 (30%), fish 34 (16%), seafood 13 (6%), salad 12 (6%), sandwiches 11 (5%) and eggs 9 (4%). Chicken, the most frequently implicated meat, was associated with 27 (13%) outbreaks. This summary demonstrates the serious nature of foodborne disease and supports the move to risk-based food safety interventions focusing on mass catering and hospital and aged care facilities.

  9. Consecutive salmonella outbreaks traced to the same bakery.

    Science.gov (United States)

    Evans, M. R.; Tromans, J. P.; Dexter, E. L.; Ribeiro, C. D.; Gardner, D.

    1996-01-01

    Two consecutive community outbreaks of Salmonella enteritidis phage type 4 (PT4) traced to the same bakery occurred in Cardiff, Wales during August-September 1992. In the first outbreak, illness was associated with eating custard slices (odds ratio 23.8, 95% confidence interval 6.5-94.4, P bakery. This incident illustrates the hazard of widespread environmental contamination with salmonella and the need for thorough environmental cleansing for any premises implicated in an outbreak of food poisoning. PMID:8620907

  10. A Methanol Intoxication Outbreak From Recreational Ingestion of Fracking Fluid.

    Science.gov (United States)

    Collister, David; Duff, Graham; Palatnick, Wesley; Komenda, Paul; Tangri, Navdeep; Hingwala, Jay

    2017-05-01

    Single-patient methanol intoxications are a common clinical presentation, but outbreaks are rare and usually occur in settings in which there is limited access to ethanol and methanol is consumed as a substitute. In this case report, we describe an outbreak of methanol intoxications that was challenging from a public health perspective and discuss strategies for managing such an outbreak. Copyright © 2016 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

  11. Control of bovine hepatic fatty acid oxidation

    Energy Technology Data Exchange (ETDEWEB)

    Jesse, B.W.; Emery, R.S.; Thomas, J.W.

    1986-09-01

    Fatty acid oxidation by bovine liver slices and mitochondria was examined to determine potential regulatory sites of fatty acid oxidation. Conversion of 1-(/sup 14/C)palmitate to /sup 14/CO/sub 2/ and total (/sup 14/C)acid-soluble metabolites was used to measure fatty acid oxidation. Oxidation of palmitate (1 mM) was linear in both liver slice weight and incubation time. Carnitine stimulated palmitate oxidation; 2 mM dl-carnitine produced maximal stimulation of palmitate oxidation to both CO/sup 2/ and acid-soluble metabolites. Propionate (10 mM) inhibited palmitate oxidation by bovine liver slices. Propionate (.5 to 10 mM) had no effect on palmitate oxidation by mitochondria, but malonyl Coenzyme A, the first committed intermediate of fatty acid synthesis, inhibited mitochondrial palmitate oxidation (inhibition constant = .3 ..mu..M). Liver mitochonndrial carnitine palmitoyltransferase exhibited Michaelis constants for palmitoyl Coenzyme A and l-carnitine of 11.5 ..mu..M and .59 mM, respectively. Long-chain fatty acid oxidation in bovine liver is regulated by mechanisms similar to those in rats but adapted to the unique digestive physiology of the bovine.

  12. Developing a vaccine for eradicating contagious bovine ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The challenge. Contagious bovine pleuropneumonia (CBPP) — also known as lung plague — is a highly contagious bacterial disease of cattle that has serious economic and trade consequences in sub-Saharan Africa. CBPP kills up to 50% of infected animals, when newly introduced into a population, and many cattle.

  13. Activities for leptin in bovine trophoblast cells.

    Science.gov (United States)

    Hughes, C K; Xie, M M; McCoski, S R; Ealy, A D

    2017-01-01

    Leptin is involved in various reproductive processes in humans and rodents, including placental development and function. The specific ways that leptin influences placental development and function in cattle are poorly understood. This work was completed to explore how leptin regulates hormone, cytokine and metalloprotease transcript abundance, and cell proliferation in cultured bovine trophoblast cells. In the first set of studies, cells were cultured in the presence of graded recombinant bovine leptin concentrations (0, 10, 50, 250 ng/mL) for 6 or 24 h. Transcript profiles were examined from extracted RNA. Leptin supplementation did not affect abundance of the maternal recognition of pregnancy factor, interferon-tau (IFNT), but leptin increased (P leptin. Transcript abundance of the remodeling factor, metalloprotease 2 (MMP2), was greater (P leptin-treated cells at 24 h but not at 6 h. The 24 h MMP2 response was greatest (P leptin treatment. In a separate set of studies, cell proliferation assays were completed. Leptin supplementation did not affect bovine trophoblast cell line proliferation at any dose tested. In conclusion, leptin supplementation did not affect bovine trophoblast cell proliferation or IFNT expression, but leptin increases CSH2 and MMP2 transcript abundance. Both of these factors are involved with peri-implantation and postimplantation placental development and function, and this implicates leptin as a potential mediator of early placental development and function in cattle. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Seroprevalence Study Of Bovine Brucellosis In Extensive ...

    African Journals Online (AJOL)

    The prevalence of bovine brucellosis was measured in cross sectional study in Jimma zone, Western Ethiopia using Rose Bengal Plate Test (RBT) and CFT from October 2003 to April 2004. The study animals consisted of 1305 local breed found in extensive system in five districts of in the zone. The overall individual animal ...

  15. Pathogenesis of bovine spongiform encephalopathy in sheep

    NARCIS (Netherlands)

    Keulen, van L.J.M.; Vromans, M.E.W.; Dolstra, C.H.; Bossers, A.; Zijderveld, van F.G.

    2008-01-01

    The pathogenesis of bovine spongiform encephalopathy (BSE) in sheep was studied by immunohistochemical detection of scrapie-associated prion protein (PrPSc) in the gastrointestinal, lymphoid and neural tissues following oral inoculation with BSE brain homogenate. First accumulation of PrPSc was

  16. Hydrophobic interactions of phenoxazine modulators with bovine ...

    Indian Academy of Sciences (India)

    The binding of phenothiazine drugs to bovine serum albumin (BSA) has been studied 1. Although most of the authors obtained total binding constants of the same order of magnitude, the number of binding sites varied considerably. It has been found 2 that the number of binding sites on BSA for promazine and ...

  17. Transmission of new bovine prion to mice

    NARCIS (Netherlands)

    Baron, T.G.M.; Biacabe, A.G.; Bencsik, A.; Langeveld, J.P.M.

    2006-01-01

    We previously reported that cattle were affected by a prion disorder that differed from bovine spongiform encephalopathy (BSE) by showing distinct molecular features of disease-associated protease-resistant prion protein (PrPres). We show that intracerebral injection of such isolates into C57BL/6

  18. Pasteurella multocida and bovine respiratory disease.

    Science.gov (United States)

    Dabo, S M; Taylor, J D; Confer, A W

    2007-12-01

    Pasteurella multocida is a pathogenic Gram-negative bacterium that has been classified into three subspecies, five capsular serogroups and 16 serotypes. P. multocida serogroup A isolates are bovine nasopharyngeal commensals, bovine pathogens and common isolates from bovine respiratory disease (BRD), both enzootic calf pneumonia of young dairy calves and shipping fever of weaned, stressed beef cattle. P. multocida A:3 is the most common serotype isolated from BRD, and these isolates have limited heterogeneity based on outer membrane protein (OMP) profiles and ribotyping. Development of P. multocida-induced pneumonia is associated with environmental and stress factors such as shipping, co-mingling, and overcrowding as well as concurrent or predisposing viral or bacterial infections. Lung lesions consist of an acute to subacute bronchopneumonia that may or may not have an associated pleuritis. Numerous virulence or potential virulence factors have been described for bovine respiratory isolates including adherence and colonization factors, iron-regulated and acquisition proteins, extracellular enzymes such as neuraminidase, lipopolysaccharide, polysaccharide capsule and a variety of OMPs. Immunity of cattle against respiratory pasteurellosis is poorly understood; however, high serum antibodies to OMPs appear to be important for enhancing resistance to the bacterium. Currently available P. multocida vaccines for use in cattle are predominately traditional bacterins and a live streptomycin-dependent mutant. The field efficacy of these vaccines is not well documented in the literature.

  19. NUTRIENTS AND EPIGENETICS IN BOVINE CELLS

    Science.gov (United States)

    This is a chapter for a book titled “Livestock Epigenetics” edited by Dr. Hasan Khatib and published by Wiley-Blackwell. This chapter is focused on the research development in our laboratory in the area of interaction of nutrients and genomic phonotype in bovine cells. Briefly, the Research on nutri...

  20. Aggregation and fibrillation of bovine serum albumin

    DEFF Research Database (Denmark)

    Holm, NK; Jespersen, SK; Thomassen, LV

    2007-01-01

    The all-alpha helix multi-domain protein bovine serum albumin (BSA) aggregates at elevated temperatures. Here we show that these thermal aggregates have amyloid properties. They bind the fibril-specific dyes Thioflavin T and Congo Red, show elongated although somewhat worm-like morphology and cha...

  1. Recombinant Bovine Growth Hormone Criticism Grows.

    Science.gov (United States)

    Gaard, Greta

    1995-01-01

    Discusses concerns related to the use of recombinant bovine growth hormone in the United States and other countries. Analyses the issue from the perspectives of animal rights, human health, world hunger, concerns of small and organic farmers, costs to the taxpayer, and environmental questions. A sidebar discusses Canadian review of the hormone.…

  2. Contagious Bovine Pleuropneumonia and lung condemnation in ...

    African Journals Online (AJOL)

    Password, Remember me, or Register. DOWNLOAD FULL TEXT Open Access DOWNLOAD FULL TEXT Subscription or Fee Access. Contagious Bovine Pleuropneumonia and lung condemnation in Sokoto Metropolitan Abattoir in Nigeria. JE Onu. Abstract. No Abstract. Bulletin of Animal Health and Production in Africa Vol.

  3. Vaccination of cattle against bovine viral diarrhoea

    NARCIS (Netherlands)

    Oirschot, van J.T.; Bruschke, C.J.M.; Rijn, van P.A.

    1999-01-01

    This brief review describes types and quality (efficacy and safety) of bovine viral diarrhoea virus (BVDV) vaccines that are in the market or under development. Both conventional live and killed vaccines are available. The primary aim of vaccination is to prevent congenital infection, but the few

  4. Immunological characterization of a modified vaccinia virus Ankara vector expressing the human papillomavirus 16 E1 protein.

    Science.gov (United States)

    Remy-Ziller, Christelle; Germain, Claire; Spindler, Anita; Hoffmann, Chantal; Silvestre, Nathalie; Rooke, Ronald; Bonnefoy, Jean-Yves; Préville, Xavier

    2014-02-01

    Women showing normal cytology but diagnosed with a persistent high-risk human papillomavirus (HR-HPV) infection have a higher risk of developing high-grade cervical intraepithelial neoplasia and cervical cancer than noninfected women. As no therapeutic management other than surveillance is offered to these women, there is a major challenge to develop novel targeted therapies dedicated to the treatment of these patients. As such, E1 and E2 antigens, expressed early in the HPV life cycle, represent very interesting candidates. Both proteins are necessary for maintaining coordinated viral replication and gene synthesis during the differentiation process of the epithelium and are essential for the virus to complete its normal and propagative replication cycle. In the present study, we evaluated a new active targeted immunotherapeutic, a modified vaccinia virus Ankara (MVA) vector containing the E1 sequence of HPV16, aimed at inducing cellular immune responses with the potential to help and clear persistent HPV16-related infection. We carried out an extensive comparative time course analysis of the cellular immune responses induced by different schedules of immunization in C57BL/6 mice. We showed that multiple injections of MVA-E1 allowed sustained HPV16 E1-specific cellular immune responses in vaccinated mice and had no impact on the exhaustion phenotype of the generated HPV16 E1-specific CD8⁺ T cells, but they led to the differentiation of multifunctional effector T cells with high cytotoxic capacity. This study provides proof of concept that an MVA expressing HPV16 E1 can induce robust and long-lasting E1-specific responses and warrants further development of this candidate.

  5. The membrane fusion step of vaccinia virus entry is cooperatively mediated by multiple viral proteins and host cell components.

    Directory of Open Access Journals (Sweden)

    Jason P Laliberte

    2011-12-01

    Full Text Available For many viruses, one or two proteins allow cell attachment and entry, which occurs through the plasma membrane or following endocytosis at low pH. In contrast, vaccinia virus (VACV enters cells by both neutral and low pH routes; four proteins mediate cell attachment and twelve that are associated in a membrane complex and conserved in all poxviruses are dedicated to entry. The aim of the present study was to determine the roles of cellular and viral proteins in initial stages of entry, specifically fusion of the membranes of the mature virion and cell. For analysis of the role of cellular components, we used well characterized inhibitors and measured binding of a recombinant VACV virion containing Gaussia luciferase fused to a core protein; viral and cellular membrane lipid mixing with a self-quenching fluorescent probe in the virion membrane; and core entry with a recombinant VACV expressing firefly luciferase and electron microscopy. We determined that inhibitors of tyrosine protein kinases, dynamin GTPase and actin dynamics had little effect on binding of virions to cells but impaired membrane fusion, whereas partial cholesterol depletion and inhibitors of endosomal acidification and membrane blebbing had a severe effect at the later stage of core entry. To determine the role of viral proteins, virions lacking individual membrane components were purified from cells infected with members of a panel of ten conditional-lethal inducible mutants. Each of the entry protein-deficient virions had severely reduced infectivity and except for A28, L1 and L5 greatly impaired membrane fusion. In addition, a potent neutralizing L1 monoclonal antibody blocked entry at a post-membrane lipid-mixing step. Taken together, these results suggested a 2-step entry model and implicated an unprecedented number of viral proteins and cellular components involved in signaling and actin rearrangement for initiation of virus-cell membrane fusion during poxvirus entry.

  6. Mutations conferring resistance to viral DNA polymerase inhibitors in camelpox virus give different drug-susceptibility profiles in vaccinia virus.

    Science.gov (United States)

    Duraffour, Sophie; Andrei, Graciela; Topalis, Dimitri; Krečmerová, Marcela; Crance, Jean-Marc; Garin, Daniel; Snoeck, Robert

    2012-07-01

    Cidofovir or (S)-HPMPC is one of the three antiviral drugs that might be used for the treatment of orthopoxvirus infections. (S)-HPMPC and its 2,6-diaminopurine counterpart, (S)-HPMPDAP, have been described to select, in vitro, for drug resistance mutations in the viral DNA polymerase (E9L) gene of vaccinia virus (VACV). Here, to extend our knowledge of drug resistance development among orthopoxviruses, we selected, in vitro, camelpox viruses (CMLV) resistant to (S)-HPMPDAP and identified a single amino acid change, T831I, and a double mutation, A314V+A684V, within E9L. The production of recombinant CMLV and VACV carrying these amino acid substitutions (T831I, A314V, or A314V+A684V) demonstrated clearly their involvement in conferring reduced sensitivity to viral DNA polymerase inhibitors, including (S)-HPMPDAP. Both CMLV and VACV harboring the A314V change showed comparable drug-susceptibility profiles to various antivirals and similar impairments in viral growth. In contrast, the single change T831I and the double change A314V+A684V in VACV were responsible for increased levels of drug resistance and for cross-resistance to viral DNA polymerase antivirals that were not observed with their CMLV counterparts. Each amino acid change accounted for an attenuated phenotype of VACV in vivo. Modeling of E9L suggested that the T→I change at position 831 might abolish hydrogen bonds between E9L and the DNA backbone and have a direct impact on the incorporation of the acyclic nucleoside phosphonates. Our findings demonstrate that drug-resistance development in two related orthopoxvirus species may impact drug-susceptibility profiles and viral fitness differently.

  7. A novel naturally occurring tandem promoter in modified vaccinia virus ankara drives very early gene expression and potent immune responses.

    Directory of Open Access Journals (Sweden)

    Sonia T Wennier

    Full Text Available Modified vaccinia virus Ankara (MVA has been shown to be suitable for the generation of experimental vaccines against cancer and infectious diseases, eliciting strong humoral and cellular immune responses. In viral vectored vaccines, strong recombinant antigen expression and timing of expression influence the quantity and quality of the immune response. Screening of synthetic and native poxvirus promoters for strong protein expression in vitro and potent immune responses in vivo led to the identification of the MVA13.5L promoter, a unique and novel naturally occurring tandem promoter in MVA composed of two 44 nucleotide long repeated motifs, each containing an early promoter element. The MVA13.5L gene is highly conserved across orthopoxviruses, yet its function is unknown. The unique structure of its promoter is not found for any other gene in the MVA genome and is also conserved in other orthopoxviruses. Comparison of the MVA13.5L promoter activity with synthetic poxviral promoters revealed that the MVA13.5L promoter produced higher levels of protein early during infection in HeLa cells and particularly in MDBK cells, a cell line in which MVA replication stops at an early stage before the expression of late genes. Finally, a recombinant antigen expressed under the control of this novel promoter induced high antibody titers and increased CD8 T cell responses in homologous prime-boost immunization compared to commonly used promoters. In particular, the recombinant antigen specific CD8 T cell responses dominated over the immunodominant B8R vector-specific responses after three vaccinations and even more during the memory phase. These results have identified the native MVA13.5L promoter as a new potent promoter for use in MVA vectored preventive and therapeutic vaccines.

  8. Vaccinia Virus Immunomodulator A46: A Lipid and Protein-Binding Scaffold for Sequestering Host TIR-Domain Proteins.

    Directory of Open Access Journals (Sweden)

    Sofiya Fedosyuk

    2016-12-01

    Full Text Available Vaccinia virus interferes with early events of the activation pathway of the transcriptional factor NF-kB by binding to numerous host TIR-domain containing adaptor proteins. We have previously determined the X-ray structure of the A46 C-terminal domain; however, the structure and function of the A46 N-terminal domain and its relationship to the C-terminal domain have remained unclear. Here, we biophysically characterize residues 1-83 of the N-terminal domain of A46 and present the X-ray structure at 1.55 Å. Crystallographic phases were obtained by a recently developed ab initio method entitled ARCIMBOLDO_BORGES that employs tertiary structure libraries extracted from the Protein Data Bank; data analysis revealed an all β-sheet structure. This is the first such structure solved by this method which should be applicable to any protein composed entirely of β-sheets. The A46(1-83 structure itself is a β-sandwich containing a co-purified molecule of myristic acid inside a hydrophobic pocket and represents a previously unknown lipid-binding fold. Mass spectrometry analysis confirmed the presence of long-chain fatty acids in both N-terminal and full-length A46; mutation of the hydrophobic pocket reduced the lipid content. Using a combination of high resolution X-ray structures of the N- and C-terminal domains and SAXS analysis of full-length protein A46(1-240, we present here a structural model of A46 in a tetrameric assembly. Integrating affinity measurements and structural data, we propose how A46 simultaneously interferes with several TIR-domain containing proteins to inhibit NF-κB activation and postulate that A46 employs a bipartite binding arrangement to sequester the host immune adaptors TRAM and MyD88.

  9. Safety and immunogenicity of novel recombinant BCG and modified vaccinia virus Ankara vaccines in neonate rhesus macaques.

    Science.gov (United States)

    Rosario, Maximillian; Fulkerson, John; Soneji, Shamit; Parker, Joe; Im, Eung-Jun; Borthwick, Nicola; Bridgeman, Anne; Bourne, Charles; Joseph, Joan; Sadoff, Jerald C; Hanke, Tomás

    2010-08-01

    Although major inroads into making antiretroviral therapy available in resource-poor countries have been made, there is an urgent need for an effective vaccine administered shortly after birth, which would protect infants from acquiring human immunodeficiency virus type 1 (HIV-1) through breast-feeding. Bacillus Calmette-Guérin (BCG) is given to most infants at birth, and its recombinant form could be used to prime HIV-1-specific responses for a later boost by heterologous vectors delivering the same HIV-1-derived immunogen. Here, two groups of neonate Indian rhesus macaques were immunized with either novel candidate vaccine BCG.HIVA(401) or its parental strain AERAS-401, followed by two doses of recombinant modified vaccinia virus Ankara MVA.HIVA. The HIVA immunogen is derived from African clade A HIV-1. All vaccines were safe, giving local reactions consistent with the expected response at the injection site. No systemic adverse events or gross abnormality was seen at necropsy. Both AERAS-401 and BCG.HIVA(401) induced high frequencies of BCG-specific IFN-gamma-secreting lymphocytes that declined over 23 weeks, but the latter failed to induce detectable HIV-1-specific IFN-gamma responses. MVA.HIVA elicited HIV-1-specific IFN-gamma responses in all eight animals, but, except for one animal, these responses were weak. The HIV-1-specific responses induced in infants were lower compared to historic data generated by the two HIVA vaccines in adult animals but similar to other recombinant poxviruses tested in this model. This is the first time these vaccines were tested in newborn monkeys. These results inform further infant vaccine development and provide comparative data for two human infant vaccine trials of MVA.HIVA.

  10. Intrarectal vaccination with recombinant vaccinia virus expressing carcinoembronic antigen induces mucosal and systemic immunity and prevents progression of colorectal cancer.

    Science.gov (United States)

    Kim-Schulze, Seunghee; Kim, Hong Sung; Wainstein, Alberto; Kim, Dae Won; Yang, Wein Cui; Moroziewicz, Dorota; Mong, Phyllus Y; Bereta, Michal; Taback, Bret; Wang, Qin; Kaufman, Howard L

    2008-12-01

    The gastrointestinal mucosa contains an intact immune system that protects the host from pathogens and communicates with the systemic immune system. Absorptive epithelial cells in the mucosa give rise to malignant tumors although the interaction between tumor cells and the mucosal immune system is not well defined. The pathophysiology of colorectal cancer has been elucidated through studies of hereditary syndromes, such as familial adenomatous polyposis, a cancer predisposition syndrome caused by germline mutations in the adenomatous polyposis coli tumor suppressor gene. Patients with FAP develop adenomas and inevitably progress to invasive carcinomas by the age of 40. To better delineate the role of mucosal immunity in colorectal cancer, we evaluated the efficacy of intrarectal recombinant vaccinia virus expressing the human carcinoembryonic Ag (CEA) in a murine FAP model in which mice are predisposed to colorectal cancer and also express human CEA in the gut. Mucosal vaccination reduced the incidence of spontaneous adenomas and completely prevented progression to invasive carcinoma. The therapeutic effects were associated with induction of mucosal CEA-specific IgA Ab titers and CD8(+) CTLs. Mucosal vaccination was also associated with an increase in systemic CEA-specific IgG Ab titers, CD4(+) and CD8(+) T cell responses and resulted in growth inhibition of s.c. implanted CEA-expressing tumors suggesting communication between mucosal and systemic immune compartments. Thus, intrarectal vaccination induces mucosal and systemic antitumor immunity and prevents progression of spontaneous colorectal cancer. These results have implications for the prevention of colorectal cancer in high-risk individuals.

  11. Concomitant infection of Neospora caninum and Bovine Herpesvirus type 5 in spontaneous bovine abortions

    Directory of Open Access Journals (Sweden)

    Maia S. Marin

    2013-11-01

    Full Text Available Bovine Herpesvirus type 5 (BoHV-5 has not been conclusively demonstrated to cause bovine abortion. Brain lesions produced by Neospora caninum and Bovine Herpesvirus type 1 (BoHV-1 exhibit common features. Therefore, careful microscopic evaluation and additional diagnostic procedures are required to achieve an accurate final etiological diagnosis. The aim of the present work was to investigate the occurrence of infections due to BoHV-1, BoHV-5 and N. caninum in 68 cases of spontaneous bovine abortions which showed microscopic lesions in the fetal central nervous system. This study allowed the identification of 4 (5.9% fetuses with dual infection by BoHV-5 and N. caninum and 33 (48.5% cases in which N. caninum was the sole pathogen identified. All cases were negative to BoHV-1. The results of this study provide evidence that dual infection by BoHV-5 and N. caninum occur during pregnancy in cattle; however, the role of BoHV-5 as a primary cause of bovine abortion needs further research. Molecular diagnosis of BoHV-5 and N. caninum confirmed the importance of applying complementary assays to improve the sensitivity of diagnosing bovine abortion.

  12. [An outbreak of legionellosis in a nursery].

    Science.gov (United States)

    Sakai, Hideaki; Akaihata, Mitsuko; Niitsuma, Katsunao; Hosoya, Mitsuaki

    2004-05-01

    We experienced an outbreak of legionellosis in infants for the first time in Japan. In Fukushima Prefecture Wakamatsu Nursery, the patients who had respiratory symptoms of cough, wheeze and fever appeared one after another from the middle of June, 2002. We suspected that an outbreak of legionellosis had occurred and then carried out urinary antigen detection of Legionella pneumophila. As a result, 8 patients were positive. They consisted of 5 boys and 3 girls, and ranged in age from 11 months to 1 year 10 months. Underlying disease was observed in one patient, and 6 patients were hospitalized. All 8 patients had rhinorrhea, cough, fever and 7 patients had wheeze. The average duration of cough was 9.9 days and that of fever was 4.5 days. In the admitted 6 patients, WBC ranged in count from 7,500/microliter to 15,300/microliter and CRP ranged from 0.2 mg/dl to 2.5 mg/dl. Chest X-rays showed infiltrative shadows (right lower lobe, left lower lobe) in 2 patients. With regard to the treatment, macrolide or tetracycline antibiotics were administered in 4 of 8 patients, and beta-lactams were administered in others. Water samples were obtained from 12 locations at the nursery, including the shower head of the bathroom, the bathtub, the taps, the laundry and so on. But cultures of water samples failed to grow legionella. We suspected that the source of infection was the humidifiers or the nebulizer used for disinfection. Through this outbreak, it became obvious that the mild case of legionellosis really existed. Furthermore, we suggested that it was possible for the patient with mild legionellosis to cure without administration of macrolide or tetracycline antibiotics.

  13. A Campylobacter coli foodborne outbreak in Belgium.

    Science.gov (United States)

    Ronveaux, O; Quoilin, S; Van Loock, F; Lheureux, P; Struelens, M; Butzler, J P

    2000-01-01

    In May 1995, the Scientific Institute of Public Health was informed of an outbreak of gastrointestinal illness in a congregational school in the Brussels area. The field investigation identified 24 cases with mild to severe gastrointestinal and general symptoms of acute bacterial enterocolitis. Campylobacter coli was detected in the stools of 5 patients. A retrospective cohort study suggested that a mixed salad (containing ham and feta cheese) was the probable source of infection, but the route of contamination remained unknown. The rapid investigation of such episodes of collective foodborne infections is essential for the implementation of adequate control measures.

  14. The first mile: community experience of outbreak control during an Ebola outbreak in Luwero District, Uganda

    Directory of Open Access Journals (Sweden)

    Daniel H. de Vries

    2016-02-01

    Full Text Available Abstract Background A major challenge to outbreak control lies in early detection of viral haemorrhagic fevers (VHFs in local community contexts during the critical initial stages of an epidemic, when risk of spreading is its highest (“the first mile”. In this paper we document how a major Ebola outbreak control effort in central Uganda in 2012 was experienced from the perspective of the community. We ask to what extent the community became a resource for early detection, and identify problems encountered with community health worker and social mobilization strategies. Methods Analysis is based on first-hand ethnographic data from the center of a small Ebola outbreak in Luwero Country, Uganda, in 2012. Three of this paper’s authors were engaged in an 18 month period of fieldwork on community health resources when the outbreak occurred. In total, 13 respondents from the outbreak site were interviewed, along with 21 key informants and 61 focus group respondents from nearby Kaguugo Parish. All informants were chosen through non-probability sampling sampling. Results Our data illustrate the lack of credibility, from an emic perspective, of biomedical explanations which ignore local understandings. These explanations were undermined by an insensitivity to local culture, a mismatch between information circulated and the local interpretative framework, and the inability of the emergency response team to take the time needed to listen and empathize with community needs. Stigmatization of the local community – in particular its belief in amayembe spirits – fuelled historical distrust of the external health system and engendered community-level resistance to early detection. Conclusions Given the available anthropological knowledge of a previous outbreak in Northern Uganda, it is surprising that so little serious effort was made this time round to take local sensibilities and culture into account. The “first mile” problem is not only a

  15. Investigation of the presence of human or bovine respiratory syncytial virus in the lungs of mink (Neovison vison with hemorrhagic pneumonia due to Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Salomonsen Charlotte M

    2012-11-01

    Full Text Available Abstract Background Hemorrhagic pneumonia is a disease of farmed mink (Neovison vison caused by Pseudomonas aeruginosa. The disease is highly seasonal in Danish mink with outbreaks occurring almost exclusively in the autumn. Human respiratory syncytial virus (RSV has been shown to augment infection with P. aeruginosa in mice and to promote adhesion of P. aeruginosa to human respiratory cells. Findings We tested 50 lung specimens from mink with hemorrhagic pneumonia for bovine RSV by reverse transcriptase polymerase chain reaction (PCR and for human RSV by a commercial real-time PCR. RSV was not found. Conclusions This study indicates that human and bovine RSV is not a major co-factor for development of hemorrhagic pneumonia in Danish mink.

  16. Investigation of the presence of human or bovine respiratory syncytial virus in the lungs of mink (Neovison vison) with hemorrhagic pneumonia due to Pseudomonas aeruginosa.

    Science.gov (United States)

    Salomonsen, Charlotte M; Breum, Solvej Ø; Larsen, Lars E; Jakobsen, Jeanette; Høiby, Niels; Hammer, Anne S

    2012-11-26

    Hemorrhagic pneumonia is a disease of farmed mink (Neovison vison) caused by Pseudomonas aeruginosa. The disease is highly seasonal in Danish mink with outbreaks occurring almost exclusively in the autumn. Human respiratory syncytial virus (RSV) has been shown to augment infection with P. aeruginosa in mice and to promote adhesion of P. aeruginosa to human respiratory cells. We tested 50 lung specimens from mink with hemorrhagic pneumonia for bovine RSV by reverse transcriptase polymerase chain reaction (PCR) and for human RSV by a commercial real-time PCR. RSV was not found. This study indicates that human and bovine RSV is not a major co-factor for development of hemorrhagic pneumonia in Danish mink.

  17. Characteristics of pertussis outbreaks in Catalonia, Spain, 1997 to 2010

    Science.gov (United States)

    Crespo, Inma; Broner, Sonia; Soldevila, Núria; Martínez, Ana; Godoy, Pere; Sala-Farré, Maria-Rosa; Company, Maria; Rius, Cristina; Domínguez, Angela; Group of Catalonia, the Pertussis Working

    2014-01-01

    In Catalonia, pertussis outbreaks must be reported to the Department of Health. This study analyzed pertussis outbreaks between 1997 and 2010 in general and according to the characteristics of the index cases. The outbreak rate, hospitalization rate and incidence of associated cases and their 95%CI were calculated. Index cases were classified in two groups according to age (<15 years and ≥15 years) and the vaccine type received: whole cell vaccine (DTwP) or acellular vaccine (DTaP). During the study period, 230 outbreaks were reported. The outbreak rate was 2.43 × 10−6 persons-year, and outbreaks ranged from 2 to 32 cases, with a median duration of 18 days. There were 771 associated cases, with an incidence rate of 0.8 × 10−5 persons-year. After classifying outbreaks according to the age of the index case, 126 outbreaks (1.3 × 10−6 persons-year) had an index case aged <15 y and 87 (0.87 × 10−6 person-year) had an index case aged ≥15 y (RR = 1.44, 95%CI 1.10–1.90; P = 0.007). Between 2003 and 2010, after the introduction of the acellular vaccine, the index case was vaccinated with DTwP vaccine in 25 outbreaks (0.43 × 10−6 persons-year) and with DTaP vaccine in 32 outbreaks (0.55 × 10−6 person-year) (RR = 0.78, 95%CI 0.46–1.31; P = 0.35). Of cases, 37.2% were correctly vaccinated, suggesting waning immunity of pertussis vaccine protection and endogenous circulation of pertussis. A greater number of outbreaks had an index case aged <15 y. No changes in the disease incidence, associated cases and hospitalization rate were observed after the introduction of DTaP. PMID:25483541

  18. Characteristics of pertussis outbreaks in Catalonia, Spain, 1997 to 2010.

    Science.gov (United States)

    Crespo, Inma; Broner, Sonia; Soldevila, Núria; Martínez, Ana; Godoy, Pere; Sala-Farré, Maria-Rosa; Company, Maria; Rius, Cristina; Domínguez, Angela; Group Of Catalonia, The Pertussis Working

    2015-01-01

    In Catalonia, pertussis outbreaks must be reported to the Department of Health. This study analyzed pertussis outbreaks between 1997 and 2010 in general and according to the characteristics of the index cases. The outbreak rate, hospitalization rate and incidence of associated cases and their 95%CI were calculated. Index cases were classified in two groups according to age (<15 years and ≥15 years) and the vaccine type received: whole cell vaccine (DTwP) or acellular vaccine (DTaP). During the study period, 230 outbreaks were reported. The outbreak rate was 2.43 × 10(-6) persons-year, and outbreaks ranged from 2 to 32 cases, with a median duration of 18 days. There were 771 associated cases, with an incidence rate of 0.8 × 10(-5) persons-year.   After classifying outbreaks according to the age of the index case, 126 outbreaks (1.3 × 10(-6) persons-year) had an index case aged <15 y and 87 (0.87 × 10(-6) person-year) had an index case aged ≥15 y (RR = 1.44, 95%CI 1.10-1.90; P = 0.007). Between 2003 and 2010, after the introduction of the acellular vaccine, the index case was vaccinated with DTwP vaccine in 25 outbreaks (0.43 × 10(-6) persons-year) and with DTaP vaccine in 32 outbreaks (0.55 × 10(-6) person-year) (RR = 0.78, 95%CI 0.46-1.31; P = 0.35). Of cases, 37.2% were correctly vaccinated, suggesting waning immunity of pertussis vaccine protection and endogenous circulation of pertussis. A greater number of outbreaks had an index case aged <15 y. No changes in the disease incidence, associated cases and hospitalization rate were observed after the introduction of DTaP.

  19. Identifying outbreaks of sexually transmitted infection: who cares?

    Directory of Open Access Journals (Sweden)

    Evans Meirion R

    2006-10-01

    Full Text Available Abstract Background Current routine surveillance schemes for sexually transmitted infections (STIs in the United Kingdom (UK are not designed for outbreak identification. Recognising STI outbreaks, therefore, depends almost entirely on the alertness of health professionals. The objective of this study was to explore health professionals' knowledge of, and attitudes towards, identification and investigation of STI outbreaks in Wales. Methods We conducted a cross-sectional survey in Wales in June 2005, and sent a questionnaire to consultants of genitourinary medicine (GUM, n = 11, a consultant microbiologist from each laboratory (n = 14, all consultants in communicable disease control (n = 5, and to epidemiologists of the National Public Health Service (n = 4. Results 26 (76% of 34 survey recipients responded. Of these, 17 (65% ranked the investigation of STI outbreaks as important or very important, and 19 (73% perceived participation in the investigation of an STI outbreak as part of their responsibility. Only six (25% respondents had actively searched their computer system or patient records for a possible STI outbreak in the previous twelve months, and 15 (63% had never looked for an outbreak. Of seven GUM physicians who said they had identified at least one STI outbreak, three had never informed public health authorities. Conclusion Prompt identification and coordinated investigation of outbreaks, usually through a multidisciplinary outbreak control team, is central to the control of many infectious diseases. This does not appear to be the case for STIs, which we believe represents a lost opportunity to reduce transmission. Besides improved surveillance methods, a change in culture towards STI outbreaks is needed among health professionals in Wales.

  20. Investigation of the presence of human or bovine respiratory syncytial virus in the lungs of mink (Neovison vison) with hemorrhagic pneumonia due to Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Salomonsen, Charlotte Mark; Breum, Solvej Østergaard; Larsen, Lars Erik

    2012-01-01

    Background Hemorrhagic pneumonia is a disease of farmed mink (Neovison vison) caused by Pseudomonas aeruginosa. The disease is highly seasonal in Danish mink with outbreaks occurring almost exclusively in the autumn. Human respiratory syncytial virus (RSV) has been shown to augment infection with P....... aeruginosa in mice and to promote adhesion of P. aeruginosa to human respiratory cells. Findings We tested 50 lung specimens from mink with hemorrhagic pneumonia for bovine RSV by reverse transcriptase polymerase chain reaction (PCR) and for human RSV by a commercial real-time PCR. RSV was not found...

  1. Landscape, Climate and Hantavirus Cardiopulmonary Syndrome Outbreaks.

    Science.gov (United States)

    Prist, Paula Ribeiro; D Andrea, Paulo Sérgio; Metzger, Jean Paul

    2017-09-01

    We performed a literature review in order to improve our understanding of how landscape and climate drivers affect HCPS outbreaks. Anthropogenic landscape changes such as forest loss, fragmentation and agricultural land uses are related with a boost in hantavirus reservoir species abundance and hantavirus prevalence in tropical areas, increasing HCPS risk. Additionally, higher precipitation, especially in arid regions, favors an increase in vegetational biomass, which augments the resources for reservoir rodents, also increasing HCPS risk. Although these relationships were observed, few studies described it so far, and the ones that did it are concentrated in few places. To guide future research on this issue, we build a conceptual model relating landscape and climate variables with HCPS outbreaks and identified research opportunities. We point out the need for studies addressing the effects of landscape configuration, temperature and the interaction between climate and landscape variables. Critical landscape thresholds are also highly relevant, once HCPS risk transmission can increase rapidly above a certain degree of landscape degradation. These studies could be relevant to implement preventive measures, creating landscapes that can mitigate disease spread risk.

  2. Safety of recombinant fowlpox strain FP9 and modified vaccinia virus Ankara vaccines against liver-stage P. falciparum malaria in non-immune volunteers.

    Science.gov (United States)

    Webster, D P; Dunachie, S; McConkey, S; Poulton, I; Moore, A C; Walther, M; Laidlaw, S M; Peto, T; Skinner, M A; Gilbert, S C; Hill, A V S

    2006-04-05

    The ability to generate potent antigen-specific T cell responses by vaccination has been a major hurdle in vaccinology. Vaccinia virus and avipox viruses have been shown to be capable of expressing antigens in mammalian cells and can induce a protective immune response against several mammalian pathogens. We report on two such vaccine constructs, modified vaccinia virus Ankara and FP9 (an attenuated fowlpox virus) both expressing the pre-erythrocytic malaria antigen thrombospondin-related adhesion protein and a string of CD8+ epitopes (ME-TRAP). In prime-boost combinations in a mouse model MVA and FP9 are highly immunogenic and induce substantial protective efficacy. A series of human clinical trials using the recombinant MVA and FP9 malaria vaccines encoding ME-TRAP, both independently and in prime-boost combinations with or without the DNA vaccine DNA ME-TRAP, has shown them to be both immunogenic for CD8+ T cells and capable of inducing protective efficacy. We report here a detailed analysis of the safety profiles of these viral vectors and show that anti-vector antibody responses induced by the vectors are generally low to moderate. We conclude that these vectors are safe and show acceptable side effect profiles for prophylactic vaccination.

  3. Use of vaccinia virus vectors to study protein processing in human disease. Normal nerve growth factor processing and secretion in cultured fibroblasts from patients with familial dysautonomia.

    Science.gov (United States)

    Edwards, R H; Rutter, W J

    1988-07-01

    Familial dysautonomia is a hereditary disorder that affects autonomic and sensory neurons. Nerve growth factor (NGF) is required for the normal development of sympathetic and sensory neurons and it has been postulated that an abnormality involving NGF may be responsible for familial dysautonomia. Previous studies have shown that the beta-NGF gene is not linked to the disease. However, NGF appears to be abnormal by immunochemical assays; the putative altered form of NGF could result from a disturbance in the processing pathway. To study the processing of the 35-kD glycosylated NGF precursor and the secretion of NGF in familial dysautonomia, we have employed a recombinant vaccinia virus vector to express high levels of NGF mRNA in primary fibroblast cultures from patients with the disorder; the processing pathway was then studied directly. Cells from several unrelated patients all produce the same 35-kD NGF precursor, process this normally to NGF within the cell, and release NGF into the medium. There are no differences in the ability of cells from patients and from unaffected relatives to process and secrete NGF. The use of similar recombinant vaccinia virus vectors to express proteins at high level in primary cell lines should facilitate the detection of posttranslational processing defects in a variety of human disorders.

  4. Role of metalloproteases in vaccinia virus epitope processing for transporter associated with antigen processing (TAP)-independent human leukocyte antigen (HLA)-B7 class I antigen presentation.

    Science.gov (United States)

    Lorente, Elena; García, Ruth; Mir, Carmen; Barriga, Alejandro; Lemonnier, François A; Ramos, Manuel; López, Daniel

    2012-03-23

    The transporter associated with antigen processing (TAP) translocates the viral proteolytic peptides generated by the proteasome and other proteases in the cytosol to the endoplasmic reticulum lumen. There, they complex with nascent human leukocyte antigen (HLA) class I molecules, which are subsequently recognized by the CD8(+) lymphocyte cellular response. However, individuals with nonfunctional TAP complexes or tumor or infected cells with blocked TAP molecules are able to present HLA class I ligands generated by TAP-independent processing pathways. Herein, using a TAP-independent polyclonal vaccinia virus-polyspecific CD8(+) T cell line, two conserved vaccinia-derived TAP-independent HLA-B*0702 epitopes were identified. The presentation of these epitopes in normal cells occurs via complex antigen-processing pathways involving the proteasome and/or different subsets of metalloproteinases (amino-, carboxy-, and endoproteases), which were blocked in infected cells with specific chemical inhibitors. These data support the hypothesis that the abundant cellular proteolytic systems contribute to the supply of peptides recognized by the antiviral cellular immune response, thereby facilitating immunosurveillance. These data may explain why TAP-deficient individuals live normal life spans without any increased susceptibility to viral infections.

  5. Transforming growth factor alpha, Shope fibroma growth factor, and vaccinia growth factor can replace myxoma growth factor in the induction of myxomatosis in rabbits.

    Science.gov (United States)

    Opgenorth, A; Nation, N; Graham, K; McFadden, G

    1993-02-01

    The epidermal growth factor (EGF) homologues encoded by vaccinia virus, myxoma virus, and malignant rabbit fibroma virus have been shown to contribute to the pathogenicity of virus infection upon inoculation of susceptible hosts. However, since the primary structures of these growth factors and the disease profiles induced by different poxvirus genera vary substantially, the degree to which the various EGF homologues perform similar roles in viral pathogenesis remains unclear. In order to determine whether different EGF-like growth factors can perform qualitatively similar functions in the induction of myxomatosis in rabbits, we created recombinant myxoma virus variants in which the native growth factor, myxoma growth factor (MGF), was disrupted and replaced with either vaccinia virus growth factor, Shope fibroma growth factor, or rat transforming growth factor alpha. Unlike the control virus containing an inactivated MGF gene, which caused marked attenuation of the disease syndrome and substantially less proliferation of the epithelial cell layers in the conjunctiva and respiratory tract, the recombinant myxoma virus strains expressing heterologous growth factors produced infections which were both clinically and histopathologically indistinguishable from wild-type myxomatosis. We conclude that these poxviral and cellular EGF-like growth factors, which are diverse with respect to primary structure and origin, have similar biological functions in the context of myxoma virus pathogenesis and are mitogenic for the same target cells.

  6. Bovine rhinitis viruses are common in U.S. cattle with bovine respiratory disease.

    Science.gov (United States)

    Hause, Ben M; Collin, Emily A; Anderson, Joe; Hesse, Richard A; Anderson, Gary

    2015-01-01

    Bovine rhinitis viruses (BRV) are established etiological agents of bovine respiratory disease complex however little research into their epidemiology and ecology has been published for several decades. In the U.S., only bovine rhinitis A virus 1 (BRAV1) has been identified while bovine rhinitis A virus 2 (BRAV2) and bovine rhinitis B virus (BRBV) were previously only identified in England and Japan, respectively. Metagenomic sequencing of a nasal swab from a bovine respiratory disease (BRD) diagnostic submission from Kansas identified contigs with approximately 90% nucleotide similarity to BRAV2 and BRBV. A combination of de novo and templated assemblies using reference genomes yielded near complete BRAV2 and BRBV genomes. The near complete genome of bovine rhinitis A virus 1 (BRAV1) was also determined from a historical isolate to enable further molecular epidemiological studies. A 5'-nuclease reverse transcription PCR assay targeting the 3D polymerase gene was designed and used to screen 204 archived BRD clinical specimens. Thirteen (6.4%) were positive. Metagenomic sequencing of six positive samples identified mixed BRAV1/BRAV2, BRAV1/BRBV and BRAV2/BRBV infections for five samples. One sample showed infection only with BRAV1. Seroprevalence studies using a cell culture adapted BRBV found immunofluorescence assay-reactive antibodies were common in the herds analyzed. Altogether, these results demonstrate that BRV infections are common in cattle with respiratory disease and that BRAV1, BRAV2 and BRBV co-circulate in U.S. cattle and have high similarity to viruses isolated more than 30 years ago from diverse locations.

  7. Live vaccinia-rabies virus recombinants, but not an inactivated rabies virus cell culture vaccine, protect B-lymphocyte-deficient A/WySnJ mice against rabies: considerations of recombinant defective poxviruses for rabies immunization of immunocompromised individuals.

    Science.gov (United States)

    Lodmell, Donald L; Esposito, Joseph J; Ewalt, Larry C

    2004-09-03

    Presently, commercially available cell culture rabies vaccines for humans and animals consist of the five inactivated rabies virus proteins. The vaccines elicit a CD4+ helper T-cell response and a humoral B-cell response against the viral glycoprotein (G) resulting in the production of virus neutralizing antibody. Antibody against the viral nucleoprotein (N) is also present, but the mechanism(s) of its protection is unclear. HIV-infected individuals with low CD4+ T-lymphocyte counts and individuals undergoing treatment with immunosuppressive drugs have an impaired neutralizing antibody response after pre- and post-exposure immunization with rabies cell culture vaccines. Here we show the efficacy of live vaccinia-rabies virus recombinants, but not a cell culture vaccine consisting of inactivated rabies virus, to elicit elevated levels of neutralizing antibody in B-lymphocyte deficient A/WySnJ mice. The cell culture vaccine also failed to protect the mice, whereas a single immunization of a vaccinia recombinant expressing the rabies virus G or co-expressing G and N equally protected the mice up to 18 months after vaccination. The data suggest that recombinant poxviruses expressing the rabies virus G, in particular replication defective poxviruses such as canarypox or MVA vaccinia virus that undergo abortive replication in non-avian cells, or the attenuated vaccinia virus NYVAC, should be evaluated as rabies vaccines in immunocompromised individuals.

  8. Genetic features of human and bovine Escherichia coli O157:H7 strains isolated in Argentina.

    Science.gov (United States)

    Pianciola, L; D'Astek, B A; Mazzeo, M; Chinen, I; Masana, M; Rivas, M

    2016-02-01

    Shiga toxin-producing Escherichia coli (STEC) are important food-borne pathogens associated with human diseases. In Argentina, O157:H7 is the dominant serotype in hemolytic uremic syndrome (HUS) cases. Previously, we have described the almost exclusive circulation of human E. coli O157 strains belonging to the hypervirulent clade 8 in Neuquén Province. The aim of the present study was to investigate, by a broad molecular characterization, if this particular distribution of E. coli O157 clades in Neuquén is similar to the situation in other regions of the country and if it may be originated in a similar profile in cattle, its main reservoir. Two-hundred and eighty O157 strains (54 bovine and 226 human) isolated between 2006 and 2008 in different regions of Argentina were studied. All strains harbored rfbO157, fliCH7, eae, and ehxA genes. The predominant genotype was stx2a/stx2c in human (76.1%) and bovine (55.5%) strains. All human isolates tested by Lineage-Specific Polymorphism Assay (LSPA-6), were lineage I/II; among bovine strains, 94.1% belonged to lineage I/II and 5.9% to lineage I. No LSPA-6 lineage II isolates were detected. Single nucleotide polymorphism (SNP) analysis has revealed the existence of nine clade phylogenetic groups. In our clinical strains collection, 87.6% belonged to the hypervirulent clade 8, and 12.4% were classified as clade 4/5. In bovine isolates, 59.3% strains were clade 8, 33.3% clade 4/5 and 7.4% clade 3. More than 80% of human strains showed the presence of 6 of the 7 virulence determinants described in the TW14359 O157 strain associated with the raw spinach outbreak in the U.S. in 2006. More than 80% of bovine strains showed the presence of 3 of these factors. The q933 allele, which has been related to high toxin production, was present in 98.2% of clinical strains and 75.9% of the bovine isolates. The molecular characterization of human STEC O157 strains allows us to conclude that the particular situation previously described

  9. 75 FR 34146 - Draft Guideline for the Prevention and Control of Norovirus Gastroenteritis Outbreaks in...

    Science.gov (United States)

    2010-06-16

    ... of Norovirus Gastroenteritis Outbreaks in Healthcare Settings AGENCY: Centers for Disease Control and... for the Prevention and Control of Norovirus Gastroenteritis Outbreaks in Healthcare Settings...-based recommendations for prevention and control of norovirus outbreaks in healthcare settings. DATES...

  10. Identification of resistance and virulence factors in an epidemic Enterobacter hormaechei outbreak strain

    NARCIS (Netherlands)

    Paauw, A.; Caspers, M.P.M.; Leverstein-van Hall, M.A.; Schuren, F.H.J.; Montijn, R.C.; Verhoef, J.; Fluit, A.C.

    2009-01-01

    Bacterial strains differ in their ability to cause hospital outbreaks. Using comparative genomic hybridization, Enterobacter cloacae complex isolates were studied to identify genetic markers specific for Enterobacter cloacae complex outbreak strains. No outbreak-specific genes were found that were

  11. Millipede outbreaks in Akwa Ibom State, Southeastern Nigeria ...

    African Journals Online (AJOL)

    Several millipede outbreaks have been reported in Akwa Ibom State, southeastern Nigeria between 1990 and 2001. Studies which involved field surveys, oral interviews of farmers, on-farm and laboratory observations and field sampling in some reported locations of outbreaks were undertaken. Results showed that nine of ...

  12. Epidemiology and clinical characteristics of the Measles outbreak in ...

    African Journals Online (AJOL)

    Introduction: Measles is a public health problem especially in South Asia and Africa. Nylon Health District has experienced two measles outbreaks over a period of three years. We hereby describe the epidemiology and clinical characteristics of the outbreak of February 2011. Methods: A retrospective descriptive cross ...

  13. Measles outbreak in Simada District, South Gondar Zone, Amhara ...

    African Journals Online (AJOL)

    2mikitser

    2009-06-27

    Jun 27, 2009 ... Abstract. Background: Recently measles outbreaks have been occurring in several areas of Ethiopia. Methods: Desk review of outbreak surveillance data was conducted to identify the susceptible subjects and highly affected groups of the community in Simada District, Amhara Region, May and June, 2009.

  14. Canine oral papillomavirus outbreak at a dog daycare facility.

    Science.gov (United States)

    Lane, Heather E; Weese, J Scott; Stull, Jason W

    2017-07-01

    This report describes an outbreak at a dog daycare facility where 13 of 52 dogs developed suspected canine papillomavirus (CPV) infection. Based on contact tracing, subclinical CPV shedding was speculated. Active surveillance, exclusion of animals with active or recent infection and cohort formation may have been effective in stopping the outbreak.

  15. Outbreak of serotype W135 Neisseria meningitidis in central river ...

    African Journals Online (AJOL)

    The W135 strain of Neisseria meningitidis was responsible for 89 (98.9%) of meningitis cases seen with an incidence rate of 74.9/100,000 in children (0-14 years) and ... The double peak wave-like pattern of the epidemic curve noted during this outbreak suggests a disseminated outbreak originating from an index case with ...

  16. Outbreaks of aflatoxicoses in India | Reddy | African Journal of Food ...

    African Journals Online (AJOL)

    Chronic health risks are particularly prevalent in India where the diets of people are highly prone to aflatoxigenic fungi and aflatoxins. The present paper reviews the disease outbreaks of aflatoxicoses in India due to the ingestion of contaminated food and feed with aflatoxins. One of the first outbreaks of aflatoxicosis was ...

  17. An outbreak of meningococcal meningitis in Gauteng, Spring 1996 ...

    African Journals Online (AJOL)

    An outbreak of meningococcal meningitis in Gauteng, Spring 1996. T.M. Balfour, M.E. Edginton, H. Koornhof, L. McGee, L. Floyd. Abstract. Objective. To describe a Neisseri.a meningitidis outbreak in Gauteng during the period 1 July to 31 December 1996. Design. A descriptive study. Setting. Patients with meningococcal ...

  18. Epidemiology and clinical characteristics of the Measles outbreak in ...

    African Journals Online (AJOL)

    abp

    2012-11-26

    Nov 26, 2012 ... Abstract. Introduction. Measles is a public health problem especially in South Asia and Africa. Nylon Health District has experienced two measles outbreaks over a period of three years. We hereby describe the epidemiology and clinical characteristics of the outbreak of February 2011. Methods.

  19. Large outbreaks of Salmonella Typhimurium infection in Denmark in 2008

    DEFF Research Database (Denmark)

    Ethelberg, S.; Wingstrand, Anne; Jensen, T.

    2008-01-01

    An outbreak of Salmonella Typhimurium phage type U292 has been ongoing in Denmark since 1 April, with 1,054 cases registered until 23 October 2008. Extensive investigations including hypothesis-generating interviews, matched case-control studies, cohort studies in embedded outbreaks, shopping list...

  20. Dependency of outbreaks distribution from insects - defoliators' seasonal development

    Science.gov (United States)

    Valentina Meshkova

    2003-01-01

    Analysis of data on the population dynamics of foliage browsing insects in time and space was conducted in the Ukraine. For each of the main species, correlation indices were calculated between outbreak characteristics (mean and specific foci area, outbreak probability), weather elements (air temperature, precipitation), indices (hydrothermal coefficient, winter...