WorldWideScience

Sample records for botulinum neurotoxin type

  1. Neurologic uses of botulinum neurotoxin type A

    Directory of Open Access Journals (Sweden)

    John P Ney

    2007-01-01

    Full Text Available John P Ney, Kevin R JosephMadigan Army Medical Center, Neurology Service, Tacoma, WA, USAAbstract: This article reviews the current and most neurologic uses of botulinum neurotoxin type A (BoNT-A, beginning with relevant historical data, neurochemical mechanism at the neuromuscular junction. Current commercial preparations of BoNT-A are reviewed, as are immunologic issues relating to secondary failure of BoNT-A therapy. Clinical uses are summarized with an emphasis on controlled clinical trials (as appropriate, including facial movement disorders, focal neck and limb dystonias, spasticity, hypersecretory syndromes, and pain.Keywords: botulinum neurotoxins, BOTOX®, Dysport®, chemodenervation

  2. Botulinum Neurotoxin Injections

    Science.gov (United States)

    ... These are botulinum neurotoxin type A (trade names Botox, Dysport, and Xeomin) and botulinum neurotoxin type B ( ... is commercially available in the United States as Botox from Allergan, Inc, Dysport from Ipsen, Ltd, and ...

  3. Structural Analysis of Botulinum Neurotoxin Type G Receptor Binding

    Energy Technology Data Exchange (ETDEWEB)

    Schmitt, John; Karalewitz, Andrew; Benefield, Desire A.; Mushrush, Darren J.; Pruitt, Rory N.; Spiller, Benjamin W.; Barbieri, Joseph T.; Lacy, D. Borden (Vanderbilt); (MCW)

    2010-10-19

    Botulinum neurotoxin (BoNT) binds peripheral neurons at the neuromuscular junction through a dual-receptor mechanism that includes interactions with ganglioside and protein receptors. The receptor identities vary depending on BoNT serotype (A-G). BoNT/B and BoNT/G bind the luminal domains of synaptotagmin I and II, homologous synaptic vesicle proteins. We observe conditions under which BoNT/B binds both Syt isoforms, but BoNT/G binds only SytI. Both serotypes bind ganglioside G{sub T1b}. The BoNT/G receptor-binding domain crystal structure provides a context for examining these binding interactions and a platform for understanding the physiological relevance of different Syt receptor isoforms in vivo.

  4. The Deubiquitinating Enzyme VCIP135 Dictates the Duration of Botulinum Neurotoxin Type A Intoxication

    Science.gov (United States)

    2017-06-27

    Classification: Biological Sciences/Cell Biology The deubiquitinating enzyme VCIP135 dictates the duration of botulinum neurotoxin type A...ubiquitin ligase HECTD2. However, the light chain evades proteasomal degradation by the dominant effect of a deubiquitinating enzyme VCIP135/VCPIP1...catalytic light chain (LCA). We report that a deubiquitinating enzyme prevents proteasomal degradation of LCA by antagonizing a ubiquitin ligase

  5. Botulinum neurotoxin type A injections for vaginismus secondary to vulvar vestibulitis syndrome.

    Science.gov (United States)

    Bertolasi, Laura; Frasson, Emma; Cappelletti, Jee Yun; Vicentini, Silvana; Bordignon, Monia; Graziottin, Alessandra

    2009-11-01

    To investigate whether botulinum neurotoxin type A improves vaginismus and study its efficacy with repeated treatments. Outpatients were referred because standard cognitive-behavioral and medical treatment for vaginismus and vulvar vestibular syndrome failed. From this group, we prospectively recruited consecutive women (n=39) whose diagnostic electromyogram (EMG) recordings from the levator ani muscle showed hyperactivity at rest and reduced inhibition during straining. These women were followed for a mean (+/-standard deviation) of 105 (+/-50) weeks. Recruited patients underwent repeated cycles of botulinum neurotoxin type A injected into the levator ani under EMG guidance and EMG monitoring thereafter. At enrollment and 4 weeks after each cycle, women were asked about sexual intercourse; underwent EMG evaluation and examinations to grade vaginal resistance according to Lamont; and completed a visual analog scale (VAS) for pain, the Female Sexual Function Index Scale, a quality-of-life questionnaire (Short-Form 12 Health Survey), and bowel and bladder symptom assessment. At 4 weeks after the first botulinum neurotoxin type A cycle, the primary outcome measures (the possibility of having sexual intercourse, and levator ani EMG hyperactivity) both improved, as did the secondary outcomes, Lamont scores, VAS, Female Sexual Function Index Scales, Short-Form 12 Health Survey, and bowel-bladder symptoms. These benefits persisted through later cycles. When follow-up ended, 63.2% of the patients completely recovered from vaginismus and vulvar vestibular syndrome, 15.4% still needed reinjections (censored), and 15.4% had dropped out. Botulinum neurotoxin type A is an effective treatment option for vaginismus secondary to vulvar vestibular syndrome refractory to standard cognitive-behavioral and medical management. After patients received botulinum neurotoxin type A, their sexual activity improved and reinjections provided sustained benefits. III.

  6. Two-component systems are involved in the regulation of botulinum neurotoxin synthesis in Clostridium botulinum type A strain Hall.

    Directory of Open Access Journals (Sweden)

    Chloé Connan

    Full Text Available Clostridium botulinum synthesizes a potent neurotoxin (BoNT which associates with non-toxic proteins (ANTPs to form complexes of various sizes. The bont and antp genes are clustered in two operons. In C. botulinum type A, bont/A and antp genes are expressed during the end of the exponential growth phase and the beginning of the stationary phase under the control of an alternative sigma factor encoded by botR/A, which is located between the two operons. In the genome of C. botulinum type A strain Hall, 30 gene pairs predicted to encode two-component systems (TCSs and 9 orphan regulatory genes have been identified. Therefore, 34 Hall isogenic antisense strains on predicted regulatory genes (29 TCSs and 5 orphan regulatory genes have been obtained by a mRNA antisense procedure. Two TCS isogenic antisense strains showed more rapid growth kinetics and reduced BoNT/A production than the control strain, as well as increased bacterial lysis and impairment of the bacterial cell wall structure. Three other TCS isogenic antisense strains induced a low level of BoNT/A and ANTP production. Interestingly, reduced expression of bont/A and antp genes was shown to be independent of botR/A. These results indicate that BoNT/A synthesis is under the control of a complex network of regulation including directly at least three TCSs.

  7. Neurotoxin gene profiling of clostridium botulinum types C and D native to different countries within Europe.

    Science.gov (United States)

    Woudstra, Cedric; Skarin, Hanna; Anniballi, Fabrizio; Fenicia, Lucia; Bano, Luca; Drigo, Ilenia; Koene, Miriam; Bäyon-Auboyer, Marie-Hélène; Buffereau, Jean-Philippe; De Medici, Dario; Fach, Patrick

    2012-05-01

    Clostridium botulinum types C and D, as well as their mosaic variants C-D and D-C, are associated with avian and mammalian botulism. This study reports on the development of low-density macroarrays based on the GeneDisc cycler platform (Pall-GeneDisc Technologies) applied to the simultaneous detection of the C. botulinum subtypes C, C-D, D, and D-C. The limit of detection of the PCR assays was 38 fg of total DNA, corresponding to 15 genome copies. Artificially contaminated samples of cecum showed a limit of detection below 50 spores/g. The tests were performed with a large variety of bacterial strains, including C. botulinum types C (n = 12), C-D (n = 29), D (n = 5), and D-C (n = 10), other botulinum neurotoxin (BoNT)-producing Clostridium strains (n = 20), non-BoNT-producing clostridia (n = 20), and other bacterial species (n = 23), and showed a high specificity. These PCR assays were compared to previously published real-time PCRs for the detection of C. botulinum in 292 samples collected from cases of botulism events in four European regions. The majority of the samples originated from wild birds (n = 108), poultry (n = 60), and bovines (n = 56). Among the 292 samples, 144 were positive for either the bont/C-D or the bont/D-C gene by using the GeneDisc arrays. The reliability of the results tallied to 97.94%. Interestingly, only BoNT mosaics, types C-D and D-C, were found in naturally contaminated samples whatever their animal origin and their geographical location. Further investigations should now be performed in order to check that mosaic types dominate in Europe and that acquisition of mosaic types helps in survival or adaptation to particular niche.

  8. PEG precipitation coupled with chromatography is a new and sufficient method for the purification of botulinum neurotoxin type B [corrected].

    Directory of Open Access Journals (Sweden)

    Yao Zhao

    Full Text Available Clostridium botulinum neurotoxins are used to treat a variety of neuro-muscular disorders, as well as in cosmetology. The increased demand requires efficient methods for the production and purification of these toxins. In this study, a new purification process was developed for purifying type B neurotoxin. The kinetics of C.botulinum strain growth and neurotoxin production were determined for maximum yield of toxin. The neurotoxin was purified by polyethylene glycol (PEG precipitation and chromatography. Based on design of full factorial experiment, 20% (w/v PEG-6000, 4 °C, pH 5.0 and 0.3 M NaCl were optimal conditions to obtain a high recovery rate of 87% for the type B neurotoxin complex, as indicated by a purification factor of 61.5 fold. Furthermore, residual bacterial cells, impurity proteins and some nucleic acids were removed by PEG precipitation. The following purification of neurotoxin was accomplished by two chromatography techniques using Sephacryl™ S-100 and phenyl HP columns. The neurotoxin was recovered with an overall yield of 21.5% and the purification factor increased to 216.7 fold. In addition, a mouse bioassay determined the purified neurotoxin complex possessed a specific toxicity (LD(50 of 4.095 ng/kg.

  9. Medical Countermeasure Models. Volume 8. Botulinum Neurotoxin

    Science.gov (United States)

    2013-04-12

    of Internal Medicine . 129(221-228). 1998. Medical Countermeasure Models Volume 8: Botulinum Neurotoxin Gryphon Scientific, LLC 6 Figure...Sauteed Onions . Clinical and Epidemiological Observations.” Journal of the American Medical Association. 253(9). 1985. 23 Arnon SS et al. “Botulinum...Factors that Predict Outcome in Type A Foodborne Botulism.” The American Journal of Medicine . 76. 1984. 25 CDC. “Notice of CDC’s Discontinuation of

  10. Differences in the multiple step process of inhibition of neurotransmitter release induced by tetanus toxin and botulinum neurotoxins type A and B at Aplysia synapses.

    Science.gov (United States)

    Poulain, B; De Paiva, A; Deloye, F; Doussau, F; Tauc, L; Weller, U; Dolly, J O

    1996-01-01

    In order to gain insights into the steps (binding, uptake, intracellular effect) which differ in the inhibitory actions of tetanus toxin and botulinum neurotoxins types A or B, their temperature dependencies were investigated at identified cholinergic and non-cholinergic synapses in Aplysia. Upon lowering the temperature from 22 degrees C to 10 degrees C, extracellularly applied botulinum neurotoxin type A and B appeared unable to inhibit transmitter release whilst tetanus toxin exhibited a residual activity. Binding of each toxin to the neuronal membrane appeared virtually unaltered following this temperature change. By contrast, the intracellular effects of botulinum neurotoxin type B and tetanus toxin were strongly attenuated by temperature reduction whereas the inhibitory action of botulinum neurotoxin type A was only moderately reduced. Importantly, this discrepancy relates to the known proteolytic cleavage of different synaptic proteins by these two toxin groups. Since both the binding and intracellular activity of botulinum neurotoxin type A are minimally affected at 10 degrees C, its inability to inhibit neurotransmission at this low temperature when applied extracellularly indicated attenuation of its uptake. Due to the strict temperature dependence of the intracellular action of tetanus toxin and botulinum neurotoxin type B, but not A, an examination of the effects of changes in temperature on the internalization step was facilitated by the use of heterologous mixtures of the toxins' heavy and light chains. At 10 degrees C, heavy chain from tetanus toxin but not from botulinum neurotoxin type B mediated uptake of botulinum neurotoxin type A light chain. Collectively, these results provide evidence that, at least in Aplysia, the uptake mechanism for botulinum neurotoxin types A and B differs from that of tetanus toxin.

  11. Botulinum neurotoxin type-A when utilized in animals with trigeminal sensitization induced a antinociceptive effect

    Directory of Open Access Journals (Sweden)

    Elcio J Piovesan

    2016-06-01

    Full Text Available ABSTRACT Purpose of the study was evaluate the possible antinociceptive effect of botulinum neurotoxin type-A (BoNT/A in an experimental model of trigeminal neuralgia. Method Neuropathic pain was induced by surgical constriction of the infraorbital nerve in rats. A control group underwent a sham procedure consisting of surgical exposure of the nerve. Subgroups of each group received either BoNT/A or isotonic saline solution. The clinical response was assessed with the -20°C test. Animals that underwent nerve constriction developed sensitization; the sham group did not. Results The sensitization was reversed by BoNT/A treatment evident 24 hours following application. Pronociceptive effect was observed in the sham group following BoNT/A. Conclusion BoNT/A has an antinociceptive effect in sensitized animals and a pronociceptive effect in non-sensitized animals.

  12. [Monoclonal antibodies to type A, B, E and F botulinum neurotoxins].

    Science.gov (United States)

    Abbasova, S G; Ruddenko, N V; Gorokhovatskiĭ, A Iu; Kapralova, M V; Vinogradova, I D; Vertiev, Iu V; Nesmeianov, V A; Grishin, E V

    2011-01-01

    Mouse monoclonal antibodies against the most acutely toxic substances, botulinum neurotoxins (BoNTs) of types A, B, E, and F, was generated and characterized, that recognize their respective toxins in natural toxin complex. Based on these antibodies, we developed sandwich-ELISA for quantitative detection of these toxins. For each respective toxin the detection limit of the assay was: BoNT/A - 0.4 ng/ml, BoNT/B - 0.5 ng/ml; BoNT/E - 0.1 ng/ml; and for BoNT/F - 2.4 ng/ml. The developed assays permitted quantitative identification of the BoNTs in canned meat and vegetables. The BNTA-4.1 and BNTA-9.1 antibodies possessed neutralizing activity against natural complex of the botulinium toxin type A in vivo, both individually and in mixture, the mixture of the antibodies neutralized the higher dose of the toxin. The BNTA-4.1 antibody binds specifically the light chain (the chain with protease activity) of the toxin, whereas BNTA-9.1 interacts with the heavy chain. We believe that the BNTA-4.1 and BNTA-9.1 monoclonal antibodies are prospective candidates for development of humanized therapeutic antibodies for treatment of BoNT/A-caused botulism.

  13. An Ultrasensitive Gold Nanoparticle-based Lateral Flow Test for the Detection of Active Botulinum Neurotoxin Type A.

    Science.gov (United States)

    Liu, Jing; Gao, Shan; Kang, Lin; Ji, Bin; Xin, Wenwen; Kang, Jingjing; Li, Ping; Gao, Jie; Wang, Hanbin; Wang, Jinglin; Yang, Hao

    2017-12-01

    Botulism is a severe and potentially lethal paralytic disease caused by several botulinum neurotoxin-producing Clostridia spp. In China, the majority of the cases caused by botulism were from less-developed rural areas. Here, we designed specific substrate peptides and reconfigured gold nanoparticle-based lateral flow test strip (LFTS) to develop an endopeptidase-based lateral flow assay for the diagnosis of botulism. We performed this lateral flow assay on botulinum neurotoxin-spiked human serum samples. The as-prepared LFTS had excellent performance in the detection of botulinum neurotoxin using only 1 μL of simulated serum, and its sensitivity and specificity were comparable to that of mouse lethality assay. Moreover, the assay takes only half a day and does not require highly trained laboratory staff, specialized facility, or equipment. Finally, our LFTS can be potentially extended to other serotypes of BoNTs by designing specific substrate peptides against the different types of BoNTs. Overall, we demonstrate a strategy by which LFTS and endopeptidase activity assays can be integrated to achieve facile and economic diagnosis of botulism in resource-limited settings.

  14. An Ultrasensitive Gold Nanoparticle-based Lateral Flow Test for the Detection of Active Botulinum Neurotoxin Type A

    Science.gov (United States)

    Liu, Jing; Gao, Shan; Kang, Lin; Ji, Bin; Xin, Wenwen; Kang, Jingjing; Li, Ping; Gao, Jie; Wang, Hanbin; Wang, Jinglin; Yang, Hao

    2017-03-01

    Botulism is a severe and potentially lethal paralytic disease caused by several botulinum neurotoxin-producing Clostridia spp. In China, the majority of the cases caused by botulism were from less-developed rural areas. Here, we designed specific substrate peptides and reconfigured gold nanoparticle-based lateral flow test strip (LFTS) to develop an endopeptidase-based lateral flow assay for the diagnosis of botulism. We performed this lateral flow assay on botulinum neurotoxin-spiked human serum samples. The as-prepared LFTS had excellent performance in the detection of botulinum neurotoxin using only 1 μL of simulated serum, and its sensitivity and specificity were comparable to that of mouse lethality assay. Moreover, the assay takes only half a day and does not require highly trained laboratory staff, specialized facility, or equipment. Finally, our LFTS can be potentially extended to other serotypes of BoNTs by designing specific substrate peptides against the different types of BoNTs. Overall, we demonstrate a strategy by which LFTS and endopeptidase activity assays can be integrated to achieve facile and economic diagnosis of botulism in resource-limited settings.

  15. High-Throughput Multiplex Flow Cytometry Screening for Botulinum Neurotoxin Type A Light Chain Protease Inhibitors

    Science.gov (United States)

    2010-01-01

    Given their medical importance, proteases have been studied by diverse approaches and screened for small molecule protease inhibitors. Here, we present a multiplexed microsphere-based protease assay that uses high-throughput flow cytometry to screen for inhibitors of the light chain protease of botulinum neurotoxin type A (BoNTALC). Our assay uses a full-length substrate and several deletion mutants screened in parallel to identify small molecule inhibitors. The use of multiplex flow cytometry has the advantage of using full-length substrates, which contain already identified distal-binding elements for the BoNTALC, and could lead to a new class of BoNTALC inhibitors. In this study, we have screened 880 off patent drugs and bioavailable compounds to identify ebselen as an in vitro inhibitor of BoNTALC. This discovery demonstrates the validity of our microsphere-based approach and illustrates its potential for high-throughput screening for inhibitors of proteases in general. PMID:20035615

  16. Assay of diffusion of different botulinum neurotoxin type a formulations injected in the mouse leg.

    Science.gov (United States)

    Carli, Luca; Montecucco, Cesare; Rossetto, Ornella

    2009-09-01

    Botulinum neurotoxin type-A (BoNT/A) is very effective in the therapy of a wide range of human syndromes characterized by hyperactivity of peripheral cholinergic nerve terminals. Little diffusion of this toxin from the site of injection is commonly observed, but even minor changes in this property would greatly affect the validity of the treatment. Different pharmacological formulations of BoNT/A are available, and they may have different diffusion characteristics due to protein complex size, product format, and pharmacological properties. Here we assessed the extent of diffusion of three commercial preparations of BoNT/A: Botox (Allergan), Dysport (Ipsen), and Xeomin (Merz Pharmaceuticals) using a novel and highly sensitive test based on neural cell adhesion molecule (N-CAM) expression in muscle. N-CAM is a membrane glycoprotein that accumulates on muscle fibers after denervation and is not expressed in untreated adult muscle. This allows fine monitoring of the functional diffusion of this toxin, and the sensitivity of this assay is emphasized by the use of the mouse model because of the small muscle dimensions. The results presented here indicate that there is no significant difference between Botox, Dysport, and Xeomin with respect to diffusion into adjacent muscles in the mouse leg.

  17. In Vitro Detection and Quantification of Botulinum Neurotoxin Type E Activity in Avian Blood▿

    OpenAIRE

    Piazza, Timothy M.; Blehert, David S.; Dunning, F. Mark; Berlowski-Zier, Brenda M.; Zeytin, Füsûn N.; Samuel, Michael D.; Tucker, Ward C.

    2011-01-01

    Botulinum neurotoxin serotype E (BoNT/E) outbreaks in the Great Lakes region cause large annual avian mortality events, with an estimated 17,000 bird deaths reported in 2007 alone. During an outbreak investigation, blood collected from bird carcasses is tested for the presence of BoNT/E using the mouse lethality assay. While sensitive, this method is labor-intensive and low throughput and can take up to 7 days to complete. We developed a rapid and sensitive in vitro assay, the BoTest Matrix E...

  18. Characterization of SNARE Cleavage Products Generated by Formulated Botulinum Neurotoxin Type-A Drug Products

    Directory of Open Access Journals (Sweden)

    Jack Xie

    2010-08-01

    Full Text Available The study evaluated substrate cleavage product(s generated by three botulinum neurotoxin serotype A (BoNT/A medicinal drug products utilizing a novel and highly specific, light-chain activity, high-performance liquid chromatography (LCA-HPLC method. Samples were reacted with a commercially available BoNT/A fluorescent substrate derived from the SNAP-25 sequence. Reaction products were separated by reversed-phase HPLC. The method detected an atypical cleavage pattern by one of the formulated drug products. IncobotulinumtoxinA produced two cleavage fragments rather than the single fragment typically generated by BoNT/A. Identification confirmed the secondary cleavage at a position corresponding to SNAP-25 Arg198–Ala199 (normal BoNT/A cleavage is Gln197–Arg198. Arg198–Ala199 is also the cleavage site for trypsin and serotype C toxin. Normal cleavage was observed for all other BoNT/A drug product samples, as well as 900-kD and 150-kD bulk toxin BoNT/A. The reason for this unexpected secondary cleavage pattern by one formulated BoNT/A drug product is unknown. Possible explanations include a contaminating protease and/or damage to the 150-kD type-A toxin causing nonspecific substrate recognition and subsequent cleavage uncharacteristic of type-A toxin. The BoNT/A drug products were also analyzed via the LCA-HPLC assay using a commercial BoNT/C fluorescent substrate derived from the syntaxin sequence. Cleavage of the serotype C substrate by incobotulinumtoxinA was also confirmed whilst neither of the other drug products cleaved the syntaxin substrate.

  19. An Ultrasensitive Gold Nanoparticle-based Lateral Flow Test for the Detection of Active Botulinum Neurotoxin Type A

    OpenAIRE

    Liu, Jing; Gao, Shan; Kang, Lin; Ji, Bin; Xin, Wenwen; Kang, Jingjing; Li, Ping; Jie GAO; Wang, Hanbin; Wang, Jinglin; Yang, Hao

    2017-01-01

    Botulism is a severe and potentially lethal paralytic disease caused by several botulinum neurotoxin-producing Clostridia spp. In China, the majority of the cases caused by botulism were from less-developed rural areas. Here, we designed specific substrate peptides and reconfigured gold nanoparticle-based lateral flow test strip (LFTS) to develop an endopeptidase-based lateral flow assay for the diagnosis of botulism. We performed this lateral flow assay on botulinum neurotoxin-spiked human s...

  20. A Highly Specific Monoclonal Antibody for Botulinum Neurotoxin Type A-Cleaved SNAP25

    Directory of Open Access Journals (Sweden)

    Catherine Rhéaume

    2015-06-01

    Full Text Available Botulinum neurotoxin type-A (BoNT/A, as onabotulinumtoxinA, is approved globally for 11 major therapeutic and cosmetic indications. While the mechanism of action for BoNT/A at the presynaptic nerve terminal has been established, questions remain regarding intracellular trafficking patterns and overall fate of the toxin. Resolving these questions partly depends on the ability to detect BoNT/A’s location, distribution, and movement within a cell. Due to BoNT/A’s high potency and extremely low concentrations within neurons, an alternative approach has been employed. This involves utilizing specific antibodies against the BoNT/A-cleaved SNAP25 substrate (SNAP25197 to track the enzymatic activity of toxin within cells. Using our highly specific mouse monoclonal antibody (mAb against SNAP25197, we generated human and murine recombinant versions (rMAb using specific backbone immunoglobulins. In this study, we validated the specificity of our anti-SNAP25197 rMAbs in several different assays and performed side-by-side comparisons to commercially-available and in-house antibodies against SNAP25. Our rMAbs were highly specific for SNAP25197 in all assays and on several different BoNT/A-treated tissues, showing no cross-reactivity with full-length SNAP25. This was not the case with other reportedly SNAP25197-selective antibodies, which were selective in some, but not all assays. The rMAbs described herein represent effective new tools for detecting BoNT/A activity within cells.

  1. Botulinum Neurotoxin Type-A for the Treatment of Atypical Odontalgia.

    Science.gov (United States)

    Cuadrado, María-Luz; García-Moreno, Héctor; Arias, José-Antonio; Pareja, Juan A

    2016-09-01

    Atypical odontalgia (AO), a subform of persistent idiopathic facial pain, is defined as a continuous toothache in which a thorough examination reveals no dental pathology. AO is believed to be a neuropathic condition, given that some cases are preceded by dental procedures. Different topical and systemic medications have been used for the treatment of AO, but their effect is often unsatisfactory. The authors aimed to assess the effect and safety of botulinum neurotoxin type-A (BoNTA) in a series of patients with AO. Four patients with refractory AO (2 males and 2 females, aged 31-72) were treated with local injections of BoNTA to the painful area. BoNTA was injected at various sites into the gums, and two patients had additional injections in the hard palate or the upper lip. The total dose of BoNTA for each procedure was 15-30 U, and the total number of injection points was 6-12. The follow-up ranged from 6 to 20 months. Two patients received two cycles of BoNTA, while the remaining patients received three and five cycles each, respectively. All patients obtained significant relief with complete or almost complete reduction of pain. The analgesic effect was apparent after a latency period of 3-14 days, and the effect persisted for 2-6 months. There were no adverse events reported from any of the interventions. The responses to BoNTA injections in this series agree with those previously observed in neuropathic pain. BoNTA injections may be a safe and effective option for the treatment of AO. © 2016 American Academy of Pain Medicine. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Antinociceptive Effects of Transcytosed Botulinum Neurotoxin Type A on Trigeminal Nociception in Rats

    Science.gov (United States)

    Kim, Hye-Jin; Lee, Geun-Woo; Kim, Min-Ji; Yang, Kui-Ye; Kim, Seong-Taek; Bae, Yong-Cheol

    2015-01-01

    We examined the effects of peripherally or centrally administered botulinum neurotoxin type A (BoNT-A) on orofacial inflammatory pain to evaluate the antinociceptive effect of BoNT-A and its underlying mechanisms. The experiments were carried out on male Sprague-Dawley rats. Subcutaneous (3 U/kg) or intracisternal (0.3 or 1 U/kg) administration of BoNT-A significantly inhibited the formalin-induced nociceptive response in the second phase. Both subcutaneous (1 or 3 U/kg) and intracisternal (0.3 or 1 U/kg) injection of BoNT-A increased the latency of head withdrawal response in the complete Freund's adjuvant (CFA)-treated rats. Intracisternal administration of N-methyl-D-aspartate (NMDA) evoked nociceptive behavior via the activation of trigeminal neurons, which was attenuated by the subcutaneous or intracisternal injection of BoNT-A. Intracisternal injection of NMDA up-regulated c-Fos expression in the trigeminal neurons of the medullary dorsal horn. Subcutaneous (3 U/kg) or intracisternal (1 U/kg) administration of BoNT-A significantly reduced the number of c-Fos immunoreactive neurons in the NMDA-treated rats. These results suggest that the central antinociceptive effects the peripherally or centrally administered BoNT-A are mediated by transcytosed BoNT-A or direct inhibition of trigeminal neurons. Our data suggest that central targets of BoNT-A might provide a new therapeutic tool for the treatment of orofacial chronic pain conditions. PMID:26170739

  3. Botulinum neurotoxin type A versus punctal plug insertion in the management of dry eye disease

    Directory of Open Access Journals (Sweden)

    Amal A Bukhari

    2014-01-01

    Full Text Available Purpose: To compare the efficacies of punctal plug insertion and Botulinum toxin injection in dry eye disease not responding to topical medications. Materials and Methods: A non-controlled randomized clinical trial of two parallel groups of 60 dry eye patients seen in the clinic not responding to topical medications were divided into two groups. One group received punctal plugs and the other group received Botulinum toxin injections to prevent lacrimal tear drainage. Results: Of a total of 36 patients with a mean age of 44.5 years who received punctal plugs, 50% of them experienced improvements in the clinical manifestations of their disease. 12/36 (33.3% developed plug extrusion, and 6/36 (16.7% patients developed conjunctival erosions with irritation that necessitated plug removal within one week of insertion. A total of 24 patients with a mean age of 47.5 years received injections of Botulinum toxin. Of these, 83.3% had improvement in all of the clinical manifestations of dry eye. 4/24 (16.7% had no improvement in the degrees to which they experienced foreign body sensations, 33.3% reported shampoo entering the eye while showering. All of the patients who received Botulinum toxin injections were satisfied with the results of their treatment, whereas only 72.3% of the patients who received punctal plugs were satisfied with their results. Conclusion: Botulinum neurotoxin A injections can be a very good alternative to punctal plugs in improving the clinical manifestations of dry eye disease They are associated with the development of fewer and milder complications and with higher levels of patient satisfaction.

  4. Zebrafish Sensitivity to Botulinum Neurotoxins

    Science.gov (United States)

    Chatla, Kamalakar; Gaunt, Patricia S.; Petrie-Hanson, Lora; Ford, Lorelei; Hanson, Larry A.

    2016-01-01

    Botulinum neurotoxins (BoNT) are the most potent known toxins. The mouse LD50 assay is the gold standard for testing BoNT potency, but is not sensitive enough to detect the extremely low levels of neurotoxin that may be present in the serum of sensitive animal species that are showing the effects of BoNT toxicity, such as channel catfish affected by visceral toxicosis of catfish. Since zebrafish are an important animal model for diverse biomedical and basic research, they are readily available and have defined genetic lines that facilitate reproducibility. This makes them attractive for use as an alternative bioassay organism. The utility of zebrafish as a bioassay model organism for BoNT was investigated. The 96 h median immobilizing doses of BoNT/A, BoNT/C, BoNT/E, and BoNT/F for adult male Tübingen strain zebrafish (0.32 g mean weight) at 25 °C were 16.31, 124.6, 4.7, and 0.61 picograms (pg)/fish, respectively. These findings support the use of the zebrafish-based bioassays for evaluating the presence of BoNT/A, BoNT/E, and BoNT/F. Evaluating the basis of the relatively high resistance of zebrafish to BoNT/C and the extreme sensitivity to BoNT/F may reveal unique functional patterns to the action of these neurotoxins. PMID:27153088

  5. Zebrafish Sensitivity to Botulinum Neurotoxins

    Directory of Open Access Journals (Sweden)

    Kamalakar Chatla

    2016-05-01

    Full Text Available Botulinum neurotoxins (BoNT are the most potent known toxins. The mouse LD50 assay is the gold standard for testing BoNT potency, but is not sensitive enough to detect the extremely low levels of neurotoxin that may be present in the serum of sensitive animal species that are showing the effects of BoNT toxicity, such as channel catfish affected by visceral toxicosis of catfish. Since zebrafish are an important animal model for diverse biomedical and basic research, they are readily available and have defined genetic lines that facilitate reproducibility. This makes them attractive for use as an alternative bioassay organism. The utility of zebrafish as a bioassay model organism for BoNT was investigated. The 96 h median immobilizing doses of BoNT/A, BoNT/C, BoNT/E, and BoNT/F for adult male Tübingen strain zebrafish (0.32 g mean weight at 25 °C were 16.31, 124.6, 4.7, and 0.61 picograms (pg/fish, respectively. These findings support the use of the zebrafish-based bioassays for evaluating the presence of BoNT/A, BoNT/E, and BoNT/F. Evaluating the basis of the relatively high resistance of zebrafish to BoNT/C and the extreme sensitivity to BoNT/F may reveal unique functional patterns to the action of these neurotoxins.

  6. Botulinum neurotoxins: genetic, structural and mechanistic insights.

    Science.gov (United States)

    Rossetto, Ornella; Pirazzini, Marco; Montecucco, Cesare

    2014-08-01

    Botulinum neurotoxins (BoNTs) are produced by anaerobic bacteria of the genus Clostridium and cause a persistent paralysis of peripheral nerve terminals, which is known as botulism. Neurotoxigenic clostridia belong to six phylogenetically distinct groups and produce more than 40 different BoNT types, which inactivate neurotransmitter release owing to their metalloprotease activity. In this Review, we discuss recent studies that have improved our understanding of the genetics and structure of BoNT complexes. We also describe recent insights into the mechanisms of BoNT entry into the general circulation, neuronal binding, membrane translocation and neuroparalysis.

  7. Facile electrochemical detection of botulinum neurotoxin type E using a two-step proteolytic cleavage.

    Science.gov (United States)

    Park, Seonhwa; Shin, Yu Mi; Song, Ji-Joon; Yang, Haesik

    2015-10-15

    Facile electrochemical methods for measuring protease concentration or protease activity are essential for point-of-care testing of toxic proteases. However, electrochemical detection of proteases, such as botulinum neurotoxin type E (BoNT/E), that cleave a peptide bond between two specific amino acid residues is challenging. This study reports a facile and sensitive electrochemical method for BoNT/E detection. The method is based on a two-step proteolytic cleavage using a target BoNT/E light chain (BoNT/E-LC) and an externally supplemented exopeptidase, L-leucine-aminopeptidase (LAP). BoNT/E-LC cleaves a peptide bond between arginine and isoleucine in IDTQNRQIDRI-4-amino-1-naphthol (oligopeptide-AN) to generate isoleucine-AN. Subsequently, LAP cleaves a bond between isoleucine and AN to liberate a free electroactive AN species. The liberated AN participates in electrochemical-chemical-chemical (ECC) redox cycling involving Ru(NH3)6(3+), AN, and a reducing agent, which allows a high signal amplification. Electrochemical detection is carried out without surface modification of indium-tin oxide electrodes. We show that dithiothreitol is beneficial for enhancing the enzymatic activity of BoNT/E-LC and also for achieving a fast ECC redox cycling. An incubation temperature of 37°C and the use of phosphate buffered saline (PBS) buffer resulted in optimal signal-to-background ratios for efficient BoNT/E detection. BoNT/E-LC could be detected at concentrations of approximately 2.0 pg/mL, 0.2, and 3 ng/mL after 4h, 2h, and 15 min incubation in PBS buffer, respectively, and approximately 0.3 ng/mL after 2-h incubation in bottled water. The method developed could be applied in fast, sensitive, and selective detection of any protease that cleaves a peptide bond between two specific amino acid residues. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. CRYSTAL STRUCTURE OF CLOSTRIDIUM BOTULINUM NEUROTOXIN SEROTYPE B.

    Energy Technology Data Exchange (ETDEWEB)

    SWAMINATHAN,S.; ESWARAMOORTHY,S.

    2001-11-19

    The toxigenic strains of Clostridium botulinum produce seven serologically distinct types of neurotoxins labeled A - G (EC 3.4.24.69), while Clostridium tetani produces tetanus neurotoxin (EC 3.4.24.68). Botulinum and tetanus neurotoxins (BoNTs and TeNT) are produced as single inactive chains of molecular mass of approximately 150 kDa. Most of these neurotoxins are released after being cleaved into two chains, a heavy chain (HI) of 100 kDa and a light chain (L) of 50 kDa held together by an interchain disulfide bond, by tissue proteinases. BoNT/E is released as a single chain but cleaved by host proteinases [1]. Clostvidium botulinum neurotoxins are extremely poisonous proteins with their LD{sub 50} for humans in the range of 0.1 - 1 ng kg{sup -1} [2]. Botulinum neurotoxins are responsible for neuroparalytic syndromes of botulism characterized by serious neurological disorders and flaccid paralysis. BoNTs block the release of acetylcholine at the neuromuscular junction causing flaccid paralysis while TeNT blocks the release of neurotransmitters like glycine and {gamma}-aminobutyric acid (GABA) in the inhibitory interneurons of the spinal cord resulting in spastic paralysis. In spite of different clinical symptoms, their aetiological agents intoxicate neuronal cells in the same way and these toxins have similar structural organization [3].

  9. Production and evaluation of a recombinant chimeric vaccine against clostridium botulinum neurotoxin types C and D.

    Science.gov (United States)

    Gil, Luciana A F; da Cunha, Carlos Eduardo P; Moreira, Gustavo M S G; Salvarani, Felipe M; Assis, Ronnie A; Lobato, Francisco Carlos F; Mendonça, Marcelo; Dellagostin, Odir A; Conceição, Fabricio R

    2013-01-01

    Bovine botulism is a fatal disease that is caused by botulinum neurotoxins (BoNTs) produced by Clostridium botulinum serotypes C and D and that causes great economic losses, with nearly 100% lethality during outbreaks. It has also been considered a potential source of human food-borne illness in many countries. Vaccination has been reported to be the most effective way to control bovine botulism. However, the commercially available toxoid-based vaccines are difficult and hazardous to produce. Neutralizing antibodies targeted against the C-terminal fragment of the BoNT heavy chain (HC) are known to confer efficient protection against lethal doses of BoNTs. In this study, a novel recombinant chimera, consisting of Escherichia coli heat-labile enterotoxin B subunit (LTB), a strong adjuvant of the humoral immune response, fused to the HC of BoNT serotypes C and D, was produced in E. coli. Mice vaccinated with the chimera containing LTB and an equivalent molar ratio of the chimera without LTB plus aluminum hydroxide (Al(OH)3) developed 2 IU/mL of antitoxins for both serotypes. Guinea pigs immunized with the recombinant chimera with LTB plus Al(OH)3 developed a protective immune response against both BoNT/C (5 IU/mL) and BoNT/D (10 IU/mL), as determined by a mouse neutralization bioassay with pooled sera. The results achieved with guinea pig sera fulfilled the requirements of commercial vaccines for prevention of botulism, as determined by the Brazilian Ministry of Agriculture, Livestock and Food, Supply. The presence of LTB was essential for the development of a strong humoral immune response, as it acted in synergism with Al(OH)3. Thus, the vaccine described in this study is a strong candidate for the control of botulism in cattle.

  10. Production and evaluation of a recombinant chimeric vaccine against clostridium botulinum neurotoxin types C and D.

    Directory of Open Access Journals (Sweden)

    Luciana A F Gil

    Full Text Available Bovine botulism is a fatal disease that is caused by botulinum neurotoxins (BoNTs produced by Clostridium botulinum serotypes C and D and that causes great economic losses, with nearly 100% lethality during outbreaks. It has also been considered a potential source of human food-borne illness in many countries. Vaccination has been reported to be the most effective way to control bovine botulism. However, the commercially available toxoid-based vaccines are difficult and hazardous to produce. Neutralizing antibodies targeted against the C-terminal fragment of the BoNT heavy chain (HC are known to confer efficient protection against lethal doses of BoNTs. In this study, a novel recombinant chimera, consisting of Escherichia coli heat-labile enterotoxin B subunit (LTB, a strong adjuvant of the humoral immune response, fused to the HC of BoNT serotypes C and D, was produced in E. coli. Mice vaccinated with the chimera containing LTB and an equivalent molar ratio of the chimera without LTB plus aluminum hydroxide (Al(OH3 developed 2 IU/mL of antitoxins for both serotypes. Guinea pigs immunized with the recombinant chimera with LTB plus Al(OH3 developed a protective immune response against both BoNT/C (5 IU/mL and BoNT/D (10 IU/mL, as determined by a mouse neutralization bioassay with pooled sera. The results achieved with guinea pig sera fulfilled the requirements of commercial vaccines for prevention of botulism, as determined by the Brazilian Ministry of Agriculture, Livestock and Food, Supply. The presence of LTB was essential for the development of a strong humoral immune response, as it acted in synergism with Al(OH3. Thus, the vaccine described in this study is a strong candidate for the control of botulism in cattle.

  11. Conjugative botulinum neurotoxin-encoding plasmids in Clostridium botulinum.

    Directory of Open Access Journals (Sweden)

    Kristin M Marshall

    Full Text Available BACKGROUND: Clostridium botulinum produces seven distinct serotypes of botulinum neurotoxins (BoNTs. The genes encoding different subtype neurotoxins of serotypes A, B, F and several dual neurotoxin-producing strains have been shown to reside on plasmids, suggesting that intra- and interspecies transfer of BoNT-encoding plasmids may occur. The objective of the present study was to determine whether these C. botulinum BoNT-encoding plasmids are conjugative. METHODOLOGY/PRINCIPAL FINDINGS: C. botulinum BoNT-encoding plasmids pBotCDC-A3 (strain CDC-A3, pCLJ (strain 657Ba and pCLL (strain Eklund 17B were tagged with the erythromycin resistance marker (Erm using the ClosTron mutagenesis system by inserting a group II intron into the neurotoxin genes carried on these plasmids. Transfer of the tagged plasmids from the donor strains CDC-A3, 657Ba and Eklund 17B to tetracycline-resistant recipient C. botulinum strains was evaluated in mating experiments. Erythromycin and tetracycline resistant transconjugants were isolated from donor:recipient mating pairs tested. Transfer of the plasmids to the transconjugants was confirmed by pulsed-field gel electrophoresis (PFGE and Southern hybridizations. Transfer required cell-to-cell contact and was DNase resistant. This indicates that transfer of these plasmids occurs via a conjugation mechanism. CONCLUSIONS/SIGNIFICANCE: This is the first evidence supporting conjugal transfer of native botulinum neurotoxin-encoding plasmids in C. botulinum, and provides a probable mechanism for the lateral distribution of BoNT-encoding plasmids to other C. botulinum strains. The potential transfer of C. botulinum BoNT-encoding plasmids to other bacterial hosts in the environment or within the human intestine is of great concern for human pathogenicity and necessitates further characterization of these plasmids.

  12. Basis Tetrapeptides as Potent Intracellular Inhibitors of type A Botulinum Neurotoxin Protease Activity

    Energy Technology Data Exchange (ETDEWEB)

    Hale, M.; Swaminathan, S.; Oyler, G.; Ahmed, S. A.

    2011-01-21

    Botulinum neurotoxins (BoNT) are the most potent of all toxins that cause flaccid muscle paralysis leading to death. They are also potential biothreat agents. A systematic investigation of various short peptide inhibitors of the BoNT protease domain with a 17-residue peptide substrate led to arginine-arginine-glycine-cysteine having a basic tetrapeptide structure as the most potent inhibitor. When assayed in the presence of dithiothreitol (DTT), the inhibitory effect was drastically reduced. Replacing the terminal cysteine with one hydrophobic residue eliminated the DTT effect but with two hydrophobic residues made the pentapeptide a poor inhibitor. Replacing the first arginine with cysteine or adding an additional cysteine at the N terminus did not improve inhibition. When assessed using mouse brain lysates, the tetrapeptides also inhibited BoNT/A cleavage of the endogenous SNAP-25. The peptides penetrated the neuronal cell lines, N2A and BE(2)-M17, without adversely affecting metabolic functions as measured by ATP production and P-38 phosphorylation. Biological activity of the peptides persisted within cultured chick motor neurons and rat and mouse cerebellar neurons for more than 40 h and inhibited BoNT/A protease action inside the neurons in a dose- and time-dependent fashion. Our results define a tetrapeptide as the smallest peptide inhibitor in the backdrop of a large substrate protein of 200+ amino acids having multiple interaction regions with its cognate enzyme. The inhibitors should also be valuable candidates for drug development.

  13. In vitro detection and quantification of botulinum neurotoxin type E activity in avian blood

    Science.gov (United States)

    Piazza, Timothy M.; Blehert, David S.; Dunning, F. Mark; Berlowski-Zier, Brenda M.; Zeytin, Fusun N.; Samuel, Michael D.; Tucker, Ward C.

    2011-01-01

    Botulinum neurotoxin serotype E (BoNT/E) outbreaks in the Great Lakes region cause large annual avian mortality events, with an estimated 17,000 bird deaths reported in 2007 alone. During an outbreak investigation, blood collected from bird carcasses is tested for the presence of BoNT/E using the mouse lethality assay. While sensitive, this method is labor-intensive and low throughput and can take up to 7 days to complete. We developed a rapid and sensitive in vitro assay, the BoTest Matrix E assay, that combines immunoprecipitation with high-affinity endopeptidase activity detection by Förster resonance energy transfer (FRET) to rapidly quantify BoNT/E activity in avian blood with detection limits comparable to those of the mouse lethality assay. On the basis of the analysis of archived blood samples (n = 87) collected from bird carcasses during avian mortality investigations, BoTest Matrix E detected picomolar quantities of BoNT/E following a 2-h incubation and femtomolar quantities of BoNT/E following extended incubation (24 h) with 100% diagnostic specificity and 91% diagnostic sensitivity.

  14. In Vitro Detection and Quantification of Botulinum Neurotoxin Type E Activity in Avian Blood▿

    Science.gov (United States)

    Piazza, Timothy M.; Blehert, David S.; Dunning, F. Mark; Berlowski-Zier, Brenda M.; Zeytin, Füsûn N.; Samuel, Michael D.; Tucker, Ward C.

    2011-01-01

    Botulinum neurotoxin serotype E (BoNT/E) outbreaks in the Great Lakes region cause large annual avian mortality events, with an estimated 17,000 bird deaths reported in 2007 alone. During an outbreak investigation, blood collected from bird carcasses is tested for the presence of BoNT/E using the mouse lethality assay. While sensitive, this method is labor-intensive and low throughput and can take up to 7 days to complete. We developed a rapid and sensitive in vitro assay, the BoTest Matrix E assay, that combines immunoprecipitation with high-affinity endopeptidase activity detection by Förster resonance energy transfer (FRET) to rapidly quantify BoNT/E activity in avian blood with detection limits comparable to those of the mouse lethality assay. On the basis of the analysis of archived blood samples (n = 87) collected from bird carcasses during avian mortality investigations, BoTest Matrix E detected picomolar quantities of BoNT/E following a 2-h incubation and femtomolar quantities of BoNT/E following extended incubation (24 h) with 100% diagnostic specificity and 91% diagnostic sensitivity. PMID:21908624

  15. CRISPR/Cas9-Mediated Genomic Deletion of the Beta-1, 4 N-acetylgalactosaminyltransferase 1 Gene in Murine P19 Embryonal Carcinoma Cells Results in Low Sensitivity to Botulinum Neurotoxin Type C.

    Directory of Open Access Journals (Sweden)

    Kentaro Tsukamoto

    Full Text Available Botulinum neurotoxins produced by Clostridium botulinum cause flaccid paralysis by inhibiting neurotransmitter release at peripheral nerve terminals. Previously, we found that neurons derived from the murine P19 embryonal carcinoma cell line exhibited high sensitivity to botulinum neurotoxin type C. In order to prove the utility of P19 cells for the study of the intracellular mechanism of botulinum neurotoxins, ganglioside-knockout neurons were generated by deletion of the gene encoding beta-1,4 N-acetylgalactosaminyltransferase 1 in P19 cells using the clustered regularly interspaced short palindromic repeats combined with Cas9 (CRISPR/Cas9 system. By using this system, knockout cells could be generated more easily than with previous methods. The sensitivity of the generated beta-1,4 N-acetylgalactosaminyltransferase 1-depleted P19 neurons to botulinum neurotoxin type C was decreased considerably, and the exogenous addition of the gangliosides GD1a, GD1b, and GT1b restored the susceptibility of P19 cells to botulinum neurotoxin type C. In particular, addition of a mixture of these three ganglioside more effectively recovered the sensitivity of knockout cells compared to independent addition of GD1a, GD1b, or GT1b. Consequently, the genome-edited P19 cells generated by the CRISPR/Cas9 system were useful for identifying and defining the intracellular molecules involved in the toxic action of botulinum neurotoxins.

  16. Crystal Structure of the Receptor-Binding Domain of Botulinum Neurotoxin Type HA, Also Known as Type FA or H

    Directory of Open Access Journals (Sweden)

    Guorui Yao

    2017-03-01

    Full Text Available Botulinum neurotoxins (BoNTs, which have been exploited as cosmetics and muscle-disorder treatment medicines for decades, are well known for their extreme neurotoxicity to humans. They pose a potential bioterrorism threat because they cause botulism, a flaccid muscular paralysis-associated disease that requires immediate antitoxin treatment and intensive care over a long period of time. In addition to the existing seven established BoNT serotypes (BoNT/A–G, a new mosaic toxin type termed BoNT/HA (aka type FA or H was reported recently. Sequence analyses indicate that the receptor-binding domain (HC of BoNT/HA is ~84% identical to that of BoNT/A1. However, BoNT/HA responds differently to some potent BoNT/A-neutralizing antibodies (e.g., CR2 that target the HC. Therefore, it raises a serious concern as to whether BoNT/HA poses a new threat to our biosecurity. In this study, we report the first high-resolution crystal structure of BoNT/HA-HC at 1.8 Å. Sequence and structure analyses reveal that BoNT/HA and BoNT/A1 are different regarding their binding to cell-surface receptors including both polysialoganglioside (PSG and synaptic vesicle glycoprotein 2 (SV2. Furthermore, the new structure also provides explanations for the ~540-fold decreased affinity of antibody CR2 towards BoNT/HA compared to BoNT/A1. Taken together, these new findings advance our understanding of the structure and function of this newly identified toxin at the molecular level, and pave the way for the future development of more effective countermeasures.

  17. Crystal Structure of the Receptor-Binding Domain of Botulinum Neurotoxin Type HA, Also Known as Type FA or H

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Guorui; Lam, Kwok-ho; Perry, Kay; Weisemann, Jasmin; Rummel, Andreas; Jin, Rongsheng (Cornell); (Dusseldorf); (UCI)

    2017-03-01

    Botulinum neurotoxins (BoNTs), which have been exploited as cosmetics and muscle-disorder treatment medicines for decades, are well known for their extreme neurotoxicity to humans. They pose a potential bioterrorism threat because they cause botulism, a flaccid muscular paralysis-associated disease that requires immediate antitoxin treatment and intensive care over a long period of time. In addition to the existing seven established BoNT serotypes (BoNT/A–G), a new mosaic toxin type termed BoNT/HA (aka type FA or H) was reported recently. Sequence analyses indicate that the receptor-binding domain (HC) of BoNT/HA is ~84% identical to that of BoNT/A1. However, BoNT/HA responds differently to some potent BoNT/A-neutralizing antibodies (e.g., CR2) that target the HC. Therefore, it raises a serious concern as to whether BoNT/HA poses a new threat to our biosecurity. In this study, we report the first high-resolution crystal structure of BoNT/HA-HC at 1.8 Å. Sequence and structure analyses reveal that BoNT/HA and BoNT/A1 are different regarding their binding to cell-surface receptors including both polysialoganglioside (PSG) and synaptic vesicle glycoprotein 2 (SV2). Furthermore, the new structure also provides explanations for the ~540-fold decreased affinity of antibody CR2 towards BoNT/HA compared to BoNT/A1. Taken together, these new findings advance our understanding of the structure and function of this newly identified toxin at the molecular level, and pave the way for the future development of more effective countermeasures

  18. Engineered botulinum neurotoxin B with improved efficacy for targeting human receptors.

    Science.gov (United States)

    Tao, Liang; Peng, Lisheng; Berntsson, Ronnie P-A; Liu, Sai Man; Park, SunHyun; Yu, Feifan; Boone, Christopher; Palan, Shilpa; Beard, Matthew; Chabrier, Pierre-Etienne; Stenmark, Pål; Krupp, Johannes; Dong, Min

    2017-07-03

    Botulinum neurotoxin B is a Food and Drug Administration-approved therapeutic toxin. However, it has lower binding affinity toward the human version of its major receptor, synaptotagmin II (h-Syt II), compared to mouse Syt II, because of a residue difference. Increasing the binding affinity to h-Syt II may improve botulinum neurotoxin B's therapeutic efficacy and reduce adverse effects. Here we utilized the bacterial adenylate cyclase two-hybrid method and carried out a saturation mutagenesis screen in the Syt II-binding pocket of botulinum neurotoxin B. The screen identifies E1191 as a key residue: replacing it with M/C/V/Q enhances botulinum neurotoxin B binding to human synaptotagmin II. Adding S1199Y/W or W1178Q as a secondary mutation further increases binding affinity. Mutant botulinum neurotoxin B containing E1191M/S1199Y exhibits ~11-fold higher efficacy in blocking neurotransmission than wild-type botulinum neurotoxin B in neurons expressing human synaptotagmin II, demonstrating that enhancing receptor binding increases the overall efficacy at functional levels. The engineered botulinum neurotoxin B provides a platform to develop therapeutic toxins with improved efficacy.Humans are less sensitive to the therapeutic effects of botulinum neurotoxin B (BoNT/B) than the animal models it is tested on due to differences between the human and the mouse receptors. Here, the authors engineer BoNT/B to improve its affinity to human receptors and enhance its therapeutic efficacy.

  19. Gangliosides in human, cow and goat milk, and their abilities as to neutralization of cholera toxin and botulinum type A neurotoxin.

    Science.gov (United States)

    Iwamori, Masao; Takamizawa, Kotarou; Momoeda, Mikio; Iwamori, Yuriko; Taketani, Yuji

    2008-10-01

    To elucidate the potential of mammalian milk as to protection of infants from infections, we determined the ganglioside compositions of human, cow and goat milk in relation with cholera toxin and botulinum type A neurotoxin-receptors. Gangliosides accounted for 1 to 2 micromol of lipid-bound sialic acid (LSA) in 100 ml of milk, and GD3 comprised about 69% of LSA in all milk samples. Among the milk samples examined, goat milk was found to contain an amount of gangliosides belonging to the b-pathway representing 15.8% of the total LSA. Accordingly, botulinum neurotoxin bound to GT1b and GQ1b in goat milk, but not to any gangliosides in human or cow milk. On the other hand, GM1, the cholera toxin receptor, was found to be present in all milk samples at concentrations of 0.02% to 0.77% of the total LSA and to be maintained at a relatively constant level in human milk during the postpartum period. Gangliosides from 1 ml of pooled human milk exhibited the ability to attenuate the binding of cholera toxin (30 ng) to GM1 by 93%, and those from 500 microl of goat milk completely inhibited the binding of botulinum type A neurotoxin 1.5 microg to GT1b.

  20. [Action mechanisms of botulinum neurotoxins and tetanus neurotoxins].

    Science.gov (United States)

    Deloye, F; Doussau, F; Poulain, B

    1997-01-01

    Tetanus (TeNT) neurotoxin and botulinum (BoNT, serotypes A-G) neurotoxins are di-chain bacterial proteins of MW-150 kDa which are also termed as clostridial neurotoxins. They are the only causative agents of two severe neuroparalytic diseases, namely tetanus and botulism. The peripheral muscle spasms which characterise tetanus are due to a blockade of inhibitory (GABAergic and glycinergic) synapses in the central nervous system leading to a motor neurones desinhibition. In contrast, botulism symptoms are only peripheral. They are consequent to a near irreversible and highly selective inhibition of acetyl-choline release at the motor nerve endings innervating skeletal muscles. During the past decade, the cellular and molecular modes of action of clostridial neurotoxins has been near completely elucidated. After a binding step of the neurotoxins to specific membrane acceptors located only on nerve terminals, BoNTs and TeNT are internalized into neurons. Inside their target neurones, the intracellularly active moiety (their light chain) is translocated from the endosomal compartment to the cytosol. The neurotoxins' light chains are zinc-dependent (endopeptidases which are specific for one among three synaptic proteins (VAMP/synaptobrevin, syntaxin or SNAP-25) implicated in neurotransmitter exocytosis. The presence of distinct targets for BoNTs and TeNT correlates well with the observed quantal alterations of neurotransmitter release which characterize certain toxin serotypes. In addition, evidence for a second, non-proteolytic, inhibitory mechanism of action has been provided recently. Most likely, this additional blocking action involves the activation of neurone transglutaminases. Due to their specific action on key proteins of the exocytosis apparatus, clostridial neurotoxins are now widely used as molecular tools to study exocytosis.

  1. Tyrosine Phosphorylation of Botulinum Neurotoxin Protease Domains

    OpenAIRE

    Stephen eToth; Ernst E Brueggemann; Oyler, George A.; Smith, Leonard A.; Hines, Harry B.; S. Ashraf eAhmed

    2012-01-01

    Botulinum neurotoxins are most potent of all toxins. Their N-terminal light chain domain (Lc) translocates into peripheral cholinergic neurons to exert its endoproteolytic action leading to muscle paralysis. Therapeutic development against these toxins is a major challenge due to their in vitro and in vivo structural differences. Although three-dimensional structures and reaction mechanisms are very similar, the seven serotypes designated A through G vastly vary in their intracellular catalyt...

  2. Botulinum neurotoxin type A injections reduce spasticity in mild to moderate hereditary spastic paraplegia--report of 19 cases.

    Science.gov (United States)

    Hecht, Martin J; Stolze, Henning; Auf dem Brinke, Matthias; Giess, Ralf; Treig, Thoams; Winterholler, Martin; Wissel, Jörg

    2008-01-30

    Hereditary spastic paraplegia (HSP) is characterized by lower extremity spasticity. Symptomatic therapy generally includes physical therapy and oral antispastic agents, in selected cases intrathecal baclofen. Because of the positive results in other treatments of spasticity, the use of botulinum neurotoxin type A (BoNT-A) might also be considered for patients with HSP. We report the effect of BoNT-A injections in 19 unselected patients with HSP treated by the members of the German Spasticity Education Group. In 17 patients, the modified Ashworth scale had improved by one point. In one patient, it improved by three points. Most of the patients reported reduction of spasticity. BoNT-A injections were continued in 11 of 19 patients (57.9%). All of the patients with continued injections had a good or very good global subjective improvement. Patients with less pronounced spasticity and patients with accompanying physical therapy tended to exhibit a better effect. Only four patients reported adverse effects which were increased weakness in three patients and pain in one patient. BoNT-A injections appear to reduce spasticity effectively and safely, especially in patients with mild to moderate spasticity. The preliminary results of our case series should encourage larger studies of BoNT-A injections in HSP. 2007 Movement Disorder Society

  3. Botulinum Neurotoxins: Biology, Pharmacology, and Toxicology

    Science.gov (United States)

    Pirazzini, Marco; Rossetto, Ornella; Eleopra, Roberto

    2017-01-01

    The study of botulinum neurotoxins (BoNT) is rapidly progressing in many aspects. Novel BoNTs are being discovered owing to next generation sequencing, but their biologic and pharmacological properties remain largely unknown. The molecular structure of the large protein complexes that the toxin forms with accessory proteins, which are included in some BoNT type A1 and B1 pharmacological preparations, have been determined. By far the largest effort has been dedicated to the testing and validation of BoNTs as therapeutic agents in an ever increasing number of applications, including pain therapy. BoNT type A1 has been also exploited in a variety of cosmetic treatments, alone or in combination with other agents, and this specific market has reached the size of the one dedicated to the treatment of medical syndromes. The pharmacological properties and mode of action of BoNTs have shed light on general principles of neuronal transport and protein-protein interactions and are stimulating basic science studies. Moreover, the wide array of BoNTs discovered and to be discovered and the production of recombinant BoNTs endowed with specific properties suggest novel uses in therapeutics with increasing disease/symptom specifity. These recent developments are reviewed here to provide an updated picture of the biologic mechanism of action of BoNTs, of their increasing use in pharmacology and in cosmetics, and of their toxicology. PMID:28356439

  4. Therapeutic applications of botulinum neurotoxins in head and neck disorders

    Directory of Open Access Journals (Sweden)

    Ahmad Alshadwi

    2015-01-01

    Conclusion: Botulinum neurotoxin therapy provides viable alternatives to traditional treatment modalities for some conditions affecting the head and neck region that have neurological components. This therapy can overcome some of the morbidities associated with conventional therapy. More research is needed to determine the ideal doses of botulinum neurotoxin to treat different diseases affecting the head and neck regions.

  5. The binding of botulinum neurotoxins to different peripheral neurons.

    Science.gov (United States)

    Rossetto, O

    2017-10-16

    Botulinum neurotoxins are the most potent toxins known. The double receptor binding modality represents one of the most significant properties of botulinum neurotoxins and largely accounts for their incredible potency and lethality. Despite the high affinity and the very specific binding, botulinum neurotoxins are versatile and multi-tasking toxins. Indeed they are able to act both at the somatic and at the autonomic nervous system. In spite of the preference for cholinergic nerve terminals botulinum neurotoxins have been shown to inhibit to some extent also the noradrenergic postganglionic sympathetic nerve terminals and the afferent nerve terminals of the sensory neurons inhibiting the release of neuropeptides and glutamate, which are responsible of nociception. Therefore, there is increasing evidence that the therapeutic effect in both motor and autonomic disorders is based on a complex mode of botulinum neurotoxin action modulating the activity of efferent as well as afferent nerve fibres. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. A Label Free Colorimetric Assay for the Detection of Active Botulinum Neurotoxin Type A by SNAP-25 Conjugated Colloidal Gold

    Directory of Open Access Journals (Sweden)

    Christopher Gwenin

    2013-08-01

    Full Text Available Botulinum neurotoxins are one of the most potent toxins known to man. Current methods of detection involve the quantification of the toxin but do not take into account the percentage of the toxin that is active. At present the assay used for monitoring the activity of the toxin is the mouse bioassay, which is lengthy and has ethical issues due to the use of live animals. This report demonstrates a novel assay that utilises the endopeptidase activity of the toxin to detect Botulinum neurotoxin in a pharmaceutical sample. The cleaving of SNAP-25 is monitored via UV-Visible spectroscopy with a limit of detection of 373 fg/mL and has been further developed into a high throughput method using a microplate reader detecting down to 600 fg/mL of active toxin. The results show clear differences between the toxin product and the placebo, which contains the pharmaceutical excipients human serum albumin and lactose, showing that the assay detects the active form of the toxin.

  7. Light chain separated from the rest of the type a botulinum neurotoxin molecule is the most catalytically active form.

    Directory of Open Access Journals (Sweden)

    Nizamettin Gul

    Full Text Available Botulinum neurotoxins (BoNT are the most potent of all toxins. The 50 kDa N-terminal endopeptidase catalytic light chain (LC of BoNT is located next to its central, putative translocation domain. After binding to the peripheral neurons, the central domain of BoNT helps the LC translocate into cytosol where its proteolytic action on SNARE (soluble NSF attachment protein receptor proteins blocks exocytosis of acetyl choline leading to muscle paralysis and eventual death. The translocation domain also contains 105 Å -long stretch of ∼100 residues, known as "belt," that crosses over and wraps around the LC to shield the active site from solvent. It is not known if the LC gets dissociated from the rest of the molecule in the cytosol before catalysis. To investigate the structural identity of the protease, we prepared four variants of type A BoNT (BoNT/A LC, and compared their catalytic parameters with those of BoNT/A whole toxin. The four variants were LC + translocation domain, a trypsin-nicked LC + translocation domain, LC + belt, and a free LC. Our results showed that K(m for a 17-residue SNAP-25 (synaptosomal associated protein of 25 kDa peptide for these constructs was not very different, but the turnover number (k(cat for the free LC was 6-100-fold higher than those of its four variants. Moreover, none of the four variants of the LC was prone to autocatalysis. Our results clearly demonstrated that in vitro, the LC minus the rest of the molecule is the most catalytically active form. The results may have implication as to the identity of the active, toxic moiety of BoNT/A in vivo.

  8. [Molecular mechanism of action of tetanus toxin and botulinum neurotoxins].

    Science.gov (United States)

    Poulain, B

    1994-02-01

    Tetanus toxin and botulinum neurotoxins are di-chain proteins of 150 kD molecular weight. They are produced by bacteria of the Clostridium genus. These toxins act on the nervous system by inhibiting neurotransmitter release (glycine and GABA in the case of tetanus toxin; acetylcholine in the case of botulinum neurotoxins) thus inducing the spastic or flaccid paralysis that characterizes tetanus and botulism, respectively. Their cellular mechanism of action involves three main steps, namely binding to the neurone membrane, internalization and intracellular blockade of the release mechanism for neurotransmitters. Membrane acceptors for these toxins are not yet fully identified; they would consist of membrane gangliosides and proteins. The internalization step would be achieved by endocytosis. Recent findings show that both binding and internalization are mediated only by the heavy chain of the toxins whereas the intracellular blockade of neurotransmitter release involves their light chain alone. The light chain has been identified as a zinc metalloprotease and its substrates would be proteins involved in the neurotransmitter release mechanism. The target of tetanus toxin and of botulinum neurotoxin type B is VAMP/synaptobrevin, a membrane protein of the synaptic vesicles of nerve cell terminals.

  9. Modulation of inflammatory mediators in the trigeminal ganglion by botulinum neurotoxin type A

    DEFF Research Database (Denmark)

    Edvinsson, Jacob; Warfvinge, Karin; Edvinsson, Lars

    2015-01-01

    incubated for 24 hrs with either the mitogen MEK1/2 inhibitor U0126, BoNT-A or NaCl. After this the TGs were prepared for immunohistochemistry. Sections of the TG were then incubated with primary antibodies against CGRP (neuronal transmitter), iNOS (inflammatory marker), IL-1β (Interleukin 1β), SNAP-25...... (synaptic vesicle docking protein) or SV2-A (Botulinum toxin receptor element). RESULTS: We report that CGRP, iNOS, IL-1β, SNAP-25 and SV2-A were observed in fresh TG with a differential distribution. Interestingly, NaCl organ culture of the TG resulted in enhanced expression of CGRP and SNAP-25 in neurons...... and iNOS in SGCs. Co-incubation with U0126 or BoNT-A retained the increased expression of SNAP-25, while it decreased the IL-1β immunoreactivity in neurons. The iNOS expression in SGCs returned to levels observed in fresh specimens. Moreover, we observed no alteration SV2-A expression in SGCs. Thus...

  10. Protein Receptor(s) of Botulinum Neurotoxin

    Science.gov (United States)

    2005-01-01

    affinity gel and CelLytic B II Bacterial Cell Lysis extraction Reagent were obtained from Sigma (St. Louis, MO). Anti-His antibody was from Amersham...Pharmacia Bioth (Piscataway, NJ). Culture and chromosomal DNA isolation of Clostridium botulinum type B cells (strain Okra ) Clostridium botulinum type...B cells (strain Okra ) in a 1.5 ml microcentrifuge tube kept in -80’C was added to a 10 ml cooked meat medium (Difco Laboratories, Becton Dickinson, MD

  11. An innovative molecular detection tool for tracking and tracing Clostridium botulinum types A, B, E, F and other botulinum neurotoxin producing Clostridia based on the GeneDisc cycler.

    Science.gov (United States)

    Fach, P; Fenicia, L; Knutsson, R; Wielinga, P R; Anniballi, F; Delibato, E; Auricchio, B; Woudstra, C; Agren, J; Segerman, B; de Medici, D; van Rotterdam, B J

    2011-03-01

    Rapid and specific detection of botulinum neurotoxin (BoNT) producing Clostridia is a priority for public health authorities, in case of both natural and intentional botulism outbreaks. This study reports on the evaluation of a detection system based on the GeneDisc Cycler designed for simultaneously testing the bont/A, bont/B, bont/E and bont/F genes encoding for the botulinum neurotoxins types A, B, E and F. BoNT-producing Clostridia (n = 102) and non-BoNT-producing bacteria (n = 52) isolated from clinical, food and environmental samples were tested using this macro-array and results were compared to the reference lethality test on mice. The bont genes were correctly detected in all C. botulinum type A, B, E and F strains available, as well as in toxigenic C. baratii type F and toxigenic C. butyricum type E. No cross reactivity was observed with non human-toxigenic bacteria, C. botulinum types C, D and G. The identification of the bont genotype using the macro-array was correlated to toxino-typing of the BoNTs as determined by the mouse bioassay. An "evaluation trial" of the GeneDisc array performed blind in four European laboratories with 77 BoNT-producing Clostridia as well as 10 food and clinical samples showed that the developed macro-array is specific and reliable for identifying BoNT/A-, BoNT/B-, BoNT/E- and BoNT/F-producing clostridial strains and for screening naturally contaminated food and fecal samples. The test is robust, has a low detection limit (c.a. 5 to 50 genome copies in the PCR reaction microwell) and is promising for monitoring BoNT-producing Clostridia in different kinds of samples including food and clinical samples. Copyright © 2010 Elsevier B.V. All rights reserved.

  12. The botulinum neurotoxin LD50 test - problems and solutions

    National Research Council Canada - National Science Library

    Bitz, Silke

    2010-01-01

    ... on cosmetic testing in animals in the case of Botulinum Neurotoxin (BoNT) testing. The European Pharmacopoeia monograph allows for the use of three alternative methods provided they are validated...

  13. The Anatomical Basis of Paradoxical Masseteric Bulging after Botulinum Neurotoxin Type A Injection

    Directory of Open Access Journals (Sweden)

    Hyung-Jin Lee

    2016-12-01

    Full Text Available The aim of this study was to determine the detailed anatomical structures of the superficial part of the masseter and to elucidate the boundaries and locations of the deep tendon structure within the superficial part of the masseter. Forty-four hemifaces from Korean and Thai embalmed cadavers were used in this study. The deep tendon structure was located deep in the lower third of the superficial part of the masseter. It was observed in all specimens and was designated as a deep inferior tendon (DIT. The relationship between the masseter and DIT could be classified into three types according to the coverage pattern: Type A, in which areas IV and V were covered by the DIT (27%, 12/44; Type B, in which areas V and VI were covered by the DIT (23%, 10/44; and Type C, in which areas IV, V, and VI were covered by the DIT (50%, 22/44. The superficial part of the masseter consists of not only the muscle belly but also the deep tendon structure. Based on the results obtained in this morphological study, we recommend performing layer-by-layer retrograde injections into the superficial and deep muscle bellies of the masseter.

  14. Ultrasound Guidance for Botulinum Neurotoxin Chemodenervation Procedures.

    Science.gov (United States)

    Alter, Katharine E; Karp, Barbara I

    2017-12-28

    Injections of botulinum neurotoxins (BoNTs) are prescribed by clinicians for a variety of disorders that cause over-activity of muscles; glands; pain and other structures. Accurately targeting the structure for injection is one of the principle goals when performing BoNTs procedures. Traditionally; injections have been guided by anatomic landmarks; palpation; range of motion; electromyography or electrical stimulation. Ultrasound (US) based imaging based guidance overcomes some of the limitations of traditional techniques. US and/or US combined with traditional guidance techniques is utilized and or recommended by many expert clinicians; authors and in practice guidelines by professional academies. This article reviews the advantages and disadvantages of available guidance techniques including US as well as technical aspects of US guidance and a focused literature review related to US guidance for chemodenervation procedures including BoNTs injection.

  15. Ultrasound Guidance for Botulinum Neurotoxin Chemodenervation Procedures

    Directory of Open Access Journals (Sweden)

    Katharine E. Alter

    2017-12-01

    Full Text Available Injections of botulinum neurotoxins (BoNTs are prescribed by clinicians for a variety of disorders that cause over-activity of muscles; glands; pain and other structures. Accurately targeting the structure for injection is one of the principle goals when performing BoNTs procedures. Traditionally; injections have been guided by anatomic landmarks; palpation; range of motion; electromyography or electrical stimulation. Ultrasound (US based imaging based guidance overcomes some of the limitations of traditional techniques. US and/or US combined with traditional guidance techniques is utilized and or recommended by many expert clinicians; authors and in practice guidelines by professional academies. This article reviews the advantages and disadvantages of available guidance techniques including US as well as technical aspects of US guidance and a focused literature review related to US guidance for chemodenervation procedures including BoNTs injection.

  16. Use of Botulinum Neurotoxin in Ophthalmology

    Directory of Open Access Journals (Sweden)

    Emel Başar

    2016-12-01

    Full Text Available Botulinum neurotoxin (BoNT is the first biological toxin used in the treatment of ophthalmic diseases and to decrease skin wrinkles as an aesthetic agent. When used appropriately, it weakens the force of muscular contraction and/or inhibits glandular secretion. The most common areas for botulinum toxin treatment are the upper face, including the glabella, forehead, brows, and lateral canthal lines or crow’s feet. By relaxing the muscles causing wrinkles, non-permanent results may be achieved with its use. BoNT has gained widespread use in a variety of ophthalmic diseases. The effect of BoNT is temporary, but the therapeutic benefit is usually maintained even after repeated injections. Treatment is usually well tolerated. Complications and side effects associated with the treatment are rare and temporary. Complications occur due to weakness (chemodenervation of adjacent muscle groups, immunological mechanisms and injection technique. Current therapeutic indications, doses, complications and contraindications of BoNT use in the following disorders related to ophthalmology were investigated: aesthetic use, strabismus, blepharospasm, hemifacial spasm, eyelid retraction, entropion, lacrimal hypersecretion syndrome, and facial paralysis.

  17. Use of Botulinum Neurotoxin in Ophthalmology

    Science.gov (United States)

    Başar, Emel; Arıcı, Ceyhun

    2016-01-01

    Botulinum neurotoxin (BoNT) is the first biological toxin used in the treatment of ophthalmic diseases and to decrease skin wrinkles as an aesthetic agent. When used appropriately, it weakens the force of muscular contraction and/or inhibits glandular secretion. The most common areas for botulinum toxin treatment are the upper face, including the glabella, forehead, brows, and lateral canthal lines, or crow’s feet. By relaxing the muscles causing wrinkles, non-permanent results may be achieved with its use. BoNT has gained widespread use in a variety of ophthalmic diseases. The effect of BoNT is temporary, but the therapeutic benefit is usually maintained even after repeated injections. Treatment is usually well tolerated. Complications and side effects associated with the treatment are rare and temporary. Complications occur due to weakness (chemodenervation) of adjacent muscle groups, immunological mechanisms and injection technique. Current therapeutic indications, doses, complications and contraindications of BoNT use in the following disorders related to ophthalmology were investigated: aesthetic use, strabismus, blepharospasm, hemifacial spasm, eyelid retraction, entropion, lacrimal hypersecretion syndrome, and facial paralysis. PMID:28050326

  18. Functional influence of botulinum neurotoxin type A treatment (Xeomin® of multifocal upper and lower limb spasticity on chronic hemiparetic gait

    Directory of Open Access Journals (Sweden)

    Maurizio Falso

    2012-05-01

    Full Text Available This report describes the modification of hemiplegic shoulder pain and walking velocity through injections of Xeomin®, a new botulinum neurotoxin type A formulation, in a 67-year-old woman with chronic residual left hemiparesis and hemiparetic gait attributable to stroke. Clinical evaluation included upper and lower limb spasticity, upper and lower limb pain, trunk control, upper and lower limb motricity index, visual gait analysis, and gait velocity. Assessments were performed before, 1 week after, and 1 month after treatment. Improvement was observed in all clinical parameters assessed. Amelioration of spasticity of the upper and lower limbs and shoulder pain was observed after 1 month. Trunk postural attitude and paraxial muscle recruitment recovered. No adverse events were observed and the patient shows significant improvement of functional impairment derived from chronic spasticity after treatment with Xeomin®. We also provide a simple and useful protocol for clinical evaluation of the treatment.

  19. A new peptide substrate for enhanced botulinum neurotoxin type B detection by endopeptidase-liquid chromatography-tandem mass spectrometry/multiple reaction monitoring assay.

    Science.gov (United States)

    Rosen, Osnat; Feldberg, Liron; Gura, Sigalit; Zichel, Ran

    2015-03-15

    Botulinum neurotoxins (BoNTs) are the most toxic proteins in nature. Rapid and sensitive detection of BoNTs is achieved by the endopeptidase-mass spectrometry (Endopep-MS) assay. In this assay, BoNT cleaves a specific peptide substrate and the cleaved products are analyzed by MS. Here we describe the design of a new peptide substrate for improved detection of BoNT type B (BoNT/B) in the Endopep-MS assay. Our strategy was based on reported BoNT/B-substrate interactions integrated with analysis method efficiency considerations. Incorporation of the new peptide led to a 5-fold increased sensitivity of the assay both in buffer and in a clinically relevant human spiked serum. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Tetanus and botulinum neurotoxins: mechanism of action and therapeutic uses.

    Science.gov (United States)

    Pellizzari, R; Rossetto, O; Schiavo, G; Montecucco, C

    1999-02-28

    The clostridial neurotoxins responsible for tetanus and botulism are proteins consisting of three domains endowed with different functions: neurospecific binding, membrane translocation and proteolysis for specific components of the neuroexocytosis apparatus. Tetanus neurotoxin (TeNT) binds to the presynaptic membrane of the neuromuscular junction, is internalized and transported retroaxonally to the spinal cord. The spastic paralysis induced by the toxin is due to the blockade of neurotransmitter release from spinal inhibitory interneurons. In contrast, the seven serotypes of botulinum neurotoxins (BoNTs) act at the periphery by inducing a flaccid paralysis due to the inhibition of acetylcholine release at the neuromuscular junction. TeNT and BoNT serotypes B, D, F and G cleave specifically at single but different peptide bonds, of the vesicle associated membrane protein (VAMP) synaptobrevin, a membrane protein of small synaptic vesicles (SSVs). BoNT types A, C and E cleave SNAP-25 at different sites located within the carboxyl-terminus, while BoNT type C additionally cleaves syntaxin. The remarkable specificity of BoNTs is exploited in the treatment of human diseases characterized by a hyperfunction of cholinergic terminals.

  1. The C Terminus of the Catalytic Domain of Type A Botulinum Neurotoxin May Facilitate Product Release from the Active Site*

    Science.gov (United States)

    Mizanur, Rahman M.; Frasca, Verna; Swaminathan, Subramanyam; Bavari, Sina; Webb, Robert; Smith, Leonard A.; Ahmed, S. Ashraf

    2013-01-01

    Botulinum neurotoxins are the most toxic of all compounds. The toxicity is related to a poor zinc endopeptidase activity located in a 50-kDa domain known as light chain (Lc) of the toxin. The C-terminal tail of Lc is not visible in any of the currently available x-ray structures, and it has no known function but undergoes autocatalytic truncations during purification and storage. By synthesizing C-terminal peptides of various lengths, in this study, we have shown that these peptides competitively inhibit the normal catalytic activity of Lc of serotype A (LcA) and have defined the length of the mature LcA to consist of the first 444 residues. Two catalytically inactive mutants also inhibited LcA activity. Our results suggested that the C terminus of LcA might interact at or near its own active site. By using synthetic C-terminal peptides from LcB, LcC1, LcD, LcE, and LcF and their respective substrate peptides, we have shown that the inhibition of activity is specific only for LcA. Although a potent inhibitor with a Ki of 4.5 μm, the largest of our LcA C-terminal peptides stimulated LcA activity when added at near-stoichiometric concentration to three versions of LcA differing in their C-terminal lengths. The result suggested a product removal role of the LcA C terminus. This suggestion is supported by a weak but specific interaction determined by isothermal titration calorimetry between an LcA C-terminal peptide and N-terminal product from a peptide substrate of LcA. Our results also underscore the importance of using a mature LcA as an inhibitor screening target. PMID:23779108

  2. Botulinum neurotoxin: a marvel of protein design.

    Science.gov (United States)

    Montal, Mauricio

    2010-01-01

    Botulinum neurotoxin (BoNT), the causative agent of botulism, is acknowledged to be the most poisonous protein known. BoNT proteases disable synaptic vesicle exocytosis by cleaving their cytosolic SNARE (soluble NSF attachment protein receptor) substrates. BoNT is a modular nanomachine: an N-terminal Zn(2+)-metalloprotease, which cleaves the SNAREs; a central helical protein-conducting channel, which chaperones the protease across endosomes; and a C-terminal receptor-binding module, consisting of two subdomains that determine target specificity by binding to a ganglioside and a protein receptor on the cell surface and triggering endocytosis. For BoNT, functional complexity emerges from its modular design and the tight interplay between its component modules--a partnership with consequences that surpass the simple sum of the individual component's action. BoNTs exploit this design at each step of the intoxication process, thereby achieving an exquisite toxicity. This review summarizes current knowledge on the structure of individual modules and presents mechanistic insights into how this protein machine evolved to this level of sophistication. Understanding the design principles underpinning the function of such a dynamic modular protein remains a challenging task.

  3. Clinical utility of different botulinum neurotoxin preparations.

    Science.gov (United States)

    Abrams, Steven B; Hallett, Mark

    2013-06-01

    Comparative literature assessing the relative safety and efficacy of different BoNT products is limited. The quantity and quality of data vary by preparation and indication. Clinicians seeking data relevant to the care of patients with specific conditions may find only reports about small numbers of patients with varying symptoms. While a literature search for "botulinum neurotoxins" will yield a large number of publications; only a fraction of these meet criteria for an academic evidence-based review. Patients may have been treated with a different BoNT formulation than that with which the physician is familiar, or there may be little or no clinical data on the use of a specific BoNT product for the proposed intervention. This paper is an introduction to a series of papers (which follow) in which an expert panel reviewed the BoNT clinical trial literature in order to provide evidence-based recommendations regarding the clinical use and efficacy of available BoNT preparations for four major therapeutic areas: movement disorders, spasticity, urology, and secretory disorders. Expert opinion is also included to address practical issues where more evidence and further research is needed. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Botulinum neurotoxin serotype D is poorly effective in humans: an in vivo electrophysiological study.

    Science.gov (United States)

    Eleopra, Roberto; Montecucco, Cesare; Devigili, Grazia; Lettieri, Christian; Rinaldo, Sara; Verriello, Lorenzo; Pirazzini, Marco; Caccin, Paola; Rossetto, Ornella

    2013-05-01

    Botulinum neurotoxins act on nerve endings and block neurotransmitter release. Their potency is due to their enzymatic activity and high affinity binding to neurons. Botulinum toxin type A is used in the treatment of human diseases characterized by hyperactivity of peripheral cholinergic nerve terminals, but some patients are or become resistant to it. This can be overcome by using other botulinum toxins, and studies have been performed with different toxin serotypes. Botulinum neurotoxin type D has never been tested in humans in vivo, and, therefore, we investigated the action of this toxin in mouse and human muscles. Botulinum toxin type D potency was determined on mouse hemidiaphragm and on rat neuronal cultures. From these experiments, doses to be injected in human volunteers were decided. The compound muscle action potential of toxin-injected Extensor Digitorum Brevis muscle was measured at different times points after injection in human volunteers. Botulinum toxin type D is poorly effective in inducing human skeletal muscle paralysis. Botulinum toxin type D is very potent in mice and almost ineffective in humans in vivo. The results shed new light on the mechanism of toxin type D binding to the neuronal surface receptors. Copyright © 2012 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  5. Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay.

    Science.gov (United States)

    Williamson, Charles H D; Vazquez, Adam J; Hill, Karen; Smith, Theresa J; Nottingham, Roxanne; Stone, Nathan E; Sobek, Colin J; Cocking, Jill H; Fernández, Rafael A; Caballero, Patricia A; Leiser, Owen P; Keim, Paul; Sahl, Jason W

    2017-09-15

    Diverse members of the genus Clostridium produce botulinum neurotoxins (BoNTs), which cause a flaccid paralysis known as botulism. While multiple species of clostridia produce BoNTs, the majority of human botulism cases have been attributed to Clostridium botulinum groups I and II. Recent comparative genomic studies have demonstrated the genomic diversity within these BoNT-producing species. This report introduces a multiplex PCR assay for differentiating members of C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Coding region sequences unique to each of the four species/subgroups were identified by in silico analyses of thousands of genome assemblies, and PCR primers were designed to amplify each marker. The resulting multiplex PCR assay correctly assigned 41 tested isolates to the appropriate species or subgroup. A separate PCR assay to determine the presence of the ntnh gene (a gene associated with the botulinum neurotoxin gene cluster) was developed and validated. The ntnh gene PCR assay provides information about the presence or absence of the botulinum neurotoxin gene cluster and the type of gene cluster present ( ha positive [ ha + ] or orfX + ). The increased availability of whole-genome sequence data and comparative genomic tools enabled the design of these assays, which provide valuable information for characterizing BoNT-producing clostridia. The PCR assays are rapid, inexpensive tests that can be applied to a variety of sample types to assign isolates to species/subgroups and to detect clostridia with botulinum neurotoxin gene ( bont ) clusters. IMPORTANCE Diverse clostridia produce the botulinum neurotoxin, one of the most potent known neurotoxins. In this study, a multiplex PCR assay was developed to differentiate clostridia that are most commonly isolated in connection with human botulism cases: C. botulinum group I, C. sporogenes , and two major subgroups within C. botulinum group II. Since Bo

  6. Tyrosine Phosphorylation of Botulinum Neurotoxin Protease Domains

    Directory of Open Access Journals (Sweden)

    Stephen eToth

    2012-06-01

    Full Text Available Botulinum neurotoxins are most potent of all toxins. Their N-terminal light chain domain (Lc translocates into peripheral cholinergic neurons to exert its endoproteolytic action leading to muscle paralysis. Therapeutic development against these toxins is a major challenge due to their in vitro and in vivo structural differences. Although three-dimensional structures and reaction mechanisms are very similar, the seven serotypes designated A through G vastly vary in their intracellular catalytic stability. To investigate if protein phosphorylation could account for this difference, we employed Src-catalyzed tyrosine phosphorylation of the Lc of six serotypes namely LcA, LcB, LcC1, LcD, LcE, and LcG. Very little phosphorylation was observed with LcD and LcE but LcA, LcB and LcG were maximally phosphorylated by Src. Phosphorylation of LcA, LcB, and LcG did not affect their secondary and tertiary structures and thermostability significantly. Phosphorylation of Y250 and Y251 made LcA resistant to autocatalysis and drastically reduced its kcat/Km for catalysis. A tyrosine residue present near the essential cysteine at the C-terminal tail of LcA, LcB and LcG was readily phosphorylated in vitro. Inclusion of a competitive inhibitor protected this Y426 of LcA from phosphorylation, shedding light on the role of the C-terminus in the enzyme’s substrate or product binding.

  7. Botulinum and tetanus neurotoxins: structure, function and therapeutic utility.

    Science.gov (United States)

    Turton, Kathryn; Chaddock, John A; Acharya, K Ravi

    2002-11-01

    The toxic products of the anaerobic bacteria Clostridium botulinum, Clostridium butyricum, Clostridium barati and Clostridium tetani are the causative agents of botulism and tetanus. The ability of botulinum neurotoxins to disrupt neurotransmission, often for prolonged periods, has been exploited for use in several medical applications and the toxins, as licensed pharmaceutical products, now represent the therapeutics of choice for the treatment for several neuromuscular conditions. Research into the structures and activities of botulinum and tetanus toxins has revealed features of these proteins that might be useful in the design of improved vaccines, effective inhibitors and novel biopharmaceuticals. Here, we discuss the relationships between structure, mechanism of action and therapeutic use.

  8. Application of Purified Botulinum Type A Neurotoxin to Treat Experimental Trigeminal Neuropathy in Rats and Patients with Urinary Incontinence and Prostatic Hyperplasia

    Directory of Open Access Journals (Sweden)

    Yoshizo Matsuka

    2012-01-01

    Full Text Available Type A neurotoxin (NTX of Clostridium botulinum was purified by a simple procedure using a lactose gel column. The toxicity of this purified toxin preparation was retained for at least 1 year at −30°C by supplementation with either 0.1% albumin or 0.05% albumin plus 1% trehalose. When purified NTX was used to treat 49 patients with urinary incontinence caused by either refractory idiopathic or neurogenic detrusor overactivity, 36 patients showed significant improvement in symptoms. These beneficial effects were also observed in cases of prostatic hyperplasia. The results obtained with NTX were similar to that of Botox. The effects of NTX on trigeminal neuralgia induced by infraorbital nerve constriction (IoNC in rats were also studied. Trigeminal ganglion neurons from ipsilateral to IoNC exhibited significantly faster onset of FM4-64 release than sham-operated contralateral neurons. Intradermal injection of NTX in the area of IoNC alleviated IoNC-induced pain behavior and reduced the exaggerated FM4-64 release in trigeminal ganglion neurons.

  9. Light Chain Separated from the Rest of the Type A Botulinum Neurotoxin Molecule is the Most Catalytically Active Form

    Science.gov (United States)

    2010-09-01

    of expressed LC in inhibiting exocytosis in sea urchin eggs [12]. There is however, no experimental evidence available in the literature if the LC...using A0.1% (1 cm light path) value of 1.0 at 278 nm [8] or by BCA assay (Pierce) with bovine serum albumin as standard. Circular dichroism spectra of...neurotoxin: substrate requirements and activation by serum albumin . J Protein Chem 16: 19–26. 38. Chen S, Barbieri JT (2006) Unique substrate recognition by

  10. Mechanism of action of tetanus and botulinum neurotoxins.

    Science.gov (United States)

    Montecucco, C; Schiavo, G

    1994-07-01

    The clostridial neurotoxins responsible for tetanus and botulism are metallo-proteases that enter nerve cells and block neurotransmitter release via zinc-dependent cleavage of protein components of the neuroexocytosis apparatus. Tetanus neurotoxin (TeNT) binds to the presynaptic membrane of the neuromuscular junction and is internalized and transported retroaxonally to the spinal cord. Whilst TeNT causes spastic paralysis by acting on the spinal inhibitory interneurons, the seven serotypes of botulinum neurotoxins (BoNT) induce a flaccid paralysis because they intoxicate the neuromuscular junction. TeNT and BoNT serotypes B, D, F and G specifically cleave VAMP/synaptobrevin, a membrane protein of small synaptic vesicles, at different single peptide bonds. Proteins of the presynaptic membrane are specifically attacked by the other BoNTs: serotypes A and E cleave SNAP-25 at two different sites located within the carboxyl terminus, whereas the specific target of serotype C is syntaxin.

  11. Botulinum neurotoxin type A in the treatment of classical Trigeminal Neuralgia (BoTN): study protocol for a randomized controlled trial

    National Research Council Canada - National Science Library

    Burmeister, Jan; Holle, Dagny; Bock, Eva; Ose, Claudia; Diener, Hans-Christoph; Obermann, Mark

    2015-01-01

    .... This is the study protocol of a prospective, placebo-controlled, double blind clinical trial investigating the add-on therapy of subcutaneous administration of botulinum toxin type A injections...

  12. Small Molecules Showing Significant Protection of Mice against Botulinum Neurotoxin Serotype A

    Science.gov (United States)

    2010-04-13

    thereby causing prolonged flaccid paralysis , serious medical sequelae, or death [1]. Despite its toxicity, the purified and diluted BoNT serotype A...BoNTA) can be harnessed to treat cholinergic nerve and muscle dysfunctions, as well as for cosmetic treatment of facial wrinkles [2,3]. Even in...botulinum neurotoxin B, C1, E, and F compared with the long lasting type A. Basis for distinct durations of inhibition of exocytosis in central neurons. J

  13. Challenges in searching for therapeutics against Botulinum Neurotoxins.

    Science.gov (United States)

    Pirazzini, Marco; Rossetto, Ornella

    2017-05-01

    Botulinum neurotoxins (BoNTs) are the most potent toxins known. BoNTs are responsible for botulism, a deadly neuroparalytic syndrome caused by the inactivation of neurotransmitter release at peripheral nerve terminals. Thanks to their specificity and potency, BoNTs are both considered potential bio-weapons and therapeutics of choice for a variety of medical syndromes. Several variants of BoNTs have been identified with individual biological properties and little antigenic relation. This expands greatly the potential of BoNTs as therapeutics but poses a major safety problem, increasing the need for finding appropriate antidotes. Areas covered: The authors describe the multi-step molecular mechanism through which BoNTs enter nerve terminals and discuss the many levels at which the toxins can be inhibited. They review the outcomes of the different strategies adopted to limit neurotoxicity and counter intoxication. Potential new targets arising from the last discoveries of the mechanism of action and the approaches to promote neuromuscular junction recovery are also discussed. Expert opinion: Current drug discovery efforts have mainly focused on BoNT type A and addressed primarily light chain proteolytic activity. Development of pan-BoNT inhibitors acting independently of BoNT immunological properties and targeting a common step of the intoxication process should be encouraged.

  14. Physical Characterization of Clostridium Botulinum Neurotoxin Genes

    Science.gov (United States)

    1993-10-01

    modern food -preserving processes in Western countries has made 1 outbreaks of botulism extremely rare. The frequent use of C.botulinum as a test...organism in the food industry, and the growing use of the toxin by neurobiochemists, has, however, led to the development of human vaccines. The...390v 400v DOTE [• - F -TK--VQ -- 0Q ---YI G Q KM YLFKL NS N - S - N I G NF N K 383 DOTFIFT ED L AINIK FIKIV C RINIT YIF I K MCF LVPIN L L D DDIDII YIT

  15. An Investigation of Immunogenicity of Chitosan-Based Botulinum Neurotoxin E Binding Domain Recombinant Candidate Vaccine via Mucosal Route

    Directory of Open Access Journals (Sweden)

    Mohammad Javad Bagheripour

    2017-01-01

    Full Text Available Background and Objectives: Botulism syndrome is caused by serotypes A-G of neurotoxins of Clostridium genus. Neurotoxin binding domain is an appropriate vaccine candidate due to its immunogenic activity. In this study, the immunogenicity of chitosan-based botulinum neurotoxin E binding domain recombinant candidate vaccine was investigated via mucosal route of administration. Methods: In this experimental study, chitosan nanoparticles containing rBoNT/E protein were synthesized by ionic gelation method and were administered orally and intranasally to mice. After each administration, IgG antibody titer was measured by ELISA method. Finally, all groups were challenged with active botulinum neurotoxin type E. Data were analyzed using Duncan and repeated ANOVA tests. The significance level was considered as p0.05, even intranasal route reduced the immunogenicity.

  16. Multiplex PCR for Detection of Botulinum Neurotoxin-Producing Clostridia in Clinical, Food, and Environmental Samples▿

    Science.gov (United States)

    De Medici, Dario; Anniballi, Fabrizio; Wyatt, Gary M.; Lindström, Miia; Messelhäußer, Ute; Aldus, Clare F.; Delibato, Elisabetta; Korkeala, Hannu; Peck, Michael W.; Fenicia, Lucia

    2009-01-01

    Botulinum neurotoxin (BoNT), the most toxic substance known, is produced by the spore-forming bacterium Clostridium botulinum and, in rare cases, also by some strains of Clostridium butyricum and Clostridium baratii. The standard procedure for definitive detection of BoNT-producing clostridia is a culture method combined with neurotoxin detection using a standard mouse bioassay (SMB). The SMB is highly sensitive and specific, but it is expensive and time-consuming and there are ethical concerns due to use of laboratory animals. PCR provides a rapid alternative for initial screening for BoNT-producing clostridia. In this study, a previously described multiplex PCR assay was modified to detect all type A, B, E, and F neurotoxin genes in isolated strains and in clinical, food, environmental samples. This assay includes an internal amplification control. The effectiveness of the multiplex PCR method for detecting clostridia possessing type A, B, E, and F neurotoxin genes was evaluated by direct comparison with the SMB. This method showed 100% inclusivity and 100% exclusivity when 182 BoNT-producing clostridia and 21 other bacterial strains were used. The relative accuracy of the multiplex PCR and SMB was evaluated using 532 clinical, food, and environmental samples and was estimated to be 99.2%. The multiplex PCR was also used to investigate 110 freshly collected food and environmental samples, and 4 of the 110 samples (3.6%) were positive for BoNT-encoding genes. PMID:19684163

  17. Multiplex PCR for detection of botulinum neurotoxin-producing clostridia in clinical, food, and environmental samples.

    Science.gov (United States)

    De Medici, Dario; Anniballi, Fabrizio; Wyatt, Gary M; Lindström, Miia; Messelhäusser, Ute; Aldus, Clare F; Delibato, Elisabetta; Korkeala, Hannu; Peck, Michael W; Fenicia, Lucia

    2009-10-01

    Botulinum neurotoxin (BoNT), the most toxic substance known, is produced by the spore-forming bacterium Clostridium botulinum and, in rare cases, also by some strains of Clostridium butyricum and Clostridium baratii. The standard procedure for definitive detection of BoNT-producing clostridia is a culture method combined with neurotoxin detection using a standard mouse bioassay (SMB). The SMB is highly sensitive and specific, but it is expensive and time-consuming and there are ethical concerns due to use of laboratory animals. PCR provides a rapid alternative for initial screening for BoNT-producing clostridia. In this study, a previously described multiplex PCR assay was modified to detect all type A, B, E, and F neurotoxin genes in isolated strains and in clinical, food, environmental samples. This assay includes an internal amplification control. The effectiveness of the multiplex PCR method for detecting clostridia possessing type A, B, E, and F neurotoxin genes was evaluated by direct comparison with the SMB. This method showed 100% inclusivity and 100% exclusivity when 182 BoNT-producing clostridia and 21 other bacterial strains were used. The relative accuracy of the multiplex PCR and SMB was evaluated using 532 clinical, food, and environmental samples and was estimated to be 99.2%. The multiplex PCR was also used to investigate 110 freshly collected food and environmental samples, and 4 of the 110 samples (3.6%) were positive for BoNT-encoding genes.

  18. The Regions on the Light Chain of Botulinum Neurotoxin Type A Recognized by T Cells from Toxin-Treated Cervical Dystonia Patients. The Complete Human T-Cell Recognition Map of the Toxin Molecule.

    Science.gov (United States)

    Oshima, Minako; Deitiker, Philip; Jankovic, Joseph; Atassi, M Zouhair

    2018-01-01

    We have recently mapped the in vitro proliferative responses of T cells from botulinum neurotoxin type A (BoNT/A)-treated cervical dystonia (CD) patients with overlapping peptides encompassing BoNT/A heavy chain (residues 449-1296). In the present study, we determined the recognition profiles, by peripheral blood lymphocytes (PBL) from the same set of patients, of BoNT/A light (L) chain (residues 1-453) by using 32 synthetic overlapping peptides that encompassed the entire L chain. Profiles of the T-cell responses (expressed in stimulation index, SI; Z score based on transformed SI) to the peptides varied among the patients. Samples from 14 patients treated solely with BoNT/A recognized 3-13 (average 7.2) peptides/sample at Z > 3.0 level. Two peptide regions representing residues 113-131 and 225-243 were recognized by around 40% of these patients. Regarding treatment parameters, treatment history with current BOTOX ® only group produced significantly lower average T-cell responses to the 32 L-chain peptides compared to treatments with mix of type A including original and current BOTOX ® . Influence of other treatment parameters on T-cell recognition of the L-chain peptides was also observed. Results of the submolecular T-cell recognition of the L chain are compared to those of the H chain and the T-cell recognition profile of the entire BoNT/A molecule is discussed. Abbreviations used: BoNT/A, botulinum neurotoxin type A; BoNT/A i , inactivated BoNT/A; BoNT/B, botulinum neurotoxin type B; CD, cervical dystonia; L chain, the light chain (residues 1-448) of BoNT/A; LNC, lymph node cells; H chain, the heavy chain (residues 449-1296) of BoNT/A; H C , C-terminal domain (residues 855-1296) of H chain; H N , N-terminal domain (residues 449-859) of H chain; MPA, mouse protection assay; SI, stimulation index (SI = cpm of 3 H-thymidine incorporated by antigen-stimulated T cells/cpm incorporated by unstimulated cells); TeNT, tetanus neurotoxin; TeNT i , inactivated TeNT.

  19. Genetic Diversity Among Botulinum Neurotoxin Producing Clostridial Strains

    Energy Technology Data Exchange (ETDEWEB)

    Hill, K K; Smith, T J; Helma, C H; Ticknor, L O; Foley, B T; Svennson, R T; Brown, J L; Johnson, E A; Smith, L A; Okinaka, R T; Jackson, P J; Marks, J D

    2006-07-06

    Clostridium botulinum is a taxonomic designation for many diverse anaerobic spore forming rod-shaped bacteria which have the common property of producing botulinum neurotoxins (BoNTs). The BoNTs are exoneurotoxins that can cause severe paralysis and even death in humans and various other animal species. A collection of 174 C. botulinum strains were examined by amplified fragment length polymorphism (AFLP) analysis and by sequencing of the 16S rRNA gene and BoNT genes to examine genetic diversity within this species. This collection contained representatives of each of the seven different serotypes of botulinum neurotoxins (BoNT A-G). Analysis of the16S rRNA sequences confirmed earlier reports of at least four distinct genomic backgrounds (Groups I-IV) each of which has independently acquired one or more BoNT serotypes through horizontal gene transfer. AFLP analysis provided higher resolution, and can be used to further subdivide the four groups into sub-groups. Sequencing of the BoNT genes from serotypes A, B and E in multiple strains confirmed significant sequence variation within each serotype. Four distinct lineages within each of the BoNT A and B serotypes, and five distinct lineages of serotype E strains were identified. The nucleotide sequences of the seven serotypes of BoNT were compared and show varying degrees of interrelatedness and recombination as has been previously noted for the NTNH gene which is linked to BoNT. These analyses contribute to the understanding of the evolution and phylogeny within this species and assist in the development of improved diagnostics and therapeutics for treatment of botulism.

  20. Substrate binding mode and its implication on drug design for botulinum neurotoxin A.

    Directory of Open Access Journals (Sweden)

    Desigan Kumaran

    2008-09-01

    Full Text Available The seven antigenically distinct serotypes of Clostridium botulinum neurotoxins, the causative agents of botulism, block the neurotransmitter release by specifically cleaving one of the three SNARE proteins and induce flaccid paralysis. The Centers for Disease Control and Prevention (CDC has declared them as Category A biowarfare agents. The most potent among them, botulinum neurotoxin type A (BoNT/A, cleaves its substrate synaptosome-associated protein of 25 kDa (SNAP-25. An efficient drug for botulism can be developed only with the knowledge of interactions between the substrate and enzyme at the active site. Here, we report the crystal structures of the catalytic domain of BoNT/A with its uncleavable SNAP-25 peptide (197QRATKM(202 and its variant (197RRATKM(202 to 1.5 A and 1.6 A, respectively. This is the first time the structure of an uncleavable substrate bound to an active botulinum neurotoxin is reported and it has helped in unequivocally defining S1 to S5' sites. These substrate peptides make interactions with the enzyme predominantly by the residues from 160, 200, 250 and 370 loops. Most notably, the amino nitrogen and carbonyl oxygen of P1 residue (Gln197 chelate the zinc ion and replace the nucleophilic water. The P1'-Arg198, occupies the S1' site formed by Arg363, Thr220, Asp370, Thr215, Ile161, Phe163 and Phe194. The S2' subsite is formed by Arg363, Asn368 and Asp370, while S3' subsite is formed by Tyr251, Leu256, Val258, Tyr366, Phe369 and Asn388. P4'-Lys201 makes hydrogen bond with Gln162. P5'-Met202 binds in the hydrophobic pocket formed by the residues from the 250 and 200 loop. Knowledge of interactions between the enzyme and substrate peptide from these complex structures should form the basis for design of potent inhibitors for this neurotoxin.

  1. Effect of previous botulinum neurotoxin treatment on microvascular decompression for hemifacial spasm

    National Research Council Canada - National Science Library

    Wang, Xuhui; Thirumala, Parthasarathy D; Shah, Aalap; Gardner, Paul; Habeych, Miguel; Crammond, Donald J; Balzer, Jeffrey; Horowitz, Michael

    2013-01-01

    ...) in patients with and without previous botulinum neurotoxin treatment for hemifacial spasm (HFS). The authors analyzed 246 MVDs performed at the University of Pittsburgh Medical Center between January 1, 2000, and December 31, 2007...

  2. The botulinum neurotoxin LD50 test - problems and solutions.

    Science.gov (United States)

    Bitz, Silke

    2010-01-01

    Apart from the fact that the LD50 test is generally considered a procedure causing severe distress, which alone should result in its immediate deletion, it also conflicts with the EU wide ban on cosmetic testing in animals in the case of Botulinum Neurotoxin (BoNT) testing. The European Pharmacopoeia monograph allows for the use of three alternative methods provided they are validated. However these alternative assays are neither implemented by the manufactures of BoNT products nor are they enforced by the responsible authorities, e.g. by deleting the LD50 from the European Pharmacopoeia. The number of animals used for the testing of BoNT is not officially recorded. However, data from an undercover investigation allow the estimation that the number of mice used in LD50tests for BoNT products is greater than 600,000 per year worldwide.

  3. Probiotic microorganisms inhibit epithelial cell internalization of botulinum neurotoxin serotype A

    Science.gov (United States)

    Botulinum neurotoxins (BoNTs) are some of the most poisonous natural toxins known to man and are threats to public health and safety. Previous work from our laboratory showed that BoNT serotype A (BoNT/A) complex (holotoxin with neurotoxin-associated proteins) bind and transit through the intestinal...

  4. Rapid multiplex immunoassay to distinguish botulinum neurotoxin serotypes on a single lateral flow device(Abstract)

    Science.gov (United States)

    Clostridium botulinum produces seven antigenically distinct serotypes of botulinum neurotoxin (BoNT/A–G). The potency of these toxins result in a high mortality rate with BoNT/A and /B accounting for most of the naturally occurring outbreaks. The ease of BoNT production and their potential use as bi...

  5. The Structure of the Neurotoxin- Associated Protein HA33/A from Clostridium botulinum Suggests a Reoccurring Beta-Trefoil Fold in the Progenitor Toxin Complex

    National Research Council Canada - National Science Library

    Arndt, Joseph W; Gu, Jenny; Jaroszewski, Lukasz; Schwarzenbacher, Robert; Hanson, Michael A; Lebeda, Frank L; Stevens, Raymond C

    2004-01-01

    The hemagglutinating protein HA33 from Clostridium botulinum is associated with the large botulinum neurotoxin secreted complexes and is critical in toxin protection, internalization, and possibly activation...

  6. A label-free biosensor assay for botulinum neurotoxin B in food and human serum.

    Science.gov (United States)

    Ferracci, Géraldine; Marconi, Séverine; Mazuet, Christelle; Jover, Emmanuel; Blanchard, Marie-Pierre; Seagar, Michael; Popoff, Michel; Lévêque, Christian

    2011-03-15

    Botulinum neurotoxins (BoNTs) are among the most toxic substances known. Surveillance and diagnostics require methods for rapid detection of BoNTs in complex media such as foodstuffs and human serum. We have developed in vitro assays to specifically detect the protease activity of botulinum neurotoxin B (BoNT/B) on a time scale of minutes. Cleavage of the BoNT/B substrate VAMP2, a membrane SNARE protein associated with synaptic vesicles, was monitored using real-time surface plasmon resonance to measure vesicle capture by specific antibodies coupled to microchips. The assay is functional in low-ionic-strength buffers and stable over a wide range of pH values (5.5-9.0). Endoproteolytic cleavage of VAMP2 was detected in 10 min with 2 pM native BoNT/B holotoxin. Contamination of liquid food products such as carrot juice, apple juice, and milk with low picomolar amounts of BoNT/B was revealed within 3h. BoNT/B activity was detected in sera from patients with type B botulism but not in healthy controls or patients with other neurological diseases. This robust, sensitive, and rapid protein chip assay is appropriate for monitoring BoNT/B in food products and diagnostic tests for type B botulism and could replace the current in vivo mouse bioassay. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. The travel diaries of tetanus and botulinum neurotoxins.

    Science.gov (United States)

    Surana, Sunaina; Tosolini, Andrew P; Meyer, Ione F G; Fellows, Alexander D; Novoselov, Sergey S; Schiavo, Giampietro

    2017-10-12

    Tetanus (TeNT) and botulinum (BoNT) neurotoxins, the causative agents of tetanus and botulism, respectively, are the most potent toxic molecules known to mankind. This extreme potency is attributed to: i) their specificity for essential components of the neurotransmitter release machinery present at vertebrate synapses, and ii) their high-affinity targeting to motor neurons by binding to polysialogangliosides and protein receptors. Comprising the clostridial neurotoxin family, TeNT and BoNTs engage distinct surface receptors and intracellular sorting pathways in neurons. BoNTs bind to the intraluminal domain of specific synaptic vesicle proteins that are exposed to the extracellular milieu upon exocytosis, and are taken up by synaptic vesicle recycling. A sizeable proportion of BoNT molecules remain at the neuromuscular junction, where their protease moiety is released into the cytoplasm, blocking synaptic transmission and causing flaccid paralysis. In contrast, TeNT undergoes binding to specific components of the basal membrane at the neuromuscular junction, is endocytosed into motor neurons and sorted to axonal signalling endosomes. Following this, TeNT is transported to the soma of motor neurons located in the spinal cord or brainstem, and then transcytosed to inhibitory interneurons, where it blocks synaptic transmission. TeNT-induced impairment of inhibitory input leads to hyperactivity of motor neurons, causing spastic paralysis, which is the hallmark of tetanus. This review examines the molecular mechanisms leading to the entry, sorting and intracellular trafficking of TeNT and BoNTs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. [Mechanism of action and therapeutic uses of botulinum and tetanus neurotoxins].

    Science.gov (United States)

    Popoff, M R; Marvaud, J C; Raffestin, S

    2001-05-01

    Botulinum neurotoxins are produced by anaerobic spore forming bacteria, Clostridiumbotulinum. They are synthesized as a single chain protein (150kDa) which is not or weakly active. The active form results from proteolysis that cleaves the precursor into a light chain (about 50kDa) and a heavy chain (about 100kDa) which are linked by a disulfide bridge. The heavy chain is involved in the recognition of a specific neurone surface receptor and mediates the internalization of the light chain into the cytosol. The light chain is responsible for the intracellular activity. It catalyzes the proteolysis of SNARE proteins which are involved in the exocytosis of synaptic vesicles containing acetylcholine. Hence, the release of acetylcholine at the neuromuscular junction is blocked leading to a flaccid paralysis. The tetanus neurotoxin shares with botulinum neurotoxins a common structure and mechanism of action. Tetanus neurotoxin blocks the release of neurotransmitters in the inhibitory interneurons leading to spastic paralysis. The paralytic properties of the botulinum neurotoxins are used to treat certain myoclonies such as blepharospasm, torticolis, hemifacial paralysis. Botulinum neurotoxins are thus efficient therapeutic agents helpful in avoiding surgery.

  9. Neurotoxins from Clostridium botulinum (serotype A) isolated from the soil of Mendoza (Argentina) differ from the A-Hall archetype and from that causing infant botulism.

    Science.gov (United States)

    Caballero, P; Troncoso, M; Patterson, S I; López Gómez, C; Fernandez, R; Sosa, M A

    2016-10-01

    The type A of neurotoxin produced by Clostridium botulinum is the prevalent serotype in strains of Mendoza. The soil is the main reservoir for C.botulinum and is possibly one of the infection sources in infant botulism. In this study, we characterized and compared autochthonous C. botulinum strains and their neurotoxins. Bacterial samples were obtained from the soil and from fecal samples collected from children with infant botulism. We first observed differences in the appearance of the colonies between strains from each source and with the A Hall control strain. In addition, purified neurotoxins of both strains were found to be enriched in a band of 300 kDa, whereas the A-Hall strain was mainly made up of a band of ∼600 kDa. This finding is in line with the lack of hemagglutinating activity of the neurotoxins under study. Moreover, the proteolytic activity of C. botulinum neurotoxins was evaluated against SNARE (soluble N-ethylmaleimide-sensitive factor-attachment protein receptor) proteins from rat brain. It was observed that both, SNAP 25 (synaptosomal-associated protein 25) and VAMP 2 (vesicle-associated membrane protein) were cleaved by the neurotoxins isolated from the soil strains, whereas the neurotoxins from infant botulism strains only induced a partial cleavage of VAMP 2. On the other hand, the neurotoxin from the A-Hall strain was able to cleave both proteins, though at a lesser extent. Our data indicate that the C.botulinum strain isolated from the soil, and its BoNT, exhibit different properties compared to the strain obtained from infant botulism patients, and from the A-Hall archetype. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. A new treatment for focal dystonias: incobotulinumtoxinA (Xeomin®, a botulinum neurotoxin type A free from complexing proteins

    Directory of Open Access Journals (Sweden)

    Jimenez-Shahed J

    2011-12-01

    Full Text Available Joohi Jimenez-ShahedDepartment of Neurology, Baylor College of Medicine, Houston, TX, USAAbstract: Dystonia is a movement disorder of uncertain pathogenesis that is characterized by involuntary and inappropriate muscle contractions which cause sustained abnormal postures and movements of multiple or single (focal body regions. The most common focal dystonias are cervical dystonia (CD and blepharospasm (BSP. The first-line recommended treatment for CD and BSP is injection with botulinum toxin (BoNT, of which two serotypes are available: BoNT type A (BoNT/A and BoNT type B (BoNT/B. Conventional BoNT formulations include inactive complexing proteins, which may increase the risk for antigenicity, possibly leading to treatment failure. IncobotulinumtoxinA (Xeomin®; Merz Pharmaceuticals GmbH, Frankfurt, Germany is a BoNT/A agent that has been recently Food and Drug Administration-approved for the treatment of adults with CD and adults with BSP previously treated with onabotulinumtoxinA (Botox®; Allergen, Inc, Irvine, CA – a conventional BoNT/A. IncobotulinumtoxinA is the only BoNT product that is free of complexing proteins. The necessity of complexing proteins for the effectiveness of botulinum toxin treatment has been challenged by preclinical and clinical studies with incobotulinumtoxinA. These studies have also suggested that incobotulinumtoxinA is associated with a lower risk for stimulating antibody formation than onabotulinumtoxinA. In phase 3 noninferiority trials, incobotulinumtoxinA demonstrated significant improvements in CD and BSP symptoms in both primary and secondary measures, compared with baseline, and met criteria for noninferiority versus onabotulinumtoxinA. In placebo-controlled trials, incobotulinumtoxinA also significantly improved the symptoms of CD and BSP, with robust outcomes in both primary and secondary measures. The use of incobotulinumtoxinA has been well tolerated in all trials, with an adverse event profile similar

  11. Regulation of Botulinum Neurotoxin Synthesis and Toxin Complex Formation by Arginine and Glucose in Clostridium botulinum ATCC 3502.

    Science.gov (United States)

    Fredrick, Chase M; Lin, Guangyun; Johnson, Eric A

    2017-07-01

    Botulinum neurotoxin (BoNT), produced by neurotoxigenic clostridia, is the most potent biological toxin known and the causative agent of the paralytic disease botulism. The nutritional, environmental, and genetic regulation of BoNT synthesis, activation, stability, and toxin complex (TC) formation is not well studied. Previous studies indicated that growth and BoNT formation were affected by arginine and glucose in Clostridium botulinum types A and B. In the present study, C. botulinum ATCC 3502 was grown in toxin production medium (TPM) with different levels of arginine and glucose and of three products of arginine metabolism, citrulline, proline, and ornithine. Cultures were analyzed for growth (optical density at 600 nm [OD 600 ]), spore formation, and BoNT and TC formation by Western blotting and immunoprecipitation and for BoNT activity by mouse bioassay. A high level of arginine (20 g/liter) repressed BoNT production approximately 1,000-fold, enhanced growth, slowed lysis, and reduced endospore production by greater than 1,000-fold. Similar effects on toxin production were seen with equivalent levels of citrulline but not ornithine or proline. In TPM lacking glucose, levels of formation of BoNT/A1 and TC were significantly decreased, and extracellular BoNT and TC proteins were partially inactivated after the first day of culture. An understanding of the regulation of C. botulinum growth and BoNT and TC formation should be valuable in defining requirements for BoNT formation in foods and clinical samples, improving the quality of BoNT for pharmaceutical preparations, and elucidating the biological functions of BoNTs for the bacterium. IMPORTANCE Botulinum neurotoxin (BoNT) is a major food safety and bioterrorism concern and is also an important pharmaceutical, and yet the regulation of its synthesis, activation, and stability in culture media, foods, and clinical samples is not well understood. This paper provides insights into the effects of critical

  12. An update on the mechanism of action of tetanus and botulinum neurotoxins.

    Science.gov (United States)

    Rossetto, Ornella; Pirazzini, Marco; Bolognese, Paolo; Rigoni, Michela; Montecucco, Cesare

    2011-12-01

    Tetanus and botulinum neurotoxins, produced by anaerobic bacteria of the genus Clostridium, are the most toxic proteins known and are the sole responsible for the pathogenesis of tetanus and botulism. They enter peripheral cholinergic nerve terminals and cleave proteins of the neuroexocytosis apparatus causing a persistent, but reversible, inhibition of neurotransmitter release. Botulinum neurotoxins are used in the therapy of many human syndromes caused by hyperactive cholinergic nerve terminals. Here we focus on the many advances that were recently made on the understanding of their molecular mechanism of action and on their use in human therapy.

  13. Recovery of a strain of Clostridium botulinum producing both neurotoxin A and neurotoxin B from canned macrobiotic food.

    Science.gov (United States)

    Franciosa, G; Fenicia, L; Pourshaban, M; Aureli, P

    1997-03-01

    A rare strain of Clostridium botulinum subtype Ab was isolated from a canned macrobiotic food suspected of being linked to a fatal case of food-borne botulism. The strain was recovered and identified by conventional methods modified by the inclusion of a PCR assay (G. Franciosa, J.L. Ferreira, and C.L. Hatheway, J. Clin. Microbiol. 32:1911-1917, 1994). The titers of neurotoxins produced by the strain were evaluated by a mouse bioassay.

  14. Effect of previous botulinum neurotoxin treatment on microvascular decompression for hemifacial spasm.

    Science.gov (United States)

    Wang, Xuhui; Thirumala, Parthasarathy D; Shah, Aalap; Gardner, Paul; Habeych, Miguel; Crammond, Donald J; Balzer, Jeffrey; Horowitz, Michael

    2013-03-01

    The objective of this study was to investigate the clinical characteristics, intraoperative findings, complications, and outcomes after the first microvascular decompression (MVD) in patients with and without previous botulinum neurotoxin treatment for hemifacial spasm (HFS). The authors analyzed 246 MVDs performed at the University of Pittsburgh Medical Center between January 1, 2000, and December 31, 2007. One hundred and seventy-six patients with HFS underwent botulinum neurotoxin injection treatment prior to first MVD (Group I), and 70 patients underwent their first MVD without previous botulinum neurotoxin treatment (Group II). Clinical outcome data were obtained immediately after the operation, at discharge, and at follow-up. Follow-up data were collected from 177 patients with a minimum follow-up period of 9 months (mean 54.48 ± 27.84 months). In 246 patients, 89.4% experienced immediate postoperative relief of spasm, 91.1% experienced relief at discharge, and 92.7% experienced relief at follow-up. There was no significant difference in outcomes and complications between Group I and Group II (p > 0.05). Preoperatively, patients in Group I had higher rates of facial weakness, tinnitus, tonus, and platysmal involvement as compared with Group II (p 0.05). No significant differences in complications were noted between the 2 groups. Microvascular decompression is an effective and safe procedure for patients with HFS previously treated using botulinum neurotoxin. Intraoperative monitoring with LSR is an effective tool for evaluating adequate decompression.

  15. Structural basis for recognition of synaptic vesicle protein 2C by botulinum neurotoxin A

    NARCIS (Netherlands)

    Benoit, Roger M.; Frey, Daniel; Hilbert, Manuel; Kevenaar, Josta T.; Wieser, Mara M.; Stirnimann, Christian U.; McMillan, David; Ceska, Tom; Lebon, Florence; Jaussi, Rolf; Steinmetz, Michel O.; Schertler, Gebhard F X; Hoogenraad, Casper C.; Capitani, Guido; Kammerer, Richard A.

    2014-01-01

    Botulinum neurotoxin A (BoNT/A) belongs to the most dangerous class of bioweapons. Despite this, BoNT/A is used to treat a wide range of common medical conditions such as migraines and a variety of ocular motility and movement disorders. BoNT/A is probably best known for its use as an antiwrinkle

  16. Recombinant rabies virus particles presenting botulinum neurotoxin antigens elicit a protective humoral response in vivo

    Directory of Open Access Journals (Sweden)

    Andrew W Hudacek

    2014-01-01

    Full Text Available Botulinum neurotoxins are one of the most potent toxins found in nature, with broad medical applications from cosmetics to the treatment of various neuropathies. Additionally, these toxins are classified as Category A-Tier 1 agents, with human lethal doses calculated at as little as 90 ng depending upon the route of administration. Of the eight distinct botulinum neurotoxin serotypes, the most common causes of human illness are from serotypes /A, /B, and /E. Protection can be achieved by eliciting antibody responses against the receptor-binding domain of the neurotoxin. Our previous research has shown that recombinant rabies virus–based particles can effectively present heterologous antigens. Here, we describe a novel strategy using recombinant rabies virus particles that elicits a durable humoral immune response against the botulinum neurotoxin receptor binding domains from serotypes /A, /B, and /E. Following intramuscular administration of β-propiolactone-inactivated rabies virus particles, mice elicited specific immune responses against the cognate antigen. Administration of a combination of these vectors also demonstrated antibody responses against all three serotypes based on enzyme-linked immunosorbent assay (ELISA measurements, with minimal decay within the study timeline. Complete protection was achieved against toxin challenge from the serotypes /A and /B and partial protection for /E, indicating that a multivalent approach is feasible.

  17. On the translocation of botulinum and tetanus neurotoxins across the membrane of acidic intracellular compartments.

    Science.gov (United States)

    Pirazzini, Marco; Azarnia Tehran, Domenico; Leka, Oneda; Zanetti, Giulia; Rossetto, Ornella; Montecucco, Cesare

    2016-03-01

    Tetanus and botulinum neurotoxins are produced by anaerobic bacteria of the genus Clostridium and are the most poisonous toxins known, with 50% mouse lethal dose comprised within the range of 0.1-few nanograms per Kg, depending on the individual toxin. Botulinum neurotoxins are similarly toxic to humans and can therefore be considered for potential use in bioterrorism. At the same time, their neurospecificity and reversibility of action make them excellent therapeutics for a growing and heterogeneous number of human diseases that are characterized by a hyperactivity of peripheral nerve terminals. The complete crystallographic structure is available for some botulinum toxins, and reveals that they consist of four domains functionally related to the four steps of their mechanism of neuron intoxication: 1) binding to specific receptors of the presynaptic membrane; 2) internalization via endocytic vesicles; 3) translocation across the membrane of endocytic vesicles into the neuronal cytosol; 4) catalytic activity of the enzymatic moiety directed towards the SNARE proteins. Despite the many advances in understanding the structure-mechanism relationship of tetanus and botulinum neurotoxins, the molecular events involved in the translocation step have been only partially elucidated. Here we will review recent advances that have provided relevant insights on the process and discuss possible models that can be experimentally tested. This article is part of a Special Issue entitled: Pore-Forming Toxins edited by Mauro Dalla Serra and Franco Gambale. Copyright © 2015. Published by Elsevier B.V.

  18. Tetanus and botulinum neurotoxins: mechanism of action and therapeutic uses.

    OpenAIRE

    Pellizzari, R; Rossetto, O.; G. Schiavo; Montecucco, C

    1999-01-01

    The clostridial neurotoxins responsible for tetanus and botulism are proteins consisting of three domains endowed with different functions: neurospecific binding, membrane translocation and proteolysis for specific components of the neuroexocytosis apparatus. Tetanus neurotoxin (TeNT) binds to the presynaptic membrane of the neuromuscular junction, is internalized and transported retroaxonally to the spinal cord. The spastic paralysis induced by the toxin is due to the blockade of neurotransm...

  19. New Elements To Consider When Modeling the Hazards Associated with Botulinum Neurotoxin in Food.

    Science.gov (United States)

    Ihekwaba, Adaoha E C; Mura, Ivan; Malakar, Pradeep K; Walshaw, John; Peck, Michael W; Barker, G C

    2015-09-08

    Botulinum neurotoxins (BoNTs) produced by the anaerobic bacterium Clostridium botulinum are the most potent biological substances known to mankind. BoNTs are the agents responsible for botulism, a rare condition affecting the neuromuscular junction and causing a spectrum of diseases ranging from mild cranial nerve palsies to acute respiratory failure and death. BoNTs are a potential biowarfare threat and a public health hazard, since outbreaks of foodborne botulism are caused by the ingestion of preformed BoNTs in food. Currently, mathematical models relating to the hazards associated with C. botulinum, which are largely empirical, make major contributions to botulinum risk assessment. Evaluated using statistical techniques, these models simulate the response of the bacterium to environmental conditions. Though empirical models have been successfully incorporated into risk assessments to support food safety decision making, this process includes significant uncertainties so that relevant decision making is frequently conservative and inflexible. Progression involves encoding into the models cellular processes at a molecular level, especially the details of the genetic and molecular machinery. This addition drives the connection between biological mechanisms and botulism risk assessment and hazard management strategies. This review brings together elements currently described in the literature that will be useful in building quantitative models of C. botulinum neurotoxin production. Subsequently, it outlines how the established form of modeling could be extended to include these new elements. Ultimately, this can offer further contributions to risk assessments to support food safety decision making. Copyright © 2015 Ihekwaba et al.

  20. Current gaps in basic science knowledge of botulinum neurotoxin biological actions.

    Science.gov (United States)

    Rossetto, Ornella; Pirazzini, Marco; Montecucco, Cesare

    2015-12-01

    Botulinum neurotoxins are produced by anaerobic spore-forming bacteria of the genus Clostridium in several dozens of variants that inactivate neurotransmitter release owing to their metalloprotease activity. This results in a persistent paralysis of peripheral nerve terminals known as botulism. They are the most potent toxins known and are classified as one of the six highest-risk threat agents of bioterrorism. Despite their high toxicity, two of them are used as valuable pharmaceutical for the therapy of many neurological and non-neurological disorders. Notwithstanding the many advances in our understanding of the genetics and structure of botulinum neurotoxins, there are still many gaps in knowledge of toxin mechanism of action that will be discussed here. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. The pattern of growth observed for Clostridium botulinum type A1 strain ATCC 19397 is influenced by nutritional status and quorum sensing: a modelling perspective

    OpenAIRE

    Ihekwaba, Adaoha E. C.; Mura, Ivan; Peck, Michael W.; Barker,G. C.

    2015-01-01

    Botulinum neurotoxins (BoNTs) produced by the anaerobic bacterium Clostridium botulinum are the most poisonous substances known to mankind. However, toxin regulation and signals triggering synthesis as well as the regulatory network and actors controlling toxin production are unknown. Experiments show that the neurotoxin gene is growth phase dependent for C. botulinum type A1 strain ATCC 19397, and toxin production is influenced both by culture conditions and nutritional status of the medium....

  2. Two-component signal transduction system CBO0787/CBO0786 represses transcription from botulinum neurotoxin promoters in Clostridium botulinum ATCC 3502.

    Directory of Open Access Journals (Sweden)

    Zhen Zhang

    2013-03-01

    Full Text Available Blocking neurotransmission, botulinum neurotoxin is the most poisonous biological substance known to mankind. Despite its infamy as the scourge of the food industry, the neurotoxin is increasingly used as a pharmaceutical to treat an expanding range of muscle disorders. Whilst neurotoxin expression by the spore-forming bacterium Clostridium botulinum appears tightly regulated, to date only positive regulatory elements, such as the alternative sigma factor BotR, have been implicated in this control. The identification of negative regulators has proven to be elusive. Here, we show that the two-component signal transduction system CBO0787/CBO0786 negatively regulates botulinum neurotoxin expression. Single insertional inactivation of cbo0787 encoding a sensor histidine kinase, or of cbo0786 encoding a response regulator, resulted in significantly elevated neurotoxin gene expression levels and increased neurotoxin production. Recombinant CBO0786 regulator was shown to bind to the conserved -10 site of the core promoters of the ha and ntnh-botA operons, which encode the toxin structural and accessory proteins. Increasing concentration of CBO0786 inhibited BotR-directed transcription from the ha and ntnh-botA promoters, demonstrating direct transcriptional repression of the ha and ntnh-botA operons by CBO0786. Thus, we propose that CBO0786 represses neurotoxin gene expression by blocking BotR-directed transcription from the neurotoxin promoters. This is the first evidence of a negative regulator controlling botulinum neurotoxin production. Understanding the neurotoxin regulatory mechanisms is a major target of the food and pharmaceutical industries alike.

  3. Botulinum neurotoxin vaccines: Past history and recent developments.

    Science.gov (United States)

    Rusnak, Janice M; Smith, Leonard A

    2009-12-01

    Botulinum toxin may cause a neuroparalytic illness that may result in respiratory failure and require prolonged mechanical ventilation. As medical resources needed for supportive care of botulism in a bioterrorist event may quickly overwhelm the local healthcare systems, biodefense research efforts have been directed towards the development of a vaccine to prevent botulism. While human botulism has been caused only by toxin serotypes A, B, and E (rarely serotype F), all seven known immunologically distinct toxin serotypes (A - G) may potentially cause intoxication in humans from a bioterrorist event. A pentavalent (ABCDE) botulinum toxoid (PBT) has been administered as an investigation new drug (IND) to at-risk individuals for nearly 50 years. Due to declining immunogenicity of the PBT, research efforts have been directed at development of both improved (less local reactogenicity) botulinum toxoids and recombinant vaccines as potential vaccine candidates to replace the PBT.

  4. Treatment of Chronic Migraine with Focus on Botulinum Neurotoxins

    Directory of Open Access Journals (Sweden)

    Sara M. Schaefer

    2015-07-01

    Full Text Available Migraine is the most common neurological disorder, and contributes to disability and large healthcare costs in the United States and the world. The treatment of migraine until recently has focused on medications, both abortive and prophylactic, but treatment of chronic migraine has been revolutionized with the introduction of botulinum toxin injection therapy. In this review, we explore the current understanding of migraine pathophysiology, and the evolution of the use of botulinum toxin therapy including proposed pathophysiological mechanisms through animal data. We also discuss the similarities and differences between three injection techniques.

  5. Botulinum neurotoxin C mutants reveal different effects of syntaxin or SNAP-25 proteolysis on neuromuscular transmission.

    Science.gov (United States)

    Zanetti, Giulia; Sikorra, Stefan; Rummel, Andreas; Krez, Nadja; Duregotti, Elisa; Negro, Samuele; Henke, Tina; Rossetto, Ornella; Binz, Thomas; Pirazzini, Marco

    2017-08-01

    Botulinum neurotoxin serotype C (BoNT/C) is a neuroparalytic toxin associated with outbreaks of animal botulism, particularly in birds, and is the only BoNT known to cleave two different SNARE proteins, SNAP-25 and syntaxin. BoNT/C was shown to be a good substitute for BoNT/A1 in human dystonia therapy because of its long lasting effects and absence of neuromuscular damage. Two triple mutants of BoNT/C, namely BoNT/C S51T/R52N/N53P (BoNT/C α-51) and BoNT/C L200W/M221W/I226W (BoNT/C α-3W), were recently reported to selectively cleave syntaxin and have been used here to evaluate the individual contribution of SNAP-25 and syntaxin cleavage to the effect of BoNT/C in vivo. Although BoNT/C α-51 and BoNT/C α-3W toxins cleave syntaxin with similar efficiency, we unexpectedly found also cleavage of SNAP-25, although to a lesser extent than wild type BoNT/C. Interestingly, the BoNT/C mutants exhibit reduced lethality compared to wild type toxin, a result that correlated with their residual activity against SNAP-25. In spite of this, a local injection of BoNT/C α-51 persistently impairs neuromuscular junction activity. This is due to an initial phase in which SNAP-25 cleavage causes a complete blockade of neurotransmission, and to a second phase of incomplete impairment ascribable to syntaxin cleavage. Together, these results indicate that neuroparalysis of BoNT/C at the neuromuscular junction is due to SNAP-25 cleavage, while the proteolysis of syntaxin provides a substantial, but incomplete, neuromuscular impairment. In light of this evidence, we discuss a possible clinical use of BoNT/C α-51 as a botulinum neurotoxin endowed with a wide safety margin and a long lasting effect.

  6. Extreme Sensitivity of Botulinum Neurotoxin Domains Toward Mild Agitation

    Science.gov (United States)

    2009-09-01

    anti- gens to aluminum salt adjuvants . J Pharm Sci 96: 2375–2389. 10. Silvaggi NR, Boldt GE, Hixon MS, Kennedy JP, Tzipori S, Janda KD, Allen KN...nature of LC and Hc domains make them ideal tools for drug develop- ment and as vaccine candidates. The catalytic activity of the recombinant LC of...of botulinum toxin. J Pharmacol Exp Ther 308:857–864. 6. Park JB, Simpson LL. 2004. Progress toward devel- opment of an inhalation vaccine against

  7. The destructive effect of botulinum neurotoxins on the SNARE protein: SNAP-25 and synaptic membrane fusion

    Directory of Open Access Journals (Sweden)

    Bin Lu

    2015-06-01

    Full Text Available Synaptic exocytosis requires the assembly of syntaxin 1A and SNAP-25 on the plasma membrane and synaptobrevin 2 (VAMP2 on the vesicular membrane to bridge the two opposite membranes. It is believed that the three SNARE proteins assemble in steps along the dynamic assembly pathway. The C-terminus of SNAP-25 is known to be the target of botulinum neurotoxins (BoNT/A and BoNT/E that block neurotransmitters release in vivo. In this study, we employed electron paramagnetic resonance (EPR spectroscopy to investigate the conformation of the SNAP-25 C-terminus in binary and ternary SNARE complexes. The fluorescence lipid mixing assay shows that the C-terminal of SNAP-25 is essential for membrane fusion, and that the truncated SNAP-25 mutants cleaved by BoNT/A and BoNT/E display different inhibition effects on membrane fusion: SNAP-25E (Δ26 abolishes the fusion activity of the SNARE complex, while SNAP-25A (Δ9 loses most of its function, although it can still form a SDS-resistant SNARE complex as the wild-type SNAP-25. CW-EPR spectra validate the unstable structures of the SNARE complex formed by SNAP-25 mutants. We propose that the truncated SNAP-25 mutants will disrupt the assembly of the SNARE core complex, and then inhibit the synaptic membrane fusion accordingly.

  8. Re-Assembled Botulinum Neurotoxin Inhibits CNS Functions without Systemic Toxicity

    Directory of Open Access Journals (Sweden)

    Bazbek Davletov

    2011-03-01

    Full Text Available The therapeutic potential of botulinum neurotoxin type A (BoNT/A has recently been widely recognized. BoNT/A acts to silence synaptic transmission via specific proteolytic cleavage of an essential neuronal protein, SNAP25. The advantages of BoNT/A-mediated synaptic silencing include very long duration, high potency and localized action. However, there is a fear of possible side-effects of BoNT/A due to its diffusible nature which may lead to neuromuscular blockade away from the injection site. We recently developed a “protein-stapling” technology which allows re-assembly of BoNT/A from two separate fragments. This technology allowed, for the first time, safe production of this popular neuronal silencing agent. Here we evaluated the re-assembled toxin in several CNS assays and assessed its systemic effects in an animal model. Our results show that the re-assembled toxin is potent in inhibiting CNS function at 1 nM concentration but surprisingly does not exhibit systemic toxicity after intraperitoneal injection even at 200 ng/kg dose. This shows that the re-assembled toxin represents a uniquely safe tool for neuroscience research and future medical applications.

  9. The destructive effect of botulinum neurotoxins on the SNARE protein: SNAP-25 and synaptic membrane fusion.

    Science.gov (United States)

    Lu, Bin

    2015-01-01

    Synaptic exocytosis requires the assembly of syntaxin 1A and SNAP-25 on the plasma membrane and synaptobrevin 2 (VAMP2) on the vesicular membrane to bridge the two opposite membranes. It is believed that the three SNARE proteins assemble in steps along the dynamic assembly pathway. The C-terminus of SNAP-25 is known to be the target of botulinum neurotoxins (BoNT/A and BoNT/E) that block neurotransmitters release in vivo. In this study, we employed electron paramagnetic resonance (EPR) spectroscopy to investigate the conformation of the SNAP-25 C-terminus in binary and ternary SNARE complexes. The fluorescence lipid mixing assay shows that the C-terminal of SNAP-25 is essential for membrane fusion, and that the truncated SNAP-25 mutants cleaved by BoNT/A and BoNT/E display different inhibition effects on membrane fusion: SNAP-25E (Δ26) abolishes the fusion activity of the SNARE complex, while SNAP-25A (Δ9) loses most of its function, although it can still form a SDS-resistant SNARE complex as the wild-type SNAP-25. CW-EPR spectra validate the unstable structures of the SNARE complex formed by SNAP-25 mutants. We propose that the truncated SNAP-25 mutants will disrupt the assembly of the SNARE core complex, and then inhibit the synaptic membrane fusion accordingly.

  10. Effects on craniofacial growth and development of unilateral botulinum neurotoxin injection into the masseter muscle.

    Science.gov (United States)

    Tsai, Chi-Yang; Chiu, Wan Chi; Liao, Yi-Hsuan; Tsai, Chih-Mong

    2009-02-01

    The effects of botulinum neurotoxin type A (BoNT/A) on masseter muscles, when injected for cosmetic purposes (volumetric reduction) or treatment of excessive muscle activity (bruxism), have been investigated. However, the full anatomic effects of treatment are not known, particularly with respect to the mandible and relevant anthropometric measurements. The intent of this study was to use unilaterial BoNT/A injections to induce localized masseter atrophy and paresis and then to measure the effects of muscle influence on craniofacial growth and development. Growing male Wistar rats, 30 days old, were studied. The experimental group consisted of 8 rats. One side of the masseter muscle was injected with BoNT/A and the other side of the masseter muscle was injected with saline. The side with BoNT/A belonged to 1 group and the side with saline was the sham group. Three rats without injections was the control. After 45 days, the masseter muscles were dissected and weighed. Dry skulls were prepared, and anthropometric measurements determined. One-way ANOVA showed that the animals maintained their weight in both groups; however, the muscles injected with BoNT/A were smaller than the sham or control muscles. Anthropometric measurements of the bony structures attached to the masseter muscle showed a significant treatment effect. After localized masseter muscle atrophy induced by BoNT/A injection, alterations of craniofacial bone growth and development were seen. The results agree with the functional matrix theory that soft tissues regulate bone growth.

  11. Identification of a Botulinum Neurotoxin-like Toxin in a Commensal Strain of Enterococcus faecium.

    Science.gov (United States)

    Zhang, Sicai; Lebreton, Francois; Mansfield, Michael J; Miyashita, Shin-Ichiro; Zhang, Jie; Schwartzman, Julia A; Tao, Liang; Masuyer, Geoffrey; Martínez-Carranza, Markel; Stenmark, Pål; Gilmore, Michael S; Doxey, Andrew C; Dong, Min

    2018-02-14

    Botulinum neurotoxins (BoNTs), produced by various Clostridium strains, are a family of potent bacterial toxins and potential bioterrorism agents. Here we report that an Enterococcus faecium strain isolated from cow feces carries a BoNT-like toxin, designated BoNT/En. It cleaves both VAMP2 and SNAP-25, proteins that mediate synaptic vesicle exocytosis in neurons, at sites distinct from known BoNT cleavage sites on these two proteins. Comparative genomic analysis determines that the E. faecium strain carrying BoNT/En is a commensal type and that the BoNT/En gene is located within a typical BoNT gene cluster on a 206 kb putatively conjugative plasmid. Although the host species targeted by BoNT/En remains to be determined, these findings establish an extended member of BoNTs and demonstrate the capability of E. faecium, a commensal organism ubiquitous in humans and animals and a leading cause of hospital-acquired multi-drug-resistant (MDR) infections, to horizontally acquire, and possibly disseminate, a unique BoNT gene cluster. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Re-Assembled Botulinum Neurotoxin Inhibits CNS Functions without Systemic Toxicity

    Science.gov (United States)

    Ferrari, Enrico; Maywood, Elizabeth S.; Restani, Laura; Caleo, Matteo; Pirazzini, Marco; Rossetto, Ornella; Hastings, Michael H.; Niranjan, Dhevahi; Schiavo, Giampietro; Davletov, Bazbek

    2011-01-01

    The therapeutic potential of botulinum neurotoxin type A (BoNT/A) has recently been widely recognized. BoNT/A acts to silence synaptic transmission via specific proteolytic cleavage of an essential neuronal protein, SNAP25. The advantages of BoNT/A-mediated synaptic silencing include very long duration, high potency and localized action. However, there is a fear of possible side-effects of BoNT/A due to its diffusible nature which may lead to neuromuscular blockade away from the injection site. We recently developed a “protein-stapling” technology which allows re-assembly of BoNT/A from two separate fragments. This technology allowed, for the first time, safe production of this popular neuronal silencing agent. Here we evaluated the re-assembled toxin in several CNS assays and assessed its systemic effects in an animal model. Our results show that the re-assembled toxin is potent in inhibiting CNS function at 1 nM concentration but surprisingly does not exhibit systemic toxicity after intraperitoneal injection even at 200 ng/kg dose. This shows that the re-assembled toxin represents a uniquely safe tool for neuroscience research and future medical applications. PMID:22069712

  13. Recombinant botulinum neurotoxin Hc subunit (BoNT Hc) and catalytically inactive Clostridium botulinum holoproteins (ciBoNT HPs) as vaccine candidates for the prevention of botulism

    Science.gov (United States)

    2017-09-03

    Recombinant botulinum neurotoxin Hc subunit (BoNT Hc) and catalytically inactive Clostridium 1 botulinum holoproteins (ciBoNT HPs) as vaccine...hundreds of years, the disease was 47 recognized as a public health concern in the United States after 32 people died in 5 outbreaks 48 associated with...ripe olives in 1919 and 1920 [3]. These incidents emphasized the need for 49 effective treatments, such as antitoxins and vaccines, to counteract

  14. Thioredoxin and Its Reductase Are Present on Synaptic Vesicles, and Their Inhibition Prevents the Paralysis Induced by Botulinum Neurotoxins

    Directory of Open Access Journals (Sweden)

    Marco Pirazzini

    2014-09-01

    Full Text Available Botulinum neurotoxins consist of a metalloprotease linked via a conserved interchain disulfide bond to a heavy chain responsible for neurospecific binding and translocation of the enzymatic domain in the nerve terminal cytosol. The metalloprotease activity is enabled upon disulfide reduction and causes neuroparalysis by cleaving the SNARE proteins. Here, we show that the thioredoxin reductase-thioredoxin protein disulfide-reducing system is present on synaptic vesicles and that it is functional and responsible for the reduction of the interchain disulfide of botulinum neurotoxin serotypes A, C, and E. Specific inhibitors of thioredoxin reductase or thioredoxin prevent intoxication of cultured neurons in a dose-dependent manner and are also very effective inhibitors of the paralysis of the neuromuscular junction. We found that this group of inhibitors of botulinum neurotoxins is very effective in vivo. Most of them are nontoxic and are good candidates as preventive and therapeutic drugs for human botulism.

  15. Assessment: Botulinum neurotoxin for the treatment of movement disorders (an evidence-based review)

    Science.gov (United States)

    Simpson, D.M.; Blitzer, A.; Brashear, A.; Comella, C.; Dubinsky, R.; Hallett, M.; Jankovic, J.; Karp, B.; Ludlow, C.L.; Miyasaki, J.M.; Naumann, M.; So, Y.

    2017-01-01

    Objective To perform an evidence-based review of the safety and efficacy of botulinum neurotoxin (BoNT) in the treatment of movement disorders. Methods A literature search was performed including MEDLINE and Current Contents for therapeutic articles relevant to BoNT and selected movement disorders. Authors reviewed, abstracted, and classified articles based on American Academy of Neurology criteria (Class I–IV). Results The highest quality literature available for the respective indications was as follows: blepharospasm (two Class II studies); hemifacial spasm (one Class II and one Class III study); cervical dystonia (seven Class I studies); focal upper extremity dystonia (one Class I and three Class II studies); focal lower extremity dystonia (one Class II study); laryngeal dystonia (one Class I study); motor tics (one Class II study); and upper extremity essential tremor (two Class II studies). Recommendations Botulinum neurotoxin should be offered as a treatment option for the treatment of cervical dystonia (Level A), may be offered for blepharospasm, focal upper extremity dystonia, adductor laryngeal dystonia, and upper extremity essential tremor (Level B), and may be considered for hemifacial spasm, focal lower limb dystonia, and motor tics (Level C). While clinicians’ practice may suggest stronger recommendations in some of these indications, evidence-based conclusions are limited by the availability of data. PMID:18458230

  16. The N-terminal half of the receptor domain of botulinum neurotoxin A binds to microdomains of the plasma membrane.

    Science.gov (United States)

    Muraro, Lucia; Tosatto, Silvio; Motterlini, Lisa; Rossetto, Ornella; Montecucco, Cesare

    2009-02-27

    Botulinum neurotoxin type A (BoNT/A) is largely employed in human therapy because of its specific inhibition of peripheral cholinergic nerve terminals. BoNT/A binds to them rapidly and with high specificity via its receptor binding domain termed HC. Recent evidence indicate that BoNT/A interacts specifically with polysialogangliosides and with a luminal loop of the synaptic vesicle protein SV2 via the C-terminal half of HC. Here we show that the N-terminal half of HC binds to sphingomyelin-enriched membrane microdomains and that it has a defined interaction with phosphatidylinositol phosphates (PIP). We have identified a PIP binding site in this half of HC and we show how this interaction could predispose BoNT/A for membrane insertion, which is the step subsequent to binding, in the four-steps route leading BoNT/A inside nerve terminals.

  17. Predicting Improvement in Writer's Cramp Symptoms following Botulinum Neurotoxin Injection Therapy

    Directory of Open Access Journals (Sweden)

    Mallory Jackman

    2016-09-01

    Full Text Available Introduction: Writer's cramp is a specific focal hand dystonia causing abnormal posturing and tremor in the upper limb. The most popular medical intervention, botulinum neurotoxin type A (BoNT-A therapy, is variably effective for 50–70% of patients. BoNT-A non-responders undergo ineffective treatment and may experience significant side effects. Various assessments have been used to determine response prediction to BoNT-A, but not in the same population of patients. Methods: A comprehensive assessment was employed to measure various symptom aspects. Clinical scales, full upper-limb kinematic measures, self-report, and task performance measures were assessed for nine writer's cramp patients at baseline. Patients received two BoNT-A injections then were classified as responders or non-responders based on a quantified self-report measure. Baseline scores were compared between groups, across all measures, to determine which scores predicted a positive BoNT-A response. Results: Five of nine patients were responders. No kinematic measures were predictably different between groups. Analyses revealed three features that predicted a favorable response and separated the two groups: higher than average cramp severity and cramp frequency, and below average cramp latency. Discussion: Non-kinematic measures appear to be superior in making such predictions. Specifically, measures of cramp severity, frequency, and latency during performance of a specific set of writing and drawing tasks were predictive factors. Since kinematic was not used to determine the injection pattern and the injections were visually guided, it may still be possible to use individual patient kinematics for better outcomes. 

  18. A Potent Peptidomimetic Inhibitor of Botulinum Neurotoxin Serotype A has a Very Different Conformation than SNAP-25 Substrate

    National Research Council Canada - National Science Library

    Zuniga, Jorge E; Schmidt, James J; Fenn, Timothy; Burnett, James C; Arac, Demet; Gussio, Rick; Stafford, Robert G; Badie, Shirin S; Bavari, Sina; Brunger, Axel T

    2008-01-01

    Botulinum neurotoxin serotype A is the most lethal of all known toxins. Here, we report the crystal structure, along with SAR data, of the zinc metalloprotease domain of BoNT/A bound to a potent peptidomimetic inhibitor (K(i)=41 nM...

  19. Botulinum neurotoxin serotype A specific cell-based potency assay to replace the mouse bioassay.

    Directory of Open Access Journals (Sweden)

    Ester Fernández-Salas

    Full Text Available Botulinum neurotoxin serotype A (BoNT/A, a potent therapeutic used to treat various disorders, inhibits vesicular neurotransmitter exocytosis by cleaving SNAP25. Development of cell-based potency assays (CBPAs to assess the biological function of BoNT/A have been challenging because of its potency. CBPAs can evaluate the key steps of BoNT action: receptor binding, internalization-translocation, and catalytic activity; and therefore could replace the current mouse bioassay. Primary neurons possess appropriate sensitivity to develop potential replacement assays but those potency assays are difficult to perform and validate. This report describes a CBPA utilizing differentiated human neuroblastoma SiMa cells and a sandwich ELISA that measures BoNT/A-dependent intracellular increase of cleaved SNAP25. Assay sensitivity is similar to the mouse bioassay and measures neurotoxin biological activity in bulk drug substance and BOTOX® product (onabotulinumtoxinA. Validation of a version of this CBPA in a Quality Control laboratory has led to FDA, Health Canada, and European Union approval for potency testing of BOTOX®, BOTOX® Cosmetic, and Vistabel®. Moreover, we also developed and optimized a BoNT/A CBPA screening assay that can be used for the discovery of novel BoNT/A inhibitors to treat human disease.

  20. Botulinum Neurotoxins

    Science.gov (United States)

    2012-03-28

    1900s. Anecdotal accounts describe the implementation of crude anaerobic fermenters made by burying canteens filled with water, green beans and...failed to respond to the survey or those at nursing facilities or schools . 6. Conclusion BoNT has been investigated as a BW by a number of

  1. Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.

    Science.gov (United States)

    Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia

    2012-01-27

    Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Use of Monoclonal Antibodies in the Sensitive Detection and Neutralization of Botulinum Neurotoxin Serotype B.

    Science.gov (United States)

    Cheng, Luisa W; Henderson, Thomas D; Lam, Tina I; Stanker, Larry H

    2015-11-27

    Botulinum neurotoxins (BoNT) are some of nature's most potent toxins. Due to potential food contamination, and bioterrorism concerns, the development of detection reagents, therapeutics and countermeasures are of urgent interest. Recently, we have developed a sensitive electrochemiluminescent (ECL) immunoassay for BoNT/B, using monoclonal antibodies (mAbs) MCS6-27 and anti-BoNT/B rabbit polyclonal antibodies as the capture and detector. The ECL assay detected as little as 1 pg/mL BoNT/B in the buffer matrix, surpassing the detection sensitivities of the gold standard mouse bioassays. The ECL assay also allowed detection of BoNT/B in sera matrices of up to 100% sera with negligible matrix effects. This highly-sensitive assay allowed the determination of the biological half-lives of BoNT/B holotoxin in vivo. We further tested the toxin neutralization potential of our monoclonal antibodies using the mouse systemic and oral intoxication models. A combination of mAbs protected mice in both pre- and post-exposure models to lethal doses of BoNT/B. MAbs were capable of increasing survival of animals when administered even 10 h post-intoxication in an oral model, suggesting a likely time for BoNT/B complexes to reach the blood stream. More sensitive detection assays and treatments against BoNT intoxication will greatly enhance efforts to combat botulism.

  3. Implementing the Bruker MALDI Biotyper in the Public Health Laboratory for C. botulinum Neurotoxin Detection

    Directory of Open Access Journals (Sweden)

    Michael J. Perry

    2017-03-01

    Full Text Available Currently, the gold standard method for active botulinum neurotoxin (BoNT detection is the mouse bioassay (MBA. A Centers for Disease Control and Prevention-developed mass spectrometry (MS-based assay that detects active BoNT was successfully validated and implemented in a public health laboratory in clinical matrices using the Bruker MALDI-TOF MS (Matrix-assisted laser desorption ionization–time of flight mass spectrometry Biotyper. For the first time, a direct comparison with the MBA was performed to determine MS-based assay sensitivity using the Bruker MALDI Biotyper. Mice were injected with BoNT/A, /B, /E, and /F at concentrations surrounding the established MS assay limit of detection (LOD and analyzed simultaneously. For BoNT/B, /E, and /F, MS assay sensitivity was equivalent or better than the MBA at 25, 0.3, and 8.8 mLD50, respectively. BoNT/A was detected by the MBA between 1.8 and 18 mLD50, somewhat more sensitive than the MS method of 18 mLD50. Studies were performed to compare assay performance in clinical specimens. For all tested specimens, the MS method rapidly detected BoNT activity and serotype in agreement with, or in the absence of, results from the MBA. We demonstrate that the MS assay can generate reliable, rapid results while eliminating the need for animal testing.

  4. Probiotic Microorganisms Inhibit Epithelial Cell Internalization of Botulinum Neurotoxin Serotype A

    Directory of Open Access Journals (Sweden)

    Tina I. Lam

    2016-12-01

    Full Text Available Botulinum neurotoxins (BoNTs are some of the most poisonous natural toxins known to man and are threats to public health and safety. Previous work from our laboratory showed that both BoNT serotype A complex and holotoxin can bind and transit through the intestinal epithelia to disseminate in the blood. The timing of BoNT/A toxin internalization was shown to be comparable in both the Caco-2 in vitro cell culture and in the oral mouse intoxication models. Probiotic microorganisms have been extensively studied for their beneficial effects in not only maintaining the normal gut mucosa but also protection from allergens, pathogens, and toxins. In this study, we evaluate whether probiotic microorganisms will block BoNT/A uptake in the in vitro cell culture system using Caco-2 cells. Several probiotics tested (Saccharomyces boulardii, Lactobacillus acidophilus, Lactobacillus rhamnosus LGG, and Lactobacillus reuteri blocked BoNT/A uptake in a dose-dependent manner whereas a non-probiotic strain of Escherichia coli did not. We also showed that inhibition of BoNT/A uptake was not due to the degradation of BoNT/A nor by sequestration of toxin via binding to probiotics. These results show for the first time that probiotic treatment can inhibit BoNT/A binding and internalization in vitro and may lead to the development of new therapies.

  5. Effect of botulinum neurotoxin treatment in the lateral spread monitoring of microvascular decompression for hemifacial spasm.

    Science.gov (United States)

    Habeych, Miguel E; Shah, Aalap C; Nikonow, Tara N; Balzer, Jeffrey R; Crammond, Donald J; Thirumala, Parthasarathy D; Kassam, Amin; Horowitz, Michael

    2011-10-01

    Botulinum neurotoxin (BtNtx) treatment for hemifacial spasm (HFS) prior to microvascular decompression (MVD) is hypothesized to be a factor in the variability of intraoperative neurophysiological monitoring (IONM) during this procedure. We analyzed 282 MVDs performed at the University of Pittsburgh Medical Center between January 1, 2000 and December 31, 2007. We retrospectively compared the lateral spread response (LSR) in the mentalis muscle when stimulus-triggered electromyography (EMG) was elicited from the facial nerve. Previous BtNtx treatment was the grouping factor. Baseline LSR amplitudes during MVD (prior BtNtx: mean = 341.47 μV; no BtNtx: mean = 241.81 μV) were significantly different between groups (df = 1,281; t = -2.463; P = 0.014). Comparisons of latency and current threshold at baseline, as well as HFS disappearance or LSR persistence after the procedure, did not achieve statistical significance. HFS patients treated with BtNtx prior to MVD demonstrated higher LSR baseline amplitudes during IONM. This could be related to muscle poly-reinnervation after recovery from repeated BtNtx use. Copyright © 2011 Wiley Periodicals, Inc.

  6. Iterative structure-based peptide-like inhibitor design against the botulinum neurotoxin serotype A.

    Directory of Open Access Journals (Sweden)

    Jorge E Zuniga

    Full Text Available The botulinum neurotoxin serotype A light chain (BoNT/A LC protease is the catalytic component responsible for the neuroparalysis that is characteristic of the disease state botulism. Three related peptide-like molecules (PLMs were designed using previous information from co-crystal structures, synthesized, and assayed for in vitro inhibition against BoNT/A LC. Our results indicate these PLMS are competitive inhibitors of the BoNT/A LC protease and their K(i values are in the nM-range. A co-crystal structure for one of these inhibitors was determined and reveals that the PLM, in accord with the goals of our design strategy, simultaneously involves both ionic interactions via its P1 residue and hydrophobic contacts by means of an aromatic group in the P2' position. The PLM adopts a helical conformation similar to previously determined co-crystal structures of PLMs, although there are also major differences to these other structures such as contacts with specific BoNT/A LC residues. Our structure further demonstrates the remarkable plasticity of the substrate binding cleft of the BoNT/A LC protease and provides a paradigm for iterative structure-based design and development of BoNT/A LC inhibitors.

  7. The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yanfeng; Varnum, Susan M.

    2012-03-01

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was found to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.

  8. Neutralization of botulinum neurotoxin by a human monoclonal antibody specific for the catalytic light chain.

    Directory of Open Access Journals (Sweden)

    Sharad P Adekar

    2008-08-01

    Full Text Available Botulinum neurotoxins (BoNT are a family of category A select bioterror agents and the most potent biological toxins known. Cloned antibody therapeutics hold considerable promise as BoNT therapeutics, but the therapeutic utility of antibodies that bind the BoNT light chain domain (LC, a metalloprotease that functions in the cytosol of cholinergic neurons, has not been thoroughly explored.We used an optimized hybridoma method to clone a fully human antibody specific for the LC of serotype A BoNT (BoNT/A. The 4LCA antibody demonstrated potent in vivo neutralization when administered alone and collaborated with an antibody specific for the HC. In Neuro-2a neuroblastoma cells, the 4LCA antibody prevented the cleavage of the BoNT/A proteolytic target, SNAP-25. Unlike an antibody specific for the HC, the 4LCA antibody did not block entry of BoNT/A into cultured cells. Instead, it was taken up into synaptic vesicles along with BoNT/A. The 4LCA antibody also directly inhibited BoNT/A catalytic activity in vitro.An antibody specific for the BoNT/A LC can potently inhibit BoNT/A in vivo and in vitro, using mechanisms not previously associated with BoNT-neutralizing antibodies. Antibodies specific for BoNT LC may be valuable components of an antibody antidote for BoNT exposure.

  9. Botulinum neurotoxin D uses synaptic vesicle protein SV2 and gangliosides as receptors.

    Directory of Open Access Journals (Sweden)

    Lisheng Peng

    2011-03-01

    Full Text Available Botulinum neurotoxins (BoNTs include seven bacterial toxins (BoNT/A-G that target presynaptic terminals and act as proteases cleaving proteins required for synaptic vesicle exocytosis. Here we identified synaptic vesicle protein SV2 as the protein receptor for BoNT/D. BoNT/D enters cultured hippocampal neurons via synaptic vesicle recycling and can bind SV2 in brain detergent extracts. BoNT/D failed to bind and enter neurons lacking SV2, which can be rescued by expressing one of the three SV2 isoforms (SV2A/B/C. Localization of SV2 on plasma membranes mediated BoNT/D binding in both neurons and HEK293 cells. Furthermore, chimeric receptors containing the binding sites for BoNT/A and E, two other BoNTs that use SV2 as receptors, failed to mediate the entry of BoNT/D suggesting that BoNT/D binds SV2 via a mechanism distinct from BoNT/A and E. Finally, we demonstrated that gangliosides are essential for the binding and entry of BoNT/D into neurons and for its toxicity in vivo, supporting a double-receptor model for this toxin.

  10. Lab-on-a-chip for botulinum neurotoxin a (BoNT-A) activity analysis.

    Science.gov (United States)

    Sun, Steven; Ossandon, Miguel; Kostov, Yordan; Rasooly, Avraham

    2009-11-21

    A Lab-on-a-chip (LOC) was designed, fabricated and tested for the in vitro detection of botulinum neurotoxin serotype A (BoNT-A) activity using an assay that measures cleavage of a fluorophore-tagged peptide substrate specific for BoNT-A (SNAP-25) by the toxin light chain (LcA). LcA cleavage was detected by Förster Resonance Energy Transfer (FRET) fluorescence. FRET fluorescence was measured by a newly developed portable charge-coupled device (CCD) fluorescent detector equipped with multi-wavelength light-emitting diodes (LED) illumination. An eight V-junction microchannel device for BoNTs activity assays was constructed using Laminated Object Manufacturing (LOM) technology. The six-layer device was fabricated with a Poly(methyl methacrylate (PMMA) core and five polycarbonate (PC) layers micromachined by CO2 laser. The LOC is operated by syringe and is equipped with reagents, sample wells, reaction wells, diffusion traps (to avoid cross contamination among channels) and waste reservoirs. The system was detected LcA at concentrations as low as 0.5 nM, which is the reported sensitivity of the SNAP-25 in vitro cleavage assay. Combined with our CCD detector, the simple point of care system enables the detection of BoNTs activity and may be useful for the performance of other complex medical assays without a laboratory. This approach may realize the potential to enhance the quality of health care delivery for underserved populations.

  11. Recommended Mass Spectrometry-Based Strategies to Identify Botulinum Neurotoxin-Containing Samples

    Directory of Open Access Journals (Sweden)

    Suzanne R. Kalb

    2015-05-01

    Full Text Available Botulinum neurotoxins (BoNTs cause the disease called botulism, which can be lethal. BoNTs are proteins secreted by some species of clostridia and are known to cause paralysis by interfering with nerve impulse transmission. Although the human lethal dose of BoNT is not accurately known, it is estimated to be between 0.1 μg to 70 μg, so it is important to enable detection of small amounts of these toxins. Our laboratory previously reported on the development of Endopep-MS, a mass-spectrometric‑based endopeptidase method to detect, differentiate, and quantify BoNT immunoaffinity purified from complex matrices. In this work, we describe the application of Endopep-MS for the analysis of thirteen blinded samples supplied as part of the EQuATox proficiency test. This method successfully identified the presence or absence of BoNT in all thirteen samples and was able to successfully differentiate the serotype of BoNT present in the samples, which included matrices such as buffer, milk, meat extract, and serum. Furthermore, the method yielded quantitative results which had z-scores in the range of −3 to +3 for quantification of BoNT/A containing samples. These results indicate that Endopep-MS is an excellent technique for detection, differentiation, and quantification of BoNT in complex matrices.

  12. Peptide inhibitors of botulinum neurotoxin serotype A: design, inhibition, cocrystal structures, structure-activity relationship and pharmacophore modeling

    Energy Technology Data Exchange (ETDEWEB)

    Kumar G.; Swaminathan S.; Kumaran, D.; Ahmed, S. A.

    2012-05-01

    Clostridium botulinum neurotoxins are classified as Category A bioterrorism agents by the Centers for Disease Control and Prevention (CDC). The seven serotypes (A-G) of the botulinum neurotoxin, the causative agent of the disease botulism, block neurotransmitter release by specifically cleaving one of the three SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptor) proteins and induce flaccid paralysis. Using a structure-based drug-design approach, a number of peptide inhibitors were designed and their inhibitory activity against botulinum serotype A (BoNT/A) protease was determined. The most potent peptide, RRGF, inhibited BoNT/A protease with an IC{sub 50} of 0.9 {micro}M and a K{sub i} of 358 nM. High-resolution crystal structures of various peptide inhibitors in complex with the BoNT/A protease domain were also determined. Based on the inhibitory activities and the atomic interactions deduced from the cocrystal structures, the structure-activity relationship was analyzed and a pharmacophore model was developed. Unlike the currently available models, this pharmacophore model is based on a number of enzyme-inhibitor peptide cocrystal structures and improved the existing models significantly, incorporating new features.

  13. Researchers unmask secret to long-lasting effects of botulinum neurotoxin A in motor neurons | Center for Cancer Research

    Science.gov (United States)

    A team of scientists led by the Center for Cancer Research's Allan M. Weissman, M.D., and Yien Che Tsai, Ph.D., has discovered a molecular mechanism that explains the extreme toxicity of botulinum neurotoxin A (BoNT/A), the most potent BoNT strain. The discovery, published June 5 in PNAS, also identifies a molecular target that the researchers hope will eventually lead to improved therapies to treat exposure and severely undermine the potential use of BoNTs as bioweapons.  Read more...  

  14. Rapid product analysis and increased sensitivity for quantitative determinations of botulinum neurotoxin proteolytic activity.

    Science.gov (United States)

    Rowe, Benjamin; Schmidt, James J; Smith, Leonard A; Ahmed, S Ashraf

    2010-01-15

    The ultimate molecular action of botulinum neurotoxin (BoNT) is a Zn-dependent endoproteolytic activity on one of the three SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptor) proteins. There are seven serotypes (A-G) of BoNT having distinct cleavage sites on the SNARE substrates. The proteolytic activity is located on the N-terminal light chain (Lc) domain and is used extensively as the primary target toward therapeutic development against botulism. Here we describe an improved method using ultra-performance liquid chromatography (UPLC) whereby quantitative data were obtained in 1/10th the time using 1/20th the sample and solvent volumes compared with a widely used high-performance liquid chromatography (HPLC) method. We also synthesized a VAMP (vesicle-associated membrane protein)-based peptide containing an intact V1 motif that was efficiently used as a substrate by BoNT/D Lc. Although serotype C1 cleaves the serotype A substrate at a bond separated by only one residue, we were able to distinguish the two reactions by UPLC. The new method can accurately quantify as low as 7 pmol of the peptide substrates for BoNT serotypes A, B, C1, and D. We also report here that the catalytic efficiency of serotype A can be stimulated 35-fold by the addition of Triton X-100 to the reaction mixture. Combining the use of Triton X-100 with the newly introduced UPLC method, we were able to accurately detect very low levels of proteolytic activity in a very short time. Sensitivity of the assay and accuracy and rapidity of product analysis should greatly augment efforts in therapeutic development.

  15. A camelid single-domain antibody neutralizes botulinum neurotoxin A by blocking host receptor binding

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Guorui; Lam, Kwok-ho; Weisemann, Jasmin; Peng, Lisheng; Krez, Nadja; Perry, Kay; Shoemaker, Charles B.; Dong, Min; Rummel, Andreas; Jin, Rongsheng (BCH); (Cornell); (Tufts CTSI); (UCI); (MHH)

    2017-08-07

    Antibody treatment is currently the only available countermeasure for botulism, a fatal illness caused by flaccid paralysis of muscles due to botulinum neurotoxin (BoNT) intoxication. Among the seven major serotypes of BoNT/A-G, BoNT/A poses the most serious threat to humans because of its high potency and long duration of action. Prior to entering neurons and blocking neurotransmitter release, BoNT/A recognizes motoneurons via a dual-receptor binding process in which it engages both the neuron surface polysialoganglioside (PSG) and synaptic vesicle glycoprotein 2 (SV2). Previously, we identified a potent neutralizing antitoxin against BoNT/A1 termed ciA-C2, derived from a camelid heavy-chain-only antibody (VHH). In this study, we demonstrate that ciA-C2 prevents BoNT/A1 intoxication by inhibiting its binding to neuronal receptor SV2. Furthermore, we determined the crystal structure of ciA-C2 in complex with the receptor-binding domain of BoNT/A1 (HCA1) at 1.68 Å resolution. The structure revealed that ciA-C2 partially occupies the SV2-binding site on HCA1, causing direct interference of HCA1 interaction with both the N-glycan and peptide-moiety of SV2. Interestingly, this neutralization mechanism is similar to that of a monoclonal antibody in clinical trials, despite that ciA-C2 is more than 10-times smaller. Taken together, these results enlighten our understanding of BoNT/A1 interactions with its neuronal receptor, and further demonstrate that inhibiting toxin binding to the host receptor is an efficient countermeasure strategy.

  16. Botulinum Neurotoxin Serotype C Associates with Dual Ganglioside Receptors to Facilitate Cell Entry*

    Science.gov (United States)

    Karalewitz, Andrew P.-A.; Fu, Zhuji; Baldwin, Michael R.; Kim, Jung-Ja P.; Barbieri, Joseph T.

    2012-01-01

    Botulinum neurotoxins (BoNTs) cleave SNARE proteins in motor neurons that inhibits synaptic vesicle (SV) exocytosis, resulting in flaccid paralysis. There are seven BoNT serotypes (A–G). In current models, BoNTs initially bind gangliosides on resting neurons and upon SV exocytosis associate with the luminal domains of SV-associated proteins as a second receptor. The entry of BoNT/C is less clear. Characterizing the heavy chain receptor binding domain (HCR), BoNT/C was shown to utilize gangliosides as dual host receptors. Crystallographic and biochemical studies showed that the two ganglioside binding sites, termed GBP2 and Sia-1, were independent and utilized unique mechanisms to bind complex gangliosides. The GBP2 binding site recognized gangliosides that contained a sia5 sialic acid, whereas the Sia-1 binding site recognized gangliosides that contained a sia7 sialic acid and sugars within the backbone of the ganglioside. Utilizing gangliosides that uniquely recognized the GBP2 and Sia-1 binding sites, HCR/C entry into Neuro-2A cells required both functional ganglioside binding sites. HCR/C entered cells differently than the HCR of tetanus toxin, which also utilizes dual gangliosides as host receptors. A point-mutated HCR/C that lacked GBP2 binding potential retained the ability to bind and enter Neuro-2A cells. This showed that ganglioside binding at the Sia-1 site was accessible on the plasma membrane, suggesting that SV exocytosis may not be required to expose BoNT/C receptors. These studies highlight the utility of BoNT HCRs as probes to study the role of gangliosides in neurotransmission. PMID:23027864

  17. Utilizing Ayurvedic literature for the identification of novel phytochemical inhibitors of botulinum neurotoxin A.

    Science.gov (United States)

    Yalamanchili, Chinni; Manda, Vamshi K; Chittiboyina, Amar G; Guernieri, Rebecca L; Harrell, William A; Webb, Robert P; Smith, Leonard A; Khan, Ikhlas A

    2017-02-02

    Ayurveda, an ancient holistic system of health care practiced on the Indian subcontinent, utilizes a number of multi-plant formulations and is considered by many as a potential source for novel treatments, as well as the identification of new drugs. Our aim is to identify novel phytochemicals for the inhibition of bacterial exotoxin, botulinum neurotoxin A (BoNT/A) based on Ayurvedic literature. BoNT/A is released by Clostridium species, which when ingested, inhibits the release of acetylcholine by concentrating at the neuromuscular junction and causes flaccid paralysis, resulting in a condition termed as botulism, and may also lead to death due to respiratory arrest. Fifteen plants were selected from the book 'Diagnosis and treatment of diseases in Ayurveda' by Vaidya Bhagwan Dash and Lalitesh Kashyap, based on their frequency of use in the formulations used for the treatment of six diseases with neuromuscular symptoms similar to botulism. Phytochemicals from these plants were screened using in silico, and in vitro methods. Structures of 570 reported phytochemicals from 14 plants were docked inside six reported BoNT/A light chain crystal structures using ensemble docking module in Maestro (Schrödinger, LLE). From the docking scores and structural diversity, nine compounds including acoric acid 1, three flavonoids, three coumarins derivatives, one kava lactone were selected and screened using an in vitro HPLC-based protease assay. The bioassay results showed that several compounds possess BoNT/A LC inhibition of 50-60% when compared to positive controls NSC 84094 and CB7967495 (80-95%). Further testing of the active compounds identified from Ayurvedic literature and structure-activity studies of acoric acid 1 using more sensitive bioassays is under way. The identification of acoric acid 1, a novel scaffold against BoNT/A, exemplifies the utility of Ayurvedic literature for the discovery of novel drug leads. Copyright © 2016 Elsevier Ireland Ltd. All rights

  18. Enhanced neutralization potency of botulinum neurotoxin antibodies using a red blood cell-targeting fusion protein.

    Directory of Open Access Journals (Sweden)

    Sharad P Adekar

    2011-03-01

    Full Text Available Botulinum neurotoxin (BoNT potently inhibits cholinergic signaling at the neuromuscular junction. The ideal countermeasures for BoNT exposure are monoclonal antibodies or BoNT antisera, which form BoNT-containing immune complexes that are rapidly cleared from the general circulation. Clearance of opsonized toxins may involve complement receptor-mediated immunoadherence to red blood cells (RBC in primates or to platelets in rodents. Methods of enhancing immunoadherence of BoNT-specific antibodies may increase their potency in vivo. We designed a novel fusion protein (FP to link biotinylated molecules to glycophorin A (GPA on the RBC surface. The FP consists of an scFv specific for murine GPA fused to streptavidin. FP:mAb:BoNT complexes bound specifically to the RBC surface in vitro. In a mouse model of BoNT neutralization, the FP increased the potency of single and double antibody combinations in BoNT neutralization. A combination of two antibodies with the FP gave complete neutralization of 5,000 LD50 BoNT in mice. Neutralization in vivo was dependent on biotinylation of both antibodies and correlated with a reduction of plasma BoNT levels. In a post-exposure model of intoxication, FP:mAb complexes gave complete protection from a lethal BoNT/A1 dose when administered within 2 hours of toxin exposure. In a pre-exposure prophylaxis model, mice were fully protected for 72 hours following administration of the FP:mAb complex. These results demonstrate that RBC-targeted immunoadherence through the FP is a potent enhancer of BoNT neutralization by antibodies in vivo.

  19. Widespread sequence variations in VAMP1 across vertebrates suggest a potential selective pressure from botulinum neurotoxins.

    Directory of Open Access Journals (Sweden)

    Lisheng Peng

    2014-07-01

    Full Text Available Botulinum neurotoxins (BoNT/A-G, the most potent toxins known, act by cleaving three SNARE proteins required for synaptic vesicle exocytosis. Previous studies on BoNTs have generally utilized the major SNARE homologues expressed in brain (VAMP2, syntaxin 1, and SNAP-25. However, BoNTs target peripheral motor neurons and cause death by paralyzing respiratory muscles such as the diaphragm. Here we report that VAMP1, but not VAMP2, is the SNARE homologue predominantly expressed in adult rodent diaphragm motor nerve terminals and in differentiated human motor neurons. In contrast to the highly conserved VAMP2, BoNT-resistant variations in VAMP1 are widespread across vertebrates. In particular, we identified a polymorphism at position 48 of VAMP1 in rats, which renders VAMP1 either resistant (I48 or sensitive (M48 to BoNT/D. Taking advantage of this finding, we showed that rat diaphragms with I48 in VAMP1 are insensitive to BoNT/D compared to rat diaphragms with M48 in VAMP1. This unique intra-species comparison establishes VAMP1 as a physiological toxin target in diaphragm motor nerve terminals, and demonstrates that the resistance of VAMP1 to BoNTs can underlie the insensitivity of a species to members of BoNTs. Consistently, human VAMP1 contains I48, which may explain why humans are insensitive to BoNT/D. Finally, we report that residue 48 of VAMP1 varies frequently between M and I across seventeen closely related primate species, suggesting a potential selective pressure from members of BoNTs for resistance in vertebrates.

  20. Solubility of the catalytic domains of Botulinum neurotoxin serotype E subtypes.

    Science.gov (United States)

    Chen, Sheng; Barbieri, Joseph T

    2016-02-01

    The Clostridium botulinum neurotoxins (BoNTs) are the most potent protein toxins known to humans. There are seven serotypes of the BoNTs (A-G), among which serotypes A, B, E and F are known to cause natural human intoxication. To date, eleven subtypes of LC/E, termed E1∼E11, have been identified. The LCs of BoNT/E were insoluble, prohibiting studies towards understanding the mechanisms of toxin action and substrate recognition. In this work, the molecular basis of insolubility of the recombinant LCs of two representative subtypes of BoNT/E, E1(Beluga) and E3 (Alaska), was determined. Hydrophobicity profile and structural modeling predicted a C-terminal candidate region responsible for the insolubility of LC/Es. Deletion of C-terminal 19 residues of LC/E(1-400) resulted in enhanced solubility, from 2 to ∼50% for LC/EAlaska and from 16 to ∼95% for LC/EBeluga. In addition, resides 230-236 were found to contribute to a different solubility level of LC/EAlaska when compared to LC/EBeluga. Substituting residues (230)TCI(232) in LC/EAlaska to the corresponding residues of (230)KYT(232) in LC/EBeluga enhanced the solubility of LC/EAlaska to a level approaching that of LC/EBeluga. Among these LC/Es and their derivatives, LC/EBeluga 1-400 was the most soluble and stable protein. Each LC/E derivative possessed similar catalytic activity, suggesting that the C-terminal region of LC/Es contributed to protein solubility, but not catalytic activity. In conclusion, this study generated a soluble and stable recombinant LC/E and provided insight into the structural components that govern the solubility and stability of the LCs of other BoNT serotypes and Tetanus toxin. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Toxic and nontoxic components of botulinum neurotoxin complex are evolved from a common ancestral zinc protein

    Energy Technology Data Exchange (ETDEWEB)

    Inui, Ken [Department of Food and Cosmetic Science, Faculty of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri 099-2493 (Japan); Japan Society for the Promotion of Science, 1-8 Chiyoda-ku, Tokyo 102-8472 (Japan); Sagane, Yoshimasa [Department of Food and Cosmetic Science, Faculty of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri 099-2493 (Japan); Miyata, Keita [Department of Food and Cosmetic Science, Faculty of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri 099-2493 (Japan); Japan Society for the Promotion of Science, 1-8 Chiyoda-ku, Tokyo 102-8472 (Japan); Miyashita, Shin-Ichiro [Department of Food and Cosmetic Science, Faculty of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri 099-2493 (Japan); Suzuki, Tomonori [Department of Bacteriology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, 2-5-1 Shikata-cho, Kita-ku, Okayama 700-8558 (Japan); Shikamori, Yasuyuki [Agilent Technologies International Japan, Ltd. Takaura-cho 9-1, Hachioji-shi, Tokyo 192-0033 (Japan); Ohyama, Tohru; Niwa, Koichi [Department of Food and Cosmetic Science, Faculty of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri 099-2493 (Japan); Watanabe, Toshihiro, E-mail: t-watana@bioindustry.nodai.ac.jp [Department of Food and Cosmetic Science, Faculty of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri 099-2493 (Japan)

    2012-03-16

    Highlights: Black-Right-Pointing-Pointer BoNT and NTNHA proteins share a similar protein architecture. Black-Right-Pointing-Pointer NTNHA and BoNT were both identified as zinc-binding proteins. Black-Right-Pointing-Pointer NTNHA does not have a classical HEXXH zinc-coordinating motif similar to that found in all serotypes of BoNT. Black-Right-Pointing-Pointer Homology modeling implied probable key residues involved in zinc coordination. -- Abstract: Zinc atoms play an essential role in a number of enzymes. Botulinum neurotoxin (BoNT), the most potent toxin known in nature, is a zinc-dependent endopeptidase. Here we identify the nontoxic nonhemagglutinin (NTNHA), one of the BoNT-complex constituents, as a zinc-binding protein, along with BoNT. A protein structure classification database search indicated that BoNT and NTNHA share a similar domain architecture, comprising a zinc-dependent metalloproteinase-like, BoNT coiled-coil motif and concanavalin A-like domains. Inductively coupled plasma-mass spectrometry analysis demonstrated that every single NTNHA molecule contains a single zinc atom. This is the first demonstration of a zinc atom in this protein, as far as we know. However, the NTNHA molecule does not possess any known zinc-coordinating motif, whereas all BoNT serotypes possess the classical HEXXH motif. Homology modeling of the NTNHA structure implied that a consensus K-C-L-I-K-X{sub 35}-D sequence common among all NTNHA serotype molecules appears to coordinate a single zinc atom. These findings lead us to propose that NTNHA and BoNT may have evolved distinct functional specializations following their branching out from a common ancestral zinc protein.

  2. Towards an international standard for detection and typing botulinum neurotoxin-producing Clostridia types A, B, E and F in food, feed and environmental samples: a European ring trial study to evaluate a real-time PCR assay.

    Science.gov (United States)

    Fenicia, Lucia; Fach, Patrick; van Rotterdam, Bart J; Anniballi, Fabrizio; Segerman, Bo; Auricchio, Bruna; Delibato, Elisabetta; Hamidjaja, Raditijo A; Wielinga, Peter R; Woudstra, Cedric; Agren, Joakim; De Medici, Dario; Knutsson, Rickard

    2011-03-01

    A real-time PCR method for detection and typing of BoNT-producing Clostridia types A, B, E, and F was developed on the framework of the European Research Project "Biotracer". A primary evaluation was carried out using 104 strains and 17 clinical and food samples linked to botulism cases. Results showed 100% relative accuracy, 100% relative sensitivity, 100% relative specificity, and 100% selectivity (inclusivity on 73 strains and exclusivity on 31 strains) of the real-time PCR against the reference cultural method combined with the standard mouse bioassay. Furthermore, a ring trial study performed at four different European laboratories in Italy, France, the Netherlands, and Sweden was carried out using 47 strains, and 30 clinical and food samples linked to botulism cases. Results showed a concordance of 95.7% among the four laboratories. The reproducibility generated a relative standard deviation in the range of 2.18% to 13.61%. Considering the high level of agreement achieved between the laboratories, this real-time PCR is a suitable method for rapid detection and typing of BoNT-producing Clostridia in clinical, food and environmental samples and thus support the use of it as an international standard method. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Genetically engineered red cells expressing single domain camelid antibodies confer long-term protection against botulinum neurotoxin.

    Science.gov (United States)

    Huang, Nai-Jia; Pishesha, Novalia; Mukherjee, Jean; Zhang, Sicai; Deshycka, Rhogerry; Sudaryo, Valentino; Dong, Min; Shoemaker, Charles B; Lodish, Harvey F

    2017-09-04

    A short half-life in the circulation limits the application of therapeutics such as single-domain antibodies (VHHs). We utilize red blood cells to prolong the circulatory half-life of VHHs. Here we present VHHs against botulinum neurotoxin A (BoNT/A) on the surface of red blood cells by expressing chimeric proteins of VHHs with Glycophorin A or Kell. Mice whose red blood cells carry the chimeric proteins exhibit resistance to 10,000 times the lethal dose (LD50) of BoNT/A, and transfusion of these red blood cells into naive mice affords protection for up to 28 days. We further utilize an improved CD34+ culture system to engineer human red blood cells that express these chimeric proteins. Mice transfused with these red blood cells are resistant to highly lethal doses of BoNT/A. We demonstrate that engineered red blood cells expressing VHHs can provide prolonged prophylactic protection against bacterial toxins without inducing inhibitory immune responses and illustrates the potentially broad translatability of our strategy for therapeutic applications.The therapeutic use of single-chain antibodies (VHHs) is limited by their short half-life in the circulation. Here the authors engineer mouse and human red blood cells to express VHHs against botulinum neurotoxin A (BoNT/A) on their surface and show that an infusion of these cells into mice confers long lasting protection against a high dose of BoNT/A.

  4. The ultimate radiochemical nightmare : upon radio-iodination of Botulinum neurotoxin A, the introduced iodine atom itself seems to be fatal for the bioactivity of this macromolecule

    NARCIS (Netherlands)

    Uhm, J.I.M. van; Visser, G.W.M.; Schans, M.J. van der; Geldof, A.A.; Meuleman, E.J.H.; Nieuwenhuijzen, J.A.

    2015-01-01

    Background: Botulinum neurotoxin A (BoNT-A) is a highly neurotoxic drug and frequently used in patients. Knowledge on the optimal way of administration of BoNT-A and its subsequent distribution is still rather limited. An accurate method for monitoring these processes might be the use of

  5. Safety and administration of treatment with botulinum neurotoxin for sialorrhoea in ALS patients: Review of the litterature and a proposal for tailored treatment

    DEFF Research Database (Denmark)

    Stokholm, Morten; Bisgård, Carsten; Vilholm, Ole Jakob

    2013-01-01

    Botulinum neurotoxin (BoNT) is a second-line treatment of sialorrhoea in ALS (amyotrophic lateral sclerosis) patients. This article is a review of the published literature concerning safety and administration of this treatment to ALS patients. A PubMed search was performed. All original...

  6. Negative effects of submandibular botulinum neurotoxin A injections on oral motor function in children with drooling due to central nervous system disorders

    NARCIS (Netherlands)

    Hulst, K. van; Kouwenberg, C.V.; Jongerius, P.H.; Feuth, T.; Hoogen, F.J.A. van den; Geurts, A.C.H.; Erasmus, C.E.

    2017-01-01

    AIM: The aims of this study were: (1) to determine the incidence and nature of adverse effects on oral motor function after first injections of botulinum neurotoxin A (BoNT-A) in submandibular glands for excessive drooling in children with central nervous system disorders; and (2) to identify

  7. Botulinum neurotoxin serotype D attacks neurons via two carbohydrate-binding sites in a ganglioside-dependent manner.

    Science.gov (United States)

    Strotmeier, Jasmin; Lee, Kwangkook; Völker, Anne K; Mahrhold, Stefan; Zong, Yinong; Zeiser, Johannes; Zhou, Jie; Pich, Andreas; Bigalke, Hans; Binz, Thomas; Rummel, Andreas; Jin, Rongsheng

    2010-10-15

    The extraordinarily high toxicity of botulinum neurotoxins primarily results from their specific binding and uptake into neurons. At motor neurons, the seven BoNT (botulinum neurotoxin) serotypes A-G inhibit acetylcholine release leading to flaccid paralysis. Uptake of BoNT/A, B, E, F and G requires a dual interaction with gangliosides and the synaptic vesicle proteins synaptotagmin or SV2 (synaptic vesicle glycoprotein 2), whereas little is known about the cell entry mechanisms of the serotypes C and D, which display the lowest amino acid sequence identity compared with the other five serotypes. In the present study we demonstrate that the neurotoxicity of BoNT/D depends on the presence of gangliosides by employing phrenic nerve hemidiaphragm preparations derived from mice expressing the gangliosides GM3, GM2, GM1 and GD1a, or only GM3 [a description of our use of ganglioside nomenclature is given in Svennerholm (1994) Prog. Brain Res. 101, XI-XIV]. High-resolution crystal structures of the 50 kDa cell-binding domain of BoNT/D alone and in complex with sialic acid, as well as biological analyses of single-site BoNT/D mutants identified two carbohydrate-binding sites. One site is located at a position previously identified in BoNT/A, B, E, F and G, but is lacking the conserved SXWY motif. The other site, co-ordinating one molecule of sialic acid, resembles the second ganglioside-binding pocket (the sialic-acid-binding site) of TeNT (tetanus neurotoxin).

  8. Clostridium botulinum serotype D neurotoxin and toxin complex bind to bovine aortic endothelial cells via sialic acid.

    Science.gov (United States)

    Yoneyama, Tohru; Miyata, Keita; Chikai, Tomoyuki; Mikami, Akifumi; Suzuki, Tomonori; Hasegawa, Kimiko; Ikeda, Toshihiko; Watanabe, Toshihiro; Ohyama, Tohru; Niwa, Koichi

    2008-12-01

    Botulinum neurotoxin (BoNT) is produced as a large toxin complex (L-TC) associated with nontoxic nonhemagglutinin (NTNHA) and three hemagglutinin subcomponents (HA-70, -33 and -17). The binding properties of BoNT to neurons and L-TC to intestinal epithelial cells are well documented, while those to other tissues are largely unknown. Here, to obtain novel insights into the pathogenesis of foodborne botulism, we examine whether botulinum toxins bind to vascular endothelial cells. BoNT and 750 kDa L-TC (a complex of BoNT, NTNHA and HAs) of Clostridium botulinum serotype D were incubated with bovine aortic endothelial cells (BAECs), and binding to the cells was assessed using sodium dodecyl sulfate polyacrylamide gel electrophoresis and Western blot. Both BoNT and L-TC bound to BAECs, with L-TC showing stronger binding. Binding of BoNT and L-TC to BAECs was significantly inhibited by N-acetyl neuraminic acid in the cell culture medium or by treatment of the cells with neuraminidase. However, galactose, lactose or N-acetyl galactosamine did not significantly inhibit toxin binding to the cells. This is the first report demonstrating that BoNT and L-TC bind to BAECs via sialic acid, and this mechanism may be important in the trafficking pathway of BoNT in foodborne botulism.

  9. No Decrease in Muscle Strength after Botulinum Neurotoxin-A Injection in Children with Cerebral Palsy

    Science.gov (United States)

    Eek, Meta N.; Himmelmann, Kate

    2016-01-01

    Spasticity and muscle weakness is common in children with cerebral palsy (CP). Spasticity can be treated with botulinum neurotoxin-A (BoNT-A), but this drug has also been reported to induce muscle weakness. Our purpose was to describe the effect on muscle strength in the lower extremities after BoNT-A injections in children with CP. A secondary aim was to relate the effect of BoNT-A to gait pattern and range of motion. Twenty children with spastic CP were included in the study, 8 girls and 12 boys (mean age 7.7 years). All were able to walk without support, but with increased muscle tone interfering with motor function and gait pattern. Sixteen children had unilateral spastic CP and four bilateral spastic CP. Twenty-four legs received injections with BoNT-A in the plantar flexor muscles. The children were tested before treatment, around 6 weeks after at the peak effect of BoNT-A, and at 6 months after treatment, with measurement of muscle strength, gait analysis, and range of motion. There were no differences in muscle strength in plantar flexors of treated legs at peak effect compared to baseline. Six months after treatment, there was still no change in untreated plantar flexor muscles, but an increasing trend in plantar flexor strength in legs treated with BoNT-A. Parents reported positive effects in all children, graded as: small in three children, moderate in eight, and large in nine children. The gait analysis showed a small improvement in knee extension at initial contact, and there was a small increase in passive range of motion for ankle dorsiflexion. Two children had a period with transient weakness and pain. We found that voluntary force production in plantar flexor muscles did not decrease after BoNT-A, instead there was a trend to increased muscle strength at follow-up. The increase may be explained as an effect of the blocking of involuntary nerve impulses, leading to an opportunity to using and training the muscles with voluntary control. Adequate

  10. Glycosylated SV2 and Gangliosides as Dual Receptors for Botulinum Neurotoxin Serotype F

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Zhuji; Chen, Chen; Barbieri, Joseph T.; Kim, Jung-Ja P.; Baldwin, Michael R.; (MCW)

    2010-02-22

    Botulinum neurotoxin causes rapid flaccid paralysis through the inhibition of acetylcholine release at the neuromuscular junction. The seven BoNT serotypes (A-G) have been proposed to bind motor neurons via ganglioside-protein dual receptors. To date, the structure-function properties of BoNT/F host receptor interactions have not been resolved. Here, we report the crystal structures of the receptor binding domains (HCR) of BoNT/A and BoNT/F and the characterization of the dual receptors for BoNT/F. The overall polypeptide fold of HCR/A is essentially identical to the receptor binding domain of the BoNT/A holotoxin, and the structure of HCR/F is very similar to that of HCR/A, except for two regions implicated in neuronal binding. Solid phase array analysis identified two HCR/F binding glycans: ganglioside GD1a and oligosaccharides containing an N-acetyllactosamine core. Using affinity chromatography, HCR/F bound native synaptic vesicle glycoproteins as part of a protein complex. Deglycosylation of glycoproteins using {alpha}(1-3,4)-fucosidase, endo-{beta}-galactosidase, and PNGase F disrupted the interaction with HCR/F, while the binding of HCR/B to its cognate receptor, synaptotagmin I, was unaffected. These data indicate that the HCR/F binds synaptic vesicle glycoproteins through the keratan sulfate moiety of SV2. The interaction of HCR/F with gangliosides was also investigated. HCR/F bound specifically to gangliosides that contain {alpha}2,3-linked sialic acid on the terminal galactose of a neutral saccharide core (binding order GT1b = GD1a GM3; no binding to GD1b and GM1a). Mutations within the putative ganglioside binding pocket of HCR/F decreased binding to gangliosides, synaptic vesicle protein complexes, and primary rat hippocampal neurons. Thus, BoNT/F neuronal discrimination involves the recognition of ganglioside and protein (glycosylated SV2) carbohydrate moieties, providing a structural basis for the high affinity and specificity of BoNT/F for neurons.

  11. Development of Germline-Humanized Antibodies Neutralizing Botulinum Neurotoxin A and B.

    Directory of Open Access Journals (Sweden)

    Sebastian Miethe

    Full Text Available Botulinum neurotoxins (BoNTs are counted among the most toxic substances known and are responsible for human botulism, a life-threatening disease characterized by flaccid muscle paralysis that occurs naturally by food poisoning or colonization of the gastrointestinal tract by BoNT-producing clostridia. To date, 7 serologically distinct serotypes of BoNT (serotype A-G are known. Due to the high toxicity of BoNTs the Centers for Disease Control and Prevention (CDC have classified BoNTs as category A agent, including the six biological agents with the highest potential risk of use as bioweapons. Well tolerated antibodies neutralizing BoNTs are required to deal with the potential risk. In a previous work, we described the development of scFv and scFv-Fc (Yumab from macaque origin (Macaca fascicularis neutralizing BoNT/A and B by targeting the heavy and light chain of each serotype. In the present study, we humanized the macaque antibodies SEM120-IIIC1 (anti-BoNT/A light chain, A1HC38 (anti-BoNT/A heavy chain, BLC3 (anti-BoNT/B light chain and B2-7 (anti-BoNT/B heavy chain by germline-humanization to obtain a better potential immunotolerance in humans. We increased the Germinality Index (GI of SEM120-IIIC1 to 94.5%, for A1HC38, to 95% for BLC3 and to 94.4% for B2-7. Furthermore, the neutralization efficacies of the germline-humanized antibodies were analyzed in lethal and non-lethal in vivo mouse assays as full IgG. The germline-humanized IgGs hu8SEM120-IIIC1, hu8A1HC38, hu8BLC3 and hu8B2-7 were protective in vivo, when anti-heavy and anti-light chain antibodies were combined. The synergistic effect and high humanness of the selected IgGs makes them promising lead candidates for further clinical development.

  12. NO DECREASE IN MUSCLE STRENGTH AFTER BOTULINUM NEUROTOXIN-A INJECTION IN CHILDREN WITH CEREBRAL PALSY

    Directory of Open Access Journals (Sweden)

    Meta Nyström Eek

    2016-10-01

    Full Text Available Spasticity and muscle weakness is common in children with cerebral palsy (CP. Spasticity can be treated with Botulinum Neurotoxin-A (BoNT-A, but this drug has also been reported to induce muscle weakness. Our purpose was to describe the effect on muscle strength in the lower extremities after BoNT-A injections in children with cerebral palsy. A secondary aim was to relate the effect of BoNT-A to gait pattern and range of motion.Twenty children with spastic cerebral palsy were included in the study, eight girls and 12 boys (mean age 7.7 years. All were able to walk without support, but with increased muscle tone interfering with motor function and gait pattern. Sixteen children had unilateral spastic CP and four bilateral spastic CP. Twenty-four legs received injections with BoNT-A in the plantar flexor muscles. The children were tested before treatment, around six weeks after at the peak effect of BoNT-A, and at six months after treatment, with measurement of muscle strength, gait analysis and range of motion.There were no differences in muscle strength in plantar flexors of treated legs at peak effect compared to baseline. Six months after treatment, there was still no change in untreated plantar flexor muscles, but an increasing trend in plantar flexor strength in legs treated with BoNT-A. Parents reported positive effects in all children, graded as: small in three children, moderate in eight, and large in nine children. The gait analysis showed a small improvement in knee extension at initial contact, and there was a small increase in passive range of motion for ankle dorsiflexion. Two children had a period with transient weakness and pain.We found that voluntary force production in plantar flexor muscles did not decrease after BoNT-A, instead there was a trend to increased muscle strength at follow-up. The increase may be explained as an effect of the blocking of involuntary nerve impulses, leading to an opportunity to using and training the

  13. Structural And Biochemical Studies of Botulinum Neurotoxin Serotype C1 Light Chain Protease: Implications for Dual Substrate Specificity

    Energy Technology Data Exchange (ETDEWEB)

    Jin, R.; Sikorra, S.; Stegmann, C.M.; Pich, A.; Binz, T.; Brunger, A.T.

    2009-06-01

    Clostridial neurotoxins are the causative agents of the neuroparalytic disease botulism and tetanus. They block neurotransmitter release through specific proteolysis of one of the three soluble N-ethylmaleimide-sensitive-factor attachment protein receptors (SNAREs) SNAP-25, syntaxin, and synaptobrevin, which constitute part of the synaptic vesicle fusion machinery. The catalytic component of the clostridial neurotoxins is their light chain (LC), a Zn2+ endopeptidase. There are seven structurally and functionally related botulinum neurotoxins (BoNTs), termed serotype A to G, and tetanus neurotoxin (TeNT). Each of them exhibits unique specificity for their target SNAREs and peptide bond(s) they cleave. The mechanisms of action for substrate recognition and target cleavage are largely unknown. Here, we report structural and biochemical studies of BoNT/C1-LC, which is unique among BoNTs in that it exhibits dual specificity toward both syntaxin and SNAP-25. A distinct pocket (S1') near the active site likely achieves the correct register for the cleavage site by only allowing Ala as the P1' residue for both SNAP-25 and syntaxin. Mutations of this SNAP-25 residue dramatically reduce enzymatic activity. The remote a-exosite that was previously identified in the complex of BoNT/A-LC and SNAP-25 is structurally conserved in BoNT/C1. However, mutagenesis experiments show that the a-exosite of BoNT/C1 plays a less stringent role in substrate discrimination in comparison to that of BoNT/A, which could account for its dual substrate specificity.

  14. The innovative therapeutic application of botulinum toxin type A in urology patients

    Directory of Open Access Journals (Sweden)

    Chrysoula Belai

    2016-06-01

    Full Text Available In the history of medical science the use of botulinum toxin was impressive. In the early 18th century it was defined as the neurotoxin implicated in the deadly disease botulism. Today, despite the toxic action finds application in the treatment of various diseases in a wide range of Medicine. Its use in urology was revolutionary in the treatment of neurogenic bladder, refractory idiopathic detrusor overactivity and other painful syndromes. The purpose of this review was to describe the treatment option of intravesical injection of botulinum toxin, in diseases of the urinary tract. The review showed that after many test applications under the experimental studies, the botulinum toxin type A has already established itself as the new treatment of choice after failure of conservative drug dealing in patients with neuro-urological symptoms of lower urinary tract. Cases of application of botulinum toxin in Urology are related to overactive bladder, neurogenic or idiopathic etiology, as bladder pain syndrome and chronic pelvic pain syndrome. According to the guidelines of the European Union directives Urology, the intravesical botulinum toxin injections are the most effective, minimally invasive treatment which results in reducing neurogenic hyperactivity of detrusor. In conclusion, this is a safe, easy and effective method that can be applied by health professionals, helping improve patients’ quality of life with neuro-urological diseases.

  15. USE OF BOTULINUM TOXIN TYPE A IN THE TREATMENT OF SPASTICITY IN CHILDREN WITH CEREBRAL PALSY

    Directory of Open Access Journals (Sweden)

    Ljiljana Lazić

    2011-06-01

    Full Text Available Cerebral palsy has an incidence of about 1-2 per 1000 live births, and in spite of the progress of neonatal medicine, it seems that the incidence will not subside in the near future. The most important characteristic of cerebral palsy is movement abnormality: spasticity, chorea, athetosis, ataxia, dystonia, as well as their different combinations. About 70% of children who suffer from cerebral palsy also suffer from some form of spasticity. Spasticity is a type of muscle hypertonicity characterized by rapid increase in resistance to passive stretching of muscles. The interest for botulinum toxin application in the treatment of spasticity has dramatically increased in the last 10 years. Botulinum toxin is the most powerful neurotoxin that is found in nature. It is produced by anaerobic bacteria – clostridium botulinum. It is produced in eight serotypes of which type A is the most commonly used. Botulinum toxin blocks neuromuscular transmission and causes irreversible weakness of the treated muscle. It has been used since 1993 in the treatment of cerebral palsy in children. The toxin effect is permanent and it results in irreversible denervation. Functional recovery is possible after 2-4 months, due to sprouting of nerve endings and the formation of new synaptic contacts. Treatment with botulinum toxin is safe. Adverse effects are rare, temporary and completely reversible. Application of botulinum toxin prevents or reduces contractures and deformities, and thus delays or avoids surgical treatment. Yet, physical therapy, which prolongs and improves the effects of botulinum toxin, remains an essential and most important form of therapy in the treatment of children with cerebral palsy.

  16. PCR for detection of Clostridium botulinum type C in avian and environmental samples.

    Science.gov (United States)

    Franciosa, G; Fenicia, L; Caldiani, C; Aureli, P

    1996-04-01

    A PCR was developed and applied for the detection of Clostridium botulinum type C in 18 avian and environmental samples collected during an outbreak of avian botulism, and the results were compared with those obtained by conventional methodologies based on the mouse bioassay. PCR and mouse bioassay results compared well (100%) after the enrichment of samples, but PCR results directly indicated the presence of this microorganism in six samples, while only one of these contained the type C botulinal neurotoxin before enrichment. The PCR assay was sensitive (limit of detection between 15 and 15 x 10(3) spores per PCR), specific (no amplification products were obtained with other clostridia), and rapid, since sonicated and heated samples provided enough template for amplification without any DNA purification. Eleven isolates of C. botulinum type C were recovered from mallards (Anas platyrhynchos), grey herons (Ardea cinerea), and mud during investigation of this outbreak.

  17. Botulinum Neurotoxin A injections influence stretching of the gastrocnemius muscle-tendon unit in an animal model.

    Science.gov (United States)

    Haubruck, Patrick; Mannava, Sandeep; Plate, Johannes F; Callahan, Michael F; Wiggins, Walter F; Schmidmaier, Gerhard; Tuohy, Christopher J; Saul, Katherine R; Smith, Thomas L

    2012-08-01

    Botulinum Neurotoxin A (BoNT-A) injections have been used for the treatment of muscle contractures and spasticity. This study assessed the influence of (BoNT-A) injections on passive biomechanical properties of the muscle-tendon unit. Mousegastrocnemius muscle (GC) was injected with BoNT-A (n = 18) or normal saline (n = 18) and passive, non-destructive, in vivo load relaxation experimentation was performed to examine how the muscle-tendon unit behaves after chemical denervation with BoNT-A. Injection of BoNT-A impaired passive muscle recovery (15% vs. 35% recovery to pre-stretching baseline, p stretch reflex; thereby modulating in vivo passive muscle properties. However, it is also possible that BoNT-A injection may alter the structure of skeletal muscle; thus modulating the in vivo passive biomechanical properties of the muscle-tendon unit.

  18. Detection of botulinum neurotoxin serotype B at sub mouse LD(50 levels by a sandwich immunoassay and its application to toxin detection in milk.

    Directory of Open Access Journals (Sweden)

    Miles C Scotcher

    2010-06-01

    Full Text Available Botulinum neurotoxin (BoNT, the causative agent of botulism, a serious neuroparylatic disease, is produced by the anaerobic bacterium Clostridium botulinum and consists of a family of seven serotypes (A-H. We previously reported production of high-affinity monoclonal antibodies to BoNT serotype A.Recombinant peptide fragments of the light chain, the transmembrane and receptor-binding domains of the heavy chain of botulinum neurotoxin type B (BoNT/B were expressed in Escherichia coli as GST-fusion proteins and purified. These proteins were used to immunize BALB/cJ mice for the generation of monoclonal antibodies (mAbs. Antibody-producing hybridomas were detected using either a direct binding ELISA binding to plate-immobilized BoNT/B, or with a capture-capture ELISA whereby the capacity of the antibody to capture BoNT/B from solution was tested. A total of five mAbs were selected, two of which bound the toxin light chain and three bound the receptor-binding domain of BoNT/B heavy chain. MAb MCS6-27 was identified via capture-capture ELISA and was the only mAb able to bind BoNT/B in solution under physiological conditions. MAbs F24-1, F26-16, F27-33 and F29-40 were identified via direct binding ELISA, and were able to capture BoNT/B in solution only in the presence of 0.5-0.9 mM sodium dodecyl sulphate (SDS. MAb MCS6-27 and an anti-BoNT/B polyclonal antibody were incorporated into a sandwich ELISA that did not require SDS.We report here the generation of monoclonal antibodies to serotype B and the subsequent development of a sensitive sandwich immunoassay. This immunoassay has a detection limit of 100 fg BoNT/B, fifty times more sensitive than the mouse bioassay detection limit of 5 pg BoNT/B. Additionally, this assay detected as little as 39 pg/mL of toxin in skim, 2% and whole milk.

  19. Augmentation of VAMP-catalytic activity of botulinum neurotoxin serotype B does not result in increased potency in physiological systems.

    Science.gov (United States)

    Elliott, Mark; Maignel, Jacquie; Liu, Sai Man; Favre-Guilmard, Christine; Mir, Imran; Farrow, Paul; Hornby, Fraser; Marlin, Sandra; Palan, Shilpa; Beard, Matthew; Krupp, Johannes

    2017-01-01

    Botulinum neurotoxins (BoNTs) are used extensively as therapeutic agents. Serotypes A and B are available as marketed products. Higher doses of BoNT/B are required to reach an efficacy similar to that of products containing BoNT/A. Advances in our understanding of BoNT/B mechanism of action have afforded the opportunity to make rational modifications to the toxin aimed at increasing its activity. Recently, a mutation in the light chain of BoNT/B (S201P) was described that increases the catalytic activity of the isolated BoNT/B light chain in biochemical assays. In this study, we have produced two full-length recombinant BoNT/B toxins in E.coli-one wild type (rBoNT/B1) and one incorporating the S201P mutation (rBoNT/B1(S201P)). We have compared the activity of these two molecules along with a native BoNT/B1 in biochemical cell-free assays and in several biological systems. In the cell-free assay, which measured light-chain activity alone, rBoNT/B1(S201P) cleaved VAMP-2 and VAMP-1 substrate with an activity 3-4-fold higher than rBoNT/B1. However, despite the enhanced catalytic activity of rBoNT/B1(S201P), there was no significant difference in potency between the two molecules in any of the in vitro cell-based assays, using either rodent spinal cord neurons or cortical neurons. Similarly in ex vivo tissue preparations rBoNT/B1(S201P) was not significantly more potent than rBoNT/B1 at inhibiting either diaphragm or detrusor (bladder) muscle activity in C57BL/6N and CD1 mice. Finally, no differences between rBoNT/B1 and rBoNT/B1(S201P) were observed in an in vivo digit abduction score (DAS) assay in C57BL/6N mice, either in efficacy or safety parameters. The lack of translation from the enhanced BoNT/B1(S201P) catalytic activity to potency in complex biological systems suggests that the catalytic step is not the rate-limiting factor for BoNT/B to reach maximum efficacy. In order to augment the efficacy of BoNT/B in humans, strategies other than enhancing light chain

  20. Assessment: Botulinum neurotoxin for the treatment of spasticity (an evidence-based review): report of the Therapeutics and Technology Assessment Subcommittee of the American Academy of Neurology.

    Science.gov (United States)

    Simpson, D M; Gracies, J-M; Graham, H K; Miyasaki, J M; Naumann, M; Russman, B; Simpson, L L; So, Y

    2008-05-06

    To perform an evidence-based review of the safety and efficacy of botulinum neurotoxin (BoNT) in the treatment of adult and childhood spasticity. A literature search was performed including MEDLINE and Current Contents for therapeutic articles relevant to BoNT and spasticity. Authors reviewed, abstracted, and classified articles based on American Academy of Neurology criteria (Class I-IV). The highest quality literature available for the respective indications was as follows: adult spasticity (14 Class I studies); spastic equinus and adductor spasticity in pediatric cerebral palsy (six Class I studies). Botulinum neurotoxin should be offered as a treatment option for the treatment of spasticity in adults and children (Level A).

  1. Structural Studies on Intact Clostridium botulinum Neurotoxins Complexed with Inhibitors Leading to Drug Design

    Science.gov (United States)

    2007-02-01

    instructions. Fractions containing recombinant proteins were dialysed against toxin assay buffer (150 mM KC glutamate, 10 mM Hepes- KOH, pH 7.2...Neurotoxin B Substrate Requirements 581Biosciences, Freiburg, Germany) or Ni2C-nitrilotriacetic acid-agarose beads and finally dialysed against 10 mM

  2. Novel Treatments for Botulism: Development of Antagonists for Identified Steps in the Action of Botulinum Neurotoxins

    Science.gov (United States)

    1991-09-20

    S tL. 1991). Collectively, this pattern of results strengthens the highly sought-after prospect for neuronal targetting of BoNT-neutralising...8217Biochemical structure and action of the botulinum toxin molecule..’ First European Conference on Spastic Dysphonia, London, U.K. Dolly, J.0. (1991

  3. The analgesic effect on neuropathic pain of retrogradely transported botulinum neurotoxin A involves Schwann cells and astrocytes.

    Directory of Open Access Journals (Sweden)

    Sara Marinelli

    Full Text Available In recent years a growing debate is about whether botulinum neurotoxins are retrogradely transported from the site of injection. Immunodetection of cleaved SNAP-25 (cl-SNAP-25, the protein of the SNARE complex targeted by botulinum neurotoxin serotype A (BoNT/A, could represent an excellent approach to investigate the mechanism of action on the nociceptive pathways at peripheral and/or central level. After peripheral administration of BoNT/A, we analyzed the expression of cl-SNAP-25, from the hindpaw's nerve endings to the spinal cord, together with the behavioral effects on neuropathic pain. We used the chronic constriction injury of the sciatic nerve in CD1 mice as animal model of neuropathic pain. We evaluated immunostaining of cl-SNAP-25 in the peripheral nerve endings, along the sciatic nerve, in dorsal root ganglia and in spinal dorsal horns after intraplantar injection of saline or BoNT/A, alone or colocalized with either glial fibrillar acidic protein, GFAP, or complement receptor 3/cluster of differentiation 11b, CD11b, or neuronal nuclei, NeuN, depending on the area investigated. Immunofluorescence analysis shows the presence of the cl-SNAP-25 in all tissues examined, from the peripheral endings to the spinal cord, suggesting a retrograde transport of BoNT/A. Moreover, we performed in vitro experiments to ascertain if BoNT/A was able to interact with the proliferative state of Schwann cells (SC. We found that BoNT/A modulates the proliferation of SC and inhibits the acetylcholine release from SC, evidencing a new biological effect of the toxin and further supporting the retrograde transport of the toxin along the nerve and its ability to influence regenerative processes. The present results strongly sustain a combinatorial action at peripheral and central neural levels and encourage the use of BoNT/A for the pathological pain conditions difficult to treat in clinical practice and dramatically impairing patients' quality of life.

  4. Onset Dynamics of Type A Botulinum Neurotoxin-Induced Paralysis

    National Research Council Canada - National Science Library

    Lebeda, Frank J; Adler, Michael; Erickson, Keith; Chushak, Yaroslav

    2008-01-01

    .... We tested the hypothesis that mathematical models having a minimal number of reactions and reactants can simulate published data concerning the onset of paralysis of skeletal muscles induced by BoNT...

  5. Attomolar detection of botulinum toxin type A in complex biological matrices.

    Directory of Open Access Journals (Sweden)

    Karine Bagramyan

    Full Text Available BACKGROUND: A highly sensitive, rapid and cost efficient method that can detect active botulinum neurotoxin (BoNT in complex biological samples such as foods or serum is desired in order to 1 counter the potential bioterrorist threat 2 enhance food safety 3 enable future pharmacokinetic studies in medical applications that utilize BoNTs. METHODOLOGY/PRINCIPAL FINDINGS: Here we describe a botulinum neurotoxin serotype A assay with a large immuno-sorbent surface area (BoNT/A ALISSA that captures a low number of toxin molecules and measures their intrinsic metalloprotease activity with a fluorogenic substrate. In direct comparison with the "gold standard" mouse bioassay, the ALISSA is four to five orders of magnitudes more sensitive and considerably faster. Our method reaches attomolar sensitivities in serum, milk, carrot juice, and in the diluent fluid used in the mouse assay. ALISSA has high specificity for the targeted type A toxin when tested against alternative proteases including other BoNT serotypes and trypsin, and it detects the holotoxin as well as the multi-protein complex form of BoNT/A. The assay was optimized for temperature, substrate concentration, size and volume proportions of the immuno-sorbent matrix, enrichment and reaction times. Finally, a kinetic model is presented that is consistent with the observed improvement in sensitivity. CONCLUSIONS/SIGNIFICANCE: The sensitivity, specificity, speed and simplicity of the BoNT ALISSA should make this method attractive for diagnostic, biodefense and pharmacological applications.

  6. Cosmetic use of botulinum toxin type A in the elderly

    Directory of Open Access Journals (Sweden)

    Christine M Cheng

    2007-04-01

    Full Text Available Christine M ChengDepartment of Clinical Pharmacy, University of California, San Francisco, CA, USAAbstract: Botulinum toxin type A injections are one of the most popular cosmetic procedures for diminishing the appearance of facial lines caused by habitual facial muscle contractions. Although the manufacturer’s labeling recommends botulinum toxin only for the treatment of glabellar lines among adults younger than 65 years of age, there is widespread use of the toxin for other cosmetic purposes and for patients who may be older than 65. Evidence-based safety and efficacy data on botulinum toxin use in elderly patients is limited. However, given the age-related skin changes and multifactorial causes of wrinkles in the elderly, as well as the higher risk for potential side effects due to concomitant diseases and medications, a careful risk-benefit assessment should precede the decision to use botulinum toxin in the elderly patient.Keywords: Botox Cosmetic, botulinum toxin, facial wrinkles, aging

  7. Botulinum neurotoxin: Progress in negating its neurotoxicity; and in extending its therapeutic utility via molecular engineering. MiniReview.

    Science.gov (United States)

    Kostrzewa, Richard M; Kostrzewa, Rose Anna; Kostrzewa, John P

    2015-10-01

    While the poisonous effects of botulinum neurotoxin (BoNT) have been recognized since antiquity, the overall actions and mechanisms of effects of BoNT have been elucidated primarily over the past several decades. The general utility of BoNT is described in the paper, but the focus is mainly on the approaches towards negating the toxic effects of BoNT, and on the projection of an engineered BoNT molecule serving as a Trojan Horse to deliver a therapeutic load for treatment of a host of medical disorders. The BoNT molecule is configured with a binding domain, a zinc-dependent protease with specificity primarily for vesicular proteins, and a translocation domain for delivery of the metalloprotease into the cytoplasm. The anti-toxin approaches for BoNT include the use of vaccines, antibodies, block of BoNT binding or translocation, inhibition of metalloprotease activity, impeded translocation of the protease/catalytic domain, and inhibition of the downstream Src signaling pathway. Projections of BoNT as a therapeutic include its targeting to non-cholinergic nerves, also targeting to non-neuronal cells for treatment of hypersecretory disorders (e.g., cystic fibrosis), and treatment of hormonal disorders (e.g., acromegaly). Still in the exploratory phase, there is the expectation of major advances in BoNT neuroprotective strategies and burgeoning utility of engineered BoNTs as therapeutics. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival

    Science.gov (United States)

    Peng, Lisheng; Liu, Huisheng; Ruan, Hongyu; Tepp, William H.; Stoothoff, William H.; Brown, Robert H.; Johnson, Eric A.; Yao, Wei-Dong; Zhang, Su-Chun; Dong, Min

    2014-01-01

    Botulinum neurotoxins (BoNT/A-G) are well-known to act by blocking synaptic vesicle exocytosis. Whether BoNTs disrupt additional neuronal functions has not been addressed. Here we report that cleavage of syntaxin 1 (Syx 1) by BoNT/C and cleavage of SNAP-25 by BoNT/E both induce degeneration of cultured rodent and human neurons. Furthermore, although SNAP-25 cleaved by BoNT/A can still support neuron survival, it has reduced capacity to tolerate additional mutations and also fails to pair with syntaxin isoforms other than Syx 1. Syx 1 and SNAP-25 are well-known for mediating synaptic vesicle exocytosis, but we found that neuronal death is due to blockage of plasma membrane recycling processes that share Syx 1/SNAP-25 for exocytosis, independent of blockage of synaptic vesicle exocytosis. These findings reveal neuronal cytotoxicity for a subset of BoNTs and directly link Syx 1/SNAP-25 to neuron survival as the prevalent SNARE proteins mediating multiple fusion events on neuronal plasma membranes. PMID:23403573

  9. Qualitative and Quantitative Detection of Botulinum Neurotoxins from Complex Matrices: Results of the First International Proficiency Test

    Directory of Open Access Journals (Sweden)

    Sylvia Worbs

    2015-11-01

    Full Text Available In the framework of the EU project EQuATox, a first international proficiency test (PT on the detection and quantification of botulinum neurotoxins (BoNT was conducted. Sample materials included BoNT serotypes A, B and E spiked into buffer, milk, meat extract and serum. Different methods were applied by the participants combining different principles of detection, identification and quantification. Based on qualitative assays, 95% of all results reported were correct. Successful strategies for BoNT detection were based on a combination of complementary immunological, MS-based and functional methods or on suitable functional in vivo/in vitro approaches (mouse bioassay, hemidiaphragm assay and Endopep-MS assay. Quantification of BoNT/A, BoNT/B and BoNT/E was performed by 48% of participating laboratories. It turned out that precise quantification of BoNT was difficult, resulting in a substantial scatter of quantitative data. This was especially true for results obtained by the mouse bioassay which is currently considered as “gold standard” for BoNT detection. The results clearly demonstrate the urgent need for certified BoNT reference materials and the development of methods replacing animal testing. In this context, the BoNT PT provided the valuable information that both the Endopep-MS assay and the hemidiaphragm assay delivered quantitative results superior to the mouse bioassay.

  10. Qualitative and Quantitative Detection of Botulinum Neurotoxins from Complex Matrices: Results of the First International Proficiency Test.

    Science.gov (United States)

    Worbs, Sylvia; Fiebig, Uwe; Zeleny, Reinhard; Schimmel, Heinz; Rummel, Andreas; Luginbühl, Werner; Dorner, Brigitte G

    2015-11-26

    In the framework of the EU project EQuATox, a first international proficiency test (PT) on the detection and quantification of botulinum neurotoxins (BoNT) was conducted. Sample materials included BoNT serotypes A, B and E spiked into buffer, milk, meat extract and serum. Different methods were applied by the participants combining different principles of detection, identification and quantification. Based on qualitative assays, 95% of all results reported were correct. Successful strategies for BoNT detection were based on a combination of complementary immunological, MS-based and functional methods or on suitable functional in vivo/in vitro approaches (mouse bioassay, hemidiaphragm assay and Endopep-MS assay). Quantification of BoNT/A, BoNT/B and BoNT/E was performed by 48% of participating laboratories. It turned out that precise quantification of BoNT was difficult, resulting in a substantial scatter of quantitative data. This was especially true for results obtained by the mouse bioassay which is currently considered as "gold standard" for BoNT detection. The results clearly demonstrate the urgent need for certified BoNT reference materials and the development of methods replacing animal testing. In this context, the BoNT PT provided the valuable information that both the Endopep-MS assay and the hemidiaphragm assay delivered quantitative results superior to the mouse bioassay.

  11. Computer-aided lead optimization: improved small-molecule inhibitor of the zinc endopeptidase of botulinum neurotoxin serotype A.

    Directory of Open Access Journals (Sweden)

    Jing Tang

    2007-08-01

    Full Text Available Optimization of a serotype-selective, small-molecule inhibitor of botulinum neurotoxin serotype A (BoNTA endopeptidase is a formidable challenge because the enzyme-substrate interface is unusually large and the endopeptidase itself is a large, zinc-binding protein with a complex fold that is difficult to simulate computationally. We conducted multiple molecular dynamics simulations of the endopeptidase in complex with a previously described inhibitor (K(i (app of 7+/-2.4 microM using the cationic dummy atom approach. Based on our computational results, we hypothesized that introducing a hydroxyl group to the inhibitor could improve its potency. Synthesis and testing of the hydroxyl-containing analog as a BoNTA endopeptidase inhibitor showed a twofold improvement in inhibitory potency (K(i (app of 3.8+/-0.8 microM with a relatively small increase in molecular weight (16 Da. The results offer an improved template for further optimization of BoNTA endopeptidase inhibitors and demonstrate the effectiveness of the cationic dummy atom approach in the design and optimization of zinc protease inhibitors.

  12. Taxonomic identity of type E botulinum toxin-producing Clostridium butyricum strains by sequencing of a short 16S rDNA region.

    Science.gov (United States)

    Pourshaban, Manoocheher; Franciosa, Giovanna; Fenicia, Lucia; Aureli, Paolo

    2002-08-27

    Several micro-organisms capable of producing botulinum neurotoxin type E, though phenotypically similar to Clostridium butyricum (a normally non-neurotoxigenic organism), have recently been isolated in Italy and China. Some of these micro-organisms had been implicated in food-borne botulism, a serious neuroparalytic disease. The taxonomic identity of the type E botulinum toxin-producing strains is confirmed here, through sequencing of a genus- and species-specific segment of the 16S rRNA gene. Confirmation leads to the conclusion that neurotoxigenic C. butyricum must be regarded as an emergent food-borne pathogen.

  13. Catalytic Properties of Botulinum Neurotoxins Subtypes A3 and A4

    OpenAIRE

    Henkel, James S.; Jacobson, Mark; Tepp, William; Pier, Christina; Johnson, Eric A.; Barbieri, Joseph T.

    2009-01-01

    Botulinum toxins (BoNT) are zinc proteases (serotypes A-G) which cause flaccid paralysis through the cleavage of SNARE proteins within motor neurons. BoNT/A was originally organized into two subtypes: BoNT/A1 and BoNT/A2, which are ~ 95 % homologous and possess similar catalytic activities. Subsequently, two additional subtypes were identified; BoNT/A3 (Loch Maree), and BoNT/A4 (657Ba), which have 81 and 88% homology with BoNT/A1, respectively. Alignment studies predicted that BoNT/A3 and BoN...

  14. Botulinum toxin type A for the management of glabellar rhytids

    Directory of Open Access Journals (Sweden)

    Anne Marie Tremaine

    2010-04-01

    Full Text Available Anne Marie Tremaine, Jerry L McCulloughDepartment of Dermatology, University of California, Irvine, CA, USAAbstract: There is an increasing demand for minimally-invasive cosmetic procedures to arrest the aging process. Botulinum toxin type A injections are the most commonly used nonsurgical cosmetic procedures in the United States. There has been research spanning over two decades dedicated to safety, efficacy, dosing, and complications of botulinum toxin type A. There are now two Food and Drug Administration (FDA approved botulinum toxin type A options in the United States: Botox® and Dysport™, with new advances being made in the field.Keywords: botulinum toxin type A, glabella, Botox, Dysport, complications, dosing

  15. [Food poisoning caused by Clostridium botulinum type E].

    Science.gov (United States)

    Aureli, P; Fenicia, L; Ferrini, A M

    1984-01-01

    The results of a microbiological investigation carried out into a home-canned tuna fish are reported in relation to a suspected botulism case. Toxin of Cl. botulinum type E was detected by mouse toxicity and neutralization tests. The food specimen were also cultured for Cl. botulinum. The isolates was identified as Cl. botulinum type E by biochemical, gas chromatographic and immunological tests. The outbreak in which for the first time in Italy, the Cl. botulinum type E is involved, concerns one person who showed typical signs and symptoms consistent with botulism (abdominal cramps, dilatated pupils, diplopia, dysphagia, paralysis of lower upper limbs). The laboratory results are discussed with relation to environmental characteristics of the micro-organism and their resistance to same chemical and physical factors with are involved in the canning practice.

  16. The pattern of growth observed for Clostridium botulinum type A1 strain ATCC 19397 is influenced by nutritional status and quorum sensing: a modelling perspective.

    Science.gov (United States)

    Ihekwaba, Adaoha E C; Mura, Ivan; Peck, Michael W; Barker, G C

    2015-12-01

    Botulinum neurotoxins (BoNTs) produced by the anaerobic bacterium Clostridium botulinum are the most poisonous substances known to mankind. However, toxin regulation and signals triggering synthesis as well as the regulatory network and actors controlling toxin production are unknown. Experiments show that the neurotoxin gene is growth phase dependent for C. botulinum type A1 strain ATCC 19397, and toxin production is influenced both by culture conditions and nutritional status of the medium. Building mathematical models to describe the genetic and molecular machinery that drives the synthesis and release of BoNT requires a simultaneous description of the growth of the bacterium in culture. Here, we show four plausible modelling options which could be considered when constructing models describing the pattern of growth observed in a botulinum growth medium. Commonly used bacterial growth models are unsuitable to fit the pattern of growth observed, since they only include monotonic growth behaviour. We find that a model that includes both the nutritional status and the ability of the cells to sense their surroundings in a quorum-sensing manner is most successful at explaining the pattern of growth obtained for C. botulinum type A1 strain ATCC 19397. © FEMS 2015.

  17. Application of Botulinum toxin Type A: An arsenal in dentistry

    OpenAIRE

    Lakshmana B Rao; Rajashekar Sangur; S Pradeep

    2011-01-01

    An extremely effective way of preventing damage to and enhancing treatment of dental hard tissues and restorations would be to ′′de-programme′′ the muscles responsible for excessive destructive forces and other gnathological-related diseases. The new paradigm is the intramuscular injection of Botulinum toxin type A (BOTOX) into the affected muscles. It is a natural protein produced by anaerobic bacterium, Clostridium botulinum. The toxin inhibits the release of acetylcholine (ACH), a neurotra...

  18. Identification and Characterization of Botulinum Neurotoxin A Substrate Binding Pockets and Their Re-Engineering for Human SNAP-23.

    Science.gov (United States)

    Sikorra, Stefan; Litschko, Christa; Müller, Carina; Thiel, Nadine; Galli, Thierry; Eichner, Timo; Binz, Thomas

    2016-01-29

    Botulinum neurotoxins (BoNTs) are highly potent bacterial proteins that block neurotransmitter release at the neuromuscular junction by cleaving SNAREs (soluble N-ethyl maleimide sensitive factor attachment protein receptors). However, their serotype A (BoNT/A) that cleaves SNAP-25 (synaptosomal-associated protein of 25 kDa) has also been an established pharmaceutical for treatment of medical conditions that rely on hyperactivity of cholinergic nerve terminals for 25 years. The expansion of its use to a variety of further medical conditions associated with hypersecretion components is prevented partly because the involved SNARE isoforms are not cleaved. Therefore, we examined by mutational analyses the reason for the resistance of human SNAP-23, an isoform of SNAP-25. We show that replacement of 10 SNAP-23 residues with their SNAP-25 counterparts effects SNAP-25-like cleavability. Conversely, transfer of each of the replaced SNAP-23 residues to SNAP-25 drastically decreased the cleavability of SNAP-25. By means of the existing SNAP-25-toxin co-crystal structure, molecular dynamics simulations, and corroborative mutagenesis studies, the appropriate binding pockets for these residues in BoNT/A were characterized. Systematic mutagenesis of two major BoNT/A binding pockets was conducted in order to adapt these pockets to corresponding amino acids of human SNAP-23. Human SNAP-23 cleaving mutants were isolated using a newly established yeast-based screening system. This method may be useful for engineering novel BoNT/A pharmaceuticals for the treatment of diseases that rely on SNAP-23-mediated hypersecretion. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Long-term effects of repeated intradetrusor botulinum neurotoxin A injections on detrusor function in patients with neurogenic bladder dysfunction.

    Science.gov (United States)

    Pannek, Jürgen; Göcking, Konrad; Bersch, Ulf

    2009-11-01

    To evaluate the influence of repeated botulinum neurotoxin A (BoNT-A) treatments on detrusor function in patients with neurogenic detrusor overactivity (DOA) due to spinal cord lesions. In a retrospective study, urodynamic evaluations of 27 consecutive patients with neurogenic DOA due to spinal cord lesions who received at least five BoNT-A treatments were analysed. After the first BoNT-A treatment, bladder capacity, reflex volume, continence status and detrusor compliance were significantly improved and maximum detrusor pressure (P(detmax)) was significantly reduced. The mean number of BoNT-A treatments was 7.1. Compared with the results of the first treatment, the incontinence rate (seven patients) and the number of patients with an elevated P(detmax) (five patients) were slightly increased after the final BoNT-A treatment. The long-term success rate was 74%. Every fourth patient needed a major surgical intervention. There was a significant decrease in P(detmax) before BoNT-A treatments, indicating that detrusor contraction strength did not completely recover after treatment. Our study confirmed the long-term efficacy of repeated BoNT-A treatments in patients with neurogenic DOA. However, in long-term follow-up, every fourth patient required surgical interventions. Moreover, our data give the first hint that BoNT-A may lead to impaired detrusor contraction strength, which could influence future treatment options. Prospective studies are necessary to elucidate the impact of repeated BoNT-A treatments on detrusor function and the interactions with future treatment options.

  20. Accelerated intoxication of GABAergic synapses by botulinum neurotoxin A disinhibits stem cell-derived neuron networks prior to network silencing

    Directory of Open Access Journals (Sweden)

    Phillip H Beske

    2015-04-01

    Full Text Available Botulinum neurotoxins (BoNTs are extremely potent toxins that specifically cleave SNARE proteins in peripheral synapses, preventing neurotransmitter release. Neuronal responses to BoNT intoxication are traditionally studied by quantifying SNARE protein cleavage in vitro or monitoring physiological paralysis in vivo. Consequently, the dynamic effects of intoxication on synaptic behaviors are not well understood. We have reported that mouse embryonic stem cell-derived neurons (ESNs are highly sensitive to BoNT based on molecular readouts of intoxication. Here we study the time-dependent changes in synapse- and network-level behaviors following addition of BoNT/A to spontaneously active networks of glutamatergic and GABAergic ESNs. Whole-cell patch-clamp recordings indicated that BoNT/A rapidly blocked synaptic neurotransmission, confirming that ESNs replicate the functional pathophysiology responsible for clinical botulism. Quantitation of spontaneous neurotransmission in pharmacologically isolated synapses revealed accelerated silencing of GABAergic synapses compared to glutamatergic synapses, which was consistent with the selective accumulation of cleaved SNAP-25 at GAD1+ presynaptic terminals at early timepoints. Different latencies of intoxication resulted in complex network responses to BoNT/A addition, involving rapid disinhibition of stochastic firing followed by network silencing. Synaptic activity was found to be highly sensitive to SNAP-25 cleavage, reflecting the functional consequences of the localized cleavage of the small subpopulation of SNAP-25 that is engaged in neurotransmitter release in the nerve terminal. Collectively these findings illustrate that use of synaptic function assays in networked neurons cultures offers a novel and highly sensitive approach for mechanistic studies of toxin:neuron interactions and synaptic responses to BoNT.

  1. [Advances in the research of mechanism in prevention and treatment of scar with botulinum toxin type A and its clinical application].

    Science.gov (United States)

    Li, Y H; Liu, J Q; Xiao, D; Zhang, W; Hu, D H

    2017-04-20

    Scar is a common complication in wound healing process, and how to effectively prevent and treat it is a hot and difficult problem in burns and plastic surgery field. Botulinum toxin type A is a neurotoxin that has been widely and effectively used in the cosmetic surgery field such as anti-wrinkle and thin face. In recent years, botulinum toxin type A has been applied in prevention and treatment of scar, which causes a great concern. Nowadays, the relevant reports have gradually increased, and the mechanisms have been explored more deeply. This article aims to summarize the possible mechanisms and clinical reports on the prevention and treatment of scar by botulinum toxin type A to provide a new way for the prevention and treatment of scar after surgery.

  2. Assessment: Botulinum neurotoxin for the treatment of movement disorders (an evidence-based review): report of the Therapeutics and Technology Assessment Subcommittee of the American Academy of Neurology.

    Science.gov (United States)

    Simpson, D M; Blitzer, A; Brashear, A; Comella, C; Dubinsky, R; Hallett, M; Jankovic, J; Karp, B; Ludlow, C L; Miyasaki, J M; Naumann, M; So, Y

    2008-05-06

    To perform an evidence-based review of the safety and efficacy of botulinum neurotoxin (BoNT) in the treatment of movement disorders. A literature search was performed including MEDLINE and Current Contents for therapeutic articles relevant to BoNT and selected movement disorders. Authors reviewed, abstracted, and classified articles based on American Academy of Neurology criteria (Class I-IV). The highest quality literature available for the respective indications was as follows: blepharospasm (two Class II studies); hemifacial spasm (one Class II and one Class III study); cervical dystonia (seven Class I studies); focal upper extremity dystonia (one Class I and three Class II studies); focal lower extremity dystonia (one Class II study); laryngeal dystonia (one Class I study); motor tics (one Class II study); and upper extremity essential tremor (two Class II studies). Botulinum neurotoxin should be offered as a treatment option for the treatment of cervical dystonia (Level A), may be offered for blepharospasm, focal upper extremity dystonia, adductor laryngeal dystonia, and upper extremity essential tremor (Level B), and may be considered for hemifacial spasm, focal lower limb dystonia, and motor tics (Level C). While clinicians' practice may suggest stronger recommendations in some of these indications, evidence-based conclusions are limited by the availability of data.

  3. Catalytic Features of the Botulinum Neurotoxin A Light Chain Revealed by High Resolution Structure of an Inhibitory Peptide Complex

    Energy Technology Data Exchange (ETDEWEB)

    Silvaggi,N.; Wilson, D.; Tzipori, S.; Allen, K.

    2008-01-01

    The Clostridium botulinum neurotoxin serotype A light chain (BoNT/A-LC) is a Zn(II)-dependent metalloprotease that blocks the release of acetylcholine at the neuromuscular junction by cleaving SNAP-25, one of the SNARE proteins required for exocytosis. Because of the potential for use of the toxin in bioterrorism and the increasingly widespread application of the toxin in the medical field, there is significant interest in the development of small-molecule inhibitors of the metalloprotease. Efforts to design such inhibitors have not benefited from knowledge of how peptides bind to the active site since the enzyme-peptide structures available previously either were not occupied in the vicinity of the catalytic Zn(II) ion or did not represent the product of SNAP-25 substrate cleavage. Herein we report the 1.4 Angstroms-resolution X-ray crystal structure of a complex between the BoNT/A-LC and the inhibitory peptide N-Ac-CRATKML, the first structure of the light chain with an inhibitory peptide bound at the catalytic Zn(II) ion. The peptide is bound with the Cys S? atom coordinating the metal ion. Surprisingly, the cysteine sulfur is oxidized to the sulfenic acid form. Given the unstable nature of this species in solution, is it likely that oxidation occurs on the enzyme. In addition to the peptide-bound structure, we report two structures of the unliganded light chain with and without the Zn(II) cofactor bound at 1.25 and 1.20 Angstroms resolution, respectively. The two structures are nearly identical, confirming that the Zn(II) ion plays a purely catalytic role. Additionally, the structure of the Zn(II)-bound uncomplexed enzyme allows identification of the catalytic water molecule and a second water molecule that occupies the same position as the peptidic oxygen in the tetrahedral intermediate. This observation suggests that the enzyme active site is prearranged to stabilize the tetrahedral intermediate of the protease reaction.

  4. Spinal central effects of peripherally applied botulinum neurotoxin A in comparison between its subtypes A1 and A2

    Directory of Open Access Journals (Sweden)

    Hidetaka eKoizumi

    2014-06-01

    Full Text Available Because of its unique ability to exert long-lasting synaptic transmission blockade, botulinum neurotoxin A (BoNT/A is used to treat a wide variety of disorders involving peripheral nerve terminal hyperexcitability. However, it has been a matter of debate whether this toxin has central or peripheral sites of action. We employed a rat model in which BoNT/A1 or BoNT/A2 was unilaterally injected into the gastrocnemius muscle. On time-course measurements of compound muscle action potential (CMAP amplitudes after injection of BoNT/A1 or BoNT/A2 at doses ranging from 1.7 U to 13.6 U, CMAP amplitude for the ipsilateral hind leg was markedly decreased on the 1st day, and this muscle flaccidity persisted up to the 14th day. Of note, both BoNT/A1 and BoNT/A2 administrations also resulted in decreased CMAP amplitudes for the contralateral leg in a dose-dependent manner ranging from 1.7 to 13.6 U, and this muscle flaccidity increased until the 4th day and then slowly recovered. Immunohistochemical results revealed that BoNT/A-cleaved SNAP-25 (synaptosomal-associated protein of 25 kDa appeared in the bilateral ventral and dorsal horns 4 days after injection of BoNT/A1 (10 U or BoNT/A2 (10 U, although there seemed to be a wider spread of BoNT/A-cleaved SNAP-25 associated with BoNT/A1 than BoNT/A2 in the contralateral spinal cord. This suggests that the catalytically active BoNT/A1 and BoNT/A2 were axonally transported via peripheral motor and sensory nerves to the spinal cord, where they spread through a transcytosis (cell-to-cell trafficking mechanism. Our results provide evidence for the central effects of intramuscularly administered BoNT/A1 and BoNT/A2 in the spinal cord, and a new insight into the clinical effects of peripheral BoNT/A applications.

  5. Sublingual immunization with adenovirus F protein-based vaccines stimulates protective immunity against botulinum neurotoxin A intoxication

    Science.gov (United States)

    Jun, SangMu; Clapp, Beata; Zlotkowska, Dagmara; Hoyt, Teri; Holderness, Kathryn; Maddaloni, Massimo

    2012-01-01

    Sublingual (s.l.) vaccination is an efficient way to induce elevated levels of systemic and mucosal immune responses. To mediate mucosal uptake, ovalbumin (OVA) was genetically fused to adenovirus 2 fiber protein (OVA-Ad2F) to assess whether s.l. immunization was as effective as an alternative route of vaccination. Ad2F-delivered vaccines were efficiently taken up by dendritic cells and migrated mostly to submaxillary gland lymph nodes, which could readily stimulate OVA-specific CD4+ T cells. OVA-Ad2F + cholera toxin (CT)-immunized mice elicited significantly higher OVA-specific serum IgG, IgA and mucosal IgA antibodies among the tested immunization groups. These were supported by elevated OVA-specific IgG and IgA antibody-forming cells. A mixed Th-cell response was induced as evident by the enhanced IL-4, IL-10, IFN-γ and TNF-α-specific cytokine-forming cells. To assess whether this approach can stimulate neutralizing antibodies, immunizations were performed with the protein encumbering the β-trefoil domain of C-terminus heavy chain (Hcβtre) from botulinum neurotoxin A (BoNT/A) as well as when fused to Ad2F. Hcβtre-Ad2F + CT-dosed mice showed the greatest serum IgG, IgA and mucosal IgA titers among the immunization groups. Hcβtre-Ad2F alone also induced elevated antibody production in contrast to Hcβtre alone. Plasma from Hcβtre + CT- and Hcβtre-Ad2F + CT-immunized groups neutralized BoNT/A and protected mice from BoNT/A intoxication. Most importantly, Hcβtre-Ad2F + CT-immunized mice were protected from BoNT/A intoxication relative to Hcβtre + CT-immunized mice, which only showed ∼60% protection. This study shows that s.l. immunization with Ad2F-based vaccines is effective in conferring protective immunity. PMID:22207133

  6. Botulinum toxin the poison that heals: A brief review.

    Science.gov (United States)

    Dutta, Shubha Ranjan; Passi, Deepak; Singh, Mahinder; Singh, Purnima; Sharma, Sarang; Sharma, Abhimanyu

    2016-01-01

    Botulinum neurotoxins, causative agents of botulism in humans, are produced by Clostridium botulinum , an anaerobic spore-former Gram-positive bacillus. Botulinum neurotoxin poses a major bioweapon threat because of its extreme potency and lethality; its ease of production, transport, and misuse; and the need for prolonged intensive care among affected persons. This paper aims at discussing botulinum neurotoxin, its structure, mechanism of action, pharmacology, its serotypes and the reasons for wide use of type A, the various indications and contraindications of the use of botulinum neurotoxin and finally the precautions taken when botulinum neurotoxin is used as a treatment approach. We have searched relevant articles on this subject in various medical databases including Google Scholar, PubMed Central, ScienceDirect, Wiley Online Library, Scopus, and Copernicus. The search resulted in more than 2669 articles, out of which a total of 187 were reviewed. However, the review has been further constricted into only 54 articles as has been presented in this manuscript keeping in mind the page limitation and the limitation to the number of references. A single gram of crystalline toxin, evenly dispersed and inhaled, can kill more than one million people. The basis of the phenomenal potency of botulinum toxin (BT) is enzymatic; the toxin is a zinc proteinase that cleaves neuronal vesicle-associated proteins responsible for acetylcholine release into the neuromuscular junction. A fascinating aspect of BT research in recent years has been the development of the most potent toxin into a molecule of significant therapeutic utility. It is the first biological toxin which is licensed for the treatment of human diseases. The present review focuses on both warfare potential as well as medical uses of botulinum neurotoxin.

  7. Application of Botulinum toxin Type A: An arsenal in dentistry

    Directory of Open Access Journals (Sweden)

    Lakshmana B Rao

    2011-01-01

    Full Text Available An extremely effective way of preventing damage to and enhancing treatment of dental hard tissues and restorations would be to ′′de-programme′′ the muscles responsible for excessive destructive forces and other gnathological-related diseases. The new paradigm is the intramuscular injection of Botulinum toxin type A (BOTOX into the affected muscles. It is a natural protein produced by anaerobic bacterium, Clostridium botulinum. The toxin inhibits the release of acetylcholine (ACH, a neurotransmitter responsible for the activation of muscle contraction and glandular secretion, and its administration results in reduction of tone in the injected muscle. There are seven distinct serotypes of Botulinum toxin, viz., A, B, C, D, E, F, and G, which differ in their potency, duration of action, and cellular target sites. This paper describes the different applications of BOTOX in dentistry.

  8. Application of Botulinum toxin type A: an arsenal in dentistry.

    Science.gov (United States)

    Rao, Lakshmana B; Sangur, Rajashekar; Pradeep, S

    2011-01-01

    An extremely effective way of preventing damage to and enhancing treatment of dental hard tissues and restorations would be to ''de-programme'' the muscles responsible for excessive destructive forces and other gnathological-related diseases. The new paradigm is the intramuscular injection of Botulinum toxin type A (BOTOX) into the affected muscles. It is a natural protein produced by anaerobic bacterium, Clostridium botulinum. The toxin inhibits the release of acetylcholine (ACH), a neurotransmitter responsible for the activation of muscle contraction and glandular secretion, and its administration results in reduction of tone in the injected muscle. There are seven distinct serotypes of Botulinum toxin, viz., A, B, C, D, E, F, and G, which differ in their potency, duration of action, and cellular target sites. This paper describes the different applications of BOTOX in dentistry.

  9. Three-dimensional database mining identifies a unique chemotype that unites structurally diverse botulinum neurotoxin serotype A inhibitors in a three-zone pharmacophore.

    Science.gov (United States)

    Hermone, Ann R; Burnett, James C; Nuss, Jonathan E; Tressler, Lyal E; Nguyen, Tam L; Solaja, Bogdan A; Vennerstrom, Jonathan L; Schmidt, James J; Wipf, Peter; Bavari, Sina; Gussio, Rick

    2008-12-01

    A search query consisting of two aromatic centers and two cationic centers was defined based on previously identified small molecule inhibitors of the botulinum neurotoxin serotype A light chain (BoNT/A LC) and used to mine the National Cancer Institute Open Repository. Ten small molecule hits were identified, and upon testing, three demonstrated inhibitory activity. Of these, one was structurally unique, possessing a rigid diazachrysene scaffold. The steric limitations of the diazachrysene imposed a separation between the overlaps of previously identified inhibitors, revealing an extended binding mode. As a result, the pharmacophore for BoNT/A LC inhibition has been modified to encompass three zones. To demonstrate the utility of this model, a novel three-zone inhibitor was mined and its activity was confirmed.

  10. High Conservation of Tetanus and Botulinum Neurotoxins Cleavage Sites on Human SNARE Proteins Suggests That These Pathogens Exerted Little or No Evolutionary Pressure on Humans

    Science.gov (United States)

    Carle, Stefan; Barth, Holger; Montecucco, Cesare

    2017-01-01

    The Genome Aggregation Database presently contains >120,000 human genomes. We searched in this database for the presence of mutations at the sites of tetanus (TeNT) and botulinum neurotoxins (BoNTs) cleavages of the three SNARE proteins: VAMP, SNAP-25 and Syntaxin. These mutations could account for some of the BoNT/A resistant patients. At the same time, this approach was aimed at testing the possibility that TeNT and BoNT may have acted as selective agents in the development of resistance to tetanus or botulism. We found that mutations of the SNARE proteins are very rare and concentrated outside the SNARE motif required for the formation of the SNARE complex involved in neuroexocytosis. No changes were found at the BoNT cleavage sites of VAMP and syntaxins and only one very rare mutation was found in the essential C-terminus region of SNAP-25, where Arg198 was replaced with a Cys residue. This is the P1’ cleavage site for BoNT/A and the P1 cleavage site for BoNT/C. We found that the Arg198Cys mutation renders SNAP-25 resistant to BoNT/A. Nonetheless, its low frequency (1.8 × 10−5) indicates that mutations of SNAP-25 at the BoNT/A cleavage site are unlikely to account for the existence of BoNT/A resistant patients. More in general, the present findings indicate that tetanus and botulinum neurotoxins have not acted as selective agents during human evolution as it appears to have been the case for tetanus in rats and chicken. PMID:29257047

  11. High Conservation of Tetanus and Botulinum Neurotoxins Cleavage Sites on Human SNARE Proteins Suggests That These Pathogens Exerted Little or No Evolutionary Pressure on Humans

    Directory of Open Access Journals (Sweden)

    Stefan Carle

    2017-12-01

    Full Text Available The Genome Aggregation Database presently contains >120,000 human genomes. We searched in this database for the presence of mutations at the sites of tetanus (TeNT and botulinum neurotoxins (BoNTs cleavages of the three SNARE proteins: VAMP, SNAP-25 and Syntaxin. These mutations could account for some of the BoNT/A resistant patients. At the same time, this approach was aimed at testing the possibility that TeNT and BoNT may have acted as selective agents in the development of resistance to tetanus or botulism. We found that mutations of the SNARE proteins are very rare and concentrated outside the SNARE motif required for the formation of the SNARE complex involved in neuroexocytosis. No changes were found at the BoNT cleavage sites of VAMP and syntaxins and only one very rare mutation was found in the essential C-terminus region of SNAP-25, where Arg198 was replaced with a Cys residue. This is the P1’ cleavage site for BoNT/A and the P1 cleavage site for BoNT/C. We found that the Arg198Cys mutation renders SNAP-25 resistant to BoNT/A. Nonetheless, its low frequency (1.8 × 10−5 indicates that mutations of SNAP-25 at the BoNT/A cleavage site are unlikely to account for the existence of BoNT/A resistant patients. More in general, the present findings indicate that tetanus and botulinum neurotoxins have not acted as selective agents during human evolution as it appears to have been the case for tetanus in rats and chicken.

  12. Double anchorage to the membrane and intact inter-chain disulfide bond are required for the low pH induced entry of tetanus and botulinum neurotoxins into neurons.

    Science.gov (United States)

    Pirazzini, Marco; Rossetto, Ornella; Bolognese, Paolo; Shone, Clifford C; Montecucco, Cesare

    2011-11-01

    Tetanus and botulinum neurotoxins are di-chain proteins that cause paralysis by inhibiting neuroexocytosis. These neurotoxins enter into nerve terminals via endocytosis inside synaptic vesicles, whose acidic pH induces a structural change of the neurotoxin molecule that becomes capable of translocating its L chain into the cytosol, via a transmembrane protein-conducting channel made by the H chain. This is the least understood step of the intoxication process primarily because it takes place inside vesicles within the cytosol. In the present study, we describe how this passage was made accessible to investigation by making it to occur at the surface of neurons. The neurotoxin, bound to the plasma membrane in the cold, was exposed to a warm low pH extracellular medium and the entry of the L chain was monitored by measuring its specific metalloprotease activity with a ratiometric method. We found that the neurotoxin has to be bound to the membrane via at least two anchorage sites in order for a productive low-pH induced structural change to take place. In addition, this process can only occur if the single inter-chain disulfide bond is intact. The pH dependence of the conformational change of tetanus neurotoxin and botulinum neurotoxin B, C and D is similar and take places in the same slightly acidic range, which comprises that present inside synaptic vesicles. Based on these and previous findings, we propose a stepwise sequence of molecular events that lead from toxin binding to membrane insertion. © 2011 Blackwell Publishing Ltd.

  13. Botulinum toxin type A as treatment of partially accommodative esotropia.

    Science.gov (United States)

    Flores-Reyes, E M; Castillo-López, M G; Toledo-Silva, R; Vargas-Ortega, J; Murillo-Correa, C E; Aguilar-Ruiz, A

    2016-03-01

    To determine the effectiveness of a botulinum toxin type A injection in both medial rectus muscles in patients with partially accommodative esotropia. Residual deviation and stability of strabismus were evaluated at 18 months follow up. A prospective, analytical, quasi-experimental study was conducted on a cohort of 21 patients who underwent total cycloplegic refraction and with a residual deviation of at least 14 DP. A botulinum toxin type A dose of 5 IU was injected into each medial rectus muscle for a residual deviation greater than 18 DP, with a dose of 2.5 IU being used for a deviation between 14 and 18 DP. Multivariate logistic regression analyses were performed to relate residual deviation to variables recorded as potential predictors. A total of 21 patients were included, 33.3% (n=7) males and 66.6% (n=14) females. Mean visual acuity was -.28±.25 logMAR for right eye (range 0 to -1) and -.42±.31 logMAR for left eye (range 0 to -1.3). Mean angle of residual deviation before application of botulinum toxin was 40.95±8.6DP without spectacles correction, and 22.3±7.99 DP with full cycloplegic refraction. Adverse effects were ptosis in 14.2% (n=3), diplopia 23.8% (n=5), and vertical deviation in 33% (n=7). One patient had a poor outcome, therefore required surgical treatment. At one year follow up, 85.71% of patients showed good results with esotropia of 12 DP or less, dropping to 71.43% at 18 months of follow up. Botulinum toxin type A is an effective long-term treatment with a good response in 71.43% of patients. No predictors of good response were demonstrated. Copyright © 2015 Sociedad Española de Oftalmología. Published by Elsevier España, S.L.U. All rights reserved.

  14. 76 FR 29752 - Nomination of In Vitro Test Methods for Detection and Quantification of Botulinum Neurotoxins and...

    Science.gov (United States)

    2011-05-23

    ... the potential to reduce or replace animal use for regulatory testing. At this time, ICCVAM requests..., Alternative Methods to Refine, Reduce, or Replace the Mouse LD 50 Assay for Botulinum Toxin Testing, in... availability of alternative methods to replace the mouse LD 50 assay for BoNT potency testing. Workshop...

  15. Efficacy and Safety of a New Botulinum Toxin Type A Free of Complexing Proteins

    Directory of Open Access Journals (Sweden)

    Hyun-Mi Oh

    2015-12-01

    Full Text Available MT10107 is botulinum neurotoxin type A derived drug which utilizes the 150 kDa portion without complexing proteins and human serum albumin contents. To evaluate the efficacy and the safety of MT10107, it was compared with onabotulinumtoxinA in this double-blind, randomized controlled trial. Twenty-five healthy males received a randomly selected dose of MT10107 into the extensor digitorum brevis (EDB muscle of one foot, and an equivalent dose of onabotulinumtoxinA (BOTOX was injected into the contralateral EDB muscle. While efficacy of the administered substance was determined by measuring paretic effects on the EDB, the local spread of toxin effects was evaluated by the paretic effects on the nearby abductor hallucis (AH and abductor digiti quinti (ADQ muscles. Paretic effects were defined as the percentage of reduction of the compound muscle action potential (CMAP amplitudes, measured at 14, 30, 90 days after the injection, compared to the baseline value. Intergroup (MT10107 and onabotulinumtoxinA differences were not significant in the percentage reduction of the amplitudes in the EDB muscles. In this study, there was no significant difference in efficacy and safety between the two test drugs. MT10107 may be effective and safe as much as onabotulinumtoxinA to produce the desired paretic effect.

  16. Identification of fibroblast growth factor receptor 3 (FGFR3 as a protein receptor for botulinum neurotoxin serotype A (BoNT/A.

    Directory of Open Access Journals (Sweden)

    Birgitte P S Jacky

    Full Text Available Botulinum neurotoxin serotype A (BoNT/A causes transient muscle paralysis by entering motor nerve terminals (MNTs where it cleaves the SNARE protein Synaptosomal-associated protein 25 (SNAP25206 to yield SNAP25197. Cleavage of SNAP25 results in blockage of synaptic vesicle fusion and inhibition of the release of acetylcholine. The specific uptake of BoNT/A into pre-synaptic nerve terminals is a tightly controlled multistep process, involving a combination of high and low affinity receptors. Interestingly, the C-terminal binding domain region of BoNT/A, HC/A, is homologous to fibroblast growth factors (FGFs, making it a possible ligand for Fibroblast Growth Factor Receptors (FGFRs. Here we present data supporting the identification of Fibroblast Growth Factor Receptor 3 (FGFR3 as a high affinity receptor for BoNT/A in neuronal cells. HC/A binds with high affinity to the two extra-cellular loops of FGFR3 and acts similar to an agonist ligand for FGFR3, resulting in phosphorylation of the receptor. Native ligands for FGFR3; FGF1, FGF2, and FGF9 compete for binding to FGFR3 and block BoNT/A cellular uptake. These findings show that FGFR3 plays a pivotal role in the specific uptake of BoNT/A across the cell membrane being part of a larger receptor complex involving ganglioside- and protein-protein interactions.

  17. Botulinum Neurotoxin A Injections Influence Stretching of the Gastrocnemius Muscle-Tendon Unit in an Animal Model

    Directory of Open Access Journals (Sweden)

    Christopher J. Tuohy

    2012-08-01

    Full Text Available Botulinum Neurotoxin A (BoNT-A injections have been used for the treatment of muscle contractures and spasticity. This study assessed the influence of (BoNT-A injections on passive biomechanical properties of the muscle-tendon unit. Mouse gastrocnemius muscle (GC was injected with BoNT-A (n = 18 or normal saline (n = 18 and passive, non-destructive, in vivo load relaxation experimentation was performed to examine how the muscle-tendon unit behaves after chemical denervation with BoNT-A. Injection of BoNT-A impaired passive muscle recovery (15% vs. 35% recovery to pre-stretching baseline, p < 0.05 and decreased GC stiffness (0.531 ± 0.061 N/mm vs. 0.780 ± 0.037 N/mm, p < 0.05 compared to saline controls. The successful use of BoNT-A injections as an adjunct to physical therapy may be in part attributed to the disruption of the stretch reflex; thereby modulating in vivo passive muscle properties. However, it is also possible that BoNT-A injection may alter the structure of skeletal muscle; thus modulating the in vivo passive biomechanical properties of the muscle-tendon unit.

  18. Impedimetric immunosensor for the label-free and direct detection of botulinum neurotoxin serotype A using Au nanoparticles/graphene-chitosan composite.

    Science.gov (United States)

    Afkhami, Abbas; Hashemi, Pegah; Bagheri, Hasan; Salimian, Jafar; Ahmadi, Ali; Madrakian, Tayyebeh

    2017-07-15

    In this work, a novel nanocomposite film consisting of the Au nanoparticles/graphene-chitosan has been designed to construct an impedimetric immunosensor for a rapid and sensitive immunoassay of botulinum neurotoxin A (BoNT/A). BoNT/A antibody was immobilized on glassy carbon electrode modified with Au nanoparticles/graphene-chitosan for the signal amplification. The fabrication of immunosensor was extensively characterized by using transmission electron microscopy (TEM), scanning electron microscopy (SEM), atomic force microscopy (AFM), X-ray diffraction (XRD), Fourier transform infrared (FTIR), cyclic voltammetry (CV), and electrochemical impedance spectroscopy (EIS). The impedance changes, due to the specific immuno-interactions at the immunosensor surface that efficiently restricted the electron transfer of redox probe Fe(CN) 6 4-/3- were utilized to detect BoNT/A. The measurements were highly targeted specific and linear with logarithmic BoNT/A concentrations in PBS, milk and human serum across a 0.27-268pgmL -1 range and associated with a detection limit of 0.11pgmL -1 . Copyright © 2016. Published by Elsevier B.V.

  19. Fabrication of a Novel Highly Sensitive and Selective Immunosensor for Botulinum Neurotoxin Serotype A Based on an Effective Platform of Electrosynthesized Gold Nanodendrites/Chitosan Nanoparticles

    Directory of Open Access Journals (Sweden)

    Rahim Sorouri

    2017-05-01

    Full Text Available In this work, a novel nanocomposite consisting of electrosynthesized gold nanodendrites and chitosan nanoparticles (AuNDs/CSNPs has been prepared to fabricate an impedimetric immunosensor based on a screen printed carbon electrode (SPCE for the rapid and sensitive immunoassay of botulinum neurotoxin A (BoNT/A. BoNT/A polyclonal antibody was immobilized on the nanocomposite-modified SPCE for the signal amplification. The structure of the prepared nanocomposite was investigated by transmission electron microscopy (TEM, scanning electron microscopy (SEM, X-ray diffraction (XRD, Fourier transform infrared (FTIR spectroscopy, cyclic voltammetry (CV, and electrochemical impedance spectroscopy (EIS. The charge transfer resistance (RCT changes were used to detect BoNT/A as the specific immuno-interactions at the immunosensor surface that efficiently limited the electron transfer of Fe(CN63−/4− as a redox probe at pH = 7.4. A linear relationship was observed between the %∆RCT and the concentration logarithm of BoNT/A within the range of 0.2 to 230 pg·mL−1 with a detection limit (S/N = 3 of 0.15 pg·mL−1. The practical applicability of the proposed sensor was examined by evaluating the detection of BoNT/A in milk and serum samples with satisfactory recoveries. Therefore, the prepared immunosensor holds great promise for the fast, simple and sensitive detection of BoNT/A in various real samples.

  20. Functional impact of different muscle localization techniques for Botulinum neurotoxin A injections in clinical routine management of post-stroke spasticity.

    Science.gov (United States)

    Zeuner, Kirsten E; Knutzen, Arne; Kühl, Carina; Möller, Bettina; Hellriegel, Helge; Margraf, Nils G; Deuschl, Günther; Stolze, Henning

    2017-01-01

    Treatment options for spasticity include intramuscular botulinum neurotoxin A (BoNT-A) injections. Both ultrasound (US) or electromyographic (EMG) guided BoNT-A injections are employed to isolate muscles. To date, most studies have included patients naïve to BoNT-A or following a prolonged wash out phase. To determine the impact of US/EMG guided BoNT-A injections on function in outpatients with spasticity receiving an established re-injection regime. Thirty patients post-stroke were investigated in a single-blinded, randomized controlled trial using a cross-over design for the EMG and US and a parallel design for the control group. The Modified Ashworth (MAS), Disability Assessment (DAS), Quality of Life (EQ-5D), self-rating scale and Barthel Index were assessed pre- and post-BoNT-A injections of upper limb muscles by a to the injection technique blinded person. MAS improved in arm, finger and upper limb 4 weeks after BoNT-A treatment. The improvement showed no significant differences between the three injection techniques. Barthel Index, DAS and EQ-5D remained unchanged in all groups. This pilot study questions the impact of the instrumental guided injection techniques on everyday functionality in a routine clinical setting with established re-injection intervals. Larger trials are warranted with patients who are under long-term treatment on a regular basis.

  1. The Translocation Domain of Botulinum Neurotoxin A Moderates the Propensity of the Catalytic Domain to Interact with Membranes at Acidic pH.

    Directory of Open Access Journals (Sweden)

    Anne Araye

    Full Text Available Botulinum neurotoxin A (BoNT/A is composed of three domains: a catalytic domain (LC, a translocation domain (HN and a receptor-binding domain (HC. Like most bacterial toxins BoNT/A is an amphitropic protein, produced in a soluble form that is able to interact, penetrate and/or cross a membrane to achieve its toxic function. During intoxication BoNT/A is internalized by the cell by receptor-mediated endocytosis. Then, LC crosses the membrane of the endocytic compartment and reaches the cytosol. This translocation is initiated by the low pH found in this compartment. It has been suggested that LC passes in an unfolded state through a transmembrane passage formed by HN. We report here that acidification induces no major conformational change in either secondary or tertiary structures of LC and HN of BoNT/A in solution. GdnHCl-induced denaturation experiments showed that the stability of LC and HN increases as pH drops, and that HN further stabilizes LC. Unexpectedly we found that LC has a high propensity to interact with and permeabilize anionic lipid bilayers upon acidification without the help of HN. This property is downplayed when LC is linked to HN. HN thus acts as a chaperone for LC by enhancing its stability but also as a moderator of the membrane interaction of LC.

  2. 9 CFR 113.110 - Clostridium Botulinum Type C Bacterin-Toxoid.

    Science.gov (United States)

    2010-01-01

    ..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Inactivated Bacterial Products § 113.110 Clostridium Botulinum Type C Bacterin-Toxoid. Clostridium... challenged intraperitoneally with botulinum Type C toxin which has been titrated in mice to provide for a 104...

  3. BOTULINUM TOXIN

    Science.gov (United States)

    Nigam, P K; Nigam, Anjana

    2010-01-01

    Botulinum toxin, one of the most poisonous biological substances known, is a neurotoxin produced by the bacterium Clostridium botulinum. C. botulinum elaborates eight antigenically distinguishable exotoxins (A, B, C1, C2, D, E, F and G). All serotypes interfere with neural transmission by blocking the release of acetylcholine, the principal neurotransmitter at the neuromuscular junction, causing muscle paralysis. The weakness induced by injection with botulinum toxin A usually lasts about three months. Botulinum toxins now play a very significant role in the management of a wide variety of medical conditions, especially strabismus and focal dystonias, hemifacial spasm, and various spastic movement disorders, headaches, hypersalivation, hyperhidrosis, and some chronic conditions that respond only partially to medical treatment. The list of possible new indications is rapidly expanding. The cosmetological applications include correction of lines, creases and wrinkling all over the face, chin, neck, and chest to dermatological applications such as hyperhidrosis. Injections with botulinum toxin are generally well tolerated and side effects are few. A precise knowledge and understanding of the functional anatomy of the mimetic muscles is absolutely necessary to correctly use botulinum toxins in clinical practice. PMID:20418969

  4. Botulinum toxin

    Directory of Open Access Journals (Sweden)

    Nigam P

    2010-01-01

    Full Text Available Botulinum toxin, one of the most poisonous biological substances known, is a neurotoxin produced by the bacterium Clostridium botulinum. C. botulinum elaborates eight antigenically distinguishable exotoxins (A, B, C 1 , C 2 , D, E, F and G. All serotypes interfere with neural transmission by blocking the release of acetylcholine, the principal neurotransmitter at the neuromuscular junction, causing muscle paralysis. The weakness induced by injection with botulinum toxin A usually lasts about three months. Botulinum toxins now play a very significant role in the management of a wide variety of medical conditions, especially strabismus and focal dystonias, hemifacial spasm, and various spastic movement disorders, headaches, hypersalivation, hyperhidrosis, and some chronic conditions that respond only partially to medical treatment. The list of possible new indications is rapidly expanding. The cosmetological applications include correction of lines, creases and wrinkling all over the face, chin, neck, and chest to dermatological applications such as hyperhidrosis. Injections with botulinum toxin are generally well tolerated and side effects are few. A precise knowledge and understanding of the functional anatomy of the mimetic muscles is absolutely necessary to correctly use botulinum toxins in clinical practice.

  5. Individual and bivalent vaccines against botulinum neurotoxin serotypes A and B using DNA-based Semliki Forest virus vectors.

    Science.gov (United States)

    Yu, Yunzhou; Yu, Jiyu; Li, Na; Wang, Shuang; Yu, Weiyuan; Sun, Zhiwei

    2009-10-19

    We evaluated individual and bivalent replicon vaccines against Clostridiumbotulinum neurotoxin serotypes A (BoNT/A) or B (BoNT/B). The DNA replicon vaccine (pSCARSBHc) encoding the Hc domain of BoNT/B (BHc) induced better responses and protection against BoNT/B mouse challenge than conventional DNA vaccine. The dual-expressing DNA vaccine (pSCARSA/BHc) protected similarly to a DNA replicon vaccine mixture (pSCARSAHc+pSCARSBHc). Additionally, recombinant SFV particles, VRP-AHc or VRP-BHc, protected mice from high-dose BoNT/A or BoNT/B challenge, respectively. Mice given either dual-expressing VRP-A/BHc or mixture of VRP-AHc and VRP-BHc were protected from challenge with serotype A/B mixtures. These data justify further testing in other animals or humans.

  6. Structural Insights into the Functional Role of the Hcn Sub-domain of the Receptor-Binding Domain of the Botulinum Neurotoxin Mosaic Serotype C/D

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yanfeng; Gardberg, Anna; Edwards, Tom E.; Sankaran, Banumathi; Robinson, Howard; Varnum, Susan M.; Buchko, Garry W.

    2013-07-01

    Botulinum neurotoxin (BoNT), the causative agent of the deadly neuroparalytic disease botulism, is the most poisonous protein known for humans. Produced by different strains of the anaerobic bacterium Clostridium botulinum, BoNT effects cellular intoxication via a multistep mechanism executed by the three modules of the activated protein. Endocytosis, the first step of cellular intoxication, is triggered by the ~50 kDa, heavy-chain receptor-binding module (HCR) that is specific for a ganglioside and a protein receptor on neuronal cell surfaces. This dual receptor recognition mechanism between BoNT and the host cell’s membrane is well documented and occurs via specific intermolecular interactions with the C-terminal sub-domain, Hcc, of BoNT-HCR. The N-terminal sub-domain of BoNT-HCR, Hcn, comprises ~50% of BoNT-HCR and adopts a B-sheet jelly roll fold. While suspected in assisting cell surface recognition, no unambiguous function for the Hcn sub-domain in BoNT has been indentified. To obtain insights into the potential function of the Hcn sub-domain in BoNT, the first crystal structure of a BoNT with an organic ligand bound to the Hcn sub-domain has been obtained. Here, we describe the crystal structure of BoNT/CD-HCR determined at 1.70 Å resolution with a tetraethylene glycol (PG4) molecule bound in an hydrophobic cleft between B-strands in the B-sheet jelly fold roll of the Hcn sub-domain. The molecule is completely engulfed in the cleft, making numerous hydrophobic (Y932, S959, W966, and D1042) and hydrophilic (S935, W977, L979, N1013, and I1066) contacts with the protein’s side chain and backbone that may mimic in vivo interactions with the phospholipid membranes on neuronal cell surfaces. A sulfate ion was also observed bound to residues T1176, D1177, K1196, and R1243 in the Hcc sub-domain of BoNT/CD-HCR. In the crystal structure of a similar protein, BoNT/D-HCR, a sialic acid

  7. Experience with botulinum toxin type A in medically intractable pediatric chronic daily headache.

    Science.gov (United States)

    Ahmed, Karman; Oas, Kimberly Hall; Mack, Kenneth J; Garza, Ivan

    2010-11-01

    In adults, botulinum toxin type A has been studied as a potentially effective treatment for chronic daily headache. For pediatric chronic daily headache, the literature evaluating efficacy of botulinum toxin type A is sparse, with no studies assessing tolerability. The purpose of this retrospective case series study was to assess tolerability and efficacy of botulinum toxin type A in the treatment of pediatric chronic daily headache. The series comprises 10 patients (ages 11-17 years) who received a standard 100-unit dose of onabotulinumtoxinA (trade name, Botox) for refractory chronic daily headache. Attention was given to therapeutic history, efficacy, and tolerability. The patients had attempted an average of 8.0 ± 2.40 S.D. therapies prior to botulinum toxin type A. Most patients reported adverse events from at least one of these prior medications. With botulinum toxin type A, four patients (40%) reported subjective but clinically meaningful relief, consisting of a decrease in headache intensity, and two patients additionally noted a decrease in headache frequency. The four responders noted improvements in quality of life. Three patients experienced minor adverse events from botulinum toxin type A. This case series suggests that botulinum toxin type A can be well tolerated and may be a useful therapeutic in pediatric patients with highly medically intractable chronic daily headache. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. Diversity of the Germination Apparatus in Clostridium botulinum Groups I, II, III and IV

    Directory of Open Access Journals (Sweden)

    Jason Brunt

    2016-10-01

    Full Text Available Clostridium botulinum is a highly dangerous pathogen that forms very resistant endospores that are ubiquitous in the environment, and which, under favourable conditions germinate to produce vegetative cells that multiply and form the exceptionally potent botulinum neurotoxin. To improve the control of botulinum neurotoxin-forming clostridia, it is important to understand the mechanisms involved in spore germination. Here we present models for spore germination in C. botulinum based on comparative genomics analyses, with C. botulinum Groups I and III sharing similar pathways, which differ from those proposed for C. botulinum Groups II and IV. All spores germinate in response to amino acids interacting with a germinant receptor, with four types of germinant receptor identified (encoded by various combinations of gerA, gerB and gerC genes (gerX. There are three gene clusters with an ABC-like configuration; ABC gerX1, ABABCB gerX2 and ACxBBB gerX4, and a single CA-B gerX3 gene cluster. Subtypes have been identified for most germinant receptors types, and the individual GerX subunits of each cluster show similar grouping in phylogenetic trees. C. botulinum Group I contained the largest variety of gerX subtypes, with three gerX1, three gerX2 and one gerX3 subtypes, while C. botulinum Group III contained two gerX1 types and one gerX4. C. botulinum Groups II and IV contained a single germinant receptor, gerX3 and gerX1, respectively. It is likely that all four C. botulinum Groups include a SpoVA channel involved in DPA release. The cortex lytic enzymes present in C. botulinum Groups I and III appear to be CwlJ and SleB, while in C. botulinum Groups II and IV, SleC appears to be important.

  9. Cost analysis of the use of botulinum toxin type A in Spain

    Directory of Open Access Journals (Sweden)

    F. de Andrés-Nogales

    2014-05-01

    Full Text Available Objective: To estimate treatment costs of blepharospasm, cervical dystonia(CD, upper limb spasticity (ULS and spasticity in children withcerebral palsy (SCCP with botulinum neurotoxin type A (BoNT-A inSpain. Method: Annual BoNT-A treatment costs were calculated (2013 ex-factoryprice ( applying RDL 8/2010 and RDL 9/2011 deductions, basedon initial dose (id, average dose (ad and maximum dose (md accordingto Summary of Product Characteristics of Botox® (100U/50U, Dysport®(500U and Xeomin® (100U and considering the use of complete vials.In addition, annual treatment costs were calculated considering the useof vials in more than one patient and also patient population annualtreatment costs based on diseases’ prevalence. Results: Annual BoNT-A treatment costs per patient were estimated atbetween 265 and 2,120 with savings from 10% to 55% accordingto the selected BoNT-A. CD and ULS treatment provided the greatestcost per patient. Botox® provided greater savings in ULS (id/ad, CD(id, and in blepharospasm and SCCP (id/ad/md. Dysport® treatmentwas less costly in CD (md and ULS (md, while Xeomin® was in CD(ad. Based on the estimated treated population in Spain, the annualtreatment costs ranged from 368,392 to 13,958,836 dependingon indication, dose and BoNT-A considered. Conclusions: The appropriate BoNT-A choice would lead to considerablesavings

  10. SYBR green real-time PCR method to detect Clostridium botulinum type A.

    Science.gov (United States)

    Fenicia, Lucia; Anniballi, Fabrizio; De Medici, Dario; Delibato, Elisabetta; Aureli, Paolo

    2007-05-01

    Botulinum toxins (BoNTs) are classically produced by Clostridium botulinum but rarely also from neurotoxigenic strains of Clostridium baratii and Clostridium butyricum. BoNT type A (BoNT/A), BoNT/B, BoNT/E, and very rarely BoNT/F are mainly responsible for human botulism. Standard microbiological methods take into consideration only the detection of C. botulinum. The presumptive identification of the toxigenic strains together with the typing of BoNT has to be performed by mouse bioassay. The development of PCR-based methods for the detection and typing of BoNT-producing clostridia would be an ideal alternative to the mouse bioassay. The objective of this study was to develop a rapid and robust real-time PCR method for detecting C. botulinum type A. Four different techniques for the extraction and purification of DNA from cultured samples were initially compared. Of the techniques used, Chelex 100, DNeasy tissue kit, InstaGene matrix DNA, and boiling, the boiling technique was significantly less efficient than the other three. These did not give statistically different results, and Chelex 100 was chosen because it was less expensive than the others. In order to eliminate any false-negative results, an internal amplification control was synthesized and included in the amplification mixture according to ISO 22174. The specificity of the method was tested against 75 strains of C. botulinum type A, 4 strains of C. botulinum type Ab, and 101 nontarget strains. The detection limit of the reaction was less than 6 x 10(1) copies of C. botulinum type A DNA. The robustness of the method was confirmed using naturally contaminated stool specimens to evaluate the tolerance of inhibitor substances. SYBR green real-time PCR showed very high specificity for the detection of C. botulinum types A and Ab (inclusivity and exclusivity, 100%).

  11. SYBR Green Real-Time PCR Method To Detect Clostridium botulinum Type A▿

    Science.gov (United States)

    Fenicia, Lucia; Anniballi, Fabrizio; De Medici, Dario; Delibato, Elisabetta; Aureli, Paolo

    2007-01-01

    Botulinum toxins (BoNTs) are classically produced by Clostridium botulinum but rarely also from neurotoxigenic strains of Clostridium baratii and Clostridium butyricum. BoNT type A (BoNT/A), BoNT/B, BoNT/E, and very rarely BoNT/F are mainly responsible for human botulism. Standard microbiological methods take into consideration only the detection of C. botulinum. The presumptive identification of the toxigenic strains together with the typing of BoNT has to be performed by mouse bioassay. The development of PCR-based methods for the detection and typing of BoNT-producing clostridia would be an ideal alternative to the mouse bioassay. The objective of this study was to develop a rapid and robust real-time PCR method for detecting C. botulinum type A. Four different techniques for the extraction and purification of DNA from cultured samples were initially compared. Of the techniques used, Chelex 100, DNeasy tissue kit, InstaGene matrix DNA, and boiling, the boiling technique was significantly less efficient than the other three. These did not give statistically different results, and Chelex 100 was chosen because it was less expensive than the others. In order to eliminate any false-negative results, an internal amplification control was synthesized and included in the amplification mixture according to ISO 22174. The specificity of the method was tested against 75 strains of C. botulinum type A, 4 strains of C. botulinum type Ab, and 101 nontarget strains. The detection limit of the reaction was less than 6 × 101 copies of C. botulinum type A DNA. The robustness of the method was confirmed using naturally contaminated stool specimens to evaluate the tolerance of inhibitor substances. SYBR green real-time PCR showed very high specificity for the detection of C. botulinum types A and Ab (inclusivity and exclusivity, 100%). PMID:17369349

  12. Detection and Quantification of Biologically Active Botulinum Neurotoxin Serotypes A and B Using a Förster Resonance Energy Transfer-Based Quantum Dot Nanobiosensor

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yun [Center for Food; Fry, H. Christopher [Center for Nanoscale Materials, Argonne National Laboratory, 9700 S. Cass Avenue, Lemont, DuPage County, Illinois 60439, United States; Skinner, Guy E. [Center for Food; Schill, Kristin M. [Center for Food; Duncan, Timothy V. [Center for Food

    2017-03-20

    Botulinum neurotoxin (BoNT) is the most potent toxin known. The ingestion of food contaminated with biologically active BoNT causes foodborne botulism, which can lead to respiratory paralysis, coma, and death after ingestion of as little as 70 mu g for a 70 kg human. Because of its lethality and challenges associated with current detection methods, there is an urgent need for highly sensitive rapid screening techniques capable of detecting biologically active BoNT. Here, we describe a Forster resonance energy transfer-based nanobiosensor that uses quantum dots (QDs) and two specific quencher-labeled peptide probes to detect and differentiate two biologically active forms of BoNT, serotypes A and B, which were responsible for 80% of human foodborne botulism cases in the U.S. from 2012 to 2015. Each peptide probe contains an enzymatic cleavage site specific to only one serotype. QDs were selected based on the spectral overlap with the quenchers. In the presence of the target BoNT serotype, the peptide probe is cleaved and the quenching of QD photoluminescence (PL) is reduced, giving a signal that is easily detected by a PL spectrophotometer. This sensor performance was evaluated with light chains of BoNT/A and BoNT/B (LcA and LcB), catalytic domains of the respective serotypes. LcA and LcB were detected in 3 h with limits of detection of 0.2 and 2 ng/mL, respectively. The specificity of the sensor was evaluated, and no cross-reactivity from nontarget serotypes was observed with 2 h of incubation. Because each serotype-specific peptide is conjugated to a QD with a unique emission wavelength, multiple biologically active BoNT serotypes could be detected in one PL spectrum. The sensor was also shown to be responsive to BoNT/A and BoNT/B holotoxins. Good performance of this sensor implies its potential application as a rapid screening method for biologically active BoNT/A and BoNT/B in the laboratory and in the field.

  13. Botulinum Neurotoxin A Injected Ipsilaterally or Contralaterally into the Striatum in the Rat 6-OHDA Model of Unilateral Parkinson’s Disease Differently Affects Behavior

    Directory of Open Access Journals (Sweden)

    Veronica A. Antipova

    2017-06-01

    Full Text Available Parkinson’s disease (PD is one of the most frequent neurodegenerative disorders. The loss of dopaminergic neurons in the substantia nigra leads to a disinhibition of cholinergic interneurons in the striatum. Pharmacotherapeutical strategies of PD-related hypercholinism have numerous adverse side effects. We previously showed that ipsilateral intrastriatal injections of 1 ng in unilaterally 6-hydroxydopamine (6-OHDA-lesioned rats inhibit apomorphine-induced rotation behavior significantly up to 6 months. In this study, we extended the behavioral testing of ipsilateral botulinum neurotoxin A (BoNT-A-injection and additionally investigated the impact of intrastriatal BoNT-A-injections contralateral to the 6-OHDA-lesioned hemisphere on the basal ganglia circuity and motor functions. We hypothesized that the interhemispheric differences of acetylcholine (ACh concentration seen in unilateral hemi-PD should be differentially and temporally influenced by the ipsilateral or contralateral injection of BoNT-A. Hemi-PD rats were injected with 1 ng BoNT-A or vehicle substance into either the ipsilateral or contralateral striatum 6 weeks after 6-OHDA-lesion and various behaviors were tested. In hemi-PD rats intrastriatal ipsilateral BoNT-A-injections significantly reduced apomorphine-induced rotations and increased amphetamine-induced rotations, but showed no significant improvement of forelimb usage and akinesia, lateralized sensorimotor integration and also no effect on spontaneous locomotor activity. However, intrastriatal BoNT-A-injections contralateral to the lesion led to a significant increase of the apomorphine-induced turning rate only 2 weeks after the treatment. The apomorphine-induced rotation rate decreases thereafter to a value below the initial rotation rate. Amphetamine-induced rotations were not significantly changed after BoNT-A-application in comparison to sham-treated animals. Forelimb usage was temporally improved by contralateral Bo

  14. Potent new small-molecule inhibitor of botulinum neurotoxin serotype A endopeptidase developed by synthesis-based computer-aided molecular design.

    Directory of Open Access Journals (Sweden)

    Yuan-Ping Pang

    Full Text Available Botulinum neurotoxin serotype A (BoNTA causes a life-threatening neuroparalytic disease known as botulism. Current treatment for post exposure of BoNTA uses antibodies that are effective in neutralizing the extracellular toxin to prevent further intoxication but generally cannot rescue already intoxicated neurons. Effective small-molecule inhibitors of BoNTA endopeptidase (BoNTAe are desirable because such inhibitors potentially can neutralize the intracellular BoNTA and offer complementary treatment for botulism. Previously we reported a serotype-selective, small-molecule BoNTAe inhibitor with a K(i (app value of 3.8+/-0.8 microM. This inhibitor was developed by lead identification using virtual screening followed by computer-aided optimization of a lead with an IC(50 value of 100 microM. However, it was difficult to further improve the lead from micromolar to even high nanomolar potency due to the unusually large enzyme-substrate interface of BoNTAe. The enzyme-substrate interface area of 4,840 A(2 for BoNTAe is about four times larger than the typical protein-protein interface area of 750-1,500 A(2. Inhibitors must carry several functional groups to block the unusually large interface of BoNTAe, and syntheses of such inhibitors are therefore time-consuming and expensive. Herein we report the development of a serotype-selective, small-molecule, and competitive inhibitor of BoNTAe with a K(i value of 760+/-170 nM using synthesis-based computer-aided molecular design (SBCAMD. This new approach accounts the practicality and efficiency of inhibitor synthesis in addition to binding affinity and selectivity. We also report a three-dimensional model of BoNTAe in complex with the new inhibitor and the dynamics of the complex predicted by multiple molecular dynamics simulations, and discuss further structural optimization to achieve better in vivo efficacy in neutralizing BoNTA than those of our early micromolar leads. This work provides new insight

  15. Botulinum toxin type A therapy for hemifacial spasm.

    Science.gov (United States)

    Costa, J; Espírito-Santo, C; Borges, A; Ferreira, J J; Coelho, M; Moore, P; Sampaio, C

    2005-01-25

    Hemifacial spasm is characterised by unilateral involuntary contractions of muscles innervated by the facial nerve. The usual cause is a vessel touching the facial nerve near its origin from the brain stem. Although it is a benign condition it can cause significant cosmetic and functional disability. It is a chronic disease and spontaneous recovery is very rare. The two treatments routinely available are microvascular decompression and Botulinum Toxin type A (BtA) muscular injections. To determine whether botulinum toxin (BtA) is an effective and safe treatment for hemifacial spasm. We searched the Cochrane Movement Disorders Group trials register, the Cochrane Central Register of Controlled Trials (The Cochrane Library Issue 1, 2004), MEDLINE (1977 to December 2003), EMBASE (1977 to December 2003), and reference lists of articles. We also contacted drug manufacturers and researchers in the field. Randomised studies comparing BtA with placebo in people with hemifacial spasm. Two reviewers independently assessed trial quality and extracted data. Study authors were contacted for additional information. Adverse effects information was collected from the trials. We found only one small randomised, placebo-controlled trial involving 11 people. It was a crossover trial during which patients underwent four sets of injections, comparing placebo with three different doses of BtA - formulation Botox(r) (low dose: one-half of the intermediate dose; intermediate dose; and high dose: twice the intermediate dose), and one of placebo. In this trial BtA was superior to placebo. The findings of this single eligible trial support the results of large, open, case-control studies showing a benefit rate between 76 and 100%. This effect size probably makes it very difficult to perform new large placebo controlled trials for hemifacial spasm. Despite the paucity of good quality controlled data, all the studies available suggest that BtA is effective and safe for treating hemifacial spasm

  16. Adverse event reporting for botulinum toxin type A.

    Science.gov (United States)

    Batra, R Sonia; Dover, Jeffrey S; Arndt, Kenneth A

    2005-12-01

    A recent article published in the Journal of the American Academy of Dermatology reviewed adverse events regarding botulinum toxin type A (BTX-A) reported to the Food and Drug Administration between 1989 and 2003. Although postmarketing surveillance is a vital mechanism to ensure drug safety, the events reported in this paper must be considered in context to be appropriately interpreted. The majority of data was related to therapeutic rather than cosmetic use. The proportion of serious adverse events was 33-fold higher for therapeutic use and no deaths were reported after cosmetic use. The data were derived from a spontaneous reporting system and do not include assessments of causality between the BTX-A and purported adverse events. The report notes that over a third of these events were related to off-label use of BTX-A, a common practice in dermatology, yet no significant differences were reported in rates of adverse events between on-label and off-label use. The report reflects a favorable safety profile for cosmetic use of BTX-A, and if misinterpreted, could lead to unreasonable conclusions regarding a product considered to be highly safe and effective.

  17. Analysis of the neurotoxin complex genes in Clostridium botulinum A1-A4 and B1 strains: BoNT/A3, /Ba4 and /B1 clusters are located within plasmids.

    Directory of Open Access Journals (Sweden)

    Theresa J Smith

    Full Text Available BACKGROUND: Clostridium botulinum and related clostridial species express extremely potent neurotoxins known as botulinum neurotoxins (BoNTs that cause long-lasting, potentially fatal intoxications in humans and other mammals. The amino acid variation within the BoNT is used to categorize the species into seven immunologically distinct BoNT serotypes (A-G which are further divided into subtypes. The BoNTs are located within two generally conserved gene arrangements known as botulinum progenitor complexes which encode toxin-associated proteins involved in toxin stability and expression. METHODOLOGY/PRINCIPAL FINDINGS: Because serotype A and B strains are responsible for the vast majority of human botulism cases worldwide, the location, arrangement and sequences of genes from eight different toxin complexes representing four different BoNT/A subtypes (BoNT/A1-Ba4 and one BoNT/B1 strain were examined. The bivalent Ba4 strain contained both the BoNT/A4 and BoNT/bvB toxin clusters. The arrangements of the BoNT/A3 and BoNT/A4 subtypes differed from the BoNT/A1 strains and were similar to those of BoNT/A2. However, unlike the BoNT/A2 subtype, the toxin complex genes of BoNT/A3 and BoNT/A4 were found within large plasmids and not within the chromosome. In the Ba4 strain, both BoNT toxin clusters (A4 and bivalent B were located within the same 270 kb plasmid, separated by 97 kb. Complete genomic sequencing of the BoNT/B1 strain also revealed that its toxin complex genes were located within a 149 kb plasmid and the BoNT/A3 complex is within a 267 kb plasmid. CONCLUSIONS/SIGNIFICANCE: Despite their size differences and the BoNT genes they contain, the three plasmids containing these toxin cluster genes share significant sequence identity. The presence of partial insertion sequence (IS elements, evidence of recombination/gene duplication events, and the discovery of the BoNT/A3, BoNT/Ba4 and BoNT/B1 toxin complex genes within plasmids illustrate the

  18. Understanding the functional anatomy of the frontalis and glabellar complex for optimal aesthetic botulinum toxin type A therapy.

    Science.gov (United States)

    Lorenc, Z Paul; Smith, Stacy; Nestor, Mark; Nelson, Diane; Moradi, Amir

    2013-10-01

    Botulinum neurotoxin type A (BoNTA) is approved for the treatment of glabellar lines and also is commonly injected in an off-label fashion in the frontalis (i.e., frontalis epicranius) muscle to improve the appearance of horizontal forehead lines. This study aimed to review and discuss both the anatomy and physiology of the frontalis muscle and its relationship with antagonist muscles in the upper face and to provide a guide for the use of BoNTA to treat forehead rhytides while minimizing the occurrence of complications such as brow ptosis. A PubMed search was conducted to identify practitioner opinion and clinical publications on the efficacy and safety of BoNTA for aesthetic treatment of the upper face. The use of BoNTA produces durable improvement in the appearance of moderate to severe horizontal forehead lines. Dose and injection technique must be adjusted and individualized based on the variable anatomy and function/mass of muscles in the forehead and upper face as well as on patient goals. Optimal aesthetic outcomes can be achieved by skillfully balancing the opposing effects of the frontalis muscle and its intricate interactions with the procerus, corrugator supercilii, depressor supercilii, and orbicularis oculi muscles. The use of BoNTA to improve the aesthetic appearance of horizontal forehead lines is optimized when clinicians take into account variations in frontalis muscle function and position, anatomy of the brow, and proper injection technique when they devise individualized treatment regimens.

  19. Quantitative reduction of saliva production with botulinum toxin type B injection into the salivary glands.

    Science.gov (United States)

    Turk-Gonzales, Melissa; Odderson, Ib R

    2005-03-01

    Drooling is common in patients with neurological disorders. Recently, botulinum toxin type B has been shown to be effective in the treatment of drooling. The authors present a unique case of a 57-year-old man with a history of a brainstem stroke and severe drooling. The patient's parotid and submandibular glands were injected under ultra-sound guidance with botulinum toxin type B. Saliva was collected and quantified before and after the injections by 2 different collection methods: suctioning and dental rolls. Total saliva production decreased by 23.8% after injection of the parotid glands and by 85.8% after submandibular injection compared to the preinjection level. The 2 methods demonstrated similar results. In addition, the patient experienced less drooling and increased participation in therapies without any side effects. This case demonstrates that saliva secretion and drooling can effectively be treated by injections of botulinum toxin type B into the salivary glands.

  20. Cost-utility analysis of botulinum toxin type A products for the treatment of cervical dystonia.

    Science.gov (United States)

    Kazerooni, Rashid; Broadhead, Christine

    2015-02-15

    A cost-utility analysis of botulinum toxin type A products for the treatment of cervical dystonia (CD) was conducted. A cost-utility analysis of botulinum toxin type A products was conducted from the U.S. government perspective using a decision-analysis model with a one-year time horizon. Probabilities of the model were taken from several studies using the three botulinum type A products approved by the Food and Drug Administration for the treatment of CD: onabotulinumtoxinA (Botox), abobotulinumtoxinA (Dysport), and incobotulinumtoxinA (Xeomin). The main outcome measurement was successful treatment response with botulinum toxin type A, measured in quality-adjusted life years (QALYs). Response was defined as a patient who experienced improvement of CD symptoms without a severe adverse event. Probabilistic sensitivity analysis was conducted to test robustness of the base-case results. All three botulinum toxin type A agents were cost-effective at a willingness-to-pay threshold of $100,000 per QALY. Xeomin was the most cost-effective with a cost-effectiveness ratio of $27,548 per QALY. Xeomin was dominant over the alternative agents with equivalent efficacy outcomes and lower costs. Dysport had the second lowest cost-effectiveness ratio ($36,678), followed by Botox ($49,337). The probabilistic sensitivity analysis supported the results of the base-case analysis. Dysport was associated with the lowest wastage (2.2%), followed by Xeomin (10%) and Botox (22.9%). A cost-utility analysis found that Xeomin was the more cost-effective botulinum toxin type A product compared with Botox and Dysport for the treatment of CD. Wastage associated with the respective products may have a large effect on the cost-effectiveness of the agents. Copyright © 2015 by the American Society of Health-System Pharmacists, Inc. All rights reserved.

  1. Hemicrania continua responsive to botulinum toxin type a: a case report.

    Science.gov (United States)

    Khalil, Modar; Ahmed, Fayyaz

    2013-05-01

    Hemicrania continua (HC) is a primary headache disorder with full response to indomethacin as one of its diagnostic criteria; however, indomethacin's side effects could limit its use in HC. We report a 33-year-old lady whose headache fulfilled the criteria for HC, but the patient developed gastric side effect to indomethacin and did not respond to other pharmacological treatments; however, injecting botulinum toxin type A has led to complete resolution of all of her symptoms. We hypothesize the mechanism by which botulinum toxin type A has led to our results through reviewing recent functional neuroimaging findings used to understand the pathophysiology of different primary headache disorders. © 2013 American Headache Society.

  2. High pressure thermal inactivation of Clostridium botulinum type E endospores - kinetic modeling and mechanistic insights.

    Science.gov (United States)

    Lenz, Christian A; Reineke, Kai; Knorr, Dietrich; Vogel, Rudi F

    2015-01-01

    Cold-tolerant, neurotoxigenic, endospore forming Clostridium (C.) botulinum type E belongs to the non-proteolytic physiological C. botulinum group II, is primarily associated with aquatic environments, and presents a safety risk for seafood. High pressure thermal (HPT) processing exploiting the synergistic effect of pressure and temperature can be used to inactivate bacterial endospores. We investigated the inactivation of C. botulinum type E spores by (near) isothermal HPT treatments at 300-1200 MPa at 30-75°C for 1 s to 10 min. The occurrence of heat and lysozyme susceptible spore fractions after such treatments was determined. The experimental data were modeled to obtain kinetic parameters and represented graphically by isoeffect lines. In contrast to findings for spores of other species and within the range of treatment parameters applied, zones of spore stabilization (lower inactivation than heat treatments alone), large heat susceptible (HPT-induced germinated) or lysozyme-dependently germinable (damaged coat layer) spore fractions were not detected. Inactivation followed first order kinetics. Dipicolinic acid release kinetics allowed for insights into possible inactivation mechanisms suggesting a (poorly effective) physiologic-like (similar to nutrient-induced) germination at ≤450 MPa/≤45°C and non-physiological germination at >500 MPa/>60-70°C. Results of this study support the existence of some commonalities in the HPT inactivation mechanism of C. botulinum type E spores and Bacillus spores although both organisms have significantly different HPT resistance properties. The information presented here contributes to closing the gap in knowledge regarding the HPT inactivation of spore formers relevant to food safety and may help industrial implementation of HPT processing. The markedly lower HPT resistance of C. botulinum type E spores compared with the resistance of spores from other C. botulinum types could allow for the implementation of milder

  3. High pressure thermal inactivation of Clostridium botulinum type E endospores – kinetic modeling and mechanistic insights

    Science.gov (United States)

    Lenz, Christian A.; Reineke, Kai; Knorr, Dietrich; Vogel, Rudi F.

    2015-01-01

    Cold-tolerant, neurotoxigenic, endospore forming Clostridium (C.) botulinum type E belongs to the non-proteolytic physiological C. botulinum group II, is primarily associated with aquatic environments, and presents a safety risk for seafood. High pressure thermal (HPT) processing exploiting the synergistic effect of pressure and temperature can be used to inactivate bacterial endospores. We investigated the inactivation of C. botulinum type E spores by (near) isothermal HPT treatments at 300–1200 MPa at 30–75°C for 1 s to 10 min. The occurrence of heat and lysozyme susceptible spore fractions after such treatments was determined. The experimental data were modeled to obtain kinetic parameters and represented graphically by isoeffect lines. In contrast to findings for spores of other species and within the range of treatment parameters applied, zones of spore stabilization (lower inactivation than heat treatments alone), large heat susceptible (HPT-induced germinated) or lysozyme-dependently germinable (damaged coat layer) spore fractions were not detected. Inactivation followed first order kinetics. Dipicolinic acid release kinetics allowed for insights into possible inactivation mechanisms suggesting a (poorly effective) physiologic-like (similar to nutrient-induced) germination at ≤450 MPa/≤45°C and non-physiological germination at >500 MPa/>60–70°C. Results of this study support the existence of some commonalities in the HPT inactivation mechanism of C. botulinum type E spores and Bacillus spores although both organisms have significantly different HPT resistance properties. The information presented here contributes to closing the gap in knowledge regarding the HPT inactivation of spore formers relevant to food safety and may help industrial implementation of HPT processing. The markedly lower HPT resistance of C. botulinum type E spores compared with the resistance of spores from other C. botulinum types could allow for the implementation of

  4. High pressure thermal inactivation of Clostridium botulinum type E endospores – kinetic modeling and mechanistic insights

    Directory of Open Access Journals (Sweden)

    Christian Andreas Lenz

    2015-07-01

    Full Text Available Cold-tolerant, neurotoxigenic, endospore forming Clostridium (C. botulinum type E belongs to the non-proteolytic physiological C. botulinum group II, is primarily associated with aquatic environments, and presents a safety risk for seafood. High pressure thermal (HPT processing exploiting the synergistic effect of pressure and temperature can be used to inactivate bacterial endospores.We investigated the inactivation of C. botulinum type E spores by (near isothermal HPT treatments at 300 – 1200 MPa at 30 – 75 °C for 1 s – 10 min. The occurrence of heat and lysozyme susceptible spore fractions after such treatments was determined. The experimental data were modeled to obtain kinetic parameters and represented graphically by isoeffect lines. In contrast to findings for spores of other species and within the range of treatment parameters applied, zones of spore stabilization (lower inactivation than heat treatments alone, large heat susceptible (HPT-induced germinated or lysozyme-dependently germinable (damaged coat layer spore fractions were not detected. Inactivation followed 1st order kinetics. DPA release kinetics allowed for insights into possible inactivation mechanisms suggesting a (poorly effective physiologic-like (similar to nutrient-induced germination at ≤ 450 MPa/≤ 45 °C and non-physiological germination at >500 MPa/>60 – 70 °C.Results of this study support the existence of some commonalities in the HPT inactivation mechanism of C. botulinum type E spores and Bacillus spores although both organisms have significantly different HPT resistance properties. The information presented here contributes to closing the gap in knowledge regarding the HPT inactivation of spore formers relevant to food safety and may help industrial implementation of HPT processing. The markedly lower HPT resistance of C. botulinum type E spores than spores from other C. botulinum types, could allow for the implementation of milder processes without

  5. Characterisation of botulinum toxins type A and B, by matrix-assisted laser desorption ionisation and electrospray mass spectrometry

    NARCIS (Netherlands)

    Baar, B.L.M. van; Hulst, A.G.; Jong, A.L. de; Wils, E.R.J.

    2002-01-01

    A method earlier developed for the mass spectrometric (MS) identification of tetanus toxin (TTx) was applied to botulinum toxins type A and B (BTxA and BTxB). Botulinum toxins are extremely neurotoxic bacterial toxins, likely to be used as biological warfare agent. Biologically active BTxA and BTxB

  6. Successful treatment of a postpolio tinnitus with type a botulinum toxin.

    Science.gov (United States)

    Scolozzi, Paolo; Carrera, Emmanuel; Jaques, Bertrand; Kuntzer, Thierry

    2005-07-01

    Objective tinnitus is a symptom often observed in patients with chronic hyperactivity of masticatory muscles. We report here the unusual case of a 63-year-old woman who developed a distressing tinnitus related to contractions of reinnervated masticatory muscles. This reinnervation process was caused by a postpolio syndrome that gave rise to an acoustic resonance phenomenon transmitted to the middle ear as an audible sound. The tinnitus was successfully treated with electromyography-guided intramuscular injections of type A botulinum toxin. The intramuscular injection of botulinum toxin was found to be effective in relieving severe and disabling postpolio tinnitus.

  7. Successful use of botulinum toxin type a in the treatment of refractory postoperative dyspareunia.

    Science.gov (United States)

    Park, Amy J; Paraiso, Marie Fidela R

    2009-08-01

    Refractory dyspareunia presents a challenging therapeutic dilemma. A woman with defecatory dysfunction and dyspareunia presented with stage 2 prolapse. She underwent laparoscopic and vaginal pelvic floor reconstruction with excision of endometriosis. The patient experienced increased dyspareunia and de novo vaginismus postoperatively that were refractory to trigger point injections, physical therapy, and medical and surgical management. She underwent botulinum toxin type A injections into her levator ani muscles, which allowed her to have sexual intercourse again after 2 years of apareunia with no recurrence of pain for 12 months. Injecting botulinum toxin into the levator ani muscles shows promise for postoperative patients who develop vaginismus and do not respond to conservative therapy.

  8. The use of botulinum toxin type A in cosmetic facial procedures

    NARCIS (Netherlands)

    Jaspers, G. W. C.; Pijpe, J.; Jansma, J.

    Over the past decade, facial cosmetic procedures have become more commonplace ill dentistry and oral and maxillofacial surgery. An increasing number of patients seek minimal invasive procedures. One of the most requested procedures is treatment with botulinum toxin type A (BoNTA). Treatment of

  9. Serial Casting as an Adjunct to Botulinum Toxin Type A Treatment in Children With Cerebral Palsy and Spastic Paraparesis With Scissoring of the Lower Extremities.

    Science.gov (United States)

    Dai, Alper I; Demiryürek, Abdullah T

    2017-06-01

    The purpose of this study was to examine whether combination therapy of serial casting and botulinum toxin type A injection can further enhance the effects of botulinum toxin type A in children with cerebral palsy with scissoring of both legs. This study was a prospective and randomized trial. The children were divided into 2 groups, one of which received serial casting after botulinum toxin type A (n = 40), and the other which only received botulinum toxin type A (n = 40). Serial casting started 3 weeks after the botulinum toxin type A. Both groups received physiotherapy. Groups were assessed at baseline then compared at 6 and 12 weeks following the intervention. Significant improvements in Gross Motor Function Measure-66 and Caregiver Health Questionnaire were recorded in both groups ( P casting group ( P casting after botulinum toxin type A can enhance the benefits of botulinum toxin type A in children with cerebral palsy.

  10. Impact of Clostridium botulinum genomic diversity on food safety.

    Science.gov (United States)

    Peck, Michael W; van Vliet, Arnoud Hm

    2016-08-01

    The deadly botulinum neurotoxin formed by Clostridium botulinum is the causative agent of foodborne botulism. The increasing availability of C. botulinum genome sequences is starting to allow the genomic diversity of C. botulinum Groups I and II and their neurotoxins to be characterised. This information will impact on microbiological food safety through improved surveillance and tracing/tracking during outbreaks, and a better characterisation of C. botulinum Groups I and II, including the risk presented, and new insights into their biology, food chain transmission, and evolution.

  11. Analgesic effects of intra-articular botulinum toxin Type B in a murine model of chronic degenerative knee arthritis pain

    Directory of Open Access Journals (Sweden)

    Stephanie Anderson

    2010-09-01

    Full Text Available Stephanie Anderson1,2, Hollis Krug1,2, Christopher Dorman1, Pari McGarraugh1, Sandra Frizelle1, Maren Mahowald1,21Rheumatology Section, Veteran’s Affairs Medical Center, Minneapolis, Minnesota; 2Division of Rheumatology and Autoimmune Diseases, University of Minnesota Medical School, Minneapolis, Minnesota, USAObjective: To evaluate the analgesic effectiveness of intra-articular botulinum toxin Type B (BoNT/B in a murine model of chronic degenerative arthritis pain.Methods and materials: Chronic arthritis was produced in adult C57Bl6 mice by intra-articular injection of Type IV collagenase into the left knee. Following induction of arthritis, the treatment group received intra-articular BoNT/B. Arthritic control groups were treated with intra-articular normal saline or sham injections. Pain behavior testing was performed prior to arthritis, after induction of arthritis, and following treatments. Pain behavior measures included analysis of gait impairment (spontaneous pain behavior and joint tenderness evaluation (evoked pain response. Strength was measured as ability to grasp and cling.Results: Visual gait analysis showed significant impairment of gait in arthritic mice that improved 43% after intra-articular BoNT/B, demonstrating a substantial articular analgesic effect. Joint tenderness, measured with evoked pain response scores, increased with arthritis induction and decreased 49.5% after intra-articular BoNT/B treatment. No improvement in visual gait scores or decrease in evoked pain response scores were found in the control groups receiving intra-articular normal saline or sham injections. Intra-articular BoNT/B was safe, and no systemic effects or limb weakness was noted.Conclusions: This study is the first report of intra-articular BoNT/B for analgesia in a murine model of arthritis pain. The results of this study validate prior work using intra-articular neurotoxins in murine models. Our findings show chronic degenerative arthritis

  12. Botulinum toxin type A in chronic plantar fasciitis: clinical effects one year after injection.

    Science.gov (United States)

    Díaz-Llopis, Ismael V; Gómez-Gallego, Diego; Mondéjar-Gómez, Francisco J; López-García, Alfredo; Climent-Barberá, Jose M; Rodríguez-Ruiz, Carmen M

    2013-08-01

    To determine whether the efficacy of botulinum toxin type A in chronic plantar fasciitis was maintained for more than six months after treatment. Observational follow-up study. Twenty-four patients who received botulinum toxin type A injection in a previous randomized study of chronic plantar fasciitis (active treatment group) and who presented a benefit one month after treatment. A visual analogue scale for pain and the Foot Health Status Questionnaire were used to re-evaluate results 12 months after the botulinum toxin injection. No further injections of botulinum toxin had been administered during the follow-up period. Patients were also asked to give a subjective assessment of treatment outcome. At 12 months, compared with the six-month evaluation, there was a further improvement in foot pain measured using the visual analogue scale, though this did not reach significance (1.78 at 6 months versus 1.22 at 12 months; P = 0.142). However, there were significant improvements in two domains of Foot Health Status Questionnaire: foot pain (91.11 at 6 months versus 80.00 at 12 months; P = 0.001) and foot function (96.19 at 6 months versus 89.38 at 12 months; P = 0.047). There was a small, non-significant deterioration in the shoe and foot health domains. Satisfaction with the outcome was good or very good in the large majority of patients. In patients with chronic plantar fasciitis, the positive effect detected six months after treatment with botulinum toxin type A was maintained at 12 months and there was a further improvement in pain and foot function.

  13. Botulinum Toxin Type a as a Therapeutic Agent against Headache and Related Disorders.

    Science.gov (United States)

    Luvisetto, Siro; Gazerani, Parisa; Cianchetti, Carlo; Pavone, Flaminia

    2015-09-23

    Botulinum neurotoxin A (BoNT/A) is a toxin produced by the naturally-occurring Clostridium botulinum that causes botulism. The potential of BoNT/A as a useful medical intervention was discovered by scientists developing a vaccine to protect against botulism. They found that, when injected into a muscle, BoNT/A causes a flaccid paralysis. Following this discovery, BoNT/A has been used for many years in the treatment of conditions of pathological muscle hyperactivity, like dystonias and spasticities. In parallel, the toxin has become a "glamour" drug due to its power to ward off facial wrinkles, particularly frontal, due to the activity of the mimic muscles. After the discovery that the drug also appeared to have a preventive effect on headache, scientists spent many efforts to study the potentially-therapeutic action of BoNT/A against pain. BoNT/A is effective at reducing pain in a number of disease states, including cervical dystonia, neuropathic pain, lower back pain, spasticity, myofascial pain and bladder pain. In 2010, regulatory approval for the treatment of chronic migraine with BoNT/A was given, notwithstanding the fact that the mechanism of action is still not completely elucidated. In the present review, we summarize experimental evidence that may help to clarify the mechanisms of action of BoNT/A in relation to the alleviation of headache pain, with particular emphasis on preclinical studies, both in animals and humans. Moreover, we summarize the latest clinical trials that show evidence on headache conditions that may obtain benefits from therapy with BoNT/A.

  14. Botulinum Toxin Type A as a Therapeutic Agent against Headache and Related Disorders

    Directory of Open Access Journals (Sweden)

    Siro Luvisetto

    2015-09-01

    Full Text Available Botulinum neurotoxin A (BoNT/A is a toxin produced by the naturally-occurring Clostridium botulinum that causes botulism. The potential of BoNT/A as a useful medical intervention was discovered by scientists developing a vaccine to protect against botulism. They found that, when injected into a muscle, BoNT/A causes a flaccid paralysis. Following this discovery, BoNT/A has been used for many years in the treatment of conditions of pathological muscle hyperactivity, like dystonias and spasticities. In parallel, the toxin has become a “glamour” drug due to its power to ward off facial wrinkles, particularly frontal, due to the activity of the mimic muscles. After the discovery that the drug also appeared to have a preventive effect on headache, scientists spent many efforts to study the potentially-therapeutic action of BoNT/A against pain. BoNT/A is effective at reducing pain in a number of disease states, including cervical dystonia, neuropathic pain, lower back pain, spasticity, myofascial pain and bladder pain. In 2010, regulatory approval for the treatment of chronic migraine with BoNT/A was given, notwithstanding the fact that the mechanism of action is still not completely elucidated. In the present review, we summarize experimental evidence that may help to clarify the mechanisms of action of BoNT/A in relation to the alleviation of headache pain, with particular emphasis on preclinical studies, both in animals and humans. Moreover, we summarize the latest clinical trials that show evidence on headache conditions that may obtain benefits from therapy with BoNT/A.

  15. Clostridium botulinum type D/C intoxication in a dairy cow stock in Saxony-Anhalt (Germany)--report on an innovative diagnostic approach.

    Science.gov (United States)

    Dlabola, Janine; Hashish, Emad; Pauly, Birgit; Kubisiak, Bernd; Behm, Ingrid; Heseler, Rüdiger; Schliephake, Annette; Wieler, Lothar H; Neubauer, Heinrich; Seyboldt, Christian

    2016-01-01

    Botulism in cattle is a rare but serious disease. In Germany there is no obligation to report botulism in animals and therefore a precise morbidity rate is not available. In this manuscript we describe an outbreak of Clostridium (C.) botulinum neurotoxin (BoNT) intoxication in a Saxony-Anhalt dairy cow stock of 286 Holstein-Friesian cows and offspring in spring/summer 2009 and its diagnostic approach. 122 animals showed clinical signs of BoNT intoxication. 115 of the affected animals (40.2% of the herd) independent of age died or had to be euthanized. Therapeutic attempts failed in almost all diseased cows, only four calves and three heifers recovered. Diagnostic samples of several animals (n = 4) (liver, ruminal and intestinal contents) and feed (n = 6) were tested for BoNT genes by polymerase chain reaction (PCR). BoNT gene type D was found in several (n = 8) organ samples. The PCR results allowed a preselection of samples for BoNT that were then tested by the mouse bioassay. Thus, the number of mice being inoculated in the mouse bioassay could be reduced. The mouse bioassay turned out positive (wasp-waist) in three preselected organ samples and the neutralization test of one sample with type-specific antitoxin confirmed the presence of BoNT type D. We succeeded in isolating a C. botulinum strain from a liver sample which was typed as a D/C mosaic strain by sequence analysis of the toxin gene. However, the source of the BoNT intoxication could not be traced back.

  16. Risk of Clostridium botulinum type E toxin production in blue crab meat packaged in four commercial-type containers.

    Science.gov (United States)

    Harrison, M A; Garren, D M; Huang, Y W; Gates, K W

    1996-03-01

    The aim of this investigation was to determine if a risk of Clostridium botulinum growth and toxin production existed in four different packaged crabmeat products. Freshly picked blue crab meat was inoculated with 10(3) to 10(4) spores per g of a mixed pool of four strains of C. botulinum type E (Beluga, Minnesota, G21-5, and 070). The lump crabmeat was packaged in four different packaging containers: (i) 12-oz copolymer polyethylene cups currently used by most crab processors; (ii) 12-oz copolymer polyethylene cups with heat-shrink, tamper-evident low-density polypropylene seals; (iii) 8-oz copolymer polyethylene cups with easy-open aluminum ends: and (iv) 8-oz copolymer polypropylene cups with integral tamper-evident pull-tabs. The packages were stored at either 4 degrees C for 21 days or 10 degrees C for 15 days. Storage at 10 degrees C was used to simulate temperature abuse. The mouse bioassay was used to detect the presence of C. botulinum toxin. Psychotrophic and anaerobic populations were enumerated and were found to increase with time regardless of packaging type. No botulinum toxin was detected in any of the four packaging types stored at 4 degrees C or 10 degrees C throughout the entire storage period.

  17. BotDB: A database resource for the clostridial neurotoxins.

    Science.gov (United States)

    Lebeda, Frank J

    2004-03-01

    BotDB is a database designed to encapsulate the rapidly expanding amount of information about the structure and function of the botulinum (BoNT) and tetanus neurotoxins and to track a variety of basic and applied research efforts. The AceDB management system was chosen for this project because of its flexibility in manipulating semistructured data sets and for its information retrieval query languages. In addition to storing amino and nucleic acid sequences of the clostridial neurotoxin genes and proteins, BotDB provides sequence data for new classes of objects, including neurotoxin mutants, substrates and their mutants, associated nontoxic proteins, and C-fragment vaccine candidates. New data types provide information on detection assays for the neurotoxins and on structural data from X-ray crystallographic and circular dichroism spectroscopic studies. Kinetic parameters from biochemical experiments include reaction rates for substrate cleavage and block of neurotransmission. The structures and kinetic characteristics of presently known chemical inhibitors are also being archived. All of these data are associated with citations of the relevant literature for on-line annotation. Graphics viewer programs are provided to display stored images and three-dimensional representations of protein structures. BotDB is in the alpha test phase of development and will become a publicly available Web site.

  18. Clostridium botulinum type E occurs and grows in the alga Cladophora glomerata

    Science.gov (United States)

    Byappanahalli, M.N.; Whitman, R.L.

    2009-01-01

    In recent years, massive avian die-offs from Clostridium botulinum type E infection have occurred in the Sleeping Bear Dunes National Lakeshore (SLBE) area of Lake Michigan. These outbreaks have been coincidental with massive blooms of the green algae Cladophora, mostly Cladophora glomerata. We tested the hypothesis that Clostridium botulinum type E can grow under suitable conditions in these algal mats. In a lab mesocosm study, Cladophora from four outbreak-impacted beaches from SLBE were compared with four unimpacted beaches in the Milwaukee–Racine area for bontE gene of Clostridium botulinum. Frequency of the bontE gene was higher after incubation (25 °C for up to 6 weeks) of Cladophora from impacted vs. the unimpacted area. Since no type E gene was detected initially in Cladophora from any of the eight locations, we infer that the increased occurrence of type E gene arose from spore germination or vegetative Clostridium growth within the existing algal mats of SLBE. Moreover, we found that the congener Clostridium perfringens readily grows in mesocosms containing Cladophora.

  19. Ninhydrin sweat test: a simple method for detecting antibodies neutralizing botulinum toxin type A.

    Science.gov (United States)

    Voller, Bernhard; Moraru, Ekaterina; Auff, Eduard; Benesch, Michael; Poewe, Werner; Wissel, Jörg; Müller, Jörg; Entner, Tanja; Bigalke, Hans; Schnider, Peter

    2004-08-01

    Approximately 5% of patients with cervical dystonia receiving repeated botulinum neurotoxin A (BoNT/A) injections develop secondary loss of treatment benefit. Currently available tests to directly detect neutralizing BoNT/A antibodies (BoNT/A-AB) are either expensive or time consuming. To establish a simple, clinically useful test for antibody detection, we adapted the ninhydrin sweat test (NST). Eighteen dystonic patients with secondary nonresponse and clinically suspected BoNT/A-AB formation were tested for BoNT/A-AB in the mouse diaphragm test (MDT). In addition, the size of the anhidrotic area was determined by the NST 21 days after an intradermal dose of 10 U Dysport into the hypothenar region of the left palm. In nine patients, positive BoNT-AB titers were found in the MDT. There was a significant correlation between the BoNT/A-AB titers and the anhidrotic area (Spearman's rho = -0.9, P < 0.0001). Both tests provided comparably good results with respect to qualitative antibody detection. In the clinical situation of secondary nonresponse to BoNT/A therapy, the economical NST may be a helpful tool to detect neutralizing BoNT/A-AB. Copyright 2004 Movement Disorder Society

  20. Effect of botulinum toxin type-A in patients with focal spasticity

    OpenAIRE

    Selimoglu, Esra; Turgut, Selin Turan; Akpinar, Pinar; Yumusakhuylu, Yasemin; Haliloglu, Sema; Baklacioglu, Hatice Sule; Icagasioglu, Afitap

    2015-01-01

    OBJECTIVE: To investigate the effect of botulinum toxin type-A (BTX-A) on spasticity and function in patients with focal spasticity. METHODS: Patients attended to the outpatient clinic of physical medicine and rehabilitation department with a diagnosis of focal spasticity and had BTX-A injections because of spasticty were evaluated for the study. Demographic data, exercise status, orthoses, drugs used for spasticity, functional status, stages of spasticity of muscles before and after 1st and ...

  1. Dynamic splinting after treatment with botulinum toxin type-A: a randomized controlled pilot study.

    Science.gov (United States)

    Lai, Jenny M; Francisco, Gerard E; Willis, F Buck

    2009-02-01

    Over 1.5 million Americans are diagnosed with a stroke each year, and excessive flexion or extension (hypertonia) of upper extremity joints are common secondary conditions. The purpose of this study was to compare the efficacy of botulinum toxin type-A and manual therapy, with the adjunct treatment of dynamic splinting on range of motion, spasticity, and elbow flexor hypertonia, in a randomized trial. Thirty-six subjects were recruited for this pilot study and all exhibited hypertonia in elbow flexion. Six patients were excluded due to noncompliance. Testing was done with pre/post active range of motion in elbow extension, and the Modified Ashworth Scale (extension) for spasticity. All patients received the current standard of care: botulinum toxin type-A injections and manual therapy. Experimental patients were randomly assigned adjunct treatment with Elbow Extension Dynasplint. Thirty patients completed the study (mean age [SD] 52+/-17 years). The percentage of change in active range of motion in elbow extension was greater for the experimental than for control subjects (33.5% vs. 18.7%). The Modified Ashworth Scale (extension) scores showed comparable changes of a mean 9.3% improvement for experimental versus 8.6% for the control subjects. This study confirmed the efficacy of botulinum toxin type-A in tone management and occupational therapy in contracture reduction. It also showed the value of dynamic splinting in maintaining gains in range of motion.

  2. The Role of Botulinum Toxin Type A in the Clinical Management of Refractory Anterior Knee Pain.

    Science.gov (United States)

    Singer, Barbara J; Silbert, Benjamin I; Silbert, Peter L; Singer, Kevin P

    2015-08-25

    Anterior knee pain is a highly prevalent condition affecting largely young to middle aged adults. Symptoms can recur in more than two thirds of cases, often resulting in activity limitation and reduced participation in employment and recreational pursuits. Persistent anterior knee pain is difficult to treat and many individuals eventually consider a surgical intervention. Evidence for long term benefit of most conservative treatments or surgical approaches is currently lacking. Injection of Botulinum toxin type A to the distal region of vastus lateralis muscle causes a short term functional "denervation" which moderates the influence of vastus lateralis muscle on the knee extensor mechanism and increases the relative contribution of the vastus medialis muscle. Initial data suggest that, compared with other interventions for anterior knee pain, Botulinum toxin type A injection, in combination with an active exercise programme, can lead to sustained relief of symptoms, reduced health care utilisation and increased activity participation. The procedure is less invasive than surgical intervention, relatively easy to perform, and is time- and cost-effective. Further studies, including larger randomized placebo-controlled trials, are required to confirm the effectiveness of Botulinum toxin type A injection for anterior knee pain and to elaborate the possible mechanisms underpinning pain and symptom relief.

  3. Comparison of sea snake (Hydrophiidae) neurotoxin to cobra (Naja) neurotoxin.

    Science.gov (United States)

    Komori, Yumiko; Nagamizu, Masaya; Uchiya, Kei-Ichi; Nikai, Toshiaki; Tu, Anthony T

    2009-12-01

    Both sea snakes and cobras have venoms containing postsynaptic neurotoxins. Comparison of the primary structures indicates many similarities, especially the positions of the four disulfide bonds. However, detailed examination reveals differences in several amino acid residues. Amino acid sequences of sea snake neurotoxins were determined, and then compared to cobra neurotoxins by computer modeling. This allowed for easy comparison of the similarities and differences between the two types of postsynaptic neurotoxins. Comparison of computer models for the toxins of sea snakes and cobra will reveal the three dimensional difference of the toxins much clearer than the amino acid sequence alone.

  4. [3 cases of Clostridium botulinum type C intoxication in the dog].

    Science.gov (United States)

    Tjalsma, E J

    1990-06-01

    Three cases of dogs showing symptoms of acute lower motor neurone disease are reported, in which a diagnosis of type C botulism was established. In one of the dogs, botulism was believed to be due to type C toxin-containing carcases in poultry droppings; in the other two, causative relationship with poultry was extremely suggestive. The toxin was shown to be present in the serum on days one and three. Clostridium botulinum was still present in cultures of the faeces within sixteen days after onset of the symptoms.

  5. Inhibition of type A and type B (proteolytic) Clostridium botulinum by sorbic acid.

    Science.gov (United States)

    Lund, B M; George, S M; Franklin, J G

    1987-01-01

    The effect of sorbic acid in the pH range 4.9 to 7.0 on the probability P of growth of a single vegetative bacterium of proteolytic strains of Clostridium botulinum has been determined by comparison of the most probable number count of the bacteria in media at pH 4.9 to 7.0 containing a series of concentrations of potassium sorbate and in a nutrient medium at pH 6.8 to 7.0. The media were maintained under strictly anaerobic conditions at a redox potential equivalent to lower than -350 mV at pH 7. In medium adjusted to the required pH with HCl, P for strain ZK3 (type A) at pH 5.1 or 5.5 after 2 days at 30 degrees C was similar to that at pH 6.8 to 7.0 but was slightly lower at pH 4.9. Potassium sorbate inhibited growth, the inhibition being a function of the concentration of undissociated sorbic acid. A calculated undissociated sorbic acid concentration of 156 mg/liter delayed growth of strain ZK3 (type A) but did not result in a significant decrease in P after an incubation time of 14 days. Higher concentrations of undissociated sorbic acid caused longer delays before maximum most probable number counts developed, and a calculated undissociated sorbic acid concentration of 282 mg/liter decreased log P for strain ZK3 after an incubation time of 14 days by a factor of 5.5 to 7.5. Four additional type A strains and five type B strains were inhibited to an extent comparable to inhibition of strain ZK3.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3300545

  6. Quantum dot immunoassays in renewable surface column and 96-well plate formats for the fluorescence detection of Botulinum neurotoxin using high-affinity antibodies

    Energy Technology Data Exchange (ETDEWEB)

    Warner, Marvin G.; Grate, Jay W.; Tyler, Abby J.; Ozanich, Richard M.; Miller, Keith D.; Lou, Jianlong; Marks, James D.; Bruckner-Lea, Cindy J.

    2009-09-01

    A fluorescence sandwich immunoassay using high affinity antibodies and quantum dot (QD) reporters has been developed for detection of botulinum toxin serotype A (BoNT/A). For the development of the assay, a nontoxic recombinant fragment of the holotoxin (BoNT/A-HC-fragment) has been used as a structurally valid simulant for the full toxin molecule. The antibodies used, AR4 and RAZ1, bind to nonoverlapping epitopes present on both the full toxin and on the recombinant fragment. In one format, the immunoassay is carried out in a 96-well plate with detection in a standard plate reader. Detection down to 31 pM of the BoNT/Hc-fragment was demonstrated with a total incubation time of 3 hours, using AR4 as the capture antibody and QD-coupled RAZ1 as the reporter. In a second format, the AR4 capture antibody was coupled to Sepharose beads, and the immunochemical reactions were carried out in microcentrifuge tubes with an incubation time of 1 hour. These beads were subsequently captured and concentrated in a rotating rod “renewable surface” flow cell as part of a sequential injection fluidic system. This flow cell was equipped with a fiber optic system for fluorescence measurements. In PBS buffer solution matrix, the BoNT/A-HC-fragment was detected to concentrations as low as 5 pM using the fluidic measurement approach.

  7. Recombination and Insertion Events Involving the Botulinum Neurotoxin Complex Genes in Clostridium botulinum Types A, B, E and F and Clostridium butyricum Type E Strains

    Science.gov (United States)

    2009-10-05

    component. Int J Syst Bacteriol 1996, 46:1105-1112. 22. Lindstrom M, Hinderink K, Somervuo P, Kivinieme K, Nevas M, Chen Y, Auvinen P, Carter AT...Gasteiger E, Martin MJ, Michoud K, O’Donovan C, Phan I, Pilbout S, Schneider M: The SWISS-PROT protein knowledgebase and its supplement TrEMBL in 2003

  8. Horizontal gene transfer of toxin genes in Clostridium botulinum: Involvement of mobile elements and plasmids

    OpenAIRE

    Skarin, Hanna; Segerman, Bo

    2011-01-01

    Intoxication with the potent botulinum neurotoxin (BoNT) gives rise to the serious paralytic illness botulism. BoNT is part of a complex that consists of the neurotoxin and several associated components, all encoded by the bont gene cluster. This gene cluster has likely been subjected to horizontal gene transfer between different groups of clostridia, which has given rise to the genetically diverse species Clostridium botulinum. C. botulinum is divided into four physiological groups (I–IV), w...

  9. Characterisation of botulinum toxins type C, D, E, and F by matrix-assisted laser desorption ionisation and electrospray mass spectrometry

    NARCIS (Netherlands)

    Baar, B.L.M. van; Hulst, A.G.; Jong, A.L. de; Wils, E.R.J.

    2004-01-01

    In a follow-up of the earlier characterisation of botulinum toxins type A and B (BTxA and BTxB) by mass spectrometry (MS), types C, D, E, and F (BTxC, BTxD, BTxE, BTxF) were now investigated. Botulinum toxins are extremely neurotoxic bacterial toxins, likely to be used as biological warfare agent.

  10. Serological Screening Test for Any Botulinum Toxin Type

    Science.gov (United States)

    1982-04-01

    e .* . . . .. .. . .~ -3- isolated by affinity chromatography (4). Type B. The Okra strain culture strain was grown in a medium consist- ing of...1% N-Z Amine type B and 1% N-Z Case (both from Humko Sheffield), 1% yeast extract , 1% glucose, 0.2% calcium lactate and 0.5% sodium thioglyco- llate...siphoning off the supernatant fluid. The harvested sediment was washed with water and then extracted with 0.1 M Tris-HCl buffer, pH 7.5, at rate of 250

  11. Evidence to Use Botulinum Toxin Injections in Tension-Type Headache Management: A Systematic Review

    Directory of Open Access Journals (Sweden)

    Mieszko Wieckiewicz

    2017-11-01

    Full Text Available Tension-type headache (TTH is the most common type of chronic recurring head pain. It can occur twice as often in women as in men. It is the most common type of headache. Its lifetime prevalence is 30% to 78% in the general population. TTH treatment should be multilevel. It often consists of taking pain medication, muscle relaxants, antidepressants, using biofeedback therapy, acupuncture, and attending behavioral therapy. Several clinical trials also suggest that botulinum toxin (BTX may be an effective treatment option for such patients. The aim of this study was to evaluate if BTX can be used as a treatment method in TTH in the light of current medical literature. The authors searched the PubMed, EBSCOhost, OVID, Web of Knowledge, Cochrane Library and CINAHL databases to identify relevant publications. The authors finally included 11 papers—prospective and retrospective cohort studies. Among most of the selected studies, there was a significant correlation between using BTX and reduction of TTH pain intensity and severity. By analyzing qualified studies, it can be concluded that botulinum toxin seems to be effective in TTH management.

  12. Evidence to Use Botulinum Toxin Injections in Tension-Type Headache Management: A Systematic Review.

    Science.gov (United States)

    Wieckiewicz, Mieszko; Grychowska, Natalia; Zietek, Marek; Wieckiewicz, Gniewko; Smardz, Joanna

    2017-11-15

    Tension-type headache (TTH) is the most common type of chronic recurring head pain. It can occur twice as often in women as in men. It is the most common type of headache. Its lifetime prevalence is 30% to 78% in the general population. TTH treatment should be multilevel. It often consists of taking pain medication, muscle relaxants, antidepressants, using biofeedback therapy, acupuncture, and attending behavioral therapy. Several clinical trials also suggest that botulinum toxin (BTX) may be an effective treatment option for such patients. The aim of this study was to evaluate if BTX can be used as a treatment method in TTH in the light of current medical literature. The authors searched the PubMed, EBSCOhost, OVID, Web of Knowledge, Cochrane Library and CINAHL databases to identify relevant publications. The authors finally included 11 papers-prospective and retrospective cohort studies. Among most of the selected studies, there was a significant correlation between using BTX and reduction of TTH pain intensity and severity. By analyzing qualified studies, it can be concluded that botulinum toxin seems to be effective in TTH management.

  13. [Tetanus and botulinum toxins are zinc metallopeptidases: molecular mechanisms and inhibition of their neurotoxicity].

    Science.gov (United States)

    Cornille, F; Roques, B P

    1999-01-01

    The very high toxicity of tetanus neurotoxin (TeNT) and botulinum neurotoxin (BoNT) are related to their nature of zinc metallopeptidases able to selectively cleave small proteins involved in neurotransmitters exocytosis. At this time, there is no efficient and selective therapy towards tetanos and tobulism as well as protection against a possible spreading of the toxins. We have therefore investigated the minimum sequences of TeNT and BoNT substrates allowing an efficient and simple fluorescent dosage of the enzymatic activity to be developed. Using synaptobrevin (93 amino acids) as substrate of TeNT and several fragments synthesised by solid phase method, we have shown that the clostridial neurotoxins behave as allosteric-type enzymes. This is the first example in zinc metallopeptidases. Based on these results a strategy, including the use of combinatorial chemistry, was carried out issuing in the design of the first potent inhibitors of TeNT and BoNT.

  14. Binding properties of Clostridium botulinum type C progenitor toxin to mucins.

    Science.gov (United States)

    Nakamura, Toshio; Takada, Noriko; Tonozuka, Takashi; Sakano, Yoshiyuki; Oguma, Keiji; Nishikawa, Atsushi

    2007-04-01

    It has been reported that Clostridium botulinum type C 16S progenitor toxin (C16S toxin) first binds to the sialic acid on the cell surface of mucin before invading cells [A. Nishikawa, N. Uotsu, H. Arimitsu, J.C. Lee, Y. Miura, Y. Fujinaga, H. Nakada, T. Watanabe, T. Ohyama, Y. Sakano, K. Oguma, The receptor and transporter for internalization of Clostridium botulinum type C progenitor toxin into HT-29 cells, Biochem. Biophys. Res. Commun. 319 (2004) 327-333]. In this study we investigated the binding properties of the C16S toxin to glycoproteins. Although the toxin bound to membrane blotted mucin derived from the bovine submaxillary gland (BSM), which contains a lot of sialyl oligosaccharides, it did not bind to neuraminidase-treated BSM. The binding of the toxin to BSM was inhibited by N-acetylneuraminic acid, N-glycolylneuraminic acid, and sialyl oligosaccharides strongly, but was not inhibited by neutral oligosaccharides. Both sialyl alpha2-3 lactose and sialyl alpha2-6 lactose prevented binding similarly. On the other hand, the toxin also bound well to porcine gastric mucin. In this case, neutral oligosaccharides might play an important role as ligand, since galactose and lactose inhibited binding. These results suggest that the toxin is capable of recognizing a wide variety of oligosaccharide structures.

  15. Polymerase chain reaction for detection of Clostridium botulinum types A, B and E in food, soil and infant faeces.

    Science.gov (United States)

    Szabo, E A; Pemberton, J M; Gibson, A M; Eyles, M J; Desmarchelier, P M

    1994-06-01

    The application of the polymerase chain reaction (PCR) for detection of Clostridium botulinum types A, B and E in foods, environmental and clinical samples was evaluated and compared to the mouse bioassay. Samples inoculated with 10, 100 and 1000 spores of Cl. botulinum types A and B included pasteurized milk, UHT milk, infant formula, infant faeces, meat juice, canned tuna, mushrooms, blood sausage and soil. Clostridium botulinum type E spores were inoculated into fish eggs, canned tuna, picked herring, raw fish and soil at similar levels. Spores were added to 2.5 g of each sample with the exception of soil which was inoculated in 10 g samples. The presence of Cl. botulinum in sample enrichments was determined by both PCR and the bioassay. An overall correlation of 95.6% was observed between PCR results and the mouse bioassay. Of the total of 114 samples tested there was disparity between the mouse bioassay and the PCR in three samples of soil inoculated with 100 type A or E spores and 10 type B spores per 10 g, respectively, and two samples of infant faeces inoculated with 10 type A or B spores per 2.5 g. All of these samples gave negative animal results and positive PCR results.

  16. Clostridium botulinum Spores Found in Honey from Small Apiaries in Poland

    Directory of Open Access Journals (Sweden)

    Wojtacka Joanna

    2016-12-01

    Full Text Available A total of 102 honey samples collected from small apiaries (≤ 20 hives in Poland were analysed for the presence of Clostridium botulinum spores. The samples were prepared using the dilution centrifugation method and cultured in parallel in cooked meat medium (CMM and tripticase peptone glucose yeast (TPGY enrichment broths. Identification of toxin types A, B, and E of Clostridium botulinum strains was performed with the use of the multiplex PCR method. Positive samples were also subjected to quantitative analysis with the use of Clostridium botulinum Isolation Agar Base (CBAB. The prevalence analysis showed 22 (21.6% samples contaminated with C. botulinum spores. The major serotype detected was botulin neurotoxin type A – 16 (72.7% whereas type B was found in 3 (13.6% honey samples and type E also only in 3 (13.6% honey samples. Dual-toxin-producing strains were noted. The average quantity of spores in PCR - C. botulinum positive samples was 190 in 1 gram of honey.

  17. SjAPI-2 is the first member of a new neurotoxin family with Ascaris-type fold and KCNQ1 inhibitory activity.

    Science.gov (United States)

    Chen, Jing; Zhang, Chuangeng; Yang, Weishan; Cao, Zhijian; Li, Wenxin; Chen, Zongyun; Wu, Yingliang

    2015-08-01

    Peptides with Ascaris-type fold are a new kind of toxins founded from venomous animals recently. Functionally, these unique toxin peptides had been identified as potent protease inhibitors, which was similar to other known Ascaris-type peptides from non-venomous animals. Whether Ascaris-type peptides from venom animals have neurotoxin activities remains unclear. Here, a scorpion toxin SjAPI-2 with Ascaris-type fold was characterized to have a neurotoxin activity, which can selectively inhibit KCNQ1 potassium channel. SjAPI-2 had 62 amino acid residues, including 10 cysteine residues. Charged residue analyses showed that two acidic residues of SjAPI-2 were regionally distributed, and 10 basic residues were distributed widely throughout the whole peptide, which was similar to classical potassium channel toxins. Pharmacological studies confirmed that SjAPI-2 was a selective KCNQ1 potassium channel inhibitor with weak effects on other potassium channels, such as Kv1.1, Kv1.2, Kv1.3, SKCa2, SKCa3, and IKCa channels. Concentration-dependent studies showed that SjAPI-2 inhibited the KCNQ1 potassium channel with an IC50 of 771.5±169.9 nM. To the best of our knowledge, SjAPI-2 is the first neurotoxin with a unique Ascaris-type fold, providing novel insights into the divergent evolution of neurotoxins from venomous animals. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Evaluating the synergistic neutralizing effect of anti-botulinum oligoclonal antibody preparations.

    Directory of Open Access Journals (Sweden)

    Eran Diamant

    Full Text Available Botulinum neurotoxins (BoNT are considered some of the most lethal known substances. There are seven botulinum serotypes, of which types A, B and E cause most human botulism cases. Anti-botulinum polyclonal antibodies (PAbs are currently used for both detection and treatment of the disease. However, significant improvements in immunoassay specificity and treatment safety may be made using monoclonal antibodies (MAbs. In this study, we present an approach for the simultaneous generation of highly specific and neutralizing MAbs against botulinum serotypes A, B, and E in a single process. The approach relies on immunization of mice with a trivalent mixture of recombinant C-terminal fragment (Hc of each of the three neurotoxins, followed by a parallel differential robotic hybridoma screening. This strategy enabled the cloning of seven to nine MAbs against each serotype. The majority of the MAbs possessed higher anti-botulinum ELISA titers than anti-botulinum PAbs and had up to five orders of magnitude greater specificity. When tested for their potency in mice, neutralizing MAbs were obtained for all three serotypes and protected against toxin doses of 10 MsLD50-500 MsLD50. A strong synergistic effect of up to 400-fold enhancement in the neutralizing activity was observed when serotype-specific MAbs were combined. Furthermore, the highly protective oligoclonal combinations were as potent as a horse-derived PAb pharmaceutical preparation. Interestingly, MAbs that failed to demonstrate individual neutralizing activity were observed to make a significant contribution to the synergistic effect in the oligoclonal preparation. Together, the trivalent immunization strategy and differential screening approach enabled us to generate highly specific MAbs against each of the A, B, and E BoNTs. These new MAbs may possess diagnostic and therapeutic potential.

  19. A Core Facility for the Study of Neurotoxins of Biological Origin

    Science.gov (United States)

    1992-02-15

    similar toxins from other sources. He has used iodinated preparations of these toxins to extract and solubilize receptors, which appear to be...neurotoxin were isolated from cultures of Clostridium botulinum strain 62A and strain OKRA . The crude neurotoxin was isolated by a series of

  20. Botulinum toxin type A in the treatment of hemifacial spasm: an 11-year experience.

    Science.gov (United States)

    Barbosa, Egberto Reis; Takada, Leonel Tadao; Gonçalves, Lilian Regina; Costa, Rose Mary Paulo do Nascimento; Silveira-Moriyama, Laura; Chien, Hsin Fen

    2010-08-01

    In order to evaluate the long-term effect of botulinum toxin type A (BTX) in the treatment of hemifacial spasm (HFS), a retrospective analysis of patients treated at the Movement Disorders Unit of the Division of Neurology, Clinical Hospital, University of São Paulo, School of Medicine from 1993 to 2004 was made. A total of 808 injections with BTX were administered to 54 patients with HFS. The mean duration of improvement per application was 3.46 months and the mean rate of improvement using subjective judgement by the patient was of 83%. Adverse effects, mostly minor, were observed in 64.8% of patients at least once along the period of follow-up and the most frequent of them was orbicularis oris paralysis (38.8%). There was no decrement in response when compared the first and the last injection recorded.

  1. Effects of botulinum toxin type A on healing of injured skeletal muscles

    Directory of Open Access Journals (Sweden)

    Shokravi Ramin

    2007-01-01

    Full Text Available Objectives: (1 Evaluation of microscopic healing of skeletal muscle fibers after injuries, especially the arrangement of new muscle fibers and scar tissue diameter in the injury region. (2 Evaluation of alterations in microscopy of the healing procedure within skeletal muscles after injury following botulinum toxin type A (BTX -A induced muscle immobilization. Materials and Methods: The study was done on 12 white lab rabbits of either sex in a 6-month period. Results: The immobilization of skeletal muscle fibers as a result of the use of BTX-A after injury caused a qualitative increase in fibrous tissue formation in the area of injury, and the BTX-A-induced immobilization for a period of 6 months led to muscle atrophy.

  2. Analgesic effects of botulinum neurotoxin type A in a model of allyl isothiocyanate- and capsaicin-induced pain in mice.

    Science.gov (United States)

    Luvisetto, Siro; Vacca, Valentina; Cianchetti, Carlo

    2015-02-01

    We evaluate analgesic effects of BoNT/A in relation to the two main transient receptor potentials (TRP), the vanilloid 1 (TRPV1) and the ankyrin 1 (TRPA1), having a role in migraine pain. BoNT/A (15 pg/mouse) was injected in the inner side of the medial part of hindlimb thigh of mice, where the superficial branch of femoral artery is located. We chosen this vascular structure because it is similar to other vascular structures, such as the temporal superficial artery, whose perivascular nociceptive fibres probably contributes to migraine pain. After an interval, ranging from 7 to 30 days, capsaicin (agonist of TRPV1) or allyl isothiocyanate (AITC; agonist of TRPA1) were injected in the same region previously treated with BoNT/A and nocifensive response to chemicals-induced pain was recorded. In absence of BoNT/A, capsaicin and AITC induced extensive nocifensive response, with a markedly different temporal profile: capsaicin induced maximal pain during the first 5 min, while AITC induced maximal pain at 15-30 min after injection. Pretreatment with BoNT/A markedly reduced both the capsaicin- and AITC-induced pain for at least 21 days. These data suggest a long lasting analgesic effect of BoNT/A exerted via prevention of responsiveness of TRPV1 and TRPA1 toward their respective agonists. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Clostridium botulinum group I strain genotyping by 15-locus multilocus variable-number tandem-repeat analysis.

    Science.gov (United States)

    Fillo, Silvia; Giordani, Francesco; Anniballi, Fabrizio; Gorgé, Olivier; Ramisse, Vincent; Vergnaud, Gilles; Riehm, Julia M; Scholz, Holger C; Splettstoesser, Wolf D; Kieboom, Jasper; Olsen, Jaran-Strand; Fenicia, Lucia; Lista, Florigio

    2011-12-01

    Clostridium botulinum is a taxonomic designation that encompasses a broad variety of spore-forming, Gram-positive bacteria producing the botulinum neurotoxin (BoNT). C. botulinum is the etiologic agent of botulism, a rare but severe neuroparalytic disease. Fine-resolution genetic characterization of C. botulinum isolates of any BoNT type is relevant for both epidemiological studies and forensic microbiology. A 10-locus multiple-locus variable-number tandem-repeat analysis (MLVA) was previously applied to isolates of C. botulinum type A. The present study includes five additional loci designed to better address proteolytic B and F serotypes. We investigated 79 C. botulinum group I strains isolated from human and food samples in several European countries, including types A (28), B (36), AB (4), and F (11) strains, and 5 nontoxic Clostridium sporogenes. Additional data were deduced from in silico analysis of 10 available fully sequenced genomes. This 15-locus MLVA (MLVA-15) scheme identified 86 distinct genotypes that clustered consistently with the results of amplified fragment length polymorphism (AFLP) and MLVA genotyping in previous reports. An MLVA-7 scheme, a subset of the MLVA-15, performed on a lab-on-a-chip device using a nonfluorescent subset of primers, is also proposed as a first-line assay. The phylogenetic grouping obtained with the MLVA-7 does not differ significantly from that generated by the MLVA-15. To our knowledge, this report is the first to analyze genetic variability among all of the C. botulinum group I serotypes by MLVA. Our data provide new insights into the genetic variability of group I C. botulinum isolates worldwide and demonstrate that this group is genetically highly diverse.

  4. Clostridium botulinum Group I Strain Genotyping by 15-Locus Multilocus Variable-Number Tandem-Repeat Analysis ▿ †

    Science.gov (United States)

    Fillo, Silvia; Giordani, Francesco; Anniballi, Fabrizio; Gorgé, Olivier; Ramisse, Vincent; Vergnaud, Gilles; Riehm, Julia M.; Scholz, Holger C.; Splettstoesser, Wolf D.; Kieboom, Jasper; Olsen, Jaran-Strand; Fenicia, Lucia; Lista, Florigio

    2011-01-01

    Clostridium botulinum is a taxonomic designation that encompasses a broad variety of spore-forming, Gram-positive bacteria producing the botulinum neurotoxin (BoNT). C. botulinum is the etiologic agent of botulism, a rare but severe neuroparalytic disease. Fine-resolution genetic characterization of C. botulinum isolates of any BoNT type is relevant for both epidemiological studies and forensic microbiology. A 10-locus multiple-locus variable-number tandem-repeat analysis (MLVA) was previously applied to isolates of C. botulinum type A. The present study includes five additional loci designed to better address proteolytic B and F serotypes. We investigated 79 C. botulinum group I strains isolated from human and food samples in several European countries, including types A (28), B (36), AB (4), and F (11) strains, and 5 nontoxic Clostridium sporogenes. Additional data were deduced from in silico analysis of 10 available fully sequenced genomes. This 15-locus MLVA (MLVA-15) scheme identified 86 distinct genotypes that clustered consistently with the results of amplified fragment length polymorphism (AFLP) and MLVA genotyping in previous reports. An MLVA-7 scheme, a subset of the MLVA-15, performed on a lab-on-a-chip device using a nonfluorescent subset of primers, is also proposed as a first-line assay. The phylogenetic grouping obtained with the MLVA-7 does not differ significantly from that generated by the MLVA-15. To our knowledge, this report is the first to analyze genetic variability among all of the C. botulinum group I serotypes by MLVA. Our data provide new insights into the genetic variability of group I C. botulinum isolates worldwide and demonstrate that this group is genetically highly diverse. PMID:22012011

  5. Phosphatidylcholine/deoxycholate lipolysis and hyaluronic acid augmentation to enhance nonsurgical lower facial contouring using botulinum toxin type A.

    Science.gov (United States)

    Wong, Garsing Roger; Chen, Wen-Pei

    2011-06-01

    Botulinum toxin type A can produce dramatic improvements in patients with benign masseteric hypertrophy but this method alone is not as effective for patients with a rounded lower face. The paper describes the effective use of selective lower jowl phosphatidylcholine/deoxycholate lipolysis and chin, cheek, and nose augmentation with hyaluronic acid to refine cosmetic lower facial contouring using botulinum toxin type A in a young Asian woman. A series of treatments was administered over 26 months. The patient's lower cheeks were slimmed and jowl definition was improved producing the patient's desired sculptured, heart-shaped face. The injection-based procedures provided much preferable alternative to surgery from the perspective of both the patient and her family. The authors believe that this is the first case report in the published literature reporting these three methods used in conjunction. © 2011 Wiley Periodicals, Inc.

  6. Botulinum Toxin Type a Injection, Followed by Home-Based Functional Training for Upper Limb Hemiparesis after Stroke

    Science.gov (United States)

    Takekawa, Toru; Kakuda, Wataru; Taguchi, Kensuke; Ishikawa, Atsushi; Sase, Yousuke; Abo, Masahiro

    2012-01-01

    Botulinum toxin type A (BoNT-A) has been reported to be an effective treatment for limb spasticity after stroke. However, the reduction in the spasticity after BoNT-A injection alone does not ensure an improvement in the active motor function of the affected limb. The aim of this study was to clarify the clinical effects of a BoNT-A injection,…

  7. Tyrosine Phosphorylation of Botulinum Neurotoxin Protease Domains

    Science.gov (United States)

    2012-06-01

    phosphorylated tyro - sine indicated by an asterisk (*). LcA− and LcA+ represent Src reaction mixtures that were incubated without and with (0.2mM...CONCLUSION In vitro reaction of LcA, LcB, LcC1, LcD, LcE, and LcG with Tyrosine kinase Src resulted in phosphorylation of several tyro - sine residues

  8. Physical Characterization of Clostridium Botulinum Neurotoxin Genes

    Science.gov (United States)

    1992-02-17

    E TNM! AE N YK I1K P tASTY PSD SLP PV K 1101 TAAAAGCTTAATGTTTOGTT TTAC ýAAACTA.ATATAGCAGAAAATTATAAAATAAAAACTAGAGCTTCTTATTTTAGTGA rTCCTTACCACCAGTAAAA...been shown to be selectable in C. acetobutylicum DSM 1731 (P. Durre, personal communication). The highest priority, however, will be given to

  9. Antispastic therapy with botulinum toxin type A in patients with traumatic spinal cord lesion

    OpenAIRE

    Spiegl, Ulrich J.; Maier, Doris; Gonschorek, Oliver; Heyde, Christoph-Eckhard; Bühren, Volker

    2014-01-01

    Objectives: The purpose of this study was to determine the effect of botulinum toxin injections for the treatment of spasticity after traumatic spinal cord injury. Methods: 9 patients were included in this prospective designed study, with a follow-up of at least 2 years. All patients suffered from a massive spasticity after traumatic spinal cord lesion. Conservative treatment options did not show satisfying results. All patients were injected a maximal dose of 2,000 units of botulinum tox...

  10. Botulinum toxin type a for the treatment of spasticity in children with cerebral palsy

    Directory of Open Access Journals (Sweden)

    Dimitrijević Lidija

    2007-01-01

    Full Text Available Background/Aim. Cerebral palsy (CP is the most common physical disability in childhood. Children have problems with motor functions as a result of limbs spasticity, which leads to severe contractures and limbs deformity. There is a growing interest in the therapeutic role of botulinum toxin type A (BTA in CP. The aim of this study was to examine the effects of BTA on spasticity, active range of motion and functional motor outcomes in children with CP. Methods. This study included 42 children of both sexes, aged 2−6 years, with spastic CP, divided into two groups: group I (21 child treated with BTA and physical therapy, and group II (21 child treated with physical therapy only. The following parameters were analyzed: spasticity; active range of motion of the hip, knee and ankle, and functional motor outcome. These parameters measurements were carried out four times in both groups: before the treatment, three, eight and 16 weeks after the beginning of the treatment. The obtained results were statistically processed and compared. Results. There was no evidence of any significant difference between the groups before the treatment. After eight weeks there was a remarkable difference concerning spasticity reducing on behalf of the group I (group I - 0.76±0.51 vs. II group - 2.17±0.64; p < 0.0001. There was statistically significant difference concerning active range of motion increasing on behalf of the group I (hip abduction: group I - 44.37±1.130 vs. group II - 32.61±8,070, p < 0,01; knee extension: group I - 0,77±1.820 vs. II group - 14.99±7.610, p < 0.01; dorsiflexion of the foot: group I - 11.50±6.080 vs. group II - 8.98±7.850, p < 0,01. A statistically significant difference was found after 16 weeks in functional motor outcome as well, on behalf of the group I: functional motor abilities level in the group I was 1.86 vs. 2.71 in the group II, p < 0.05. Conclusion. Botulinum toxin type A application leads to an important spasticity

  11. Purification and some properties of progenitor toxins of Clostridium botulinum type B.

    Science.gov (United States)

    Kozaki, S; Sakaguchi, S; Sakaguchi, G

    1974-10-01

    Purification of progenitor toxin of Clostridium botulinum type B strain Okra was undertaken by sequential steps of acid precipitation, extraction, ammonium sulfate precipitation, ribonuclease digestion, acid precipitation, protamine treatment, sulphopropyl-Sephadex chromatography, and Sephadex G-200 gel filtration. Two different molecular-sized toxins, named large (L) and medium (M) toxins, were obtained. L toxin was centrifugally homogeneous but electrophoretically heterogeneous. It contained 2.5 x 10(8) to 3.0 x 10(8) mean lethal doses per mg of nitrogen, and its sedimentation constant was 16S. M toxin was centrifugally and electrophoretically homogeneous. It contained 5.5 x 10(8) to 6.0 x 10(8) mean lethal doses per mg of nitrogen, and its sedimentation constant was 12S. The presence of both L and M toxins in spent culture was demonstrated. It seems justified, therefore, to call both progenitor toxins. Both consisted of toxic and nontoxic components. The toxic components of L and M toxins appeared to be identical with each other. The nontoxic component of L toxin was 12S and possessed a hemagglutinin activity of about 0.5% that of type A crystalline toxin; that of M toxin was 7S and possessed no hemagglutinin activity. They were antigenically related but not identical.

  12. Association of toxin-producing Clostridium botulinum with the macroalga Cladophora in the Great Lakes

    Science.gov (United States)

    Chun, Chan Lan; Ochsner, Urs; Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Tepp, William H.; Lin, Guangyun; Johnson, Eric A.; Peller, Julie; Sadowsky, Michael J.

    2013-01-01

    Avian botulism, a paralytic disease of birds, often occurs on a yearly cycle and is increasingly becoming more common in the Great Lakes. Outbreaks are caused by bird ingestion of neurotoxins produced by Clostridium botulinum, a spore-forming, gram-positive, anaerobe. The nuisance, macrophytic, green alga Cladophora (Chlorophyta; mostly Cladophora glomerata L.) is a potential habitat for the growth of C. botulinum. A high incidence of botulism in shoreline birds at Sleeping Bear Dunes National Lakeshore (SLBE) in Lake Michigan coincides with increasingly massive accumulations of Cladophora in nearshore waters. In this study, free-floating algal mats were collected from SLBE and other shorelines of the Great Lakes between June and October 2011. The abundance of C. botulinum in algal mats was quantified and the type of botulism neurotoxin (bont) genes associated with this organism were determined by using most-probable-number PCR (MPN-PCR) and five distinct bont gene-specific primers (A, B, C, E, and F). The MPN-PCR results showed that 16 of 22 (73%) algal mats from the SLBE and 23 of 31(74%) algal mats from other shorelines of the Great Lakes contained the bont type E (bont/E) gene. C. botulinum was present up to 15 000 MPN per gram dried algae based on gene copies of bont/E. In addition, genes for bont/A and bont/B, which are commonly associated with human diseases, were detected in a few algal samples. Moreover, C. botulinum was present as vegetative cells rather than as dormant spores in Cladophora mats. Mouse toxin assays done using supernatants from enrichment of Cladophora containing high densities of C. botulinum (>1000 MPN/g dried algae) showed that Cladophora-borne C. botulinum were toxin-producing species (BoNT/E). Our results indicate that Cladophora provides a habitat for C. botulinum, warranting additional studies to better understand the relationship between this bacterium and the alga, and how this interaction potentially contributes to botulism

  13. Detection of Clostridium botulinum in liquid manure and biogas plant wastes.

    Science.gov (United States)

    Neuhaus, Jürgen; Schrödl, Wieland; Shehata, Awad A; Krüger, Monika

    2015-09-01

    Biogas plants have been considered as a source for possible amplification and distribution of pathogenic bacteria capable of causing severe infections in humans and animals. Manure and biogas wastes could be sources for spore-forming bacteria such as Clostridium botulinum. In the present study, 24 liquid manure and 84 biogas waste samples from dairies where the majority of the cows suffered from chronic botulism were investigated for the presence of botulinum neurotoxins (BoNT) and C. botulinum spores. The prevalence of BoNT/A, B, C, D, and E in biogas wastes was 16.6, 8.3, 10.7, 7.1, and 10.8 %, respectively, while in manure, the prevalence was 0.0, 0.0, 0.0, 8.3, and 4.1 %, respectively. After enrichment of samples in reinforced cultural medium, they were tested for C. botulinum BoNT/A, B, C, D, and E using ELISA (indirect C. botulinum detection). The prevalence of C. botulinum type A, B, C, D, and E samples in biogas wastes was 20.2, 15.5, 19, 10.7, and 34.8 %, respectively, while the prevalence in liquid manure was 0.0, 0.0, 0.0, 8.3, and 12.5 %, respectively. In conclusion, the occurrence of BoNT and C. botulinum spores in biogas waste of diseased animals indicates an increased and underestimated hygienic risk. Application of digestates from biogas fermentations as fertilizers could lead to an accumulation of long lifespan spores in the environment and could be a possible health hazard.

  14. Use of botulinum toxin type A (Botox in the treatment of infantile cerebral palsy

    Directory of Open Access Journals (Sweden)

    A. L. Kurenkov

    2014-01-01

    Full Text Available Botulinum toxin type A (BoNT-A is used in cerebral palsy (CP for more than 20 years. Nevertheless, the unified protocol of injections and doses does not exist by now. The correct selection of target muscles for BoNT-A injections is based on the experience of the doctor, detailed analysis of neurological and orthopedic status of the patient, standard scales to evaluate motor potential of the patient. The article represents the detailed review of international clinical trials for multi-level use of BoNT-A in CP and recommendations on doses calculation. Based on our own observations of efficacy and safety of single-used doses of Botox we present the recommended dose ranges for upper and lower limb that led to clinically significant decrease of spasticity with no undesirable weakness. The review of clinical cases presents the doses per targeted muscle and total doses we used, they are advisory in nature.

  15. Treatment of hemifacial spasm with botulinum toxin type a: effective, long lasting and well tolerated

    Directory of Open Access Journals (Sweden)

    Jean Pierre Mette Batisti

    Full Text Available ABSTRACT Hemifacial spasm (HFS is a common movement disorder characterized by involuntary tonic or clonic contractions of the muscles innervated by the facial nerve. Objective To evaluate the long-term effect of botulinum toxin type A (BTX-A in the treatment of HFS. Methods A retrospective analysis of patients treated at the Movement Disorders Outpatient Clinic in the Neurology Service, Hospital de Clínicas, Federal University of Paraná, Curitiba, from 2009 to 2013 was carried out. A total of 550 BTX-A injections were administered to 100 HFS patients. Results Mean duration of improvement following each injection session was 3.1 months, mean latency to detection of improvement was 7.1 days and mean success rate was 94.7%. Patients were evaluated at an interval of 5.8 months after each application. Adverse effects, which were mostly minor, were observed in 37% of the patients at least once during follow-up. The most frequent was ptosis (35.1%. Conclusion Treatment of HFS with BTX-A was effective, sustainable and safe and had minimal, well-tolerated side effects.

  16. Treatment of hemifacial spasm with botulinum toxin type a: effective, long lasting and well tolerated.

    Science.gov (United States)

    Batisti, Jean Pierre Mette; Kleinfelder, Alais Daiane Fadini; Galli, Natália Bassalobre; Moro, Adriana; Munhoz, Renato Puppi; Teive, Hélio Afonso Ghizoni

    2017-02-01

    To evaluate the long-term effect of botulinum toxin type A (BTX-A) in the treatment of HFS. A retrospective analysis of patients treated at the Movement Disorders Outpatient Clinic in the Neurology Service, Hospital de Clínicas, Federal University of Paraná, Curitiba, from 2009 to 2013 was carried out. A total of 550 BTX-A injections were administered to 100 HFS patients. Mean duration of improvement following each injection session was 3.1 months, mean latency to detection of improvement was 7.1 days and mean success rate was 94.7%. Patients were evaluated at an interval of 5.8 months after each application. Adverse effects, which were mostly minor, were observed in 37% of the patients at least once during follow-up. The most frequent was ptosis (35.1%). Treatment of HFS with BTX-A was effective, sustainable and safe and had minimal, well-tolerated side effects.

  17. Intradermal botulinum toxin type A injection effectively reduces residual limb hyperhidrosis in amputees: a case series.

    Science.gov (United States)

    Charrow, Alexandra; DiFazio, Marc; Foster, Leslie; Pasquina, Paul F; Tsao, Jack W

    2008-07-01

    To study the effectiveness of botulinum toxin type A (BTX-A) therapy for residual limb hyperhidrosis, prosthesis fit and function, and residual and phantom limb pain in patients with limb amputation. Consecutive case series. Outpatient physical medicine and rehabilitation clinic. Walter Reed Army Medical Center patients (N=8) with unilateral traumatic upper- or lower-limb amputation. BTX-A was injected transdermally in a circumferential pattern around the residual limb by using a 1-cm matrix grid. A 10-cm continuous Likert visual analog scale was used to assess residual limb sweating and pain and prosthesis fit and function before and 3 weeks after BTX-A injections. Patients reported a significant reduction in sweating and improvement in prosthesis fit and function after treatment. However, residual limb and phantom pain were unaffected by treatment. BTX-A may be an effective treatment for residual limb hyperhidrosis, resulting in subjective improvement in prosthesis fit and functioning. BTX-A should be considered as a method to manage excessive sweating in the residual limb of traumatic amputees.

  18. Knee flexion contracture treated with botulinum toxin type A in patients with haemophilia (PWH).

    Science.gov (United States)

    Daffunchio, C; Caviglia, H; Nassif, J; Morettil, N; Galatro, G

    2016-01-01

    Knee flexion contracture (KFC) remains a common complication of haemoarthrosis in children and young adults with haemophilia. If the KFC is not treated properly it produces disability, postural and gait abnormalities. Evaluate the effectiveness of conservative treatment of KFC with Botulinum toxin type A (BTX-A) in PWH. Seventeen patients were treated, with 21 affected knees. Mean age was 26 years. The mean follow up was 12 months. We evaluated flexion and KFC pretreatment BTX-A and up to 12 months posttreatment. BTX-A application was in hamstring and calf muscles. To evaluate the function, a questionnaire about different activities was made, and it was checked 3, 6 and 12 months after BTX-A. According to the degree of KFC, knees were divided into 3 groups: Group 1: -10° to -30° (n = 10), Group 2: -31° to -45° (n = 6) Group 3: -46° or more (n = 5). The average KFC improved from -38° to -24°. The improvement was 14° (P < 0.001). The average KFC improvement was 9° in group 1, 17° in group 2, and 23° in group 3. There was a high correlation between the improvement in KFC and the total score of the questionnaire R = 0.77. Treatment of KFC with BTX-A improves knee-related functional activities, with the advantage of being a low-cost procedure and easy to apply. © 2015 John Wiley & Sons Ltd.

  19. Ultrasound-Guided Nerve Block with Botulinum Toxin Type A for Intractable Neuropathic Pain

    Directory of Open Access Journals (Sweden)

    Young Eun Moon

    2016-01-01

    Full Text Available Neuropathic pain includes postherpetic neuralgia (PHN, painful diabetic neuropathy (PDN, and trigeminal neuralgia, and so on. Although various drugs have been tried to treat neuropathic pain, the effectiveness of the drugs sometimes may be limited for chronic intractable neuropathic pain, especially when they cannot be used at an adequate dose, due to undesirable severe side effects and the underlying disease itself. Botulinum toxin type A (BoNT-A has been known for its analgesic effect in various pain conditions. Nevertheless, there are no data of nerve block in PHN and PDN. Here, we report two patients successfully treated with ultrasound-guided peripheral nerve block using BoNT-A for intractable PHN and PDN. One patient had PHN on the left upper extremity and the other patient had PDN on a lower extremity. Due to side effects of drugs, escalation of the drug dose could not be made. We injected 50 Botox units (BOTOX®, Allergan Inc., Irvine, CA, USA into brachial plexus and lumbar plexus, respectively, under ultrasound. Their pain was significantly decreased for about 4–5 months. Ultrasound-guided nerve block with BoNT-A may be an effective analgesic modality in a chronic intractable neuropathic pain especially when conventional treatment failed to achieve adequate pain relief.

  20. Botulinum toxin type A combined with neurodynamic mobilization for lower limb spasticity: a case report.

    Science.gov (United States)

    Villafañe, Jorge H

    2013-03-01

    This case report describes a patient with severe lower limb spasticity treated with botulinum toxin type A (BoNT-A) and neurodynamic mobilization (NM). An 81-year-old male patient presented with a severe spastic lower limbs after total right hip replacement and severe alcoholic polyneuropathy. After the right hip replacement, he presented with generalized spasticity, crouched posture, and a large sacral pressure sore. The severe spasticity in his knees prevented walking. The patient underwent combined treatment with BoNT-A and NM of the lower limb in 4 weekly applications. Evaluations were performed pretreatment, 4 weeks after the injection, and at a follow-up session 9 months after finishing treatment. We measured the following outcomes: pain by the Numerical Rating Scale, spasticity by the Modified Ashworth Scale for Grading Spasticity, acceptance and emotional reaction to the treatment by the Hospital Anxiety and Depression Scale, and functionality by ranges of motion. We found that the patient improved in all of the outcomes after treatment, and these results were maintained during the follow-up. After treatment, the patient was able to improve wound healing by properly positioning himself in bed or on his wheelchair and walking with help. At the follow-up evaluation, the results were maintained. The patient showed good acceptance and decreased anxiety/depression after treatment. For this patient, the combination of NM and BoNT-A treatment decreased pain and spasticity and improved joint ranges of motion.

  1. Changes in masticatory function after injection of botulinum toxin type A to masticatory muscles.

    Science.gov (United States)

    Park, H U; Kim, B I; Kang, S M; Kim, S T; Choi, J H; Ahn, H J

    2013-12-01

    This study examined changes in masticatory function after botulinum toxin type A (BTX-A) injection using objective and subjective tests during 12 weeks. Also, we compared differences in masticatory function between group in which only masseter muscle (M group) was injected and group in which masseter and temporal muscle (M-T group) were injected. Forty subjects were assigned into two groups; M group (n = 20) and the M-T group (n = 20). The Meditoxin(®) was used as BTX-A injection. The mixing ability index (MAI) was used as the objective indicator, and visual analogue scale (VAS) and food intake ability (FIA) index were used as subjective indicators. Overall, the masticatory function drastically declined after 4 weeks and gradually recovered with time. Compared with the pre-injection state, the masticatory function decreased by 89·2% (MAI), 12·2% (FIA) and 32·2% (VAS) 4 weeks after the injection (P masticatory function was significantly decreased after BTX-A injection into the masticatory muscle after 4 and 8 weeks from injection. However, masticatory efficiency measured using MAI could completely recover after 12 weeks. Furthermore, after 8 weeks from the injection, the masticatory function measured after injection into only the masseter muscle was similar to that measured after injection into both masseter and temporal muscle. © 2013 John Wiley & Sons Ltd.

  2. Botulinum toxin type A and myofascial pain syndrome: a retrospective study of 301 patients.

    Science.gov (United States)

    Avendaño-Coy, Juan; Gómez-Soriano, Julio; Valencia, Marta; Estrada, Jesús; Leal, Francisco; Ruiz-Campa, Rafael

    2014-01-01

    Botulinum toxin type A (BTX-A) intramuscular injections have been used for the treatment of myofascial pain syndrome (MPS), although its efficacy remains still unknown and its safety is controversial. To analyze the effectiveness and safety of the injection protocol for BTX-A in the shoulder-scapular and lumbar-pelvic girdles combined with physiotherapy in patients with primary and secondary MPS. Retrospective descriptive study including 301 medical files of patients with persistent MPS. Positive responses to treatment were considered to be a satisfactory level of effectiveness with 50% pain relief or a fully satisfactory level of effectiveness at 80%. Overall, 58.1% of patients obtained a positive result at 6 months. Differences in effectiveness were found between primary MPS (82.9% of patients) and secondary MPS (54.9%; p=0.002). In patients with secondary MPS, differences in effectiveness arose based on pathologies associated with MPS (p=0.03). In 23.9% of cases, mild and temporary adverse effects were observed post-infiltration. BTX-A injections and physiotherapy is an alternative to conventional treatment which should be considered when treating refractory MPS. Nonetheless, the differences in effectiveness based on diagnosis suggest the need to clarify the criteria used to select patients with MPS in future clinical trials and applications.

  3. Botulinum toxin type-B improves sialorrhea and quality of life in bulbaronset amyotrophic lateral sclerosis.

    Science.gov (United States)

    Costa, João; Rocha, Maria Luz; Ferreira, Joaquim; Evangelista, Teresinha; Coelho, Miguel; de Carvalho, Mamede

    2008-04-01

    Sialorrhea is a disabling problem in bulbaronset amyotrophic lateral sclerosis (ALS). Botulinum toxin (BTX) type A and B have been proposed as alternatives to traditional treatments. To evaluate the efficacy and safety of BTX type B in the treatment of sialorrhea in patients with bulbar-onset ALS. Open-label prospective study of BTX type B injections in parotids (1000 U) and submandibular (250 U) glands using anatomic landmarks. Primary outcome was rate of responders (improvement > 50% on visual analogue scales (VAS) of severity and disability of sialorrhea) 1 month post-treatment. Other outcomes included subjective (drooling and quality of daily living questionnaires) and objective (cotton roll weights and number of paper handkerchiefs used) evaluations. Safety evaluations included questionnaires regarding brain stem symptoms. Sixteen ALS patients were included. At 1 month the rate of responders was 75% with a mean reduction of 70% in severity and disabling VASs. Fifteen patients (94 %) reported some benefit with drooling reduction. In objective measurements there was a reduction over 60 % in saliva production and in the number of handkerchiefs used. Onset of effect occurred within 3 days. Most patients reported better quality of living. The most frequent side-effects were viscous saliva, local pain, chewing weakness and respiratory infection. There were no changes in blood pressure or cardiac rate. At 3 months, there was still a positive effect in all outcomes. All patients except one manifested their willingness to repeat treatment. Anatomic guided BTX type B injections seem effective and safe to treat sialorrhea in bulbar-onset ALS.

  4. A double-blind, randomised, crossover trial of two botulinum toxin type a in patients with spasticity.

    Directory of Open Access Journals (Sweden)

    Fábio Coelho Guarany

    Full Text Available Botulinum toxin type A (btxA is one of the main treatment choices for patients with spasticity. Prosigne® a new released botulinum toxin serotype A may have the same effectiveness as Botox® in focal dystonia. However, there are no randomized clinical trials comparing these formulations in spasticity treatment. The aim of our study was to compare the efficacy and safety of Prosigne® with Botox® in the treatment of spasticity.We performed a double-blind, randomized, crossover study consisting of 57 patients with clinically meaningful spasticity. The patients were assessed at baseline, 4 and 12 weeks after Prosigne® or Botox® administration. The main outcomes were changes in the patients' Modified Ashworth Scale (MAS, Functional Independence Measure (FIM and Pediatric Evaluation of Disability Inventory (PEDI scores and adverse effects related to the botulinum toxin. Both of the toxins were significantly effective in relieving the level of spasticity in adults and children. There were no significant differences found between the Prosigne® and Botox® treatments regarding their MAS, FIM and PEDI scores. Likewise, the incidence of adverse effects was similar between the two groups.Our results suggest that Prosigne® and Botox® are both efficient and comparable with respect to their efficacy and safety for the three month treatment of spasticity.ClinicalTrials.gov NCT00819065.

  5. The efficiency of botulinum toxin type A for the treatment of masseter muscle pain in patients with temporomandibular joint dysfunction and tension-type headache.

    Science.gov (United States)

    Pihut, Malgorzata; Ferendiuk, Ewa; Szewczyk, Michal; Kasprzyk, Katarzyna; Wieckiewicz, Mieszko

    2016-01-01

    Temporomandibular joint dysfunction are often accompanied by symptoms of headache such as tension-type headache which is the most frequent spontaneous primary headache. Masseter muscle pain is commonly reported in this group. The purpose of the study was to assess the efficiency of intramuscular botulinum toxin type A injections for treating masseter muscle pain in patients with temporomandibular joint dysfunction and tension-type headache. This prospective outcome study consisted of 42 subjects of both genders aged 19-48 years diagnosed with masseter muscle pain related to temporomandibular joint dysfunction and tension-type headache. The subjects were treated by the intramuscular injection of 21 U (mice units) of botulinum toxin type A (Botox, Allergan) in the area of the greatest cross-section surface of both masseter bellies. Pain intensity was evaluated using visual analogue scale (VAS) and verbal numerical rating scale (VNRS) 1 week before the treatment and 24 weeks after the treatment. The obtained data were analyzed using the Wilcoxon matched pairs test (p ≤ 0,005). The results of this study showed a decrease in the number of referred pain episodes including a decrease in pain in the temporal region bilaterally, a reduction of analgesic drugs intake as well as a decrease in reported values of VAS and VNRS after injections (p = 0,000). The intramuscular botulinum toxin type A injections have been an efficient method of treatment for masseter muscle pain in patients with temporomandibular joint dysfunction and tension-type headache.

  6. Botulinum toxin A is effective to treat tension-type headache caused by hemifacial spasm.

    Science.gov (United States)

    Mizuma, Atsushi; Nagata, Eiichiro; Yasuda, Takashi; Kouchi, Maiko; Nakayama, Taira; Honma, Kazunari; Tokuoka, Kentaro; Kitagawa, Yasuhisa; Nogawa, Shigeru; Takizawa, Shunya

    2017-10-01

    We examined the relationship between hemifacial spasm (HFS; a form of cranio-cervical dystonia) and chronic primary headache, including tension-type headache (TTH). We also examined whether botulinum toxin A (BoNT/A) therapy for HFS ameliorates concomitant TTH. Fifty-one HFS patients receiving BoNT/A therapy were recruited. Patients' characteristics (including age, gender, chronic headache history, exercise habits, stiff neck, cervical spondylolysis history), stress factors, worsening/new onset of headache associated with HFS, and dose of BoNT/A were examined. We diagnosed headache types according to The International Classification of Headache Disorders, 3rd edition, beta. Numerical Rating Scale (NRS) and Headache Impact Test-6 (HIT-6) scores for headache severity were compared between the 6-week baseline before BoNT/A therapy and 6-week follow-up after BoNT/A therapy. Of 51 patients with HFS, 17 (33.3%) reported worsening or new onset of headache (especially TTH) associated with HFS (Group-S), and 34 were not aware of headache (Group-N). Twelve patients (70.6%) in group-S reported improvement of headache after BoNT/A therapy. NRS (from 7 [5-9] to 0 [0-5], p<0.01) and HIT-6 (from 55 [54-64] to 44 [36-52], p<0.001) scores were significantly improved after BoNT/A therapy. Logistic regression analysis revealed significant interaction between TTH associated with HFS and the presence of stress factors (odds ratio 43.11: 2.95-629.39, p<0.001) and history of chronic headache (odds ratio 28.53: 2.96-275.10, p<0.001). Primary headache, especially TTH, is associated with HFS. BoNT/A therapy for HFS may also be indirectly effective for treatment of TTH. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Prospective, double-blind, randomized, parallel-group, dose-ranging study of botulinum toxin type A in men with glabellar rhytids.

    Science.gov (United States)

    Carruthers, Alastair; Carruthers, Jean

    2005-10-01

    The effective dose for treating glabellar lines with botulinum toxin type A in men has not been studied adequately. To compare the safety, efficacy, and duration of response of four doses of botulinum toxin type A on glabellar rhytids in men. Eighty men were randomized to receive a total dose of either 20, 40, 60, or 80 U of botulinum toxin type A (BOTOX, BOTOX Cosmetic, or Vistabel, Allergan, Inc., Irvine, CA, USA) in the glabellar area. Glabellar lines were assessed at rest and maximum frown by a trained observer at baseline, 2 and 4 weeks, and monthly thereafter. Patients provided self-evaluations at the same visits. Adverse events were monitored throughout. The 40, 60, and 80 U doses of botulinum toxin type A were consistently more effective in reducing glabellar lines than the 20 U dose (duration, peak response rate, improvement from baseline). There was a dose-dependent increase in both the response rate at maximum frown and the duration of effect assessed by the trained observer. In addition, the participants reported a dose-dependent reduction in the ability to frown, improvement in their global assessment, and increased feelings of attractiveness, self-confidence, and satisfaction. The incidence of adverse events was not increased with higher doses. Male participants with glabellar rhytids benefit from starting doses of at least 40 U of botulinum toxin type A.

  8. Kinetic and Reaction Pathway Analysis in the Application of Botulinum Toxin A for Wound Healing

    Directory of Open Access Journals (Sweden)

    Frank J. Lebeda

    2012-01-01

    Full Text Available A relatively new approach in the treatment of specific wounds in animal models and in patients with type A botulinum toxin is the focus of this paper. The indications or conditions include traumatic wounds (experimental and clinical, surgical (incision wounds, and wounds such as fissures and ulcers that are signs/symptoms of disease or other processes. An objective was to conduct systematic literature searches and take note of the reactions involved in the healing process and identify corresponding pharmacokinetic data. From several case reports, we developed a qualitative model of how botulinum toxin disrupts the vicious cycle of muscle spasm, pain, inflammation, decreased blood flow, and ischemia. We transformed this model into a minimal kinetic scheme for healing chronic wounds. The model helped us to estimate the rate of decline of this toxin's therapeutic effect by calculating the rate of recurrence of clinical symptoms after a wound-healing treatment with this neurotoxin.

  9. Preoperative progressive pneumoperitoneum and botulinum toxin type A in patients with large incisional hernia.

    Science.gov (United States)

    Bueno-Lledó, J; Torregrosa, A; Ballester, N; Carreño, O; Carbonell, F; Pastor, P G; Pamies, J; Cortés, V; Bonafé, S; Iserte, J

    2017-04-01

    Combination of preoperative progressive pneumoperitoneum (PPP) and botulinum toxin type A (BT) has not been previously reported in the management of large incisional hernia (LIH). Observational study of 45 consecutive patients with LIH between June 2010 and July 2014. The diameters of the hernia sac, the volumes of the incisional hernia (VIH) and the abdominal cavity (VAC), and the VIH/VAC ratio were measured before and after PPP and BT using abdominal CT scan data. We indicated the combination of both techniques when the volume of the incisional hernia (VIH)/volume of the abdominal cavity (VAC) ratio was >20%. The median insufflated volume of air for PPP was 8.600 ± 3.200 cc (4.500-13.250), over a period of 14.3 ± 1.3 days (13-16). BT administration time was 40.2 ± 3.3 days (37-44). We obtained an average value of reduction of 14% of the VIH/VAC ratio after PPP and BT (p < 0.05). Complications associated with PPP were 15.5%, and with surgical technique, 26.6%. No complications occurred during the BT administration. Reconstructive technique was anterior CST and primary fascial closure was achieved in all patients. Median follow-up was 40.5 ± 19 months (12-60) and we reported 2 cases of hernia recurrence (4.4%). Preoperative combination of PPP and BT is feasible and a useful tool in the surgical management of LIH, although at the cost of some specific complications.

  10. Botulinum Toxin Type A Injections as Monotherapy for Upper Limb Essential Tremor Using Kinematics.

    Science.gov (United States)

    Samotus, Olivia; Kumar, Niraj; Rizek, Philippe; Jog, Mandar

    2018-01-01

    There is a significant need for a targeted therapy for essential tremor (ET), as medications have not been developed specifically for ET, and the ones prescribed are often not well-tolerated, so that many patients remain untreated. Recent work has shown that, unlike previous experience, kinematically guided individualized botulinum toxin type A (BoNT-A) injections provide benefit along with minimal weakness. Ours is the first long-term (96-week) safety and efficacy study of BoNT-A as monotherapy for ET using kinematically driven injection parameters. Ten ET patients were administered six serial BoNT-A treatments every 16 weeks and were assessed at 6 weeks following treatment. During each study visit, the Fahn-Tolosa-Marin (FTM) scale, the Unified Parkinson's Disease Rating Scale, and the Quality of Life for Essential Tremor Questionnaire (QUEST) were administered along with kinematic assessment of the treated limb. Participants performed scripted tasks with motion sensors placed over each arm joint. Dosing patterns were determined using the movement disorder neurologist's interpretation of muscles contributing to the kinematically analyzed upper limb tremor biomechanics. There was a 33.8% (pfunctional improvement (FTM part C) and a 39.8% (ptremor score was reduced by 62.9% (p=0.001) in the treated and by 44.4% (p=0.03) in the untreated arm at week 96 compared to week 48. Individualized BoNT-A dosing patterns to each individual's tremor biomechanics provided an effective monotherapy for ET as function improved without functionally limiting muscle weakness.

  11. Intravesical botulinum toxin a injections do not benefit patients with ulcer type interstitial cystitis.

    Science.gov (United States)

    Lee, Cheng-Ling; Kuo, Hann-Chorng

    2013-01-01

    Ulcer type and non-ulcer type interstitial cystitis/bladder pain syndromes (IC/BPS) are considered different disease entities. Thus, intravesical botulinum toxin A (BoNT-A) treatment outcomes could differ for each entity. To evaluate and compare the treatment outcomes of BoNT-A injections for treatment of each IC/BPS type. Prospective interventional study. Tertiary medical center affiliated with Buddhist Tzu Chi General Hospital and Tzu Chi University, Taiwan. Forty-four consecutive patients with IC/BPS for whom conventional treatments failed were prospectively enrolled in this study. Patients were classified as having ulcer (n = 10) or non-ulcer (n = 30) IC/BPS based on their previous cystoscopic findings. All patients received 4 sets of intravesical BoNT-A injections (100 U in 40 suburothelial injections) every 6 months. The primary end-point was the global response assessment (GRA) 6 months after the fourth set of BoNT-A injections. Secondary end-points included the O'Leary-Sant score (OSS) including symptom indexes (ICSI) and problem indexes (ICPI), visual analog scale (VAS) pain score, voiding diary, and urodynamics variables. After 4 sets of BoNT-A injections, 15 patients with non-ulcer IC/BPS had GRA scores >= 2, while the other 15 had GRA scores ulcer IC/BPS had GRA scores ulcer IC/BPS had significantly higher daytime frequency, nocturia, smaller functional bladder capacity, smaller voided volume, greater VAS, smaller maximal bladder capacity, and greater glomerulation grade than did patients with non-ulcer IC/BPS. After 4 sets of BoNT-A injections, patients with non-ulcer IC/BPS and GRA scores >= 2 or ulcer IC/BPS showed no significant change in any clinical or urodynamic variable. After failure of repeated BoNT-A injections, all 10 patients with ulcer IC/BPS underwent transurethral electrocauterization of their ulcers, which resulted in immediate pain relief. Lack of a control arm in this study. Repeated intravesical BoNT-A injections provided effective

  12. Botulinum toxin type-A effect as a preemptive treatment in a model of acute trigeminal pain: a pre-clinical double-blind and placebo-controlled study

    Directory of Open Access Journals (Sweden)

    Elcio Juliato Piovesan

    2011-02-01

    Full Text Available The purpose of this study was to investigate if botulinum neurotoxin type-A (BoNT/A had a preemptive antinociceptive effect in a formalin-induced orofacial pain model (FT. To test this hypothesis, male Rattus norvegicus were injected with isotonic saline solution 0.9% or BoNT/A administered as a 40 μl bolus, lateral to their nose, at 24 hours, 8, 15, 22, 29 or 36 days pre-FT. The procedures were repeated 42 days later. Influence on motor activity was assessed through the open-field test. Pain scores corresponded to the time spent rubbing and flicking the injected area. Animals pre-treated with BoNT/A at the first protocol (8 days subgroup showed reduced inflammatory scores (p=0.011. For the other groups no significant results were observed at any phase. Motor activity was similar in both groups. BoNT/A showed to be effective preventing inflammatory pain up to eight days after the first treatment, an effect not reproduced on the second dose administration.

  13. Botulinum toxin type A management of spasticity in the context of orthopaedic surgery for children with spastic cerebral palsy.

    Science.gov (United States)

    Graham, H K

    2001-11-01

    Cerebral palsy is the most common cause of physical disability affecting children in developed countries. Although cerebral palsy is, by definition, a 'static encephalopathy' the associated musculoskeletal pathology is progressive and current definitions are therefore somewhat inadequate. Understanding the stages of the musculoskeletal pathology is fundamental to understanding current management strategies, including spasticity management, strengthening programmes and deformity correction by orthopaedic surgery. In this review, a number of new management strategies are described, in which spasticity management by intramuscular injections of botulinum toxin type A and deformity correction, by orthopaedic surgery, are combined.

  14. Botulinum toxin.

    Science.gov (United States)

    The National Institutes of Health Consensus Development Conference on Clinical Use of Botulinum Toxin brought together neurologists, ophthalmologists, otolaryngologists, speech pathologists, and other health care professionals as well as the public to address: the mechanisms of action of botulinum toxin, the indications and contraindications for botulinum toxin treatment, the general principles of technique of injection and handling for its safe and effective use, and the short-term and long-term side effects and complications of therapy. Following 2 days of presentations by experts and discussion by the audience, a consensus panel weighed the evidence and prepared their consensus statement. Among their findings, the panel recommended that (1) botulinum toxin therapy is safe and effective for treating strabismus, blepharospasm, hemifacial spasm, adductor spasmodic dysphonia, jaw-closing oromandibular dystonia, and cervical dystonia; (2) botulinum toxin is not curative in chronic neurological disorders; (3) the safety of botulinum toxin therapy during pregnancy, breast feeding, and chronic use during childhood is unknown; (4) the long-term effects of chronic treatment with botulinum toxin remain unknown; and (5) botulinum toxin should be administered by committed interdisciplinary teams of physicians and related health care professionals with appropriate instrumentation. The full text of the consensus panel's statement follows.

  15. Clostridium botulinum Group II Isolate Phylogenomic Profiling Using Whole-Genome Sequence Data.

    Science.gov (United States)

    Weedmark, K A; Mabon, P; Hayden, K L; Lambert, D; Van Domselaar, G; Austin, J W; Corbett, C R

    2015-09-01

    Clostridium botulinum group II isolates (n = 163) from different geographic regions, outbreaks, and neurotoxin types and subtypes were characterized in silico using whole-genome sequence data. Two clusters representing a variety of botulinum neurotoxin (BoNT) types and subtypes were identified by multilocus sequence typing (MLST) and core single nucleotide polymorphism (SNP) analysis. While one cluster included BoNT/B4/F6/E9 and nontoxigenic members, the other comprised a wide variety of different BoNT/E subtype isolates and a nontoxigenic strain. In silico MLST and core SNP methods were consistent in terms of clade-level isolate classification; however, core SNP analysis showed higher resolution capability. Furthermore, core SNP analysis correctly distinguished isolates by outbreak and location. This study illustrated the utility of next-generation sequence-based typing approaches for isolate characterization and source attribution and identified discrete SNP loci and MLST alleles for isolate comparison. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Actions of sea anemone type 1 neurotoxins on voltage-gated sodium channel isoforms.

    Science.gov (United States)

    Wanke, Enzo; Zaharenko, André Junqueira; Redaelli, Elisa; Schiavon, Emanuele

    2009-12-15

    As voltage-gated Na(+) channels are responsible for the conduction of electrical impulses in most excitable tissues in the majority of animals (except nematodes), they have become important targets for the toxins of venomous animals, from sea anemones to molluscs, scorpions, spiders and even fishes. During their evolution, different animals have developed a set of cysteine-rich peptides capable of binding different extracellular sites of this channel protein. A fundamental question concerning the mechanism of action of these toxins is whether they act at a common receptor site in Na(+) channels when exerting their different pharmacological effects, or at distinct receptor sites in different Na(v) channels subtypes whose particular properties lead to these pharmacological differences. The alpha-subunits of voltage-gated Na(+) channels (Na(v)1.x) have been divided into at least nine subtypes on the basis of amino acid sequences. Sea anemones have been extensively studied from the toxinological point of view for more than 40 years. There are about 40 sea anemone type 1 peptides known to be active on Na(v)1.x channels and all are 46-49 amino acid residues long, with three disulfide bonds and their molecular weights range between 3000 and 5000 Da. About 12 years ago a general model of Na(v)1.2-toxin interaction, developed for the alpha-scorpion toxins, was shown to fit also to action of sea anemone toxin such as ATX-II. According to this model these peptides are specifically acting on the type 3 site known to be between segments 3 and 4 in domain IV of the Na(+) channel protein. This region is indeed responsible for the normal Na(+) currents fast inactivation that is potently slowed by these toxins. This fundamental "gain-of-function" mechanism is responsible for the strong increase in the action potential duration. They constitute a class of tools by means of which physiologists and pharmacologists can study the structure/function relationships of channel proteins. As

  17. Improvement in laboratory diagnosis of wound botulism and tetanus among injecting illicit-drug users by use of real-time PCR assays for neurotoxin gene fragments.

    Science.gov (United States)

    Akbulut, D; Grant, K A; McLauchlin, J

    2005-09-01

    An upsurge in wound infections due to Clostridium botulinum and Clostridium tetani among users of illegal injected drugs (IDUs) occurred in the United Kingdom during 2003 and 2004. A real-time PCR assay was developed to detect a fragment of the neurotoxin gene of C. tetani (TeNT) and was used in conjunction with previously described assays for C. botulinum neurotoxin types A, B, and E (BoNTA, -B, and -E). The assays were sensitive, specific, rapid to perform, and applicable to investigating infections among IDUs using DNA extracted directly from wound tissue, as well as bacteria growing among mixed microflora in enrichment cultures and in pure culture on solid media. A combination of bioassay and PCR test results confirmed the clinical diagnosis in 10 of 25 cases of suspected botulism and two of five suspected cases of tetanus among IDUs. The PCR assays were in almost complete agreement with the conventional bioassays when considering results from different samples collected from the same patient. The replacement of bioassays by real-time PCR for the isolation and identification of both C. botulinum and C. tetani demonstrates a sensitivity and specificity similar to those of conventional approaches. However, the real-time PCR assays substantially improves the diagnostic process in terms of the speed of results and by the replacement of experimental animals. Recommendations are given for an improved strategy for the laboratory investigation of suspected wound botulism and tetanus among IDUs.

  18. Patient Perceived Benefit in Facial Aesthetic Procedures: FACE-Q as a Tool to Study Botulinum Toxin Injection Outcomes.

    Science.gov (United States)

    Chang, Brian L; Wilson, Anthony J; Taglienti, Anthony J; Chang, Catherine S; Folsom, Nancy; Percec, Ivona

    2016-07-01

    There are numerous methods of assessing patient satisfaction with botulinum toxin type A neuromodulation of the glabellar rhytids. As the use of aesthetic neuromodulation increases both in breadth and number of procedures, there is a need for more comprehensive tools to evaluate patient-reported outcomes. The FACE-Q is a recently validated patient-reported outcome instrument that can be used to measure patient perceptions of botulinum toxin type A neuromodulation. This study used the FACE-Q to assess patient satisfaction following botulinum toxin type A neuromodulation of the glabellar rhytids. 57 female patients completed the FACE-Q, a survey that evaluates patients' satisfaction with their facial appearance. After this baseline survey, the patients received injections of one of onabotulinumtoxinA (Botox, Allergan, Dublin, Ireland), abobotulinumtoxinA (Dysport, Galderma, Lausanne, Switzerland), or incobotulinumtoxinA (Xeomin, Merz Pharmaceuticals, Frankfurt am Main, Germany) in the glabella. Two weeks post-injection, the patients completed the FACE-Q again. The percentage changes in patient responses were tabulated to determine how neuromodulation affects patient satisfaction with their facial appearance. The percentage changes for each of the neurotoxin groups were compared to determine if patient satisfaction with neuromodulation varies with the type of neurotoxin. Patient satisfaction with their overall facial appearance increased by 28% following neuromodulation. Patients stated that they believe they look an average of 5.6 years younger post-neuromodulation. There were no significant differences among the treatment groups. The FACE-Q demonstrates that patients are more satisfied by their overall facial appearance and age appearance following neuromodulation of their glabellar rhytids. Patients are equally satisfied with the improvement of their facial appearance regardless of which neurotoxin they received. LEVEL OF EVIDENCE 2: Therapeutic. © 2016 The

  19. [Costs and efficacy of type A botulinum toxin for the treatment of essential blepharospasm and hemifacial spasm].

    Science.gov (United States)

    Lasalvia, Cintia Gomes Galvão; Pereira, Luciano de Sousa; da Cunha, Marcos Carvalho; Kitadai, Silvia Prado Smit

    2006-01-01

    To evaluate the costs and efficacy of type A botulinum toxin in the treatment of essential blepharospasm and hemifacial spasm. Pacients with essential blepharospasm and hemifacial spasm had their files analyzed. All patients were treated with type A botulinum toxin (Dysport) between April 2002 and May 2004 at the Oculoplastic Clinics of "Santa Casa de São Paulo". Twenty-seven patients presented essential blepharospasm and 23 presented hemifacial spasm. Information about the patient's degree of satisfaction after treatment, complaints and personal costs were recorded by a questionnaire, and information about the costs of Dysport treatment were obtained at the administration department of "Santa Casa de São Paulo". Wilcoxon and Mann-Whitney tests were used for statistical analysis. 1- The annual treatment costs were R Dollars 1,239.32 for essential blepharospasm and R Dollars 661.72 for hemifacial spasm. 2- The patient's annual costs were R Dollars 145.48 for essential blepharospasm and R Dollars 6.07 for hemifacial spasm. 3- The hospital's annual costs for the treatment were R Dollars 1,095.84 for essential blepharospasm and R Dollars 535.65 for hemifacial spasm. 4- Dysport treatment is successful in both essential blepharospasm and hemifacial spasm. The costs of essential blepharospasm and hemifacial spasm treatment with Dysport are high, mainly because of the toxin price. On economic analysis of health, we can conclude that this procedure has an excellent cost-benefit ratio.

  20. Spatial, Temporal, and Matrix Variability of Clostridium botulinum Type E Toxin Gene Distribution at Great Lakes Beaches

    Science.gov (United States)

    Oster, Ryan J.; Haack, Sheridan K.; Fogarty, Lisa R.; Tucker, Taaja R.; Riley, Stephen C.

    2015-01-01

    Clostridium botulinum type E toxin is responsible for extensive mortality of birds and fish in the Great Lakes. The C. botulinum bontE gene that produces the type E toxin was amplified with quantitative PCR from 150 sloughed algal samples (primarily Cladophora species) collected during summer 2012 from 10 Great Lakes beaches in five states; concurrently, 74 sediment and 37 water samples from four sites were also analyzed. The bontE gene concentration in algae was significantly higher than in water and sediment (P Lake Front beaches (Lake Michigan) and Bay City State Recreation Area beach on Saginaw Bay (Lake Huron), where 77, 100, and 83% of these algal samples contained the bontE gene, respectively. The highest concentration of bontE was detected at Bay City (1.98 × 105 gene copies/ml of algae or 5.21 × 106 g [dry weight]). This study revealed that the bontE gene is abundant in the Great Lakes but that it has spatial, temporal, and matrix variability. Further, embayed beaches, low wave height, low wind velocity, and greater average water temperature enhance the bontE occurrence. PMID:25888178

  1. Antibody-induced secondary treatment failure in a patient treated with botulinum toxin type A for glabellar frown lines

    Directory of Open Access Journals (Sweden)

    Stengel G

    2011-11-01

    Full Text Available Gabriele Stengel, Eva Kristina Bee Hautarztpraxis Stengel and Bee, Münster, Germany Abstract: Botulinum toxin type A (BTX-A preparations are widely used nonsurgical treatments for facial wrinkles. Higher doses of BTX-A are also used for therapeutic purposes in the treatment of conditions involving increased muscle tone, such as cervical dystonia. The phenomenon of antibody-induced treatment failure is well known in the therapeutic setting, but reports are also emerging following cosmetic use of BTX-A. We describe the case of a 41-year-old female nurse who developed secondary treatment failure during 6 years of BTX-A treatment for glabellar lines. After a good response to the first BTX-A injection, the intensity and duration of effect decreased after subsequent treatments. Antibody tests revealed a high titer of neutralizing anti-BTX-A antibodies. This case shows secondary treatment failure due to the production of neutralizing antibodies following administration of BTX-A formulations for cosmetic purposes and demonstrates that immunogenicity of BTX-A preparations is an important consideration, even in the cosmetic setting. Keywords: botulinum toxin type A, neutralizing antibodies, antibody-induced treatment failure

  2. Taping versus electrical stimulation after botulinum toxin type A injection for wrist and finger spasticity. A case-control study.

    Science.gov (United States)

    Carda, Stefano; Molteni, Franco

    2005-09-01

    To compare results from two approaches used in conjunction with botulinum toxin type A administration in rehabilitation: the application of a taping system and the electrical stimulation of the injected muscles and splinting. Case-control study. Two tertiary care rehabilitation hospitals in Italy. Sixty-five adult subjects affected by spasticity of the wrist and finger flexors. After injection with botulinum toxin type A, the group at hospital A (n=33) was treated with adhesive taping for six days and those at hospital B (n=32) with electrical stimulation and splinting for six days. Spastic hypertonia at the injected muscles was assessed before treatment, one week and one month post injection. Modified Ashworth Scale. In group A, the mean Modified Ashworth Scale reduction was 2.76 +/- 0.94 for wrist flexors and 2.45 +/- 0.92 for finger flexors; in group B the mean Modified Ashworth Scale reduction was 2.18 +/- 1.11 for wrist flexors and 2.1 +/- 0.98 for finger flexors. The observed difference between the two groups was statistically relevant (p spastic hypertonia as measured with Modified Ashworth Scale, with less time dedicated for the treatment.

  3. [The structure and mechanism of action of clostridial neurotoxins].

    Science.gov (United States)

    Parasion, Sylwia; Bartoszcze, Michał; Gryko, Romuald

    2007-01-01

    Clostridium botulinum and Clostridium tetani produce highly potent neurotoxins, called botulinum toxins and tetanus toxin, respectively. The clostridial neurotoxins specifically bind to neuronal cells and disrupt neurotransmisser release by cleaving proteins involved in specific vesicle membrane fusion. Each toxin is synthesized as an inactive approximately 150 kDa single-chain protein. The protein is posttranslationally proteolyzed to form the active dichain molecule in which the chains approximately 50 and approximately 100 kDa, remain linked by a disulfide bond. The structural organization is funcionally related to the fact that CNTs intoxicate neurons via four-step mechanism consisting of 1. binding, 2. internalization, 3. membrane translocation, and 4. enzymatic target modification. The L chain is responsible for the intracellular catalitic activity. The NH2-terminal 50-kDa domain of the H chain (HN) is implicated in membrane translocation, whereas the COOH-terminal part (HC) is mainly responsible for neurospecific binding.

  4. The combined effect of lower-limb multilevel botulinum toxin type A and comprehensive rehabilitation on mobility in children with cerebral palsy: A randomized clinical trial

    NARCIS (Netherlands)

    Scholtes, V.A.; Dallmeijer, A.J.; Knol, D.L.; Speth, L.A.; Maathuis, C.G.; Jongerius, P.H.; Becher, J.G.

    2006-01-01

    Objective: To evaluate the combined effect on mobility of treatment with multilevel botulinum toxin type A (BTX-A) and comprehensive rehabilitation in children with cerebral palsy (CP). Design: Randomized clinical trial using a multiple baseline design. The intervention group was treated 6 weeks

  5. The combined effect of lower-limb multilevel botulinum toxin type A and comprehensive rehabilitation on mobility in children with cerebral palsy : A randomized clinical trial

    NARCIS (Netherlands)

    Scholtes, Vanessa A.; Dallmeijer, Annet J.; Knol, Dirk L.; Speth, Lucianne A.; Maathuis, Carel G.; Jongerius, Peter H.; Becher, Jules G.

    2006-01-01

    Objective: To evaluate the combined effect on mobility of treatment with multilevel botulinum toxin type A (BTX-A) and comprehensive rehabilitation in children with cerebral palsy (CP). Design: Randomized clinical trial using a multiple baseline design. The intervention group was treated 6 weeks

  6. Functional effects of botulinum toxin type-A treatment and subsequent stretching of spastic calf muscles: a study in patients with hereditary spastic paraplegia.

    Science.gov (United States)

    de Niet, Mark; de Bot, Susanne T; van de Warrenburg, Bart P C; Weerdesteyn, Vivian; Geurts, Alexander C

    2015-02-01

    Although calf muscle spasticity is often treated with botulinum toxin type-A, the effects on balance and gait are ambiguous. Hereditary spastic paraplegia is characterized by progressive spasticity and relatively mild muscle weakness of the lower limbs. It is therefore a good model to evaluate the functional effects of botulinum toxin type-A. Explorative pre-post intervention study. Fifteen subjects with pure hereditary spastic paraplegia. Patients with symptomatic calf muscle spasticity and preserved calf muscle strength received botulinum toxin type-A injections in each triceps surae (Dysport®, 500-750 MU) followed by daily stretching exercises (18 weeks). Before intervention (T0), and 4 (T1) and 18 (T2) weeks thereafter, gait, balance, motor selectivity, calf muscle tone and strength were tested. Mean comfortable gait velocity increased from T0 (0.90 m/s (standard deviation (SD) 0.18)) to T1 (0.98 m/s (SD 0.20)), which effect persisted at T2, whereas balance and other functional measures remained unchanged. Calf muscle tone declined from T0 (median 2; range 1-2) to T1 (median 0; range 0-1), which effect partially persisted at T2 (median 1; range 0-2). Calf muscle strength did not change. Botulinum toxin type-A treatment and subsequent muscle stretching of the calves improved comfortable gait velocity and reduced muscle tone in patients with hereditary spastic paraplegia, while preserving muscle strength. Balance remained unaffected.

  7. Functional effects of botulinum toxin type-A treatment and subsequent stretching of spastic calf muscles: a study in patients with hereditary spastic paraplegia

    NARCIS (Netherlands)

    Niet, M. de; Bot, S.T. de; Warrenburg, B.P.C. van de; Weerdesteijn, V.G.M.; Geurts, A.C.H.

    2015-01-01

    OBJECTIVE: Although calf muscle spasticity is often treated with botulinum toxin type-A, the effects on balance and gait are ambiguous. Hereditary spastic paraplegia is characterized by progressive spasticity and relatively mild muscle weakness of the lower limbs. It is therefore a good model to

  8. The course of cervical dystonia with head tremor during botulinum toxin type A treatment

    Directory of Open Access Journals (Sweden)

    A. N. Korenko

    2017-01-01

    Full Text Available Objective: to evaluate the efficacy and safety of botulinum toxin type A (BTA injections into the neck muscles to reduce dystonic postures, head tremor, and pain syndrome in patients with cervical dystonia (CD within the first 8 cycles of treatment.Patients and methods. The investigation included 76 patients (26 (34% men and 50 (66% women with CD and dystonic head tremor, who were given BTA injections into the neck muscles for the first time. All the 76 patients received at least one cycle of BTA therapy. At the same type, 18 of these patients received 4 cycles of injections and 36 patients had 8 cycles. Injections were given when the symptoms of CD recurred or increased and the patient needed to be retreated. The interval between the injection cycles was arbitrary, but not less than 12 weeks. The doses of BTA agents per treatment cycle were as follows: Dysport was 400 to 1000 U, xeomin was 50 to 300 U, and Botox 200 to 300 U. The symptoms of CD were assessed using the Toronto Western Spasmodic Torticollis Rating Scale (TWSTRS and the Tsui scale before the first injection of BTA and injection cycles 4 and 8; the presence or absence of head tremor was recorded.Results. The TWSTRS severity of CD symptoms decreased from 38 [36; 41] to 30 [27; 33] scores by injection cycle 4 (p < 0.001 and to 26 [23; 27] scores by cycle 8 (p<0.01. The Tsui severity of CD reduced from 9.3 [9; 10] to 7.2 [7; 8] scores by injection cycle 4 (p<0.001 and to 6.7 [6; 7] scores by cycle 8. The Tsui tremor scores decreased from 1.9 [1.6; 2.1] to 1.4 [1.1; 1.6] scores by injection cycle 4 and to 1.1 [0.9;1.4] scores by cycle 8 (p<0.01. Tremor completely disappeared in 6 (11% of patients by injection cycle 4 and in 6 (18% patients by cycle 8. According to Section 3 of the TWSTRS, pain intensity was reduced from 9.9 [8.9; 11.0] to 5.0 [3.3; 6.6] scores by injection cycle 4 (p<0.001 and to 2.1 [0.7; 3.6] scores by cycle 8 (p < 0.01; pain regressed completely in 12 (41

  9. Accuracy of botulinum toxin type A injection into the forearm muscles of chronic stroke patients with spastic flexed wrist and clenched fist: manual needle placement evaluated using ultrasonography.

    Science.gov (United States)

    Picelli, Alessandro; Roncari, Laura; Baldessarelli, Silvia; Berto, Giulia; Lobba, Davide; Santamato, Andrea; Fiore, Pietro; Smania, Nicola

    2014-11-01

    To investigate the accuracy of manual needle placement for injection of botulinum toxin type A into the forearm muscles of adults with spastic flexed wrist and clenched fist as a consequence of stroke. Prospective clinical study. A total of 41 adults with chronic stroke who were scheduled to receive botulinum toxin type A injection into the following forearm muscles: flexor carpi radialis, flexor carpi ulnaris, flexor digitorum superficialis and flexor digitorum profundus. According to Huber & Heck's atlas suggestions on treatment of spasticity with botulinum toxin, surface identification of muscles to inject was performed by means of palpation and anatomical landmarks. Accuracy of needle placement and muscle thickness at the site of needle insertion were assessed using ultrasonography. Overall accuracy of manual needle placement evaluated using ultrasonography was 51.2%. Accuracy was significantly higher for the finger flexors than for the wrist flexors (63.4% vs 39.0%). The finger flexors were significantly thicker than the wrist flexors (mean 1.58 vs 0.49 cm). Instrumental guidance should be used in order to achieve an acceptable accuracy of needle placement when performing botulinum toxin type A injections into the forearm muscles of chronic stroke patients with spastic flexed wrist and clenched fist.

  10. Comparison of clinical marking and ultrasound-guided injection of Botulinum type A toxin into the masseter muscles for treating bruxism and its cosmetic effects.

    Science.gov (United States)

    Quezada-Gaon, Natacha; Wortsman, Ximena; Peñaloza, Osvaldo; Carrasco, Juan Eduardo

    2016-09-01

    Botulinum toxin type A has been used for treating the hypertrophy of the masseter muscles and its cosmetic effects. Ultrasound is increasingly used in dermatology, along with the guidance of mini-invasive procedures. To evaluate the role of ultrasound for guiding the application of Botulinum A toxin in patients with cosmetic alterations due to bruxism, correlate the clinical landmarks with the ultrasound findings, and study the effect on the symptoms, cosmetics, and quality of life. Twenty individuals with bruxism and cosmetic alterations underwent an ultrasound-guided injection of Botulinum toxin type A in each masseter muscle. Clinical and ultrasound marking of the procedure was compared. Clinical and sonographic evaluation was performed at the time of injection and 3 months later. Ten normal individuals underwent ultrasound of the masseter muscles as a control group. Up to 65% of individuals showed anatomical variants of the salivary glands. The method for clinically marking the skin showed a frequently erroneous location of the anterior point (up to 40% of cases) that was proven by ultrasound to be out of the muscle. In 20% of cases, ultrasound showed that the needle should be longer to enter the muscle. After injection, most of the patients demonstrated a decrease of the symptoms and cosmetic and quality of life improvements. Ultrasound can be a potent tool for guiding the injection of Botulinum toxin into the masseter muscles. It may contribute to a more personalized procedure, better cosmetic results, and help to avoid potential complications. © 2016 Wiley Periodicals, Inc.

  11. Effects of botulinum toxin type A for spastic foot in post-stroke patients enrolled in a rehabilitation program

    Directory of Open Access Journals (Sweden)

    Leonardo Halley Carvalho Pimentel

    2014-01-01

    Full Text Available The objective of this study was to evaluate the effects of botulinum toxin type A (BTX-A on spastic foot in stroke patients in a rehabilitation program. Method: Hemiparetic stroke patients (n=21 enrolled in a rehabilitation program were divided into two groups. The first group (n=11 received a total of 300UI BTX-A, and the second group (n=10 received 100 UI BTX-A. All patients were assessed at baseline and 2, 4, 8 and 12 weeks after injection for Modified Ashworth Score, time walking 10 meters, and the Functional Independence Measure (mFIM motor score. Results: The higher-dose group exhibited a significant improvement in spasticity, and both groups showed an improvement in time walking 10 meters and mFIM, with no significant differences between them. Conclusions: Our findings suggest that gains in gait velocity and functional independence were not correlated to BTX-A dose.

  12. Cloning and characterization of an alpha-neurotoxin-type protein specific for the coral snake Micrurus corallinus.

    Science.gov (United States)

    Silveira de Oliveira, J; Rossan de Brandão Prieto da Silva, A; Soares, M B; Stephano, M A; de Oliveira Dias, W; Raw, I; Ho, P L

    2000-01-27

    During the cloning of abundant cDNAs expressed in the Micrurus corallinus coral snake venom gland, we cloned an alpha-neurotoxin homologue cDNA (nxh1). Two others isoforms were also cloned (nxh3 and nxh7, respectively). The nxh1 cDNA codes for a potential coral snake toxin with a signal peptide of 21 amino acids plus a predicted mature peptide with 57 amino acids. The deduced protein is highly similar to known toxic three-finger alpha-neurotoxins, with four deduced S-S bridges at the same conserved positions. This is the first cDNA coding for a three-finger related protein described so far for coral snakes. However, the predicted protein does not possess some of the important amino acids for the nicotinic acetylcholine receptor interaction. This protein was expressed in Escherichia coli as a His-tagged protein that allowed the rapid purification of the recombinant protein. This protein was used to generate antibodies which recognized the recombinant protein in Western blot and also a single band present in the M. corallinus venom, but not in the venom of 10 other Micrurus species. Copyright 2000 Academic Press.

  13. Rapid Detection of Clostridium botulinum Toxins A, B, E, and F in Clinical Samples, Selected Food Matrices, and Buffer Using Paramagnetic Bead-Based Electrochemiluminescence Detection

    National Research Council Canada - National Science Library

    Rivera, Victor R; Gamez, Frank J; Keener, William K; White, Jill A; Poli, Mark A

    2006-01-01

    Sensitive and specific electrochemiluminescence (ECL) assays were used to detect Clostridium botulinum neurotoxins serotypes A, B, E, and F in undiluted human serum, undiluted human urine, assay buffer, and selected food matrices...

  14. Unique Ganglioside Recognition Strategies for Clostridial Neurotoxins

    Energy Technology Data Exchange (ETDEWEB)

    Benson, Marc A.; Fu, Zhuji; Kim, Jung-Ja P.; Baldwin, Michael R. (MCW); (UMC)

    2012-03-15

    Botulinum neurotoxins (BoNTs) and tetanus neurotoxin are the causative agents of the paralytic diseases botulism and tetanus, respectively. The potency of the clostridial neurotoxins (CNTs) relies primarily on their highly specific binding to nerve terminals and cleavage of SNARE proteins. Although individual CNTs utilize distinct proteins for entry, they share common ganglioside co-receptors. Here, we report the crystal structure of the BoNT/F receptor-binding domain in complex with the sugar moiety of ganglioside GD1a. GD1a binds in a shallow groove formed by the conserved peptide motif E ... H ... SXWY ... G, with additional stabilizing interactions provided by two arginine residues. Comparative analysis of BoNT/F with other CNTs revealed several differences in the interactions of each toxin with ganglioside. Notably, exchange of BoNT/F His-1241 with the corresponding lysine residue of BoNT/E resulted in increased affinity for GD1a and conferred the ability to bind ganglioside GM1a. Conversely, BoNT/E was not able to bind GM1a, demonstrating a discrete mechanism of ganglioside recognition. These findings provide a structural basis for ganglioside binding among the CNTs and show that individual toxins utilize unique ganglioside recognition strategies.

  15. [Treatment of spasticity in nursing homes: botulinum toxin type A as part of therapy].

    Science.gov (United States)

    Wolswijk, Adrie H M; Dirkx, Anita E M

    2015-01-01

    Complications of spasticity can severely limit daily activities and care-giving. For those who treat or provide care to patients with spasticity in nursing homes, it is important to recognise complaints in order to prevent serious complications such as care-related pain, contractures and pressure sores. The involvement of a rehabilitation physician is essential to provide a high standard of care. We present two nursing home patients, a 95-year-old woman and a 63-year-old man, with severe upper limb complications following spasticity. Both patients received botulinum toxin injections in the affected muscles, combined with an appropriate splint. A treatment team consisting of a specialist in geriatric medicine, a rehabilitation physician, a physical and an occupational therapist provided consistent daily care in the institution. These efforts substantially reduced care-related pain and improved social behaviour and care options. If spasticity prohibits treatment or care, consultation of a rehabilitation physician at an early stage is indicated.

  16. Characterization of Hemagglutinin Negative Botulinum Progenitor Toxins

    Directory of Open Access Journals (Sweden)

    Suzanne R. Kalb

    2017-06-01

    Full Text Available Botulism is a disease involving intoxication with botulinum neurotoxins (BoNTs, toxic proteins produced by Clostridium botulinum and other clostridia. The 150 kDa neurotoxin is produced in conjunction with other proteins to form the botulinum progenitor toxin complex (PTC, alternating in size from 300 kDa to 500 kDa. These progenitor complexes can be classified into hemagglutinin positive or hemagglutinin negative, depending on the ability of some of the neurotoxin-associated proteins (NAPs to cause hemagglutination. The hemagglutinin positive progenitor toxin complex consists of BoNT, nontoxic non-hemagglutinin (NTNH, and three hemagglutinin proteins; HA-70, HA-33, and HA-17. Hemagglutinin negative progenitor toxin complexes contain BoNT and NTNH as the minimally functional PTC (M-PTC, but not the three hemagglutinin proteins. Interestingly, the genome of hemagglutinin negative progenitor toxin complexes comprises open reading frames (orfs which encode for three proteins, but the existence of these proteins has not yet been extensively demonstrated. In this work, we demonstrate that these three proteins exist and form part of the PTC for hemagglutinin negative complexes. Several hemagglutinin negative strains producing BoNT/A, /E, and /F were found to contain the three open reading frame proteins. Additionally, several BoNT/A-containing bivalent strains were examined, and NAPs from both genes, including the open reading frame proteins, were associated with BoNT/A. The open reading frame encoded proteins are more easily removed from the botulinum complex than the hemagglutinin proteins, but are present in several BoNT/A and /F toxin preparations. These are not easily removed from the BoNT/E complex, however, and are present even in commercially-available purified BoNT/E complex.

  17. National outbreak of type a foodborne botulism associated with a widely distributed commercially canned hot dog chili sauce.

    Science.gov (United States)

    Juliao, Patricia C; Maslanka, Susan; Dykes, Janet; Gaul, Linda; Bagdure, Satish; Granzow-Kibiger, Lynae; Salehi, Ellen; Zink, Donald; Neligan, Robert P; Barton-Behravesh, Casey; Lúquez, Carolina; Biggerstaff, Matthew; Lynch, Michael; Olson, Christine; Williams, Ian; Barzilay, Ezra J

    2013-02-01

    On 7 and 11 July 2007, health officials in Texas and Indiana, respectively, reported 4 possible cases of type A foodborne botulism to the US Centers for Disease Control and Prevention. Foodborne botulism is a rare and sometimes fatal illness caused by consuming foods containing botulinum neurotoxin. Investigators reviewed patients' medical charts and food histories. Clinical specimens and food samples were tested for botulinum toxin and neurotoxin-producing Clostridium species. Investigators conducted inspections of the cannery that produced the implicated product. Eight confirmed outbreak associated cases were identified from Indiana (n = 2), Texas (n = 3), and Ohio (n = 3). Botulinum toxin type A was identified in leftover chili sauce consumed by the Indiana patients and 1 of the Ohio patients. Cannery inspectors found violations of federal canned-food regulations that could have led to survival of Clostridium botulinum spores during sterilization. The company recalled 39 million cans of chili. Following the outbreak, the US Food and Drug Administration inspected other canneries with similar canning systems and issued warnings to the industry about the danger of C. botulinum and the importance of compliance with canned food manufacturing regulations. Commercially produced hot dog chili sauce caused these cases of type A botulism. This is the first US foodborne botulism outbreak involving a commercial cannery in >30 years. Sharing of epidemiologic and laboratory findings allowed for the rapid identification of implicated food items and swift removal of potentially deadly products from the market by US food regulatory authorities.

  18. Clinical effectiveness of botulinum toxin type B in the treatment of subacromial bursitis or shoulder impingement syndrome.

    Science.gov (United States)

    Lee, Jung Hwan; Lee, Sang-Ho; Song, Sun Hong

    2011-01-01

    Subacromial steroid injections are used as a treatment method in subacromial bursitis (SB) or shoulder impingement syndrome (SIS). However, the steroid effect is relatively restricted to the short-term and repeated injections are frequently required, which contributes to unwanted side effects. As an alternative, botulinum toxin (BT) has recently been used for pain relief. This study aimed to investigate the clinical effectiveness of BT type B and to compare this with the effectiveness of steroids. Sixty-one patients diagnosed with SB or SIS were divided into 2 groups and treated with BT type B (BT group) and trimacinolone injection (TA group) under ultrasound guidance, respectively. Numeric Rating Scale (NRS), active shoulder abduction angle, and the Korean version of the score on the Disability of Arm, Shoulder, and Hand (DASH) were measured before the treatment, and at 1 and 3 months after the treatment. Both groups obtained a significant improvement of NRS, DASH, and active shoulder abduction at 1 and 3 months follow-up. BT group showed significantly better outcomes in terms of reduction of NRS and DASH at 3 months than TA group. BT group showed strong trend toward the larger degree of active shoulder abduction than the TA group at 3 months follow-up, as well. Whereas, no significant difference was found in NRS, DASH, and active shoulder abduction between the 2 groups at 1 month follow-up. BT type B can be a useful strategy and has great potential for replacing steroids as a treatment for SB or SIS.

  19. Hemifacial Spasm due to Compression of the Posterior Inferior Cerebellar Artery Aneurysm Treated with Botulinum Toxin Type-A: A Case Report

    OpenAIRE

    Azize Esra Gürsoy; Gülsen Babacan Yildiz; Adam Mehmet Gülhan; Mehmet Kolukisa

    2012-01-01

    A 79-year-old female presented with five months history of progressive involuntary twitching movement on left face. Brain MR imaging revealed a heterogeneous T2 hyperintense lesion at left cerebellopontine angle. CT angiography showed a partially thrombosed saccular aneurysm of left PICA (posterior inferior cerebellar artery). The patient was treated with Botulinum toxin type A and almost total relief of symptoms was noticed during one month followup. Botulinium toxin injection is an effectiv...

  20. The use of botulinum toxin type A in the treatment of spasticity of the lower limbs in stroke patients. Clinical case

    Directory of Open Access Journals (Sweden)

    A. P. Kovalenko

    2014-01-01

    Full Text Available The article describes a clinical case of spasticity and its treatment with botulinum toxin type A in a patient with the consequences of acute stroke. Given a comprehensive assessment of patterns of spasticity and muscle involved in the syndrome. Described in detail and the result is the introduction of a technique. It is concluded that the effectiveness and feasibility of using Botox to treat spasticity of the lower limb.

  1. A single-blinded, randomized pilot study of botulinum toxin type A combined with non-pharmacological treatment for spastic foot.

    Science.gov (United States)

    Baricich, Alessio; Carda, Stefano; Bertoni, Michele; Maderna, Luca; Cisari, Carlo

    2008-11-01

    To explore the effect of treatment after botulinum toxin type A combined with treatments for the spastic foot. Single-blind, randomized trial, with 3-month follow-up. Twenty-three chronic hemiplegic adult patients with spastic equinus foot. Following botulinum toxin type A injection at the medial and lateral gastrocnemius, patients were assigned randomly to 3 groups, and treated with taping, electrical stimulation or stretching. They were evaluated before treatment (t0), and at 10 (t1), 20 (t2) and 90 (t3) days after treatment. Outcome measures were: Modified Ashworth Scale; passive range of motion at the ankle; measurement of muscle action potential at the gastrocnemius medialis; and measurement of maximum ankle dorsiflexion angle in stance using gait analysis. The group treated with electrical stimulation performed better at t1 on the Modified Ashworth Scale. The taping and electrical stimulation groups performed better in all outcome measures at t3. The taping group performed better mainly for maximum ankle dorsiflexion angle in stance. The stretching group showed a less durable result, with some worsening at the t3 evaluation compared with the assessment performed before treatment. This pilot study indicates that combining botulinum toxin type A administration for the ankle plantar flexors with taping and electrical stimulation might be beneficial.

  2. Phenotypic characterization of Clostridium botulinum strains isolated from infant botulism cases in Argentina Caracterización fenotípica de cepas de Clostridium botulinum aisladas de casos de botulismo del lactante en Argentina

    Directory of Open Access Journals (Sweden)

    M. D. Sagua

    2009-09-01

    Full Text Available Infant botulism is the most common form of human botulism; however, its transmission has not been completely explained yet. Some of the most recognized potential sources of Clostridium botulinum spores are the soil, dust, honey and medicinal herbs. In Argentina, 456 cases of infant botulism were reported between 1982 and 2007. C. botulinum type A was identified in 455 of these cases whereas type B was identified in just one case. However, in Argentina, types A, B, E, F, G, and Af have been isolated from environmental sources. It is not clearly known if strains isolated from infant botulism cases have different characteristics from strains isolated from other sources. During this study, 46 C. botulinum strains isolated from infant botulism cases and from environmental sources were typified according to phenotypic characteristics. Biochemical tests, antimicrobial activity, and haemagglutinin-negative botulinum neurotoxin production showed uniformity among all these strains. Despite the variability observed in the botulinum neurotoxin's binding to cellular receptors, no correlation was found between these patterns and the source of the botulinum neurotoxin. However, an apparent geographical clustering was observed, since strains isolated from Argentina had similar characteristics to those isolated from Italy and Japan, but different to those isolated from the United States.El botulismo del lactante es la forma más común del botulismo humano; sin embargo, su forma de transmisión no ha sido totalmente explicada. El suelo, el polvo ambiental, la miel y algunas hierbas medicinales son potenciales fuentes de esporas de Clostridium botulinum. Entre 1982 y 2007 se informaron en Argentina 456 casos de botulismo del lactante, 455 casos debidos al serotipo A y uno al serotipo B. Sin embargo, los serotipos A, B, E, F, G y Af han sido aislados de suelos y otras fuentes en Argentina. No se conoce si las cepas aisladas de casos de botulismo del lactante

  3. Effect of intrathecal baclofen, botulinum toxin type A and a rehabilitation programme on locomotor function after spinal cord injury: a case report.

    Science.gov (United States)

    Santamato, Andrea; Panza, Francesco; Ranieri, Maurizio; Amoruso, Maria Teresa; Amoruso, Loredana; Frisardi, Vincenza; Solfrizzi, Vincenzo; Fiore, Pietro

    2010-10-01

    A few studies have reported the use of botulinum toxin injections after spinal cord injury, as this is the gold standard to treat focal spasticity. We report such a case here. A 38-year-old woman who had become paraplegic and care-dependent secondary to cervico-thoracic intramedullary ependymoma, presented 8 months later with painful lower limb spasticity, which was being treated with oral anti-spastic and benzodiazepine drugs with no therapeutic effect. We treated the patient with intrathecal baclofen to reduce her spasticity and in order to avoid the major side-effects of high dosages of oral baclofen. After motor rehabilitation programmes, which included functional electrical stimulation, the patient was able to wear an advanced reciprocating gait orthosis. However, she experienced painful muscle spasms in her toes of the feet that limited her gait. Therefore, she was also treated with bilateral injections of botulinum toxin type A into the flexor digitorum brevis muscles. The patient reported relief of spasms and pain, enabling her to wear an advanced reciprocating gait orthosis and facilitating rehabilitation programmes. The use of botulinum toxin type A may be an important adjunctive therapy to increase the therapeutic effect of baclofen on spasticity in small muscles, resulting in a more focal effect, and improving the use of orthoses and the effectiveness of rehabilitation programmes in patients after spinal cord injury.

  4. Side effects and potential risk factors of botulinum toxin type A intramuscular injections in knee flexion contractures of hemophiliacs.

    Science.gov (United States)

    Rodriguez-Merchan, E Carlos; De la Corte-Rodriguez, Hortensia

    2017-07-01

    Knee flexion contracture (KFC) is a common complication of recurrent hemarthrosis in children and young adults with hemophilia. If the KFC is not prevented (by means of primary prophylaxis) and treated properly and early (be means of physical medicine and rehabilitation), it will become fixed. Areas covered: The aim of this article is to review the potential role of botulinum toxin type A (BTX-A) intramuscular injections for the treatment of KFC in people with hemophilia (PWH). Expert commentary: Although two recent reports have mentioned the benefits of intramuscular injections of BTX-A in PWH with KFC, the data are still scant and too preliminary. The use of intramuscular injections of BTX-A in PWH today should not be recommended until more case studies/small series (ideally well-designed clinical trials) fully demonstrate that this is safe and effective. The risks of intramuscular injections to a hemophilia patient cannot be underestimated (iatrogenic muscle hematomas and pseudotumors). This paper calls the attention of hemophilia treaters on the potential risks of this apparently interesting technique. The current use of BTX-A intramuscular injections in KFC of PWH could make no sense. Raising false expectations in these patients should be avoided.

  5. Quantitative assessment of efficacy of dysport (botulinum toxin type A) in the treatment of idiopathic blepharospasm and hemifacial spasm.

    Science.gov (United States)

    Tsai, Ching-Piao; Chiu, Ming-Chang; Yen, Der-Jen; Guo, Yuh-Cherng; Yuan, Chih-Lun; Lee, Tzu-Chi

    2005-06-01

    This study was a Phase IV, prospective, one arm, non-comparative open trial, to investigate the efficacy and safety of Dysport (Botulinum toxin type A) in patients with idiopathic blepharospasm or hemifacial spasm. During the treatment period, patients were evaluated at baseline (week 0), week 6, and week 8, 10, or 12. Thirty two women and 16 men completed the whole course of the study. The therapeutic efficacy of Dysport became evident from 1.5 to 15 days (mean+/- SD, 6.1 +/- 2.9 days). The maximal effect appeared 12.2+/-5.0 days later. Injection of Dysport achieved 72.9 (13.0% amelioration in the spasm symptom. Dysport significantly improved the following functions, such as reading, watching TV, house work, working, driving and outing alone. At the twelfth week after Dysport injection, it was still effective in relieving blepharospasm or hemifacial spasm. The most frequent adverse event was ptosis, which was noted in 9 cases and represented 18.7% of total patients. Other adverse events were very mild, although lagophthalmos and dry eyes occurred in some patients, but none manifested any corneal complications. In conclusion, Dysport injection appears to be a safe, and effective procedure - accompanied only by minor, and transit adverse events.

  6. The effect and complication of botulinum toxin type a injection with serial casting for the treatment of spastic equinus foot.

    Science.gov (United States)

    Lee, Sook Joung; Sung, In Young; Jang, Dae Hyun; Yi, Jin Hwa; Lee, Jin Ho; Ryu, Ju Seok

    2011-06-01

    To identify the effect of serial casting combined with Botulinum toxin type A (BTX-A) injection on spastic equinus foot. Twenty-nine children with cerebral palsy who had equinus foot were recruited from the outpatient clinic of Rehabilitation Medicine. The children were divided into 2 groups, one of which received serial casting after BTX-A injection, and the other which only received BTX-A injection. Serial casting started 3 weeks after the BTX-A injection, and was changed weekly for 3 times. Spasticity of the ankle joint was evaluated using the modified Ashworth scale (MAS), and the modified Tardieu scale (MTS). Gait pattern was measured using the physician's rating scale (PRS). The degree of ankle dorsiflexion and the MAS improved significantly until 12 weeks following the BTX-A injection in the serial casting group (pcasting. Our study demonstrated that the effect of BTX-A injection with serial casting was superior and lasted longer than the effect of BTX-A injection only in patients with spastic equinus foot. We therefore recommend BTX-A injection with serial casting for the treatment of equinus foot. However, physicians must also consider the possible complications associated with serial casting.

  7. Preoperative combination of progressive pneumoperitoneum and botulinum toxin type A in patients with loss of domain hernia.

    Science.gov (United States)

    Bueno-Lledó, José; Torregrosa, Antonio; Jiménez, Raquel; Pastor, Providencia García

    2018-02-15

    Preoperative progressive pneumoperitoneum (PPP) and botulinum toxin type A (BT) are tools in the surgical preparation of patients with loss of domain hernias (LODH). The aim of this paper is to report our experience with these preoperative techniques in 70 patients with LODH. Observational study of 70 consecutive patients with LODH was conducted between May 2010 and May 2016. Diameters of the hernia sac, incisional hernia (VIH), and abdominal cavity (VAC) volumes, and VIH/VAC ratio were measured before and after PPP and BT, using abdominal CT scan data. Combination of both techniques was performed when the VIH/VAC ratio was > 20%. Median insufflated volume of air for PPP was 8450 ± 3400 cc (4500-13,450), over a period of 11.3 ± 2.3 days (9-16). BT administration time was 38.1 ± 3.7 days (35-44). An average reduction of 16.6% of the VIH/VAC ratio after PPP and BT was obtained (p VIH/VAC ratio and hernia defect diameters, which constitutes a key factor in the treatment of LODH.

  8. Botulinum toxin type A combined with neurodynamic mobilization for upper limb spasticity after stroke: a case report.

    Science.gov (United States)

    Villafañe, Jorge H; Silva, Guillermo B; Chiarotto, Alessandro; Ragusa, Orazio L F

    2012-09-01

    The purpose of this study is to report a case in which combinatory therapy of botulinum toxin type A (BoNT-A) and neurodynamic mobilization (NM) was used as treatment for a patient with severe upper limb spasticity and pain after stroke. A 76-year-old male patient had spastic muscles in the upper limb 10 months after an ischemic stroke. The patient underwent combined treatment with BoNT-A and NM of the upper limb in 6 monthly applications. Evaluation was performed pretreatment, 3 months after the first injection, 3 months after the second injection, and at a follow-up session 9 months after starting the treatment. The following outcomes were measured: pain by using a numeric rating scale, spasticity by the Modified Ashworth Scale for Grading Spasticity, acceptance and emotional reaction to the treatment by the Hospital Anxiety and Depression Scale, and functionality by ranges of motion. The patient improved in all outcomes after treatment, and results were maintained during the follow-up sessions. The combined NM and BoNT-A treatment appeared to decrease pain and improve joint ranges of motion during treatment for this patient. The patient showed decreased anxiety and depression during and after the treatment.

  9. Botulinum Toxin Type A for the Treatment of Neuropathic Pain in Neuro-Rehabilitation

    Directory of Open Access Journals (Sweden)

    Domenico Intiso

    2015-06-01

    Full Text Available Pain is a natural protective mechanism and has a warning function signaling imminent or actual tissue damage. Neuropathic pain (NP results from a dysfunction and derangement in the transmission and signal processing along the nervous system and it is a recognized disease in itself. The prevalence of NP is estimated to be between 6.9% and 10% in the general population. This condition can complicate the recovery from stroke, multiple sclerosis, spinal cord lesions, and several neuropathies promoting persistent disability and poor quality of life. Subjects suffering from NP describe it as burning, itching, lancing, and numbness, but hyperalgesia and allodynia represent the most bothersome symptoms. The management of NP is a clinical challenge and several non-pharmacological and pharmacological interventions have been proposed with variable benefits. Botulinum toxin (BTX as an adjunct to other interventions can be a useful therapeutic tool for the treatment of disabled people. Although BTX-A is predominantly used to reduce spasticity in a neuro-rehabilitation setting, it has been used in several painful conditions including disorders characterized by NP. The underlying pharmacological mechanisms that operate in reducing pain are still unclear and include blocking nociceptor transduction, the reduction of neurogenic inflammation by inhibiting neural substances and neurotransmitters, and the prevention of peripheral and central sensitization. Some neurological disorders requiring rehabilitative intervention can show neuropathic pain resistant to common analgesic treatment. This paper addresses the effect of BTX-A in treating NP that complicates frequent disorders of the central and peripheral nervous system such as spinal cord injury, post-stroke shoulder pain, and painful diabetic neuropathy, which are commonly managed in a rehabilitation setting. Furthermore, BTX-A has an effect in relief pain that may characterize less common neurological disorders

  10. Botulinum Toxin Type A for the Treatment of Neuropathic Pain in Neuro-Rehabilitation

    Science.gov (United States)

    Intiso, Domenico; Basciani, Mario; Santamato, Andrea; Intiso, Marta; Di Rienzo, Filomena

    2015-01-01

    Pain is a natural protective mechanism and has a warning function signaling imminent or actual tissue damage. Neuropathic pain (NP) results from a dysfunction and derangement in the transmission and signal processing along the nervous system and it is a recognized disease in itself. The prevalence of NP is estimated to be between 6.9% and 10% in the general population. This condition can complicate the recovery from stroke, multiple sclerosis, spinal cord lesions, and several neuropathies promoting persistent disability and poor quality of life. Subjects suffering from NP describe it as burning, itching, lancing, and numbness, but hyperalgesia and allodynia represent the most bothersome symptoms. The management of NP is a clinical challenge and several non-pharmacological and pharmacological interventions have been proposed with variable benefits. Botulinum toxin (BTX) as an adjunct to other interventions can be a useful therapeutic tool for the treatment of disabled people. Although BTX-A is predominantly used to reduce spasticity in a neuro-rehabilitation setting, it has been used in several painful conditions including disorders characterized by NP. The underlying pharmacological mechanisms that operate in reducing pain are still unclear and include blocking nociceptor transduction, the reduction of neurogenic inflammation by inhibiting neural substances and neurotransmitters, and the prevention of peripheral and central sensitization. Some neurological disorders requiring rehabilitative intervention can show neuropathic pain resistant to common analgesic treatment. This paper addresses the effect of BTX-A in treating NP that complicates frequent disorders of the central and peripheral nervous system such as spinal cord injury, post-stroke shoulder pain, and painful diabetic neuropathy, which are commonly managed in a rehabilitation setting. Furthermore, BTX-A has an effect in relief pain that may characterize less common neurological disorders including post

  11. Botulinum Toxin Type A as Preoperative Treatment for Immediately Loaded Dental Implants Placed in Fresh Extraction Sockets for Full-Arch Restoration of Patients With Bruxism.

    Science.gov (United States)

    Mijiritsky, Eitan; Mortellaro, Carmen; Rudberg, Omri; Fahn, Miri; Basegmez, Cansu; Levin, Liran

    2016-05-01

    The aim of the present report was to describe the use of Botulinum toxin type A as preoperative treatment for immediately loaded dental implants placed in fresh extraction sockets for full-arch restoration of patients with bruxism. Patients with bruxism who were scheduled to receive immediately loaded full-arch implant supported fixed restorations were included in this retrospective clinical report. To reduce the occlusal forces applied in patients with bruxism, Botulinum toxin type A was introduced prior to the implant placement procedure. Patients were followed and implant survival as well as peri-implant bone level was assessed in each periodic follow-up visit. Adverse effects were also recorded. A control group with no use of Botulinum toxin was evaluated as well. A total of 26 patients (13 test and 13 control), with bruxism, aged 59.15 ± 11.43 years on average were included in this retrospective report and received immediately loaded dental implants placed in fresh extraction sockets for full-arch restoration. The test group treatment preceded by Botulinum toxin type A injection. Maxillary arches were supported by 8 to 10 implants while the mandibular arch was supported by 6 implants. All surgeries went uneventfully and no adverse effects were observed. The average follow-up time was 32.5 ± 10.4 months (range, 18-51). In the test group, no implant failures were recorded. One patient presented with 1 to 2 mm bone loss around 4 of the implants; the other implants presented with stable bone level. In the control group 1 patient lost 2 implants and another demonstrated 2 mm bone loss around 3 of the implants. The preoperative use of Botulinum toxin in patients with bruxism undergoing full-arch rehabilitation using immediately loaded dental implants placed in fresh extraction sockets seems to be a technique that deserves attention. Further long-term, large-scale randomized clinical trials will help to determine the additional benefit of this suggested

  12. Botulinum toxin in children with cerebral palsy.

    Science.gov (United States)

    Singhi, Pratibha; Ray, Munni

    2004-12-01

    Botulinum toxin is a neurotoxin that blocks the synaptic release of acetylcholine from cholinergic nerve terminals mainly at the neuromuscular junction, resulting in irreversible loss of motor end plates. It is being widely tried as a targeted antispasticity treatment in children with cerebral palsy. A number of studies have shown that it reduces spasticity and increases the range of motion and is particularly useful in cases with dynamic contractures. However improvement in function has not been convincingly demonstrated. It is an expensive mode of therapy and the injections need to be repeated after 3-6 months. Whereas Botulinum toxin can be a valuable adjunct in select cases, it should not be projected as a panacea for children with spastic cerebral palsy.

  13. Molecular Structures and Functional Relationships in Clostridial Neurotoxins

    Energy Technology Data Exchange (ETDEWEB)

    Swaminathan S.

    2011-12-01

    The seven serotypes of Clostridium botulinum neurotoxins (A-G) are the deadliest poison known to humans. They share significant sequence homology and hence possess similar structure-function relationships. Botulinum neurotoxins (BoNT) act via a four-step mechanism, viz., binding and internalization to neuronal cells, translocation of the catalytic domain into the cytosol and finally cleavage of one of the three soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNARE) causing blockage of neurotransmitter release leading to flaccid paralysis. Crystal structures of three holotoxins, BoNT/A, B and E, are available to date. Although the individual domains are remarkably similar, their domain organization is different. These structures have helped in correlating the structural and functional domains. This has led to the determination of structures of individual domains and combinations of them. Crystal structures of catalytic domains of all serotypes and several binding domains are now available. The catalytic domains are zinc endopeptidases and share significant sequence and structural homology. The active site architecture and the catalytic mechanism are similar although the binding mode of individual substrates may be different, dictating substrate specificity and peptide cleavage selectivity. Crystal structures of catalytic domains with substrate peptides provide clues to specificity and selectivity unique to BoNTs. Crystal structures of the receptor domain in complex with ganglioside or the protein receptor have provided information about the binding of botulinum neurotoxin to the neuronal cell. An overview of the structure-function relationship correlating the 3D structures with biochemical and biophysical data and how they can be used for structure-based drug discovery is presented here.

  14. The efficacy of two formulations of botulinum toxin type A for masseter reduction: a split-face comparison study.

    Science.gov (United States)

    Wanitphakdeedecha, Rungsima; Ungaksornpairote, Chanida; Kaewkes, Arisa; Sathaworawong, Angkana; Lektrakul, Nittaya; Manuskiatti, Woraphong

    2017-08-01

    Botulinum toxin type A (BTA) is now extensively used to address cosmetic concerns. OnabotulinumtoxinA (ONA, Botox; Allergan Inc., Irvine, CA) received FDA approval for upper face rejuvenation, including glabella frown lines and crow's-feet lines. The other off-label uses for lower face conditions have been utilized for contouring purposes, especially masseter hypertrophy. Recently, a new Daewoong BTA, (NABOTA ® , NBT, Daewoong Pharmaceutical, Seoul, Korea), was recently introduced. To compare efficacy and safety of ONA and NBT for masseter reduction. Thirty-five subjects with masseter hypertrophy were randomly injected with 25 units of ONA on one side and 25 units of NBT on the other side into masseter. Standardized photographic documentation was obtained at baseline, 1, 3 and 6 months after treatment. The mean volume of masseter was acquired by using three-dimensional computed tomography (3-D CT) at baseline, 3-, and 6-month follow-up visits. In addition, patients' satisfaction and side effects were also record at every follow-up visits. The mean masseter volume on the sides treated with ONA and NBT at baseline were 21.20 ± 4.23 cm 3 and 21.26 ± 4.58 cm 3 , respectively. There was no statistically significant difference in the mean volume of both sides (p= 0.827). The mean masseter volume at 3- and 6-month follow-up visits reduced significantly on both ONA and NBT sides (pNBT sides at 3 and 6 months after treatment (p= 0.769 and p = 0.346, respectively). There was also no statistically significant difference in masseter reduction when compared between ONA and NBT sides evaluated by physicians and patients at each follow-up visit. No side effect on both sides was reported after injection. This study demonstrated that ONA and NBT provided comparable efficacy and safety for masseter reduction.

  15. The effects of intradermal botulinum toxin type a injections on pain symptoms of patients with diabetic neuropathy

    Directory of Open Access Journals (Sweden)

    Majid Ghasemi

    2014-01-01

    Full Text Available Background: Considering the dramatic increasing rate of diabetes and consequently its related complications, most importantly diabetic peripheral neuropathy (DPN, challenges regarding proper treatment of DPN and its effect on the quality-of-life and care of diabetic patients, the aim of this current study is to evaluate the effect of intradermal botulinum toxin type A (BTX-A injections on pain symptoms of patients with diabetic neuropathic pain. Materials and Methods: In this randomized double-blind placebo-controlled clinical trial study, diabetic patients aged <70 years with neuropathic pain in both feet were enrolled. Diabetic neuropathy (DN in selected patients was diagnosed using DN4 questionnaire and nerve conduction velocity examinations. They randomized in two intervention (BTX-A injection/100 unit, N = 20 and placebo groups (normal saline injection, N = 20. The outcome of injection on diabetic neuropathic pain was assessed using neuropathy pain scale (NPS and visual analog scale (VAS score and compared in two studied groups. Results: There was no significant difference in DN4, NPS and VAS scales of studied population after intervention in the placebo group. Intradermal injection of BTX-A reduced NPS scores for all items except cold sensation (P = 0.05. It reduced DN4 scores for electric shocks, burning, pins and needles and brushing (P < 0.05. According to VAS scale 30% and 0% of patients in intervention and placebo groups have no pain after intervention (P = 0.01. Conclusion: Intradermal injection of BTX-A is a well-tolerated agent that has a significant effect on DPN pain.

  16. Long-term tremor therapy for Parkinson and essential tremor with sensor-guided botulinum toxin type A injections.

    Science.gov (United States)

    Samotus, Olivia; Lee, Jack; Jog, Mandar

    2017-01-01

    Current pharmacological agents used to treat Parkinson disease (PD) tremor and essential tremor (ET) provide suboptimal benefit and are commonly associated with significant adverse effects. Botulinum toxin type A (BoNT-A) has been shown to be effective for wrist tremor though functionally bothersome muscle weakness frequently occurs. This is the longest study to date demonstrating that BoNT-A therapy coupled with kinematic guidance can provide efficacious outcomes for upper limb tremor with minimized unwanted weakness. A total of 28 PD and 24 ET participants with bothersome, disabling tremor, received six serial BoNT-A treatments every 16 weeks starting at week 0 with a follow-up visit 6 weeks following a treatment, totaling 96 weeks. Clinical scales, including Fahn-Tolosa-Marin tremor rating scale (FTM), and sensor-based tremor assessments were conducted at each visit. Kinematics was utilized to identify which arm muscles contributed to the tremulous movements and the experienced injector used clinical expertise in determining BoNT-A dosages. Following BoNT-A treatment, clinical ratings of tremor severity and functional ability (FTM) showed significant improvements following the first treatment which was maintained up to week 96 in PD and ET. Kinematics detected a significant reduction in PD and ET tremor amplitudes by 70% and 76% over the treatment course, respectively. By objectively distinguishing tremulous muscles and tremor severity, adverse effects were limited to mild perceived weakness by participants in injected muscles during follow-ups. Following the fourth treatment, BoNT-A dosages in flexor and extensor wrist muscles and biceps were reduced for those experiencing residual weakness which ultimately did not interfere with tremor relief or arm function. Kinematics is an objective method that can aid clinicians in assessing and determining optimal BoNT-A parameters to alleviate both PD and ET tremor. BoNT-A injections are tolerable and effective when

  17. Time course analysis of the effects of botulinum toxin type a on elbow spasticity based on biomechanic and electromyographic parameters.

    Science.gov (United States)

    Lee, Hsin-Min; Chen, Jia-Jin Jason; Wu, Yi-Ning; Wang, Yu-Lin; Huang, Sheng-Chih; Piotrkiewicz, Maria

    2008-04-01

    To quantify changes of elbow spasticity over time after botulinum toxin type A (BTX-A) injection in the upper extremity of stroke patients. Before-after trial in which the therapeutic effects were followed up at 2, 6, and 9 weeks after the BTX-A injection (Botox). Hospital. Chronic stroke patients (N=8) with upper-limb spasticity. BTX-A was injected in upper-limb muscles, including the biceps brachii. Treatment effects were quantified as the changes in the velocity and the length dependence of hyperexcitable stretch reflexes. Manual sinusoid stretches of the elbow joint at 4 frequencies (1/3, 1/2, 1, 3/2Hz) over a movement range of 60 degrees were performed on patients by using a portable device. The Modified Ashworth Scale (MAS), biomechanic viscosity, and the reflexive electromyography threshold (RET) of the biceps brachii were used to evaluate the degree of hypertonia. The statistical analyses of the MAS score, biomechanic viscosity, and RET revealed a significant decrease in spasticity after the injection (all Pbiomechanic viscosity, RET) revealed small changes in spasticity after the BTX-A injection that could not be observed from clinical MAS evaluations. Five of 8 subjects showed a maximal reduction in spasticity (in terms of biomechanic viscosity value) within 6 weeks after the injection, whereas it was notable that all subjects exhibited peak RET values at either 2 or 6 weeks after the injection with variable degrees of relapse of spasticity. Early relapse of spasticity (within 9 weeks of the injection) can be detected from biomechanic and neurophysiologic assessments in a clinical setup. These quantitative indices provide valuable information for clinicians when making decisions to perform additional rehabilitation interventions or another BTX-A injection in the early stages of treatment.

  18. The Effect of Botulinum Toxin Type A on Expression Profiling of Long Noncoding RNAs in Human Dermal Fibroblasts

    Directory of Open Access Journals (Sweden)

    Ying-ying Miao

    2017-01-01

    Full Text Available Objective. This study was aimed at analyzing the expressions of long noncoding RNAs (lncRNAs in Botulinum Toxin Type A (BoNTA treated human dermal fibroblasts (HDFs in vitro. Methods. We used RNA sequencing to characterize the lncRNAs and mRNAs transcriptome in the control and BoNTA treated group, in conjunction with application of GO (gene ontology analysis and KEGG (kyoto encyclopedia of genes and genomes analysis to delineate the alterations in gene expression. We also obtained quantitative real time polymerase chain reaction (qRT-PCR to confirm some differentially expressed genes. Results. Numerous differentially expressed genes were observed by microarrays between the two groups. qRT-PCR confirmed the changes of six lncRNAs (RP11-517C16.2-001, FR271872, LOC283352, RP11-401E9.3, FGFR3P, and XXbac-BPG16N22.5 and nine mRNAs (NOS2, C13orf15, FOS, FCN2, SPINT1, PLAC8, BIRC5, NOS2, and COL19A1. Farther studies indicated that the downregulating effect of BoNTA on the expression of FGFR3P was time-related and the dosage of BoNTA at a range from 2.5 U/106 cells to 7.5 U/106 cells increased the expression of FGFR3P and COL19A1 in HDFs as well. Conclusion. The expression profiling of lncRNAs was visibly changed in BoNTA treated HDFs. Further studies should focus on several lncRNAs to investigate their functions in BoNTA treated HDFs and the underlying mechanisms.

  19. Botulinum Toxin Type A Inhibits α-Smooth Muscle Actin and Myosin II Expression in Fibroblasts Derived From Scar Contracture.

    Science.gov (United States)

    Chen, Minliang; Yan, Tongtong; Ma, Kui; Lai, Linying; Liu, Chang; Liang, Liming; Fu, Xiaobing

    2016-09-01

    Scar contracture (SC) is one of the most common complications resulting from major burn injuries. Numerous treatments are currently available but they do not always yield excellent therapeutic results. Recent reports suggest that botulinum toxin type A (BTXA) is effective at reducing SC clinically, but the molecular mechanism for this action is unknown. α-Smooth muscle actin (α-SMA) and myosin II are the main components of stress fibers, which are the contractile structures of fibroblasts. The effects of BTXA on α-SMA and myosin II in SC are still unknown. This study aimed to explore the effect of BTXA on α-SMA and myosin II expression in fibroblasts derived from SC and to elucidate its actual mechanism further. Fibroblasts were isolated from tissue specimens of SC. Fibroblasts were cultured in Dulbecco modified Eagle medium with different concentrations of BTXA and their proliferation was analyzed through the tetrazolium-based colorimetric method at 1, 4, and 7 days. Proteins of α-SMA and myosin II were checked using Western blot in fibroblasts treated with different concentrations of BTXA at 1, 4, and 7 days. Fibroblasts without BTXA treatment had a higher proliferation than that in other groups, which indicated that the proliferation of fibroblasts was significantly inhibited by BTXA (P < 0.05). Proteins of α-SMA and myosin II between fibroblasts with BTXA and fibroblasts without BTXA are statistically significant (P < 0.05). These results suggest that BTXA effectively inhibited the growth of fibroblasts derived from SC and reduced the expression of α-SMA and myosin II, which provided theoretical support for the application of BTXA to control SC.

  20. Botulinum toxin type a injections for cervical and shoulder girdle myofascial pain using an enriched protocol design.

    Science.gov (United States)

    Nicol, Andrea L; Wu, Irene I; Ferrante, F Michael

    2014-06-01

    Myofascial pain syndrome is a regional condition of muscle pain and stiffness and is classically characterized by the presence of trigger points in affected musculature. Botulinum toxin type A (BoNT-A) has been shown to have antinociceptive properties and elicit sustained muscle relaxation, thereby possibly affording even greater relief than traditional strategies. Our goal was to determine whether direct injection of BoNT-A into painful muscle groups is effective for cervical and shoulder girdle myofascial pain. An enriched protocol design was used, wherein 114 patients with cervical and shoulder girdle myofascial pain underwent injection of BoNT-A to determine their response to the drug. Fifty-four responders were then enrolled in a 12-week, randomized, double-blind, placebo-controlled trial. Pain scales and quality of life measures were assessed at baseline and at routine follow-up visits until completion of the study after 26 weeks. Injection of BoNT-A into painful muscle groups improved average visual numerical pain scores in subjects who received a second dose of BoNT-A compared to placebo (P = 0.019 [0.26, 2.78]). Subjects who received a second dose of BoNT-A had a reduced number of headaches per week (P = 0.04 [0.07, 4.55]). Brief Pain Inventory interference scores for general activity and sleep were improved (P = 0.046 [0.038, 3.700] and 0.02 [0.37, 4.33], respectively) in those who received a second dose of BoNT-A. BoNT-A injected directly into painful muscle groups improves average pain scores and certain aspects of quality of life in patients experiencing severe cervical and shoulder girdle myofascial pain.

  1. Clinical Practice: evidence-Based Recommendations for the Treatment of Cervical Dystonia with Botulinum Toxin

    NARCIS (Netherlands)

    Contarino, Maria Fiorella; van den Dool, Joost; Balash, Yacov; Bhatia, Kailash; Giladi, Nir; Koelman, Johannes H.; Lokkegaard, Annemette; Marti, Maria J.; Postma, Miranda; Relja, Maja; Skorvanek, Matej; Speelman, Johannes D.; Zoons, Evelien; Ferreira, Joaquim J.; Vidailhet, Marie; Albanese, Alberto; Tijssen, Marina A. J.

    2017-01-01

    Cervical dystonia (CD) is the most frequent form of focal dystonia. Symptoms often result in pain and functional disability. Local injections of botulinum neurotoxin are currently the treatment of choice for CD. Although this treatment has proven effective and is widely applied worldwide, many

  2. What Clinical Strategies Are Applied for Botulinum Toxin Injection in the Oromandibular Region?

    DEFF Research Database (Denmark)

    Bakke, Merete; Dalager, Torben; Møller, Eigild

    2016-01-01

    Botulinum neurotoxin (BoNT) inhibits the release of acetylcholine from cholinergic nerve terminals in muscles or salivary glands. With reduced activation, the muscle activity or secretion decreases. Indications for medical, non‐cosmetic use of BoNT in the orofacial area include among others oroma...

  3. Hemifacial Spasm due to Compression of the Posterior Inferior Cerebellar Artery Aneurysm Treated with Botulinum Toxin Type-A: A Case Report

    Directory of Open Access Journals (Sweden)

    Azize Esra Gürsoy

    2012-01-01

    Full Text Available A 79-year-old female presented with five months history of progressive involuntary twitching movement on left face. Brain MR imaging revealed a heterogeneous T2 hyperintense lesion at left cerebellopontine angle. CT angiography showed a partially thrombosed saccular aneurysm of left PICA (posterior inferior cerebellar artery. The patient was treated with Botulinum toxin type A and almost total relief of symptoms was noticed during one month followup. Botulinium toxin injection is an effective symptomatic treatment option in nonsurgical secondary hemifacial spasm (HFS cases.

  4. Hemifacial Spasm due to Compression of the Posterior Inferior Cerebellar Artery Aneurysm Treated with Botulinum Toxin Type-A: A Case Report.

    Science.gov (United States)

    Gürsoy, Azize Esra; Babacan Yildiz, Gülsen; Gülhan, Adam Mehmet; Kolukisa, Mehmet

    2012-01-01

    A 79-year-old female presented with five months history of progressive involuntary twitching movement on left face. Brain MR imaging revealed a heterogeneous T2 hyperintense lesion at left cerebellopontine angle. CT angiography showed a partially thrombosed saccular aneurysm of left PICA (posterior inferior cerebellar artery). The patient was treated with Botulinum toxin type A and almost total relief of symptoms was noticed during one month followup. Botulinium toxin injection is an effective symptomatic treatment option in nonsurgical secondary hemifacial spasm (HFS) cases.

  5. Quantification of toxin-encoding mRNA from Clostridium botulinum type E in media containing sorbic acid or sodium nitrite by competitive RT-PCR.

    Science.gov (United States)

    Sharkey, Freddie H; Markos, Spiros I; Haylock, Richard W

    2004-03-19

    Competitive reverse transcription polymerase chain reaction (cRT-PCR) was used to quantify the toxin-encoding mRNA production of a Clostridium botulinum type E strain in media containing either sorbic acid or sodium nitrite. A 10-fold reduction in toxin mRNA production and a 25-fold reduction in the proportion of toxin mRNA to total RNA, was estimated when either 1 mg ml(-1) sorbic acid or 100 microg ml(-1) sodium nitrite were added to the medium at pH 7.0.

  6. Botulinum Toxin Therapy

    Science.gov (United States)

    ... AADA Health System Reform Principles Drug pricing and availability CVS dermatologic formulary restrictions Access to compounded medications ... Botulinum toxin therapy: Overview Also called botulinum rejuvenation Brand names: Botox® Cosmetic, Dysport®, MYOBLOC®, and XEOMIN® When ...

  7. Structure-function relationships in the receptor for urokinase-type plasminogen activator. Comparison to other members of the Ly-6 family and snake venom alpha-neurotoxins

    DEFF Research Database (Denmark)

    Ploug, M; Ellis, V

    1994-01-01

    -anchored membrane proteins. Recent evidence has highlighted similarities between the individual domains of uPAR and the large family of secreted, single domain snake venom alpha-neurotoxins, suggesting that uPAR may adopt the same gross folding pattern as these structurally well characterized proteins. Structural...

  8. Casting, taping or stretching after botulinum toxin type A for spastic equinus foot: a single-blind randomized trial on adult stroke patients.

    Science.gov (United States)

    Carda, Stefano; Invernizzi, Marco; Baricich, Alessio; Cisari, Carlo

    2011-12-01

    To investigate the effect of different adjunctive treatments after botulinum toxin type A. Single-blind, randomized trial, with three-month follow-up. Secondary rehabilitative care. Convenience sample of 69 chronic hemiplegic adult patients with spastic equinus foot. Following botulinum toxin type A injection at the plantar flexors, patients were randomly assigned to three groups and treated with either taping, casting or stretching for one week, and with stretching and gait training for the next week. Modified Ashworth Scale at plantar flexors, passive range of motion at the ankle, six-minute walking test, 10-metre walking test, Functional Ambulation Categories, ankle dorsiflexor strength were evaluated before treatment (t(0)) at 20 days (t(1)) and 90 days (t(2)) after treatment. At t(1) only the taping and casting groups showed significant improvements in Modified Ashworth Scale, six-minute walking test, 10-metre walking test and passive range of motion (P stretching groups at Modified Ashworth Scale and passive range of motion, and better than the stretching group at six-minute walking test (P stretching alone.

  9. Long-term tremor therapy for Parkinson and essential tremor with sensor-guided botulinum toxin type A injections

    Science.gov (United States)

    Samotus, Olivia; Lee, Jack; Jog, Mandar

    2017-01-01

    Objective Current pharmacological agents used to treat Parkinson disease (PD) tremor and essential tremor (ET) provide suboptimal benefit and are commonly associated with significant adverse effects. Botulinum toxin type A (BoNT-A) has been shown to be effective for wrist tremor though functionally bothersome muscle weakness frequently occurs. This is the longest study to date demonstrating that BoNT-A therapy coupled with kinematic guidance can provide efficacious outcomes for upper limb tremor with minimized unwanted weakness. Methods A total of 28 PD and 24 ET participants with bothersome, disabling tremor, received six serial BoNT-A treatments every 16 weeks starting at week 0 with a follow-up visit 6 weeks following a treatment, totaling 96 weeks. Clinical scales, including Fahn-Tolosa-Marin tremor rating scale (FTM), and sensor-based tremor assessments were conducted at each visit. Kinematics was utilized to identify which arm muscles contributed to the tremulous movements and the experienced injector used clinical expertise in determining BoNT-A dosages. Results Following BoNT-A treatment, clinical ratings of tremor severity and functional ability (FTM) showed significant improvements following the first treatment which was maintained up to week 96 in PD and ET. Kinematics detected a significant reduction in PD and ET tremor amplitudes by 70% and 76% over the treatment course, respectively. By objectively distinguishing tremulous muscles and tremor severity, adverse effects were limited to mild perceived weakness by participants in injected muscles during follow-ups. Following the fourth treatment, BoNT-A dosages in flexor and extensor wrist muscles and biceps were reduced for those experiencing residual weakness which ultimately did not interfere with tremor relief or arm function. Conclusions Kinematics is an objective method that can aid clinicians in assessing and determining optimal BoNT-A parameters to alleviate both PD and ET tremor. BoNT-A injections

  10. Features of treatment of cervical dystonia associated with head tremor with botulinum toxin type A drugs under electro myographic control

    Directory of Open Access Journals (Sweden)

    A. N. Korenko

    2016-01-01

    Full Text Available The study was aimed to evaluate the efficacy and safety of injections of botulinum toxin typeA (BTA in the neck muscles under electromyographic control and without it to reduce head tremor, muscle tone and dystonic postures, as well as pain in patients with cervical dystonia (CD. 49 patients with CD and dystonic head tremor who received injections of BTA were examined. 33 (67 % patients received Dysport in an average dose of 695 (627; 762 units, 15 (31 % patients received Xeomin in an average dose of 262 (227; 297 units and 1 (2 % patient received 300 units of Botox. 16 (33 % patients received injections under EMGcontrol. The level of symptoms of CD and tremor before and 4 weeks after the treatment were measured by the TWSTRS and Tsui scales. Evaluation of the treatment efficacy was carried out using the patientreported Clinical Global Improvement (CGI scale, and the presence or absence of head tremor after injection was also recorded. The TWSTRS score decreased from 39 (36, 42 to 24 (21, 26, the TZUI score decreased from 9.8 (9, 10 to 4.9 (4, 6 in 4 weeks after injection (p <0.001. The level of tremor measured by Tsui scale decreased from 2.1 (1.7, 2.4 and 0.7 points (0,5; 0,9 (p <0.001. In 24 (49 % cases, complete disappearance of tremor was noted in 4 weeks after injection. Complete regression of tremor was observed significantly more frequently in patients with torticollis who received injections with EMG-control in 10(71 % cases vs. 8(32 % without it (p <0.05. 28(57 % patients noted moderate or significant improvement on the CGI scale. Pain decreased from 5.4 (3.9, 6.9 points to 2.4 (1.3, 3.6 (p <0.001 according to section 3 of TWSTRS scale, pain completely regressed in 15 (52 % patients. BTA injections are highly effective and safe treatment of CD symptoms such as dystonic posture, pain and dystonic tremor. BTA injections in the neck muscles under EMGcontrol can improve outcome in patients with torticollis associated with

  11. Studies on growth and toxin production of C. botulinum type E on cod homogenate treated with a combination of spices, sodium chloride and gamma-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Siddiqui, A.K. (Atomic Energy Centre, Dacca (Bangladesh)); Ando, Y.; Karashimada, T.; Kameyama, K.

    1979-09-01

    Cod homogenates inoculated with spores of C. botulinum type E strain Erimo at 10/sup 2/ and 10/sup 4//g were treated with 1% and 2% sodium chloride, 0.25% each of mustard, garlic and turmeric and 0.3 Mrad ..gamma..-radiation either in single or combination treatments. The growth and toxin production of type E spores in the inoculated homogenates were followed at incubation temperatures of 30/sup 0/, 10/sup 0/ and 5/sup 0/C for 7, 28 and 56 days respectively. Growth and gas formation were noted in all the samples but type E toxin could not be detected. The reason for the absence of toxin in both the untreated and treated homogenates could not be ascertained. Inadequate detection method, unfavourable growth conditions in the homogenate and weak toxigenicity of the strain employed have been advanced as probable factors that contributed to the negative results on the toxin assay.

  12. Analysis of epitope information related to Bacillus anthracis and Clostridium botulinum

    Science.gov (United States)

    Zarebski, Laura M; Vaughan, Kerrie; Sidney, John; Peters, Bjoern; Grey, Howard; Janda, Kim D; Casadevall, Arturo

    2012-01-01

    We have reviewed the information about epitopes of immunological interest from Clostridium botulinum and Bacillus anthracis, by mining the Immune Epitope Database and Analysis Resource. For both pathogens, the vast majority of epitopes reported to date are derived from a single protein: the protective antigen of B. anthracis and the neurotoxin type A of C. botulinum. A detailed analysis of the data was performed to characterize the function, localization and conservancy of epitopes identified as neutralizing and/or protective. In order to broaden the scope of this analysis, we have also included data describing immune responses against defined fragments (over 50 amino acids long) of the relevant antigens. The scarce information on T-cell determinants and on epitopes from other antigens besides the toxins, highlights a gap in our knowledge and identifies areas for future research. Despite this, several distinct structures at the epitope and fragment level are described herein, which could be potential additions to future vaccines or targets of novel immunotherapeutics and diagnostic reagents. PMID:18251694

  13. [Molecular biology of neurosecretion and its inhibition bu tetanus and botulinum toxins (review)].

    Science.gov (United States)

    Veit, M

    1999-06-01

    Signal transfer between neurons and between neurons and muscle cells is mediated by the secretion of neurotransmitters. The axon of the presynaptic cell contains synaptic vesicles, the storage organelles for neurotransmitters. Arrival of an action potential causes calcium-influx into the axon and leads to fusion of synaptic vesicles with the presynaptic plasma membrane. Recently, the events between calcium-influx and membrane fusion were elucidated on a molecular level. The family of SNARE-proteins was identified as the key players in neurosecretion. They are located on synaptic vesicles (VAMP) or on the presynaptic plasma membrane (syntaxin, SNAP-25). Intimate protein-protein interactions between the SNARE-proteins are responsible for the attachment and merger of vesicle and the plasma membrane. Fusion is triggered by calcium-binding to synaptotagmin, another protein recently identified on synaptic vesicles. The molecular mechanism of the action of clostridial neurotoxins was also elucidated. Botulinum-as well as Tetanus toxins are proteases which cleave neuronal SNARE-proteins. This explains the long known inhibition of neurosecretion caused by these toxins. The proteolytic action of Tetanus- and Botulinum toxin occurs in different types of neurons, resulting in a stimulatory or inhibitory effect on muscle cells. This selective degradation of SNAREs explains the opposing clinical signs of tetanus (cramps) and botulismus (paralysis).

  14. Botulinum Toxin Injection for Treatment of Chronic Anal Fissure: Is There Any Dose-Dependent Efficiency? A Meta-Analysis.

    Science.gov (United States)

    Bobkiewicz, Adam; Francuzik, Wojciech; Krokowicz, Lukasz; Studniarek, Adam; Ledwosiński, Witold; Paszkowski, Jacek; Drews, Michal; Banasiewicz, Tomasz

    2016-12-01

    Chronic anal fissure (CAF) is a linear split of the anoderm. The minimally invasive management of CAF such as botulinum toxin (BT) injection is recommended. However, the exact efficient dose of BT, number of injections per session and the injection sites are still debatable. The aim of this analysis was to assess the dose-dependent efficiency of botulinum toxin injection for CAF. PubMed and Web of Science databases were searched for terms: "anal fissure" AND "botulinum toxin." Studies published between October 1993 and May 2015 were included and had to meet the following criteria: (1) chronic anal fissure, (2) prospective character of the study, (3) used simple BT injection without any other interventions and (4) no previous treatment with BT. A total of 1577 patients from 34 prospective studies used either Botox or Dysport formulations were qualified for this meta-analysis. A total number of BT units per session ranged from 5 to 150 IU, whereas the efficiency across analyzed studies ranged from 33 to 96 %. Surprisingly, we did not observe a dose-dependent efficiency (Spearman's rank correlation coefficient, ρ = 0.060; p = 0.0708). Moreover, there were no BT dose-dependent postoperative complications or fecal incontinence and significant difference in healing rates compared BT injection into the anal sphincter muscles. BT injection has been an accepted method for the management of CAF. Surprisingly, there is no dose-dependent efficiency, and the postoperative incontinence rate is not related to the BT dosage regardless the type of formulation of botulinum neurotoxin used. Moreover, no difference in healing rate has been observed in regard to the site and number of injections per session.

  15. Characterization of Fatty Acid Composition, Spore Germination, and Thermal Resistance in a Nisin-Resistant Mutant of Clostridium botulinum 169B and in the Wild-Type Strain†

    Science.gov (United States)

    Mazzotta, Alejandro S.; Montville, Thomas J.

    1999-01-01

    The membrane fatty acids, thermal resistance, and germination of a nisin-resistant (Nisr) mutant of Clostridium botulinum 169B were compared with those of the wild-type (WT) strain. In the membranes of WT cells, almost 50% of the total fatty acids were unsaturated, but in those of Nisr cells, only 23% of the fatty acids were unsaturated. WT and Nisr spores contained similar amounts (approximately 23%) of unsaturated fatty acids, but the saturated straight-chain/branched-chain ratio was significantly higher in Nisr spores than in WT spores. These fatty acid differences suggest that Nisr cell and spore membranes may be more rigid, a characteristic which would interfere with the pore-forming ability of nisin. Nisr C. botulinum did not produce an extracellular nisin-degrading enzyme, nor were there any differences in the sodium dodecyl sulfate-polyacrylamide gel electrophoresis patterns of coat proteins extracted from WT and Nisr spores, eliminating these as possible reasons for nisin resistance. Nisr spores had thermal resistance parameters similar to those of WT spores. In WT spores, but not in Nisr spores, nisin caused a 40% reduction in thermal resistance and a twofold increase in the germination rate. Because the nisin-induced increase in the germination rate of WT spores occurred only in the presence of a germinant (a molecule that triggers germination), nisin can be classified as a progerminant (a molecule that stimulates germination only in the presence of a germinant). PMID:9925597

  16. Use of Botulinum Neurotoxin for the Treatment of Movement Disorders

    Science.gov (United States)

    ... this disorder. Will BoNT help my facial spasms (hemifacial spasms)? There is good evidence that BoNT injection is useful in treating hemifacial spasms. People with hemifacial spasms who have had BoNT ...

  17. Genetic Diversity Among Botulinum Neurotoxin-Producing Clostridial Strains

    Science.gov (United States)

    2007-02-01

    fragment length polymorphism analysis of Norwegian Bacillus cereus and Bacillus thuringiensis soil isolates. Appl. Environ. Microbiol. 67:4863–4873...seven toxin genes of the serotypes were compared and showed various degrees of interrelat- edness and recombination, as was previously noted for the...environmental toxin sensors, diagnostic tests for botulism, and specific coun- termeasures for the prevention and treatment of intoxication have become

  18. Host Response to Botulinum Neurotoxins for Developing Diagnostics and Antidotes

    Science.gov (United States)

    2009-09-18

    cytosol to block neurotransmitter release. BoNTs possess Zn2+ endopeptidase activity against a select group of neuronal proteins involved in the exocytosis ...2M sulfuric acid and the absorbance was measured at 490 nm. The antibody titer of the sera was 7 measured by plotting absorbance vs. serum dilution...2007) BoNT/A and Hn-33 seem to translocate at a similar rate , the mixture of the two enhances the translocation of BoNT/A and Hn-33 each by about

  19. Exploitation of Botulinum Neurotoxins for Research and Clinical Purposes

    Science.gov (United States)

    1993-06-01

    agenesis . Thus, results to date dictate that the desired non-toxic transporter can be readily constructed by routine reconstitution (involving S-S...structures which fell into 3 groups: uncoated vesicles, large vesicles and multi- vesicular bodies with mean sizes of 50, 165 and • 400 rim, respectively...vesicles and multi- vesicular bodies in which grains were located are typical endocytotic structures corresponding to early and late endosomes

  20. Historical Perspectives and Guidelines for Botulinum Neurotoxin Subtype Nomenclature

    Science.gov (United States)

    2016-08-26

    Universidad Nacional de Cuyo, Mendoza, Argentina 9Foodborne Toxin Detection and Prevention Research Unit, Western Regional Research Center, U.S...USA 13Los Alamos National Laboratories, Los Alamos, New Mexico , USA 14National Center for Environmental Health, Centers for Disease Control and...ACG50065 A6 CDC 41370 food/ Mexico ACW83608 A7 2008-148 enchiladas/France, 2008 AFV13854 A8 Chemnitz green bean salad/Germany, 2007 AJA05787 BoNT

  1. Primary Cell Culture for Evaluation of Botulinum Neurotoxin Antagonists

    National Research Council Canada - National Science Library

    Sheridan, Robert E; Smith, Theresa J; Adler, Michael

    2005-01-01

    .... When spinal cord cultures were exposed to BoNT/A for 24 h, inhibition of 3[H]-glycine release was detected at toxin concentrations as low as 10-14 M, and complete inhibition was observed at concentration >10-12 M...

  2. Can botulinum toxin type A injection technique influence the clinical outcome of patients with post-stroke upper limb spasticity? A randomized controlled trial comparing manual needle placement and ultrasound-guided injection techniques.

    Science.gov (United States)

    Santamato, Andrea; Micello, Maria Francesca; Panza, Francesco; Fortunato, Francesca; Baricich, Alessio; Cisari, Carlo; Pilotto, Alberto; Logroscino, Giancarlo; Fiore, Pietro; Ranieri, Maurizio

    2014-12-15

    Botulinum toxin type A is a first-line treatment for post-stroke focal spasticity, and the accuracy in delivering the toxin to the target muscles may influence the treatment outcome. Our aim was to compare the reduction of spasticity and the related finger position at rest improvement in post-stroke patients treated with botulinum toxin type A in upper limb muscles using ultrasound guidance and manual needle placement. In a randomized clinical trial, two groups of 15 stroke patients were treated with botulinum toxin type A injections in the wrist and finger flexor muscles of the affected upper limb using ultrasound guidance or manual needle placement. The Modified Ashworth Scale and the finger position at rest were measured at baseline and one month after toxin injections. After one month of follow-up from toxin injections, the Modified Ashworth Scale and finger position at rest significantly improved in both treatment groups, although these clinical outcomes were significantly better in patients treated under ultrasound guidance than in patients injected using manual needle placement. Ultrasound guidance for botulinum toxin type A injections could improve clinical outcome measures better than manual needle placement in post-stroke patients with spasticity. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Adhesive taping vs. daily manual muscle stretching and splinting after botulinum toxin type A injection for wrist and fingers spastic overactivity in stroke patients: a randomized controlled trial.

    Science.gov (United States)

    Santamato, Andrea; Micello, Maria Francesca; Panza, Francesco; Fortunato, Francesca; Picelli, Alessandro; Smania, Nicola; Logroscino, Giancarlo; Fiore, Pietro; Ranieri, Maurizio

    2015-01-01

    To compare the effectiveness of two procedures increasing the botulinum toxin type A effect for wrist and finger flexor spasticity after stroke. A single-blind randomized trial. Seventy patients with upper limb post-stroke spasticity. Adults with wrist and finger flexor muscles spasticity after stroke were submitted to botulinum toxin type A therapy. After the treatment, the subjects injected were randomly divided into two groups and submitted to adhesive taping (Group A) or daily muscle manual stretching, passive articular mobilization of wrist and fingers, and palmar splint (Group B) for 10 days. We measured spasticity with Modified Ashworth Scale, related disability with Disability Assessment Scale, and fingers position at rest. The measurements were done at baseline, after two weeks, and after one month from the treatment session. After two weeks, subjects in Group A reported a significantly greater decrease in spasticity scores (Modified Ashworth Scale fingers: mean (standard deviation) 1.3±0.6 vs. 2.1±0.6; Modified Ashworth Scale wrist: 1.7 ±0.6 vs. 2.3 ±0.8), and after one month in spasticity and disability scores (Modified Ashworth Scale fingers: mean (standard deviation) 1.9 ±0.7 vs. 2.5 ±0.6; Modified Ashworth Scale wrist: 2.0 ±0.7 vs. 2.6 ±0.6; Disability Assessment Scale: 1.6 ±0.7 vs. 2.1 ±0.7) compared with Group B subjects. Subjects in Group A reported also a significantly improved fingers position at rest compared with Group B subjects after two weeks (2.8 ±0.9 vs. 2.1 ±0.7) and one month (2.3 ±0.7 vs. 1.5 ±0.6). Adhesive taping of wrist and finger flexor muscles appeared to enhance the effect of botulinum toxin type A therapy more than daily manual muscle stretching combined with passive articular mobilization and palmar splint. © The Author(s) 2014.

  4. Identification and characterization of Clostridium botulinum group III field strains by matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF MS).

    Science.gov (United States)

    Bano, Luca; Drigo, Ilenia; Tonon, Elena; Pascoletti, Simone; Puiatti, Cinzia; Anniballi, Fabrizio; Auricchio, Bruna; Lista, Florigio; Montecucco, Cesare; Agnoletti, Fabrizio

    2017-12-01

    Animal botulism is primarily due to botulinum neurotoxin (BoNT) types C, D or their chimeric variants C/D or D/C, produced by Clostridium botulinum group III, which appears to include the genetically indistinguishable Clostridium haemolyticum and Clostridium novyi. In the present study, we used matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI TOF MS) to identify and characterize 81 BoNT-producing Clostridia isolated in 47 episodes of animal botulism. The instrument's default database, containing no entries for Clostridium botulinum, permitted reliable identification of 26 strains at the genus level. Although supplementation of the database with reference strains enhanced the instrument's ability to identify the neurotoxic strains at the genus level, resolution was not sufficient to recognize field strains at species level. Characterization by MALDI TOF confirmed the well-documented phenotypic and genetic differences between Clostridium botulinum strains of serotypes normally implicated in human botulism (A, B, E, F) and other Clostridium species able to produce BoNTs type C and D. The chimeric and non-chimeric field strains grouped separately. In particular, very low similarity was found between two non-chimeric type C field strains isolated in the same outbreak and the other field strains. This difference was comparable with the differences among the various Clostridia species included in the study. Characterization by MALDI TOF confirmed that BoNT-producing Clostridia isolated from animals are closely related and indistinguishable at the species level from Clostridium haemolyticum and Clostridium novyi reference strains. On the contrary, there seem to be substantial differences among chimeric and some non-chimeric type C strains. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Clinical and electrophysiological studies of botulinum toxin type A to treat hemifacial spasm complicated with auricular symptoms.

    Science.gov (United States)

    Peng, Bin; Dong, Hongjuan; Chu, Hong; Zhang, Shenqi; Lu, Zuneng

    2015-01-01

    To investigate the involvement of posterior auricular muscle (PAM) and the effect of botulinum toxin type A (BTX-A) injection into PAM in patients with hemifacial spasm (HFS) complicated with auricular symptoms. Sixty-three consecutive HFS patients complicated with auricular symptoms such as tinnitus or murmur, "ticking" or a "clicking" sound and discomfort on the same side, who were referred to our department between July 2009 and January 2010, were enrolled. The diagnosis of idiopathic HFS was made clinically. The patients were largely randomized into two BTX-A treatment groups according to the order of referral. The first group included 33 cases where the injection sites were routinely located at the frontal, orbicularis oculi, zygomaticus and buccinator muscles while the other was the PAM group, which included 30 cases, where 4 units of BTX-A were additionally injected into the PAM prior to injection at other sites. A test of blink reflex was performed and the lateral spread of blink reflex to the orbicularis oris (OO) and PAM, i.e. abnormal muscle response (AMR), was recorded and the peak-peak amplitude of AMR was measured. The patients were followed up clinically and electrophysiologically for at least 4 weeks (29.47 ± 2.53 days). 1) Before injection, the latencies of R1, R2, R2' were normal, there was no significant difference between uninjured and affected side; The amplitudes of R1, R2, R2' in affected side were higher. 2) After injection, there was no significant change of the R1, R2 and R2' latencies; The amplitudes of R1, R2 and R2' decreased significantly. 3) Patients reported that their auricular symptoms subsided after injection in both groups; The remission rate was 45.5% (15/33) and 76.7% (23/30) in the regular and PAM group, respectively, with a higher rate in the PAM group (χ(2) = 6.40, P = 0.011). 4) In both groups the AMR amplitude decreased significantly after injection. In the regular group, the respective OO amplitudes (μV) before and

  6. Rationale for using botulinum toxin A as an adjunct to upper limb rehabilitation in children with cerebral palsy.

    Science.gov (United States)

    Hoare, Brian

    2014-08-01

    Cerebral palsy describes a group of disorders of movement and posture that result from disturbances in the developing brain. Although the brain lesion is nonprogressive, the secondary physical symptoms change with time and growth. If left untreated, symptoms may result in the development of physical impairment and impede independent performance of daily tasks. Intramuscular injection of botulinum neurotoxin A is a relatively safe and effective adjunct to upper limb therapy. Botulinum neurotoxin A primarily aims to reduce muscle overactivity, thereby reducing the development of increased muscle stiffness that can lead to permanent changes. With a specific focus on the physiological action of botulinum neurotoxin A, this article describes the secondary symptoms of cerebral palsy and their different contributions. To highlight research directions and future implications for clinical practice, this article also documents the recent scientific evidence for upper limb botulinum neurotoxin A and proposes a preventive clinical model that aims to mitigate the effects of increasing upper limb impairment. © The Author(s) 2014.

  7. Linden flower (Tilia spp. as potential vehicle of Clostridium botulinum spores in the transmission of infant botulism El té de tilo como vehículo potencial de esporas de Clostridium botulinum en la transmisión del botulismo infantil

    Directory of Open Access Journals (Sweden)

    M. I. Bianco

    2009-12-01

    Full Text Available Infant botulism is an intestinal toxemia caused principally by Clostridium botulinum. Since the infection occurs in the intestinal tract, numerous food products have been investigated for the presence of C. botulinum and its neurotoxins. In many countries, people use linden flower (Tilia spp tea as a household remedy and give it to infants as a sedative. Therefore, to help provide a clear picture of this disease transmission, we investigated the presence of botulinum spores in linden flowers. In this study, we analyzed 100 samples of unwrapped linden flowers and 100 samples of linden flowers in tea bags to determine the prevalence and spore-load of C. botulinum. Results were analyzed by the Fisher test. We detected a prevalence of 3% of botulinum spores in the unwrapped linden flowers analyzed and a spore load of 30 spores per 100 grams. None of the industrialized linden flowers analyzed were contaminated with botulinum spores. C. botulinum type A was identified in two samples and type B in one sample. Linden flowers must be considered a potential vehicle of C. botulinum, and the ingestion of linden flower tea can represent a risk factor for infant botulism.El botulismo del lactante es una toxiinfección causada, principalmente, por Clostridium botulinum. Debido a que esta infección ocurre en el tracto intestinal, la presencia de esta bacteria y sus neurotoxinas ha sido investigada en numerosos alimentos. En muchos países se utiliza el té de tilo (Tilia spp. como sedante natural, el que se administra incluso a los lactantes. A fin de contribuir al esclarecimiento de la transmisión de esta enfermedad, se investigó la prevalencia y la carga de esporas botulínicas en esta hierba. Se analizaron 100 muestras de tilo comercializado a granel y 100 muestras de tilo industralizado en “saquitos”. Los resultados de prevalencia fueron analizados por el test de Fisher y la carga de esporas por la técnica del número más probable. Se halló una

  8. [Functional results of type A botulinum toxin versus oral anti-inflammatory agents in the rehabilitation of painful shoulder syndrome caused by rotator cuff lesion].

    Science.gov (United States)

    Becerril, Bautista P; Negrete-Corona, J; Chávez-Hinojosa, E

    2014-01-01

    Rotator cuff conditions are characterized by unspecific signs, as well as anatomic alterations and symptoms. They have a multifactorial etiology and may include everything from tendinitis to massive, full thickness tears of the rotator cuff tendon that compromise the normal biomechanics of the involved shoulder. They usually occur in people over 40 years of age but lesions resulting from trauma may vary according to the mechanism of injury and are not directly related with the age at onset of symptoms. Vascular factors have been described as related with rotator cuff tendon damage in conditions affecting the microcirculation. However, recent studies have not proven that the tendon under direct observation shows hypovascularity. Type A botulinum toxin acts by blocking the release of acetylcholine in the neuromuscular plate; in the joints it releases capsular tension and reduces proinflammatory factors such as interleukin-1 (IL-1). There are only a few papers on its intraarticular benefit; in muscle and tendon groups it not only has a muscle relaxant effect, but several publications support its utility for pain management. It has been widely used in the rehabilitation of this group of patients at low doses. Material and methods: Prospective, investigational and longitudinal study involving the follow-up of 24 patients with a diagnosis of painful shoulder syndrome proven clinically and with imaging tests, and caused by rotator cuff lesions. The patients either did not meet the criteria for immediate surgical repair or had already undergone such a repair. Type A botulinum toxin was applied to 12 patients in the subacromial space around the rotator cuff conjoint tendon, as well as in the painful spots and in the muscle contracture in the shoulder. The total dose of Type A botulinum toxin was 200 IU. The control group, also composed of 12 patients, was given a COX-2 oral antiinflammatory agent for 6 weeks (Celecoxib, 100 mg BID). Both groups followed a pre

  9. Occurrence of Clostridium botulinum in fresh and cured fish in retail trade in Cochin (India).

    Science.gov (United States)

    Lalitha, K V; Surendran, P K

    2002-01-30

    The occurrence of Clostridium botulinum in fresh (67) and cured fish (278) samples in retail trade in Cochin was studied. An overall prevalence of 19% (13/67) was found in fresh retail fish and types A to D were detected in the positive samples. In pelagic fish, incidence of C. botulinum was 18% (7/39) whereas in demersal fish, 21% (5/24) of the samples harboured C. botulinum. Incidence of C. botulinum in shrimp was 25% (1/4) and type D was found in the positive sample. Of 257 cured fish in retail trade tested for the presence of C. botulinum, the overall contamination level was 10% (25/257). Among the C. botulinum types A to D prevalent in fresh fish, types C and D were the predominant types found in cured products. In salt-dried shrimp, of the 21 samples analysed, 10 samples (48%) harboured C. botulinum.

  10. Botulinum toxin type A-a novel treatment for provoked vestibulodynia? Results from a randomized, placebo controlled, double blinded study

    DEFF Research Database (Denmark)

    Petersen, Christina Damsted; Giraldi, Annamaria; Lundvall, Lene

    2009-01-01

    INTRODUCTION: Vestibulodynia is an increasingly recognized problem among women and is often difficult to treat. AIM: This randomized, double blinded, placebo-controlled study aimed to evaluate the efficacy of Botox in the treatment of vestibulodynia. METHODS: Sixty-four women were randomized...... to receive Botox (N = 32) or saline placebo (N = 32). Botulinum toxin A (20 I.E.) diluted in 0.5 mL saline or 0.5 mL saline was injected in the musculus bulbospongiosus at baseline. MAIN OUTCOME MEASURES: Pain was measured monthly on a visual analog scale (VAS) Likert scale. Sexual function was measured...... using the Female Sexual Function Index (FSFI) and the Female Sexual Distress Scale at baseline and at 3 and 6 months follow up. Quality of life was measured using the 36-item short-form (SF-36). RESULTS: Sixty women (94%) completed the 6 months follow up. Both Botox and placebo produced significantly...

  11. Management of the upper limb with botulinum toxin type A in children with spastic type cerebral palsy and acquired brain injury: clinical implications.

    Science.gov (United States)

    Autti-Rämö, I; Larsen, A; Taimo, A; von Wendt, L

    2001-11-01

    The aim of this article is to describe our clinical experience in treating muscle imbalance in 49 children with spastic upper extremity involvement. We discuss four cohorts of children treated with botulinum toxin type A (BTX-A), each with different treatment objectives. In the first group, 27 children were treated for functional improvement and, of these, 23 had a positive effect, while four had no objective benefit. In the second group, eight children were treated for purposes of presurgical planning; of these, four were referred for surgery, three continued with serial treatment and one child did not benefit from injection. The third group comprised six children who were treated to improve posture and care: in this group, four children demonstrated clear benefit and two children lost some function subsequent to injection. Finally, a fourth group of seven children were treated after acquired brain injury (three with severe tetraplegia, four with hemiplegia). In this group, all children experienced spasticity relaxation and two children with hemiplegia also gained functional benefit. In terms of adverse events, deterioration of upper extremity function was poorly tolerated but limited to the first 1--3 weeks postinjection. Grip strength or thumb grip were diminished if too high doses were used. Overall, our results with BTX-A were rewarding in children with no fixed contracture, good motor learning capacity and high motivation to train. Additionally, BTX-A treatment has proven valuable for counteracting spasticity in children with acquired brain injury. This treatment modality may not, however, be an appropriate treatment option for all children with severe upper extremity spasticity, due to the shorter duration of effect and the potential reduction in functional abilities seen in this cohort. In all cases, the selection of muscles to be treated needs careful clinical assessment. Dynamic EMG analysis should be performed whenever required to aid muscle selection

  12. Botulinum toxin for the treatment of strabismus.

    Science.gov (United States)

    Rowe, Fiona J; Noonan, Carmel P

    2017-03-02

    The use of botulinum toxin as an investigative and treatment modality for strabismus is well reported in the medical literature. However, it is unclear how effective it is in comparison to other treatment options for strabismus. The primary objective was to examine the efficacy of botulinum toxin therapy in the treatment of strabismus compared with alternative conservative or surgical treatment options. This review sought to ascertain those types of strabismus that particularly benefit from the use of botulinum toxin as a treatment option (such as small angle strabismus or strabismus with binocular potential, i.e. the potential to use both eyes together as a pair). The secondary objectives were to investigate the dose effect and complication rates associated with botulinum toxin. We searched CENTRAL (which contains the Cochrane Eyes and Vision Trials Register) (2016, Issue 6), Ovid MEDLINE, Ovid MEDLINE In-Process and Other Non-Indexed Citations, Ovid MEDLINE Daily, Ovid OLDMEDLINE (January 1946 to July 2016), Embase (January 1980 to July 2016), Latin American and Caribbean Literature on Health Sciences (LILACS) (January 1982 to July 2016), the ISRCTN registry (www.isrctn.com/editAdvancedSearch), ClinicalTrials.gov (www.clinicaltrials.gov), and the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) (www.who.int/ictrp/search/en). We did not use any date or language restrictions in the electronic searches for trials. We last searched the electronic databases on 11 July 2016. We handsearched the British and Irish Orthoptic Journal, Australian Orthoptic Journal, proceedings of the European Strabismological Association (ESA), International Strabismological Association (ISA) and International Orthoptic Association (IOA) (www.liv.ac.uk/orthoptics/research/search.htm) and American Academy of Paediatric Ophthalmology and Strabismus meetings (AAPOS). We contacted researchers who are active in this field for information about further

  13. Occurrence of human pathogenic Clostridium botulinum among healthy dairy animals: an emerging public health hazard.

    Science.gov (United States)

    Abdel-Moein, Khaled A; Hamza, Dalia A

    2016-01-01

    The current study was conducted to investigate the occurrence of human pathogenic Clostridium botulinum in the feces of dairy animals. Fecal samples were collected from 203 apparently healthy dairy animals (50 cattle, 50 buffaloes, 52 sheep, 51 goats). Samples were cultured to recover C. botulinum while human pathogenic C. botulinum strains were identified after screening of all C. botulinum isolates for the presence of genes that encode toxins type A, B, E, F. The overall prevalence of C. botulinum was 18.7% whereas human pathogenic C. botulinum strains (only type A) were isolated from six animals at the rates of 2, 2, 5.8, and 2% for cattle, buffaloes, sheep, and goats, respectively. High fecal carriage rates of C. botulinum among apparently healthy dairy animals especially type A alarm both veterinary and public health communities for a potential role which may be played by dairy animals in the epidemiology of such pathogen.

  14. Botulinum Toxin (Botox) for Facial Wrinkles

    Science.gov (United States)

    ... Eye Health / Eye Health A-Z Botulinum Toxin (Botox) for Facial Wrinkles Sections Botulinum Toxin (Botox) for ... How Does Botulinum Toxin (Botox) Work? Botulinum Toxin (Botox) for Facial Wrinkles Leer en Español: La toxina ...

  15. Detection of Clostridium botulinum in natural sweetening.

    Science.gov (United States)

    Nakano, H; Yoshikuni, Y; Hashimoto, H; Sakaguchi, G

    1992-06-01

    Various sugar products were examined for contamination with C. botulinum spores. Type A, B and C spores were detected in three of 56 samples of sugar for apiculture, which may attest the significance of bee-feed as a source of contamination of honey. The heavy contamination of honey with C. botulinum spores sometimes encountered, however, can not be explained unless some other factors, e.g., that allowing germination and multiplication of the spores somewhere during honey production, are found. Type A spores were detected in some samples of raw sugar and molasses and also in two of 41 samples of brown sugar lump, but not in refined sugar or other various samples taken at a sugar factory or in sugar cane left on the field in Okinawa. The fact that some natural sweetenings are contaminated with C. botulinum spores, even in low concentrations, may be food-hygienically important.

  16. Prospective, randomized, double-blind study, comparing botulinum toxins type a botox and prosigne for blepharospasm and hemifacial spasm treatment.

    Science.gov (United States)

    Quagliato, Elizabeth Maria Aparecida Barasnevicius; Carelli, Edmur Franco; Viana, Maura Aparecida

    2010-01-01

    Botulinum toxin A (BTA) is considered an effective treatment of blepharospasm and hemifacial spasm, but there are few studies to permit a comparison of its different formulations. This prospective, randomized, double-blind study compared Prosigne, a BTA of Chinese origin, with Botox to establish safety, efficacy, and equivalence of doses between those 2 formulations in blepharospasm and hemifacial spasm treatment. Fifty-seven patients participated in this study: 21 blepharospasm (from whom 11 were treated with Botox; and 10, with Prosigne) and 36 hemifacial spasm patients (17 were treated with Botox; and 19, with Prosigne). All patients were similar in age, disease time span, number of previous shots, and time elapsed since the last BTA application. Pain and burning during the injection and the result of the treatment were similar in both groups. There were no systemic adverse events, and the local ones were observed with similar intensity and frequency for both groups. The mean effect time length was similar for both blepharospasm (11.3 weeks for both toxins) and hemifacial spasm patients (12.8 weeks for Botox and 12.9 weeks for Prosigne). In both blepharospasm groups, only the 36-Item Short-Form Health Survey emotional aspects domain showed improvement from baseline after 16 weeks. There were no differences between the 36-Item Short-Form Health Survey scores before and after the treatment of all hemifacial spasm patients. Therefore, it has been concluded that Botox and Prosigne have similar efficacy, safety, and tolerability profiles, so that a dose equivalence of 1:1 may be considered for blepharospasm and hemifacial spasm treatments.

  17. Difference in response to botulinum toxin type A treatment between patients with benign essential blepharospasm and hemifacial spasm.

    Science.gov (United States)

    Cannon, Paul S; MacKenzie, Kenneth R; Cook, Anne E; Leatherbarrow, Brian

    2010-10-01

    Botulinum toxin (BTX) is the first-line treatment in managing benign essential blepharospasm (BEB) and hemifacial spasm (HFS). We wished to assess the difference in duration of effect and the number of BTX treatments required to treat patients with BEB and HFS. A prospective study of patients attending the BTX clinic in Manchester Royal Eye Hospital over 6 months. All treatments were administered by a single experienced ophthalmologist. A questionnaire was completed for each patient. In patients with BEB where the BTX was injected bilaterally, one side was randomized to compare with HFS patients. Patient demographics, cumulative dose of BTX, duration of BTX effect with patient satisfaction and the number of previous BTX injections were recorded. Sixty-four patients were included in the study. The mean age was 60.8 years. Among them, 30 patients had BEB and 34 had HFS. Patients with HFS received a lower mean dose of BTX than patients with BEB (12.23 units vs. 16.2 units). The patients with HFS had a longer duration of effect than patients with BEB, with fewer BTX treatments. Of all patients, 90% with HFS and BEB were satisfied with the effect of their last BTX injection. Three unsatisfied patients in the BEB group were referred on for surgical management of their disorder. We have shown that patients with BEB have a shorter duration of effect with BTX and require more frequent BTX treatments than patients with HFS, highlighting that facial dystonias in patients with BEB is more challenging to manage. © 2010 The Authors. Journal compilation © 2010 Royal Australian and New Zealand College of Ophthalmologists.

  18. A pilot study to investigate the combined use of Botulinum toxin type-a and ankle foot orthosis for the treatment of spastic foot in chronic hemiplegic patients.

    Science.gov (United States)

    Pradon, Didier; Hutin, Emilie; Khadir, Simon; Taiar, Redha; Genet, François; Roche, Nicolas

    2011-10-01

    Botulinum toxin is commonly used to treat spastic equinus foot. This treatment seems to improve gait in hemiplegic patients when used alone or combined with an ankle-foot orthosis. However, the nature and effects of this improvement have until now rarely been studied. The aim of this study was to quantify the impact of a Botulinum toxin injection in the triceps surae of hemiplegic patients with equinus foot, used either alone or in combination with an ankle-foot orthosis, on the kinematics and dynamics of the paretic lower limb, and to determine the advantage of combining an ankle-foot orthosis with this pharmacological treatment. Patients were assessed using gait analysis to measure spatio-temporal, kinematic and dynamic parameters of the gait cycle before Botulinum toxin injection and then 3 and 6weeks after injection. Eight chronic hemiplegics following central nervous system lesion were included. Botulinum toxin injection led to an increase in velocity, peak ankle dorsiflexion during stance phase, and peak knee flexion during swing phase. It also resulted in an increased peak plantarflexion moment. Use of ankle-foot orthosis led to a specific increase in peak ankle dorsiflexion during swing phase and also increased peak plantarflexion moment. The results indicate that combined Botulinum toxin injection of the triceps surae and wearing an ankle-foot orthosis is more effective than the use of Botulinum toxin only. Use of an ankle-foot orthosis increases ankle dorsiflexion during the swing phase and does not reduce the benefits gained by the use of Botulinum toxin in stance phase. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Ultrasound-Guided Injection of Botulinum Toxin Type A for Piriformis Muscle Syndrome: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Andrea Santamato

    2015-08-01

    Full Text Available Piriformis muscle syndrome (PMS is caused by prolonged or excessive contraction of the piriformis muscle associated with pain in the buttocks, hips, and lower limbs because of the close proximity to the sciatic nerve. Botulinum toxin type A (BoNT-A reduces muscle hypertonia as well as muscle contracture and pain inhibiting substance P release and other inflammatory factors. BoNT-A injection technique is important considering the difficult access of the needle for deep location, the small size of the muscle, and the proximity to neurovascular structures. Ultrasound guidance is easy to use and painless and several studies describe its use during BoNT-A administration in PMS. In the present review article, we briefly updated current knowledge regarding the BoNT therapy of PMS, describing also a case report in which this syndrome was treated with an ultrasound-guided injection of incobotulinumtoxin A. Pain reduction with an increase of hip articular range of motion in this patient with PMS confirmed the effectiveness of BoNT-A injection for the management of this syndrome.

  20. Effect of botulinum toxin type A in lateral abdominal wall muscles thickness and length of patients with midline incisional hernia secondary to open abdomen management.

    Science.gov (United States)

    Ibarra-Hurtado, T R; Nuño-Guzmán, C M; Miranda-Díaz, A G; Troyo-Sanromán, R; Navarro-Ibarra, R; Bravo-Cuéllar, L

    2014-10-01

    Abdominal wall hernia secondary to open abdomen management represents a surgical challenge. The hernia worsens due to lateral muscle retraction. Our objective was to evaluate if Botulinum Toxin Type A (BTA) application in lateral abdominal wall muscles modifies its thickness and length. A clinical trial of male trauma patients with hernia secondary to open abdomen management was performed from January 2009 to July 2011. Thickness and length of lateral abdominal muscles were measured by a basal Computed Tomography and 1 month after BTA application. A dosage of 250 units of BTA was applied at five points at each side between the external and internal oblique muscles under ultrasonographic guidance. Statistical analysis for differences between basal and after BTA application measures was performed by a paired Student's t test (significance: p muscle measure modifications in all the patients. Left muscle thickness: mean reduction of 1 ± 0.55 cm (p muscle thickness: mean reduction of 1.00 ± 0.49 cm (p muscle length: mean increase of 2.44 ± 1.22 cm (p muscle length: mean increase of 2.59 ± 1.38 cm (p follow-up of 49 months were observed. BTA application in lateral abdominal muscles decreases its thickness and increases its length in abdominal wall hernia patients secondary to open abdomen management.

  1. An objective assessment of botulinum toxin type A injection in the treatment of post-facial palsy synkinesis and hyperkinesis using the synkinesis assessment questionnaire.

    Science.gov (United States)

    Neville, Catriona; Venables, Vanessa; Aslet, Margaret; Nduka, Charles; Kannan, Ruben

    2017-11-01

    This study aimed to provide reliable and valid evidence that botulinum toxin type A (BTX-A) is a successful treatment for facial synkinesis in facial palsy by using the synkinesis assessment questionnaire (SAQ) tool. Fifty-one patients completed questionnaires pre- and post-BTX-A treatment over 103 cycles of treatment. Each patient was individually assessed and then treated according to their presenting symptoms with a dosage in each injection site of between 0.5 and 5 U of BTX-A. A two-tailed paired samples t-test was used to compare the scores for each question before and after treatment. A significant difference was found between all scores before and after treatment at the level of p < 0.05. There was not only an improvement in the mean score in the post-treatment group but also a smaller spread of scores in the post-treatment group than in the pre-treatment group. The study showed that SAQ scores decreased significantly for every question on the SAQ after treatment. This indicates that BTX-A is an effective treatment for synkinesis, adding further weight to current evidence. The study also indicated that BTX-A continues to be effective even after three rounds of treatment, with a significant decrease in overall scores after each treatment cycle. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  2. Semen parameters and seminal plasma protein and biochemical profiles of dogs with benign prostatic hyperplasia after botulinum toxin type A intraprostatic injection

    Directory of Open Access Journals (Sweden)

    Tathiana Ferguson Motheo

    2014-06-01

    Full Text Available This study aimed to determine the effects of different concentrations of botulinum toxin type A (BT-A on semen parameters, and seminal plasma biochemical and protein profiles of dogs with benign prostatic hyperplasia (BPH. Eighteen sexually intact male dogs with BPH were randomly divided in three groups, and received an intraprostatic injection of saline solution (control group - CG, 250UI (GI or 500UI (GII of BT-A under transabdominal ultrasound guidance. Semen was collected at baseline, 2, 4 and 8 weeks after treatment. Semen parameters were determined and seminal plasma pH, total protein (TP, total chlorides (TC, calcium (Ca, potassium (K, and sodium (Na concentrations were assessed. One-dimensional sodium dodecyl sulfatepolyacrilamide gel eletrophoresis (SDS- PAGE was performed to determine seminal plasma protein profile. Sperm parameters and seminal plasma pH, TP, TC, Ca and K mean values did not change significantly at any time point and among treated groups (P>0.05. The SDS-PAGE analysis of the pooled fractions identified 31 protein bands with molecular weights ranging from 3.9 to 106.2kDA in all treatment groups during the entire evaluation period. Regardless the used dose, intraprostatic BT-A injection do not alter semen parameters and seminal plasma biochemical and protein profiles of dogs with BPH.

  3. Genes that encode botulism neurotoxins A,B,E and F in Neotropical bee honey identified with the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ana Teresa Fournier

    2006-03-01

    Full Text Available Honey can be used for the treatment of wounds, sores and skin burns, but it might be contaminated with Clostridium botulinum spores. In order to evaluate Costa Rican raw honey samples, the detection of neurotoxin gene sequences (corresponding to the bacterium C. botulinum A, B, E and F was done with the polymerase chain reaction. A total of 64 raw honey samples, coming from different Costa Rican sites were analyzed. Reference C. botulinum strains type A (ATCC 19397, type B (ATCC 7949, type E (ATCC 17786 and type F (ATCC 25764 were used as templates for testing the effectivity of the method. The process consisted in culturing the honey samples in prereduced triptose-peptone-glucose-yeast extract media (TGPYfor 5 days. After this, the bacteria lysate obtained was used for PCR. The amplicons,product of the reaction, were visualized using agarose gel 2%. From the 64 honey samples analyzed, none produced positive results in the PCR, since no amplicons were obtained. Even though, all the reference C. botulinum strains used as controls were visualized and showed the effectivity of the extraction method and of the PCR used. The results obtained show promising therapeutic uses for honey from Costa Rica, but further evaluations shall be done in order to be sure of the safety of the product. Rev. Biol. Trop. 54(1: 29-34. Epub 2006 Mar 31.La miel de abeja es un producto que podría ser utilizado en el tratamiento de heridas, abrasiones y quemaduras de piel; no obstante, podría estar contaminada con esporas de C. botulinum. Con el fin de evaluar muestras de miel de origen costarricense, se detectó las secuencias de genes productores de neurotoxina correspondientes a C. botulinum tipos A, B, E y F utilizando la técnica de PCR (reacción de polimerasa en cadena. 64 diferentes muestras de miel, provenientes de diversos sitios costarricenses, fueron analizadas. Con el fin de evaluar la efectividad del método, se utilizó cepas de referencia tipos A (ATCC

  4. Study design and methods of the BoTULS trial: a randomised controlled trial to evaluate the clinical effect and cost effectiveness of treating upper limb spasticity due to stroke with botulinum toxin type A

    Directory of Open Access Journals (Sweden)

    Graham Laura

    2008-10-01

    Full Text Available Abstract Background Following a stroke, 55–75% of patients experience upper limb problems in the longer term. Upper limb spasticity may cause pain, deformity and reduced function, affecting mood and independence. Botulinum toxin is used increasingly to treat focal spasticity, but its impact on upper limb function after stroke is unclear. The aim of this study is to evaluate the clinical and cost effectiveness of botulinum toxin type A plus an upper limb therapy programme in the treatment of post stroke upper limb spasticity. Methods Trial design : A multi-centre open label parallel group randomised controlled trial and economic evaluation. Participants : Adults with upper limb spasticity at the shoulder, elbow, wrist or hand and reduced upper limb function due to stroke more than 1 month previously. Interventions : Botulinum toxin type A plus upper limb therapy (intervention group or upper limb therapy alone (control group. Outcomes : Outcome assessments are undertaken at 1, 3 and 12 months. The primary outcome is upper limb function one month after study entry measured by the Action Research Arm Test (ARAT. Secondary outcomes include: spasticity (Modified Ashworth Scale; grip strength; dexterity (Nine Hole Peg Test; disability (Barthel Activities of Daily Living Index; quality of life (Stroke Impact Scale, Euroqol EQ-5D and attainment of patient-selected goals (Canadian Occupational Performance Measure. Health and social services resource use, adverse events, use of other antispasticity treatments and patient views on the treatment will be compared. Participants are clinically reassessed at 3, 6 and 9 months to determine the need for repeat botulinum toxin type A and/or therapy. Randomisation : A web based central independent randomisation service. Blinding : Outcome assessments are undertaken by an assessor who is blinded to the randomisation group. Sample size : 332 participants provide 80% power to detect a 15% difference in treatment

  5. Efficacy and Safety of Single Botulinum Toxin Type A (Botox®) Injection for Relief of Upper Trapezius Myofascial Trigger Point: A Randomized, Double-Blind, Placebo-Controlled Study.

    Science.gov (United States)

    Kwanchuay, Photsawee; Petchnumsin, Thavatchai; Yiemsiri, Pichet; Pasuk, Nakkamol; Srikanok, Wannarat; Hathaiareerug, Chanasak

    2015-12-01

    Botulinum toxin injection has been applied for pain relief in various chronic pain syndromes. Recently, systematic review studies reported inconclusive effects of Botulinum toxin in myofascial pain management. The present study aimed to demonstrate the efficacy and safety of Botulinum toxin type A (BTxA) (Botox®) injection for pain reduction in myofascial trigger point (MTrP) of the upper trapezius muscle. Thirty-three patients with 48 MTrP on the upper trapezius muscles over three months with moderate to severe pain intensity diagnosed at physical medicine and rehabilitation outpatient department were recruited between December 2011 and March 2012. Eligible patients were blinded and randomly injected with single 0.2 ml (20 IU) of BTxA for 24 MTrP and 0.2 ml of 0.9% NaCl solution for 24 MTrP at the most tender trigger point on the upper trapezius muscle. All patients were advised for stretching exercise and ergonomic adaptation throughout the study. At 3- and 6-week after injections, visual analogue scale (VAS), the pressure pain threshold (PPT), and reported adverse effects were measured. Both BTxA and control groups demonstrated statistically significant differences in VAS reduction and increased PPT after 3 weeks and 6 weeks compared with before treatment. There were no statistically significant differences in VAS reduction from baseline between the two groups at 3- and 6-week after treatment. A statistically significant difference in improvement of PPT from baseline and 6-week after BTxA injection compared with 0.9% NaCl group was shown (1.0 ± 0.9 and 0.5 ± 0.7, p = 0.036). There was mild degree side-effects that spontaneous resolved within one week in both groups without significant difference in percentage. No severe adverse effects were reported during the study. The efficacy in VAS reduction of a single 20 IU of Botulinum toxin type A (Botox®) injection was not different from 0.9% NaCl for myofascial trigger point at the upper trapezius muscle. However

  6. The Efficacy of Botulinum Toxin Type a Injection in the Hamstring and Calf Muscles With and Without Serial Foot Casting in Gait Improvement in Children With Cerebral Palsy

    Directory of Open Access Journals (Sweden)

    Shamsodini A

    2011-11-01

    Full Text Available Background: The goal of this study was to compare the efficacy of botulinum toxin type A (BTX-A injection in the hamstring and calf muscles with and without ankle serial casting in the improvement of gait in children with cerebral palsy (CP.Methods : This double-blind prospective clinical trial was performed on 25, 2 to 8-year-old children with hemiplegic or diplegic CP in Tehran, Iran in 2010. The participants were chosen by simple randomized sampling and were matched for age, gross motor function classification system (GMFCS and type of CP and were randomly divided into two groups: children in the first group (13 only received BTX-A injection, but the second group (12 received BTX-A and serial foot casting starting one week after the injection.Results : Comparison of the gross motor function, right and left knee spasticities and passive ROM of both knees between the two groups before and 1, 3, 6 and 12 months after the injections were not statistically significant (P>0.1. Furthermore, comparison of the right and left ankle spasticities and passive ROM before the injections and in1 and 3-month follow-ups did not show a statistically significant difference (P>0.1, but the differences were significant in 6 and 12-month follow-ups (P<0.05.Conclusion: BTX-A injection with serial foot casting vs. BTX-A alone was more effective in decreasing spasticity and improving passive ROM in the ankle of children with CP, but such injections in the hamstrings were not useful in these regards.

  7. Systemic colonization of clover (Trifolium repens by Clostridium botulinum strain 2301

    Directory of Open Access Journals (Sweden)

    Matthias eZeiller

    2015-10-01

    Full Text Available In recent years, cases of botulism in cattle and other farm animals and also in farmers increased dramatically. It was proposed, that these cases could be affiliated with the spreading of compost or other organic manures contaminated with Clostridium botulinum spores on farm land. Thus, soils and fodder plants and finally farm animals could be contaminated. Therefore, the colonization behavior and interaction of the botulinum neurotoxin (BoNT D producing C. botulinum strain 2301 and the non-toxin producing Clostridium sporogenes strain 1739 were investigated on clover (Trifolium repens in a field experiment as well as in phytochamber experiments applying axenic and additionally soil based systems under controlled conditions. Plants were harvested and divided into root and shoot parts for further DNA isolation and PCR assays; subsamples were fixed for fluorescence in situ hybridization (FISH analysis in combination with confocal laser scanning microscopy (CLSM. To target C. botulinum and C. sporogenes, 16S rDNA directed primers were used and to specifically detect C. botulinum, BoNT D toxin genes targeted primers, using a multiplex PCR approach, were applied. Our results demonstrate an effective colonization of roots and shoots of clover by C. botulinum strain 2301 and C. sporogenes strain 1739. Detailed analysis of colonization behavior showed that C. botulinum can occur as individual cells, in cell clusters and in microcolonies within the rhizosphere, lateral roots and within the roots tissue of clover. In addition, we observed significant differences in the growth behavior of clover plants when inoculated with Clostridia spores, indicating a plant growth promoting effect. Inoculated plants showed an increased growth index (shoot size, wet and dry weight and an enlarged root system, which suggests the involvement of phytohormonal effects induced by the systemic colonization of clover by C. botulinum strain 2301.

  8. Mechanisms of food processing and storage-related stress tolerance in Clostridium botulinum.

    Science.gov (United States)

    Dahlsten, Elias; Lindström, Miia; Korkeala, Hannu

    2015-05-01

    Vegetative cultures of Clostridium botulinum produce the extremely potent botulinum neurotoxin, and may jeopardize the safety of foods unless sufficient measures to prevent growth are applied. Minimal food processing relies on combinations of mild treatments, primarily to avoid deterioration of the sensory qualities of the food. Tolerance of C. botulinum to minimal food processing is well characterized. However, data on effects of successive treatments on robustness towards further processing is lacking. Developments in genetic manipulation tools and the availability of annotated genomes have allowed identification of genetic mechanisms involved in stress tolerance of C. botulinum. Most studies focused on low temperature, and the importance of various regulatory mechanisms in cold tolerance of C. botulinum has been demonstrated. Furthermore, novel roles in cold tolerance were shown for metabolic pathways under the control of these regulators. A role for secondary oxidative stress in tolerance to extreme temperatures has been proposed. Additionally, genetic mechanisms related to tolerance to heat, low pH, and high salinity have been characterized. Data on genetic stress-related mechanisms of psychrotrophic Group II C. botulinum strains are scarce; these mechanisms are of interest for food safety research and should thus be investigated. This minireview encompasses the importance of C. botulinum as a food safety hazard and its central physiological characteristics related to food-processing and storage-related stress. Special attention is given to recent findings considering genetic mechanisms C. botulinum utilizes in detecting and countering these adverse conditions. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  9. Botulinum toxin type B (Myobloc) in subjects with hemifacial spasm: results from an open-label, dose-escalation safety study.

    Science.gov (United States)

    Trosch, Richard M; Adler, Charles H; Pappert, Eric J

    2007-07-15

    Evaluate the safety of botulinum toxin type B (BoNT-B) in subjects with hemifacial spasm (HFS). This open-label, sequential dose-escalation study evaluated BoNT-B in subjects with HFS. Eligible subjects were enrolled and received a single injection of one of four sequential BoNT-B doses (100, 200, 400, or 800 U). Following injection, subjects were evaluated in person at Weeks 2 and 8 and by phone at Weeks 1, 4, and 10 and every 2 weeks thereafter until benefit was lost. Safety was assessed by adverse events (AEs), vital signs and clinical laboratory evaluation. The severity of HFS was assessed using a patient social impairment visual analog scale (VAS), subject severity of contraction VAS, the HFS physician assessment, and subject HFS frequency and severity assessment. Nineteen predominately Caucasian (92%) and female (67%) subjects (aged 36-80 years) with HFS participated in this study. Subjects remained in the study an average of 88 days (range of 41-332 days) after receiving a single dose of BoNT-B. No deaths, serious AEs or AEs leading to trial discontinuation occurred during the study period. Two subjects in the 400 U dose group requested early withdrawal, whereas all other subjects completed the study. A reduction in HFS severity was observed in subjects treated with doses of 200 U or more. Improvements in subject HFS assessments tended to return to baseline values by 8 weeks following injection. BoNT-B was well-tolerated and reduced HFS severity in subjects who received injections of 200 to 800 U. Additional investigation is necessary to confirm the findings from this open-label study. 2007 Movement Disorder Society

  10. Utility of ultrasound-guided injection of botulinum toxin type A for muscle imbalance in children with obstetric brachial plexus palsy: Description of the procedure and action protocol.

    Science.gov (United States)

    García Ron, A; Gallardo, R; Huete Hernani, B

    2017-03-24

    Obstetric brachial plexus palsy (OBPP) usually has a favourable prognosis. However, nearly one third of all severe cases have permanent sequelae causing a high level of disability. In this study, we explore the effectiveness of ultrasound-guided injection of botulinum toxin A (BoNT-A) and describe the procedure. We designed a prospective, descriptive study including patients with moderate to severe OBPP who were treated between January 2010 and December 2014. We gathered demographic data, type of OBPP, and progression. Treatment effectiveness was assessed with the Active Movement Scale (AMS), the Mallet classification, and video recordings. We gathered a total of 14 133 newborns, 15 of whom had OBPP (1.6 per 1000 live births). Forty percent of the cases had severe OBPP (0.4/1000), a dystocic delivery, and APGAR scores treatment onset was 11.5 months. The muscles most frequently receiving BoNT-A injections were the pronator teres, subscapularis, teres major, latissimus dorsi, and pectoralis major. All the patients who completed the follow-up period (83%) experienced progressive improvements: up to 3 points on the AMS and a mean score of 19.5 points out of 25 on the Mallet classification at 2 years. Treatment improved muscle function and abnormal posture in all cases. Surgery was avoided in 3 patients and delayed in one. Adverse events were mild and self-limited. Due to its safety and effectiveness, BoNT-A may be used off-label as an adjuvant to physical therapy and/or surgery in moderate to severe OBPP. Ultrasound may increase effectiveness and reduce adverse effects. Copyright © 2017 The Authors. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. Botulinum type A toxin complex for the relief of upper back myofascial pain syndrome: how do fixed-location injections compare with trigger point-focused injections?

    Science.gov (United States)

    Benecke, Reiner; Heinze, Axel; Reichel, Gerhard; Hefter, Harald; Göbel, Hartmut

    2011-11-01

    This was a prospective, randomized, double-blind, placebo-controlled, 12-week, multicenter study to evaluate the efficacy and tolerability of fixed location injections of botulinum type A toxin (BoNT-A, Dysport) in predetermined injection sites in patients with myofascial pain syndrome of the upper back. Patients with moderate-to-severe myofascial pain syndrome affecting cervical and/or shoulder muscles (10 trigger points, disease duration 6-24 months) and moderate-to-severe pain intensity were randomized to BoNT-A (N = 81) or saline (N = 72). Patients received treatment into 10 predetermined fixed injection sites in the head, neck, and shoulder (40 units of BoNT-A per site or saline, a total of 400 units of BoNT-A). The primary efficacy outcome was the proportion of patients with mild or no pain at week 5 (responders). Secondary outcomes included changes in pain intensity and the number of pain-free days per week. At week 5, 49% (37/76) of BoNT-A patients and 38% (27/72) of placebo patients had responded to treatment (P = 0.1873). Duration of daily pain was reduced in the BoNT-A group compared with the placebo group from week 5, with statistically significant differences at weeks 9 and 10 (P = 0.04 for both). Treatment was well tolerated. Fixed-location treatment with BoNT-A of patients with upper back myofascial pain syndrome did not lead to a significant improvement of the main target parameter in week 5 after treatment. Only in week 8 were significant differences found. Several secondary parameters, such as physicians' global assessment and patients' global assessment, significantly favored BoNT-A over placebo at weeks 8 and 12. Wiley Periodicals, Inc.

  12. Botulinum toxin type A for the treatment of head and neck chronic myofascial pain syndrome: A systematic review and meta-analysis.

    Science.gov (United States)

    Khalifeh, Mohammad; Mehta, Kalpesh; Varguise, Nibu; Suarez-Durall, Piedad; Enciso, Reyes

    2016-12-01

    The authors conducted a systematic review to study the efficacy of botulinum toxin type A (BoTN-A) in the treatment of myofascial pain syndrome. The authors identified randomized, double-masked, placebo-controlled studies on June 1, 2016, from PubMed, Web of Science, and the Cochrane Library. Three of the authors assessed the studies for risk of bias. Outcomes included pain reduction on a visual analog scale, the number of responders, and the posttreatment pain threshold to applied pressure using algometry. The initial search strategy yielded 253 unduplicated references, which the authors reduced to 13 relevant studies. The authors included 11 studies in the meta-analyses as the investigators of those studies had reported similar outcomes. Pooled results showed a nonsignificant improvement in the posttreatment intensity of pain in the BoTN-A group compared with the placebo group at 4 to 6 weeks (standardized difference in means [SDM], -0.110; 95% confidence interval [CI], -0.344 to 0.124; P = .356) and a significant improvement at 2 to 6 months (SDM, -0.360; 95% CI, -0.623 to -0.096; P = .008). The number of study participants who responded to treatment was not statistically significantly different between the groups (risk ratio, 1.346; 95% CI, 0.922-1.964; P = .123) nor was the increase of pain threshold to pressure (algometry) at 2 months (SDM, 0.131; 95% CI, -0.178 to 0.440; P = .405). The study investigators reported no major adverse events. Pain was reduced significantly in the group that received BoTN-A compared with the placebo group at 2 to 6 months but not at 4 to 6 weeks (with moderate quality of the evidence). Additional studies with larger numbers of participants are needed to confirm these results. Copyright © 2016 American Dental Association. Published by Elsevier Inc. All rights reserved.

  13. Detection and confirmation of Clostridium botulinum in water used for cooling at a plant producing low-acid canned foods.

    Science.gov (United States)

    Sachdeva, Amita; Defibaugh-Chávez, Stephanie L H; Day, James B; Zink, Donald; Sharma, Shashi K

    2010-11-01

    Our laboratory tested water samples used for cooling low-acid canned foods at a canning facility under investigation by the U.S. Food and Drug Administration. We used an enzyme-linked immunosorbent assay with digoxigenin-labeled antibodies (DIG-ELISA) and real-time PCR as screening methods and confirmed the presence of neurotoxin-producing Clostridium botulinum in the samples by mouse bioassay.

  14. Botulinum toxin paralysis of the orbicularis oculi muscle. Types and time course of alterations in muscle structure, physiology and lid kinematics.

    Science.gov (United States)

    Horn, A K; Porter, J D; Evinger, C

    1993-01-01

    In chronically prepared guinea pigs, we investigated the time course of botulinum toxin A's (Bot A) effect on the blink reflex by monitoring lid movements and EMG activity prior to and after Bot A injection into the orbicularis oculi muscle (OOemg), or after nerve crush of the zygomatic nerve. We correlated these alterations with the morphological changes of the orbicularis oculi (lid-closing) muscles of the same animals. After Bot A treatment there was a profound reduction of OOemg activity and blink amplitudes as well as a slowing of maximum blink down-phase velocity. Blink up-phases, however, remained unchanged. Gradual recovery of OOemg magnitude and blink amplitude started around day 6; a functioning blink reflex appeared on day 21, and full recovery of blink amplitude occurred by day 42. Crushing the zygomatic branch of the facial nerve produced similar changes in blink parameters, but recovery was much more rapid (15 days) than for Bot A-treated guinea pigs. The morphological analysis demonstrated that Bot A produced a denervation-like atrophy in the orbicularis oculi. No fiber type-specific alterations were noted, and all muscle fiber types ultimately recovered, with no longstanding consequences of the transient denervation. Our findings support the notion that functional recovery was the result of preterminal and terminal axonal sprouting that subsequently re-established functional innervation. Moreover, differences between the present findings and those seen after injection of Bot A into the extraocular muscles strongly support the hypothesis that the composition in terms of muscle fiber type and the properties of the motor control system of a given muscle greatly influence both how the particular muscle responds to toxin injection, and how effective the toxin is in resolution of neuromuscular disorders that affect a particular muscle. The present findings were consistent with clinical observations that Bot A produces only temporary relief in patients

  15. [Effect of botulinum toxin type B on residual limb sweating and pain. Is there a chance for indirect phantom pain reduction by improved prosthesis use?].

    Science.gov (United States)

    Kern, K-U; Kohl, M; Seifert, U; Schlereth, T

    2012-04-01

    Hyperhidrosis of a residual limb after amputation is one of the most common reasons for impaired prosthesis use and quality of life and affects 30-50% of all amputees causing skin irritation in about 25%. Thus the probability of residual limb pain increases in addition to an increased likelihood of phantom pain due to shorter duration of prothesis use. Development of both types of pain was studied following treatment of hyperhidrosis in 9 amputees. A total of 9 lower limb amputees received injections of 1750 units of botulinum toxin type B (BTX-B) for the treatment of hyperhidrosis of a residual limb (20 intracutaneous injections each). Prior to injections and 4 weeks and 3 months afterwards, patients rated the impairments regarding residual limb pain, phantom pain and sweating of the residual limb. Furthermore the duration of use of the prosthetic device and quality of life were rated on a numeric rating scale (NRS 0-10). Stump pain (n=9) was highly significantly reduced after 3 months (baseline: NRS 5; 4 weeks: NRS 4, p=0.109; 3 months: NRS 3, p=0.008) and also a tendency for phantom pain after 3 months (baseline NRS 5; 3 months: NRS 3; p=0.109). Sweating of the residual limb prior to BTX-B application was rated as a median 7 on the NRS scale with significant improvements after 4 weeks (NRS 3, p=0.027) and 3 months (NRS 3, p=0.020). Impaired duration of prothesis use improved from NRS 8 to NRS 2 (4 weeks; p=0.023) and NRS 3 (3 months; p=0.023) as well as the quality of life (p=0.016, p=0.023, respectively). Residual limb pain improved 3 months after intracutaneous, low-dose BTX-B in a trial with 9 patients and also phantom pain by tendency. Sweating of the residual limb was significantly reduced, probably thereby improving the duration of prothesis use. Larger studies should confirm these findings and conclusions.

  16. Investigation of Clostridium botulinum group III's mobilome content.

    Science.gov (United States)

    Woudstra, Cédric; Le Maréchal, Caroline; Souillard, Rozenn; Anniballi, Fabrizio; Auricchio, Bruna; Bano, Luca; Bayon-Auboyer, Marie-Hélène; Koene, Miriam; Mermoud, Isabelle; Brito, Roseane B; Lobato, Francisco C F; Silva, Rodrigo O S; Dorner, Martin B; Fach, Patrick

    2017-12-26

    Clostridium botulinum group III is mainly responsible for botulism in animals. It could lead to high animal mortality rates and, therefore, represents a major environmental and economic concern. Strains of this group harbor the botulinum toxin locus on an unstable bacteriophage. Since the release of the first complete C. botulinum group III genome sequence (strain BKT015925), strains have been found to contain others mobile elements encoding for toxin components. In this study, seven assays targeting toxin genes present on the genetic mobile elements of C. botulinum group III were developed with the objective to better characterize C. botulinum group III strains. The investigation of 110 C. botulinum group III strains and 519 naturally contaminated samples collected during botulism outbreaks in Europe showed alpha-toxin and C2-I/C2-II markers to be systematically associated with type C/D bont-positive samples, which may indicate an important role of these elements in the pathogenicity mechanisms. On the contrary, bont type D/C strains and the related positive samples appeared to contain almost none of the markers tested. Interestingly, 31 bont-negative samples collected on farms after a botulism outbreak revealed to be positive for some of the genetic mobile elements tested. This suggests loss of the bont phage, either in farm environment after the outbreak or during laboratory handling. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Clostridium botulinum group III: a group with dual identity shaped by plasmids, phages and mobile elements.

    Science.gov (United States)

    Skarin, Hanna; Håfström, Therese; Westerberg, Josefina; Segerman, Bo

    2011-04-12

    Clostridium botulinum strains can be divided into four physiological groups that are sufficiently diverged to be considered as separate species. Here we present the first complete genome of a C. botulinum strain from physiological group III, causing animal botulism. We also compare the sequence to three new draft genomes from the same physiological group. The 2.77 Mb chromosome was highly conserved between the isolates and also closely related to that of C. novyi. However, the sequence was very different from the human C. botulinum group genomes. Replication-directed translocations were rare and conservation of synteny was high. The largest difference between C. botulinum group III isolates occurred within their surprisingly large plasmidomes and in the pattern of mobile elements insertions. Five plasmids, constituting 13.5% of the total genetic material, were present in the completed genome. Interestingly, the set of plasmids differed compared to other isolates. The largest plasmid, the botulinum-neurotoxin carrying prophage, was conserved at a level similar to that of the chromosome while the medium-sized plasmids seemed to be undergoing faster genetic drift. These plasmids also contained more mobile elements than other replicons. Several toxins and resistance genes were identified, many of which were located on the plasmids. The completion of the genome of C. botulinum group III has revealed it to be a genome with dual identity. It belongs to the pathogenic species C. botulinum, but as a genotypic species it should also include C. novyi and C. haemolyticum. The genotypic species share a conserved chromosomal core that can be transformed into various pathogenic variants by modulation of the highly plastic plasmidome.

  18. Botulinum toxin type A for the treatment of non-neurogenic overactive bladder: does using onabotulinumtoxinA (Botox(®) ) or abobotulinumtoxinA (Dysport(®) ) make a difference?

    Science.gov (United States)

    Ravindra, Pravisha; Jackson, Benjamin L; Parkinson, Richard J

    2013-07-01

    To compare the clinical effects of two different commercially available botulinum toxin type A products, onabotulinumtoxinA (Botox(®) ; Allergan Inc., Irvine, CA, USA) and abobotulinumtoxinA (Dysport(®) ; Ipsen Ltd, Slough, UK), on non-neurogenic overactive bladder (OAB). We included 207 patients, who underwent treatment with botulinum toxin type A for non-neurogenic OAB from January 2009 to June 2012 at our institution, in a prospective database that recorded details of their presentation, treatment and outcomes. In December 2009, our institution switched from using onabotulinumtoxinA to using abobotulinumtoxinA. Results from the onabotulinumtoxinA cohort (n = 101) and the abobotulinumtoxinA cohort (n = 106) were compared. Similar reductions in daytime frequency, nocturia and incontinence episodes were observed after treatment, with no difference in duration of effect. The abobotulinumtoxinA cohort had almost twice the rate of symptomatic urinary retention (23 vs 42%) requiring intermittent self-catheterisation (ISC). AbobotulinumtoxinA use was complicated by a significantly higher risk of requiring ISC. The study suggests that these two toxins are not interchangeable at the doses used. © 2013 BJU International.

  19. Botulinum toxin injections for adults with overactive bladder syndrome.

    Science.gov (United States)

    Duthie, James B; Vincent, Michael; Herbison, G Peter; Wilson, David Iain; Wilson, Don

    2011-12-07

    instillation techniques, neuromodulation, and different types, doses, and injection techniques of botulinum toxin. Binary outcomes were presented as relative risk and continuous outcomes by mean differences. Little data could be synthesised across studies due to differing study designs and outcome measures. Where applicable standard deviations were calculated from P values according to the formula described in section 7.7.3.3 of the Cochrane Handbook of Systematic Reviews of Interventions. Data were tabulated where possible with results taken from trial reports where this was not possible. Where multiple publications were found, the reports were treated as a single source of data. Nineteen studies were identified that met the inclusion criteria.  Most patients in the studies had neurogenic OAB, but some included patients with idiopathic OAB.  All studies demonstrated superiority of botulinum toxin to placebo.  Lower doses of botulinum toxin (100 to 150 U) appeared to have beneficial effects, but larger doses (300 U) may have been more effective and longer lasting, but with more side effects.  Suburothelial injection had comparable efficacy to intradetrusor injection. The effect of botulinum toxin may last for a number of months and is dependent upon dose and type of toxin used. Patients receiving repeated doses do not seem to become refractory to botulinum toxin. Botulinum toxin appeared to have beneficial effects in OAB that quantitatively exceeded the effects of intravesical resiniferatoxin. Intravesical botulinum toxin appeared to be reasonably safe; however, one study was halted due to a perceived unacceptable rate of urinary retention.  Intravesical botulinum toxin appears to be an effective therapy for refractory OAB symptoms, but as yet little controlled trial data exist on benefits and safety compared with other interventions, or with placebo. Further robust data are required on long term outcomes, safety, and optimal dose of botulinum toxin for OAB.

  20. Management of stroke patients submitted to botulinum toxin type A therapy: a Delphi survey of an Italian expert panel of specialist injectors.

    Science.gov (United States)

    Franceschini, M; Iocco, M; Molteni, F; Santamato, A; Smania, N

    2014-10-01

    Spasticity is a common disabling symptom of several neurological conditions including stroke. Botulinum toxin type A (BTX-A) injection represents the gold standard therapy for focal spasticity. Post-stroke management of patients receiving BTX-A therapy has been variously investigated, but general agreement on how and when to implement rehabilitation is lacking. To perform a national survey of experts on the most appropriate rehabilitation procedures after BTX-A therapy for the focal treatment of spasticity. The study employed the Delphi technique through the COSMO project (Consensus on Post-Injection Management in Post-stroke Spasticity). Italian neurologists and physiatrists with experience in BTX-A therapy were selected to participate in the survey. Their anonymous opinions on key issues in treatment strategies in post-stroke spasticity were collected in three sequential rounds facilitated by a web platform. Consensus on a given issue was defined as agreed opinion by at least 66% of the survey participants. In all, 44 Italian experts were involved. Positive consensus was reached on the need to start rehabilitation during the first week after BTX-A injection therapy, with a rehabilitation program comprising both stretching combined with electrical stimulation and exercise therapy. Functional surgery may be considered only after 12-24 months in cases of BTX-A therapy failure. The use of commercial or custom-made orthoses in selected cases was recommended. The appropriate time interval between two BTX-A injections is 3-6 months, and clinical assessment should be performed 1 month after injection. The results of this national survey confirm that clinical experts on the use of BTX-A therapy for spasticity after stroke agree on the need to initiate rehabilitation treatment immediately after BTX-A injection: muscle stretching exercises, eventually combined with neuromuscular electrical stimulation, may enhance the effect of BTX-A therapy. Outcome after BTX-A therapy

  1. Horizontal gene transfer of toxin genes in Clostridium botulinum: Involvement of mobile elements and plasmids.

    Science.gov (United States)

    Skarin, Hanna; Segerman, Bo

    2011-09-01

    Intoxication with the potent botulinum neurotoxin (BoNT) gives rise to the serious paralytic illness botulism. BoNT is part of a complex that consists of the neurotoxin and several associated components, all encoded by the bont gene cluster. This gene cluster has likely been subjected to horizontal gene transfer between different groups of clostridia, which has given rise to the genetically diverse species Clostridium botulinum. C. botulinum is divided into four physiological groups (I-IV), where group I and II cause disease in humans and group III in animals. Analysis of the genomes of group I, II and III has revealed that toxin genes, including the bont cluster, often are plasmid-borne. The genomes analyzed from group III contain an unusually high number of plasmids carrying different toxin genes. Some of these genes are also found in other Clostridium species and some have moved between different plasmids within the same physiological group. This indicates that horizontal transfer of toxin genes is taking place within and between species of Clostridium. The abundance of mobile elements, especially in genomes of group III, is likely connected to accelerated genome plasticity and gene transfer events.

  2. The use of botulinum toxin type A in the treatment of HTLV-1-associated overactive bladder refractory to conventional therapy

    Directory of Open Access Journals (Sweden)

    José Abraão Carneiro Neto

    2014-07-01

    Full Text Available Urinary symptoms occur in 19% of human T-cell lymphotropic virus type 1 (HTLV-1-infected patients who do not fulfill criteria for HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP and in almost 100% of HAM/TSP patients. Few studies have evaluated therapies for overactive bladder (OAB caused by HTLV-1 infection. This case report describes the effect of onabotulinum toxin A on the urinary manifestations of three patients with HAM/TSP and OAB symptoms. The patients were intravesically administered 200 units of Botox®. Their incontinence episodes improved, and their OAB symptoms scores (OABSS reduced significantly. These data indicate that Botox® should be a treatment option for OAB associated with HTLV-1 infection.

  3. Purification and characterization of a neurotoxin from the venom of Ophiophagus hannah (king cobra).

    Science.gov (United States)

    Chang, Long-Sen; Liou, Jau-Cheng; Lin, Shinne-Ren; Huang, Hsien-Bin

    2002-06-14

    A neurotoxin, Oh9-1, from the venom of Ophiophagus hannah was isolated by a combination of ion-exchange chromatography and reverse phase HPLC. Amino acid sequence analysis revealed that Oh9-1 consists of 57 amino acids and eight cysteine residues. This protein was mainly constituted with beta-sheet as evidenced by CD spectrum. Oh9-1 inhibited carbachol-induced muscle contraction in an irreversible manner and the dose for achieving 50% inhibition was approximately fourfold that of alpha-bungarotoxin. Since the residues in alpha-neurotoxins closely involve in the binding with acetylcholine receptors are not highly conserved in this toxin molecule, Oh9-1 represents a novel type of neurotoxin structurally distinct from alpha-neurotoxins.

  4. Botulinum toxin type A potentiates the effect of neuromotor rehabilitation of Pisa syndrome in Parkinson disease: a placebo controlled study.

    Science.gov (United States)

    Tassorelli, C; De Icco, R; Alfonsi, E; Bartolo, M; Serrao, M; Avenali, M; De Paoli, I; Conte, C; Pozzi, N G; Bramanti, P; Nappi, G; Sandrini, G

    2014-11-01

    Pisa syndrome (PS) is a tonic lateral flexion of trunk that represents a disabling complication of advanced Parkinson disease (PD). Conventional rehabilitation treatment (CT) ameliorates axial posture and trunk mobility in PD patients, but the improvement tends to wane in 4-6 months. Botulin toxin (BT) may reduce muscle hyperactivity, therefore improving CT effectiveness. We evaluated whether the injection of incabotulinum toxin type A (iBTA) into the hyperactive trunk muscles might improve the effectiveness of rehabilitation in a group of PD patients with PS. Twenty-six PD patients were enrolled in a randomized placebo-controlled trial. Group A was treated with iBTA before undergoing CT (a 4-week intensive programme), while Group B received saline before the 4-week CT treatment. Patients were evaluated at baseline, at the end of the rehabilitative period, 3 and 6 months with kinematic analysis of movement, UPDRS, Functional Independence Measure and Visual Analog Scale for pain. At the end of the rehabilitation period, both groups improved significantly in terms of static postural alignment and of range of motion. Group A showed a significantly more marked reduction in pain score as compared with Group B and a more prolonged efficacy on several clinical and kinematic variables. Our preliminary data suggest that BT may be considered an important addition to the rehabilitation programme for PD subjects with PS for improving axial posture and trunk mobility, as well as for a better control of pain. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. A survey of the current practice of intramuscular Botulinum toxin injections for hemiplegic shoulder pain in the UK.

    Science.gov (United States)

    Holmes, Richard J; Connell, Louise A

    2017-11-10

    To describe the current UK practice for the use of intramuscular Botulinum Toxin type A injections to treat hemiplegic shoulder pain. A UK-based cross-sectional study using an online survey. Participants (n = 68) were medical and non-medical practitioners recruited via the membership of the British Society for Rehabilitation Medicine and the British Neurotoxin Network. Data was analysed using descriptive statistics and content analysis. The majority of respondents would consider Botulinum Toxin type A for hemiplegic shoulder pain (86.8%), though most of these respondents inject for this goal infrequently (83.1%). Pectoralis major was most commonly selected to achieve this goal. Barriers to this intervention included difficulties determining the cause of pain (29.4%), difficulty isolating muscles (27.9%), and a lack of evidence (25%). The doses reported regularly deviated from guidelines and a substantial range in the volumes suggested was observed. Clinicians were mostly reliant on unstandardised measures to assess outcomes. Current UK practice of Botulinum Toxin type A injections for hemiplegic shoulder pain associated with spasticity is highly variable. There are large gaps between current practice and available evidence with regards to muscle selection and doses used. A number of areas for further investigation have been identified to progress current understanding of this intervention. Implications for rehabilitation There are wide variations in practice for this complex intervention and clinicians should consider that their individual decision-making could be based on their own beliefs rather than available evidence. Pectoralis major is most commonly injected to treat hemiplegic shoulder pain, but further evaluation is required to address whether it is the most effective. Clinicians most often use a limitation of shoulder abduction and external rotation, flexor patterning of the upper limb, and pain on passive movement to identify when hemiplegic shoulder

  6. Recurrent contact granuloma: experience with excision and botulinum toxin injection.

    Science.gov (United States)

    Yilmaz, Taner; Süslü, Nilda; Atay, Gamze; Özer, Serdar; Günaydin, Riza Önder; Bajin, Münir Demir

    2013-06-01

    Contact granuloma is a difficult-to-treat laryngeal disorder associated with vocal abuse, habitual throat clearing, and laryngopharyngeal reflux. It has a high propensity for persistence and recurrence despite many treatment alternatives. To present our experience with recurrent contact granuloma treated with microlaryngoscopic excision and botulinum toxin injection. Case series. The follow-up period had a mean (range) of 41 (11-88) months. Tertiary referral university clinic. Twenty patients with recurrent, grade 3 and grade 4 contact granuloma whose lesion was excised at least once after failure of conservative treatments. Microlaryngoscopic excision and botulinum toxin type A injection into the region of the bilateral thyroarytenoid and lateral cricoarytenoid muscles. Disappearance of contact granuloma. Seventeen patients were cured of their contact granuloma. Three patients experienced recurrences: 2 received botulinum toxin injection only as outpatients and recovered. The other patient required reexcision and reinjection under general anesthesia. These 3 patients were free of granuloma at their last follow-up. After failed conservative treatment, microlaryngoscopic excision and botulinum toxin type A injection is successful in the treatment of recurrent contact granuloma. Removing recurrent granulomas can result in a low recurrence rate if botulinum toxin type A is added at the time of removal.

  7. Peptide fingerprinting of the sea anemone Heteractis magnifica mucus revealed neurotoxins, Kunitz-type proteinase inhibitors and a new β-defensin α-amylase inhibitor.

    Science.gov (United States)

    Sintsova, Oksana; Gladkikh, Irina; Chausova, Victoria; Monastyrnaya, Margarita; Anastyuk, Stanislav; Chernikov, Oleg; Yurchenko, Ekaterina; Aminin, Dmitriy; Isaeva, Marina; Leychenko, Elena; Kozlovskaya, Emma

    2017-11-27

    Sea anemone mucus, due to its multiple and vital functions, is a valuable substance for investigation of new biologically active peptides. In this work, compounds of Heteractis magnifica mucus were separated by multistage liquid chromatography and resulting fractions were analyzed by MALDI-TOF MS. Peptide maps constructed according to the molecular masses and hydrophobicity showed presence of 326 both new and known peptides. Several major peptides from mucus were identified, including the sodium channel toxin RpII isolated earlier from H. magnifica, and four Kunitz-type proteinase inhibitors identical to H. crispa ones. Kunitz-type transcript diversity was studied and sequences of mature peptides were deduced. New β-defensin α-amylase inhibitor, a homolog of helianthamide from Stichodactyla helianthus, was isolated and structurally characterized. Overall, H. magnifica is a source of biologically active peptides with great pharmacological potential. Proteinase and α-amylase inhibitors along with toxins are major components of H. magnifica mucus which play an important role in the successful existence of sea anemones. Obtained peptide maps create a basis for more accurate identification of peptides during future transcriptomic/genomic studies of sea anemone H. magnifica. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. A critical appraisal of the evidence for botulinum toxin type A in the treatment for cervico-thoracic myofascial pain syndrome.

    Science.gov (United States)

    Desai, Mehul J; Shkolnikova, Tatyana; Nava, Andrew; Inwald, Danielle

    2014-02-01

    Myofascial pain syndrome (MPS) is a musculoskeletal condition characterized by regional pain and muscle tenderness associated with the presence of myofascial trigger points (MTrPs). The last decade has seen an exponential increase in the use of botulinum toxin (BTX) to treat MPS. To understand the medical evidence substantiating the role of therapeutic BTX injections and to provide useful information for the medical practitioner, we applied the principles of evidence-based medicine to the treatment for cervico-thoracic MPS. A search was conducted through MEDLINE (PubMed, OVID, MDConsult), EMBASE, SCOPUS and the Cochrane database for the period 1966 to 2012 using the following keywords: myofascial pain, muscle pain, botulinum toxin, trigger points, and injections. A total of 7 trials satisfied our inclusion criteria and were evaluated in this review. Although the majority of studies found negative results, our analysis identified Gobel et al.'s as the highest quality study among these prospectively randomized investigations. This was due to appropriate identification of diagnostic criteria, excellent study design and objective endpoints. The 6 other identified studies had significant failings due to deficiencies in 1 or more major criteria. We conclude that higher quality, rigorously standardized studies are needed to more appropriately investigate this promising treatment modality. © 2013 World Institute of Pain.

  9. Molecular Analysis of Neurotoxin-Induced Apoptosis

    National Research Council Canada - National Science Library

    D'Mello, Santosh R

    2006-01-01

    Apoptosis is a cell-suicide process that is required for the normal development of the nervous system, but that can be aberrantly activated in neurodegenerative diseases and following exposure to neurotoxins...

  10. Two cases of type E infant botulism caused by neurotoxigenic Clostridium butyricum in Italy.

    Science.gov (United States)

    Aureli, P; Fenicia, L; Pasolini, B; Gianfranceschi, M; McCroskey, L M; Hatheway, C L

    1986-08-01

    The first two confirmed cases of type E infant botulism occurred in two 16-week-old girls in Rome, Italy. The original diagnosis for the first patient was intestinal blockage due to an ileocecal invagination, which was treated surgically. Postoperatively, the patient became unresponsive and required ventilatory assistance. A diagnosis of infant botulism was then made. The second infant presented to the same hospital 7 1/2 months later with profound weakness, hypotonicity, mydriasis, and areflexia. This case was recognized as possible botulism at admission. Both cases were confirmed by detection and identification of type E botulinal toxin in stool specimens and in enrichment cultures of those specimens. The toxigenic organisms isolated were quite different from Clostridium botulinum type E. The apparent causative organism in each case resembles Clostridium butyricum but produces a neurotoxin that is indistinguishable from type E botulinal toxin by its effects on mice and by its neutralization with type E botulinal antitoxin.

  11. [Botulinum toxin treatment of hip adductor spasticity in multiple sclerosis].

    Science.gov (United States)

    Wissel, J; Entner, T

    2001-01-01

    Spasticity results in a resistance to passive movement and decrease of passive mobility of the involved joints and is defined as a state of hypertonicity with exaggeration of tendon reflexes mediated by a loss of inhibitory control of upper motor neurons. In patients with severe stages of multiple sclerosis (MS) spasticity of the lower limbs often leeds to a spastic pattern with hip adduction resulting in decreased range-of-motion (ROM), increased pain, spasms, and functional disability (disturbed gait and sitting position) as well as difficulties with perineal hygiene. Local botulinum toxin type A (Btx-A) injections in spastic muscles offer a new treatment approach for managing spasticity and associated problems. Up to now Btx-A is approved for the treatment of blepharospasm and cervical dystonia and the treatment of equinous gait in children with cerebral palsy in Austria and Germany. Up to now only in Switzerland Botox is licensed for the treatment of focal spasticity. Btx-A is a neurotoxin derived from Clostridium botulinum. In most european countries Btx-A is available as Dysport (vial = 500 units) and Botox (vial = 100 units). In prospective studies a ratio of 1 unit Botox to 3-4 units Dysport was found. Following intramuscular injection Btx-A blocks the release of acetylcholine at the neuromuscular junctions, thereby inhibiting muscle contraction, and decreases spastic muscle tone and muscle spindles afferent information to the spinal cord. The spectrum of side effects includes local weakening of the injected and adjacent muscles as well as pain and haematoma at the injection site. At therapeutic doses side effects are local and transient. According to a double blind, placebo controlled, dose ranging study published by Hyman et al. (2000, Dysport in a dose of 500, 1000 and 1500 units reduced the degree of hip adductor spasticity associated with MS, and this benefit was evident despite concomitant use of oral antispasticity medication. According to the

  12. Inhibition of Metalloprotease Botulinum Serotype A from a Pseudo-Peptide Binding Mode to a Small Molecule that is Active in Primary Neurons

    Science.gov (United States)

    2007-02-16

    then with laminin. Cultures were incubated overnight at 37 °C prior to intoxication . Microscopy—Autofluorescence was used to examine inhibi- tor entry...488-conjugated goat anti-mouse secondary antibody, 1:25 Texas Red phalloidin, and Hoechst stain (Molecular Probes, Eugene, OR). Intoxication , Inhibitor...pharmacophore. Q2–15 chlorine atoms are light green; all other col- ors are as indicated for B. Small Molecule Inhibition of Botulinum Neurotoxin

  13. Global Aesthetics Consensus: Hyaluronic Acid Fillers and Botulinum Toxin Type A—Recommendations for Combined Treatment and Optimizing Outcomes in Diverse Patient Populations

    Science.gov (United States)

    Liew, Steven; Signorini, Massimo; Vieira Braz, André; Fagien, Steven; Swift, Arthur; De Boulle, Koenraad L.; Raspaldo, Hervé; Trindade de Almeida, Ada R.; Monheit, Gary

    2016-01-01

    Background: Combination of fillers and botulinum toxin for aesthetic applications is increasingly popular. Patient demographics continue to diversify, and include an expanding population receiving maintenance treatments over decades. Methods: A multinational panel of plastic surgeons and dermatologists convened the Global Aesthetics Consensus Group to develop updated guidelines with a worldwide perspective for hyaluronic acid fillers and botulinum toxin. This publication considers strategies for combined treatments, and how patient diversity influences treatment planning and outcomes. Results: Global Aesthetics Consensus Group recommendations reflect increased use of combined treatments in the lower and upper face, and some midface regions. A fully patient-tailored approach considers physiologic and chronologic age, ethnically associated facial morphotypes, and aesthetic ideals based on sex and culture. Lower toxin dosing, to modulate rather than paralyze muscles, is indicated where volume deficits influence muscular activity. Combination of toxin with fillers is appropriate for several indications addressed previously with toxin alone. New scientific data regarding hyaluronic acid fillers foster an evidence-based approach to selection of products and injection techniques. Focus on aesthetic units, rather than isolated rhytides, optimizes results from toxin and fillers. It also informs longitudinal treatment planning, and analysis of toxin nonresponders. Conclusions: The emerging objective of injectable treatment is facial harmonization rather than rejuvenation. Combined treatment is now a standard of care. Its use will increase further as we refine the concept that aspects of aging are intimately related, and that successful treatment entails identifying and addressing the primary causes of each. CLINICAL QUESTION/LEVEL OF EVIDENCE: Therapeutic, V. PMID:27119917

  14. Botulinum toxin therapy of hemifacial spasm: comparing different therapeutic preparations.

    Science.gov (United States)

    Frei, K; Truong, D D; Dressler, D

    2006-02-01

    Hemifacial spasm (HFS) is characterized by involuntary irregular clonic or tonic movements of the muscles innervated by cranial nerve VII on one side of the face, and is most often a result of vascular compression of the facial nerve at the root exit zone (Muscle and Nerve 1998;21:1740). Disability associated with this disorder ranges from social embarrassment to interference with vision resulting from involuntary eye closure. Treatment of HFS most often involves botulinum toxin injections, but may also include medications and surgery. We describe treatment with the three types of botulinum toxin currently commercially available--Botox, Dysport and Myobloc/NeuroBloc.

  15. Botulinum toxin is efficient to treat obstructive symptoms in children with Hirschsprung disease.

    Science.gov (United States)

    Wester, Tomas; Granström, Anna Löf

    2015-03-01

    Obstructive symptoms are common after pull-through for Hirschsprung disease. Botulinum toxin injection treatment may improve the bowel function if internal sphincter achalasia is the cause of obstructive symptoms. The aim of this study was to review the outcome in patients treated with intrasphincteric botulinum toxin injections after pull-through for Hirschsprung disease. The operative records were used to identify children with Hirschsprung disease who were treated with botulinum toxin injections at Karolinska University Hospital, Stockholm, Sweden, from September 2007 to November 2014. Data on age, sex, associated syndromes, length of aganglionic segment, age at pull-through, type of pull-through, age at first botulinum toxin injection, indication for botulinum toxin injection, and effect of first botulinum toxin injection were retrieved from the case records. Bowel function at last follow-up visit or telephone contact was recorded. Nineteen patients were identified. All had biopsy-verified Hirschsprung disease. Eighteen (15 males and 3 females) children had undergone intrasphincteric botulinum toxin injection treatment for obstructive symptoms after pull-through, which was done at 127 (18-538) days of age. Four children had total colonic aganglionosis. The first botulinum toxin injection was given at 2.4 (0.53-6.9) years of age. Thirteen children (72 %) had a good response to the first injection treatment. The children underwent 3 (1-13) injection treatments. At follow-up four patients had improved and did not need treatment for obstruction, four were scheduled for further botulinum toxin injections, eight had persistent obstructive symptoms treated with laxatives or enemas, and two children had an ileostomy. Botulinum toxin injection treatment improves the obstructive symptoms in children after pull-through for Hirschsprung disease. The effect is reversible and a majority of patients need repeat injections. When injection treatment is not repeated, a large

  16. Intramural injection with botulinum toxin significantly elongates the pig esophagus

    DEFF Research Database (Denmark)

    Larsen, Heidi Fhær; Jensen, Thorbjørn Søren Rønn; Rasmussen, Lars

    2013-01-01

    Surgical treatment of long-gap esophageal atresia (LGEA) is challenging. Methods which facilitate stretching of the esophageal pouches may allow primary anastomosis. Botulinum toxin type A (BTX-A) blocks acetylcholine release in neuromuscular junctions, thereby causing muscle relaxation. We hypot...

  17. Botulinum toxin in cervical dystonia: low dosage with electromyographic guidance

    NARCIS (Netherlands)

    Brans, J. W.; de Boer, I. P.; Aramideh, M.; Ongerboer de Visser, B. W.; Speelman, J. D.

    1995-01-01

    Sixty patients with idiopathic cervical dystonia were treated a total of 240 times with botulinum toxin type A (BTA). Selected muscles were injected with BTA under electromyographic (EMG) guidance. The clinical effect was measured on the Tsui scale and a 10-point anchored visual analogue scale. A

  18. Pretarsal application of botulinum toxin for treatment of blepharospasm

    NARCIS (Netherlands)

    Aramideh, M.; Ongerboer de Visser, B. W.; Brans, J. W.; Koelman, J. H.; Speelman, J. D.

    1995-01-01

    The response to botulinum toxin type A was compared after two injection techniques in 45 patients with blepharospasm. Initially, patients were treated according to a triple injection technique; two injections into the upper eyelid and one injection into the lower eyelid. Subsequently, without

  19. Botulinum toxin for myofascial pain syndromes in adults.

    Science.gov (United States)

    Soares, Adriana; Andriolo, Régis B; Atallah, Alvaro N; da Silva, Edina M K

    2014-07-25

    This is an updated version of the original Cochrane review published in Issue 4, 2012. Myofascial pain syndrome (MPS) is a regional muscular pain syndrome characterised by the presence of trigger points, which are painful points in one or more muscles. The pain can be felt at the site where the trigger point is located or it can be felt away from that place when the muscle is pressed (referred pain). Botulinum toxin is a protein produced by the bacterium Clostridium botulinum and is a potent neurotoxin that eventually inhibits muscle contractions. It is capable of selectively weakening painful muscles and interrupting the pain cycle. To assess the effectiveness and safety of botulinum toxin A (BTXA) in the treatment of myofascial pain syndrome (MPS), excluding MPS in neck and head muscles. This is an updated version of the original Cochrane review published in Issue 4, 2012. The search strategy for the update was the same as in the original review and we searched CENTRAL in The Cochrane Library (2013, Issue 11 of 12), MEDLINE (Ovid) (2012 to 29 November 2013) and EMBASE (Ovid) (2012 to 27 November 2013). The search strategy was composed of terms for myofascial pain and botulinum toxin. For the original review, we also searched the Cochrane Pain, Palliative and Supportive Care (PaPaS) Review Group Specialised Register until December 2011, PubMed (from 1966 to 2011) and LILACS (from 1982 to 2011). There was no language restriction. We included randomised controlled trials (RCTs) involving botulinum toxin for treating participants with MPS. We excluded studies with MPS of the neck and head from this review as they have already been assessed in existing systematic reviews. We considered a diagnosis of MPS to be based on the identification of trigger points in the taut band through palpation of sensitive nodules, local twitch response and specific patterns of referred pain associated with each trigger point. Two review authors independently screened identified studies

  20. Botulinum toxin A versus B in sialorrhea: a prospective, randomized, double-blind, crossover pilot study in patients with amyotrophic lateral sclerosis or Parkinson's disease.

    Science.gov (United States)

    Guidubaldi, Arianna; Fasano, Alfonso; Ialongo, Tamara; Piano, Carla; Pompili, Maurizio; Mascianà, Roberta; Siciliani, Luisa; Sabatelli, Mario; Bentivoglio, Anna Rita

    2011-02-01

    Either botulinum toxins (BoNTs) A and B have been used for improving drooling in different neurological conditions. Consecutive patients affected by Amyotrophic Lateral Sclerosis (ALS) or Parkinson's Disease (PD) accompanied by severe drooling were randomized to receive botulinum neurotoxin type A (BoNT-A) or B (BoNT-B) injections into the salivary glands. Following the first treatment, when sialorrhea returned to baseline (at least three months after the first injection), subjects were re-treated with the other serotype. Ultrasound-guided injections into parotid and submandibular glands were bilaterally performed: total doses were 250 U BoNT-A (Dysport) and 2500 U BoNT-B (Neurobloc). Objective (cotton roll weight) and subjective (ad hoc clinical scales) evaluations were performed at baseline, after 1 and 4 weeks, and every 4 weeks until drooling returned to baseline. Twenty-seven patients (15 ALS and 12 PD) were enrolled, fourteen completed the study. BoNT-A and BoNT-B treatments gave both subjective and objective improvements in all patients. The latency was significantly shorter after BoNT-B treatments (3.2 ± 3.7 days) compared to BoNT-A (6.6 ± 4.1 days; P = 0.002). The mean benefit duration was similar at 75 and 90 days for BoNT-A and BoNT-B, respectively (P = NS). The only toxin-related side effect was a change to saliva thickness. Either 250 U Dysport or 2500 U Neurobloc have similar effectiveness and safety in controlling sialorrhea. BoNT-B has a shorter latency and comparable duration. Cost analysis, considering the doses used in this study protocol favored BoNT-B treatment. Copyright © 2010 Movement Disorder Society.

  1. Monitoring of laying capacity, immunoglobulin Y concentration, and antibody titer development in chickens immunized with ricin and botulinum toxins over a two-year period.

    Science.gov (United States)

    Pauly, D; Dorner, M; Zhang, X; Hlinak, A; Dorner, B; Schade, R

    2009-02-01

    One of the key benefits in using chickens for immunization is the high yield of antibodies obtainable. It is known that egg production decreases over time, while animal maintenance costs remain stable. It would, however, be desirable to keep hens as long as possible to obtain maximal amounts of antibodies. To identify a suitable length of time that animals can be kept and to optimize the cost:yield ratio, we monitored the number of eggs laid, the total amount of chicken IgY, and the specific antibody titer from individually prepared eggs over a 2-yr period. The plant toxin ricin and the Clostridium botulinum neurotoxins type A and B were used to immunize 4 chickens. The number of eggs laid in 2 yr was approximately 600 per hen (about 80% of the maximum egg number), yielding about 20 to 40 g of total IgY per hen. A stable antibody titer of 1:100,000 to 1:1,000,000, as measured by ELISA, was obtained following up to 11 injections of 10 to 20 microg of immobilized native toxin. Laying capacities were found to decrease, on average, from 7 eggs/wk at the point of first immunization to 2 eggs/wk after more than 2 yr. In parallel, the yield of total and specific IgY increased over time, so that the antibody recovery remained high, even after prolonged immunization times. Using purified IgY preparations, classical immunological assays such as ELISA and Western blotting were performed. Furthermore, the IgY showed neutralizing capacity when used to block the functional activity of the toxins both in vitro and in vivo. Analysis of the total IgY content over time demonstrated a complex biological oscillation (and the antigen-specific titer), with a shorter time period of around 7 d (circaseptan rhythm). In summary, we successfully immunized chickens with ricin and botulinum neurotoxins and monitored laying capacity, IgY concentration, and specific antibody titer over an extended period of 2 yr.

  2. Botulinum toxin in poststroke spasticity.

    Science.gov (United States)

    Ozcakir, Suheda; Sivrioglu, Koncuy

    2007-06-01

    Poststroke hemiparesis, together with abnormal muscle tone, is a major cause of morbidity and disability. Although most hemiparetic patients are able to reach different ambulatory levels with rehabilitation efforts, upper and lower limb spasticity can impede activities of daily living, personal hygiene, ambulation and, in some cases, functional improvement. The goals of spasticity management include increasing mobility and range of motion, attaining better hygiene, improving splint wear and other functional activities. Conservative measures, such as positioning, stretching and exercise are essential in spasticity management, but alone often are inadequate to effectively control it. Oral antispastic medications often provide limited effects with short duration and frequent unwanted systemic side effects, such as weakness, sedation and dry mouth. Therefore, neuromuscular blockade by local injections have become the first choice for the treatment of focal spasticity, particularly in stroke patients. Botulinum toxin (BTX), being one of the most potent biological toxins, acts by blocking neuromuscular transmission via inhibiting acetylcholine release. Currently, focal spasticity is being treated successfully with BTX via injecting in the spastic muscles. Two antigenically distinct serotypes of BTX are available on the market as type A and B. Clinical studies of BTX used for spastic hemiplegic patients are reviewed in this article in two major categories, upper and lower limb applications. This review addresses efficacy in terms of outcome measures, such as muscle tone reduction and functional outcome, as well as safety issues. Application modifications of dose, dilutions, site of injections and combination therapies with BTX injections are also discussed.

  3. Synthetic peptide antigens derived from long-chain alpha-neurotoxins: Immunogenicity effect against elapid venoms.

    Science.gov (United States)

    de la Rosa, Guillermo; Pastor, Nina; Alagón, Alejandro; Corzo, Gerardo

    2017-02-01

    Three-finger toxins (3FTXs), especially α-neurotoxins, are the most poorly neutralized elapid snake toxins by current antivenoms. In this work, the conserved structural similarity and motif arrangements of long-chain α-neurotoxins led us to design peptides with consensus sequences. Eight long-chain α-neurotoxins (also known as Type II) were used to generate a consensus sequence from which two peptides were chemically synthesized, LCP1 and LCP2. Rabbit sera raised against them were able to generate partially-neutralizing antibodies, which delayed mice mortality in neutralization assays against Naja haje, Dendrospis polylepis and Ophiophagus hannah venoms. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Avaliação da fenda palpebral após aplicação de toxina botulínica tipo A em pacientes com distonias faciais Evaluation of palpebral fissure after botulinum toxin type A injection in patients with facial dystonias

    Directory of Open Access Journals (Sweden)

    Mariana Eleonora Pereira Cunial

    2012-12-01

    Full Text Available OBJETIVO: Avaliar a medida da fenda palpebral em pacientes com blefaroespasmo essencial benigno (BEB e espasmo hemifacial (EHF após a aplicação periocular de toxina botulínica tipo A. MÉTODOS: Foram estudados pacientes portadores de BEB e EHF submetidos à injeção periocular de toxina botulínica tipo A pela técnica inner orbital de aplicação. Os pacientes foram fotografados em PPO antes da aplicação e catorze dias depois dela. A fenda palpebral foi mensurada nestas imagens por meio de processamento computadorizado de imagens, utilizando o programa ImageJ. As alterações da fenda palpebral foram observadas comparando-se as medidas obtidas no pré e pós-aplicação. RESULTADOS: Comparando-se as imagens obtidas com o programa ImageJ, houve aumento estatisticamente significante (pPURPOSE: To evaluate the measurement of palpebral fissure in patients with facial dystonias before and after periocular injection with botulinum toxin type A. METHODS: We studied patients with benign essential blepharospasm and hemifacial spasm underwent periocular injection of botulinum toxin type A by the inner orbital technique of application. Patients were photographed 14 days before and after application. The palpebral fissure was measured in these images by means of computerized image processing using the program ImageJ. The palpebral fissure changes were observed by comparing the measurements obtained before and after application. RESULTS: Comparing the images obtained with the program ImageJ, there was a statistically significant increase (p <0.001 of the palpebral fissure in 14 eyes (51,8% after the application of periocular injection of botulinum toxin and the images analyzed showed no decrease of the palpebral fissure. CONCLUSION: In this study, patients with facial dystonias showed increased palpebral fissure periocular statistically significant after application of botulinum toxin type A.

  5. Prevalence of toxin-producing Clostridium botulinum associated with the macroalga Cladophora in three Great Lakes: growth and management

    Science.gov (United States)

    Chun, Chan Lan; Kahn, Chase I.; Borchert, Andrew J.; Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Peller, Julie R.; Pier, Christina; Lin, Guangyun; Johnson, Eric A.; Sadowsky, Michael J.

    2015-01-01

    The reemergence of avian botulism caused by Clostridium botulinum type E has been observed across the Great Lakes in recent years. Evidence suggests an association between the nuisance algae, Cladophoraspp., and C. botulinum in nearshore areas of the Great Lakes. However, the nature of the association between Cladophora and C. botulinum is not fully understood due, in part, to the complex food web interactions in this disease etiology. In this study, we extensively evaluated their association by quantitatively examining population size and serotypes of C. botulinum in algal mats collected from wide geographic areas in lakes Michigan, Ontario, and Erie in 2011–2012 and comparing them with frequencies in other matrices such as sand and water. A high prevalence (96%) of C. botulinum type E was observed inCladophora mats collected from shorelines of the Great Lakes in 2012. Among the algae samples containing detectable C. botulinum, the population size of C. Botulinum type E was 100–104 MPN/g dried algae, which was much greater (up to 103 fold) than that found in sand or the water column, indicating thatCladophora mats are sources of this pathogen. Mouse toxinantitoxin bioassays confirmed that the putativeC. botulinum belonged to the type E serotype. Steam treatment was effective in reducing or eliminating C. botulinum type E viable cells in Cladophora mats, thereby breaking the potential transmission route of toxin up to the food chain. Consequently, our data suggest that steam treatment incorporated with a beach cleaning machine may be an effective treatment of Cladophora-borne C. botulinum and may reduce bird mortality and human health risks.

  6. Fetal exposure to environmental neurotoxins in Taiwan.

    Directory of Open Access Journals (Sweden)

    Chuen-Bin Jiang

    Full Text Available Mercury (Hg, lead (Pb, cadmium (Cd, and arsenic (As are recognized neurotoxins in children that particularly affect neurodevelopment and intellectual performance. Based on the hypothesis that the fetal basis of adult disease is fetal toxic exposure that results in adverse outcomes in adulthood, we explored the concentrations of key neurotoxins (i.e., Hg, Pb, Cd, and As in meconium to identify the risk factors associated with these concentrations. From January 2007 to December 2009, 545 mother-infant pairs were recruited. The geometric mean concentrations of Pb and As in the meconium of babies of foreign-born mothers (22.9 and 38.1 µg/kg dry weight, respectively were significantly greater than those of babies of Taiwan-born mothers (17.5 and 33.0 µg/kg dry weight, respectively. Maternal age (≥30 y, maternal education, use of traditional Chinese herbs during pregnancy, and fish cutlet consumption (≥3 meals/wk were risk factors associated with concentrations of key prenatal neurotoxins. The Taiwan government should focus more attention on providing intervention programs for immigrant mothers to help protect the health of unborn babies. Further investigation on how multiple neurotoxins influence prenatal neurodevelopment is warranted.

  7. Building-block architecture of botulinum toxin complex: Conformational changes provide insights into the hemagglutination ability of the complex

    Directory of Open Access Journals (Sweden)

    Tomonori Suzuki

    2017-03-01

    Full Text Available Clostridium botulinum produces the botulinum neurotoxin (BoNT. Previously, we provided evidence for the “building-block” model of botulinum toxin complex (TC. In this model, a single BoNT is associated with a single nontoxic nonhemagglutinin (NTNHA, yielding M-TC; three HA-70 molecules are attached and form M-TC/HA-70, and one to three “arms” of the HA-33/HA-17 trimer (two HA-33 and one HA-17 further bind to M-TC/HA-70 via HA-17 and HA-70 binding, yielding one-, two-, and three-arm L-TC. Of all TCs, only the three-arm L-TC caused hemagglutination. In this study, we determined the solution structures for the botulinum TCs using small-angle X-ray scattering (SAXS. The mature three-arm L-TC exhibited the shape of a “bird spreading its wings”, in contrast to the model having three “arms”, as revealed by transmission electron microscopy. SAXS images indicated that one of the three arms of the HA-33/HA-17 trimer bound to both HA-70 and BoNT. Taken together, these findings regarding the conformational changes in the building-block architecture of TC may explain why only three-arm L-TC exhibited hemagglutination.

  8. [Safety and efficacy of botulinum toxin in hemifacial spasm].

    Science.gov (United States)

    Mazlout, H; Kamoun Gargouri, H; Triki, W; Kéfi, S; Brour, J; El Afrit, M A; Chéour, M; Kraiem, A

    2013-03-01

    Given the failure of pharmacologic and surgical treatment in the management of hemifacial spasm, the use of botulinum toxin as first line therapy is interesting. To evaluate the safety and efficacy of type A botulinum toxin in the treatment of hemifacial spasm. We conducted a retrospective, descriptive and comparative study of 25 patients with hemifacial spasm followed in the ophthalmology department of Habib Thameur hospital in Tunis over the period from June 2003 to June 2009. All patients received injections of botulinum toxin type A (Botox). We carried out 168 Botulinum A toxin injections (Botox) with an average of 6.85 ± 4.32 injections per patient. Doses varied between 12.5 U and 28 U Botox. A good response to treatment was observed in 92% of patients with a satisfactory return to daily activities and work. Based on a subjective scale from 1 to 3, the average total functional benefit was 2.55 ± 0.56. Average total duration of therapeutic response was 9.35 ± 3.64 weeks. Local side effects observed were comparable to those described in the literature: ptosis (32.4%), diplopia (8.2%), drooping of the labial commissure (11.2%), lagophthalmos (21.3%), tearing (7%), dry eye (4%). No systemic complication was noted. Botulinum toxin type A provides effective short-term and medium-term results in the treatment of hemifacial spasm. It is well tolerated locally and systemically. This safety and efficacy make it a valuable therapeutic alternative in the management of hemifacial spasm. Copyright © 2012. Published by Elsevier Masson SAS.

  9. Neurotoxin localization to ectodermal gland cells uncovers an alternative mechanism of venom delivery in sea anemones.

    Science.gov (United States)

    Moran, Yehu; Genikhovich, Grigory; Gordon, Dalia; Wienkoop, Stefanie; Zenkert, Claudia; Ozbek, Suat; Technau, Ulrich; Gurevitz, Michael

    2012-04-07

    Jellyfish, hydras, corals and sea anemones (phylum Cnidaria) are known for their venomous stinging cells, nematocytes, used for prey and defence. Here we show, however, that the potent Type I neurotoxin of the sea anemone Nematostella vectensis, Nv1, is confined to ectodermal gland cells rather than nematocytes. We demonstrate massive Nv1 secretion upon encounter with a crustacean prey. Concomitant discharge of nematocysts probably pierces the prey, expediting toxin penetration. Toxin efficiency in sea water is further demonstrated by the rapid paralysis of fish or crustacean larvae upon application of recombinant Nv1 into their medium. Analysis of other anemone species reveals that in Anthopleura elegantissima, Type I neurotoxins also appear in gland cells, whereas in the common species Anemonia viridis, Type I toxins are localized to both nematocytes and ectodermal gland cells. The nematocyte-based and gland cell-based envenomation mechanisms may reflect substantial differences in the ecology and feeding habits of sea anemone species. Overall, the immunolocalization of neurotoxins to gland cells changes the common view in the literature that sea anemone neurotoxins are produced and delivered only by stinging nematocytes, and raises the possibility that this toxin-secretion mechanism is an ancestral evolutionary state of the venom delivery machinery in sea anemones.

  10. Evaluation of group versus individual physiotherapy following lower limb intra-muscular Botulinum Toxin-Type A injections for ambulant children with cerebral palsy: A single-blind randomized comparison trial.

    Science.gov (United States)

    Thomas, Rachel E; Johnston, Leanne M; Sakzewski, Leanne; Kentish, Megan J; Boyd, Roslyn N

    2016-01-01

    This study aimed to evaluate efficacy of group (GRP) versus individual (IND) physiotherapy rehabilitation following lower limb intramuscular injections of Botulinum Toxin-Type A (BoNT-A) for ambulant children with cerebral palsy (CP). Following lower limb BoNT-A injections, 34 children were randomly allocated to GRP (n=17; mean age 7y8m SD 2.0; 13 males; Gross Motor Function Classification System (GMFCS) I=5, II=8, III=4) or IND physiotherapy (n=17; mean age 8y7m SD 2.0; 11 males; GMFCS I=9, II=5, III=3). Primary outcomes were the Canadian Occupational Performance Measure (COPM) and Edinburgh Visual Gait Score (EVGS) assessed at baseline, 10 and 26 weeks post intervention. There were no baseline differences between groups. GRP intervention had greater, but not clinically meaningful, improvement in COPM satisfaction (estimated mean difference EMD 1.7, 95% CI 0.4-3.1; pphysiotherapy (either GRP or IND) with an additional indirect dose (median 16 episodes) of individualized home programme activities following lower limb BoNT-A injections, however, was inadequate to drive clinically meaningful changes in lower limb motor outcomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. A double-blind, randomized, placebo-controlled health-outcomes survey of the effect of botulinum toxin type a injections on quality of life and self-esteem.

    Science.gov (United States)

    Dayan, Steven H; Arkins, John P; Patel, Amit B; Gal, Thomas J

    2010-12-01

    Although studies show that botulinum toxin type A (BoNTA) can positively influence one's first impression, little research has been conducted to measure the effect that BoNTA has on mental well-being. To determine the effects that BoNTA injections for the treatment of facial wrinkles had on quality of life (QOL) and self-esteem. One hundred participants received treatment with BoNTA or placebo saline in this double-blind randomized placebo-controlled survey. All participants completed a health outcomes survey consisting of Quality of Life Enjoyment and Satisfaction Questionnaire-Short Form and Heatherton and Polivy State Self-Esteem measurements before injection and 2 weeks and 3 months after injection. Statistically significant improvements (pself-consciousness, intellect, self-worth, appearance, comprehension, weight satisfaction, attractiveness, and sense of well-being. Increases in overall self-esteem and appearance-, social-, and performance-related self-esteem were observed in participants treated with BoNTA. Our findings showed that BoNTA injections result in improvements in QOL and self-esteem. In addition, BoNTA-naïve participants demonstrate greater improvements in QOL and self-esteem than participants previously exposed to BoNTA. Moreover, BoNTA-familiar participants demonstrated sustained improvement in QOL and self-esteem relative to BoNTA-naïve participants, even when injected with placebo. © 2010 by the American Society for Dermatologic Surgery, Inc.

  12. A Double-Blind Randomized Controlled Trial Investigating the Most Efficacious Dose of Botulinum Toxin-A for Sialorrhea Treatment in Asian Adults with Neurological Diseases

    Directory of Open Access Journals (Sweden)

    Mazlina Mazlan

    2015-09-01

    Full Text Available This study aims to determine the most efficacious dose of Botulinum neurotoxin type A (BoNT-A in reducing sialorrhea in Asian adults with neurological diseases. A prospective, double-blind randomized controlled trial was conducted over 24 weeks. Thirty patients with significant sialorrhea were randomly assigned to receive a BoNT-A (Dysport® injection into the submandibular and the parotid glands bilaterally via an ultrasound guidance. The total dose given per patient was either BoNT-A injection of (i 50 U; (ii 100 U; or (iii 200 U. The primary outcome was the amount of saliva reduction, measured by the differential weight (wet versus dry of intraoral dental gauze at baseline and at 2, 6, 12, and 24 weeks after injection. The secondary outcome was the subjective report of drooling using the Drooling Frequency and Severity Scale (DFS. Saliva reduction was observed in response to all BoNT-A doses in 17 patients who completed the assessments. Although no statistically significant difference among the doses was found, the measured reduction was greater in groups that received higher doses (100 U and 200 U. The group receiving 200 U of Dysport® showed the greatest reduction of saliva until 24 weeks and reported the most significant improvement in the DFS score.

  13. Tailored botulinum toxin type A injections in aesthetic medicine: consensus panel recommendations for treating the forehead based on individual facial anatomy and muscle tone

    Directory of Open Access Journals (Sweden)

    Anido J

    2017-10-01

    Full Text Available Javier Anido,1 Daniel Arenas,2 Cristina Arruabarrena,3 Alfonso Domínguez-Gil,4 Carlos Fajardo,5 Mar Mira,6 Javier Murillo,7 Natalia Ribé,8 Helga Rivera,9 Sofia Ruiz del Cueto,6 Helder Silvestre,10 Marisa Tirado11 1A-Clinic, Madrid, 2Hospital Cruz Roja, Madrid, 3Clinic Cristina Arruabarrena, San Sebastiá, 4Salamanca University, Salamanca, 5Clinic Fajardo, Malaga, 6Clinic Mira+Cueto, Madrid, 7Clinic CIR, Seville, 8Institute Natalia Ribé, Barcelona, 9Clinic Helga Rivera, Vigo, Spain; 10Clinic Europa, Lisbon, Portugal; 11Clinic Derma Alemar, Castellón, Spain Background: Facial lines and wrinkles are strongly influenced by individual differences in anatomy and muscle activity and no single injection protocol will suit all patients. However, there is only limited information in the published literature on how to develop a tailored approach to botulinum toxin treatment.Methods: An expert panel of physicians was convened to establish a consensus on developing an individualized approach to treatment of the forehead with incobotulinumtoxinA. Separate treatment protocols were developed for men and women and subdivided by background level of muscle activity: kinetic, hyperkinetic, and hypertonic. Each muscle tone category was then further subdivided to take account of individual characteristics that can influence treatment.Results: Consensus members describe how to perform a dynamic assessment to optimize the dose and injection technique for each patient. A tailored treatment protocol is described for men and women with a wide range of forehead presentations. For each presentation, units of toxin as well as the precise location of injection points were defined by creating a 12-zone map of the forehead.Conclusion: These recommendations depart from traditional consensus documents by providing detailed incobotulinumtoxinA injection protocols for the forehead based on the major parameters that differ between patients, including muscular anatomy, size, and

  14. Botulinum toxin for vaginismus treatment.

    Science.gov (United States)

    Ferreira, Juliana Rocha; Souza, Renan Pedra

    2012-01-01

    Vaginismus is characterized by recurrent or persistent involuntary contraction of the perineal muscles surrounding the outer third of the vagina when penile, finger, tampon, or speculum penetration is attempted. Recent results have suggested the use of botulinum toxin for the treatment of vaginismus. Here, we assessed previously published data to evaluate the therapeutic effectiveness of botulinum toxin for vaginismus. We have carried out a systematic review followed by a meta-analysis. Our results indicate that botulinum toxin is an effective therapeutic option for patients with vaginismus (pooled odds ratio of 8.723 with 95% confidence interval limits of 1.942 and 39.162, p = 0.005). This may hold particularly true in treatment-refractory patients because most of the studies included in this meta-analysis have enrolled these subjects in their primary analysis. Botulinum toxin appears to bea reasonable intervention for vaginismus. However, this conclusion should be read carefully because of the deficiency of placebo-controlled randomized clinical trials and the quality issues presented in the existing ones.

  15. Aptamer Selection Express: A Novel Method for Rapid Single-Step Selection and Sensing of Aptamers

    National Research Council Canada - National Science Library

    Fan, Maomian; Roper, Shelly; Andrews, Carrie; Allman, Amity; Bruno, John; Kiel, Jonathan

    2008-01-01

    ...). This process has been used to select aptamers against different types of targets (Bacillus anthracis spores, Bacillus thuringiensis spores, MS-2 bacteriophage, ovalbumin, and botulinum neurotoxin...

  16. Long-term response of different Botulinum toxins in refractory neurogenic detrusor overactivity due to spinal cord injury.

    Science.gov (United States)

    Lombardi, Giuseppe; Musco, Stefania; Bacci, Giovanni; Celso, Maria; Bellio, Valerio; Del Popolo, Giulio

    2017-01-01

    To assess the response in spinal cord injured patients alternatively treated with different types and dosages of Botulinum neurotoxin type A (BoNT/A) over 15 years. Patients who underwent first BoNT/A from 1999-2001 and practiced intermittent catheterization were included. Baseline 3-day bladder diary (BD) and urodynamics were collected. BoNT/A failure was defined when patients asked for re-injection ≤ 3 months post-treatment. Criteria for re-injection was at least one daily episode of urinary incontinence at BD. Before re-injection, patients were asked if they had reached 6 months of dryness without antimuscarinics (YES response). Overall, 32/60 (53.4%) "No failure" (NF) group; 16 (26.6%) "occasional failure" (OF) and 12 (20%) "consecutive failure" (CF) were included. A total of 822 BoNT/A infiltrations were performed. The mean interval from previous injection to treatment re-scheduling was 8 months. No significant differences between treatments were found within the three groups (p>0.05). The percentage of YES responses increased from 19% (AboBoNT/A 500IU) to 29 % (OnaBoNT/A 300IU) in NF, and from 18% (AboBoNT/A 500IU) to 25% (OnaBoNT/A 300IU) for OF. Five NF cases (15.6%) maintained 6 months of dryness after each injection. Among the baseline variables, only low compliance (Definition of failure and other criteria for continuing repetitive BoNT/A treatment is mandatory. CF was predictable for no response in earlier follow-up. Copyright® by the International Brazilian Journal of Urology.

  17. Use of botulinum toxin in individuals with neurogenic detrusor overactivity: State of the art review

    Science.gov (United States)

    Linsenmeyer, Todd A.

    2013-01-01

    Background Botulinum neurotoxin (BoNT) injection into the bladder wall has been shown to be an effective alternative to anticholinergic (antimuscarinic) medications and more invasive surgery in those with multiple sclerosis and spinal cord injury with neurogenic detrusor overactivity (NDO) and urinary incontinence who are not tolerating anticholinergic medications. In August 2011, Botox® (onabotulinumtoxinA) received Food and Drug Administration (FDA) approval for this use. Clinically, intradetrusor injection of BoNT has been found to decrease urinary incontinence and improve quality of life. Its impact on urodynamic parameters is an increase in the maximum cystometric (bladder) capacity and decrease in the maximum detrusor pressures. The most common side effects are urinary tract infections and urinary retention. There have been rare reports and a black box warning of distant spread of BoNT. BoNT has gained popularity because of its effectiveness and long duration of action, relative ease of administration, easy learning curve, reproducibility of results on repeated administration, and low incidence of complications. Objective To discuss the structure and function, mechanisms of action, clinical and urodynamic studies, injection technique, potential beneficial and adverse effects, and potential areas of research of BoNT. Methods Literature search focused on botulinum toxin in MEDLINE/PubMed. Search terms included botulinum toxin, neurogenic bladder, NDO, botox bladder, botox spinal cord injury, botox, FDA, botox side effects. All papers identified were English language, full-text papers. In addition, English abstracts of non-English papers were noted. The reference list of identified articles was also searched for further papers. Conclusion Botulinum toxin is an alternative treatment for individuals with NDO who fail to tolerate anticholinergic medications. Its popularity has increased because of the literature, which has supported its effectiveness, safety, easy

  18. Mechanism of Action of Botulinum Neurotoxin and Overview of Medical Countermeasures for Intoxication

    Science.gov (United States)

    2008-01-01

    dystonias and movement disorders following its approval in 1989 as an " orphan drug" by the U.S. Food and Drug Administration (FDA) for the treatment of...Monoclonals, Inc) was used for precipitation, whereas rabbit polyclonal antiserum 2777was used as the primary antibody (BioSynthesis, Inc.). The...toxin in milk . Proc. NatL. Acad. Sci. U.S.A. 102:9984-9989. Wilcox, P.G., Morrison, N.J., and Pardy, R.L. 1990. Recovery of the ventilatory and upper

  19. Theoretical Analyses of the Functional Regions of the Heavy Chain of Botulinum Neurotoxin

    Science.gov (United States)

    1994-01-01

    hemifacial spasm . Mov Disord 1987:4:237-254. 5. Brin MF. Blitzer A, Fahn S, Gould W. Lovelace RE. Adductor laryngeal dystonia (spastic dysphonia): treatment... reviews (6-9). The primary toxic effect of all the BTX serotypes (excluding the C2 and C3 serotypes I10)) is flaccid paralysis. The toxin prevents

  20. Utilizing Ayurvedic literature for the identification of novel phytochemical inhibitors of botulinum neurotoxin A

    Science.gov (United States)

    Ethnopharmacological relevance: Ayurveda, an ancient holistic system of health care practiced on the Indian subcontinent, utilizes a number of multi-plant formulations and is considered by many as a potential source for novel treatments, as well as the identification of new drugs. Our aim is to iden...

  1. A Review of the Disruptive Potential of Botulinum Neurotoxins as Chemical Warfare Agents

    Science.gov (United States)

    2011-10-01

    broad range of therapeutic and cosmetic uses [2-3]. BOTOX ® (the brand name for the most common BoNT preparation) and its competitors are projected to...2006. 63(2): p. 145-52. 4. Tirrell, M., Allergan’s Wrinkle-Busting Botox to Grow From Therapeutic Uses. Bloomberg Businessweek, 2011, Bloomberg: New...York City. 5. Coleman, K. and R.A. Zilinskas, Fake Botox , Real Threat: A booming market for a counterfeit beauty product could put a deadly biological

  2. Structural Studies on Intact Clostridium Botulinum Neurotoxins Complexed with Inhibitors Leading to Drug Design

    Science.gov (United States)

    2006-02-01

    active site mutant of the Bacillus cereus thermolysin-like neutral protease where albeit in the absence of a charged base some residual activity was...1996) E144S Active-site mutant of the Bacillus cereus thermol- ysin-like neutral protease at 2.8 Å Resolution, Acta Crystallogr. D52, 543-550. 33. Li...the toxin in complex with a potential inhibitor via x-ray crystallography and then analyze the interactions between the inhibitor and the protein

  3. Fungal bis-Naphthopyrones as Inhibitors of Botulinum Neurotoxin Serotype A

    Science.gov (United States)

    2012-04-02

    Delitschia sp. (JS 300) isolated from a sample of kangaroo dung collected in Australia. The talaroderxines were originally described as metabolites of...expected HREX-SRTI to provide more accurate relative binding free energy predictions than conventional TI methods . The results of the calculations are...statistical methods . J. Chem. Inf. Comput. Sci. 2003, 1463−1470. (13) Helma, C.; Cramer, T.; Kramer, S.; De Raedt, L. Data mining and machine learning

  4. The use of botulinum toxin as primary or adjunctive treatment for post acne and traumatic scarring

    Directory of Open Access Journals (Sweden)

    Greg J Goodman

    2010-01-01

    Full Text Available Background : Botulinum toxin has been utilised successfully in many facial and extra facial regions to limit superfluous movement. Scars, whether traumatic or disease-related, are treated with many modalities. Objective: To assess the available literature concerning the prophylactic use of botulinum toxin for the improvement in the cosmetic outcome of scars induced by surgery and to examine its role in the treatment of established scars alone, as also combined with other modalities. Material and Methods : The results of the prophylactic use of botulinum toxin to limit the resultant scarring from surgery are examined by a literature review. The primary and adjunctive use of botulinum toxin in the treatment of post acne and post surgical and traumatic scars is explored by case examples. Results : Literature review and personal experience shows good Improvement in the appearance of scars with the use of botulinum toxin alone or with other adjuvant modalities in the treatment of scars. Conclusion : Botulinum toxin would appear to be useful both in the prophylaxis and treatment of certain types of scars.

  5. Toxin yet not toxic: Botulinum toxin in dentistry

    Directory of Open Access Journals (Sweden)

    Archana M.S.

    2016-04-01

    Full Text Available Paracelsus contrasted poisons from nonpoisons, stating that “All things are poisons, and there is nothing that is harmless; the dose alone decides that something is a poison”. Living organisms, such as plants, animals, and microorganisms, constitute a huge source of pharmaceutically useful medicines and toxins. Depending on their source, toxins can be categorized as phytotoxins, mycotoxins, or zootoxins, which include venoms and bacterial toxins. Any toxin can be harmful or beneficial. Within the last 100 years, the perception of botulinum neurotoxin (BTX has evolved from that of a poison to a versatile clinical agent with various uses. BTX plays a key role in the management of many orofacial and dental disorders. Its indications are rapidly expanding, with ongoing trials for further applications. However, despite its clinical use, what BTX specifically does in each condition is still not clear. The main aim of this review is to describe some of the unclear aspects of this potentially useful agent, with a focus on the current research in dentistry.

  6. International consensus statement for the use of botulinum toxin treatment in adults and children with neurological impairments--introduction.

    Science.gov (United States)

    Esquenazi, A; Novak, I; Sheean, G; Singer, B J; Ward, A B

    2010-08-01

    Botulinum neurotoxin (BoNT) is most commonly used to reduce focal over-activity in skeletal muscle, although newer indications such as management of drooling, pain and tremor are emerging. Treatment of spasticity incorporating BoNT is usually part of an integrated multidisciplinary rehabilitation programme. Prior to initiating this therapy, specific functional limitations, goals and expected outcomes of treatment should be discussed with the patient/carers. Muscle selection and the order/priority of treatment should be agreed. Treatment goals may involve increasing active or passive function or the avoidance of secondary complications or impairment progression. This paper describes the basic science mechanisms of the action of BoNT and subsequent nerve recovery and introduces a supplement comprising the best available evidence and expert opinion from international panels on questions of assessment, indications, BoNT regimen, adjunctive therapy, expected outcomes and recommended monitoring. Speciality areas reviewed include Paediatric Lower Limb Hypertonicity, Paediatric Upper Limb Hypertonicity, Adult Lower Limb Hypertonicity, Adult Upper Limb Hypertonicity, Cervical Dystonia, Drooling and Pain and Niche Indications. There is good quality scientific evidence to support the efficacy of BoNT to reduce muscle over-activity in the limbs secondary to central nervous system disorders in adults and children, to address primary or secondary cervical dystonia, to reduce saliva flow and to treat some pain syndromes. There is emergent evidence for the efficacy of BoNT to reduce focal tremor, to treat other types of pain including neuropathic pain and also to improve function following treatment of focal muscle over-activity.

  7. Custos e eficácia da toxina botulínica tipo A no tratamento do blefaroespasmo essencial e espasmo hemifacial Costs and efficacy of type A botulinum toxin for the treatment of essential blepharospasm and hemifacial spasm

    Directory of Open Access Journals (Sweden)

    Cintia Gomes Galvão Lasalvia

    2006-10-01

    Full Text Available OBJETIVO: Avaliar os custos do tratamento para blefaroespasmo essencial e espasmo hemifacial com toxina botulínica tipo A (Dysport®, correlacionando-os com sua eficácia terapêutica. MÉTODOS: Análise de 50 prontuários de pacientes com blefaroespasmo essencial e espasmo hemifacial, submetidos à terapia com Dysport®, no período de abril de 2002 a maio de 2004 no setor de Óculo-Plástica da Santa Casa de São Paulo. Dos 50 pacientes, 27 apresentavam blefaroespasmo essencial e 23 espasmo hemifacial. Informações sobre grau de satisfação, queixas e custos pessoais foram obtidas mediante questionário. Os custos do medicamento e dos materiais foram pesquisados no almoxarifado e na farmácia da Santa Casa. Quanto ao custo das consultas, utilizou-se a tabela de pagamento do SUS. Para a estatística foram utilizados os testes de Wilcoxon e Mann-Whitney. RESULTADOS: O custo total anual do tratamento foi de R$ 1.239,32 para o blefaroespasmo essencial e R$ 661,72 para o espasmo hemifacial. Para o paciente, o custo anual foi de R$ 145,48 para o blefaroespasmo essencial e R$ 126,07 para o espasmo hemifacial. Para o hospital, o custo anual foi de R$ 1.095,84 para o blefaroespasmo essencial e R$ 535,65 para o espasmo hemifacial. O tratamento com Dysport® promoveu melhora funcional significativa nos dois grupos. CONCLUSÃO: O procedimento tem custo elevado, principalmente devido ao preço da toxina. Entretanto, pela análise econômica da saúde fica demonstrado que o procedimento possui excelente relação custo-benefício.PURPOSE: To evaluate the costs and efficacy of type A botulinum toxin in the treatment of essential blepharospasm and hemifacial spasm. METHODS: Pacients with essential blepharospasm and hemifacial spasm had their files analyzed. All patients were treated with type A botulinum toxin (Dysport® between April 2002 and May 2004 at the Oculoplastic Clinics of "Santa Casa de São Paulo". Twenty-seven patients presented essential

  8. A Prospective Randomized Double-blinded Pilot Study to Examine the Effect of Botulinum Toxin Type A Injection Versus Lidocaine/Depomedrol Injection on Residual and Phantom Limb Pain

    Science.gov (United States)

    Wu, Hong; Sultana, Rizwana; Taylor, Kerrey Barton; Szabo, Aniko

    2013-01-01

    Objective Botulinum toxin type A (Botox) injection has been used to manage pain. However, it remains to be proved whether Botox injection is effective to relieve residual limb pain (RLP) and phantom limb pain (PLP). Design Randomized, double-blinded pilot study. Setting Medical College and an outpatient clinic in Department of Physical Medicine and Rehabilitation. Participants Amputees (n=14) with intractable RLP and/or PLP who failed in the conventional treatments. Interventions Study amputees were randomized to receive 1 Botox injection versus the combination of Lidocaine and Depomedrol injection. Each patient was evaluated at baseline and every month after the injection for 6 months. Main Outcome Measure The changes of RLP and PLP as recorded by VAS, and the changes of the pressure pain tolerance as determined by a pressure algometer. Results All patients completed the protocol treatment without acute side effects, and monthly assessments of RLP, PLP, and pain tolerance after the treatment. The time trend in the outcomes was modeled as an immediate change owing to the treatment followed by a linear tread afterward. Repeated measures were incorporated using mixed effects modeling. We found that both Botox and Lidocaine/Depomedrol injections resulted in immediate improvements of RLP (Botox: P=0.002; Lidocaine/Depomedrol: P=0.06) and pain tolerance (Botox: P=0.01; Lidocaine/Depomedrol: P=0.07). The treatment effect lasted for 6 months in both groups. The patients who received Botox injection had higher starting pain than those who received Lidocaine/Depomedrol injection (P=0.07). However, there were no statistical differences in RLP and pain tolerance between these 2 groups. In addition, no improvement of PLP was observed after Botox or Lidocaine/Depomedrol injection. Conclusions Both Botox and Lidocaine/Depomedrol injections resulted in immediate improvement of RLP (not PLP) and pain tolerance, which lasted for 6 months in amputees who failed in conventional

  9. Is an instrumented spasticity assessment an improvement over clinical spasticity scales in assessing and predicting the response to integrated botulinum toxin type a treatment in children with cerebral palsy?

    Science.gov (United States)

    Bar-On, Lynn; Van Campenhout, Anja; Desloovere, Kaat; Aertbeliën, Erwin; Huenaerts, Catherine; Vandendoorent, Britt; Nieuwenhuys, Angela; Molenaers, Guy

    2014-03-01

    To compare responsiveness and predictive ability of clinical and instrumented spasticity assessments after botulinum toxin type A (BTX) treatment combined with casting in the medial hamstrings (MEHs) in children with spastic cerebral palsy (CP). Prospective cohort study. Hospital. Consecutive sample of children (N=31; 40 MEH muscles) with CP requiring BTX injections. Clinical and instrumented spasticity assessments before and on average ± SD 53±14 days after BTX. Clinical spasticity scales included the Modified Ashworth Scale and the Modified Tardieu Scale. The instrumented spasticity assessment integrated biomechanical (position and torque) and electrophysiological (surface electromyography) signals during manually performed low- and high-velocity passive stretches of the MEHs. Signals were compared between both stretch velocities and were examined pre- and post-BTX. Responsiveness of clinical and instrumented assessments was compared by percentage exact agreement. Prediction ability was assessed with a logistic regression and the area under the receiver operating characteristic (ROC) curves of the baseline parameters of responders versus nonresponders. Both clinical and instrumented parameters improved post-BTX (P≤.005); however, they showed a low percentage exact agreement. The baseline Modified Tardieu Scale was the only clinical scale predictive for response (area under the ROC curve=0.7). For the instrumented assessment, baseline values of root mean square (RMS) electromyography and torque were better predictors for a positive response (area under the ROC curve=.82). Baseline RMS electromyography remained an important predictor in the logistic regression. The instrumented spasticity assessment showed higher responsiveness than the clinical scales. The amount of RMS electromyography is considered a promising parameter to predict treatment response. Copyright © 2014 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights

  10. Botulinum toxin: mechanisms of action

    OpenAIRE

    Dirk Dressler; Fereshte Adib Saberi; Egberto Reis Barbosa

    2005-01-01

    This review describes therapeutically relevant mechanisms of action of botulinum toxin (BT). BT's molecular mode of action includes extracellular binding to glycoproteine structures on cholinergic nerve terminals and intracellular blockade of the acetylcholine secretion. BT affects the spinal stretch reflex by blockade of intrafusal muscle fibres with consecutive reduction of Ia/II afferent signals and muscle tone without affecting muscle strength (reflex inhibition). This mechanism allows fo...

  11. Botulinum toxin — therapeutic effect in cosmetology

    Directory of Open Access Journals (Sweden)

    Morrison A.V.

    2016-09-01

    Full Text Available This review presents the data from published literatures and the research works conducted by the authors about mechanisms of action of botulinum toxin and its use in the practical medicine (particularly in dermatology and cosmetology. Indications and contraindications of botulinum toxin use in cosmetology are also considered in this work.

  12. Botulinum toxin — therapeutic effect in cosmetology

    OpenAIRE

    Morrison A.V.; Bocharova Y.M.; Morrison V.V.

    2016-01-01

    This review presents the data from published literatures and the research works conducted by the authors about mechanisms of action of botulinum toxin and its use in the practical medicine (particularly in dermatology and cosmetology). Indications and contraindications of botulinum toxin use in cosmetology are also considered in this work.

  13. Childhood-onset hemifacial spasm: successful treatment with botulinum toxin.

    Science.gov (United States)

    Singer, Carlos; Papapetropoulos, Spiridon; Farronay, Oscar

    2005-09-01

    Hemifacial spasm is a disorder characterized by involuntary contractions of muscles innervated by the ipsilateral facial nerve. The majority of cases are of adult-onset. However, a few cases have been described in children. Detectable causes of pediatric hemifacial spasm include facial nerve compression by vasculature and brainstem masses. In the treatment of hemifacial spasm, surgical decompression of the facial nerve has been used with good results in both adults and children. However, surgical procedures have serious risks and should be used only in selected cases. Although injections of botulinum toxin type A have been successfully used in adult hemifacial spasm patients, to our knowledge there is no report of use of this indication in children. This report presents the first case of a pediatric patient with childhood-onset hemifacial spasm successfully treated with periorbital botulinum toxin injections. The literature on the subject is also reviewed.

  14. Botulinum toxin type A in refractory chronic migraine: an open-label trial Toxina botulínica tipo A no tratamento da enxaqueca refratária: um estudo aberto

    Directory of Open Access Journals (Sweden)

    Carla Menezes

    2007-09-01

    Full Text Available Botulinum toxin type A (BT-A has been described as an important strategy to various types of pain such as cervical dystonia, myofascial pain syndrome and headache. Although BT-A efficacy has not been proven in tension type headache, its use in migraine continues controversial. In this open trial, we evaluated the efficacy of BT-A in refractory migraine. BT-A was injected in patients diagnosed with migraine who had previously used three classes of prophylactic drugs by at least one year with no response. The most important improvement was observed within 30 days, but pain intensity and frequency of headache had been decreased until the end of three months of follow up. Side effects of BT-A were mild and self limited. We conclude that BT-A seems to be a safe and effective treatment to refractory migraine patients.Toxina botulínica tipo A (TB-A tem sido descrita como importante estratégia para diversos tipos de dor como cefaléia e dores relacionadas a distonia cervical ou síndrome miofascial. Embora a eficácia da TB-A não tenha sido demonstrada na cefaléia do tipo tensional, seu uso na enxaqueca continua controverso. Nesse estudo avaliamos a eficácia da TB-A na enxaqueca refratária. TB-A foi injetada em pacientes com enxaqueca que fizeram tratamento prévio com no mínimo três classes de medicamentos profiláticos, sem resultados satisfatórios. A melhora mais significativa dos pacientes foi observada após 30 dias de aplicação de TB-A, enquanto intensidade da dor e freqüência de cefaléia continuaram reduzidas até o final de três meses de seguimento. Os efeitos colaterais observados após a aplicação de TB-A foram moderados e auto-limitados. Os nossos dados mostram que TB-A parece ser um tratamento seguro e eficaz para pacientes com enxaqueca refratária.

  15. Neurotoxins from Marine Dinoflagellates: A Brief Review

    Directory of Open Access Journals (Sweden)

    Da-Zhi Wang

    2008-06-01

    Full Text Available Dinoflagellates are not only important marine primary producers and grazers, but also the major causative agents of harmful algal blooms. It has been reported that many dinoflagellate species can produce various natural toxins. These toxins can be extremely toxic and many of them are effective at far lower dosages than conventional chemical agents. Consumption of seafood contaminated by algal toxins results in various seafood poisoning syndromes: paralytic shellfish poisoning (PSP, neurotoxic shellfish poisoning (NSP, amnesic shellfish poisoning (ASP, diarrheic shellfish poisoning (DSP, ciguatera fish poisoning (CFP and azaspiracid shellfish poisoning (ASP. Most of these poisonings are caused by neurotoxins which present themselves with highly specific effects on the nervous system of animals, including humans, by interfering with nerve impulse transmission. Neurotoxins are a varied group of compounds, both chemically and pharmacologically. They vary in both chemical structure and mechanism of action, and produce very distinct biological effects, which provides a potential application of these toxins in pharmacology and toxicology. This review summarizes the origin, structure and clinical symptoms of PSP, NSP, CFP, AZP, yessotoxin and palytoxin produced by marine dinoflagellates, as well as their molecular mechanisms of action on voltage-gated ion channels.

  16. Long-term botulinum toxin treatment of benign essential blepharospasm, hemifacial spasm, and Meige syndrome.

    Science.gov (United States)

    Czyz, Craig N; Burns, John A; Petrie, Thomas P; Watkins, John R; Cahill, Kenneth V; Foster, Jill A

    2013-07-01

    To report the clinical success and incidence of adverse events of repetitive botulinum toxin treatment of 15 years or greater. Retrospective cohort study. The study sample consisted of 37 patients from a clinical practice, 11 male and 26 female. Inclusion criteria consisted of patients treated a minimum of 15 consecutive years for facial dystonia. Seven patients had hemifacial spasm, 4 Meige syndrome, and 26 benign essential blepharospasm. Main outcome measures consisted of treatment efficacy and adverse events. Mean treatment duration was 19.4 years (SD 2.2) with an average of 62 (SD 22) treatments of 70.2 (SD 20.8) neurotoxin units. Mean duration of treatment efficacy was 127 days (SD 37) with a 5% physician-reported minor adverse event rate and no major adverse events over each patient's clinical course. Patients reported no major and 20% incidence of minor adverse events over the treatment course. Results suggest that long-term botulinum toxin treatment produces clinical success in the alleviation of facial dystonia symptoms. Treatment produced a low incidence of major adverse events and minor adverse events. Previous studies may under-report clinical success and over-report adverse events because of study design. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Botulinum toxin type A for refractory post-stroke shoulder pain Toxina botulínica do tipo A no tratamento do ombro doloroso após AVC

    Directory of Open Access Journals (Sweden)

    Glícia Pedreira

    2008-06-01

    Full Text Available Botulinum toxin type A (BTX-A has been used to treat several neurological conditions such as sialorrhea, hyperhydrosis, dystonia, hemifacial spasm, spasticity and pain. Although spasticity has been successfully treated with BTX-A, few are the authors studying the use of BTX-A to treat shoulder pain secondary to stroke. In order to study if BTX-A is effective to treat post-stroke shoulder pain, we followed up during 4 months 16 patients with sustained shoulder pain. Patients received BTX-A according to previous discussion with the rehabilitation group to determine the muscles and dose to be injected and were evaluated by the join range of motion and analogic pain scale. There was decrease of pain during shoulder motion, mainly during the movements of extension and rotation. We conclude that BTX-A is a safe and efficacious therapy.A toxina botulínica do tipo A (TB-A tem sido utilizada com sucesso para o tratamento de várias enfermidades neurológicas, tais como sialorréia, hiperidrose, distonia, espasmo hemifacial, espasticidade e dor. Embora espasticidade seja tratada com sucesso após o advento da TB-A, poucos são os autores que utilizaram a TB-A no tratamento da dor no ombro espástico secundária a acidente vascular cerebral (AVC. Com o objetivo de estudar a eficácia da TB-A no tratamento da dor no ombro secundária a AVC, foram acompanhados 16 pacientes com esta enfermidade associada à dor refratária no ombro espástico. Os pacientes receberam TB-A de acordo com dose e pontos de injeção definidos previamente pelo grupo de reabilitação e foram avaliados pelos ângulos de abertura da articulação do ombro e escala de avaliação analógica de dor. Houve melhora da dor à movimentação da articulação do ombro, principalmente nos movimentos de rotação e extensão. Concluímos que a TB-A é uma terapêutica segura e eficaz para o tratamento do ombro doloroso secundário a AVC.

  18. Botulinum toxin type A in the treatment of hemifacial spasm: an 11-year experience Toxina botulínica tipo A no tratamento do espasmo hemifacial: 11 anos de experiência

    Directory of Open Access Journals (Sweden)

    Egberto Reis Barbosa

    2010-08-01

    Full Text Available In order to evaluate the long-term effect of botulinum toxin type A (BTX in the treatment of hemifacial spasm (HFS, a retrospective analysis of patients treated at the Movement Disorders Unit of the Division of Neurology, Clinical Hospital, University of São Paulo, School of Medicine from 1993 to 2004 was made. A total of 808 injections with BTX were administered to 54 patients with HFS. The mean duration of improvement per application was 3.46 months and the mean rate of improvement using subjective judgement by the patient was of 83%. Adverse effects, mostly minor, were observed in 64.8% of patients at least once along the period of follow-up and the most frequent of them was orbicularis oris paralysis (38.8%. There was no decrement in response when compared the first and the last injection recorded.Para avaliar o efeito em longo prazo da toxina botulínica tipo A (TXB no tratamento do espasmo hemifacial (EHF, foi feita uma análise retrospectiva de pacientes tratados no Ambulatório de Distúrbios do Movimento da Divisão de Clínica Neurológica - Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo no período de 1993 a 2004. Um total de 808 aplicações de TXB foram administradas a 54 pacientes com EHF. A duração média de melhora foi de 3,46 meses e a taxa média de melhora segundo avaliação subjetiva do paciente foi de 83%. Efeitos adversos, em sua maioria menores, foram observados em 64,8% dos pacientes ao menos uma vez durante o seguimento e o mais freqüente foi paralisia do orbicular da boca (38,3%. Não se observou decremento na resposta quando se comparou a primeira com a última aplicação anotada.

  19. Clostridium botulinum spores and toxin in mascarpone cheese and other milk products.

    Science.gov (United States)

    Franciosa, G; Pourshaban, M; Gianfranceschi, M; Gattuso, A; Fenicia, L; Ferrini, A M; Mannoni, V; De Luca, G; Aureli, P

    1999-08-01

    A total of 1,017 mascarpone cheese samples, collected at retail, were analyzed for Clostridium botulinum spores and toxin, aerobic mesophilic spore counts, as well as pH, a(w) (water activity), and Eh (oxidation-reduction potential). In addition 260 samples from other dairy products were also analyzed for spores and botulinum toxin. Experiments were carried out on naturally and artificially contaminated mascarpone to investigate the influence of different temperature conditions on toxin production by C. botulinum. Three hundred and thirty-one samples (32.5%) of mascarpone were positive for botulinal spores, and 7 (0.8%) of the 878 samples produced at the plant involved in an outbreak of foodborne botulism also contained toxin type A. The chemical-physical parameters (pH, a(w), Eh) of all samples were compatible with C. botulinum growth and toxinogenesis. Of the other milk products, 2.7% were positive for C. botulinum spores. Growth and toxin formation occurred in naturally and experimentally contaminated mascarpone samples after 3 and 4 days of incubation at 28 degrees C, respectively.

  20. Toxina botulínica tipo A tópica con iontoforesis para el tratamiento de la hiperhidrosis axilar: Efecto y persistencia Topic type A botulinum toxin with iontophoresis in the treatment of armpit hyperhidrosis: effect and persistency

    Directory of Open Access Journals (Sweden)

    J.F. Silva-Gavarrete

    2011-09-01

    exocrine glands is termed Hyperhidrosis (HH and frequently become a dermatologic and social problem for humans. Nowadays, we have multiple treatments that controls the armpit HH. Botulinum toxin type A (TXB-A is known to be the best treatment to eliminate this problem but the needing of multiple injections in the armpit limits patients´ acceptance. Clinical iontophoresis method uses galvanic current to introduce many transdermal medications. We perform a simple blind clinical assay over 10 patients with armpit HH in who we apply an inert gel blended with Botulinum toxin type A (TXB-A Dysport® using one session of iontopheresis in one armpit; in the same moment the other armpit was injected with the toxin in the conventional way. The results where evaluated and compare by Minor Test (starch-iodine test in each patient at day 10th, 2 months and 5 months after the application. The same number of units and dilution of TXB-A where used in the topic and injected administration way. Results shows a diminished armpit HH in both sides over the whole study, been higher percentage of the effect in the injected way. In general a 74.67% decrease of armpit sweat for the topical way with iontopheresis and 90.33% of decrease of armpit sweat for the injected way. In the 5 months control of the persistency of the effect, both ways of administration of TXB-A reports with statistical significant results. Therefore in the present study we conclude that TXB-A apply topically with iontopheresis improves the armpit HH and shows a persistency of the effect at least for 5 months period.

  1. Botulinum A toxin utilizations in obstetric palsy

    Directory of Open Access Journals (Sweden)

    Atakan Aydin

    2012-12-01

    Conclusion: We conclude that with the help of botulinum A toxin and physyotherapy, obstetrical palsy patient with cocontractions can significantly improve movements and may have less surgery. [Hand Microsurg 2012; 1(3.000: 89-94

  2. Ultrasound-guided botulinum toxin injections

    OpenAIRE

    S. E. Khatkova; A. A. Balbert

    2016-01-01

    One of the key conditions for achieving the desirable result during botulinum toxin therapy for muscular dystonia, spasticity, and other diseases accompanied by spasm, pain, and autonomic dysfunction (dystonias, spasticity, etc.) is the proper administration of the agent into the muscles directly involved in the pathological process. The exact entry of botulinum toxin into the target muscles is essential for successful and safe treatment because its injection into a normal muscle may cause si...

  3. Botulinum toxin treatment of hemifacial spasm.

    OpenAIRE

    Elston, J S

    1986-01-01

    Six patients with hemifacial spasm were treated with injections of botulinum toxin A into the orbicularis oculi; the abnormal movements around the eye were relieved for an average of 15 weeks. There were no systemic or significant local side effects, and in view of the risks involved in neurosurgical treatment, a trial of botulinum toxin injections is recommended in the first instance in this condition.

  4. Botulinum toxin treatment of hemifacial spasm.

    Science.gov (United States)

    Elston, J S

    1986-01-01

    Six patients with hemifacial spasm were treated with injections of botulinum toxin A into the orbicularis oculi; the abnormal movements around the eye were relieved for an average of 15 weeks. There were no systemic or significant local side effects, and in view of the risks involved in neurosurgical treatment, a trial of botulinum toxin injections is recommended in the first instance in this condition. PMID:3746313

  5. Botulinum toxin in the management of sialorrhoea in acquired brain injury

    LENUS (Irish Health Repository)

    Carroll, A

    2016-06-01

    Sialorrhoea as a consequence of severe acquired brain injury can significantly negatively impact on quality of life. Medications used in its management have many side effects which can cause problems in the severely disabled. Botulinum toxin is an effective treatment of sialorrhoea in a number of neurological conditions but may also have a role to play in the management of sialorrhoea following severe ABI. We report on 4 cases of sialorrhoea following acquired brain injury causing a variety of problems, whose parotid glands were injected with Botulinum toxin type A (Dysport) 50mu each, under ultrasound guidance. All cases had a clinically and statistically significant reduction in drooling as measured by the teacher drooling scale (p=0.005) and carers Visual Analogue Scale (p=0.012). There were no side effects reported. Botulinum toxin is an effective treatment for sialorrhoea associated with acquired brain injury.

  6. An Overview on the Marine Neurotoxin, Saxitoxin: Genetics, Molecular Targets, Methods of Detection and Ecological Functions

    Directory of Open Access Journals (Sweden)

    Gary S. Sayler

    2013-03-01

    Full Text Available Marine neurotoxins are natural products produced by phytoplankton and select species of invertebrates and fish. These compounds interact with voltage-gated sodium, potassium and calcium channels and modulate the flux of these ions into various cell types. This review provides a summary of marine neurotoxins, including their structures, molecular targets and pharmacologies. Saxitoxin and its derivatives, collectively referred to as paralytic shellfish toxins (PSTs, are unique among neurotoxins in that they are found in both marine and freshwater environments by organisms inhabiting two kingdoms of life. Prokaryotic cyanobacteria are responsible for PST production in freshwater systems, while eukaryotic dinoflagellates are the main producers in marine waters. Bioaccumulation by filter-feeding bivalves and fish and subsequent transfer through the food web results in the potentially fatal human illnesses, paralytic shellfish poisoning and saxitoxin pufferfish poisoning. These illnesses are a result of saxitoxin’s ability to bind to the voltage-gated sodium channel, blocking the passage of nerve impulses and leading to death via respiratory paralysis. Recent advances in saxitoxin research are discussed, including the molecular biology of toxin synthesis, new protein targets, association with metal-binding motifs and methods of detection. The eco-evolutionary role(s PSTs may serve for phytoplankton species that produce them are also discussed.

  7. An overview on the marine neurotoxin, saxitoxin: genetics, molecular targets, methods of detection and ecological functions.

    Science.gov (United States)

    Cusick, Kathleen D; Sayler, Gary S

    2013-03-27

    Marine neurotoxins are natural products produced by phytoplankton and select species of invertebrates and fish. These compounds interact with voltage-gated sodium, potassium and calcium channels and modulate the flux of these ions into various cell types. This review provides a summary of marine neurotoxins, including their structures, molecular targets and pharmacologies. Saxitoxin and its derivatives, collectively referred to as paralytic shellfish toxins (PSTs), are unique among neurotoxins in that they are found in both marine and freshwater environments by organisms inhabiting two kingdoms of life. Prokaryotic cyanobacteria are responsible for PST production in freshwater systems, while eukaryotic dinoflagellates are the main producers in marine waters. Bioaccumulation by filter-feeding bivalves and fish and subsequent transfer through the food web results in the potentially fatal human illnesses, paralytic shellfish poisoning and saxitoxin pufferfish poisoning. These illnesses are a result of saxitoxin's ability to bind to the voltage-gated sodium channel, blocking the passage of nerve impulses and leading to death via respiratory paralysis. Recent advances in saxitoxin research are discussed, including the molecular biology of toxin synthesis, new protein targets, association with metal-binding motifs and methods of detection. The eco-evolutionary role(s) PSTs may serve for phytoplankton species that produce them are also discussed.

  8. Neurotoxins and their binding areas on voltage-gated sodium channels

    Directory of Open Access Journals (Sweden)

    Marijke eStevens

    2011-11-01

    Full Text Available Voltage-gated Sodium Channels (VGSCs are large transmembrane proteins that conduct sodium ions across the membrane and by doing so they generate signals of communication between many kinds of tissues. They are responsible for the generation and propagation of action potentials in excitable cells, in close collaboration with other channels like potassium channels. Genetic defects in sodium channel genes therefore can cause a wide variety of diseases, generally called ‘channelopathies’.The first insights into the mechanism of action potentials and the involvement of sodium channels originated from Hodgkin and Huxley for which they were awarded the Nobel Prize in 1963. Until now, these concepts still form the basis for understanding the functioning of VGSCs. When VGSCs sense a sufficient change in membrane potential, they are activated and will generate a massive influx of sodium ions. Immediately after, channels will start inactivating and currents decrease. In the inactivated state channels stay refractory for any new stimulus and they must return to the closed state before being susceptible to any new depolarization. On the other hand, studies with neurotoxins like tetrodotoxin (TTX and saxitoxin (STX also contributed largely to our today’s understanding of the structure and function of ion channels and specifically of VGSCs. Moreover, neurotoxins acting on ion channels turned out to be valuable tools in the development of new drugs for the enormous range of diseases in which ion channels are involved. A recent example of a synthetic neurotoxin that made it to the market is ziconotide (Prialt®, Elan. The original peptide, -MVIIA, is derived from the cone snail Conus magus and now FDA/EMEA-approved for the management of severe chronic pain by blocking the N-type voltage-gated calcium channels in neurons.This review focuses on the current status of research on neurotoxins acting on VGSC, their contribution to further unravel the

  9. Botulinum toxin for the treatment of bruxism.

    Science.gov (United States)

    Tinastepe, Neslihan; Küçük, Burcu Bal; Oral, Koray

    2015-10-01

    Botulinum toxin, the most potent biological toxin, has been shown to be effective for a variety of disorders in several medical conditions, when used both therapeutically and cosmetically. In recent years, there has been a rising trend in the use of this pharmacological agent to control bruxing activity, despite its reported adverse effects. The aim of this review was to provide a brief overview to clarify the underlying essential ideas for the use of botulinum toxin in bruxism based on available scientific papers. An electronic literature search was performed to identify publications related to botulinum toxin and its use for bruxism in PubMed. Hand searching of relevant articles was also made to identify additional studies. Of the eleven identified studies, only two were randomized controlled trials, compared with the effectiveness of botulinum toxins on the reduction in the frequency of bruxism events and myofascial pain after injection. The authors of these studies concluded that botulinum toxin could be used as an effective treatment for reducing nocturnal bruxism and myofascial pain in patients with bruxism. Evidence-based research was limited on this topic. More randomized controlled studies are needed to confirm that botulinum toxin is safe and reliable for routine clinical use in bruxism.

  10. Adenovirus F protein as a delivery vehicle for botulinum B

    Directory of Open Access Journals (Sweden)

    Staats Herman F

    2010-07-01

    Full Text Available Abstract Background Immunization with recombinant carboxyl-terminal domain of the heavy chain (Hc domain of botulinum neurotoxin (BoNT stimulates protective immunity against native BoNT challenge. Most studies developing a botulism vaccine have focused on the whole Hc; however, since the principal protective epitopes are located within β-trefoil domain (Hcβtre, we hypothesize that immunization with the Hcβtre domain is sufficient to confer protective immunity. In addition, enhancing its uptake subsequent to nasal delivery prompted development of an alternative vaccine strategy, and we hypothesize that the addition of targeting moiety adenovirus 2 fiber protein (Ad2F may enhance such uptake during vaccination. Results The Hcβtre serotype B immunogen was genetically fused to Ad2F (Hcβtre/B-Ad2F, and its immunogenicity was tested in mice. In combination with the mucosal adjuvant, cholera toxin (CT, enhanced mucosal IgA and serum IgG Ab titers were induced by nasal Hcβtre-Ad2F relative to Hcβtre alone; however, similar Ab titers were obtained upon intramuscular immunization. These BoNT/B-specific Abs induced by nasal immunization were generally supported in large part by Th2 cells, as opposed to Hcβtre-immunized mice that showed more mixed Th1 and Th2 cells. Using a mouse neutralization assay, sera from animals immunized with Hcβtre and Hcβtre-Ad2F protected mice against 2.0 LD50. Conclusion These results demonstrate that Hcβtre-based immunogens are highly immunogenic, especially when genetically fused to Ad2F, and Ad2F can be exploited as a vaccine delivery platform to the mucosa.

  11. Beyond Beauty : Botulinum Toxin Use in Anal Fissure

    National Research Council Canada - National Science Library

    Mehrotra, S

    2009-01-01

    .... In this scenario chemical sphincterotomy using Botulinum toxin offers an alternative modality. A total of 30 patients of chronic fissure in ano were treated with Botulinum toxin injection in the internal sphincter...

  12. No clinical or neurophysiological evidence of botulinum toxin diffusion to non-injected muscles in patients with hemifacial spasm.

    Science.gov (United States)

    Lorenzano, C; Bagnato, S; Gilio, F; Fabbrini, G; Berardelli, A

    2006-04-01

    Botulinum toxin injected into a muscle may diffuse to nearby muscles thus producing unwanted effects. In patients with hemifacial spasm, we evaluated clinically and neurophysiologically, whether botulinum toxin type A (BoNT-A) diffuses from the injection site (orbicularis oculi) to untreated muscles (orbicularis oris from the affected side and orbicularis oculi and oris from the unaffected side). We studied 38 patients with idiopathic hemifacial spasm. Botulinum toxin was injected into the affected orbicularis oculi muscle alone (at 3 standardized sites) at a clinically effective dose. Patients were studied before (T0) and 3-4 weeks after treatment (T1). We evaluated the clinical effects of botulinum toxin and muscle strength in the affected and unaffected muscles. We also assessed the peak-to-peak amplitude compound muscle action potential (CMAP) recorded from the orbicularis oculi and orbicularis oris muscles on both sides after supramaximal electrical stimulation of the facial nerve at the stylomastoid foramen. In all patients, botulinum toxin treatment reduced muscle spasms in the injected orbicularis oculi muscle and induced no muscle weakness in the other facial muscles. The CMAP amplitude significantly decreased in the injected orbicularis oculi muscle, but remained unchanged in the other facial muscles (orbicularis oris muscle on the affected side and contra-lateral unaffected muscles). In conclusion, in patients with hemifacial spasm, botulinum toxin, at a clinically effective dose, induces no clinical signs of diffusion and does not reduce the CMAP size in the nearby untreated orbicularis oris or contralateral facial muscles.

  13. Botulinum therapy for poststroke spasticity of the lower extremity (clinical cases

    Directory of Open Access Journals (Sweden)

    L. V. Krylova

    2014-01-01

    Full Text Available The paper deals with the topical problem – the medical rehabilitation of patients with poststroke spasticity. It describes clinical cases of patients with poststroke spasticity of the upper and lower extremities who have received combined therapy using botulinum toxin type A (Botox injections.

  14. Thickened Saliva after Effective Management of Drooling with Botulinum Toxin A

    Science.gov (United States)

    Erasmus, Corrie E.; van Hulst, Karen; van den Hoogen, Frank J. A.; van Limbeek, Jacques; Roeleveld, Nel; Veerman, Enno C. I.; Rotteveel, Jan J.; Jongerius, Peter H.

    2010-01-01

    Aim: The aim of this study was to evaluate the rheological properties of saliva after submandibular botulinum toxin type A (BoNT-A) injections. Method: We enrolled 15 children (11 males and six females; age range 3-17y, mean age 9y 10mo) diagnosed with spastic (n=9) or dyskinetic (n=6) quadriplegic cerebral palsy (CP); Gross Motor Function…

  15. Thickened saliva after effective management of drooling with botulinum toxin A.

    NARCIS (Netherlands)

    Erasmus, C.E.; Hulst, K. van; Hoogen, F.J.A. van den; Limbeek, J. van; Roeleveld, N.; Veerman, E.C.; Rotteveel, J.J.; Jongerius, P.H.

    2010-01-01

    AIM: The aim of this study was to evaluate the rheological properties of saliva after submandibular botulinum toxin type A (BoNT-A) injections. METHOD: We enrolled 15 children (11 males and six females; age range 3-17 y, mean age 9 y 10 mo) diagnosed with spastic (n=9) or dyskinetic (n=6)

  16. Thickened saliva after effective management of drooling with botulinum toxin A

    NARCIS (Netherlands)

    Erasmus, C.E.; van Hulst, K.; van den Hoogen, F.J.; van Limbeek, J.; Roeleveld, N.; Veerman, E.C.I.; Rotteveel, J.J.; Jongerius, P.H.

    2010-01-01

    Aim: The aim of this study was to evaluate the rheological properties of saliva after submandibular botulinum toxin type A (BoNT-A) injections. Method: We enrolled 15 children (11 males and six females; age range 3-17y, mean age 9y 10mo) diagnosed with spastic (n=9) or dyskinetic (n=6) quadriplegic

  17. Identification of novel linear megaplasmids carrying a ß-lactamase gene in neurotoxigenic Clostridium butyricum type E strains.

    Directory of Open Access Journals (Sweden)

    Giovanna Franciosa

    Full Text Available Since the first isolation of type E botulinum toxin-producing Clostridium butyricum from two infant botulism cases in Italy in 1984, this peculiar microorganism has been implicated in different forms of botulism worldwide. By applying particular pulsed-field gel electrophoresis run conditions, we were able to show for the first time that ten neurotoxigenic C. butyricum type E strains originated from Italy and China have linear megaplasmids in their genomes. At least four different megaplasmid sizes were identified among the ten neurotoxigenic C. butyricum type E strains. Each isolate displayed a single sized megaplasmid that was shown to possess a linear structure by ATP-dependent exonuclease digestion. Some of the neurotoxigenic C. butyricum type E strains possessed additional smaller circular plasmids. In order to investigate the genetic content of the newly identified megaplasmids, selected gene probes were designed and used in Southern hybridization experiments. Our results revealed that the type E botulinum neurotoxin gene was chromosome-located in all neurotoxigenic C. butyricum type E strains. Similar results were obtained with the 16S rRNA, the tetracycline tet(P and the lincomycin resistance protein lmrB gene probes. A specific mobA gene probe only hybridized to the smaller plasmids of the Italian C. butyricum type E strains. Of note, a ß-lactamase gene probe hybridized to the megaplasmids of eight neurotoxigenic C. butyricum type E strains, of which seven from clinical sources and the remaining one from a food implicated in foodborne botulism, whereas this ß-lactam antibiotic resistance gene was absent form the megaplasmids of the two soil strains examined. The widespread occurrence among C. butyricum type E strains associated to human disease of linear megaplasmids harboring an antibiotic resistance gene strongly suggests that the megaplasmids could have played an important role in the emergence of C. butyricum type E as a human

  18. Quinolinic Acid: Neurotoxin or Oxidative Stress Modulator?

    Directory of Open Access Journals (Sweden)

    Lenka Kubicova

    2013-10-01

    Full Text Available Quinolinic acid (2,3-pyridinedicarboxylic acid, QUIN is a well-known neurotoxin. Consequently, QUIN could produce reactive oxygen species (ROS. ROS are generated in reactions catalyzed by transition metals, especially iron (Fe. QUIN can form coordination complexes with iron. A combination of differential pulse voltammetry, deoxyribose degradation and Fe(II autoxidation assays was used for explorating ROS formation in redox reactions that are catalyzed by iron in QUIN-Fe complexes. Differential pulse voltammetry showed an anodic shift of the iron redox potential if iron was liganded by QUIN. In the H2O2/FeCl3/ascorbic acid variant of the deoxyribose degradation assay, the dose-response curve was U-shaped. In the FeCl3/ascorbic acid variant, QUIN unambiguously showed antioxidant effects. In the Fe(II autoxidation assay, QUIN decreased the rate of ROS production caused by Fe(II oxidation. Our study confirms that QUIN toxicity may be caused by ROS generation via the Fenton reaction. This, however, applies only for unnaturally high concentrations that were used in attempts to provide support for the neurotoxic effect. In lower concentrations, we show that by liganding iron, QUIN affects the Fe(II/Fe(III ratios that are beneficial to homeostasis. Our results support the notion that redox chemistry can contribute to explaining the hormetic dose-response effects.

  19. Use of Botulinum toxin in 55 children with cerebral palsy

    Directory of Open Access Journals (Sweden)

    Mohammadi M

    2000-10-01

    Full Text Available Botulinum toxin A (BTA inhibits presynaptic release of acetylcholine at the neuromuscular junction and has reportedly been successful in the treatment of spastic disorders.To evaluate the effect of botulinum toxin on cerebral palsied children with spastic or mixed type of the disease, especially those patiens having spasticity as a cardinal symptom without joint contracture, we designed the following study. Ninety-one cases (55 of referred patients to pediatic Neurology outpatient clinics of children’s Medical Center were given BTA injections in affected muscles of the lower limb. They were reevaluating 3 to 5 weeks and 3 months later for type of walking and range of affected joints’ movement. The study showed a clinically significant gait improvement in 71.2% of patients (P<0.0005 and also an overall increased range of motion in affected limbs after BTA injection (P<0.04. Side effects occurred only in two cases as transient generalized weakness, gent recurvatum and ptosis. Drug effectiveness was time-limited, lasting abot 3 months in all patients ( a golden time for rehabilitation therapists to improve the patients’ condition. Overall, BTA has improved both the type of walking as well as the range of joints motion in our patients. So its’ administration is suggested in cerebral palsied children if the spasticity is a major and disabling sign

  20. Safety and pharmacokinetics of XOMA 3AB, a novel mixture of three monoclonal antibodies against botulinum toxin A.

    Science.gov (United States)

    Nayak, S U; Griffiss, J M; McKenzie, R; Fuchs, E J; Jurao, R A; An, A T; Ahene, A; Tomic, M; Hendrix, C W; Zenilman, J M

    2014-09-01

    Botulinum neurotoxin A is a category A bioterrorism agent. Current antitoxin therapies are scarce and produce adverse reactions. XOMA 3AB consists of 3 IgG1 monoclonal antibodies (MAbs), each with a distinct human or humanized variable region, which bind to distinct epitopes on botulinum neurotoxin serotype A. This first-in-human study evaluated the safety and pharmacokinetics (PK) of escalating doses of XOMA 3AB administered intravenously (i.v.) to healthy adults. In this double-blind placebo-controlled dose escalation study, 3 cohorts of 8 healthy subjects received a single intravenous dose of XOMA 3AB or placebo at a 3:1 ratio. Follow-up examinations included physical examinations, hematology and chemistry blood tests, electrocardiograms, and pharmacokinetics. Pharmacokinetic parameters were estimated using noncompartmental methods. There were no infusion discontinuations or hypersensitivity reactions. Two or more subjects experienced headache, hyperglycemia, or anemia; none was dose related. All adverse events (AEs) were mild to moderate except for an episode of exercise-induced elevation of a subject's creatine phosphokinase (CPK) level, unrelated to XOMA 3AB. Concentration-time plots demonstrated a peak in MAb concentrations 1 to 2 h after completion of the infusion, after which the levels declined in a biexponential decay pattern for all analytes. For each MAb, the maximum concentration of drug in serum (Cmax) and the area under the concentration-time curve from 0 to infinity (AUCinf) increased as the dose increased. Clearance of the humanized mouse MAb was more rapid than that of the two fully human MAbs, particularly at the lowest dose. None of the MAbs was immunogenic. At the doses administered, XOMA 3AB was well tolerated. These safety findings support further investigation of XOMA 3AB as a potential agent for botulism treatment and postexposure prophylaxis. (This study has been registered at ClinicalTrials.gov under registration no. NCT01357213