WorldWideScience

Sample records for bone sarcoma part

  1. Bone sarcomas

    International Nuclear Information System (INIS)

    Mudry, P.

    2008-01-01

    Bone sarcomas are malignancies with peak incidence in adolescents and young adults. The most frequent are osteosarcoma and Ewing sarcoma/PNET, in an older adults are seen chondrosarcomas, other ones are rare. In general, biology of sarcomas is closely related to pediatric malignancies with fast growth, local aggressiveness, tendency to early hematogenic dissemination and chemo sensitivity. Diagnostics and treatment of bone sarcomas should be done in well experienced centres due to low incidence and broad issue of this topic. An interdisciplinary approach and staff education is essential in due care of patients with bone sarcoma. If these criteria are achieved, the cure rate is contemporary at 65 - 70 %, while some subpopulation of patients has chance for cure up to 90 %. Osteosarcoma and Ewing sarcoma/PNET are discussed below as types of most frequent bone sarcoma. (author)

  2. [Imaging diagnostics of bone sarcomas].

    Science.gov (United States)

    Krämer, J A; Gübitz, R; Beck, L; Heindel, W; Vieth, V

    2014-06-01

    Bone tumors and especially bone sarcomas are rare lesions of the skeletal system in comparison to the much more frequently occurring bone metastases. Despite the relative rarity they are important differential diagnoses of bone lesions. The aim of this article is to give the reader an insight into the fundamentals of the primary imaging of bone sarcomas and to illustrate this with the help of two examples (e.g. osteosarcoma and chondrosarcoma). The foundation of the imaging of bone sarcomas is the radiograph in two planes. This method delivers important information on bone tumors. This information should be analyzed with the help of the Lodwick classification, the configuration of periosteal reactions and a possible reaction of the cortex. A possible tumor matrix and the localization within the skeleton or within long bones also provide important information for differential diagnostic delimitation. Magnetic resonance imaging (MRI) with specific adapted bone tumor sequences allows an exact local staging of a bone sarcoma. In addition to local imaging a compartmental MRI which illustrates the entire extent of tumor-bearing bone and the adjacent joints should be performed to rule out possible skip lesions. The most common distant metastases of osteosarcoma and chondrosarcoma occur in the lungs; therefore, a computed tomography (CT) of the chest is part of staging. Other imaging methods, such as CT of the tumor, positron emission tomography CT (PET-CT), bone scan and whole body MRI supplement the imaging depending on tumor type.

  3. Primary clear cell sarcoma of bone

    International Nuclear Information System (INIS)

    Choi, J.H.; Gu, M.J.; Kim, M.J.; Bae, Y.K.; Choi, W.H.; Shin, D.S.; Cho, K.H.

    2003-01-01

    Clear cell sarcoma is a rare soft tissue sarcoma of young adults with melanocytic differentiation. It occurs predominantly in the soft tissue of extremities, typically involving tendons and aponeuroses. Primary clear cell sarcoma of bone is extremely rare. We report a case of primary clear cell sarcoma of the right first metatarsal in a 48-year-old woman and provide a literature review of the entity. (orig.)

  4. Current Molecular Targeted Therapies for Bone and Soft Tissue Sarcomas

    Directory of Open Access Journals (Sweden)

    Kenji Nakano

    2018-03-01

    Full Text Available Systemic treatment options for bone and soft tissue sarcomas remained unchanged until the 2000s. These cancers presented challenges in new drug development partly because of their rarity and heterogeneity. Many new molecular targeting drugs have been tried in the 2010s, and some were approved for bone and soft tissue sarcoma. As one of the first molecular targeted drugs approved for solid malignant tumors, imatinib’s approval as a treatment for gastrointestinal stromal tumors (GISTs has been a great achievement. Following imatinib, other tyrosine kinase inhibitors (TKIs have been approved for GISTs such as sunitinib and regorafenib, and pazopanib was approved for non-GIST soft tissue sarcomas. Olaratumab, the monoclonal antibody that targets platelet-derived growth factor receptor (PDGFR-α, was shown to extend the overall survival of soft tissue sarcoma patients and was approved in 2016 in the U.S. as a breakthrough therapy. For bone tumors, new drugs are limited to denosumab, a receptor activator of nuclear factor κB ligand (RANKL inhibitor, for treating giant cell tumors of bone. In this review, we explain and summarize the current molecular targeting therapies approved and in development for bone and soft tissue sarcomas.

  5. BONE TUMOR ENVIRONMENT AS POTENTIAL THERAPEUTIC TARGET IN EWING SARCOMA

    Directory of Open Access Journals (Sweden)

    Françoise eREDINI

    2015-12-01

    Full Text Available Ewing sarcoma is the second most common pediatric bone tumor, with three cases per million worldwide. In clinical terms, ES is an aggressive, rapidly fatal malignancy that mainly develops in osseous sites (85%, but also in extraskeletal soft tissue. It spreads naturally to the lungs, bones and bone marrow with poor prognosis in the two latter cases. Bone lesions from primary or secondary (metastases tumors are characterized by extensive bone remodeling, more often due to osteolysis. Osteoclast activation and subsequent bone resorption is responsible for the clinical features of bone tumors including pain, vertebral collapse and spinal cord compression. Based on the vicious cycle concept of tumor cells and bone resorbing cells, drugs which target osteoclasts may be promising agents as adjuvant setting for treating bone tumors, including Ewing sarcoma. There is also increasing evidence that cellular and molecular protagonists present in the bone microenvironment play a part in establishing a favorable niche for tumor initiation and progression. The purpose of this review is to discuss the potential therapeutic value of drugs targeting the bone tumor microenvironment in Ewing Sarcoma. The first part of the review will focus on targeting the bone resorbing function of osteoclasts by means of bisphosphonates (BPs or drugs blocking the pro-resorbing cytokine Receptor Activator of NF-kappa B Ligand (RANKL. Second, the role of this peculiar hypoxic microenvironment will be discussed in the context of resistance to chemotherapy, escape from the immune system, or neo-angiogenesis. Therapeutic interventions based on these specificities could be then proposed in the context of Ewing sarcoma.

  6. Sarcomas of Soft Tissue and Bone.

    Science.gov (United States)

    Ferrari, Andrea; Dirksen, Uta; Bielack, Stefan

    2016-01-01

    The definition of soft tissue and bone sarcomas include a large group of several heterogeneous subtypes of mesenchymal origin that may occur at any age. Among the different sarcomas, rhabdomyosarcoma, synovial sarcoma, Ewing sarcoma and osteosarcoma are aggressive high-grade malignancies that often arise in adolescents and young adults. Managing these malignancies in patients in this age bracket poses various clinical problems, also because different therapeutic approaches are sometimes adopted by pediatric and adult oncologists, even though they are dealing with the same condition. Cooperation between pediatric oncologists and adult medical oncologists is a key step in order to assure the best treatment to these patients, preferably through their inclusion into international clinical trials. © 2016 S. Karger AG, Basel.

  7. Radiation induced sarcomas of bone following therapeutic radiation

    International Nuclear Information System (INIS)

    Kim, J.H.; Chu, F.C.H.; Woodward, H.Q.; Huvos, A.

    1983-01-01

    Because of new therapeutic trends of multi-modality and the importance of late effects, we have updated our series of radiation induced bone sarcomas seen at Memorial Sloan-Kettering Cancer Center over the past four decades. A total of 37 cases of bone sarcoma arising from normal bone in the irradiated field was analyzed. The median for latent period from irradiation to diagnosis of bone sarcoma was 11 years with a minimum latent period of four years. The median radiation dose for the bone sarcoma was 6000 rad in 6 weeks with a minimum total radiation dose of 3000 rad in 3 weeks. We have found nine patients who developed bone sarcomas in the radiation field after successful treatment of Hodgkin's disease. Criteria for radiation induced bone sarcomas and the magnitude of the risk of bone sarcomas are briefly discussed

  8. Immunotherapy for Bone and Soft Tissue Sarcomas

    Directory of Open Access Journals (Sweden)

    Takenori Uehara

    2015-01-01

    Full Text Available Although multimodal therapies including surgery, chemotherapy, and radiotherapy have improved clinical outcomes of patients with bone and soft tissue sarcomas, the prognosis of patients has plateaued over these 20 years. Immunotherapies have shown the effectiveness for several types of advanced tumors. Immunotherapies, such as cytokine therapies, vaccinations, and adoptive cell transfers, have also been investigated for bone and soft tissue sarcomas. Cytokine therapies with interleukin-2 or interferons have limited efficacy because of their cytotoxicities. Liposomal muramyl tripeptide phosphatidylethanolamine (L-MTP-PE, an activator of the innate immune system, has been approved as adjuvant therapeutics in combination with conventional chemotherapy in Europe, which has improved the 5-year overall survival of patients. Vaccinations and transfer of T cells transduced to express chimeric antigen receptors have shown some efficacy for sarcomas. Ipilimumab and nivolumab are monoclonal antibodies designed to inhibit immune checkpoint mechanisms. These antibodies have recently been shown to be effective for patients with melanoma and also investigated for patients with sarcomas. In this review, we provide an overview of various trials of immunotherapies for bone and soft tissue sarcomas, and discuss their potential as adjuvant therapies in combination with conventional therapies.

  9. Postradiation sarcoma of bone in Hodgkin disease

    International Nuclear Information System (INIS)

    Smith, J.

    1987-01-01

    We report 16 cases seen in the Memorial Sloan-Kettering Cancer Center (MSKCC) during the past 50 years. These patients had been treated with external radiation for Hodgkin disease and had developed sarcomas in the field 4-31 years after the diagnosis of Hodgkin disease. Most of the tumors (12 of 16) occurred in the chest wall. There were three tumors of the pelvis and an unusual osteosarcoma of the femur following treatment for a primary Hodgkin disease of the femur. The tumors were predominantly osteosarcomas. In addition, there were five malignant fibrous histiocytomas, one fibrosarcoma, and one chondrosarcoma. Prognosis was poor; the mean survival was 12 months. Survival of patients with other primary cancers who developed radiation sarcomas was not significantly different from that of patients with Hodgkin disease. Hodgkin disease is now the most common tumor among radiation-induced sarcomas in previously normal bone and has surpassed breast cancer, which was previously the most common original tumor. (orig.)

  10. Radiation-induced soft-tissue and bone sarcoma

    International Nuclear Information System (INIS)

    Kim, J.H.; Chu, F.C.; Woodard, H.Q.; Melamed, R.; Huvos, A.; Cantin, J.

    1978-01-01

    From the records of Memorial Hospital of the past 50 years, 47 cases with an established diagnosis of radiation-induced sarcoma were identified and divided into two groups: the first included 20 cases of soft-tissue sarcoma arising from irradiated tissues, and the second comprised 27 cases of bone sarcoma arising from normal bones in the irradiated field. Medians for the latent periods from irradiation to diagnosis of bone and soft-tissue sarcoma were 11 and 12, years, respectively. In bone sarcomas, the latent period was longer after larger radiation doses and children appeared to be more susceptible to cancer induction than adults. Criteria for establishing the diagnosis of radiation-induced sarcoma and the magnitude of the risk of bone sarcoma are discussed

  11. Complex treatment of localized bone marrow sarcoma in children

    International Nuclear Information System (INIS)

    Kolygin, B.A.; Punanov, Yu.A.; Malinin, A.P.; Safonova, S.A.

    1997-01-01

    The retrospective analysis included the results of the treatment of 67 children suffering from localized sarcomas of bone (Ewing's sarcoma, lymphosarcoma). The advantage was demonstrated in patients, received combination of chemotherapy and radiotherapy on the involved bone. The resection of the primary tumor in combination with radio-chemotherapy improves the 10-year survival

  12. Postradiation sarcoma of bone: review of 78 Mayo Clinic cases

    Energy Technology Data Exchange (ETDEWEB)

    Weatherby, R.P.; Dahlin, D.C.; Ivins, J.C.

    1981-05-01

    Postradiation sarcoma of bone is an uncommon but serious sequela of radiation therapy. Seventy-eight Mayo Clinic patients have been treated for sarcomas arising in irradiated bones. They received their initial radiotherapy for a wide variety of nonneoplastic and neoplastic conditions, both benign and malignant. Thirty-five sarcomas arose in bone that was normal at the time of radiotherapy, and 43 arose in irradiated preexisting osseous lesions. The latent period between radiotherapy and diagnosis of sarcoma averaged 14.3 years. Ninety percent of the postradiation sarcomas were either osteosarcomas or fibrosarcomas; chondrosarcoma, malignant (fibrous) histiocytoma, malignant lymphoma, Ewing's tumor, and metastasizing chondroblastoma also occurred. Prompt radical surgery, when feasible, is usually the treatment of choice for the sarcoma. About 30% of patients with sarcomas of the extremities or craniofacial bones survived 5 years without recurrence; there were no disease-free survivors among patients with tumors of the vertebral column, pelvis, or shoulder girdle. The low risk of sarcoma following radiotherapy for the treatment of cancer should not be a contraindication to its use in these patients; however, radiation therapy for benign bone tumors should be reserved for lesions that are not amenable to surgical treatment. An unusual case is also reported herein in which a fibrosarcoma was discovered in the humerus of a patient who had received radiotherapy 55 years previously for a verified osteosarcoma in the same site.

  13. Postradiation sarcoma of bone: review of 78 Mayo Clinic cases

    International Nuclear Information System (INIS)

    Weatherby, R.P.; Dahlin, D.C.; Ivins, J.C.

    1981-01-01

    Postradiation sarcoma of bone is an uncommon but serious sequela of radiation therapy. Seventy-eight Mayo Clinic patients have been treated for sarcomas arising in irradiated bones. They received their initial radiotherapy for a wide variety of nonneoplastic and neoplastic conditions, both benign and malignant. Thirty-five sarcomas arose in bone that was normal at the time of radiotherapy, and 43 arose in irradiated preexisting osseous lesions. The latent period between radiotherapy and diagnosis of sarcoma averaged 14.3 years. Ninety percent of the postradiation sarcomas were either osteosarcomas or fibrosarcomas; chondrosarcoma, malignant (fibrous) histiocytoma, malignant lymphoma, Ewing's tumor, and metastasizing chondroblastoma also occurred. Prompt radical surgery, when feasible, is usually the treatment of choice for the sarcoma. About 30% of patients with sarcomas of the extremities or craniofacial bones survived 5 years without recurrence; there were no disease-free survivors among patients with tumors of the vertebral column, pelvis, or shoulder girdle. The low risk of sarcoma following radiotherapy for the treatment of cancer should not be a contraindication to its use in these patients; however, radiation therapy for benign bone tumors should be reserved for lesions that are not amenable to surgical treatment. An unusual case is also reported herein in which a fibrosarcoma was discovered in the humerus of a patient who had received radiotherapy 55 years previously for a verified osteosarcoma in the same site

  14. The Prognostic Value of Serum Biomarkers in Localized Bone Sarcoma

    DEFF Research Database (Denmark)

    Aggerholm-Pedersen, Ninna; Maretty-Kongstad, Katja; Keller, Johnny

    2016-01-01

    OBJECTIVE: Certain biomarkers such as the C-reactive protein, serum albumin, and the neutrophils to lymphocyte ratio are of prognostic significance regarding survival in different types of cancers. Data from sarcoma patients are sparse and mainly derived from soft tissue sarcoma and/or metastatic...... cases. Adjusting for confounders such as comorbidity and age is an essential safeguard against erroneous conclusions regarding the possible prognostic value of these biomarkers. The aim of this study was to assess the prognostic value of a battery of pretreatment biomarkers in the serum of patients...... with localized bone sarcomas and to adjust for potential confounders. MATERIAL AND METHODS: All patients diagnosed with localized intermediate and high-grade bone sarcoma during 1994 to 2008 were extracted from the Aarhus Sarcoma Registry. The serum levels of albumin, C-reactive protein, hemoglobin, neutrophils...

  15. Primary clear cell sarcoma of bone: a unique site of origin

    International Nuclear Information System (INIS)

    Gelczer, R.K.; Wenger, D.E.; Wold, L.E.

    1999-01-01

    Clear cell sarcoma is a rare soft tissue neoplasm, accounting for less than 1% of soft tissue sarcomas. We are presenting a case of a clear cell sarcoma of bone which, to our knowledge, is the only report of a primary clear cell sarcoma of bone. (orig.)

  16. Case report 501: Alveolar soft parts sarcoma with pulmonary metastases

    International Nuclear Information System (INIS)

    Munk, P.L.; Connell, D.G.; Mueller, N.L.; Lentle, B.C.

    1988-01-01

    Alveolar soft part sarcoma (ASPS) is a rare, soft tissue malignancy, usually presenting in young adults. We report a patient with ASPS in the thigh, evaluated with plain films, computed tomography, and a radionuclide scan. The findings in this patient and those in which CT findings have been reported in the literature, show a similar appearance which we believe is highly suggestive of this unusual tumor. The combination of a soft tissue lesion, that on CT appears highly vascular, with features suggestive of an arteriovenous malformation, in association with multiple pulmonary nodules and a bone scan with features suggestive of infection should lead to a consideration of this rare entity. (orig./GDG)

  17. Alveolar soft part sarcoma: A rare diagnosis

    Directory of Open Access Journals (Sweden)

    Priyanka Sarkar

    2013-01-01

    Full Text Available Alveolar soft-part sarcoma (ASPS is an extremely rare disease arising from connective tissues with a propensity for recurrence and metastasis. Clinically, it can be confused with hemangioma or arterio-venous malformations. Thus, a high index of suspicion and histopathological examination are required to make a definitive diagnosis. We report a case of recurrent ASPS in a young female with multiple sites involvement without any features of metastasis who has been treated with excision of the symptomatic lesions followed by chemotherapy.

  18. Ewing sarcoma

    Science.gov (United States)

    Bone cancer - Ewing sarcoma; Ewing family of tumors; Primitive neuroectodermal tumors (PNET); Bone neoplasm - Ewing sarcoma ... Ewing sarcoma can occur anytime during childhood and young adulthood. But it usually develops during puberty, when bones are ...

  19. Occupational factors and risk of adult bone sarcomas

    DEFF Research Database (Denmark)

    Merletti, Franco; Richiardi, Lorenzo; Bertoni, Franco

    2006-01-01

    . Response proportions were 90% among cases and 66% among controls. Odds ratios (OR) and 95% confidence intervals (CI) were estimated for selected categories of job titles and branches of industry and for use of pesticides. We found an increased OR for bone sarcoma among blacksmiths, toolmakers, machine-tool...

  20. Dose-response relationships for radium-induced bone sarcomas

    International Nuclear Information System (INIS)

    Rowland, R.E.; Stehney, A.F.; Lucas, H.F. Jr.

    1981-01-01

    The incidence of bone sarcomas among 3055 female radium-dial workers who entered the dial industry before 1950 was used to determine dose-response relationships for the induction of bone sarcomas by radium. Two subpopulations were analyzed: all measured cases who survived at last five years after the start of employment and all cases who survived at least two years after first measurement. The first constituted a group based on year of entry; it contained 1468 women who experienced 42 bone sarcomas; the expected number was 0.4. The second comprised a group based on first measurement; it contained 1257 women who experienced 13 bone sarcomas; the expected number was 0.2. The dose-response function, I = (C + αD + #betta#D 2 )e/sup -#betta#D/, and simplifications of this general form, were fit to each data set. Two functions, I = (C + αD + #betta#D 2 )e/sup -#betta#D/ and I = (C + #betta#D 2 )e/sup -#betta#D/, fit the data for year of entry (p greater than or equal to 0.05); both these functions and I = (C + αD) fit the data for first measurement. The function I = (C + #betta#D 2 )e/sup -#betta#D/ was used to predict the number of bone sarcomas in all other pre-1950 radium cases (medical, laboratory, and other exposure); fewer were actually observed than the fit of this function to the female dial workers predicted

  1. Uterine sarcoma part III—Targeted therapy: The Taiwan Association of Gynecology (TAG systematic review

    Directory of Open Access Journals (Sweden)

    Ming-Shyen Yen

    2016-10-01

    Full Text Available Uterine sarcoma is a very aggressive and highly lethal disease. Even after a comprehensive staging surgery or en block cytoreduction surgery followed by multimodality therapy (often chemotherapy and/or radiation therapy, many patients relapse or present with distant metastases, and finally die of diseases. The worst outcome of uterine sarcomas is partly because of their rarity, unknown etiology, and highly divergent genetic aberration. Uterine sarcomas are often classified into four distinct subtypes, including uterine leiomyosarcoma, low-grade uterine endometrial stromal sarcoma, high-grade uterine endometrial stromal sarcoma, and undifferentiated uterine sarcoma. Currently, evidence from tumor biology found that these tumors showed alternation and/or mutation of genomes and the intracellular signal pathway. In addition, some preclinical studies showed promising results for targeting receptor tyrosine kinase signaling, phosphatidylinositol 3-kinase/AKT/mammalian target of rapamycin pathway, various kinds of growth factor pathways, Wnt/beta-catenin signaling pathway, transforming growth factor β/bone morphogenetic protein signal pathway, aurora kinase A, MDM2 proto-oncogene, histone deacetylases, sex hormone receptors, certain types of oncoproteins, and/or loss of tumor suppressor genes. The current review is attempted to summarize the recurrent advance of targeted therapy for uterine sarcomas.

  2. Advances in the Treatment of Pediatric Bone Sarcomas.

    Science.gov (United States)

    Grohar, Patrick J; Janeway, Katherine A; Mase, Luke D; Schiffman, Joshua D

    2017-01-01

    Bone tumors make up a significant portion of noncentral nervous system solid tumor diagnoses in pediatric oncology patients. Ewing sarcoma and osteosarcoma, both with distinct clinical and pathologic features, are the two most commonly encountered bone cancers in pediatrics. Although mutations in the germline have classically been more associated with osteosarcoma, there is recent evidence germline alterations in patients with Ewing sarcoma also play a significant role in pathogenesis. Treatment advances in this patient population have lagged behind that of other pediatric malignancies, particularly targeted interventions directed at the biologic underpinnings of disease. Recent advances in biologic and genomic understanding of these two cancers has expanded the potential for therapeutic advancement and prevention. In Ewing sarcoma, directed focus on inhibition of EWSR1-FLI1 and its effectors has produced promising results. In osteosarcoma, instead of a concentrated focus on one particular change, largely due to tumor heterogeneity, a more diversified approach has been adopted including investigations of growth factors inhibitors, signaling pathway inhibitors, and immune modulation. Continuing recently made treatment advances relies on clinical trial design and enrollment. Clinical trials should include incorporation of biological findings; specifically, for Ewing sarcoma, assessment of alternative fusions and, for osteosarcoma, stratification utilizing biomarkers. Expanded cancer genomics knowledge, particularly with solid tumors, as it relates to heritability and incorporation of family history has led to early identification of patients with cancer predisposition. In these patients through application of cost-effective evidence-based screening techniques the ultimate goal of cancer prevention is becoming a realization.

  3. The multidisciplinary management of bone and soft tissue sarcoma: an essential organizational framework

    Science.gov (United States)

    Siegel, Geoffrey W; Biermann, J Sybil; Chugh, Rashmi; Jacobson, Jon A; Lucas, David; Feng, Mary; Chang, Andrew C; Smith, Sean R; Wong, Sandra L; Hasen, Jill

    2015-01-01

    The rarity of bone and soft tissue sarcoma, the difficulty in interpretation of imaging and histology, the plethora of treatment modalities, and the complexity and intensity of the treatment contribute to the need for systematic multidisciplinary team management of patients with these diseases. An integrated multidisciplinary clinic and team with a structured sarcoma tumor board facilitate team coordination and communication. This paper reviews the rationale for multidisciplinary management of sarcoma and details the operational structure of the Multidisciplinary Sarcoma Clinic and Sarcoma Tumor Board. The structured Multidisciplinary Sarcoma Tumor Board provides opportunity for improvement in logistics, teaching, quality, and enrollment in clinical trials. PMID:25733913

  4. Primary alveolar soft part sarcoma of fibula demonstrating ASPL-TFE3 fusion: a case report and review of the literature

    International Nuclear Information System (INIS)

    Aisner, Seena C.; Mirani, Neena; Hameed, Meera; Beebe, Kathleen; Blacksin, Marcia

    2008-01-01

    Alveolar soft part sarcoma is a rare soft tissue tumor typically affecting young adults. These tumors are most often seen in the deep soft tissues of the extremities and patients generally present with advanced disease. Primary bone involvement is extremely rare and has only been reported in seven cases. This is the first case of alveolar soft part sarcoma in bone documenting the ASPL-TFE3 gene product. Herein, we report a rare presentation of alveolar soft part sarcoma presenting as a primary bone neoplasm involving the proximal fibula in a 41-year-old woman. (orig.)

  5. Primary alveolar soft part sarcoma of fibula demonstrating ASPL-TFE3 fusion: a case report and review of the literature

    Energy Technology Data Exchange (ETDEWEB)

    Aisner, Seena C.; Mirani, Neena; Hameed, Meera [University Hospital, Department of Pathology, Newark, NJ (United States); New Jersey Medical School, Newark (United States); Beebe, Kathleen [University Hospital, Department of Orthopedic Surgery, Newark, NJ (United States); New Jersey Medical School, Newark (United States); Blacksin, Marcia [University Hospital, Department of Radiology, Newark, NJ (United States); New Jersey Medical School, Newark (United States)

    2008-11-15

    Alveolar soft part sarcoma is a rare soft tissue tumor typically affecting young adults. These tumors are most often seen in the deep soft tissues of the extremities and patients generally present with advanced disease. Primary bone involvement is extremely rare and has only been reported in seven cases. This is the first case of alveolar soft part sarcoma in bone documenting the ASPL-TFE3 gene product. Herein, we report a rare presentation of alveolar soft part sarcoma presenting as a primary bone neoplasm involving the proximal fibula in a 41-year-old woman. (orig.)

  6. Late sarcoma development after curettage and bone grafting of benign bone tumors

    International Nuclear Information System (INIS)

    Picci, Piero; Sieberova, Gabriela; Alberghini, Marco; Balladelli, Alba; Vanel, Daniel; Hogendoorn, Pancras C.W.; Mercuri, Mario

    2011-01-01

    Background and aim: Rarely sarcomas develop in previous benign lesions, after a long term disease free interval. We report the experience on these rare cases observed at a single Institution. Patients and methods: 12 cases curetted and grafted, without radiotherapy developed sarcomas, between 1970 and 2005, 6.5-28 years from curettage (median 18, average 19). Age ranged from 13 to 55 years (median 30, average 32) at first diagnosis; tumors were located in the extremities (9 GCT, benign fibrous histiocytoma, ABC, and solitary bone cyst). Radiographic and clinic documentation, for the benign and malignant lesions, were available. Histology was available for 7 benign and all malignant lesions. Results: To fill cavities, autogenous bone was used in 4 cases, allograft in 2, allograft and tricalcium-phosphate/hydroxyapatite in 1, autogenous/allograft in 1, heterogenous in 1. For 3 cases the origin was not reported. Secondary sarcomas, all high grade, were 8 osteosarcoma, 3 malignant fibrous histiocytoma, and 1 fibrosarcoma. Conclusions: Recurrences with progression from benign tumors are possible, but the very long intervals here reported suggest a different cancerogenesis for these sarcomas. This condition is extremely rare accounting for only 0.26% of all malignant bone sarcomas treated in the years 1970-2005 and represents only 8.76% of all secondary bone sarcomas treated in the same years. This incidence is the same as that of sarcomas arising on fibrous dysplasia, and is lower than those arising on bone infarcts or on Paget's disease. This possible event must be considered during follow-up of benign lesions.

  7. Vascularized fibula grafts for reconstruction of bone defects after resection of bone sarcomas

    DEFF Research Database (Denmark)

    Petersen, Michael Mørk; Hovgaard, Dorrit; Elberg, Jens Jørgen

    2010-01-01

    We evaluated the results of limb-sparing surgery and reconstruction of bone defects with vascularized fibula grafts in 8 consecutive patients (mean age at operation 13.6 years (range 4.1-24.2 years), female/male = 6/2) with bone sarcomas (BS) (osteosarcoma/Ewing's sarcoma/chondrosarcoma= 4......'s sarcoma had an early hip disarticulation, developed multiple metastases, and died 9 months after the operation. The remaining patients (n = 7) are all alive 50 months (range 26-75 months) after surgery. During the follow-up the following major complications were seen: 1-2 fractures (n = 4), pseudarthrosis...... (n = 2), and hip dislocation (n = 1). Limb-sparing surgery with reconstruction of bone defects using vascularized fibular grafts in BS cases is feasible with acceptable clinical results, but fractures should be expected in many patients....

  8. Indian data on bone and soft tissue sarcomas: A summary of published study results

    Directory of Open Access Journals (Sweden)

    Anant Ramaswamy

    2016-01-01

    Full Text Available Bone sarcomas are rare tumors, approximating 0.2% of all cancers, with osteosarcoma (OGS, chondrosarcoma, and Ewing sarcoma being the most common cancers in this subset. The formation of disease management groups/clinics focused on sarcomas has resulted in better understanding and management of these uncommon tumors. Multiple large-scale retrospective data from Tata Memorial Hospital (TMH and All India Institute of Medical Sciences have reported outcomes comparable to Western data in the field of OGS and Ewing sarcoma, with interesting prognostic factors identified for further evaluation. Soft tissue sarcomas are a rare heterogeneous group of tumors, more than 50 different tumor entities. The common subtypes identified in India include Ewing sarcoma and synovial sarcoma. Valuable work regarding brachytherapy has been done by radiation oncologists from the TMH, especially in pediatric patients.

  9. The Edinburgh experience of treating sarcomas of soft tissues and bone with neutron irradiation

    International Nuclear Information System (INIS)

    Duncan, W.; Arnott, S.J.; Jack, W.J.L.

    1986-01-01

    The experience of treating 30 patients with sarcomas of soft tissue and bone with d(15)+Be neutron irradiation is reported. The local control of measurable soft-tissue sarcomas was 38.5% (minimum follow-up 2 years), which is similar to that expected after photon therapy. The radiation morbidity was unacceptably high (50%). Bone tumours did not respond well; in only one out of nine was lasting local tumour control achieved. (author)

  10. Oxidative stress and antioxidant status in primary bone and soft tissue sarcoma

    International Nuclear Information System (INIS)

    Nathan, Fatima M; Singh, Vivek A; Dhanoa, Amreeta; Palanisamy, Uma D

    2011-01-01

    Oxidative stress is characterised by an increased level of reactive oxygen species (ROS) that disrupts the intracellular reduction-oxidation (redox) balance and has been implicated in various diseases including cancer. Malignant tumors of connective tissue or sarcomas account for approximately 1% of all cancer diagnoses in adults and around 15% of paediatric malignancies per annum. There exists no information on the alterations of oxidant/antioxidant status of sarcoma patients in literature. This study was aimed to determine the levels of oxidative stress and antioxidant defence in patients with primary bone and soft tissue sarcoma and to investigate if there exists any significant differences in these levels between both the sarcomas. The study cohort consisted of 94 subjects; 20 soft tissue sarcoma, 27 primary bone sarcoma and 47 healthy controls. Malondialdehyde (MDA) and protein carbonyls were determined to assess their oxidative stress levels while antioxidant status was evaluated using catalase (CAT), superoxide dismutase (SOD), thiols and trolox equivalent antioxidant capacity (TEAC). Sarcoma patients showed significant increase in plasma and urinary MDA and serum protein carbonyl levels (p < 0.05) while significant decreases were noted in TEAC, thiols, CAT and SOD levels (p < 0.05). No significant difference in oxidative damage was noted between both the sarcomas (p > 0.05). In conclusion, an increase in oxidative stress and decrease in antioxidant status is observed in both primary bone and soft tissue sarcomas with a similar extent of damage. This study offers the basis for further work on whether the manipulation of redox balance in patients with sarcoma represents a useful approach in the design of future therapies for bone disease

  11. The multidisciplinary management of bone and soft tissue sarcoma: an essential organizational framework

    Directory of Open Access Journals (Sweden)

    Siegel GW

    2015-02-01

    Full Text Available Geoffrey W Siegel,1 J Sybil Biermann,1 Rashmi Chugh,2 Jon A Jacobson,3 David Lucas,4 Mary Feng,5 Andrew C Chang,6 Sean R Smith,7 Sandra Wong,6 Jill L Hasen1 1Department of Orthopedics, 2Department of Medical Oncology, 3Department of Radiology, 4Department of Pathology, 5Department of Radiation, 6Department of Surgery, 7Department of Physical Medicine and Rehabilitation, University of Michigan, Ann Arbor, MI, USA Abstract: The rarity of bone and soft tissue sarcoma, the difficulty in interpretation of imaging and histology, the plethora of treatment modalities, and the complexity and intensity of the treatment contribute to the need for systematic multidisciplinary team management of patients with these diseases. An integrated multidisciplinary clinic and team with a structured sarcoma tumor board facilitate team coordination and communication. This paper reviews the rationale for multidisciplinary management of sarcoma and details the operational structure of the Multidisciplinary Sarcoma Clinic and Sarcoma Tumor Board. The structured Multidisciplinary Sarcoma Tumor Board provides opportunity for improvement in logistics, teaching, quality, and enrollment in clinical trials. Keywords: sarcoma, sarcoma care, sarcoma tumor board, collaborative approach

  12. [Classic and aggressive Kaposi sarcoma with bone involvement].

    Science.gov (United States)

    Sbiyaa, Mouhcine; El Alaoui, Adil; El Bardai, Mohammed; Mezzani, Amine; Lahrach, Kamal; Marzouki, Amine; Boutayeb, Fawzi

    2016-01-01

    Classic Kaposi sarcoma is a multifocal rare tumor originating from vascular endothelial cells with progressive evolution and little malignant predisposition. Although Kaposi sarcoma with extensive visceral involvement is sometimes observed among HIV-positive patients, tumor dissemination to visceral lymph nodes in classic SK remains very rare. We report a rare case of aggressive classic Kaposi sarcoma of the hand with a rapid and destructive development.

  13. The ENCCA-WP7/EuroSarc/EEC/PROVABES/EURAMOS 3rd European Bone Sarcoma Networking Meeting/Joint Workshop of EU Bone Sarcoma Translational Research Networks; Vienna, Austria, September 24-25, 2015. Workshop Report

    NARCIS (Netherlands)

    Kager, L.; Whelan, J.; Dirksen, U.; Hassan, B.; Anninga, J.; Bennister, L.; Bovee, J.V.; Brennan, B.; Broto, J.M.; Brugieres, L.; Cleton-Jansen, A.M.; Copland, C.; Dutour, A.; Fagioli, F.; Ferrari, S.; Fiocco, M.; Fleuren, E.D.; Gaspar, N.; Gelderblom, H.; Gerrand, C.; Gerss, J.; Gonzato, O.; Graaf, W.T. van der; Hecker-Nolting, S.; Herrero-Martin, D.; Klco-Brosius, S.; Kovar, H.; Ladenstein, R.; Lancia, C.; Ledeley, M.C.; McCabe, M.G.; Metzler, M.; Myklebost, O.; Nathrath, M.; Picci, P.; Potratz, J.; Redini, F.; Richter, G.H.; Reinke, D.; Rutkowski, P.; Scotlandi, K.; Strauss, S.; Thomas, D; Tirado, O.M.; Tirode, F.; Vassal, G.; Bielack, S.S.

    2016-01-01

    This report summarizes the results of the 3rd Joint ENCCA-WP7, EuroSarc, EEC, PROVABES, and EURAMOS European Bone Sarcoma Network Meeting, which was held at the Children's Cancer Research Institute in Vienna, Austria on September 24-25, 2015. The joint bone sarcoma network meetings bring together

  14. Pembrolizumab in advanced soft-tissue sarcoma and bone sarcoma (SARC028): a multicentre, two-cohort, single-arm, open-label, phase 2 trial.

    Science.gov (United States)

    Tawbi, Hussein A; Burgess, Melissa; Bolejack, Vanessa; Van Tine, Brian A; Schuetze, Scott M; Hu, James; D'Angelo, Sandra; Attia, Steven; Riedel, Richard F; Priebat, Dennis A; Movva, Sujana; Davis, Lara E; Okuno, Scott H; Reed, Damon R; Crowley, John; Butterfield, Lisa H; Salazar, Ruth; Rodriguez-Canales, Jaime; Lazar, Alexander J; Wistuba, Ignacio I; Baker, Laurence H; Maki, Robert G; Reinke, Denise; Patel, Shreyaskumar

    2017-11-01

    Patients with advanced sarcomas have a poor prognosis and few treatment options that improve overall survival. Chemotherapy and targeted therapies offer short-lived disease control. We assessed pembrolizumab, an anti-PD-1 antibody, for safety and activity in patients with advanced soft-tissue sarcoma or bone sarcoma. In this two-cohort, single-arm, open-label, phase 2 study, we enrolled patients with soft-tissue sarcoma or bone sarcoma from 12 academic centres in the USA that were members of the Sarcoma Alliance for Research through Collaboration (SARC). Patients with soft-tissue sarcoma had to be aged 18 years or older to enrol; patients with bone sarcoma could enrol if they were aged 12 years or older. Patients had histological evidence of metastatic or surgically unresectable locally advanced sarcoma, had received up to three previous lines of systemic anticancer therapy, had at least one measurable lesion according to the Response Evaluation Criteria In Solid Tumors version 1.1, and had at least one lesion accessible for biopsy. All patients were treated with 200 mg intravenous pembrolizumab every 3 weeks. The primary endpoint was investigator-assessed objective response. Patients who received at least one dose of pembrolizumab were included in the safety analysis and patients who progressed or reached at least one scan assessment were included in the activity analysis. Accrual is ongoing in some disease cohorts. This trial is registered with ClinicalTrials.gov, number NCT02301039. Between March 13, 2015, and Feb 18, 2016, we enrolled 86 patients, 84 of whom received pembrolizumab (42 in each disease cohort) and 80 of whom were evaluable for response (40 in each disease cohort). Median follow-up was 17·8 months (IQR 12·3-19·3). Seven (18%) of 40 patients with soft-tissue sarcoma had an objective response, including four (40%) of ten patients with undifferentiated pleomorphic sarcoma, two (20%) of ten patients with liposarcoma, and one (10%) of ten patients

  15. Postradiation osteogenic sarcoma of bone and soft tissues. A clinicopathologic study of 66 patients

    International Nuclear Information System (INIS)

    Huvos, A.G.; Woodard, H.Q.; Cahan, W.G.; Higinbotham, N.L.; Stewart, F.W.; Butler, A.; Bretsky, S.S.

    1985-01-01

    Sixty-six patients with well-documented osteogenic sarcomas arising in bones and soft tissues after exposure to x-rays, which represent approximately 5.5 percent of all osteogenic sarcomas registered since 1921 at this institution, were studied. These secondary sarcomas occurred in equal proportion in both sexes, with the sixth decade of life being the most common age. In 42 patients, the bone had been normal at the time of irradiation, whereas in 24, the radiation was directed against an osseous tumor or tumor-like lesion. The median latent period was 10.5 years in both groups, ranging from 3.5 to 33 years. The radiation varied from diagnostic quality to 1 MeV x-rays. The dose was variable, but none was less than 2000 rads. Postradiation osteogenic sarcomas most commonly arose in the bones of the pelvic and shoulder regions. Histologically, the sarcomas were mostly of the fibrous type (46%) and radiographically showed a destructive bone lesion with or without signs of radiation osteitis. The cumulative disease-free survival rate at 5 years was 17%, with a median survival estimate of 1 year

  16. Summary of dosimetry, pathology, and dose response for bone sarcomas in beagles injected with 226Ra

    International Nuclear Information System (INIS)

    Wrenn, M.E.; Taylor, G.N.; Stevens, W.

    1985-01-01

    One hundred and sixty dogs given single intravenous injections of 226 Ra citrate at age 17 +/- 2 months (116) or a non-radioactive solution (44 controls) were part of a 30 year long experiment to determine the relative radiotoxicity of injected 226 Ra and 239 Pu. The authors report a preliminary summary of the results of the 226 Ra study. Skeletal development of the beagles used in this study is analogous to a young adult human, simulating that of a young adult radium dial painter or occupationally exposed person. Injected dosage of 226 Ra, average skeletal dose, and number of dogs and dogs developing bone sarcomas in each group are presented. The lowest nominal injected activity was 0.007 μCi/kg. Each of the 8 dosage levels contained about 12 dogs, except for 23 dogs at 0.06 μCi/kg and 25 dogs at 0.02 μCi/kg

  17. The modified Glasgow prognostic score in patients undergoing surgery for bone and soft tissue sarcoma.

    Science.gov (United States)

    Morhij, Rossel; Mahendra, Ashish; Jane, Mike; McMillan, Donald C

    2017-05-01

    The prognostic significance of markers of the systemic inflammatory response in patients with soft tissue and bone sarcomas remains unclear. Therefore, the present study aimed to compare the prognostic value of markers of the systemic inflammatory response in patients undergoing surgery for primary soft tissue and bone sarcoma. Patients who underwent resection of primary soft tissue/bone sarcoma between 2008 and 2012 and had pre-operative measurements of the systemic inflammatory response [C-reactive protein, albumin, white cell, neutrophil, lymphocyte and platelet counts, and the combination of C-reactive protein and albumin (mGPS)] were included in the study (n = 111). The majority of the patients were ≤50 years old (84%), were female (63%), had soft tissue sarcoma (62%), and had tumours >10 cm (52%), mostly of high grade (85%). The median follow-up of survivors was 50 months (range 34-78); 24 (21%) developed local recurrence, 35 (31%) developed distant metastases and 30 (30%) died of their cancer. On univariate analysis, tumour size (P sarcoma. Copyright © 2017 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

  18. Uterine sarcoma Part II—Uterine endometrial stromal sarcoma: The TAG systematic review

    Directory of Open Access Journals (Sweden)

    Huann-Cheng Horng

    2016-08-01

    Full Text Available Endometrial stromal tumors are rare uterine tumors (<1%. Four main categories include endometrial stromal nodule, low-grade endometrial stromal sarcoma (LG-ESS, high-grade endometrial stromal sarcoma (HG-ESS, and uterine undifferentiated sarcoma (UUS. This review is a series of articles discussing the uterine sarcomas. LG-ESS, a hormone-dependent tumor harboring chromosomal rearrangement, is an indolent tumor with a favorable prognosis, but characterized by late recurrences even in patients with Stage I disease, suggesting the requirement of a long-term follow-up. Patients with HG-ESS, based on the identification of YWHAE-NUTM2A/B (YWHAE-FAM22A/B gene fusion, typically present with advanced stage diseases and frequently have recurrences, usually within a few years after initial surgery. UUS is, a high-grade sarcoma, extremely rare, lacking a specific line of differentiation, which is a diagnosis of exclusion (the wastebasket category, which fails to fulfill the morphological and immunohistochemical criteria of translocation-positive ESS. Surgery is the main strategy in the management of uterine sarcoma. Due to rarity, complex biological characteristics, and unknown etiology and risk factors of uterine sarcomas, the role of adjuvant therapy is not clear. Only LG-ESS might respond to progestins or aromatase inhibitors.

  19. Alveolar soft-part sarcoma of the orbit | Rose | African Journal of ...

    African Journals Online (AJOL)

    Alveolar soft-part sarcoma (ASPS) is a rare soft tissue tumour of uncertain cellular origin. It accounts for only 1% of all sarcomas, which themselves represent only a small proportion of human tumours. ASPS can arise in any soft tissue of the body, but there is an unexplained predilection for the right side. The most common ...

  20. Understanding the biology of bone sarcoma from early initiating events through late events in metastasis and disease progression.

    Directory of Open Access Journals (Sweden)

    Limin eZhu

    2013-09-01

    Full Text Available The two most common primary bone malignancies, osteosarcoma and Ewing sarcoma, are both aggressive, highly metastatic cancers that most often strike teens, though both can be found in younger children and adults. Despite distinct origins and pathogenesis, both diseases share several mechanisms of progression and metastasis, including neovascularization, invasion, anoikis resistance, chemoresistance and evasion of the immune response. Some of these processes are well-studies in more common carcinoma models, and the observation from adult diseases may be readily applied to pediatric bone sarcomas. Neovascularization, which includes angiogenesis and vasculogenesis, is a clear example of a process that is likely to be similar between carcinomas and sarcomas, since the responding cells are the same in each case. Chemoresistance mechanisms also may be similar between other cancers and the bone sarcomas. Since osteosarcoma and Ewing sarcoma are mesenchymal in origin, the process of epithelial-to-mesenchymal transformation is largely absent in bone sarcomas, necessitating different approaches to study progression and metastasis in these diseases. One process that is less well-studied in bone sarcomas is dormancy, which allows micrometastatic disease to remain viable but not growing in distant sites – typically the lungs – for months or years before renewing growth to become overt metastatic disease. By understanding the basic biology of these processes, novel therapeutic strategies may be developed that could improve survival in children with osteosarcoma or Ewing sarcoma.

  1. Maturation toward neuronal tissue in a Ewing sarcoma of bone after chemotherapy

    NARCIS (Netherlands)

    Salet, Maria Carolina Wilhelmina; Vogels, Rob; Brons, Paul P. T.; Schreuder, Bart; Flucke, Uta

    2016-01-01

    Background: Ewing sarcoma is the second most common bone tumor, occurring mainly in children and young adults. It shows a typical primitive, small round cell morphology and a characteristic fusion oncogene involving EWSR1 and members of the ETS family in most of the cases. Neuronal maturation after

  2. HEMIPELVECTOMY AND INTRAOPERATIVE RADIOTHERAPY FOR BONE AND SOFT-TISSUE SARCOMAS OF THE PELVIC GIRDLE

    NARCIS (Netherlands)

    HOEKSTRA, HJ; SINDELAR, WF; SZABO, BG; KINSELLA, TJ

    1995-01-01

    Current treatment of locally advanced bone and soft tissue sarcomas of the pelvic girdle are associated with a high local and distant failure rate, and local tumor control after hemipelvectomy can be a significant problem. IORT has been used in conjunction with hemipelvectomy, both conventional

  3. Cyclophosphamide versus ifosfamide for paediatric and young adult bone and soft tissue sarcoma patients

    NARCIS (Netherlands)

    Mulder, Renée L.; Paulides, Marios; Langer, Thorsten; Kremer, Leontien C. M.; van Dalen, Elvira C.

    2010-01-01

    BACKGROUND: Alkylating agents, such as cyclophosphamide and ifosfamide, play a major role in the improved survival of children and young adults with bone and soft tissue sarcoma. However, there is still controversy as to their comparative anti-tumour efficacy and possible adverse effects.

  4. Cyclophosphamide versus ifosfamide for paediatric and young adult bone and soft tissue sarcoma patients

    NARCIS (Netherlands)

    Mulder, Renée L.; Paulides, Marios; Langer, Thorsten; Kremer, Leontien C. M.; van Dalen, Elvira C.

    2012-01-01

    Background Alkylating agents, such as cyclophosphamide and ifosfamide, play a major role in the improved survival of children and young adults with bone and soft tissue sarcoma. However, there is still controversy as to their comparative anti-tumour efficacy and possible adverse effects. This is an

  5. Cyclophosphamide versus ifosfamide for paediatric and young adult bone and soft tissue sarcoma patients

    NARCIS (Netherlands)

    Mulder, Renée L.; Paulides, Marios; Langer, Thorsten; Kremer, Leontien C. M.; van Dalen, Elvira C.

    2015-01-01

    Alkylating agents, such as cyclophosphamide and ifosfamide, play a major role in the improved survival of children and young adults with bone and soft tissue sarcoma. However, there is still controversy as to their comparative anti-tumour efficacy and possible adverse effects. This is the second

  6. Quality of Life Following Amputation or Limb Preservation in Patients with Lower Extremity Bone Sarcoma

    Directory of Open Access Journals (Sweden)

    Gary E Mason

    2013-08-01

    Full Text Available PURPOSE: Although functional differences have been described between patients with lower extremity bone sarcoma with amputation and limb preservation surgery, differences have not clearly been shown between the two groups related to quality of life. The aim of the study was to determine if there is a difference in overall quality of life in lower extremity bone sarcoma survivors related to whether they had an amputation or a limb preservation procedure. PATIENTS AND METHODS: Eighty-two long-term survivors of lower extremity bone sarcoma were studied to make a comparison of the overall quality of life, pain assessment and psychological evaluations in limb preservation and amputation patients. Forty-eight patients with limb preservation and thirty-four patients with amputations were enrolled in the study. Validated psychometric measures including the Quality of Life Questionnaire, the Minnesota Multiphasic Personality Inventory and visual analog scales were utilized.RESULTS: The overall quality of life of patients with limb preservation was significantly higher than patients with amputation (p-value < 0.01. Significant differences were noted in the categories of material well being, job satisfiers and occupational relations. CONCLUSION: The overall quality of life of patients with limb preservation appears to be better than for those patients with amputation based on the quality of life questionnaire in patients surviving lower extremity bone sarcoma. Further analysis needs to verify the results and focus on the categories that significantly affect the overall quality of life.

  7. Radioisotopic methods for the study of bone sarcoma and soft tissue neoplasms

    Energy Technology Data Exchange (ETDEWEB)

    Gongora, R.

    1988-01-01

    Radioisotopic methods are widely applied to investigations of bone sarcoma and soft tissue neoplasms. We have at our disposal molecules with osseous, tumoral or vascular tropism. Their use, as single agents or combination, is helpful in positive and differential diagnosis and provides nosological informations. They are also useful in treatment monitoring and in long-term follow-up.

  8. Preclinical evaluation of telomerase-specific oncolytic virotherapy for human bone and soft tissue sarcomas.

    Science.gov (United States)

    Sasaki, Tsuyoshi; Tazawa, Hiroshi; Hasei, Jo; Kunisada, Toshiyuki; Yoshida, Aki; Hashimoto, Yuuri; Yano, Shuya; Yoshida, Ryosuke; Uno, Futoshi; Kagawa, Shunsuke; Morimoto, Yuki; Urata, Yasuo; Ozaki, Toshifumi; Fujiwara, Toshiyoshi

    2011-04-01

    Tumor-specific replication-selective oncolytic virotherapy is a promising antitumor therapy for induction of cell death in tumor cells but not of normal cells. We previously developed an oncolytic adenovirus, OBP-301, that kills human epithelial malignant cells in a telomerase-dependent manner. Recent evidence suggests that nonepithelial malignant cells, which have low telomerase activity, maintain telomere length through alternative lengthening of telomeres (ALT). However, it remains unclear whether OBP-301 is cytopathic for nonepithelial malignant cells. Here, we evaluated the antitumor effect of OBP-301 on human bone and soft tissue sarcoma cells. The cytopathic activity of OBP-301, coxsackie and adenovirus receptor (CAR) expression, and telomerase activity were examined in 10 bone (OST, U2OS, HOS, HuO9, MNNG/HOS, SaOS-2, NOS-2, NOS-10, NDCS-1, and OUMS-27) and in 4 soft tissue (CCS, NMS-2, SYO-1, and NMFH-1) sarcoma cell lines. OBP-301 antitumor effects were assessed using orthotopic tumor xenograft models. The fiber-modified OBP-301 (termed OBP-405) was used to confirm an antitumor effect on OBP-301-resistant sarcomas. OBP-301 was cytopathic for 12 sarcoma cell lines but not for the non-CAR-expressing OUMS-27 and NMFH-1 cells. Sensitivity to OBP-301 was dependent on CAR expression and not on telomerase activity. ALT-type sarcomas were also sensitive to OBP-301 because of upregulation of human telomerase reverse transcriptase (hTERT) mRNA following virus infection. Intratumoral injection of OBP-301 significantly suppressed the growth of OST and SYO-1 tumors. Furthermore, fiber-modified OBP-405 showed antitumor effects on OBP-301-resistant OUMS-27 and NMFH-1 cells. A telomerase-specific oncolytic adenovirus is a promising antitumor reagent for the treatment of bone and soft tissue sarcomas.

  9. Alveolar soft-part sarcoma of the mediastinum: A case report

    Directory of Open Access Journals (Sweden)

    Yohei Kameda

    2017-02-01

    Full Text Available We report a 53-year-old man with metastases of alveolar soft-part sarcoma originated from the mediastinum. He was hospitalized due to lower extremities’ paralysis. Computed tomography scan findings revealed multiple nodules of bilateral lungs, swollen mediastinal lymph nodes, and osteolysis of thoracic vertebrae. We performed spinal decompression and biopsy from vertebra. And, we finally diagnosed this case as metastases of mediastinal alveolar soft-part sarcoma which was removed 10 years ago. Alveolar soft-part sarcoma is rare tumor accounted for 0.5%–1.0% of soft tissue sarcoma that often occurs primarily in the lower extremities and trunk. It is difficult to distinguish between alveolar soft-part sarcoma and paraganglioma, renal cell carcinoma and granular cell tumor morphologically. Periodic acid–Schiff stain and immunohistochemical staining of ASPL-TFE3 are useful in making a definitive diagnosis of alveolar soft-part sarcoma. This case is a rare case of alveolar soft-part sarcoma originated in the mediastinum with local recurrence and distant metastases 10 years after the initial surgery.

  10. Primary alveolar soft part sarcoma of vertebra: a case report and literature review

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Fei-Peng [Nanjing University, Department of Medical Imaging, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); Xuzhou Medical College, Xuzhou, Jiangsu Province (China); Lu, Guang-Ming; Zhang, Long-Jiang [Nanjing University, Department of Medical Imaging, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); Wang, Jian-Dong [Nanjing University, Department of Pathology, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); An, Xiao-Jing [Nanjing University, Department of Pathology, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); Nanjing University, Medical College, Nanjing, Jiangsu Province (China); Dong, Ying-Chun [Nanjing Stomatology Hospital/The Affiliated Stomatology Hospital of Medical School of Nanjing University, Department of Anesthesiology, Nanjing, Jiangsu Province (China)

    2009-08-15

    Alveolar soft part sarcoma (ASPS) is a rare malignant soft tissue tumor, which rarely occurs in bone. We present a case of ASPS in a 23-year-old man with a 2-month history of back pain. Computed tomography scanning and magnetic resonance images demonstrated a destructive process in the 12th thoracic vertebra associated with a unilateral soft tissue mass. The tumor showed evidence of hypervascularity on MRI; it obviously was enhanced on T1-weighted images after injection of Gd-GDPA, and signal voids were shown on all pulse sequences which may help to differentiate ASPS from other tumors of the vertebra. We believe that this is the first case of ASPS arising in a vertebra. (orig.)

  11. Roentgenographic-pathologic correlation of diffuse sclerosis in Ewing sarcoma of bone

    International Nuclear Information System (INIS)

    Shirley, S.K.; Kissane, J.M.; Siegal, G.P.; Askin, F.B.; Foulkes, M.A.; University of Texas Cancer Center, Houston

    1984-01-01

    Roentgenographic review of the first 210 cases of Ewing sarcoma (ES) in the Intergroup Ewing Sarcoma Study revealed that 37.6% of cases has evidence of diffusely increased intraosseous density or diffuse sclerosis (DS). In these cases the sclerosis was usually mixed with various patterns of lysis and/or combined with a periosteal reaction. A radiograph blinded histologic review of selected biopsies showed an 83% incidence of dead bone compared to 23% in those without DS. Ten percent of the cases with DS had appositional new bone formation on dead bone whereas none of the cases without DS showed such reactions. Pathologic explanation of the roentgenographically identified diffuse sclerosis in ES has not been previously well documented in the medical literature. (orig.)

  12. Summary of dosimetry, pathology, and dose response for bone sarcomas in beagles injected with radium-226

    International Nuclear Information System (INIS)

    Wrenn, M.E.; Taylor, G.N.; Stevens, W.

    1986-01-01

    In the completed 226 Ra portion of a 30-year-long experiment to determine the relative radiotoxicity of injected 226 Ra and 239 Pu, 42 of 116 animals injected with 226 Ra developed 63 bone sarcomas; none were observed in 44 controls. Average alpha plus beta dose to the skeleton to death was calculated on the basis of mathematical functions developed from sequential measurements of radium and radon retention in each dog. Bone sarcomas were identified radiographically or clinically, with subsequent histopathological confirmation and classification. Most primary bone tumors were classified as osteosarcomas if osteoid arose from a malignant stroma. The dose-response curve over the six lowest injected dose levels fits well to a linear, no-threshold, least squares fit, through a control incidence of 0.8%, and with a slope of 0.042% incidence per rad. 19 refs., 5 figs., 2 tabs

  13. TNF-related apoptosis-inducing ligand (TRAIL) for bone sarcoma treatment: Pre-clinical and clinical data.

    Science.gov (United States)

    Gamie, Zakareya; Kapriniotis, Konstantinos; Papanikolaou, Dimitra; Haagensen, Emma; Da Conceicao Ribeiro, Ricardo; Dalgarno, Kenneth; Krippner-Heidenreich, Anja; Gerrand, Craig; Tsiridis, Eleftherios; Rankin, Kenneth Samora

    2017-11-28

    Bone sarcomas are rare, highly malignant mesenchymal tumours that affect teenagers and young adults, as well as older patients. Despite intensive, multimodal therapy, patients with bone sarcomas have poor 5-year survival, close to 50%, with lack of improvement over recent decades. TNF-related apoptosis-inducing ligand (TRAIL), a member of the tumour necrosis factor (TNF) ligand superfamily (TNFLSF), has been found to induce apoptosis in cancer cells while sparing nontransformed cells, and may therefore offer a promising new approach to treatment. We cover the existing preclinical and clinical evidence about the use of TRAIL and other death receptor agonists in bone sarcoma treatment. In vitro studies indicate that TRAIL and other death receptor agonists are generally potent against bone sarcoma cell lines. Ewing's sarcoma cell lines present the highest sensitivity, whereas osteosarcoma and chondrosarcoma cell lines are considered less sensitive. In vivo studies also demonstrate satisfactory results, especially in Ewing's sarcoma xenograft models. However, the few clinical trials in the literature show only low or moderate efficacy of TRAIL in treating bone sarcoma. Potential strategies to overcome the in vivo resistance reported include co-administration with other drugs and the potential to deliver TRAIL on the surface of primed mesenchymal or immune cells and the use of targeted single chain antibodies such as scFv-scTRAIL. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Uterine sarcoma Part I—Uterine leiomyosarcoma: The Topic Advisory Group systematic review

    Directory of Open Access Journals (Sweden)

    Kuo-Chang Wen

    2016-08-01

    Full Text Available Uterine sarcomas account for 3–7% of all uterine cancers. Because of their rarity, unknown etiology, and highly divergent genetic aberration, there is a lack of consensus on risk factors for occurrence and predictive poor outcomes as well as optimal therapeutic choices. Tumor types according to the World Health Organization classification include leiomyosarcoma, endometrial stroma sarcoma, and undifferentiated sarcoma. Staging is done using the 2014 Federation International Gynecology and Obstetrics and 2010 American Joint Committee on Cancer tumor, lymph node, and metastases systems. Tumor grade can be classified based on the French Federation of Cancer Centers Sarcoma Group system or the Broder’s system that incorporates tumor differentiation, mitotic count, and tumor necrosis. This review is a series of articles discussing uterine sarcoma, and this is Part I, which focuses on one of the subtypes of uterine sarcomas—uterine leiomyosarcoma. The clinical characteristics, diagnosis, outcome, and recent advances are summarized in this article.

  15. Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

    Science.gov (United States)

    Price, Richard L; Harkins, Lualhati; Chiocca, Ennio A; Zhang, Paul J; Kurt, Habibe; Iwenofu, Obiajulu H

    2017-10-01

    Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that

  16. ENCCA WP17-WP7 consensus paper on teenagers and young adults (TYA) with bone sarcomas.

    Science.gov (United States)

    Wilhelm, M; Dirksen, U; Bielack, S S; Whelan, J S; Lewis, I J; Jürgens, H; Ferrari, S; Sundby Hall, K; Cleton-Jansen, A M; Stark, D

    2014-08-01

    Teenagers and young adults (TYA) cancer contributes substantially to morbidity and mortality in a population with much to offer society. TYA place distinct challenges upon cancer care services, many reporting feeling marginalized and their needs not being met in adult or paediatric cancer services. Bone tumours such as osteosarcoma and Ewing sarcoma, because of their age at presentation and the complexity of their care, are where challenges in managing (TYA) with cancer have often been most readily apparent. Bone sarcomas may be managed by paediatric or medical oncologists, and require fastidious attention to protocol. A lack of recent improvement in survival in TYA with bone tumours may be linked to a lack of specialist care, poor concordance with therapy in some situations and TYA-specific pharmacology. Participation in clinical trials, particularly of young adults, is low, hindering progress. All these requirements may be best met by a concerted effort to create collaborative care between adult and paediatric experts in bone sarcoma, working together to meet TYA patients' needs. © The Author 2014. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  17. Long-term survivors of childhood bone and soft tissue sarcomas are at risk of hospitalization.

    Science.gov (United States)

    Gonzalez, Cristian D; Randall, R Lor; Wright, Jennifer; Spraker-Perlman, Holly; Ying, Jian; Sweeney, Carol; Smith, Ken R; Kirchhoff, Anne C

    2017-06-01

    Childhood cancer survivors can have a high burden of chronic conditions related to cancer treatment, some of which are debilitating or potentially life-threatening. Much remains to be learned about late effects in bone and soft tissue sarcoma survivors. The Utah Cancer Registry was used to identify survivors of bone (N = 71) and soft tissue sarcomas (N = 98) who were diagnosed at ages 0-20 years between 1973 and 2007 and were alive at least 5 years after diagnosis. We selected an age-sex-matched comparison cohort (N = 934). Hospitalizations from 1996 to 2012 were extracted from the Utah Department of Health statewide inpatient hospitalization discharge records. Cox, Poisson, and Gamma regressions were used to evaluate the risk of hospitalization, rate of admission, and length of stay for survivors versus the comparison cohort. Primary ICD-9 codes defined the most common reasons for hospitalizations. The hazard ratio (HR) of any hospitalization was higher for survivors in reference to the comparison cohort (HR = 2.12, 95% confidence interval [CI] 1.51-2.97). Survivors experienced more hospital admissions (rate ratio [RR] = 4.58, 95% CI 3.92-5.35) and longer length of stay (RR = 1.28, 95% CI 1.12-1.46) compared with the comparison cohort. Survivors treated with any chemotherapy were at three-fold higher risk (HR = 3.37, 95% CI 1.94-5.83) of hospitalization compared with survivors who received surgery and/or radiation alone. Among hospitalized survivors, the most common reason was injury for bone tumor (26.8%) and neoplasm for soft tissue sarcoma (12.2%). Childhood survivors of bone tumor and soft tissue sarcoma face ongoing risk of hospitalization for years after diagnosis. © 2016 Wiley Periodicals, Inc.

  18. Stereotactic Radiotherapy in the Treatment of Lung Metastases from Bone and Soft-tissue Sarcomas.

    Science.gov (United States)

    Frakulli, Rezarta; Salvi, Fabrizio; Balestrini, Damiano; Parisi, Alessandro; Palombarini, Marcella; Cammelli, Silvia; Rocca, Michele; Salone, Mariacristina; Longhi, Alessandra; Ferrari, Stefano; Morganti, Alessio G; Frezza, Giovanni

    2015-10-01

    The purpose of this study was to evaluate local control and toxicity in a group of patients treated with stereotactic body radiotherapy (SBRT) for lung metastases (LM) from bone and soft tissue sarcomas. From October 2010 to July 2014, patients with LM from sarcomas not suitable for surgery were treated with daily cone-beam computed tomography-guided SBRT. The dose administered ranged from 30 to 60 Gy in 3-8 fractions. Acute and late toxicity were scored according to Common Terminology Criteria for Adverse Events version 4.0. A total of 24 patients with 68 LM from sarcomas were treated with SBRT. The median follow-up after SBRT was 17 months (range=11-51 months). Two-year actuarial lesion local control and overall survival were 85.9% and 66.4%, respectively. No G3 or greater acute and late toxicities were observed. SBRT is a safe and effective treatment for LM from sarcoma and might be used as an alternative option in patients unfit for surgery. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  19. Alveolar soft-part sarcoma in paranasal sinuses

    Directory of Open Access Journals (Sweden)

    Jie ZHANG

    2015-07-01

    Full Text Available Objective To investigate clinicopathological features, immune phenotype, diagnosis and differential diagnosis of alveolar soft-part sarcoma (ASPS in paranasal sinuses. Methods Retrospective study of clinical manifestations, histopathological features and immunohistochemical features was conducted in one case of ASPS in paranasal sinuses.  Results A 28-year-old female presented with bulging forehead for 2 months. MRI revealed a well-circumscribed lesion in left frontal and ethmoid sinuses extending to anterior skull base that showed slightly hyperintense signal on T1WI and hypointense signal on T2WI without obvious enhancement after contrast administration. The patient subsequently underwent endoscopic open surgery on left ethmoid and bilateral frontal sinuses and performed partial resection of the lesion. Three months after the initial surgery, the patient received reoperation for total removal of residual lesion and reconstructive surgery of anterior skull base. Adjuvant chemotherapy and radiotherapy were not administered. Histologically, the tumor was composed of epithelioid cells arranged in organoid nests and/or alveolar structures varying in size and shape, which were separated by connective tissue richly containing sinusoidal vascular channels. The tumor cells were generally large-sized, round, oval or polygonal with abundant eosinophilic granular or translucent vacuolated cytoplasm. The nuclei showed round or oval shape containing centrally placed and obvious nucleoli. The presence a lot of mono- or multi-nuclear giant cells served as another striking feature. Mitotic activities were rare. Reticular fiber staining indicated that reticular fibers surrounded the nest of tumor cells, and diastase-resistant periodic acid-Schiff (PAS-positive crystalline inclusions were identified within the cytoplasm of tumor cells. Immunohistochemically, the tumor cells were reactive for TFE3, while were negative for glial fibrillary acidic protein (GFAP

  20. Can FDG-PET/CT replace blind bone marrow biopsy of the posterior iliac crest in Ewing sarcoma?

    NARCIS (Netherlands)

    Kasalak, Omer; Glaudemans, Andor W. J. M.; Overbosch, Jelle; Jutte, Paul C.; Kwee, Thomas C.

    OBJECTIVE: To determine and compare the value of (18)F-fluoro-2-deoxy-D-glucose positron emission tomography/computed tomography (FDG-PET/CT) to blind bone marrow biopsy (BMB) of the posterior iliac crest in detecting metastatic bone marrow involvement in newly diagnosed Ewing sarcoma. MATERIALS AND

  1. Can Bone Tissue Engineering Contribute to Therapy Concepts after Resection of Musculoskeletal Sarcoma?

    Directory of Open Access Journals (Sweden)

    Boris Michael Holzapfel

    2013-01-01

    Full Text Available Resection of musculoskeletal sarcoma can result in large bone defects where regeneration is needed in a quantity far beyond the normal potential of self-healing. In many cases, these defects exhibit a limited intrinsic regenerative potential due to an adjuvant therapeutic regimen, seroma, or infection. Therefore, reconstruction of these defects is still one of the most demanding procedures in orthopaedic surgery. The constraints of common treatment strategies have triggered a need for new therapeutic concepts to design and engineer unparalleled structural and functioning bone grafts. To satisfy the need for long-term repair and good clinical outcome, a paradigm shift is needed from methods to replace tissues with inert medical devices to more biological approaches that focus on the repair and reconstruction of tissue structure and function. It is within this context that the field of bone tissue engineering can offer solutions to be implemented into surgical therapy concepts after resection of bone and soft tissue sarcoma. In this paper we will discuss the implementation of tissue engineering concepts into the clinical field of orthopaedic oncology.

  2. The reverse protraction factor in the induction of bone sarcomas in radium-224 patients

    International Nuclear Information System (INIS)

    Chmelevsky, D.; Spiess, H.; Mays, C.W.; Kellerer, A.M.

    1990-01-01

    More than 50 bone sarcomas have occurred among a collective of about 800 patients who had been injected in Germany after World War II with large activities of radium-224 for the intended treatment of bone tuberculosis and ankylosing spondylitis. In an earlier analysis it was concluded that, at equal mean absorbed doses in the skeleton, patients with longer exposure time had a higher incidence of bone sarcomas. The previous analysis was based on approximations; in particular, it did not account for the varying times at risk of the individual patients. In view of the implications of a reverse protraction factor for basic considerations in radiation protection, the need was therefore felt to reevaluate the data from the continued follow-up by more rigorous statistical methods. A first step of the analysis demonstrates the existence of the reverse dose-rate effect in terms of a suitably constructed rank-order test. In a second step of the analysis it is concluded that the data are consistent with a linear no-threshold dose dependence under the condition of constant exposure time, while there is a steeper than linear dependence on dose when the exposure times increase proportionally to dose. A maximum likelihood fit of the data is then performed in terms of a proportional hazards model that includes the individual parameters, dose, treatment duration, and age at treatment. The fit indicates proportionality of the tumor rates to mean skeletal dose with an added factor (1 + 0.18.tau), where tau is the treatment time in months. This indicates that a protraction of the injections over 15 months instead of 5 months doubles the risk of bone sarcoma

  3. Lung Metastasis of Primary Alveolar Soft-Part Sarcoma Occurring 20 Years after Initial Treatment

    Directory of Open Access Journals (Sweden)

    R. F. Falkenstern-Ge

    2013-01-01

    Full Text Available A 30-year old woman was referred to our center because of suspicion of a primary lung tumor of the right upper lobe. Histological examination of the lung lesion revealed lung metastasis of a previously treated alveolar soft part sarcoma of the musculus vastus medialis of the right femur, which was resected 20 years ago. Alveolar soft-part sarcoma is a rare malignant tumor that occurs most often in the soft tissue of lower limbs. It is a slow-growing malignant soft tissue tumor arising in muscle tissue, usually in young adults. Due to pleural and extensive mediastinal infiltration with bilateral lung metastases, a systemic treatment with chemotherapy doxorubicin and ifosfamide was initiated. Late metastases from previously treated alveolar part sarcoma should be considered in patients with suspicious lung lesions even if surgical treatment was performed a long time ago.

  4. Genetics Home Reference: Ewing sarcoma

    Science.gov (United States)

    ... Facebook Twitter Home Health Conditions Ewing sarcoma Ewing sarcoma Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Ewing sarcoma is a cancerous tumor that occurs in bones ...

  5. Bone sarcoma as a second malignant neoplasm in children: influence of radiation and genetic predisposition

    International Nuclear Information System (INIS)

    Meadows, A.T.; Strong, L.C.; Li, F.P.; D'angio, G.J.; Schweisguth, O.; Freeman, A.I.; Jenkin, R.D.T.; Morris-Jones, P.; Nesbit, M.E.

    1980-01-01

    Osteosarcoma or chondrosarcoma developed as a second malignant neoplasm (SMN) in 40 of 188 individuals with SMN whose first neoplasm occurred in childhood. A genetic susceptibility to cancer was found in 23; the SMN developed in an irradiated field in 32; both factors were present in 16; neither in one. When a genetic predisposition was present, radiation shortened the interval to SMN. The intervals between tumors and the age at which the bone sarcomas developed in relation to genetic disease and therapy were analyzed by a two-mutation hypothesis

  6. Surgical therapy of primary malignant bone tumours and soft tissue sarcomas of the chest wall: a two-institutional experience.

    Science.gov (United States)

    Friesenbichler, Joerg; Leithner, Andreas; Maurer-Ertl, Werner; Szkandera, Joanna; Sadoghi, Patrick; Frings, Andreas; Maier, Alfred; Andreou, Dimosthenis; Windhager, Reinhard; Tunn, Per-Ulf

    2014-06-01

    Primary malignant bone tumours and soft tissue sarcomas of the chest wall are exceedingly rare entities. The aim of this study was a retrospective two-institutional analysis of surgical therapy with respect to the kind and amount of the resection performed, the type of reconstruction and the oncological outcome. Between September 1999 and August 2010 31 patients (seven women and 24 men) were treated due to a primary malignant bone tumour or soft tissue sarcoma of the chest wall in two centres. Eight low-grade sarcomas were noted as well as 23 highly malignant sarcomas. The tumours originated from the sternum in six cases, from the ribs in 12 cases, from the soft tissues of the thoracic wall in 11 cases and from a vertebral body and the clavicle in one case each. In 26 cases wide resection margins were achieved, while four were intralesional and one was marginal. In all 31 cases the defect of the chest wall was reconstructed using mesh grafts. At a mean follow-up of 51 months 20 patients were without evidence of disease, three were alive with disease, seven patients had died and one patient was lost to follow-up. One recurrence was detected after wide resection of a malignant triton tumour. Primary malignant bone tumour or soft tissue sarcoma of the chest wall should be treated according to the same surgical oncological principles as established for the extremities. Reconstruction with mesh grafts and musculocutaneous flaps is associated with a low morbidity.

  7. Bone sarcoma induction by radium 224 in beagles: an interim report

    International Nuclear Information System (INIS)

    Mays, C.W.; Taylor, G.N.; Lloyd, R.D.; Bruenger, F.W.; Angus, W.

    1989-01-01

    Detailed results are given of a pilot study of 20 beagles given a single intravenous injection of 224 RA contaminated with 210 Pb and some 228 Th. All these dogs have died, eight with bone sarcoma. Interim results are summarized on a new study of 128 beagles given purified 224 Ra in 1, 10 or 50 weekly injections during 1977-79. The acute lethal dosage (LD 50 ) for a single injection was about 400 kBq 224 Ra/kg (11 μCi 224 Ra/kg). As of 14 September 1987, at the highest skeletal dose of 3 Gy from purified 224 Ra, bone sarcomas had occurred in five out of six dogs at an average ± SD of 2069 ± 302 days after the start of 50 injections (no survivors), in four out of six dogs at 2485 ± 1110 days after the start of ten injections (one healthy survivor) and in one out of eight dogs at 3066 days after a single injection (three healthy survivors). At 3 Gy the toxicity of 224 Ra relative to 239 Pu, based on the ratio of skeletal doses at equal tumour appearance times, was 1.0 for 50 injections of 224 Ra, 0.7 for ten injections, and 0.4 for one injection. (author)

  8. Bone sarcoma induction by radium 224 in beagles: an interim report

    International Nuclear Information System (INIS)

    Mays, C.W.; Taylor, G.N.; Lloyd, R.D.; Bruenger, F.W.; Angus, W.

    1989-01-01

    Twenty beagles were given an injection of Ra 224 contaminated with 210 Pb and 228 Th. All have died, 8 with bone sarcoma. In a new study, 128 dogs were given purified Ra 224 in 1, 10 or 50 weekly injections from 1977-1979 (LD 50 for single injection ∼ 400 kBq 224 Ra/kg). As of 14 September 1987, at the highest skeletal dose of 3 Gy from 224 Ra, bone sarcomas had occurred in 5 of 6 dogs at an average of ± SD of 2069±302 days after the start of 50 injections (0 survivors), in 4 of 6 dogs at 2485±1110 days after the start of 10 injections (1 survivor), and in 1 of 8 dogs at 3066 days after a single injection (3 survivors). At 3 Gy, the toxicity of 224 Ra relative to 239 Pu, was 1.0 for 50 injections of 224 Ra, 0.7 for 10, and 0.4 for 1. The effectiveness per Gy of 224 Ra-equivalent dose from 1 injection of 224 Ra contaminated with 228 Th and 210 Pb was equal to that of 239 Pu. (UK)

  9. Treatment pathway of bone sarcoma in children, adolescents, and young adults.

    Science.gov (United States)

    Reed, Damon R; Hayashi, Masanori; Wagner, Lars; Binitie, Odion; Steppan, Diana A; Brohl, Andrew S; Shinohara, Eric T; Bridge, Julia A; Loeb, David M; Borinstein, Scott C; Isakoff, Michael S

    2017-06-15

    When pediatric, adolescent, and young adult patients present with a bone sarcoma, treatment decisions, especially after relapse, are complex and require a multidisciplinary approach. This review presents scenarios commonly encountered in the therapy of bone sarcomas with the goal of objectively presenting a consensus, multidisciplinary management approach. Little variation was found in the authors' group with respect to local control or systemic therapy. Clinical trials were universally prioritized in all settings. Decisions regarding relapse therapies in the absence of a clinical trial had very minor variations initially, but a consensus was reached after a literature review and discussion. This review presents a concise document and figures as a starting point for evidence-based care for patients with these rare diseases. This framework allows prospective decision making and prioritization of clinical trials. It is hoped that this framework will inspire and focus future clinical research and thus lead to new trials to improve efficacy and reduce toxicity. Cancer 2017;123:2206-2218. © 2017 American Cancer Society. © 2017 The Authors. Cancer published by Wiley Periodicals, Inc. on behalf of American Cancer Society.

  10. In vivo, noninvasive functional measurements of bone sarcoma using diffuse optical spectroscopic imaging

    Science.gov (United States)

    Peterson, Hannah M.; Hoang, Bang H.; Geller, David; Yang, Rui; Gorlick, Richard; Berger, Jeremy; Tingling, Janet; Roth, Michael; Gill, Jonathon; Roblyer, Darren

    2017-12-01

    Diffuse optical spectroscopic imaging (DOSI) is an emerging near-infrared imaging technique that noninvasively measures quantitative functional information in thick tissue. This study aimed to assess the feasibility of using DOSI to measure optical contrast from bone sarcomas. These tumors are rare and pose technical and practical challenges for DOSI measurements due to the varied anatomic locations and tissue depths of presentation. Six subjects were enrolled in the study. One subject was unable to be measured due to tissue contact sensitivity. For the five remaining subjects, the signal-to-noise ratio, imaging depth, optical properties, and quantitative tissue concentrations of oxyhemoglobin, deoxyhemoglobin, water, and lipids from tumor and contralateral normal tissues were assessed. Statistical differences between tumor and contralateral normal tissue were found in chromophore concentrations and optical properties for four subjects. Low signal-to-noise was encountered during several subject's measurements, suggesting increased detector sensitivity will help to optimize DOSI for this patient population going forward. This study demonstrates that DOSI is capable of measuring optical properties and obtaining functional information in bone sarcomas. In the future, DOSI may provide a means to stratify treatment groups and monitor chemotherapy response for this disease.

  11. Bone sarcoma induction by 224Ra in Beagles: An interim report

    International Nuclear Information System (INIS)

    Mays, C.W.; Taylor, G.N.; Lloyd, R.D.; Bruenger, F.W.; Angus, W.

    1988-01-01

    During 1963-1968, 20 young adult Beagle dogs were given a single intravenous injection of 224 Ra that was unintentionally contaminated with 210 Pb and 228 Th. All of these dogs have died, eight with bone sarcomas. In addition, 128 Beagle dogs were given purified 224 Ra in one, ten or fifty weekly injections during 1977-1979. The acute lethal dosage (LD 50 ) for a single injection was about 400 kBq 224 Ra/kg (11 μCi 224 Ra/kg). As of September 14, 1987, at the highest skeletal dose of 3 Gy from purified 224 Ra, bone sarcomas occurred in 5 of 6 dogs at an average ± SD of 2069 ± 302 days after the start of injections (no survivors), in 4 of 6 dogs at 2485 ± 1,110 days after the start of 10 injections (healthy survivor) and in 1 of 8 dogs at 3066 days after a single injection (3 healthy survivors). At 3 Gy the toxicity of 224 Ra relative to 239 Pu, based on the ratio of skeletal doses at equal tumor appearance times, was 1.0 for 50 injections of 224 Ra, 0.7 for 10 injections, and 0.4 for one injection. In contrast, the effectiveness per Gy of a 224 Ra-equivalent dose from a single injection of 224 Ra contaminated with 228 Th and 210 Pb was equal to that from 239 Pu, assuming that the 224 Ra-equivalent dose equaled the 224 Ra dose plus the 228 Th dose pus 0.1 of the 210 Pb dose. A possible explanation is that protracted irradiation from the 1.91-yr half-life 228 Th and the 22.3-yr half-life 210 Pb may have 'activated' residual damage from the short-lived, 3.62 day half-life 224 Ra, possibly by stimulating the division of damaged stem cells to replace the bone cells killed by the protracted alpha particle irradiation. An important spin off from the study is experimental support for the assumption that the bone sarcoma effectiveness for 210 Pb is similar to that from long-lived, 1600 yr half-life 226 Ra. (author)

  12. Treatment of osteogenic sarcomas (and other bone sarcomas) by the association of radiotherapy (high dose per fraction) and BUdR as a radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Regnier, R.; Lejeune, F.; Kenis, Y.; Henry, J. (Institut Jules Bordet, Brussels (Belgium))

    1985-01-01

    The possibility to save the limb in cases of osteogenic sarcomas (with soft tissue involvement) was evaluated in a pilot study performed at the J. Bordet Institute (1978-1982). Ten patients whose tumour localized to the lower limb was deemed inappropriate for conservative surgery with prosthetic replacement, were treated, according to a method proposed by the Stanford University, California, by a few sessions of high dose irradiation and concomitant administration of BUdR as a radiosensitizer. By intra arterial perfusion. On the whole, the treatment salvaged an anatomical limb in 6 of 10 patients presenting with extensive lesions. It was also of some palliative value for 2 patients with osteogenic sarcomas of the skull or pelvis and for 5 patients with other forms of bone tumours. After comparing these results with the literature, the authors conclude that the method seems useful for this category of patients and worth new efforts to diminishing the sequelae (multiple daily fractions).

  13. Analysis of Dietary Intake during Consecutive-Day Chemotherapy for Bone and Soft-Tissue Sarcomas

    Directory of Open Access Journals (Sweden)

    Yuta Hori

    2018-01-01

    Full Text Available BackgroundBone and soft tissue sarcomas are commonly treated with consecutive-day chemotherapy regimens consisting of multiple anticancer agents. Chemotherapy-induced nausea and vomiting (CINV is a serious adverse effect of these regimens and may result in decreased energy intake during chemotherapy. Decreased energy intake may lead to undernutrition and may cause adverse effects on patient quality of life and survival.MethodsPatients with bone and soft tissue sarcomas who received consecutive-day chemotherapy were retrospectively evaluated. CINV and dietary energy intake were assessed, as well as the occurrences of hiccups and constipation during chemotherapy.ResultsA total of 13 patients, 10 males and 3 females, with a total 16 chemotherapy courses were included in the study. All patients received antiemetic prophylaxis. The CINV control rate, defined as no emesis and no rescue therapy, gradually decreased from chemotherapy day 1 (94% to day 5 (75%. Four patients experienced emesis, two of whom had been treated with a cisplatin-containing regimen. Decreased dietary energy intake was possibly associated with CINV during chemotherapy. Anorexia was grade 2 except for one case of grade 3. The incidences of hiccups and constipation were high on days 3–5.ConclusionAntiemetic prophylaxis treatment did not prevent emesis due to consecutive-day chemotherapy, especially with cisplatin-containing regimens, in patients with bone and soft-tissue tumors. Dietary energy intake decreased during chemotherapy, and this appeared to be associated with CINV. In addition, the incidence of hiccups and constipation increased during the course of consecutive-day chemotherapy regimens. Although these results are based on a small number of patients, it may be important to observe nutritional status during chemotherapy, as this may reflect a patient’s general condition. Nutritional counseling might be useful in supporting nutritional status in patients undergoing

  14. Surgical guides (patient-specific instruments) for pediatric tibial bone sarcoma resection and allograft reconstruction.

    Science.gov (United States)

    Bellanova, Laura; Paul, Laurent; Docquier, Pierre-Louis

    2013-01-01

    To achieve local control of malignant pediatric bone tumors and to provide satisfactory oncological results, adequate resection margins are mandatory. The local recurrence rate is directly related to inappropriate excision margins. The present study describes a method for decreasing the resection margin width and ensuring that the margins are adequate. This method was developed in the tibia, which is a common site for the most frequent primary bone sarcomas in children. Magnetic resonance imaging (MRI) and computerized tomography (CT) were used for preoperative planning to define the cutting planes for the tumors: each tumor was segmented on MRI, and the volume of the tumor was coregistered with CT. After preoperative planning, a surgical guide (patient-specific instrument) that was fitted to a unique position on the tibia was manufactured by rapid prototyping. A second instrument was manufactured to adjust the bone allograft to fit the resection gap accurately. Pathologic evaluation of the resected specimens showed tumor-free resection margins in all four cases. The technologies described in this paper may improve the surgical accuracy and patient safety in surgical oncology. In addition, these techniques may decrease operating time and allow for reconstruction with a well-matched allograft to obtain stable osteosynthesis.

  15. Surgical Guides (Patient-Specific Instruments for Pediatric Tibial Bone Sarcoma Resection and Allograft Reconstruction

    Directory of Open Access Journals (Sweden)

    Laura Bellanova

    2013-01-01

    Full Text Available To achieve local control of malignant pediatric bone tumors and to provide satisfactory oncological results, adequate resection margins are mandatory. The local recurrence rate is directly related to inappropriate excision margins. The present study describes a method for decreasing the resection margin width and ensuring that the margins are adequate. This method was developed in the tibia, which is a common site for the most frequent primary bone sarcomas in children. Magnetic resonance imaging (MRI and computerized tomography (CT were used for preoperative planning to define the cutting planes for the tumors: each tumor was segmented on MRI, and the volume of the tumor was coregistered with CT. After preoperative planning, a surgical guide (patient-specific instrument that was fitted to a unique position on the tibia was manufactured by rapid prototyping. A second instrument was manufactured to adjust the bone allograft to fit the resection gap accurately. Pathologic evaluation of the resected specimens showed tumor-free resection margins in all four cases. The technologies described in this paper may improve the surgical accuracy and patient safety in surgical oncology. In addition, these techniques may decrease operating time and allow for reconstruction with a well-matched allograft to obtain stable osteosynthesis.

  16. Prominent Intracytoplasmic Crystals in Alveolar Soft Part Sarcoma (ASPS): An Aid in Cytological Diagnosis.

    Science.gov (United States)

    Mannan, Rahul; Bhasin, Tejinder Singh; Kaur, Parampreet; Manjari, Mridu; Gill, Karamjit Singh

    2014-02-01

    Alveolar soft part sarcoma (ASPS) is a rare neoplasm of unknown histogenesis with poor prognosis. Due to the epithelioid appearance of the neoplastic cells, ASPS may resemble many neoplastic conditions, such as metastatic epithelial cell tumours with clear cell change, metastatic renal cell carcinoma, granular cell tumour, epithelioid sarcoma, malignant melanoma and even paragangliomas. Presence of abundant, rod like crystals in the cytoplasm of tumour cells is an important finding characteristic of this tumour, which helps in differentiating it from the other entities. The case study highlights the importance of correlating cytological features that help in reaching the diagnosis such as the background, cell morphology and presence of characteristic rod shaped crystals as immunohistochemical studies are often non-conclusive. The case also is unique as it demonstrates presence of intra-cytoplamic crystals in such abundance.

  17. Can FDG-PET/CT replace blind bone marrow biopsy of the posterior iliac crest in Ewing sarcoma?

    International Nuclear Information System (INIS)

    Kasalak, Oemer; Glaudemans, Andor W.J.M.; Overbosch, Jelle; Kwee, Thomas C.; Jutte, Paul C.

    2018-01-01

    To determine and compare the value of 18 F-fluoro-2-deoxy-d-glucose positron emission tomography/computed tomography (FDG-PET/CT) to blind bone marrow biopsy (BMB) of the posterior iliac crest in detecting metastatic bone marrow involvement in newly diagnosed Ewing sarcoma. This retrospective study included 20 patients with newly diagnosed Ewing sarcoma who underwent pretreatment FDG-PET/CT and a total of 38 blind BMBs (two unilateral and 18 bilateral) of the posterior iliac crest. FDG-PET/CT scans were evaluated for bone marrow involvement, both in the posterior iliac crest and other sites, and compared to blind BMB results. FDG-PET/CT was positive for bone marrow involvement in 7/38 posterior iliac crests, whereas BMB was positive in 5/38 posterior iliac crests. FDG-PET/CT and BMB results in the posterior iliac crest agreed in 36/38 cases (94.7%, 95% confidence interval [CI]: 82.7-98.5%). On a patient level, FDG-PET/CT was positive for bone marrow involvement in 4/20 patients, whereas BMB of the posterior iliac crest was positive in 3/20 patients. On a patient level, FDG-PET/CT and BMB results agreed in 19/20 patients (95.0%, 95% CI: 76.4-99.1%). The only discrepancies between FDG-PET/CT and BMB were observed in two BMBs of one patient. Both BMBs in this patient were negative, whereas FDG-PET/CT indicated bilateral posterior iliac crest involvement and also extensive bone marrow involvement elsewhere. FDG-PET/CT appears to be a valuable method for metastatic bone marrow assessment in newly diagnosed Ewing sarcoma. The routine use of blind BMB of the posterior iliac crest should be reconsidered when FDG-PET/CT is available. (orig.)

  18. Local changes in bone marrow at MRI after treatment of extremity soft tissue sarcoma

    International Nuclear Information System (INIS)

    Hwang, Sinchun; Lefkowitz, Robert; Landa, Jonathan; Akin, Oguz; Schwartz, Lawrence H.; Cassie, Conrad; Panicek, David M.; Healey, John H.; Alektiar, Kaled M.

    2009-01-01

    To determine the prevalence and appearance of magnetic resonance imaging (MRI) signal changes that occur in local bone marrow after radiation therapy (RT) and/or chemotherapy for extremity soft tissue sarcoma (STS). Seventy patients with primary STS at the level of a long bone who also had undergone pretreatment MRI and at least one post-treatment MRI of the tumor bed were identified. MRIs of each patient were retrospectively reviewed for new changes in marrow signal in the region of the tumor bed and for the morphology, relative signal intensities, heterogeneity, and progression or regression of changes over time. Focal signal changes in marrow were observed in 26/70 patients (37%) at a median of 9.5 months after RT and/or chemotherapy and diffuse changes in seven (10%) at a median of 8 months. Patients who received neither RT nor chemotherapy did not develop marrow changes. Mean RT doses in patients with changes and those without were 5,867 and 6,076 cGy, respectively. In most patients with focal changes, changes were seen in all sequences and were linear-curvilinear, patchy, or mixed at the level of the tumor bed. Predominant signal intensity of changes was between muscle and fat at T1WI and between muscle and fluid at fat-saturated T2WI or short tau inversion recovery. Most focal changes enhanced heterogeneously and increased or fluctuated in size over time. Changes in MRI appearance of long bone marrow frequently are evident after combined RT and chemotherapy for STS and most commonly increase or fluctuate in size over time. These changes have various non-mass-like configurations and often show signal intensities similar to those of red marrow and thus should not be mistaken for metastases. The marrow changes might represent an early stage of gelatinous transformation of marrow. (orig.)

  19. Collecting and Storing Tissue, Blood, and Bone Marrow Samples From Patients With Rhabdomyosarcoma or Other Soft Tissue Sarcoma

    Science.gov (United States)

    2017-12-11

    Adult Rhabdomyosarcoma; Childhood Desmoplastic Small Round Cell Tumor; Chordoma; Desmoid Tumor; Metastatic Childhood Soft Tissue Sarcoma; Nonmetastatic Childhood Soft Tissue Sarcoma; Previously Treated Childhood Rhabdomyosarcoma; Previously Untreated Childhood Rhabdomyosarcoma; Recurrent Adult Soft Tissue Sarcoma; Recurrent Childhood Rhabdomyosarcoma; Recurrent Childhood Soft Tissue Sarcoma; Stage I Adult Soft Tissue Sarcoma; Stage II Adult Soft Tissue Sarcoma; Stage III Adult Soft Tissue Sarcoma; Stage IV Adult Soft Tissue Sarcoma

  20. Development of a preclinical orthotopic xenograft model of ewing sarcoma and other human malignant bone disease using advanced in vivo imaging.

    Directory of Open Access Journals (Sweden)

    Britta Vormoor

    Full Text Available Ewing sarcoma and osteosarcoma represent the two most common primary bone tumours in childhood and adolescence, with bone metastases being the most adverse prognostic factor. In prostate cancer, osseous metastasis poses a major clinical challenge. We developed a preclinical orthotopic model of Ewing sarcoma, reflecting the biology of the tumour-bone interactions in human disease and allowing in vivo monitoring of disease progression, and compared this with models of osteosarcoma and prostate carcinoma. Human tumour cell lines were transplanted into non-obese diabetic/severe combined immunodeficient (NSG and Rag2(-/-/γc(-/- mice by intrafemoral injection. For Ewing sarcoma, minimal cell numbers (1000-5000 injected in small volumes were able to induce orthotopic tumour growth. Tumour progression was studied using positron emission tomography, computed tomography, magnetic resonance imaging and bioluminescent imaging. Tumours and their interactions with bones were examined by histology. Each tumour induced bone destruction and outgrowth of extramedullary tumour masses, together with characteristic changes in bone that were well visualised by computed tomography, which correlated with post-mortem histology. Ewing sarcoma and, to a lesser extent, osteosarcoma cells induced prominent reactive new bone formation. Osteosarcoma cells produced osteoid and mineralised "malignant" bone within the tumour mass itself. Injection of prostate carcinoma cells led to osteoclast-driven osteolytic lesions. Bioluminescent imaging of Ewing sarcoma xenografts allowed easy and rapid monitoring of tumour growth and detection of tumour dissemination to lungs, liver and bone. Magnetic resonance imaging proved useful for monitoring soft tissue tumour growth and volume. Positron emission tomography proved to be of limited use in this model. Overall, we have developed an orthotopic in vivo model for Ewing sarcoma and other primary and secondary human bone malignancies, which

  1. Chemokines in Ewing sarcoma

    NARCIS (Netherlands)

    Sand, L.G.L.

    2016-01-01

    Ewing sarcoma is an aggressive primary malignant bone tumor with high degree of tumor vascularization and is the second most common sarcoma of bone in children and young adults. Patients with disseminated disease at diagnosis or early relapse have a poor prognosis. To identify novel therapies and

  2. In vitro radiation studies on Ewing's sarcoma cell lines and human bone marrow: application to the clinical use of total body irradiation (TBI)

    International Nuclear Information System (INIS)

    Kinsella, T.J.; Mitchell, J.B.; McPherson, S.; Miser, J.; Triche, T.; Glatstein, E.

    1984-01-01

    Patients with Ewing's sarcoma who present with a central axis or proximal extremity primary and/or with metastatic disease have a poor prognosis despite aggressive combination chemotherapy and local irradiation. In this high risk group of patients, total body irradiation (TBI) has been proposed as a systemic adjuvant. To aid in the design of a clinical TBI protocol, the authors have studied in the in vitro radiation response of two established cell lines of Ewing's sarcoma and human bone marrow CFUc. The Ewing's lines showed a larger D 0 and anti-n compared to the bone marrow CFU. No repair of potentially lethal radiation damage (PLDR) was found after 4.5 Gy in plateau phase Ewing's sarcoma cells. A theoretical split dose survival curve for both the Ewing's sarcoma lines and human bone marrow CFUc using this TBI schedule shows a significantly lower surviving fraction (10 -4 -10 -5 ) for the bone marrow CFUc. Based on these in vitro results, two 4.0 Gy fractions separated by 24 hours is proposed as the TBI regimen. Because of the potentially irreversible damage to bone marrow, autologous bone marrow transplantation following the TBI is felt to be necessary. The details of this clinical protocol in high risk Ewing's sarcoma patients are outlined

  3. Treatment Outcome Following Transarterial Chemoembolization in Advanced Bone and Soft Tissue Sarcomas

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Chunyu; Wang, Jianbo, E-mail: a602131499@163.com [Shanghai Jiaotong University Affiliated Sixth People’s Hospital, Department of Radiology (China); Wang, Yonggang [Shanghai Jiaotong University Affiliated Sixth People’s Hospital, Department of Oncology (China); Zhao, Jungong; Zhu, Yueqi; Ma, Xu; Zhou, Jia [Shanghai Jiaotong University Affiliated Sixth People’s Hospital, Department of Radiology (China); Yan, Xuebing [Shanghai Jiaotong University Affiliated Sixth People’s Hospital, Department of General Surgery (China)

    2016-10-15

    PurposeTransarterial chemoembolization (TACE) is used to treat unresectable bone and soft tissue sarcoma (STS) and as a pre-surgical adjuvant treatment. However, its efficiency for advanced STS is undetermined. This study evaluated TACE’s efficiency in treating advanced STS and prognostic factors for patient survival.Materials and MethodsWe enrolled 39 patients with unresectable STS who underwent TACE as an alternative treatment during 2010–2014, with overall survival (OS) as the primary end point. Cancer pain was evaluated by visual analogue scores (VAS) before and after TACE procedures. Factors that affect survival were evaluated by multivariate analyses (Cox proportional hazard model).ResultsMean OS after TACE was 23.7 ± 2.1 months, with 1-year OS 71.5 %, 2-year OS 45.8 %, and 3-year OS 32.5 %. Lesion number and tumor stage were key predictors of survival. TACE was found to decrease cancer pain VAS and increase relapse interval. Size of polyvinyl alcohol (PVA) particle diameter (P = 0.03) and imaging response (P = 0.044) were also found to affect relapse interval.ConclusionTACE was an effective treatment for advanced STS, with a 32.5 % 3-year OS rate, and led to lower cancer pain VAS and longer relapse intervals than chemoinfusion only. Smaller PVA particles are preferable during the TACE procedure.

  4. Image guided surgery : New technology for surgery of soft tissue and bone sarcomas

    NARCIS (Netherlands)

    Reijnders, K.; Coppes, M. H.; van Hulzen, A. L. J.; Gravendeel, J. P.; van Ginkel, R. J.; Hoekstra, H. J.

    Aim: Providing the surgical oncologist with a new means of performing safe and radical sarcoma surgery with the help of image guidance technology. Method: Two patients with pelvic sarcomas were operated upon with the help of an intra-operative navigation system. The technology of image guided

  5. Ewing sarcoma of the bone in children under 6 years of age.

    Directory of Open Access Journals (Sweden)

    Maria Antonietta De Ioris

    Full Text Available BACKGROUND: Ewing Sarcoma Family Tumours (ESFT are rare in early childhood. The aim of this study was to report the clinical characteristics and outcome of children under 6 years of age affected by ESFT of the bone in Italy. METHODS: The records of all the children diagnosed with osseous ESFT in centres members of the Associazione Italiana di Ematologia ed Oncologia Pediatrica (AIEOP from 1990 to 2008 were reviewed. The Kaplan-Meier method was used for estimating overall and progression-free survival (OS, PFS curves; multivariate analyses were performed using Cox proportional hazards regression model. RESULTS: This study includes 62 patients. An axial primary localization was present in 66% of patients, with the primary site in the chest wall in 34%. Fourteen (23% patients presented metastatic disease. The 5-year OS and PFS were 73% (95% confidence interval, CI, 58-83% and 72% (95% CI 57-83% for patients with localized disease and 38% (95% CI 17-60% and 21% (95% CI 5-45% for patients with metastatic disease. Metastatic spread, skull/pelvis/spine primary localization, progression during treatment and no surgery predicted worse survival (P<0.01, while patients treated in the last decade had better survival (P = 0.002. In fact, the 5-year OS and PFS for patients diagnosed in the period 2000-2008 were 89% (95% CI 71-96% and 86% (95% CI 66-94%, respectively. CONCLUSION: The axial localization is the most common site of ESFT in pre-scholar children. Patients treated in the most recent period have an excellent outcome.

  6. Sarcomas de partes moles: experiência cirúrgica de cinco anos em hospital escola

    Directory of Open Access Journals (Sweden)

    Gabrielle Amaral Nunes

    2012-10-01

    Full Text Available INTRODUÇÃO Os sarcomas de partes moles compõem um grupo heterogêneo de neoplasias malignas com diferentes padrões morfológicos da linhagem mesenquimal. O Hospital de Clínicas de Porto Alegre (HCPA é um centro de referência para tratamento desta doença, interessando, por isso, o conhecimento de dados demográficos, clínicos, anátomo-patológicos e terapêuticos dos casos aqui tratados. OBJETIVO Estudar retrospectivamente os registros de pacientes operados por sarcomas de partes moles no HCPA nos últimos cinco anos e cotejar os resultados com os encontrados na literatura, como estadiamento, tipo histológico, localização e tratamento.  MÉTODOS Foram revisados os prontuários eletrônicos de pacientes com 18 ou mais anos de idade, que foram submetidos a tratamento cirúrgico de sarcoma de partes moles, no período entre 2006-2011. Os dados foram registrados em banco de dados no Microsoft Excel, no qual se coletaram informações referentes a idade, sexo, características histopatológicas, estadiamento, tipo de cirurgia, margens cirúrgicas, complicações cirúrgicas, tempo livre de doença, sobrevida e tratamentos complementares. RESULTADOS Os prontuários de 141 pacientes foram avaliados. Excluídos os casos com cirurgia em outra instituição e os que não foram tratados com cirurgia, 40 prontuários compuseram esta amostra. Os tipos histológicos mais frequentes foram histiocitoma fibroso maligno (27,5% e fibrossarcoma (15%, tumor desmoide (12,5%, leiomiossarcoma (10% e GIST (10%. Os locais mais acometidos foram os membros inferiores (40% e o abdome (30%. A maioria dos pacientes apresentava doença em estádio avançado (III no momento da cirurgia, principalmente devido ao grande tamanho do tumor (média de 12,2 cm e ao alto grau histológico (G3, encontrado em 50% dos pacientes. Cirurgias conservadoras de extremidades foram realizadas em 85% dos pacientes. Em 80% dos casos foi indicado tratamento complementar. A média do

  7. Evaluation of static and dynamic MRI for assessing response of bone sarcomas to preoperative chemotherapy: Correlation with histological necrosis

    International Nuclear Information System (INIS)

    Amit, Priyadarshi; Malhotra, Atul; Kumar, Rahul; Kumar, Lokesh; Patro, Dilip Kumar; Elangovan, Sundar

    2015-01-01

    Preoperative chemotherapy plays a key role in management of bone sarcomas. Postoperative evaluation of histological necrosis has been the gold standard method of assessing response to preoperative chemotherapy. This study was done to evaluate the efficacy of static and dynamic magnetic resonance imaging (MRI) for assessing response preoperatively. Our study included 14 patients (12 osteosarcomas and 2 malignant fibrous histiocytomas) with mean age of 21.8 years, treated with preoperative chemotherapy followed by surgery. They were evaluated with static and dynamic MRI twice, before starting chemotherapy and again prior to surgery. Change in tumor volume and slope of signal intensity - time curve were calculated and correlated with percentage of histological necrosis using Pearson correlation test. The change in dynamic MRI slope was significant (P = 0.001). Also, ≥60% reduction in slope of the curve proved to be an indicator of good histological response [positive predictive value (PPV) =80%]. Change in tumor volume failed to show significant correlation (P = 0.071). Although it showed high negative predictive value (NPV = 85.7%), PPV was too low (PPV = 57.14%). Dynamic MRI correctly predicts histological necrosis after administration of preoperative chemotherapy to bone sarcomas. Hence, it can be used as a preoperative indicator of response to neoadjuvant chemotherapy. On the other hand, volumetric assessment by static MRI is not an effective predictor of histological necrosis. This study proves the superiority of dynamic contrast-enhanced study over volumetric study by MRI

  8. Targeted therapy for sarcomas

    Directory of Open Access Journals (Sweden)

    Forscher C

    2014-03-01

    Full Text Available Charles Forscher,1 Monica Mita,2 Robert Figlin3 1Sarcoma Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 2Experimental Therapeutics Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 3Academic Development Program, Samuel Oschin Comprehensive Cancer Institute, and Division of Hematology/Oncology, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: Sarcomas are tumors of mesenchymal origin that make up approximately 1% of human cancers. They may arise as primary tumors in either bone or soft tissue, with approximately 11,280 soft tissue tumors and 2,650 bone tumors diagnosed each year in the United States. There are at least 50 different subtypes of soft tissue sarcoma, with new ones described with ever-increasing frequency. One way to look at sarcomas is to divide them into categories on the basis of their genetic make-up. One group of sarcomas has an identifiable, relatively simple genetic signature, such as the X:18 translocation seen in synovial sarcoma or the 11:22 translocation seen in Ewing's sarcoma. These specific abnormalities often lead to the presence of fusion proteins, such as EWS-FLI1 in Ewing's sarcoma, which are helpful as diagnostic tools and may become therapeutic targets in the future. Another group of sarcomas is characterized by complex genetic abnormalities as seen in leiomyosarcoma, osteosarcoma, and undifferentiated sarcoma. It is important to keep these distinctions in mind when contemplating the development of targeted agents for sarcomas. Different abnormalities in sarcoma could be divided by tumor subtype or by the molecular or pathway abnormality. However, some existing drugs or drugs in development may interfere with or alter more than one of the presented pathways. Keywords: sarcoma, targeted agents, tyrosine kinase inhibitors, mTor inhibition

  9. Quality of Life and Utility in Patients with Metastatic Soft Tissue and Bone Sarcoma: The Sarcoma Treatment and Burden of Illness in North America and Europe (SABINE Study

    Directory of Open Access Journals (Sweden)

    Peter Reichardt

    2012-01-01

    Full Text Available The aim of the study was to assess health-related quality of life (HRQoL among metastatic soft tissue (mSTS or bone sarcoma (mBS patients who had attained a favourable response to chemotherapy. We employed the EORTC QLQ-C30, the 3-item Cancer-Related Symptoms Questionnaire, and the EQ-5D instrument. HRQoL was evaluated overall and by health state in 120 mSTS/mBS patients enrolled in the SABINE study across nine countries in Europe and North America. Utility was estimated from responses to the EQ-5D instrument using UK population-based weights. The mean EQ-5D utility score was 0.69 for the pooled patient sample with little variation across health states. However, patients with progressive disease reported a clinically significant lower utility (0.56. Among disease symptoms, pain and respiratory symptoms are common. This study showed that mSTS/mBS is associated with reduced HRQoL and utility among patients with metastatic disease.

  10. Kaposi's sarcoma in the northern part of Nigeria: pre-aids era ...

    African Journals Online (AJOL)

    Background: In the last two decades, the incidence of Kaposi's sarcoma has increased due to acquired immune deficiency syndrome epidemic. This study was designed to highlight the characteristic features of Kaposi's sarcoma in our centre before this epidemic. Method: In a retrospective study, all histologically diagnosed ...

  11. Ewing sarcoma

    International Nuclear Information System (INIS)

    Hamanoue, Satoshi; Makimoto, Atsushi

    2007-01-01

    Ewing sarcoma is the second most frequent primary bone cancer affecting children or young adults. Advances in molecular biology have revealed common chromosomal translocations such as EWS-FLI1 among Ewing sarcoma and related diseases such as primitive neuroectodermal tumor (PNET), so these are considered as Ewing sarcoma family tumor (ESFT). Although fewer than 10% of patients with ESFT survived before establishment of modern multiagent chemotherapy, the multimodal therapeutic regimens including combination chemotherapy, radiotherapy, and surgery can cure 60% of patients with localized disease, due to the collaborative research in European-American or the international trials. The standard chemotherapy for localized ESFT now comprises vincristine, actinomycin D, cyclophosphamide and doxorubicin (VACD) in Europe or vincristine, doxorubicin, cyclophosphamide, ifosfamide and etoposide (VDC-IE) in North America. Meanwhile, those with metastatic disease have a much worse outcome with an approximately 10-30% 5-year event-free survival rate. New American-European collaborative trials such as EURO-E.W.I.N.G. 99 are in progress for further improvement of the cure rate in localized and metastatic ESFT. In Japan, Japan Ewing Sarcoma Study Group (JESS) phase II clinical trial for localized ESFT, and some clinical trials including new drugs are ongoing and waiting for results. (author)

  12. A reappraisal of hemangiopericytoma of bone; analysis of cases reclassified as synovial sarcoma and solitary fibrous tumor of bone

    DEFF Research Database (Denmark)

    Verbeke, Sofie L J; Fletcher, Christopher D M; Alberghini, Marco

    2010-01-01

    Hemangiopericytoma (HPC) was first described as a neoplasm with distinct morphologic features, presumably composed of pericytes. In soft tissue, it is accepted that most such lesions are solitary fibrous tumors (SFTs), monophasic synovial sarcomas (SSs), or myofibromatoses. It is unclear whether...

  13. A reappraisal of hemangiopericytoma of bone; analysis of cases reclassified as synovial sarcoma and solitary fibrous tumor of bone

    DEFF Research Database (Denmark)

    Verbeke, Sofie L J; Fletcher, Christopher D M; Alberghini, Marco

    2010-01-01

    Hemangiopericytoma (HPC) was first described as a neoplasm with distinct morphologic features, presumably composed of pericytes. In soft tissue, it is accepted that most such lesions are solitary fibrous tumors (SFTs), monophasic synovial sarcomas (SSs), or myofibromatoses. It is unclear whether ...

  14. MR imaging of clear cell sarcoma (malignant melanoma of the soft parts): a multicenter correlative MRI-pathology study of 21 cases and literature review

    International Nuclear Information System (INIS)

    Beuckeleer, L.H. de; Schepper, A.M. de; Vandevenne, J.E.; Bloem, J.L.; Davies, A.M.; Oudkerk, M.; Hauben, E.; Marck, E. van; Somville, J.; Vanel, D.; Steinbach, L.S.; Guinebretiere, J.M.; Hogendoorn, P.C.W.; Mooi, W.J.; Verstraete, K.; Zaloudek, C.; Jones, H.

    2000-01-01

    Objective. To evaluate MR imaging and pathology findings in order to define the characteristic features of clear cell sarcoma of the soft tissues (malignant melanoma of the soft parts).Design and patients. MR examinations of 21 patients with histologically proven clear cell sarcoma of the musculoskeletal system were retrospectively reviewed and assessed for shape, homogeneity, delineation, signal intensities on T1- and T2-weighted images, contrast enhancement, relationship with adjacent fascia or tendon, secondary bone involvement, and intratumoral necrosis. In 19 cases the pathology findings were available for review and for a comparative MR-pathology study.Results. On T1-weighted images, lesions were isointense (n=3), hypointense (n=7) or slightly hyperintense to muscle (n=11). Immunohistochemical examination was performed in 17 patients. All 17 specimens showed positivity for HMB-45 antibody. In nine of 11 lesions with slightly increased signal intensity on T1-weighted images, a correlative MR imaging-pathology study was possible. All nine were positive to HMB-45 antibody.Conclusions. Clear cell sarcoma of the musculoskeletal system often has a benign-looking appearance on MR images. In up to 52% of patients, this lesion with melanocytic differentiation has slightly increased signal intensity on T1-weighted images compared with muscle. As the presence of this relative higher signal intensity on T1-weighted images is rather specific for tumors displaying melanocytic differentiation, radiologists should familiarize themselves with this rare entity and include it in their differential diagnosis when confronted with a well-defined, homogeneous, strongly enhancing mass with slightly higher signal intensity compared with muscle on native T1-weighted images. (orig.)

  15. The role of FDG PET/CT in patients treated with neoadjuvant chemotherapy for localized bone sarcomas

    Energy Technology Data Exchange (ETDEWEB)

    Palmerini, Emanuela; Marchesi, Emanuela; Paioli, Anna; Ferrari, Stefano [Istituto Ortopedico Rizzoli, Chemotherapy, Bologna (Italy); Colangeli, Marco; Donati, Davide; Cevolani, Luca; De Paolis, Massimiliano [Istituto Ortopedico Rizzoli, Orthopaedic Surgery, Bologna (Italy); Nanni, Cristina; Fanti, Stefano; Cambioli, Silvia [Sant' Orsola Hospital, Nuclear Medicine, Bologna (Italy); Picci, Piero [Istituto Ortopedico Rizzoli, Research Laboratory, Bologna (Italy); Gambarotti, Marco [Istituto Ortopedico Rizzoli, Surgical Pathology, Bologna (Italy); Istituto Ortopedico Rizzoli, Radiology, Musculoskeletal Oncology Department, Bologna (Italy)

    2017-02-15

    The histological response to neoadjuvant chemotherapy is an important prognostic factor in patients with osteosarcoma (OS) and Ewing sarcoma (EWS). The aim of this study was to assess baseline primary tumour FDG uptake on PET/CT, and serum values of alkaline phosphatase (ALP) and lactate dehydrogenase (LDH), to establish whether these factors are correlated with tumour necrosis and prognosis. Patients treated between 2009 and 2014 for localized EWS and OS, who underwent FDG PET/CT as part of their staging work-up, were included. The relationships between primary tumour SUVmax at baseline (SUV1), SUVmax after induction chemotherapy (SUV2), metabolic response calculated as [(SUV1 - SUV2)/(SUV1)] x 100, LDH and ALP and tumour response/survival were analysed. A good response (GR) was defined as tumour necrosis >90 % in patients with OS, and grade II-III Picci necrosis (persistence of microscopic foci only or no viable tumor) in patients with Ewing sarcoma. The study included 77 patients, 45 with EWS and 32 with OS. A good histological response was achieved in 53 % of EWS patients, and 41 % of OS patients. The 3-year event-free survival (EFS) was 57 % in EWS patients and 48 % OS patients. The median SUV1 was 5.6 (range 0 - 17) in EWS patients and 7.9 (range 0 - 24) in OS patients (p = 0.006). In EWS patients the GR rate was 30 % in those with a high SUV1 (≥6) and 72 % in those with a lower SUV1 (p = 0.0004), and in OS patients the GR rate was 29 % in those with SUV1 ≥6 and 64 % in those with a lower SUV1 (p = 0.05). In the univariate analysis the 3-year EFS was significantly better in patients with a low ALP level (59 %) than in those with a high ALP level (22 %, p = 0.02) and in patients with a low LDH level (62 %) than in those with a high LDH level (37 %, p = 0.004). In EWS patients the 3-year EFS was 37 % in those with a high SUV1 and 75 % in those with a low SUV1 (p = 0.004), and in OS patients the 3-year EFS was 32 % in those with a high SUV1 and 66 % in those

  16. Performance of Positron Emission Tomography and Positron Emission Tomography/Computed Tomography Using Fluorine-18-Fluorodeoxyglucose for the Diagnosis, Staging, and Recurrence Assessment of Bone Sarcoma

    Science.gov (United States)

    Liu, Fanxiao; Zhang, Qingyu; Zhu, Dezhi; Li, Zhenfeng; Li, Jianmin; Wang, Boim; Zhou, Dongsheng; Dong, Jinlei

    2015-01-01

    Abstract To investigate the performance of fluorine-18-fluorodeoxyglucose (18F-FDG) positron emission tomography (PET) and PET/computed tomography (CT) in the diagnosis, staging, restaging, and recurrence surveillance of bone sarcoma by systematically reviewing and meta-analyzing the published literature. To retrieve eligible studies, we searched the MEDLINE, Embase, and the Cochrane Central library databases using combinations of following Keywords: “positron emission tomography” or “PET,” and “bone tumor” or “bone sarcoma” or “sarcoma.” Bibliographies from relevant articles were also screened manually. Data were extracted and the pooled sensitivity, specificity, and diagnostic odds ratio (DOR), on an examination-based or lesion-based level, were calculated to appraise the diagnostic accuracy of 18F-FDG PET and PET/CT. All statistical analyses were performed using Meta-Disc 1.4. Forty-two trials were eligible. The pooled sensitivity and specificity of PET/CT to differentiate primary bone sarcomas from benign lesions were 96% (95% confidence interval [CI], 93–98) and 79% (95% CI, 63–90), respectively. For detecting recurrence, the pooled results on an examination-based level were sensitivity 92% (95% CI, 85–97), specificity 93% (95% CI, 88–96), positive likelihood ratio (PLR) 10.26 (95% CI, 5.99–17.60), and negative likelihood ratio (NLR) 0.11 (95% CI, 0.05–0.22). For detecting distant metastasis, the pooled results on a lesion-based level were sensitivity 90% (95% CI, 86–93), specificity 85% (95% CI, 81–87), PLR 5.16 (95% CI, 2.37–11.25), and NLR 0.15 (95% CI, 0.11–0.20). The accuracies of PET/CT for detecting local recurrence, lung metastasis, and bone metastasis were satisfactory. Pooled outcome estimates of 18F-FDG PET were less complete compared with those of PET/CT. 18F-FDG PET and PET/CT showed a high sensitivity for diagnosing primary bone sarcoma. Moreover, PET/CT demonstrated excellent accuracy for the staging

  17. Alveolar Soft Part Sarcoma of Urinary Bladder Occurring as a Second Primary Malignancy: A Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Manint Usawachintachit

    2016-01-01

    Full Text Available We report a case of bladder alveolar soft part sarcoma in an 18-year-old Thai male patient who had been treated with testicular radiation and systemic chemotherapy for acute lymphoblastic leukemia with testicular relapse. He presented with recurrent dysuria and gross hematuria. Cystoscopy revealed a 2-centimeter irregular sessile mass at the bladder base adjacent to left ureteral orifice. Transurethral resection of the tumor was performed. The histopathological diagnosis was alveolar soft part sarcoma. Chest and abdominal computed tomography showed no evidence of metastasis. He was treated with partial cystectomy and left ureteral reimplantation with negative surgical margin. No evidence of recurrence was found during a 28-month follow-up period with surveillance cystoscopy and computed tomography of the chest and abdomen.

  18. Ewing's sarcoma, fibrogenic tumors, giant cell tumor, hemangioma of bone. Radiology and pathology; Ewing-Sarkom, fibrogene Tumoren, Riesenzelltumor, Haemangiom des Skeletts. Radiologie und Pathologie

    Energy Technology Data Exchange (ETDEWEB)

    Freyschmidt, J. [Beratungsstelle und Referenzzentrum fuer Osteoradiologie, Bremen (Germany); Ostertag, H. [Klinikum Region Hannover GmbH, Pathologisches Institut, Hannover (Germany)

    2016-06-15

    Radiological imaging only reflects the anatomy and its pathological abnormalities. Therefore, the radiologist should be able to recognize the basic features of the pathological anatomy of bone tumors. This can only be learned working closely with a pathologist who is experienced in this field. On the other hand, the pathologist needs from the radiologist their diagnostic assessment with information on size, location, aggressiveness and the existence of a bone tumor's matrix, of the whole lesion, because he usually only receives a small part for examination in the form of a biopsy. In this article, the features and fundamentals (standards) of radiological-pathological cooperation as the mainstay for a precise diagnosis in bone tumors are outlined. The radiological appearance and the histopathological features behind it are presented for Ewing's sarcoma, fibrogenic tumors, giant cell tumor, and hemangioma of the bone. (orig.) [German] Radiologische Bilder spiegeln nichts anderes als die Anatomie und ihre pathologischen Abweichungen wider. Deshalb sollte der Radiologe die Grundzuege der pathologischen Anatomie auch von Knochentumoren kennen. Das kann er nur durch eine enge Zusammenarbeit mit einem auf diesem Gebiet erfahrenen Pathologen erlernen. Andererseits braucht der Pathologe vom Radiologen dessen diagnostische Einschaetzung mit Informationen ueber die Groesse, Lage, Aggressivitaet und das Vorhandensein einer Matrix eines Knochentumors und zwar von der gesamten Laesion, denn er bekommt inform einer Biopsie i. d. R. nur einen mehr oder weniger kleinen Teil zur Untersuchung. In diesem Beitrag werden die Grundzuege und Standards der radiologisch-pathologischen Zusammenarbeit aufgezeigt, auf denen eine praezise Diagnosestellung beruht. Radiologisches Erscheinungsbild und die dahintersteckenden - und erklaerenden - histopathologischen Merkmale werden fuer das Ewing-Sarkom, fuer fibrogene Tumoren, den Riesenzelltumor und das Haemangiom des Knochens

  19. Down-regulated E-cadherin expression is associated with poor five-year overall survival in bone and soft tissue sarcoma: results of a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Ning Wang

    Full Text Available To conduct a meta-analysis to evaluate the prognostic role of E-cadherin expression in bone and soft tissue sarcomas.The PubMed, EMBASE, and Web of Science databases were searched using terms related to E-cadherin, sarcoma, and prognosis for all articles published in English before March 2014. Pooled effect was calculated from the available data to evaluate the association between negative E-cadherin expression and 5-year overall survival and tumor clinicopathological features in sarcoma patients. Pooled odds ratios (OR and risk ratios (RR with 95% confidence intervals (CI were calculated using a fixed-effects model.Eight studies met the selection criteria and reported on 812 subjects. A total of 496 subjects showed positive E-cadherin expression (59.9%. Negative E-cadherin expression in bone and soft tissue sarcomas was correlated with lower 5-year overall survival (OR = 3.831; 95% CI: 2.246-6.534, and was associated with higher clinical stage (RR = 1.446; 95% CI: 1.030-2.028 and with male sex (RR = 0.678; 95% CI: 0.493-0.933.In the E-cadherin negative group, 5-year overall survival was significantly worse than in the E-cadherin positive group. However, further studies are required to confirm these results.

  20. Bone biology and physiology: Part I. The fundamentals.

    Science.gov (United States)

    Buck, Donald W; Dumanian, Gregory A

    2012-06-01

    The principles of bone biology and physiology permeate all subspecialty practices in plastic and reconstructive surgery from hand surgery to aesthetic surgery. Despite its importance in our practices, the biology of bone healing and bone physiology rarely surfaces within textbooks, literature reviews, or residency curricula. In this article, the authors present the first of a two-part series reviewing the important concepts of bone biology and bone physiology relevant to plastic surgery in an effort to ameliorate this educational gap.

  1. Technetium-99 m-MDP scintigraphy and long-term follow-up of musculo-skeletal sarcoma reconstructed with pasteurized autologous bone graft.

    Science.gov (United States)

    Ahmed, Adel Refaat

    2009-04-01

    Local bone tumor excision followed by pasteurization and reimplantation is a unique technique of reconstruction for sarcoma patients. The long-term scintigraphic findings of pasteurized bone grafts in relation to clinical patients' data were reviewed retrospectively. Twenty-two sarcoma patients (mean age, 24 years) done between April 2000 and January 2004 constituted the material of this study. One hundred and fifty-two 99 m TC-methylene diphosphonate (MDP) whole-body scans were reviewed. Initially, all autografts appeared as photon deficient areas. Diffusely increased bone uptake was present at the osteotomy sites within 4-6 months after surgery, the uptake of the grafted pasteurized bone was detected in 17 patients from about 6 months after surgery. Of 22 patients, 11 (50%) showed higher uptake than the normal bone, 6 (27%) had uptake similar to the normal bone, while 5 (23%) had less uptake than the normal bone. Radiologically, 15 patients (68%) showed complete incorporation of graft and 5 patients (23%) had partial incorporation. Oncologically, 16 patients are disease free, while 6 died of disease. No local recurrence was detected at a mean of 59 months, while fracture (13.6%) eventually healed with bone grafting and revision of internal fixation, graft collapse (9%) (needed revision arthroplasty) and infection (9%), one cured and one converted to rotationplasty, were the major complications encountered. Significantly more mechanical complications were seen when tracer uptake suggestive of revascularization occurred; thus, revascularization and partial bone ingrowth are not sufficient conditions for lower mechanical complication rate. The method of pasteurization of bone is a useful option for reconstruction after resection of malignant bone tumors.

  2. Kaposi sarcoma herpesvirus pathogenesis.

    Science.gov (United States)

    Mariggiò, Giuseppe; Koch, Sandra; Schulz, Thomas F

    2017-10-19

    Kaposi sarcoma herpesvirus (KSHV), taxonomical name human gammaherpesvirus 8, is a phylogenetically old human virus that co-evolved with human populations, but is now only common (seroprevalence greater than 10%) in sub-Saharan Africa, around the Mediterranean Sea, parts of South America and in a few ethnic communities. KSHV causes three human malignancies, Kaposi sarcoma, primary effusion lymphoma, and many cases of the plasmablastic form of multicentric Castleman's disease (MCD) as well as occasional cases of plasmablastic lymphoma arising from MCD; it has also been linked to rare cases of bone marrow failure and hepatitis. As it has colonized humans physiologically for many thousand years, cofactors are needed to allow it to unfold its pathogenic potential. In most cases, these include immune defects of genetic, iatrogenic or infectious origin, and inflammation appears to play an important role in disease development. Our much improved understanding of its life cycle and its role in pathogenesis should now allow us to develop new therapeutic strategies directed against key viral proteins or intracellular pathways that are crucial for virus replication or persistence. Likewise, its limited (for a herpesvirus) distribution and transmission should offer an opportunity for the development and use of a vaccine to prevent transmission.This article is part of the themed issue 'Human oncogenic viruses'. © 2017 The Authors.

  3. Imaging Ewing's sarcoma

    International Nuclear Information System (INIS)

    Henk, C.B.; Grampp, S.; Kainberger, F.; Breitenseher, M.; Imhof, H.; Mostbeck, G.H.

    1998-01-01

    Ewing's sarcoma is a highly malignant neoplasm of the bone whose origin is still uncertain. A strong relationship exists between Ewing's sarcoma and tumors of neural origin (Ewing family of tumors). Ewing's sarcoma must be distinguished from other round-cell tumors like lymphoma and neuroblastoma and also must be differentiated from osteogenic sarcomas. On plain radiographs, Ewing's sarcoma appears as a lytic or mixed lytic-sclerotic, rarely as predominantly sclerotic lesion with margins Lodwick grade III. It is located primarily in the diaphyseal and metadiaphyseal regions of the long bones of the lower extremities. A large soft tissue tumor is usually present. Magnetic resonance imaging is the imaging modality of choice to evaluate the extent of the primary lesion, to monitor the response to neoadjuvant chemotherapy and to follow up non-resected Ewing's sarcomas. Bone scintigraphy is necessary to detect skeletal metastasis, and 201 thallium scanning has been shown to be sensitive in the monitoring of treatment response. Today, computed tomography is not longer used to image the tumor site; however, spiral CT of the lungs plays a central role as a staging and follow-up tool. (orig.) [de

  4. Histologic Appearance After Preoperative Radiation Therapy for Soft Tissue Sarcoma: Assessment of the European Organization for Research and Treatment of Cancer-Soft Tissue and Bone Sarcoma Group Response Score.

    Science.gov (United States)

    Schaefer, Inga-Marie; Hornick, Jason L; Barysauskas, Constance M; Raut, Chandrajit P; Patel, Sagar A; Royce, Trevor J; Fletcher, Christopher D M; Baldini, Elizabeth H

    2017-06-01

    To critically assess the prognostic value of the European Organization for Research and Treatment of Cancer-Soft Tissue and Bone Sarcoma Group (EORTC-STBSG) response score and define histologic appearance after preoperative radiation therapy (RT) for soft tissue sarcoma (STS). For a cohort of 100 patients with STS of the extremity/trunk treated at our institution with preoperative RT followed by resection, 2 expert sarcoma pathologists evaluated the resected specimens for percent residual viable cells, necrosis, hyalinization/fibrosis, and infarction. The EORTC response score and other predictors of recurrence-free survival (RFS) and overall survival (OS) were assessed by Kaplan-Meier and proportional hazard models. Median tumor size was 7.5 cm; 92% were intermediate or high grade. Most common histologies were unclassified sarcoma (34%) and myxofibrosarcoma (25%). Median follow-up was 60 months. The 5-year local recurrence rate was 5%, 5-year RFS was 68%, and 5-year OS was 75%. Distribution of cases according to EORTC response score tiers was as follows: no residual viable tumor for 9 cases (9% pathologic complete response); <1% viable tumor for 0, ≥1% to <10% for 9, ≥10% to <50% for 44, and ≥50% for 38. There was no association between EORTC-STBSG response score and RFS or OS. Conversely, hyalinization/fibrosis was a significant independent favorable predictor for RFS (hazard ratio 0.49, P=.007) and OS (hazard ratio 0.36, P=.02). Histologic evaluation after preoperative RT for STS showed a 9% pathologic complete response rate. The EORTC-STBSG response score and percent viable cells were not prognostic. Hyalinization/fibrosis was associated with favorable outcome, and if validated, may become a valid endpoint for neoadjuvant trials. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Histologic Appearance After Preoperative Radiation Therapy for Soft Tissue Sarcoma: Assessment of the European Organization for Research and Treatment of Cancer–Soft Tissue and Bone Sarcoma Group Response Score

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, Inga-Marie; Hornick, Jason L. [Department of Pathology, Brigham and Women' s Hospital, Harvard Medical School, Boston, Massachusetts (United States); Barysauskas, Constance M. [Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States); Raut, Chandrajit P. [Division of Surgical Oncology, Brigham and Women' s Hospital, Harvard Medical School, Boston, Massachusetts (United States); Center for Sarcoma and Bone Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States); Patel, Sagar A.; Royce, Trevor J. [Department of Radiation Oncology, Brigham and Women' s Hospital, Harvard Medical School, Boston, Massachusetts (United States); Fletcher, Christopher D.M. [Department of Pathology, Brigham and Women' s Hospital, Harvard Medical School, Boston, Massachusetts (United States); Baldini, Elizabeth H., E-mail: ebaldini@partners.org [Center for Sarcoma and Bone Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States); Department of Radiation Oncology, Brigham and Women' s Hospital, Harvard Medical School, Boston, Massachusetts (United States)

    2017-06-01

    Purpose: To critically assess the prognostic value of the European Organization for Research and Treatment of Cancer–Soft Tissue and Bone Sarcoma Group (EORTC-STBSG) response score and define histologic appearance after preoperative radiation therapy (RT) for soft tissue sarcoma (STS). Methods and Materials: For a cohort of 100 patients with STS of the extremity/trunk treated at our institution with preoperative RT followed by resection, 2 expert sarcoma pathologists evaluated the resected specimens for percent residual viable cells, necrosis, hyalinization/fibrosis, and infarction. The EORTC response score and other predictors of recurrence-free survival (RFS) and overall survival (OS) were assessed by Kaplan-Meier and proportional hazard models. Results: Median tumor size was 7.5 cm; 92% were intermediate or high grade. Most common histologies were unclassified sarcoma (34%) and myxofibrosarcoma (25%). Median follow-up was 60 months. The 5-year local recurrence rate was 5%, 5-year RFS was 68%, and 5-year OS was 75%. Distribution of cases according to EORTC response score tiers was as follows: no residual viable tumor for 9 cases (9% pathologic complete response); <1% viable tumor for 0, ≥1% to <10% for 9, ≥10% to <50% for 44, and ≥50% for 38. There was no association between EORTC-STBSG response score and RFS or OS. Conversely, hyalinization/fibrosis was a significant independent favorable predictor for RFS (hazard ratio 0.49, P=.007) and OS (hazard ratio 0.36, P=.02). Conclusion: Histologic evaluation after preoperative RT for STS showed a 9% pathologic complete response rate. The EORTC-STBSG response score and percent viable cells were not prognostic. Hyalinization/fibrosis was associated with favorable outcome, and if validated, may become a valid endpoint for neoadjuvant trials.

  6. Alveolar soft-part sarcoma: a rare soft-tissue malignancy with distinctive clinical and radiological features

    International Nuclear Information System (INIS)

    Pang, L.M.; Griffith, J.F.; Metreweli, C.; Roebuck, D.J.; Kumta, S.M.

    2001-01-01

    Alveolar soft-part sarcoma (ASPS) is a rare tumour. Certain distinctive clinical and radiological features suggest the correct diagnosis. There is moderate predilection for young women. ASPS almost always arises in skeletal muscle and occurs most frequently in the lower limbs. There is often a long clinical history and a large mass at presentation. Two young females with ASPS presented with very vascular tumours in the thigh, with prominent intra- and extra-tumoural blood vessels. The imaging findings and the existing literature are reviewed. (orig.)

  7. [Primary pulmonary sarcomas].

    Science.gov (United States)

    Jakubcová, T; Jakubec, P

    2009-01-01

    Primary pulmonary sarcomas are rare diseases unlike lung carcinomas. The occurence of these sarcomas is between 0.013-0.40% of all malignant lung tumours. There are malignant mesenchymal tumours. They are flowing from the soft tissue of lung. The pulmonary sarcomas are heterogenic group with various biological behaviour. Their morfologic structure does not digger from the sarcomas of soft tissue. The primary pulmonary sarcomas occur more often in childhood and in young people unlike lung carcinomas. Radiation and some toxic substances are noted risk factors. Some gene mutations, infectious pathoghens and contraception have a possible impact on the origin of some types of the sarcomas. The current hypothesis is, that most of the sarcomas, if not all sarcomas, stem from primitive multipotent mesenchymal cell by malignant transformation in one or more lines. The diagnostic standard is biopsy from tumour with histologic and immunohistochemistry examination of a sample. The basic diagnostic problem is exclusion of a secondary origin of sarcomatic cells in the lung, because pulmonary metastasis of extrapulmonary sarcomas are more often than the primary pulmonary involvement.The optimal treatment is a resection of the tumour.The other therapeutic modalities are radiotherapy and chemotherapy, but results of these modalities are unsatisfactory. There are various chemotherapeutic regimes, monotherapy or combination regimes. The basic cytostatics are doxorubicine, iphosphamide, dacarbazine. Problems of the chemotherapy are high toxicity and relatively low curative effect about 20%.The first studies with biological treatment of the sarcomas of soft tissue have been published recently.This types of drugs could be a part of the complex management of these primary pulmonary tumours in the future. The primary pulmonary sarcomas have mostly aggresive course and often recur. Their prognosis is usually not very good. The survival median is 48 months and 5-years survival ranges

  8. Particle Therapy Using Protons or Carbon Ions for Unresectable or Incompletely Resected Bone and Soft Tissue Sarcomas of the Pelvis

    Energy Technology Data Exchange (ETDEWEB)

    Demizu, Yusuke, E-mail: y_demizu@nifty.com [Department of Radiology, Hyogo Ion Beam Medical Center, Tatsuno, Hyogo (Japan); Jin, Dongcun; Sulaiman, Nor Shazrina; Nagano, Fumiko; Terashima, Kazuki; Tokumaru, Sunao [Department of Radiology, Hyogo Ion Beam Medical Center, Tatsuno, Hyogo (Japan); Akagi, Takashi [Department of Radiation Physics, Hyogo Ion Beam Medical Center, Tatsuno, Hyogo (Japan); Fujii, Osamu [Department of Radiation Oncology, Hakodate Goryokaku Hospital, Hakodate, Hokkaido (Japan); Daimon, Takashi [Department of Biostatistics, Hyogo College of Medicine, Nishinomiya, Hyogo (Japan); Sasaki, Ryohei [Division of Radiation Oncology, Kobe University Graduate School of Medicine, Kobe, Hyogo (Japan); Fuwa, Nobukazu [Department of Radiation Oncology, Ise Red Cross Hospital, Ise, Mie (Japan); Okimoto, Tomoaki [Department of Radiology, Hyogo Ion Beam Medical Center, Tatsuno, Hyogo (Japan)

    2017-06-01

    Purpose: To retrospectively analyze the treatment outcomes of particle therapy using protons or carbon ions for unresectable or incompletely resected bone and soft tissue sarcomas (BSTSs) of the pelvis. Methods and Materials: From May 2005 to December 2014, 91 patients with nonmetastatic histologically proven unresectable or incompletely resected pelvic BSTSs underwent particle therapy with curative intent. The particle therapy used protons (52 patients) or carbon ions (39 patients). All patients received a dose of 70.4 Gy (relative biologic effectiveness) in 32 fractions (55 patients) or 16 fractions (36 patients). Results: The median patient age was 67 years (range 18-87). The median planning target volume (PTV) was 455 cm{sup 3} (range 108-1984). The histologic type was chordoma in 53 patients, chondrosarcoma in 14, osteosarcoma in 10, malignant fibrous histiocytoma/undifferentiated pleomorphic sarcoma in 5, and other in 9 patients. Of the 91 patients, 82 had a primary tumor and 9 a recurrent tumor. The median follow-up period was 32 months (range 3-112). The 3-year rate of overall survival (OS), progression-free survival (PFS), and local control was 83%, 72%, and 92%, respectively. A Cox proportional hazards model revealed that chordoma histologic features and a PTV of ≤500 cm{sup 3} were significantly associated with better OS, and a primary tumor and PTV of ≤500 cm{sup 3} were significantly associated with better PFS. Ion type and number of fractions were not significantly associated with OS, PFS, or local control. Late grade ≥3 toxicities were observed in 23 patients. Compared with the 32-fraction protocol, the 16-fraction protocol was associated with significantly more frequent late grade ≥3 toxicities (18 of 36 vs 5 of 55; P<.001). Conclusions: Particle therapy using protons or carbon ions was effective for unresectable or incompletely resected pelvic BSTS, and the 32-fraction protocol was effective and relatively less toxic. Nevertheless, a

  9. Magnetic resonance imaging features of extremity sarcomas of uncertain differentiation

    International Nuclear Information System (INIS)

    Stacy, G.S.; Nair, L.

    2007-01-01

    The purpose of this review is to illustrate the pertinent clinical and imaging features of extremity sarcomas of uncertain differentiation, including synovial sarcoma, epithelioid sarcoma, clear-cell sarcoma, and alveolar soft part sarcoma. These tumours should be considered in the differential diagnosis when a soft-tissue mass is encountered in the extremity of an adolescent or young adult

  10. Phase 1/2 study of immunotherapy with dendritic cells pulsed with autologous tumor lysate in patients with refractory bone and soft tissue sarcoma.

    Science.gov (United States)

    Miwa, Shinji; Nishida, Hideji; Tanzawa, Yoshikazu; Takeuchi, Akihiko; Hayashi, Katsuhiro; Yamamoto, Norio; Mizukoshi, Eishiro; Nakamoto, Yasunari; Kaneko, Shuichi; Tsuchiya, Hiroyuki

    2017-05-01

    There are limited options for the curative treatment of refractory bone and soft tissue sarcomas. The purpose of this phase 1/2 study was to assess the immunological and clinical effects of dendritic cells (DCs) pulsed with autologous tumor lysate (TL) in patients with advanced bone and soft tissue sarcomas. Thirty-seven patients with metastatic or recurrent sarcomas were enrolled in this study. Peripheral blood mononuclear cells obtained from the patients were suspended in media containing interleukin 4 (IL-4) and granulocyte-macrophage colony-stimulating factor. Subsequently, these cells were treated with TL, tumor necrosis factor α, and OK-432. The DCs were injected into the inguinal or axillary region. One treatment course comprised 6 weekly DC injections. The toxicity, clinical response (tumor volume, serum interferon-γ [IFN-γ], and serum IL-12), and oncological outcomes were observed. In total, 47 courses of DC therapy were performed in 37 patients. No severe adverse events or deaths associated with the DC injections were observed in the study patients. Increased serum IFN-γ and IL-12 levels were observed 1 month after the DC injection. Among the 37 patients, 35 patients were assessed for clinical responses: 28 patients showed tumor progression, 6 patients had stable disease, and 1 patient showed a partial response 8 weeks after the DC injection. The 3-year overall and progression-free survival rates of the patients were 42.3% and 2.9%, respectively. Although DC therapy appears safe and resulted in an immunological response in patients with refractory sarcoma, it resulted in an improvement of the clinical outcome in only a small number of patients. Cancer 2017;123:1576-1584. © 2017 American Cancer Society. © 2017 American Cancer Society.

  11. Vorinostat in refractory soft tissue sarcomas - Results of a multi-centre phase II trial of the German Soft Tissue Sarcoma and Bone Tumour Working Group (AIO).

    Science.gov (United States)

    Schmitt, Thomas; Mayer-Steinacker, Regine; Mayer, Frank; Grünwald, Viktor; Schütte, Jochen; Hartmann, Jörg T; Kasper, Bernd; Hüsing, Johannes; Hajda, Jacek; Ottawa, Gregor; Mechtersheimer, Gunhild; Mikus, Gerd; Burhenne, Jürgen; Lehmann, Lorenz; Heilig, Christoph E; Ho, Anthony D; Egerer, Gerlinde

    2016-09-01

    New treatment options for patients with metastatic Soft Tissue Sarcoma are urgently needed. Preclinical studies suggested activity of vorinostat, a histone deacetylase inhibitor. A multi-centre, open-label, non-randomised phase II trial to investigate the efficacy and safety of vorinostat in patients with locally advanced or metastatic Soft Tissue Sarcoma failing 1st-line anthracycline-based chemotherapy was initiated. Patients were treated with vorinostat 400 mg po qd for 28 d followed by a treatment-free period of 7 d, representing a treatment cycle of 5 weeks. Restaging was performed every three cycles or at clinical progression. Between 06/10 and 09/13, 40 Soft Tissue Sarcoma patients were treated with vorinostat at seven participating centres. Patients had received 1 (n=8, 20%), 2 (n=10, 25%) or ≥3 (n=22, 55%) previous lines of chemotherapy. Best response after three cycles of treatment was stable disease (n=9, 23%). Median progression-free survival and overall survival were 3.2 and 12.3 months, respectively. Six patients showed long-lasting disease stabilisation for up to ten cycles. Statistical analyses failed to identify baseline predictive markers in this subgroup. Major toxicities (grade ≥III) included haematological toxicity (n=6, 15%) gastrointestinal disorders (n=5, 13%), fatigue (n=4, 10%), musculoskeletal pain (n=4, 10%), and pneumonia (n=2, 5%). In a heavily pre-treated patient population, objective response to vorinostat was low. However, a small subgroup of patients had long-lasting disease stabilisation. Further studies aiming to identify predictive markers for treatment response as well as exploration of combination regimens are warranted. NCT00918489 (ClinicalTrials.gov) EudraCT-number: 2008-008513-19. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Segmenting Bone Parts for Bone Age Assessment using Point Distribution Model and Contour Modelling

    Science.gov (United States)

    Kaur, Amandeep; Singh Mann, Kulwinder, Dr.

    2018-01-01

    Bone age assessment (BAA) is a task performed on radiographs by the pediatricians in hospitals to predict the final adult height, to diagnose growth disorders by monitoring skeletal development. For building an automatic bone age assessment system the step in routine is to do image pre-processing of the bone X-rays so that features row can be constructed. In this research paper, an enhanced point distribution algorithm using contours has been implemented for segmenting bone parts as per well-established procedure of bone age assessment that would be helpful in building feature row and later on; it would be helpful in construction of automatic bone age assessment system. Implementation of the segmentation algorithm shows high degree of accuracy in terms of recall and precision in segmenting bone parts from left hand X-Rays.

  13. Kaposi's Sarcoma

    Science.gov (United States)

    ... Name: Category: Share: Yes No, Keep Private Kaposi’s Sarcoma Share | Kaposi’s sarcoma (KS) is a vascular neoplasm of the skin ... symptoms of HIV infection. This type of Kaposi's sarcoma progresses slowly, with new lesions appearing every few ...

  14. Adult soft tissue sarcoma

    Science.gov (United States)

    STS; Leiomyosarcoma; Hemangiosarcoma; Kaposi's sarcoma; Lymphangiosarcoma; Synovial sarcoma; Neurofibrosarcoma; Liposarcoma; Fibrosarcoma; Malignant fibrous histiocytoma; Dermatofibrosarcoma; Angiosarcoma

  15. Dose-volume histogram and dose-surface histogram analysis for skin reactions to carbon ion radiotherapy for bone and soft tissue sarcoma.

    Science.gov (United States)

    Yanagi, Takeshi; Kamada, Tadashi; Tsuji, Hiroshi; Imai, Reiko; Serizawa, Itsuko; Tsujii, Hirohiko

    2010-04-01

    To evaluate the usefulness of the dose-volume histogram (DVH) and dose-surface histogram (DSH) as clinically relevant and available parameters that helped to identify bone and soft tissue sarcoma patients at risk of developing late skin reactions, including ulceration, when treated with carbon ion radiotherapy. Thirty-five patients with bone and soft tissue sarcoma treated with carbon ion beams were studied. The clinical skin reactions were evaluated. Some pretreatment variables were compared with the grade of late skin reactions. Average DVH and DSH were established in accordance with the grading of the skin reactions. Prescribed dose, the difference in depths between the skin surface and the proximal extent of the tumor, and some DVH/DSH parameters were correlated with late skin reaction (> or = grade 3) according to univariate analysis. Furthermore, the area irradiated with over 60 GyE (S(60)>20 cm(2)) on DSH was the most important factor by multivariate analysis. The area irradiated with over 60 GyE (S(60)>20 cm(2)) on DSH was found to be a parameter for use as a predictor of late skin reactions. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

  16. Performance of Positron Emission Tomography and Positron Emission Tomography/Computed Tomography Using Fluorine-18-Fluorodeoxyglucose for the Diagnosis, Staging, and Recurrence Assessment of Bone Sarcoma: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Liu, Fengxia; Zhang, Qingyu; Zhu, Dezhi; Li, Zhenfeng; Li, Jianmin; Wang, Boim; Zhou, Dongsheng; Dong, Jinlei

    2015-09-01

    To investigate the performance of fluorine-18-fluorodeoxyglucose (F-FDG) positron emission tomography (PET) and PET/computed tomography (CT) in the diagnosis, staging, restaging, and recurrence surveillance of bone sarcoma by systematically reviewing and meta-analyzing the published literature.To retrieve eligible studies, we searched the MEDLINE, Embase, and the Cochrane Central library databases using combinations of following Keywords: "positron emission tomography" or "PET," and "bone tumor" or "bone sarcoma" or "sarcoma." Bibliographies from relevant articles were also screened manually. Data were extracted and the pooled sensitivity, specificity, and diagnostic odds ratio (DOR), on an examination-based or lesion-based level, were calculated to appraise the diagnostic accuracy of F-FDG PET and PET/CT. All statistical analyses were performed using Meta-Disc 1.4.Forty-two trials were eligible. The pooled sensitivity and specificity of PET/CT to differentiate primary bone sarcomas from benign lesions were 96% (95% confidence interval [CI], 93-98) and 79% (95% CI, 63-90), respectively. For detecting recurrence, the pooled results on an examination-based level were sensitivity 92% (95% CI, 85-97), specificity 93% (95% CI, 88-96), positive likelihood ratio (PLR) 10.26 (95% CI, 5.99-17.60), and negative likelihood ratio (NLR) 0.11 (95% CI, 0.05-0.22). For detecting distant metastasis, the pooled results on a lesion-based level were sensitivity 90% (95% CI, 86-93), specificity 85% (95% CI, 81-87), PLR 5.16 (95% CI, 2.37-11.25), and NLR 0.15 (95% CI, 0.11-0.20). The accuracies of PET/CT for detecting local recurrence, lung metastasis, and bone metastasis were satisfactory. Pooled outcome estimates of F-FDG PET were less complete compared with those of PET/CT.F-FDG PET and PET/CT showed a high sensitivity for diagnosing primary bone sarcoma. Moreover, PET/CT demonstrated excellent accuracy for the staging, restaging, and recurrence surveillance of bone sarcoma. However

  17. Sarcoma risk after radiation exposure

    Directory of Open Access Journals (Sweden)

    Berrington de Gonzalez Amy

    2012-10-01

    Full Text Available Abstract Sarcomas were one of the first solid cancers to be linked to ionizing radiation exposure. We reviewed the current evidence on this relationship, focusing particularly on the studies that had individual estimates of radiation doses. There is clear evidence of an increased risk of both bone and soft tissue sarcomas after high-dose fractionated radiation exposure (10 + Gy in childhood, and the risk increases approximately linearly in dose, at least up to 40 Gy. There are few studies available of sarcoma after radiotherapy in adulthood for cancer, but data from cancer registries and studies of treatment for benign conditions confirm that the risk of sarcoma is also increased in this age-group after fractionated high-dose exposure. New findings from the long-term follow-up of the Japanese atomic bomb survivors suggest, for the first time, that sarcomas can be induced by acute lower-doses of radiation (

  18. Uma nova abordagem para as endopróteses parciais de joelho em sarcomas primários ósseos A new approach to partial knee endoprosthesis in primary bone sarcomas

    Directory of Open Access Journals (Sweden)

    Valter Penna

    2009-02-01

    Full Text Available OBJETIVO: As endopróteses parciais de joelho para as ressecções em sarcomas ósseos demonstram serem boa solução para o tratamento de pacientes com imaturidade esquelética. O objetivo deste estudo é avaliar o escore funcional, as vantagens, as desvantagens e indicações para esta técnica cirúrgica em quatorze pacientes em um protocolo brasileiro de osteossarcoma e sarcoma de Ewing. MÉTODOS: Análise retrospectiva realizada para identificar a evolução funcional e as possíveis complicações do procedimento. 14 pacientes com idade entre 10 e 22 anos avaliados funcionalmente pelos critérios de Enneking/ISOLS (International Society of Limb Salvage, sendo todos operados na mesma Instituição e pelo mesmo cirurgião. Foram utilizadas endopróteses parciais das extremidades distal do fêmur e proximal da tíbia com reconstrução ligamentar. ReSULTADOS: A análise do escore funcional de Enneking/ISOLS demonstrou 78,6 % de excelentes resultados e 21,4% de bons. Dos 14 pacientes, todos portadores de tumores primitivos ósseos em protocolo de quimioterapia, nove não apresentaram nenhum tipo de complicação e cinco indivíduos evoluíram com complicações relacionadas ao procedimento, sendo que houve relação estatística positiva entre os maus resultados e a presença de complicações (p=0,027. CONCLUSÃO: As endopróteses parciais de joelhos são menos prejudiciais ao estoque ósseo de pacientes com esqueleto imaturo. As críticas sobre os maus resultados funcionais estão sendo suplantadas pelas novas técnicas de reconstrução, corretos protocolos de reabilitação, qualidade e tecnologia dos implantes, e o aumento da curva de aprendizado. Essa opção de tratamento per-mite a preservação do estoque ósseo e a possibilidade de revisão da artroplastia não convencional de modo menos agressivo.OBJECTIVE: Partial knee endoprosthesis to bone sarcomas resections seems to be a good solution to treat this immature skeletal patients

  19. Kaposi's sarcoma

    International Nuclear Information System (INIS)

    Kirova, Y.M.; Belembaogo, E.; Frikha, H.; Yu, S.J.; Le Bourgeois, J.P.

    1997-01-01

    Moriz Kaposi was the first who, in 1872, described five patients presenting with 'sarcoma idiopathicum multiple hemorrhagicum'. In 1912 Sternberg termed this disease Kaposi's sarcoma. Since then various forms of this rare disease have been observed. In 1914 Hallenberg described the first cases of African or endemic Kaposi's sarcoma. In the 1960's the first reports discussing Kaposi's sarcoma following organ transplantation and immunosuppressive therapy were published. After 1981, the epidemic form associated with the acquired immunodeficiency syndrome (AIDS) was described. All these forms, their history, treatment methods and the role of radiation therapy in the management of this rare malignancy are discussed, and the literature is reviewed. (authors)

  20. Bariatric Surgery: Bad to the Bone, Part 1.

    Science.gov (United States)

    Pizzorno, Lara

    2016-03-01

    Obesity is now a global epidemic affecting a significant and rapidly increasing number of adults, adolescents, and children. As the incidence of obesity has increased, so has the use of bariatric surgery as a medical solution. A growing number of studies now report that, despite calcium and vitamin D supplementation, the most frequently performed types of bariatric surgery, the Roux-en-Y gastric bypass and the sleeve gastrectomy, cause significant ongoing bone loss. In resources available to the general public and to physicians, this adverse outcome is rarely mentioned or is attributed solely to reduced calcium absorption. Recent studies investigating micronutrient malabsorption and changes in a wide range of hormones induced by bariatric surgery now indicate that calcium malabsorption is the tip of a formidable iceberg. The current article, part 1 of a 2-part series, reviews the latest research findings confirming that obesity prevalence is skyrocketing and that bariatric surgery causes ongoing, accelerated bone loss. Part 1 also discusses the mechanisms through which the bariatric surgery-induced malabsorption of key nutrients adversely affects bone homeostasis. Part 2 discusses the specific changes seen in bone metabolism after bariatric surgery and reviews current data on the underlying mechanisms, in addition to nutrient malabsorption, which are thought to contribute to bariatric surgery-induced ongoing accelerated bone loss. These processes include mechanical unloading and changes in a wide variety of hormones (eg, leptin, adiponectin, testosterone, estradiol, serotonin, ghrelin, glucagon-like peptide 1, and gastric inhibitory peptide). Also, part 2 covers interventions that may help lessen bariatric surgery-induced bone loss, which are now beginning to appear in the medical literature. Bariatric surgery's adverse effects on bone must be widely recognized and protocols developed to prevent early onset osteoporosis in the recipients of an increasingly utilized

  1. Synovial sarcoma

    Directory of Open Access Journals (Sweden)

    Sucari S.C. Vlok

    2014-12-01

    Full Text Available Synovial sarcoma is a malignant, predominantly juxta-articular, soft-tissue tumour representing approximately 10% of all soft-tissue sarcomas. Frequently initially incorrectly diagnosed as a benign lesion, it should be considered as a diagnosis when a young adult patient presents with a calcified juxta-articular soft-tissue mass of insidious onset.

  2. Epidemic Kaposi Sarcoma

    Science.gov (United States)

    ... Sarcoma Treatment Childhood Vascular Tumors Treatment Research Kaposi Sarcoma Treatment (PDQ®)–Patient Version General Information About Kaposi Sarcoma Go to Health Professional Version Key Points Kaposi ...

  3. Classic Kaposi Sarcoma

    Science.gov (United States)

    ... Sarcoma Treatment Childhood Vascular Tumors Treatment Research Kaposi Sarcoma Treatment (PDQ®)–Patient Version General Information About Kaposi Sarcoma Go to Health Professional Version Key Points Kaposi ...

  4. Ewing's sarcoma mimicking a meningioma in radiological findings: a case report

    International Nuclear Information System (INIS)

    Kwon, Hee Jin; Choi, Sun Seob

    2007-01-01

    Ewing's sarcoma is an uncommon primary bone tumor. Primary Ewing's sarcoma of the cranium is extremely rare and constitutes only 1% of all Ewing's sarcoma cases. Usually, primary Ewing's sarcoma of the carnium manifests as an expansile osteolytic malignant bone tumor with or without intracranial extension. We report here the radiological findings of a case of Ewing's sarcoma mimicking a meningioma in an 18-year-old man

  5. Exploring the Histogenesis and Diagnostic Strategy Using Immunoassay and RT-PCR in Alveolar Soft Part Sarcoma.

    Science.gov (United States)

    Ju, Xinxin; Sun, Kunming; Liu, Ruixue; Li, Shugang; Abulajiang, Gulinaer; Zou, Hong; Lan, Jiaojiao; Ren, Yan; Jiang, Jinfang; Liang, Weihua; Pang, Lijuan; Li, Feng

    2017-08-01

    Alveolar soft part sarcoma (ASPS) is a rare soft tissue sarcoma, but it's easily misdiagnosed in rare locations. The derivation of ASPS is still uncertain, therefore we conducted this study to explore the histogenesis of ASPS by analyzing stem cell markers (ALDH1, CD29, CD133 and Nestin). Protein TFE3 and fusion gene ASPS-TFE3 were tested in paraffin to explore diagnostic strategy and molecular pathological features. In this study, nine cases of ASPS were immunostained with stem cell surface markers (ALDH1, CD29, CD133 and Nestin) and protein TFE3. Seven cases of ASPS mRNA were successfully extracted from nine paraffin-embedded tissues. The expression of fusion gene ASPL-TFE3 was examined by reverse transcriptase-polymerase chain reaction. The immunohistochemical staining of nine patients showed that CD29 and Nestin were negative in all nine cases (0/9). CD133 was weakly positive in one cases (1/9) and ALDH1 was weakly positive in one cases (1/9). TFE3 was positive in nine cases (9/9). Seven paraffin tissues could be successfully extracted with mRNA in nine cases. The results of Reverse Transcription Polymerase Chain Reaction (RT-PCR) showed that ASPL-TFE3 fusion transcripts could be tested in the seven cases (four cases being type 2 and three cases being type 1). The positive rate of CD133 and ALDH1 were less than 1% and the expression of CD29 and Nestin were negative in ASPS. Immunohistochemistry results indicated that the histogenesis of ASPS maybe not derive from mesenchymal stem cells. Immunohistochemistry staining showed that TFE3 protein expression was highly sensitive in ASPS. Furthermore, RT-PCR results showed that fusion gene ASPL-TFE3 (ASPL-TFE3 type 1 and ASPL-TFE3 type 2) was expressed in ASPS, which could provide information for clinical molecular pathological diagnosis and improve the diagnosis rate of rare atypical ASPS.

  6. Alveolar soft part sarcoma: the new primary intracranial malignancy : A case report and review of the literature.

    Science.gov (United States)

    Kumar, Aditaya; Alrohmain, B; Taylor, W; Bhattathiri, P

    2017-07-26

    The purpose of this paper is to serve as a reference to aid in the management of this poorly understood intracranial malignancy. The authors report their experience treating the eighth ostensible case of a primary intracranial alveolar soft part sarcoma (ASPS). A 21-year-old man presented to hospital after collapsing. He gave a 1-year history of headache, a 2-month history of reduced visual acuity and on examination had left facial paraesthesia with left-sided incoordination. MRI of the brain revealed a large left posterior fossa mass. The patient underwent resection of the tumour with good recovery in function. Immunohistochemical analysis of the tumour specimen confirmed an ASPS, and multimodal imaging in search of an extra-cranial disease primary was negative. A review of the literature yielded only seven other cases of primary intracranial ASPS. A variety of diagnostic imaging modalities were employed in search of a disease primary, as were various combinations of surgical resection, chemotherapy and radiotherapy as treatment. Half of the cases documented delayed disease recurrence. The authors discuss the following: the unique radiological and immunohistological characteristics of this disease including the potential for its misdiagnosis; the investigations required to diagnose a primary intracranial ASPS; the efficacy of current medical and surgical treatment options and the factors that will aid in prognostication. This is the first review of this new primary intracranial malignancy. From our analysis, we offer a joint radiological and immunohistochemical algorithm for the diagnosis of primary intracranial ASPS and specific operative considerations prior to resection.

  7. Effect of flavonoid-containing extracts on the growth of transplanted sarcoma 45, peripheral blood and bone marrow condition after oral and intramuscular administration in rats

    Directory of Open Access Journals (Sweden)

    Nikita A. Navolokin

    2017-08-01

    Full Text Available Objective — Discovery of the apoptosis-inducing effects of flavonoid vagonin allowed to make an assumption of existence of similar effect in others flavonoids. This study of the effects of extracts from Gratīola officinālis, Helichrýsum arenárium and diploid forms of Zea mays on bone marrow and blood leucocytes at intramuscular and oral administration was carried out on rats bearing sarcoma 45. Earlier, the apoptosis-inducing effects were detected for these extracts but the toxic effects of extracts on blood and bone marrow have not been studied. Therefore, the aim of this study was to investigate the effects of these extracts on white blood cell count and bone marrow morphology. Material and Methods — The experiments were carried out on 48 male Wistar albino rats according to University's Animal Ethics Committee (Protocol № 13, 2011, Saratov, Russia and the relevant national agency regulating experiments on animals. We evaluated white blood cell count and bone marrow morphology in animals after oral and intramuscular administration of extracts. A growth rate of tumor was also ranked. Results — Oral and intramuscular administration of extracts from flavonoid-containing plants Zea mays and Gratīola officinālis causes normalization of myelocytic germ parameters in bone marrow of tumor-bearing rats and increase of lymphocyte percent in white blood cell count of blood and myelogram. Conclusion — Absence of toxic effects and normalization of myelocytic germ parameters in bone marrow of tumor-bearing rats after oral and intramuscular administration of extracts from flavonoid-containing plants Zea mays and Gratīola officinālis allows to recommend further study of the antitumor effect of these extracts.

  8. Epidemiology and therapies for metastatic sarcoma

    Directory of Open Access Journals (Sweden)

    Amankwah EK

    2013-05-01

    Full Text Available Ernest K Amankwah,1 Anthony P Conley,2 Damon R Reed2 1Department of Cancer Epidemiology, H Lee Moffitt Cancer Center and Research Institute, Tampa, FL, USA; 2Sarcoma Department, H Lee Moffitt Cancer Center and Research Institute, Tampa, FL, USA Abstract: Sarcomas are cancers arising from the mesenchymal layer that affect children, adolescents, young adults, and adults. Although most sarcomas are localized, many display a remarkable predilection for metastasis to the lungs, liver, bones, subcutaneous tissue, and lymph nodes. Additionally, many sarcoma patients presenting initially with localized disease may relapse at metastatic sites. While localized sarcomas can often be cured through surgery and often radiation, controversies exist over optimal management of patients with metastatic sarcoma. Combinations of chemotherapy are the most effective in many settings, and many promising new agents are under active investigation or are being explored in preclinical models. Metastatic sarcomas are excellent candidates for novel approaches with additional agents as they have demonstrated chemosensitivity and affect a portion of the population that is motivated toward curative therapy. In this paper, we provide an overview on the common sarcomas of childhood (rhabdomyosarcoma, adolescence, and young adults (osteosarcoma, Ewing sarcoma, synovial sarcoma, and malignant peripheral nerve sheath tumor and older adults (leiomyosarcoma, liposarcoma, and undifferentiated high grade sarcoma in terms of the epidemiology, current therapy, promising therapeutic directions and outcome with a focus on metastatic disease. Potential advances in terms of promising therapy and biologic insights may lead to more effective and safer therapies; however, more clinical trials and research are needed for patients with metastatic sarcoma. Keywords: chemotherapy, pediatric sarcoma, rhabdomyosarcoma, osteosarcoma, Ewing sarcoma, synovial sarcoma

  9. Granulocytic Sarcoma by AML M4eo (inv16 after Allogeneic Stem Cell Transplantation without Bone Marrow Involvement

    Directory of Open Access Journals (Sweden)

    Stephan Zaenker

    2011-01-01

    Full Text Available Granulocytic sarcoma (GS represents a rare type of extramedullar manifestation from the acute myeloid leukaemia (AML. We report the case of a patient with recurrences of AML M4eo leukaemia in the uterus and the small intestine at 3 and 5 years, respectively, after matched related peripheral blood stem cell transplantation (PBSCT. The patient underwent the withdrawal of immunosuppression, hysterectomy, and local irradiation at first relapse, as well as systemic chemotherapy and donor lymphocyte infusions at second recurrence, inducing a second and third complete remission, respectively. At year six after transplantation, the patient experienced disease progression by meningeosis leukaemia to which she succumbed despite intrathecal chemotherapy. Following allogeneic stem cell transplantation, awareness for atypical manifestations of granulocytic sarcoma appears prudent, the cellular immunotherapy should aim at immunological disease control.

  10. Epidemiology and therapies for metastatic sarcoma

    Science.gov (United States)

    Amankwah, Ernest K; Conley, Anthony P; Reed, Damon R

    2013-01-01

    Sarcomas are cancers arising from the mesenchymal layer that affect children, adolescents, young adults, and adults. Although most sarcomas are localized, many display a remarkable predilection for metastasis to the lungs, liver, bones, subcutaneous tissue, and lymph nodes. Additionally, many sarcoma patients presenting initially with localized disease may relapse at metastatic sites. While localized sarcomas can often be cured through surgery and often radiation, controversies exist over optimal management of patients with metastatic sarcoma. Combinations of chemotherapy are the most effective in many settings, and many promising new agents are under active investigation or are being explored in preclinical models. Metastatic sarcomas are excellent candidates for novel approaches with additional agents as they have demonstrated chemosensitivity and affect a portion of the population that is motivated toward curative therapy. In this paper, we provide an overview on the common sarcomas of childhood (rhabdomyosarcoma), adolescence, and young adults (osteosarcoma, Ewing sarcoma, synovial sarcoma, and malignant peripheral nerve sheath tumor) and older adults (leiomyosarcoma, liposarcoma, and undifferentiated high grade sarcoma) in terms of the epidemiology, current therapy, promising therapeutic directions and outcome with a focus on metastatic disease. Potential advances in terms of promising therapy and biologic insights may lead to more effective and safer therapies; however, more clinical trials and research are needed for patients with metastatic sarcoma. PMID:23700373

  11. Imaging characteristics of primary cranial Ewing sarcoma

    International Nuclear Information System (INIS)

    Li, Wai-Yung; Saunders, Dawn E.; Brock, Penelope

    2005-01-01

    Ewing sarcoma accounts for 10-15% of all childhood malignant bone tumours and is second in prevalence to osteosarcoma. The skull bones are an unusual site of origin of primary Ewing sarcoma in children. Previous reports concentrate on the neurosurgical aspects and relatively good outcome compared to other bone tumours of the calvarium. Reported cases mainly describe the imaging characteristics on CT. To describe the MRI and CT features of primary cranial Ewing sarcoma. The neuroimaging of three cases of primary cranial Ewing sarcoma are reviewed. Our three cases show an extra-axial mass that is high attenuation on CT and low signal on T2-weighted MRI. Haemorrhagic components, dural extension and contrast enhancement are also characteristic features. CT attenuation and magnetic resonance signal characteristics reflect sheets of densely packed cells seen in Ewing sarcoma. (orig.)

  12. Clinic-radiology findings at limp-sparing surgery of alveolar sarcoma

    International Nuclear Information System (INIS)

    Tzekov, A.; Penchev, V.; Niagolova, S.; Kovachev, V.

    2007-01-01

    Soft-tissue sarcomas are a rare and heterogeneous group of tumors. Alveolar soft part sarcoma is a rare sarcoma of an unclear cause. It is representing 0.2-1 percent of soft tissue sarcomas. Unique biologic behaviors of soft-tissue sarcomas features include formation of a reactive zone, intra-compartmental growth, and, rarely, the presence of skip metastases. Although the soft-tissue sarcomas have a unique morphology, biological behavior, and prognosis, they share biological characteristics and are treated in a similar fashion. The concept of limb-sparing surgery, or limb salvage, has gradually evolved over the past 25 years. Prior to this the basic principles of surgical oncology for the extremities consisted solely of determining the correct level at which to perform an amputation. The three stages of a limb-sparing procedure are as follows: tumor resection skeletal reconstruction and soft-tissue coverage and muscle transfers to restore function. Imaging diagnostic is a key step in the limp-sparing surgery of a soft tissue sarcomas at relation of: preoperatively - the diagnosis of lesion, the decision for biopsy, about location of the lesion and what is the safest anatomic route to that location, possibly lung and bone metastases; postoperative - checking the position of the prosthesis, inflammatory, mechanic and oncology complications. (authors)

  13. Computed tomography in malignant primary bone tumours

    International Nuclear Information System (INIS)

    Kersjes, W.; Harder, T.; Haeffner, P.

    1990-01-01

    The importance of computed tomography is examined in malignant primary bone tumours using a strongly defined examination group of 13 Patients (six Ewing's-sarcomas, five osteosarcomas, one chondrosarcoma and one spindle-shaped cell sarcoma). Computed tomography is judged superior compared to plain radiographs in recognition of bone marrow infiltration and presentation of parosteal tumour parts as well as in analysis of tissue components of tumours, CT is especially suitable for therapy planning and evaluating response to therapy. CT does not provide sufficient diagnostic information to determine dignity and exact diagnosis of bone tumours. (orig.) [de

  14. Adrenal Ewing's Sarcoma in an Elderly Man.

    Science.gov (United States)

    Toda, Kazuyoshi; Ishii, Sumiyasu; Yasuoka, Hidetoshi; Nishioka, Masaki; Kobayashi, Takayuki; Horiguchi, Kazuhiko; Tomaru, Takuya; Ozawa, Atsushi; Shibusawa, Nobuyuki; Satoh, Tetsurou; Koshi, Hiromi; Segawa, Atsuki; Shimizu, Shin-Ichi; Oyama, Tetsunari; Yamada, Masanobu

    2018-02-15

    Ewing's sarcoma usually arises in the bones of children and adolescents. We herein report a 74-year-old man with Ewing's sarcoma in the adrenal gland. The diagnosis was confirmed by a genetic test, pathological studies, and several imaging studies. He already had multiple liver metastases when he was transferred to our hospital and died on the 37th day. The diagnosis was further confirmed by autopsy studies. Adrenal Ewing's sarcoma is very rare, and our patient was older than other reported cases. Ewing's sarcoma should be considered even in elderly patients with adrenal tumors.

  15. Recurrence of a t(8;21-Positive Acute Myeloid Leukemia in the Form of a Granulocytic Sarcoma Involving Cranial Bones: A Diagnostic and Therapeutic Challenge

    Directory of Open Access Journals (Sweden)

    Ambra Di Veroli

    2013-01-01

    Full Text Available Granulocytic sarcoma (GS is a rare extramedullary solid tumor defined as an accumulation of myeloblasts or immature myeloid cells. It can cooccur with or precede the acute myeloid leukemia (AML as well as following treated AML. The incidence of GS in AML patients is 3–8% but it significantly rises in M2 FAB subtype AML. This variety of AML harbors t(8;21 in up to 20–25% of cases (especially in children and black ones of African origin and, at a molecular level, it is characterized by the generation of a fusion gene known as RUNX1-RUNX1T1. Approximately 10% of M2 AML patients will develop GS, as a consequence, the t(8;21 and the relative transcript represent the most common cytogenetic and molecular abnormalities in GS. FLT3-ITD mutation was rarely described in AML patients presenting with GS. FLT3 ITD is generally strongly associated with poor prognosis in AML, and is rarely reported in patients with t(8;21. GS presentation is extremely variable depending on organs involved; in general, cranial bones and sinus are very rarely affected sites. We report a rare case of GS occurring as a recurrence of a previously treated t(8;21, FLT3-ITD positive AML, involving mastoid bones and paravertebral tissues.

  16. The role of imaging in the evaluation of extraskeletal Ewing's sarcoma

    African Journals Online (AJOL)

    Primary bone tumours account for 5% of all adolescent and child cancers. When Ewing's sarcoma arises in soft tissue rather than bone, it is referred to as extraskeletal Ewing's sarcoma (ESS). Computed tomography (CT) scanning and magnetic resonance imaging (MRI) features of Ewing's sarcoma are non-specific, and a ...

  17. The long-term outcome following the use of frozen autograft treated with liquid nitrogen in the management of bone and soft-tissue sarcomas.

    Science.gov (United States)

    Igarashi, K; Yamamoto, N; Shirai, T; Hayashi, K; Nishida, H; Kimura, H; Takeuchi, A; Tsuchiya, H

    2014-04-01

    In 1999, we developed a technique for biological reconstruction after excision of a bone tumour, which involved using autografts of the bone containing the tumour treated with liquid nitrogen. We have previously reported the use of this technique in 28 patients at a mean follow up of 27 months (10 to 54). In this study, we included 72 patients who underwent reconstruction using this technique. A total of 33 patients died and three were lost to follow-up, at a mean of 23 months (2 to 56) post-operatively, leaving 36 patients available for a assessment at a mean of 101 months 16 to 163) post-operatively. The methods of reconstruction included an osteo-articular graft in 16, an intercalary in 13 and, a composite graft with prosthesis in seven. Post-operative function was excellent in 26 patients (72.2%), good in seven (19.4%), and fair in three (8.3%) according to the functional evaluation system of Enneking. No recurrent tumour occurred within the grafts. The autografts survived in 29 patients (80.6%), and the rates of survival at five and ten years were 86.1% and 80.6 %, respectively. Seven of 16 osteo-articular grafts (44%) failed because of fracture or infection, but all the composite and intercalary grafts survived. The long-term outcomes of frozen autografting, particularly using composite and intercalary grafts, are satisfactory and thus represent a good method of treatment for patients with a sarcoma of bone or soft tissue.

  18. Mechanisms of Ewing sarcoma metastasis : biochemistry and biophysics

    NARCIS (Netherlands)

    Beletkaia, Elena

    2015-01-01

    Ewing sarcoma (ES) is a special type of bone cancer, first described by Dr. James Ewing in his paper ‘Diffusive endothelioma of bone’. Today Ewing sarcoma represents the second most common bone cancer among adolescents and young adults. Contrary to the positive achievement in treatment of localized

  19. Radiographic appearance of Ewing sarcoma of the hands and feet: report from the Intergroup Ewing Sarcoma Study

    International Nuclear Information System (INIS)

    Reinus, W.R.; Gilula, L.A.; Shirley, S.K.; Askin, F.B.; Siegal, G.P.

    1985-01-01

    Review of current data from the Intergroup Ewing Sarcoma Study (IESS) shows that Ewing sarcoma is rare in bones of the hands and feet. The 12 patients from the IESS protocols with hand or foot Ewing sarcoma are comparable to those already reported in the literature. With the exception of lesions in the calcaneus, the prognosis for disease-free survival is excellent. The radiographic features of hand and foot Ewing sarcoma are generally those of classic Ewing sarcoma: permeation, soft-tissue mass, and often, associated sclerotic reaction. However, with the exception of sclerosis, features suggesting bone reaction and slow tumor growth in these patients were distinctly uncommon compared with Ewing sarcoma in general. Apparently location of the lesion is important, since in the reported cases in the literature and in this series, lesions of the calcaneus fared poorly. The importance of this set of patients therefore relates to awareness and early recognition of an unusual appearance and location of Ewing sarcoma

  20. FDG PET/CT in Initial Staging of Adult Soft-Tissue Sarcoma

    Directory of Open Access Journals (Sweden)

    David Roberge

    2012-01-01

    Full Text Available Soft-tissue sarcomas spread predominantly to the lung and it is unclear how often FDG-PET scans will detect metastases not already obvious by chest CT scan or clinical examination. Adult limb and body wall soft-tissue sarcoma cases were identified retrospectively. Ewing’s sarcoma, rhabdomyosarcoma, GIST, desmoid tumors, visceral tumors, bone tumors, and retroperitoneal sarcomas were excluded as were patients imaged for followup, response assessment, or recurrence. All patients had a diagnostic chest CT scan. 109 patients met these criteria, 87% of which had intermediate or high-grade tumors. The most common pathological diagnoses were leiomyosarcoma (17%, liposarcoma (17%, and undifferentiated or pleomorphic sarcoma (16%. 98% of previously unresected primary tumors were FDG avid. PET scans were negative for distant disease in 91/109 cases. The negative predictive value was 89%. Fourteen PET scans were positive. Of these, 6 patients were already known to have metastases, 3 were false positives, and 5 represented new findings of metastasis (positive predictive value 79%. In total, 5 patients were upstaged by FDG-PET (4.5%. Although PET scans may be of use in specific circumstances, routine use of FDG PET imaging as part of the initial staging of soft-tissue sarcomas was unlikely to alter management in our series.

  1. The use of bone age in clinical practice - Part 1

    DEFF Research Database (Denmark)

    Martin, D.D.; Caliebe, J.; Binder, Gitte Sommer

    2011-01-01

    addressed in part 2). Various manual and automatic methods of BA assessment have been developed. Healthy tall children tend to have advanced BA and healthy short children tend to have delayed BA in comparison to chronological age. Growth hormone (GH) treatment of children with GH deficiency leads to a catch......This review examines the role of skeletal maturity ('bone age', BA) assessment in clinical practice. BA is mainly used in children with the following conditions: short stature (addressed in part 1 of this review), tall stature, early or late puberty, and congenital adrenal hyperplasia (all...... of the growth plate to sex steroids, thus further impairing adult height. The assessment of BA provides an important contribution to the diagnostic workup and management of children with short stature....

  2. Study on osteogenic sarcoma

    International Nuclear Information System (INIS)

    Park, Eung Chun; Kim, Young Il; Choi, Won Jae; Kim, Young Jin

    1993-01-01

    The author observed a case of osteogenic sarcoma in a 11-year-old female with complaint of painful swelling on face in right side. The observed results were as follows: 1. Large hematoma was observed, and patient complained painfull swelling on c/c site. 2. Predisposing factor of osteogenic sarcoma was not clear, but patient had history of extraction before patient visiting infirmary of our dental collage. 3. Serologic findings were not specific, and serum aldaline level was normal. 4. Radiographic findings were as follows: a. Diffuse faint radiopacit in the lesion. b. Bony destruction and increased radiopacity in right antrum. c. Displacement of multiple teeth on involved area(i. e no 12, 15, 55, 16, 17, 18) d. Increased periodontal space in single tooth(no 13) e. Destruction of bony crypt on involved teeth(no 13, 14, 15, 17, 18) f. Loss of lamina dura of three teeth in involved area(no 11, 12, 16) 5. Computed tomographic findings were as follows: a. Large calcific and heterogenous component mass in the Rt. maxillary sinus, and this mass extending to Rt. maxilla, alveolar bone, ethmoid sinus. b. Soft tissue bulging in to Rt. side nasal cavity and oral cavity. c. Bone destruction of maxillary sinus wall and Rt. alveolar bone.

  3. Volume-Based F-18 FDG PET/CT Imaging Markers Provide Supplemental Prognostic Information to Histologic Grading in Patients With High-Grade Bone or Soft Tissue Sarcoma

    DEFF Research Database (Denmark)

    Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid

    2015-01-01

    The aim of the study is to assess the prognostic value of different volume-based calculations of tumor metabolic activity in the initial assessment of patients with high-grade bone sarcomas (BS) and soft tissue sarcomas (STS) using F-18 FDG PET/CT.A single-site, retrospective study from 2002...... to 2012 including 92 patients with histologically verified high-grade BS (N = 37) or STS (N = 55). All patients underwent a pretreatment F-18 FDG PET/CT scan. Clinical data were registered. Measurements of the accuracy of metabolic tumor volume with a preset threshold of 40% of the maximum standardized...... uptake value of primary tumor (MTV40%) and total lesion glycolysis (TLG) as prognostic variables and identification of optimal discriminating cut-off values were performed through ROC curve analysis. Patients were grouped according to the cut-off values. All deaths were considered an event in survival...

  4. Intracranial Dural Metastasis of Ewing's Sarcoma: a Case Report

    International Nuclear Information System (INIS)

    Kim, Eung Yeop; Lee, Seung Koo; Kim, Dong Joon; Kim, Jin Na; Lee, Kyu Sung; Jung, Woo Hee; Kim, Dong Ik

    2008-01-01

    Ewing's sarcoma is a malignant bone tumor that can occur anywhere in the body, but it is most commonly observed in the long bones of the arms and legs, the pelvis and in the chest. The predominant sites of metastasis include the lung (38%), bone (including the spine; 31%), and the bone marrow (11%). Metastasis of Ewing's sarcoma to the central nervous system (CNS) is relatively rare, and most of the previous reports have demonstrated involvement of the bony calvarium or brain parenchyma. We describe here the imaging findings of dural metastasis of Ewing's sarcoma, and these imaging findings have not been previously reported on in the medical literature. In conclusion, dural metastasis of Ewing's sarcoma is very rare and its imaging characteristics are similar to those of a primary tumor, which mimic the findings of a schwannoma or meningioma. Despite its rarity, secondary Ewing's sarcoma may be included in the differential diagnosis of extra-axial dural masses

  5. Sarcoma Immunotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Gouw, Launce G., E-mail: launce.gouw@hsc.utah.edu [Departments of Oncology, Huntsman Cancer Institute at the University of Utah, 2000 Circle of Hope, Salt Lake City, UT 84112 (United States); Jones, Kevin B. [Departments of Orthopaedic Surgery, Huntsman Cancer Institute at the University of Utah, 2000 Circle of Hope, Salt Lake City, UT 84112 (United States); Sharma, Sunil [Departments of Oncology, Huntsman Cancer Institute at the University of Utah, 2000 Circle of Hope, Salt Lake City, UT 84112 (United States); Randall, R. Lor [Departments of Orthopaedic Surgery, Huntsman Cancer Institute at the University of Utah, 2000 Circle of Hope, Salt Lake City, UT 84112 (United States)

    2011-11-10

    Much of our knowledge regarding cancer immunotherapy has been derived from sarcoma models. However, translation of preclinical findings to bedside success has been limited in this disease, though several intriguing clinical studies hint at the potential efficacy of this treatment modality. The rarity and heterogeneity of tumors of mesenchymal origin continues to be a challenge from a therapeutic standpoint. Nonetheless, sarcomas remain attractive targets for immunotherapy, as they can be characterized by specific epitopes, either from their mesenchymal origins or specific alterations in gene products. To date, standard vaccine trials have proven disappointing, likely due to mechanisms by which tumors equilibrate with and ultimately escape immune surveillance. More sophisticated approaches will likely require multimodal techniques, both by enhancing immunity, but also geared towards overcoming innate mechanisms of immunosuppression that favor tumorigenesis.

  6. Long-term cause-specific mortality in survivors of adolescent and young adult bone and soft tissue sarcoma: a population-based study of 28,844 patients.

    Science.gov (United States)

    Youn, Paul; Milano, Michael T; Constine, Louis S; Travis, Lois B

    2014-08-01

    Despite improved cure rates for bone and soft tissue sarcomas, to the authors' knowledge, no large population-based study to date has evaluated long-term cause-specific mortality in patients diagnosed in the adolescent and young adult (AYA) age range (15 years-39 years). A total of 28,844 survivors of AYA bone and soft tissue sarcoma, who accrued 113,206 person-years of follow-up, were identified in the population-based Surveillance, Epidemiology, and End Results program. Standardized mortality ratios (SMR) and absolute excess risks (AER) (per 10,000 person-years) were calculated to evaluate associations with histology (chemotherapy-sensitive subtypes: Ewing sarcoma, osteosarcoma, and rhabdomyosarcoma vs all other subtypes), age, and initial therapy. All-cause mortality in survivors of AYA sarcoma was found to be significantly increased compared with that of the general population (SMR, 1.76; 95% confidence interval [95% CI], 1.60-1.92 [AER of 19]), and persisted for > 20 years (SMR, 1.39; 95% CI, 1.04-1.82 [AER of 20]). Significant excess mortality was observed for both second malignant neoplasms (SMR, 2.05; 95% CI, 1.71-2.43 [AER of 7]) and noncancer causes (SMR, 1.66; 95% CI, 1.49-1.85 [AER of 19]). Significant excess deaths occurred among patients with chemotherapy-sensitive (SMR, 2.76; 95% CI, 2.20-3.41 [AER of 32]) and nonchemosensitive (SMR, 1.63; 95% CI, 1.47-1.80 [AER of 17]) subtypes. Significantly elevated noncancer mortality in the former group included cardiovascular disease (SMR, 2.33) and infections (SMR, 15.6), whereas significant excess deaths in the latter group included diabetes (SMR, 2.40) and infections (SMR, 2.77). Survivors of AYA bone and soft tissue sarcoma experience significant long-term mortality due to second malignant neoplasms and noncancer causes. Further research is needed to develop preventive and surveillance guidelines in this understudied population to prevent and reduce long-term excess mortality. © 2014 American Cancer

  7. Randomised phase II trial of pegylated liposomal doxorubicin (DOXIL/CAELYX) versus doxorubicin in the treatment of advanced or metastatic soft tissue sarcoma: a study by the EORTC Soft Tissue and Bone Sarcoma Group.

    NARCIS (Netherlands)

    Judson, I.; Radford, J.A.; Harris, M.; Blay, J.Y.; Hoesel, Q.G.C.M. van; Cesne, A. le; Oosterom, A. van; Clemons, M.J.; Kamby, C.; Hermans, C.; Whittaker, J.; Donato di Paola, E.; Verweij, J.; Nielsen, S.

    2001-01-01

    CAELYX/DOXIL, pegylated liposomal doxorubicin, has shown antitumour activity and reduced toxicity compared with standard doxorubicin in other tumour types. In this prospective randomised trial, 94 eligible patients with advanced soft-tissue sarcoma (STS) were treated, 50 with CAELYX (50 mg/m(2) by a

  8. Phase III trial of two investigational schedules of ifosfamide compared with standard-dose doxorubicin in advanced or metastatic soft tissue sarcoma: a European Organisation for Research and Treatment of Cancer Soft Tissue and Bone Sarcoma Group Study

    NARCIS (Netherlands)

    Lorigan, Paul; Verweij, Jaap; Papai, Zsuzsa; Rodenhuis, Sjoerd; Le Cesne, Axel; Leahy, Michael G.; Radford, John A.; van Glabbeke, Martine M.; Kirkpatrick, Anne; Hogendoorn, Pancras C. W.; Blay, Jean-Yves

    2007-01-01

    PURPOSE: Single-agent doxorubicin remains the standard treatment for advanced soft tissue sarcomas. Combining doxorubicin with standard-dose ifosfamide has not been shown to improve survival and is associated with a significantly increased toxicity; it is not known whether higher dose single-agent

  9. Therapy of Ewing's sarcoma

    International Nuclear Information System (INIS)

    Dunst, J.; Sauer, R.

    1993-01-01

    Therapy of Ewing's sarcoma requires a qualified clinical, radiological, and pathohistological diagnosis and, in particular, an optimal therapy by an experienced team of oncological specialists. Important prognostic factors are the presence of hematogenous metastases at diagnosis, the initial tumor volume, the response to chemotherapy, and adequate local therapy. Presently, cure rates of more than 60% can be achieved for localized Ewing's sarcoma by combination of local therapy and chemotherapy. The four-drug combination VACA (vincristin, actinomycin D, cyclophosphamide, adriamycin) can be considered as cytostatic gold standard. More aggressive regimens (VAIA, EVAIA, autologous bone marrow transplant) may be beneficial in subgroups and are under investigation. Concerning local therapy adequate radiotherapy plays a major role and achieves the same survival rates as radical surgery, comparable patient selection provided. Several factors have impact on radiotherapeutic results, especially total dose (45 Gy large volume, 55 Gy to the primary tumor), target volume (safety margin at least 2 cm according to the pretreatment volume, at least 5 cm in proximal and distal extension of long bones), timing of radiotherapy (as early as possible) and quality of treatment. Radiotherapy as sole local treatment is indicated in inoperable lesions (spine, sacrum, skull) and in small, good-responding tumors. High-risk patients should receive combined radiotherapeutic-surgical treatment, preferably as pre-operative irradiation. The value of hyperfractionation is not yet proven despite theoretical advantages. (orig.) [de

  10. General Information about Kaposi Sarcoma

    Science.gov (United States)

    ... Sarcoma Treatment Childhood Vascular Tumors Treatment Research Kaposi Sarcoma Treatment (PDQ®)–Patient Version General Information About Kaposi Sarcoma Go to Health Professional Version Key Points Kaposi ...

  11. Treatment Option Overview (Kaposi Sarcoma)

    Science.gov (United States)

    ... Sarcoma Treatment Childhood Vascular Tumors Treatment Research Kaposi Sarcoma Treatment (PDQ®)–Patient Version General Information About Kaposi Sarcoma Go to Health Professional Version Key Points Kaposi ...

  12. Treatment Options for Kaposi Sarcoma

    Science.gov (United States)

    ... Sarcoma Treatment Childhood Vascular Tumors Treatment Research Kaposi Sarcoma Treatment (PDQ®)–Patient Version General Information About Kaposi Sarcoma Go to Health Professional Version Key Points Kaposi ...

  13. Sarcomas en la extremidad superior: revisión del Servicio de Cirugía Plástica - Comité de Sarcomas de Partes Blandas del Hospital Dr. Negrin

    Directory of Open Access Journals (Sweden)

    Javier Fernández-Palacios

    Full Text Available Introducción y Objetivo. Los sarcomas de la extremidad superior suponen un bajo porcentaje dentro de los sarcomas en general. Las características anatómicas de las extremidades superiores representan un reto quirúrgico a la hora de conjugar la radicalidad con la preservación funcional de la extremidad. Por el contrario, la raíz de la extremidad ya presenta otras características anatómicas y dimensiones, permitiendo extirpaciones más amplias y siendo además asiento favorito de sarcomas de bajo grado. Con estas premisas, es de suponer que el pronóstico global de esta localización sea más favorable que el del resto de la extremidad. El objetivo del presente estudio es confirmar dicha hipótesis en base a nuestra propia experiencia. Material y Método. De los 131 sarcomas intervenidos en nuestro Servicio durante los últimos 10 años, recogemos 29 casos de sarcomas en extremidad superior, que dividimos en 2 grupos según su asiento: los que afectan a la cintura escapular (hombro, escápula y clavícula, con 12 casos; y los de asiento en la extremidad propiamente dicha (axila, brazo, antebrazo y mano con 17 casos. Analizamos una serie de variables en ambos grupos: sexo, edad, localización, tipo histológico, grado de diferenciación, presentación, tipo de extirpación, tratamiento quirúrgico, terapias complementarias, estado local, estado general y seguimiento. Resultados. Los sarcomas de la cintura escapular fueron, en nuestro grupo de estudio, de menor grado que los de la extremidad propiamente dicha. Se presentaron en su mayoría como casos primarios. Estos sarcomas son susceptibles de tratamientos más radicales y como consecuencia, los márgenes obtenidos fueron mejores que los del otro grupo. Ninguno de los 12 pacientes con sarcoma en cintura escapular presentó enfermedad local o general. Los sarcomas de la extremidad superior propiamente dicha fueron de predomino femenino, de más alto grado y se presentaron como recidivas o

  14. Bone morphometry and mineral contents of the distal part of the fractured third metacarpal bone in thoroughbred racehorses

    International Nuclear Information System (INIS)

    Yoshihara, T.; Oikawa, M.; Wada, R.; Hasegawa, M.; Kaneko, M.

    1990-01-01

    Most of the bone fractures in racehorses occur in the fore limb, especially in the metacarpal joint during the racing and training. The longitudinal fracture of the third metacarpal bone (Mc III) often occurs in the osteosclerotic and/or necrotic lesions in the distal part of the bone. To elucidate the endogenous factors of its fracture, soft radiograms of 4 fractured and 4 non-fractured control cases have been investigated morphometrically by a image analyzer. In addition, to analyze the quality of these bones, 20 elements of mineral contents in the crashed bones have been measured using a fluorescent X-ray analyzer. As the results, the osteosclerotic change was observed in both groups in the plantar side of the distal part of Mc III, however, no significant differences were found in the bone morphometry. No significant differences in the 19 elements of bone mineral were found except Fe. From these findings, the mechanism of the occurrence of the longitudinal fracture in the Mc III remains to be elucidated. In future, further work needs to be done with regard to the mechanical intensity and collagen disposition of the distal part of the Mc III

  15. The insulin-like growth factor system and sarcomas

    NARCIS (Netherlands)

    Rikhof, Bart; de Jong, Steven; Suurmeijer, Albert J. H.; Meijer, Coby; van der Graaf, Winette T. A.

    Sarcomas are a diverse group of malignant mesenchymal tumours arising from bone and soft tissues. The identification of critical cellular signalling pathways in sarcomas is an important issue for the development of new targeted therapies. This review highlights the experimental and clinical evidence

  16. The insulin-like growth factor system and sarcomas.

    NARCIS (Netherlands)

    Rikhof, B.; Jong, S. de; Suurmeijer, A.J.H.; Meijer, C.; Graaf, W.T.A. van der

    2009-01-01

    Sarcomas are a diverse group of malignant mesenchymal tumours arising from bone and soft tissues. The identification of critical cellular signalling pathways in sarcomas is an important issue for the development of new targeted therapies. This review highlights the experimental and clinical evidence

  17. Ewing Sarcoma: Current Management and Future Approaches Through Collaboration

    NARCIS (Netherlands)

    Gaspar, Nathalie; Hawkins, Douglas S.; Dirksen, Uta; Lewis, Ian J.; Ferrari, Stefano; Le Deley, Marie-Cecile; Kovar, Heinrich; Grimer, Robert; Whelan, Jeremy; Claude, Line; Delattre, Olivier; Paulussen, Michael; Picci, Piero; Sundby Hall, Kirsten; van den Berg, Hendrik; Ladenstein, Ruth; Michon, Jean; Hjorth, Lars; Judson, Ian; Luksch, Roberto; Bernstein, Mark L.; Marec-Bérard, Perrine; Brennan, Bernadette; Craft, Alan W.; Womer, Richard B.; Juergens, Heribert; Oberlin, Odile

    2015-01-01

    Ewing sarcoma (ES) is an aggressive sarcoma of bone and soft tissue occurring at any age with a peak incidence in adolescents and young adults. The treatment of ES relies on a multidisciplinary approach, coupling risk-adapted intensive neoadjuvant and adjuvant chemotherapies with surgery and/or

  18. Sarcoma de Ewing en paciente masculino Ewing's sarcoma in a male patient

    Directory of Open Access Journals (Sweden)

    Eddy Millán Escalona

    2010-09-01

    Full Text Available El sarcoma de Ewing es un tumor óseo maligno de células redondas pequeñas. Es el segundo tumor óseo maligno más frecuente en la infancia, y se puede presentar en cualquier momento durante la niñez y comienzos de la edad adulta. El tumor puede originarse en cualquier parte del cuerpo, generalmente en los huesos largos de las extremidades, la pelvis o el tórax, al igual que en el cráneo o en los huesos planos del tronco. Se trata de un paciente masculino, mestizo, de 38 años de edad, que acude a consulta externa en el hospital de Nickerie, Suriname, por presentar aumento de volumen en la región lateral derecha del abdomen. Refiere que ha presentado pérdida de peso, decaimiento marcado y anorexia. Estos síntomas se iniciaron 3 meses antes, y se han incrementado paulatina y progresivamente. Tiene también dificultad para deambular y dolor en la pierna derecha.The Ewing's sarcoma is a malignant bone tumor of round cells. The second malignant bone tumor more frequent in childhood and may to appear in any moment during this life stage and at onset of adulthood. Tumor may to originate in any place of body, generally in limbs long bones, pelvis or thorax as well as in skull or in trunk flat bones. This case is a black male patient aged 38 seen in external consultation in the hospital of Nickerie, Surinam presenting with a volume increase in the right lateral region of abdomen. He refers a weight loss, a marked weakness and anorexia. These symptoms appeared three months before increasing in a gradual and progressively way. He has difficulty to walk and pain in the right leg.

  19. Whole-Body Radiation Therapy, Systemic Chemotherapy, and High-Dose Chemotherapy Followed By Stem Cell Rescue in Treating Patients With Poor-Risk Ewing Sarcoma

    Science.gov (United States)

    2015-01-07

    Adult Supratentorial Primitive Neuroectodermal Tumor (PNET); Ewing Sarcoma of Bone; Extraosseous Ewing Sarcoma; Metastatic Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Recurrent Childhood Supratentorial Primitive Neuroectodermal Tumor; Recurrent Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor; Untreated Childhood Supratentorial Primitive Neuroectodermal Tumor

  20. Sarcoma Arising from the Chest Wall : A Case Report.

    Science.gov (United States)

    Akhtar, Aisha; Shah, Sana; Sheikh, Abu Baker; Nasrullah, Adeel; Haq, Shujaul; Ghazanfar, Haider; Rizwan, Muneeba

    2017-08-24

    Chest wall contains a wide array of tissues ranging from soft tissues like skin and muscle to bone. A variety of sarcomas can present with a painful or painless mass, which often requires histological testing for diagnosis. Chest wall sarcomas are very rare entities which are often growing slow . A multidisciplinary team is necessary for the management of chest wall sarcomas. We present a case of a 30-year-old male with spindle cell sarcoma of the chest wall and he underwent wide local excision along with surgical reconstruction.

  1. Sarcoma Arising from the Chest Wall : A Case Report

    OpenAIRE

    Akhtar, Aisha; Shah, Sana; Sheikh, Abu Baker; Nasrullah, Adeel; Haq, Shujaul; Ghazanfar, Haider; Rizwan, Muneeba

    2017-01-01

    Chest wall contains a wide array of tissues ranging from soft tissues like skin and muscle to bone. A variety of sarcomas can present with a painful or painless mass, which often requires histological testing for diagnosis. Chest wall sarcomas are very rare entities which are often growing slow . A multidisciplinary team is necessary for the management of chest wall sarcomas. We present a case of a 30-year-old male with spindle cell sarcoma of the chest wall and he underwent wide local excisi...

  2. Angiography of histopathologic variants of synovial sarcoma

    International Nuclear Information System (INIS)

    Lois, J.F.; Fischer, H.J.; Mirra, J.M.; Gomes, A.S.; California Univ., Los Angeles

    1986-01-01

    Synovial sarcomas are rare soft tissue tumors which histopathologically can be divided into monophasic, biphasic and mixed variants. As part of a protocol for intra-arterial chemotherapy 12 patients with biopsy proven synovial sarcoma underwent angiography. The angiograms on these patients were reviewed to determine whether synovial sarcomas and their variants demonstrated a characteristic angiographic appearance. Synovial sarcomas appeared angiographically as soft tissue masses which showed a fine network of tumor vessels with an inhomogeneous capillary blush. Their degree of vascularity varied according to their histopathology. Monophasic synovial sarcomas demonstrated in general a higher degree of neovascularity than the biphasic form. This finding was also suggested by histopathologic analysis of the vessels in the tumor. Although angiography did not show a distinctive vascular pattern it may be useful to evaluate tumor size and vascularity. (orig.)

  3. Postradiation sarcoma involving the spine

    International Nuclear Information System (INIS)

    Sundaresan, N.; Huvos, A.G.; Krol, G.; Hughes, J.E.; Cahan, W.G.

    1986-01-01

    Postradiation sarcomas arising many years after treatment of cancer are long term sequelae of therapy. We describe the clinical features, radiographic findings, and results of treatment in 13 patients with such sarcomas encountered over a 6-year period. Of these patients, 9 had bone sarcomas and the remaining 4 had paraspinal tumors arising from adjacent soft tissue and nerve. The primary cancer for which radiation was given included Hodgkin's disease (4 patients), breast cancer (2 patients), cervix cancer (2 patients), and a variety of others (5 patients). The latent interval to the occurrence of the second neoplasm varied from 6 to 30 years (median, 10 years) after treatment of the original tumor. Despite aggressive treatment, the overall prognosis was poor. The median survival was 8 months, with only 3 surviving more than 2 years. Although rare, postradiation sarcoma should be considered in the differential diagnosis of patients presenting with late onset of spinal pain or neurological symptoms after clinical remission of an original cancer

  4. Cuadro clínico patológico y factores pronósticos de sobrevida en adultos con sarcomas de partes blandas

    Directory of Open Access Journals (Sweden)

    Juan Díaz-Plasencia

    1997-10-01

    Full Text Available Objetivo: Identificar el cuadro clínico - patológico y algunos factores pronósticos que influyen en la sobrevida actuarial a 5 años. Material y métodos: Analizamos retrospectivamente información de 44 adultos portadores de sarcomas de partes blandas tratados en el Hospital Belén, Perú, desde 1967 a 1994. La estimación de la sobrevida fue hecha por el método de Kaplan - Meier y en el análisis univariado utilizamos el test de log - rank. Resultados: La edad promedio fue de 46 ± 19 años (límites, 16 a 85 años. Hubo 21 hombres y 23 mujeres (H:M, 0,9:1. Las molestias más frecuentes fueron tumor y dolor local. Las localizaciones más afectadas fueron las extremidades inferiores (52% y superiores (21%. De acuerdo a la clasificación UICC, 48% de los casos estuvieron en estadio II. 23 % en estadio III, 18 % en estadio IV y 11 % en estadio I. Los tipos histológicos predominantes fueron: Fibrosarcoma (34 %, liposarcoma (16 % y rabdomiosarcoma (14 %. Trece tumores (30 % fueron clasificados como grado 3, 24 (55% como grado 2 y 7 (16 % como grado 1. La sobrevida a 5 años fue de 54 % con cirugía sola (n=27, 11 % con cirugía más radioterapia y/o quimioterapia (n=13 y 0% con radioterapia y /o quimioterapia (n=4 (p< 0.01. La sobrevida a 5 años en la serie total fue 38 %. Fueron factores que influyeron en la sobrevida: Edad (p< 0.001, tiempo de enfermedad (p <0.001, estado ganglionar regional (p <0.001, grado histológico (p < 0.01, estadio clínico (p <0.001 y tipo de tratamiento (p <0.001. Conclusión: El tratamiento de elección para los sarcomas de partes blandas es la cirugía de amplio margen. (Rev Med Hered 1997; 8: 129-141.

  5. Soft Tissue Sarcoma

    Science.gov (United States)

    ... muscles, tendons, fat, and blood vessels. Soft tissue sarcoma is a cancer of these soft tissues. There ... have certain genetic diseases. Doctors diagnose soft tissue sarcomas with a biopsy. Treatments include surgery to remove ...

  6. Irradiation for conjunctival granulocytic sarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Fleckenstein, K.; Geinitz, H.; Grosu, A.; Molls, M. [Dept. of Radiation Oncology, Technical Univ. of Munich (Germany); Goetze, K. [Dept. of Hematology and Oncology, Technical Univ. of Munich (Germany); Werner, M. [Dept. of Pathology, Technical Univ. of Munich (Germany)

    2003-03-01

    Case History and Findings: A 73-year-old woman with a history of myeloproliferative syndrome (MPS) presented with bilateral chemosis, redness and burning of the eyes. The ocular motility was severely impaired. Ophthalmological examination revealed markedly distended conjunctivas on both sides. Biopsy disclosed conjunctival granulocytic sarcoma as an initial symptom of acute myelogenous leukemia (AML). Diagnosis was confirmed by peripheral blood smear and bone marrow aspiration. Treatment and Outcome: The orbital tumor disappeared completely after local external beam irradiation with a total dose of 30 Gy and no further orbital recurrence occurred. With chemotherapy following irradiation transient hematological remission was achieved. 5 months after diagnosis the patient died of respiratory failure following atypical pneumonia as a consequence of her underlying disorder. Conclusion: Detection of orbital granulocytic sarcoma, even in the absence of typical leukemic symptoms is of practical importance, because treatment with irradiation can lead to stabilization or improvement in the patient's vision. (orig.)

  7. The use of bone age in clinical practice - Part 2

    DEFF Research Database (Denmark)

    Martin, D.D.; Binder, Gitte Sommer; Ranke, M.B.

    2011-01-01

    and measures of bone lengths, width, thickness and cortical thickness should always be evaluated in relation to a child's height and BA, especially around puberty. The use of skeletal maturity, assessed on a radiograph alone to estimate chronological age for immigration authorities or criminal courts...

  8. [Surgical resection of primary soft-tissue sarcoma of the extremities].

    Science.gov (United States)

    Kolarz, K; Treder, M; Lorczyński, A

    2001-01-01

    We evaluated 5 patients who had soft tissue sarcoma of the extremity treated by limb sparing surgery. All tumors were adjacent to bone, with no features of infiltration. According to the Surgical Staging System, all tumors were IIB. The mean follow-up was 13 months. To achieve wide resections of the tumors in such cases we recommend resections of the tumor with part of the bone, which is in direct contact with the tumor. Wide resection margins were achieved in all patients and none had local recurrence during the observation period.

  9. Synovial sarcoma with radiological appearances of primitive neuroectodermal tumour/Ewing sarcoma: differentiation by molecular genetic studies

    International Nuclear Information System (INIS)

    O'Donnell, P.; Diss, T.C.; Whelan, J.; Flanagan, A.M.

    2006-01-01

    Synovial sarcoma (SS) arises in soft tissues but may invade adjacent bone. We describe a case of SS presenting as aggressive lysis of the proximal ulna, the imaging of which suggested a primary bone lesion. Needle biopsy showed a 'small round blue cell tumour', and a primitive neuroectodermal tumour (PNET)/Ewing sarcoma was suggested on the basis of the imaging appearances. The definitive diagnosis of synovial sarcoma was made following molecular genetic studies, which demonstrated a fusion product incorporating the genes SYT and SSX1. The importance of correct diagnosis to guide appropriate management, and, therefore, the necessity for molecular genetic studies, is discussed. (orig.)

  10. Bone transplantation and tissue engineering, part III: allografts, bone grafting and bone banking in the twentieth century.

    Science.gov (United States)

    Hernigou, Philippe

    2015-03-01

    During the 20th century, allograft implantation waned in popularity as a clinical activity. Reports appeared in the literature describing several small series of patients in whom bone was obtained from amputation specimens or recently deceased individuals. The concept of bone banking became a reality during and after World War II when the National Naval Tissue Bank was established in Bethesda and a number of small banks sprang up in hospitals throughout the world. Small fragments, either of cortical or medullary bone, from these banks were used heterotopically to augment spinal fusions, to implant into cyst cavities, or to serve as a scaffolding for repair of non- or delayed union of fractures of the long bones.

  11. Primary ewing sarcoma of the anterior mandible localized to the midline

    NARCIS (Netherlands)

    Ko, E.; Brouns, E.R.E.A.; Korones, D.N.; Pochal, W.F.; Philipone, E.M.; Zegarelli, D.J.; Yoon, A.J.

    2013-01-01

    Ewing sarcoma is a malignant, small, round blue-cell tumor of the bone that is usually located in the long bones and the pelvis. Fewer than 3% of all Ewing sarcomas originate in the head and neck region and these are mostly located in the posterior mandible. We report the case of a 17-year-old girl

  12. Myeloid Sarcoma after Allogenic Stem Cell Transplantation for Acute Myeloid Leukemia: Successful Consolidation Treatment Approaches in Two Patients

    Directory of Open Access Journals (Sweden)

    Silje Johansen

    2018-01-01

    Full Text Available Myeloid sarcoma is an extramedullary (EM manifestation (i.e., manifestation outside the bone marrow of acute myeloid leukemia (AML; it is assumed to be relatively uncommon and can be the only manifestation of leukemia relapse after allogenic stem cell transplantation (allo-SCT. An EM sarcoma can manifest in any part of the body, although preferentially manifesting in immunological sanctuary sites as a single or multiple tumors. The development of myeloid sarcoma after allo-SCT is associated with certain cytogenetic abnormalities, developing of graft versus host disease (GVHD, and treatment with donor lymphocytes infusion (DLI. It is believed that posttransplant myeloid sarcomas develop because the EM sites evade immune surveillance. We present two patients with EM myeloid sarcoma in the breast and epipharynx, respectively, as the only manifestation of leukemia relapse. Both patients were treated with a combination of local and systemic therapy, with successfully longtime disease-free survival. Based on these two case reports, we give an updated review of the literature and discuss the pathogenesis, diagnosis, and treatment of EM sarcoma as the only manifestation of AML relapse after allo-SCT. There are no standard guidelines for the treatment of myeloid sarcomas in allotransplant recipients. In our opinion, the treatment of these patients needs to be individualized and should include local treatment (i.e., radiotherapy combined with systemic therapy (i.e., chemotherapy, immunotherapy, DLI, or retransplantation. The treatment has to consider both the need for sufficient antileukemic efficiency versus the risk of severe complications due to cumulative toxicity.

  13. Cirurgia conservadora, radioterapia externa e reforço de dose com braquiterapia de alta taxa de dose: uma nova perspectiva no tratamento de sarcomas de partes moles do adulto Limb-sparing surgery, external beam radiotherapy and boost with high-dose rate brachytherapy: a new perspective for the treatment of soft tissue sarcomas in adults

    Directory of Open Access Journals (Sweden)

    Antonio Cássio Assis Pellizzon

    2002-03-01

    Full Text Available OBJETIVO: Avaliar a influência no controle local de pacientes adultos e portadores de sarcoma de partes moles em extremidades e submetidos a cirurgia conservadora do membro, com braquiterapia de alta taxa de dose (BATD como reforço para a radioterapia externa (RT. MATERIAL E MÉTODOS: Foram avaliados 16 pacientes tratados, de 1993 até 1999. A RT foi utilizada com finalidade pré ou pós-operatória (30--55 Gy e BATD com dose de 18--36 Gy (fx 3--6 Gy BID. Com base no modelo linear quadrático calculou-se a dose efetiva biológica ("biological effective dose" - BED para o tumor e comparou-se seu valor a dados da literatura internacional, que utiliza tratamentos com RT e braquiterapia de baixa taxa de dose (BBTD. RESULTADOS: Os valores médios e medianos da BED para os sarcomas de partes moles foram de 78,5 Gy7 e 80 Gy7. A análise univariada mostrou que a BED para o tumor, quando utilizada BATD, era semelhante ao valor de 83 Gy7 quando utilizada BBTD (p = 0,008. As taxas de controle local, sobrevida livre de doença e sobrevida global atuarial em cinco anos foram de 83,2%, 75% e 93,7%, respectivamente. CONCLUSÕES: A BATD, quando utilizada como método complementar no reforço de dose da RT no tratamento conservador dos sarcomas de partes moles, apresenta taxas de controle local equiparáveis às da literatura internacional; no entanto, estudos com número maior de pacientes e período maior de seguimento são ainda necessários para determinar o verdadeiro potencial da BATD em substituir a BBTD.PURPOSE: To evaluate the influence on local control in adult patients with soft tissue sarcomas of the limbs that underwent limb-sparing surgery and high-dose rate brachytherapy (HDRB in association with teletherapy. MATERIAL AND METHODS: Sixteen patients treated from 1993 to 1999 were reviewed. Teletherapy was used pre- or postoperatively (30--55 Gy in association with HDRB in a dose range of 18--36 Gy (fx 3--6 Gy BID. The linear quadratic model was

  14. AICRG, Part II: Crestal bone loss associated with the Ankylos implant: loading to 36 months.

    Science.gov (United States)

    Chou, Cherng-Tzeh; Morris, Harold F; Ochi, Shigeru; Walker, Lori; DesRosiers, Deborah

    2004-01-01

    The Ankylos endosseous dental implant is a new implant design that will be available in the United States in early 2004. It features an internal tapered abutment connection, a smooth polished collar without threads at the coronal part of the implant body, and a roughened surface with variable threads on the body of the implant fixture. A precise, tapered, conical abutment connection eliminates the microgap often found in 2-stage implant systems. This microgap may allow the accumulation of food debris and bacteria, as well as micromovement between the parts during clinical function, both of which can lead to a localized inflammation and crestal bone loss. The purpose of this section of the study was to assess any crestal bone loss associated with this new implant. The clinical performance of this new implant design was studied under well-controlled clinical conditions. Over 1500 implants were placed and restored. The vertical crestal bone loss was measured "directly" between the time of implant placement and uncovering, using a periodontal probe. Serial dental radiographs were taken between loading, and the 12-, 24-, and 36-month follow-up visits to determine "indirect" crestal bone loss within a specific period. Bone loss varied among the participating centers from less than 0.5 mm to 2.0 mm. The largest amount of bone loss occurred between the time of placement and uncovering. Following loading, the mean bone loss for all implants for a period of 3 years was about 0.2 mm/y. The extent of the crestal bone loss after loading was minimal for patients regardless of age, gender, prosthetic applications, bone density, and remote or crestal incisions, as well as for smokers or nonsmokers. Bone loss per year is well within the guidelines of 0.2 mm/y proposed by others.

  15. The Danish Sarcoma Database

    DEFF Research Database (Denmark)

    Jørgensen, Peter Holmberg; Lausten, Gunnar Schwarz; Pedersen, Alma B

    2016-01-01

    AIM: The aim of the database is to gather information about sarcomas treated in Denmark in order to continuously monitor and improve the quality of sarcoma treatment in a local, a national, and an international perspective. STUDY POPULATION: Patients in Denmark diagnosed with a sarcoma, both...... skeletal and ekstraskeletal, are to be registered since 2009. MAIN VARIABLES: The database contains information about appearance of symptoms; date of receiving referral to a sarcoma center; date of first visit; whether surgery has been performed elsewhere before referral, diagnosis, and treatment; tumor...... of Diseases - tenth edition codes and TNM Classification of Malignant Tumours, and date of death (after yearly coupling to the Danish Civil Registration System). Data quality and completeness are currently secured. CONCLUSION: The Danish Sarcoma Database is population based and includes sarcomas occurring...

  16. Cystic Pleural Synovial Sarcoma.

    Science.gov (United States)

    Sharif, Atif; Akhtar, Tasleem; Akhtar, Mumtaz; Zia, Naeem

    2016-11-01

    Fewer than 40 cases of primary pleural synovial sarcoma have been reported so far with only 3 cases of cystic synovial sarcoma including cases originating from sites other than the pleura. Here, we present an exceedingly rare case of cystic synovial sarcoma originating from the mediastinal side of the visceral pleura in a 25-year man presenting with hemoptysis. On contrast-enhanced computed tomography (CT), cystic synovial sarcoma and cystic thymoma were difficult to be distinguished due to mediastinal location. Histopathological examination showed spindled morphology of tumor cells with hypercellularity and nuclear atypia. As these features are associated with both monophasic fibrous synovial sarcoma and type Athymoma, immunohistochemistry was performed. Adiagnosis of synovial sarcoma was confirmed by detection of CD99 and EMAand negativity of other markers. Fluorescence in situhybridization (FISH) was not done. Surgical excision was done and followed by oncology referral.

  17. Hyperplastic Cardiac Sarcoma Recurrence

    Directory of Open Access Journals (Sweden)

    Masood A. Shariff

    2015-01-01

    Full Text Available Primary cardiac sarcomas are rare tumors with a median survival of 6–12 months. Data suggest that an aggressive multidisciplinary approach may improve patient outcome. We present the case of a male who underwent resection of cardiac sarcoma three times from the age of 32 to 34. This report discusses the malignant nature of cardiac sarcoma and the importance of postoperative multidisciplinary care.

  18. Oncolytic Maraba Virus MG1 as a Treatment for Sarcoma.

    Science.gov (United States)

    Le Boeuf, Fabrice; Selman, Mohammed; Son, Hwan Hee; Bergeron, Anabel; Chen, Andrew; Tsang, Jovian; Butterwick, Derek; Arulanandam, Rozanne; Forbes, Nicole E; Tzelepis, Fanny; Bell, John C; Werier, Joel; Abdelbary, Hesham; Diallo, Jean-Simon

    2017-09-15

    The poor prognosis of patients with advanced bone and soft-tissue sarcoma has not changed in the past several decades, highlighting the necessity for new therapeutic approaches. Immunotherapies, including oncolytic viral (OV) therapy, have shown great promise in a number of clinical trials for a variety of tumor types. However, the effective application of OV in treating sarcoma still remains to be demonstrated. Although few pre-clinical studies using distinct OVs have been performed and demonstrated therapeutic benefit in sarcoma models, a side-by-side comparison of clinically relevant OV platforms has not been performed. Four clinically relevant OV platforms (Reovirus, Vaccinia virus, Herpes-simplex virus and Rhabdovirus) were screened for their ability to infect and kill human and canine sarcoma cell lines in vitro, and human sarcoma specimens ex vivo. In vivo treatment efficacy was tested in a murine model. The rhabdovirus MG1 demonstrated the highest potency in vitro. Ex vivo, MG1 productively infected more than 80% of human sarcoma tissues tested, and treatment in vivo led to a significant increase in long-lasting cures in sarcoma-bearing mice. Importantly, MG1 treatment induced the generation of memory immune response that provided protection against a subsequent tumor challenge. This study opens the door for the use of MG1-based oncolytic immunotherapy strategies as treatment for sarcoma or as a component of a combined therapy. © 2017 UICC.

  19. Ewing's sarcoma: a neuroectodermal tumor of the chest wall; Sarcoma de Ewing/tumor neuroectodermico de pared toracica

    Energy Technology Data Exchange (ETDEWEB)

    Alcaraz, M. J.; Lorente, M. L.; Martin, A. M. [Hospital Universitario de Getafe. Madrid (Spain); Gonzalez, I. [Hospital Nacional del Nino Jesus. Madrid (Spain)

    2000-07-01

    Ewing's sarcoma is the second most common malignant bone tumor in children and young adults. It is most prevalent between the ages of 10 and 15 years. There are present two cases of Ewing's sarcoma of the chest wall. The clinical, radiological and pathological features are described and the therapeutic options are discussed. (Author)

  20. Clear cell sarcoma of the abdominal wall with peritoneal sarcomatosis: CT features

    International Nuclear Information System (INIS)

    Sabate, J.M.; Fernandez, A.; Torrubia, S.; Villanueva, A.; Monill, J.M.

    1999-01-01

    Clear cell sarcoma, also called malignant melanoma of soft parts, is an uncommon neoplasm that involves tendons or aponeuroses of the lower extremity. The CT features of a clear cell sarcoma arising from the abdominal wall with later peritoneal dissemination are described. Peritoneal sarcomatosis from soft tissue sarcomas is a very rare condition previously unreported in the radiologic literature. Metastases to peritoneal surfaces must therefore be considered a possible site for systemic dissemination of soft tissue sarcomas. (orig.)

  1. Postirradiation sarcoma (malignant fibrous histiocytoma) following cervix cancer

    International Nuclear Information System (INIS)

    Pinkston, J.A.; Sekine, Ichiro.

    1980-12-01

    A case of postirradiation sarcoma is described. The tumor, a malignant fibrous histiocytoma, occurred in the radiation field 11 years following postoperative external beam radiation therapy (7,000 rad) for carcinoma of the cervix. Reports of postirradiation malignant fibrous histiocytoma are rare, and the occurrence of this neoplasm following treatment for cervix cancer has not previously been described. The literature concerning postirradiation bone and soft tissue sarcomas is briefly reviewed, with special attention to malignant fibrous histiocytomas. (author)

  2. Current State of Pediatric Sarcoma Biology and Opportunities for Future Discovery: A Report from the Sarcoma Translational Research Workshop

    Science.gov (United States)

    Hingorani, Pooja; Janeway, Katherine; Crompton, Brian D.; Kadoch, Cigall; Mackall, Crystal L.; Khan, Javed; Shern, Jack F.; Schiffman, Joshua; Mirabello, Lisa; Savage, Sharon A.; Ladanyi, Marc; Meltzer, Paul; Bult, Carol J.; Adamson, Peter C.; Lupo, Philip J.; Mody, Rajen; DuBois, Steven G.; Parsons, D. Williams; Khanna, Chand; Lau, Ching; Hawkins, Douglas S.; Randall, R. Lor; Smith, Malcolm; Sorensen, Poul H.; Plon, Sharon E.; Skapek, Stephen X.; Lessnick, Stephen; Gorlick, Richard; Reed, Damon R.

    2017-01-01

    Sarcomas are a rare subgroup of pediatric cancers comprised of a variety of bone and soft-tissue tumors. While significant advances have been made in improving outcomes of patients with localized pediatric sarcomas since the addition of systemic chemotherapy to local control many decades ago, outcomes for patients with metastatic and relapsed sarcoma remain poor with few novel therapeutics identified to date. With the advent of new technologies to study cancer genomes, transcriptomes and epigenomes, our understanding of sarcoma biology has improved tremendously in a relatively short period of time. However, much remains to be accomplished in this arena especially with regard to translating all of this new knowledge to the bedside. To this end, a meeting was convened in Philadelphia, PA on April 18, 2015 sponsored by the QuadW foundation, Children’s Oncology Group and CureSearch for Children’s Cancer that brought together sarcoma clinicians and scientists from North America to review the current state of pediatric sarcoma biology and ongoing/planned genomics based clinical trials in an effort to identify and bridge knowledge gaps that continue to exist at the current time. At the conclusion of the workshop, three key objectives that would significantly further our understanding of sarcoma were identified and a proposal was put forward to develop an all-encompassing pediatric sarcoma biology protocol that would address these specific needs. This review summarizes the proceedings of the workshop. PMID:27132463

  3. Osteogenic sarcoma with skeletal muscle metastases

    International Nuclear Information System (INIS)

    Peh, W.C.G.; Shek, T.W.H.; Wang Shihchang; Wong, J.W.K.; Chien, E.P.

    1999-01-01

    Two cases of osteogenic sarcoma with skeletal muscle metastases are described. A 40-year-old woman presented with progressive swelling of both calves and a soft tissue back lump. She had been diagnosed with mandibular chondroblastic osteogenic sarcoma 6 years earlier. Radiographs showed calcified masses. MRI scans and bone scintigraphy revealed multiple soft tissue masses in both calves. Bone scintigraphy also showed uptake in the back lump, right thigh and left lung base. Biopsy confirmed metastatic chondroblastic osteogenic sarcoma, which initially responded well to chemotherapy. However, the metastatic disease subsequently progressed rapidly and she died 21 months after presentation. The second case concerns a 20-year-old man who presented with a pathologic fracture of the humerus, which was found to be due to osteoblastic osteogenic sarcoma. He developed cerebral metastases 17 months later, followed by metastases at other sites. Calcified masses were subsequently seen on radiographs of the abdomen and chest. CT scans confirmed the presence of densely calcified muscle metastases in the abdominal wall, erector spinae and gluteal muscles. The patient's disease progressed rapidly and he died 30 months after presentation. (orig.)

  4. Osteogenic sarcoma with skeletal muscle metastases

    Energy Technology Data Exchange (ETDEWEB)

    Peh, W.C.G. [Department of Diagnostic Radiology, The University of Hong Kong, Queen Mary Hospital (Hong Kong); Shek, T.W.H. [Department of Pathology, The University of Hong Kong, Queen Mary Hospital (Hong Kong); Wang Shihchang [Department of Diagnostic Imaging, National University of Singapore, National University Hospital (Singapore); Wong, J.W.K.; Chien, E.P. [Department of Orthopaedic Surgery, The University of Hong Kong, Queen Mary Hospital (Hong Kong)

    1999-05-01

    Two cases of osteogenic sarcoma with skeletal muscle metastases are described. A 40-year-old woman presented with progressive swelling of both calves and a soft tissue back lump. She had been diagnosed with mandibular chondroblastic osteogenic sarcoma 6 years earlier. Radiographs showed calcified masses. MRI scans and bone scintigraphy revealed multiple soft tissue masses in both calves. Bone scintigraphy also showed uptake in the back lump, right thigh and left lung base. Biopsy confirmed metastatic chondroblastic osteogenic sarcoma, which initially responded well to chemotherapy. However, the metastatic disease subsequently progressed rapidly and she died 21 months after presentation. The second case concerns a 20-year-old man who presented with a pathologic fracture of the humerus, which was found to be due to osteoblastic osteogenic sarcoma. He developed cerebral metastases 17 months later, followed by metastases at other sites. Calcified masses were subsequently seen on radiographs of the abdomen and chest. CT scans confirmed the presence of densely calcified muscle metastases in the abdominal wall, erector spinae and gluteal muscles. The patient`s disease progressed rapidly and he died 30 months after presentation. (orig.) With 6 figs., 29 refs.

  5. Soft Tissue Sarcoma

    Science.gov (United States)

    ... removed Causes In most cases, it's not clear what causes soft tissue sarcoma. In general, cancer occurs when cells develop ... of cell that develops the genetic mutation determines what type of soft tissue sarcoma you have. For example, angiosarcoma begins in ...

  6. Uterine sarcoma - current perspectives.

    Science.gov (United States)

    Benson, Charlotte; Miah, Aisha B

    2017-01-01

    Uterine sarcomas comprise a group of rare tumors with differing tumor biology, natural history and response to treatment. Diagnosis is often made following surgery for presumed benign disease. Currently, preoperative imaging does not reliably distinguish between benign leiomyomas and other malignant pathology. Uterine leiomyosarcoma is the most common sarcoma, but other subtypes include endometrial stromal sarcoma (low grade and high grade), undifferentiated uterine sarcoma and adenosarcoma. Clinical trials have shown no definite survival benefit of adjuvant radiotherapy or chemotherapy and have been hampered by the rarity and heterogeneity of these disease types. There is a role of adjuvant treatment in carefully selected cases following multidisciplinary discussion at sarcoma reference centers. In patients with metastatic disease, systemic chemotherapy can then be considered. There is activity of a number of agents, including doxorubicin, trabectedin, gemcitabine-based chemotherapy, eribulin and pazopanib. Patients should be considered for clinical trial entry where possible. Close international collaboration is important to allow progress in this group of diseases.

  7. Cytology of Bone.

    Science.gov (United States)

    Barger, Anne M

    2017-01-01

    Cytology of bone is a useful diagnostic tool. Aspiration of lytic or proliferative lesions can assist with the diagnosis of inflammatory or neoplastic processes. Bacterial, fungal, and protozoal organisms can result in significant osteomyelitis, and these organisms can be identified on cytology. Neoplasms of bone including primary bone tumors such as osteosarcoma, chondrosarcoma, fibrosarcoma, synovial cell sarcoma, and histiocytic sarcoma and tumors of bone marrow including plasma cell neoplasia and lymphoma and metastatic neoplasia can result in significant bone lysis or proliferation and can be diagnosed effectively with cytology. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. BONE MARROW TRANSPLANTATION

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. BONE MARROW TRANSPLANTATION. AUTOLOGOUS TRANSPLANTS: Oct 1986 - Dec 2007. Multiple Myeloma 90. NHL 39. Hodgkins lymphoma 19. AML 36. APML 9. ALL 2. Amyloidosis 2. Granulocytic Sarcoma 1.

  9. Immunosuppressive Therapy-Related Kaposi Sarcoma

    Science.gov (United States)

    ... Sarcoma Treatment Childhood Vascular Tumors Treatment Research Kaposi Sarcoma Treatment (PDQ®)–Patient Version General Information About Kaposi Sarcoma Go to Health Professional Version Key Points Kaposi ...

  10. Long-term follow-up of 15 patients with non-metastatic Ewing's sarcoma and a skip lesion

    NARCIS (Netherlands)

    Jiya, T.U.; Wuisman, P.I.J.M.

    2005-01-01

    Background: Skip lesions in Ewing's sarcoma of the bone seem to be rare; to our knowledge only 7 cases have been published in the English medical literature. Methods: We retrospectively reviewed imaging and histological data relating to 235 patients with non-metastatic Ewing's sarcoma of the bone

  11. Ewing sarcoma versus osteomyelitis: differential diagnosis with magnetic resonance imaging

    International Nuclear Information System (INIS)

    Henninger, B.; Glodny, B.; Rudisch, A.; Trieb, T.; Loizides, A.; Judmaier, W.; Schocke, M.F.; Putzer, D.

    2013-01-01

    To find and evaluate characteristic magnetic resonance imaging (MRI) patterns for the differentiation between Ewing sarcoma and osteomyelitis. We identified 28 consecutive patients referred to our department for MRI (1.5 T) of an unclear bone lesion with clinical symptoms suggestive of Ewing sarcoma or osteomyelitis. MRI scans were re-evaluated by two experienced radiologists, typical MR imaging features were documented and a diagnostic decision between Ewing sarcoma and osteomyelitis was made. Statistical significance of the association between MRI features and the biopsy-based diagnosis was assessed using Fisher's exact test. The most clear-cut pattern for determining the correct diagnosis was the presence of a sharp and defined margin of the bone lesion, which was found in all patients with Ewing sarcoma, but in none of the patients with osteomyelitis (P < 0.0001). Contrast enhancing soft tissue was present in all cases with Ewing sarcoma and absent in 4 patients with osteomyelitis (P = 0.0103). Cortical destruction was found in all patients with Ewing sarcoma, 4 patients with osteomyelitis did not present any cortical reaction (P = 0.0103). Cystic or necrotic areas were identified in 13 patients with Ewing sarcoma and in 1 patient with osteomyelitis (P = 0.004). Interobserver reliability was very good (kappa = 1) in Ewing sarcoma and moderate (kappa = 0.6) in patients with osteomyelitis. A sharp and defined margin, optimally visualized on T1-weighted images in comparison to short tau inversion recovery (STIR) images, is the most significant feature of Ewing sarcoma in differentiating from osteomyelitis. (orig.)

  12. Osteonecrosis of the Jaw in Patients Receiving Bone-Targeted Therapies: An Overview--Part I.

    Science.gov (United States)

    Turner, Bruce; Drudge-Coates, Lawrence; Ali, Sacha; Pati, Jhumur; Nargund, Vinod; Ali, Enamul; Cheng, Leo; Wells, Paula

    2016-01-01

    Urologic patients receiving bone-targeted therapies are at risk of developing osteonecrosis of the jaw (ONJ). ONJ has historically been associated with bisphosphonate therapy. More recently, RANK-Ligand inhibitors (denosumab) have also been used to reduce the risk of skeletal-related events in patients who have advanced cancers with bone metastases. More than 65% of men with metastatic prostate cancer and nearly 75% of women with metastatic breast cancer are affected by bone metastases. The literature has described ONJ associated with bisphosphonate therapy as bisphosphonate-related osteonecrosis of the jaw (BRONJ). However, with evidence also linking the use of RANK-Ligand inhibitors with osteonecrosis of the jaw, we advocate use of the term "anti-bone resorption therapy-related osteonecrosis of the jaw" (ABRT-ONJ). The term "medication-related osteonecrosis of the jaw" (MRONJ) is now becoming more widespread. There is not a universally accepted definition of ABRT-ONJ, which may have hindered recognition and reporting of the condition. In Part I of this article, a review of current knowledge around the etiology of ABRT-ONJ and incidence data are provided. In Part II, we provide an audit of ONJ in a nurse consultant-led bone support clinic. In the article, we refer to zoledronic acid because this is the bisphosphonate of choice for use in men with prostate cancer in the United Kingdom.

  13. Primary Occipital Ewing’s Sarcoma with Subsequent Spinal Seeding

    Directory of Open Access Journals (Sweden)

    Ali Alqahtani

    2017-01-01

    Full Text Available Ewing’s sarcoma is a primary bone cancer that mainly affects the long bones. This malignancy is particularly common in pediatric patients. Primary cranial involvement accounts for 1% of cases, with occipital involvement considered extremely rare. In this case study, primary occipital Ewing’s sarcoma with a posterior fossa mass and subsequent relapse resulting in spinal seeding is reported. A 3-year-old patient presented with a 1-year history of left-sided headaches, localized over the occipital bone with progressive torticollis. Computed tomography (CT imaging showed a mass in the left posterior fossa compressing the brainstem. The patient then underwent surgical excision followed by adjuvant chemoradiation therapy. Two years later, the patient presented with severe lower back pain and urinary incontinence. Whole-spine magnetic resonance imaging (MRI showed cerebrospinal fluid (CSF seeding from the L5 to the S4 vertebrae. Primary cranial Ewing’s sarcoma is considered in the differential diagnosis of children with extra-axial posterior fossa mass associated with destructive permeative bone lesions. Although primary cranial Ewing’s sarcoma typically has good prognosis, our patient developed metastasis in the lower spine. Therefore, with CNS Ewing’s sarcoma, screening of the entire neural axis should be taken into consideration for early detection of CSF seeding metastasis in order to decrease the associated morbidity and mortality.

  14. The Danish Sarcoma Database

    Directory of Open Access Journals (Sweden)

    Jorgensen PH

    2016-10-01

    Full Text Available Peter Holmberg Jørgensen,1 Gunnar Schwarz Lausten,2 Alma B Pedersen3 1Tumor Section, Department of Orthopedic Surgery, Aarhus University Hospital, Aarhus, 2Tumor Section, Department of Orthopedic Surgery, Rigshospitalet, Copenhagen, 3Department of Clinical Epidemiology, Aarhus University Hospital, Aarhus, Denmark Aim: The aim of the database is to gather information about sarcomas treated in Denmark in order to continuously monitor and improve the quality of sarcoma treatment in a local, a national, and an international perspective. Study population: Patients in Denmark diagnosed with a sarcoma, both skeletal and ekstraskeletal, are to be registered since 2009. Main variables: The database contains information about appearance of symptoms; date of receiving referral to a sarcoma center; date of first visit; whether surgery has been performed elsewhere before referral, diagnosis, and treatment; tumor characteristics such as location, size, malignancy grade, and growth pattern; details on treatment (kind of surgery, amount of radiation therapy, type and duration of chemotherapy; complications of treatment; local recurrence and metastases; and comorbidity. In addition, several quality indicators are registered in order to measure the quality of care provided by the hospitals and make comparisons between hospitals and with international standards. Descriptive data: Demographic patient-specific data such as age, sex, region of living, comorbidity, World Health Organization's International Classification of Diseases – tenth edition codes and TNM Classification of Malignant Tumours, and date of death (after yearly coupling to the Danish Civil Registration System. Data quality and completeness are currently secured. Conclusion: The Danish Sarcoma Database is population based and includes sarcomas occurring in Denmark since 2009. It is a valuable tool for monitoring sarcoma incidence and quality of treatment and its improvement, postoperative

  15. Primary pericardial synovial sarcoma.

    Science.gov (United States)

    Muramatsu, Takashi; Takeshita, Shinji; Tanaka, Yoko; Morooka, Hiroaki; Higure, Ryota; Shiono, Motomi

    2015-10-01

    A 57-year-old man was admitted to our hospital with cardiomegaly on a chest roentgenogram. A mediastinal tumor was observed during a chest computed tomographic scan and the patient was diagnosed with pericardial synovial sarcoma as a result of a tumor biopsy. Surgery, radiotherapy and chemotherapy were carried out, and although the tumor temporarily decreased in size, it subsequently increased and the patient died approximately 3 years following the initial medical examination. Most synovial sarcomas commonly occur in the vicinity of the joints of the extremities. Therefore, we herein report a rare case of synovial sarcoma which occurred in the pericardium.

  16. Clinical management of soft tissue sarcomas

    International Nuclear Information System (INIS)

    Pinedo, H.M.; Verweij, J.

    1986-01-01

    This book is concerned with the clinical management of soft tissue sarcomas. Topics covered include: Radiotherapy; Pathology of soft tissue sarcomas; Surgical treatment of soft tissue sarcomas; and Chemotherapy in advanced soft tissue sarcomas

  17. Sarcoma survivors' perspectives on their body image and functional quality of life post-resection/limb salvage surgery.

    Science.gov (United States)

    Taylor, Myra F; Pooley, Julie A

    2017-11-01

    Sarcomas often occur in patients' extremities and treatment typically involves bone resection/limb salvage surgery. Such treatments leave survivors with physical disfigurements, functional disabilities, and/or emotional traumas. Our post-surgery psychological intervention investigated how these experiences impinge on sarcoma survivors' lives. Twenty-three survivors aged 19-60 years (M = 36 years) participated in a tri-disciplinary (rehabilitative exercise, plastic surgery and psychological) intervention. Of these, 17 participated in psychodynamic counselling, 10 completed a mental-health questionnaire and seven kept a reflective journal. An exemplar case study research design was employed and data were subjected to interpretative phenomenological analysis. The findings reveal that survivors typically experience a number of body image issues and mobility difficulties, which they are reluctant to share with their oncologist in case they are viewed as being ungrateful or vain. In instances where such issues remain unaddressed, then sarcoma survivors have a tendency to adopt avoidant coping strategies and social isolation practices. These practices negatively impact on their mental health and functional quality of life. Hence, it is suggested that a short three part (body image, mobility, and coping strategy) screen be devised and used at all sarcoma 2-year follow-up assessment consults to identify which survivors are in need of psychological assistance. © 2017 John Wiley & Sons Ltd.

  18. Diagnostic performance of magnetic resonance imaging in the assessment of periosteal reactions in bone sarcomas using conventional radiography as the reference

    Science.gov (United States)

    de Sá Neto, José Luiz; Simão, Marcelo Novelino; Crema, Michel Daoud; Engel, Edgard Eduard; Nogueira-Barbosa, Marcello Henrique

    2017-01-01

    Objective: To evaluate the performance of magnetic resonance imaging (MRI) in detecting periosteal reactions and to compare MRI and conventional radiography (CR) in terms of the classification of periosteal reactions. Materials and Methods: Retrospective study of 42 consecutive patients (mean age, 22 years; 20 men) with a confirmed diagnosis of osteosarcoma or Ewing's sarcoma, MRI and CR images having been acquired pretreatment. Three blinded radiologists detected periosteal reactions and evaluated each periosteal reaction subtype in CR and MRI images: Codman's triangle; laminated; and spiculated. The CR was used as a benchmark to calculate the diagnostic performance. We used the kappa coefficient to assess interobserver reproducibility. A two-tailed Fisher's exact test was used in order to assess contingency between CR and MRI classifications. Results: In the detection of periosteal reactions, MRI showed high specificity, a high negative predictive value, and low-to-moderate sensitivity. For CR and for MRI, the interobserver agreement for periosteal reaction was almost perfect, whereas, for the classification of different subtypes of periosteal reaction, it was higher for the Codman's triangle subtype and lower for the spiculated subtype. There was no significant difference between MRI and CR in terms of the classifications (p < 0.05). Conclusion: We found no difference between MRI and CR in terms of their ability to classify periosteal reactions. MRI showed high specificity and almost perfect interobserver agreement for the detection of periosteal reactions. The interobserver agreement was variable for the different subtypes of periosteal reaction. PMID:28670029

  19. Recent advances in targeted therapy for Ewing sarcoma [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Kathleen I. Pishas

    2016-08-01

    Full Text Available Ewing sarcoma is an aggressive, poorly differentiated neoplasm of solid bone that disproportionally afflicts the young. Despite intensive multi-modal therapy and valiant efforts, 70% of patients with relapsed and metastatic Ewing sarcoma will succumb to their disease. The persistent failure to improve overall survival for this subset of patients highlights the urgent need for rapid translation of novel therapeutic strategies. As Ewing sarcoma is associated with a paucity of mutations in readily targetable signal transduction pathways, targeting the key genetic aberration and master regulator of Ewing sarcoma, the EWS/ETS fusion, remains an important goal.

  20. The importance of surgery as part of multimodal therapy in rapid progressive primary extraosseous Ewing sarcoma of the cervical intra- and epidural space

    Directory of Open Access Journals (Sweden)

    Richard Bostelmann

    2016-12-01

    Full Text Available Primary extraosseous Ewing sarcomas (EESs are an extremely rare pathological entity. Less than 32 cases have been reported in the literature. Here we report an uncommon case with very rapid progression in the cervical region with extra- and intradural involvement. We present a thorough review of the literature and discuss possible treatment modalities. The Medline database was searched using the search terms: Ewing sarcoma, extraosseus tumour, treatment, management, cervical spine. A previously healthy 29-year-old man complained of right-sided radiculopathy (C7. Magnetic resonance imaging showed an enhancing foraminal, sandglass shaped neurinoma- like lesion. Surgery revealed an intraand extra-dural lesion, which was histologically diagnosed as Ewing sarcoma. Despite gross total resection, there was a massive symptomatic tumor recurrence within 6 weeks. A second gross total resection was realized. The patient was treated according to the EURO E.W.I.N.G.-Protocol (VIDE and recovered very well (progression-free interval during therapy. Several decompressive re-surgeries were realized with adjuvant radio-chemotherapy. At the last follow-up (17 months after initial surgery the patient was in remission with a good quality of live. This case is to illustrate that despite extensive therapeutic efforts, the progression- free survival in case of primary EES may be very short. To maintain neurological function and good quality of live as long as possible, a multimodal strategy seems to be adequate. Like in the present case this implies several surgeries and adjuvant chemo-and radiotherapy. Whether this improves overall survival remains unclear.

  1. Primary renal synovial sarcoma

    Directory of Open Access Journals (Sweden)

    Girish D. Bakhshi

    2012-03-01

    Full Text Available Primary Renal Sarcoma is rare tumor comprising only 1% of all renal tumours. Synovial sarcomas are generally deep-seated tumors arising in the proximity of large joints of adolescents and young adults and account for 5-10% of all soft tissue tumours. Primary synovial sarcoma of kidney is rare and has poor prognosis. It can only be diagnosed by immunohistochemistry. It should be considered as a differential in sarcomatoid and spindle cell tumours. We present a case of 33-year-old female, who underwent left sided radical nephrectomy for renal tumour. Histopathology and genetic analysis diagnosed it to be primary renal synovial sarcoma. Patient underwent radiation therapy and 2 years follow up is uneventful. A brief case report with review of literature is presented.

  2. Primary intrathoracic biphasic synovial sarcoma.

    Science.gov (United States)

    Tezcan, Yilmaz; Koc, Mehmet; Kocak, Husnu; Kaya, Yusuf

    2012-05-01

    Synovial sarcomas are most frequently observed in the extremities. Although synovial sarcomas are the third most common histological type of soft-tissue sarcomas of the extremities, primary mediastinal synovial sarcoma is extremely rare. Monophasic synovial sarcoma is the most commonly observed subtype. whereas the biphasic subtype is less common. We present our case which was diagnosed as biphasic synovial sarcoma located in the anterior mediastinum, which is considered to be a rare entity. The patient underwent surgical resection together with multimodal adjuvant radiotherapy and chemotherapy.

  3. Positron emission tomography with fluorine-deoxyglucose in sarcomas and non-sarcoma non-epithelial tumors

    International Nuclear Information System (INIS)

    Massardo, Teresa; Jofre, Maria Josefina; Sierralta, Maria Paulina; Canessa, Jose; Castro, Gabriel; Berrocal, Isabel; Gallegos, Ivan

    2012-01-01

    Background: The usefulness of positron emission tomography (PET) with fluorine-deoxyglucose (FDG) in sarcomas and non-sarcoma non-epithelial (NSNE) tumors is not clearly defined. Aim: To report a Chilean experience with NSNE tumors evaluated using PET with FDG. Material and Methods: Retrospective review of the database of a PET laboratory. Demographic data, indications and metabolic findings were compared with conventional imaging in 88 adults and children with diverse bone and soft tissue sarcomas as well as 24 gastrointestinal stromal tumors (GIST), 6 pleural malignant mesotheliomas in adults, and 9 medulloblastomas in children. Results: FDG showed good concordance with conventional imaging in NSNE tumors. It was helpful for staging, restaging, follow-up after treatment and for the detection of new not previously suspected lesions. Conclusions: PET with FDG could have a prognostic role and help in patient management, mainly in musculoskeletal and high grade or less differentiated sarcomas. In GIST, it was a good tool for immunotherapy control

  4. Carbon ion radiotherapy for sarcomas

    International Nuclear Information System (INIS)

    Imai, Reiko

    2013-01-01

    Principles of heavy ion therapy, its application to bone and soft tissue sarcomas and outline of its general state are described. The heavy ion therapy has advantages of its high dose distribution to the target and strong biological effect due to the Bragg peak formation and high linear energy transfer, respectively. The authors use carbon ion generated by Heavy Ion Medical Accelerator in Chiba (HIMAC) for the therapy of performance state 0-2 patients with the sarcomas unresectable, diagnosed pathologically, and of 60 y, 45% and teens, 8%) have been treated, whose tumor site has been the pelvis in 73%, volume >600 mL in 63%, tissue type of bone tumor in 70% (where cordoma has amounted to>200 cases). Five-year local control rate is found 71% and survival, 59%. In 175 therapeutically fresh cases with sacral cordoma of median age 67 y, with median clinical target volume 9 cm, treated with median dose 70.4 GyE/16 irradiations, the 8-y local control rate is found to be 69% and survival, 74%, within the median follow-up 54 months; with severe skin ulcer in 2 cases and deterioration of nervous dysfunction in 15 cases; suggesting the therapy is as effective and useful as surgical resection. At present, the therapy is not applicable to Japan health insurance. In the author's hospital, the heavy ion therapy has been conducted to total of >6,000 patients, which amounting to the largest number in the world. Now, 3 Japanese facilities can do the therapy as well and 3 countries in the world.(T.T.)

  5. Bone-prosthesis composite with rotating hinged-knee prosthesis in limb salvage surgery for high-grade sarcoma around the knee.

    Science.gov (United States)

    Wang, Chien-Shun; Wu, Po-Kuei; Chen, Cheng-Fong; Chen, Wei-Ming; Liu, Chien-Lin; Chen, Tain-Hsiung

    2015-01-01

    Bone prosthesis composite (BPC) had been widely-used in reconstruction after wide excision of malignant tumors around the knee. However, implant selection for BPC remains a dilemma. Forty-one patients with high-grade malignant bone tumors around the knee who underwent excision and reconstruction with BPC and rotating hinged knee (RHK) prosthesis were included. The mean follow-up time was 54 months (range, 31-78 months). The average Musculoskeletal Tumor Society Rating score was 93.4% (range, 73-100%). The mean range of motion was 125°. Complications included 2 local recurrences, 2 nonunions, and 1 peri-prosthetic fracture. The reconstruction with BPC using the RHK prosthesis provided consistently good functional results with a low complication rate. The RHK prosthesis is a promising choice for BPC reconstruction. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Prognostic and predictive factors for outcome to first-line ifosfamide-containing chemotherapy for adult patients with advanced soft tissue sarcomas An exploratory, retrospective analysis on large series from the European Organization for Research and Treatment of Cancer-Soft Tissue and Bone Sarcoma Group (EORTC-STBSG)

    DEFF Research Database (Denmark)

    Sleiffer, S.; Ouali, M.; van Glabbeke, M.

    2010-01-01

    Background: Adult patients with advanced soft tissue sarcomas (STS) are generally treated similarly, regardless of great differences between STS subtypes, disease presentation and patients' characteristics. As ifosfamide is frequently applied in first line systemic therapy, we aimed to establish...

  7. Retro-orbital granulocytic sarcoma: case report.

    Science.gov (United States)

    Di Marzo, Alessandro; Parca, Giampiero; Ingrosso, Gianluca; Giubilei, Cesare; Battista, Michele; Benassi, Michaela; Barbarino, Rosaria; Proietti, Federica; Costantini, Sara; Di Murro, Luana; Nicolais, Rebeca; Santarelli, Federico; Santoni, Riccardo

    2008-01-01

    Granulocytic sarcomas (chloromas) are rare extra-medullary tumors arising from primitive granulocytic cells. The term "chloroma" is derived from the Greek word chloros (green), and it refers to the frequently greenish color of the tumor, which is due to the presence and oxidation of the myeloperoxidase enzyme. These tumors can arise de novo or can be associated with other myeloid disorders, such as acute or chronic myeloid leukemia, myeloproliferative or myelodysplastic conditions. Presentation can occur prior to, in association with the underlying myeloid disorder, or upon relapse. The location of the tumor can vary: sub-periosteal bone, skull, pelvis, ribs, sternum or lymph nodes. We report the case of a 58-year-old man who presented right exophthalmos and ophthalmoplegy with computerized tomography (CT) evidence of a retro-orbital mass, which histology confirmed to be a granulocytic sarcoma.

  8. Scanning electron microscopic studies on bone tumors

    International Nuclear Information System (INIS)

    Itoh, Motoya

    1978-01-01

    Surface morphological observations of benign and malinant bone tumors were made by the use of scanning electron microscopy. Tumor materials were obtained directly from patients of osteogenic sarcomas, chondrosarcomas, enchondromas, giant cell tumors and Paget's sarcoma. To compare with these human tumors, the following experimental materials were also observed: P 32 -induced rat osteogenic sarcomas with their pulmonary metastatic lesions, Sr 89 -induced transplantable mouse osteogenic sarcomas and osteoid tissues arising after artificial fractures in mice. One of the most outstanding findings was a lot of granular substances seen on cell surfaces and their intercellular spaces in osteoid or chondroid forming tissues. These substances were considered to do some parts in collaborating extracellular matrix formation. Protrusions on cell surface, such as mucrovilli were more or less fashioned by these granular substances. Additional experiments revealed these substances to be soluble in sodium cloride solution. Benign osteoid forming cells, such as osteoblasts and osteoblastic osteosarcoma cells had granular substances on their surfaces and their intercellular spaces. On the other hand, undifferentiated transplantable osteosarcoma which formed on osteoid or chondroid matrix had none of these granular substances. Consequently, the difference of surface morphology between osteosarcoma cells and osteoblasts was yet to be especially concluded. (author)

  9. Brain Metastasis in Bone and Soft Tissue Cancers: A Review of Incidence, Interventions, and Outcomes

    Directory of Open Access Journals (Sweden)

    Faris Shweikeh

    2014-01-01

    Full Text Available Bone and soft tissue malignancies account for a small portion of brain metastases. In this review, we characterize their incidence, treatments, and prognosis. Most of the data in the literature is based on case reports and small case series. Less than 5% of brain metastases are from bone and soft tissue sarcomas, occurring most commonly in Ewing’s sarcoma, malignant fibrous tumors, and osteosarcoma. Mean interval from initial cancer diagnosis to brain metastasis is in the range of 20–30 months, with most being detected before 24 months (osteosarcoma, Ewing sarcoma, chordoma, angiosarcoma, and rhabdomyosarcoma, some at 24–36 months (malignant fibrous tumors, malignant peripheral nerve sheath tumors, and alveolar soft part sarcoma, and a few after 36 months (chondrosarcoma and liposarcoma. Overall mean survival ranges between 7 and 16 months, with the majority surviving < 12 months (Ewing’s sarcoma, liposarcoma, malignant fibrous tumors, malignant peripheral nerve sheath tumors, angiosarcoma and chordomas. Management is heterogeneous involving surgery, radiosurgery, radiotherapy, and chemotherapy. While a survival advantage may exist for those given aggressive treatment involving surgical resection, such patients tended to have a favorable preoperative performance status and minimal systemic disease.

  10. Immunotherapeutic Intervention against Sarcomas

    Directory of Open Access Journals (Sweden)

    Paolo Pedrazzoli, Simona Secondino, Vittorio Perfetti, Patrizia Comoli, Daniela Montagna

    2011-01-01

    Full Text Available Advances in systemic therapy for sarcoma have produced, over the last two decades, relatively short-term benefits for the majority of patient. Among the novel biologic therapeutics that will likely increase our ability to cure human cancer in the years to come, immunotherapy is one of the most promising approaches. While past attempts to use immunotherapy have failed to dramatically shift the paradigm of care for the treatment of patients with sarcoma, major advances in basic and translational research have resulted, in more recent years, in clinical trial activity that is now beginning to generate promising results. However, to move from “proof of principle” to large scale clinical applicability, we need well-designed, multi-institutional clinical trials, along with continuous laboratory research to explore further the immunological characteristics of individual sarcoma subtypes and the consequent tailoring of therapy.

  11. [Moritz Kaposi and his sarcoma].

    Science.gov (United States)

    van Kessel, Anne; Quint, Koen D

    2011-01-01

    Nowadays, Kaposi sarcoma is a multidisciplinary condition, not only observed by dermatologists. Since the HIV epidemic in the 80s and 90s of the last century, more insight into the aetiology of Kaposi sarcoma has been acquired. However, this sarcoma had already been described in 1872 by a Hungarian dermatologist named Moritz Kaposi (1832-1902). Kaposi described the entity as 'idiopathic multiple pigmented sarcoma of the skin'. This entity was an extraordinary diagnosis at that time, mostly observed in Jewish or Mediterranean men. In 1912, 10 years after the death of Moritz Kaposi, the entity name was changed to Kaposi sarcoma.

  12. AIDS-related cancer in the era of highly active antiretroviral therapy (HAART): a model of the interplay of the immune system, virus, and cancer. "On the offensive--the Trojan Horse is being destroyed"--Part A: Kaposi's sarcoma.

    Science.gov (United States)

    Cheung, Tony W

    2004-01-01

    The introduction of highly active antiretroviral therapy (HAART), aimed at controlling human immunodeficiency virus (HIV), has been associated with a dramatic decrease in the incidence of acquired immunodeficiency syndrome-Kaposi's sarcoma (AIDS-KS) and the clinical manifestations of KS appear to be less aggressive. The pathogenesis of AIDS-related KS is related to a system of cytokines (e.g., interleukin-6) driven by autocrine and paracrine loops. More recently, human herpesvirus 8 (HHV-8), was discovered to be the putative etiological agent of this disease. This virus encodes several unique open reading frames that are homologs of human cellular proteins involved in cellular regulations, cell proliferation, apoptosis, and immune regulation. The treatment of this disease depends on whether it is "limited" disease or "extensive" disease. For "limited" disease, local therapy or non-bone marrow suppressive agents should be used. For "extensive" disease, new chemotherapeutic agents, such as liposomal anthracycline, which are active and have little adverse reactions, are indicated. The control of HIV infection continues to be essential. Knowledge of the pathogenesis of the disease has led to the development of novel treatment strategies, aimed at the inflammatory or angiogenesis cytokines necessary for growth or at HHV-8 as the target of therapy.

  13. Molecular diagnosis of sarcomas: chromosomal translocations in sarcomas.

    Science.gov (United States)

    Lazar, Alexander; Abruzzo, Lynne V; Pollock, Raphael E; Lee, Sangkyou; Czerniak, Bogdan

    2006-08-01

    Sarcomas are rare, numerous in type, and often difficult to definitively classify. Work in the last 2 decades has revealed that a significant subset of sarcomas are associated with specific chromosomal translocations producing chimeric (fusion) genes that play a role in the sarcomas' biology and are helpful in their differential diagnosis. To briefly review the sarcomas associated with specific translocations presenting Ewing sarcoma and synovial sarcoma as archetypes and to further explain how cytogenetic and molecular biologic approaches are being used in the diagnosis of sarcomas. This work is based on a selected review of the relevant medical and scientific literature and our extensive experience with molecular testing in sarcomas. In addition to, and complementing, the traditional diagnostic methods of examination of hematoxylin-eosin stained slides, immunohistochemistry, and sound clinical-pathologic correlation, additional cytogenetic and molecular biologic methods are being increasingly utilized and relied on in sarcoma pathology. These methods include chromosomal karyotyping, fluorescence in-situ hybridization, spectral karyotyping, and polymerase chain reaction- based methods for demonstrating specific chromosomal translocations and fusion genes. Understanding the basis of these methods and their application is critical to better provide accurate and validated specific diagnoses of sarcomas.

  14. Bilateral clear cell sarcoma of the kidney

    International Nuclear Information System (INIS)

    Zekri, W.; Yehia, D.; Alfaar, A.S.; Elshafie, M.M.; Younes, A.A.; Zaghloul, M.S.; El-Kinaai, N.; Taha, H.; Refaat, A.; Zekri, W.; Elshafie, M.M.; Zaghloul, M.S.; Taha, H.; Refaat, A.; Younes, A.A.; Alfaar, A.S.; Yehia, D.

    2015-01-01

    Clear cell sarcoma of the kidney (CCSK) accounts for 2-5% of all pediatric renal malignancies, and is known for its propensity to metastasize to bone and other sites. We are reporting two cases with bilateral CCSK that were diagnosed at our institution. One patient initially presented with bilateral renal masses, as well as pulmonary, hepatic and bone metastasis; while other present only with bilateral masses with no evident distant metastasis. Both patients received aggressive neo-adjuvant chemotherapy to decrease tumor size. One patient completed his designated treatment and initially showed complete remission (CR); eventually suffering from relapse. The other patient’s tumor progressed during the course of chemotherapy. Both cases manifested brain dissemination at the time of relapse or progression. This emphasizes the importance of staging stratification in CCSK. This also illustrates CCSK’s ability to metastasize to bone and other sites including the brain (a primary relapse site in our cases)

  15. Extremity perfusion for sarcoma

    NARCIS (Netherlands)

    Hoekstra, Harald Joan

    2008-01-01

    For more than 50 years, the technique of extremity perfusion has been explored in the limb salvage treatment of local, recurrent, and multifocal sarcomas. The "discovery" of tumor necrosis factor-or. in combination with melphalan was a real breakthrough in the treatment of primarily irresectable

  16. Synovial sarcoma mechanisms

    DEFF Research Database (Denmark)

    Svejstrup, Jesper Q

    2013-01-01

    Human synovial sarcoma is caused by a chromosome translocation, which fuses DNA encoding SSX to that encoding the SS18 protein. Kadoch and Crabtree now show that the resulting cellular transformation stems from disruption of the normal architecture and function of the human SWI/SNF (BAF) complex....

  17. Leukosis/Sarcoma Group

    Science.gov (United States)

    The leukosis/sarcoma (L/S) group of diseases designates a variety of transmissible benign and malignant neoplasms of chickens caused by members that belong to the family Retroviridae. Because the expansion of the literature on this disease, it is no longer feasible to cite all relevant publications ...

  18. Efficacy of ATR inhibitors as single agents in Ewing sarcoma

    DEFF Research Database (Denmark)

    Nieto-Soler, Maria; Morgado-Palacin, Isabel; Lafarga, Vanesa

    2016-01-01

    Ewing sarcomas (ES) are pediatric bone tumors that arise from a driver translocation, most frequently EWS/FLI1. Current ES treatment involves DNA damaging agents, yet the basis for the sensitivity to these therapies remains unknown. Oncogene-induced replication stress (RS) is a known source...... efficacy in ES xenografts as single agents. Expression of EWS/FLI1 or EWS/ERG oncogenic translocations sensitizes non-ES cells to ATR inhibitors. Our data shed light onto the sensitivity of ES to genotoxic agents, and identify ATR inhibitors as a potential therapy for Ewing Sarcomas....

  19. Diagnosis and treatment of Ewing's sarcoma

    International Nuclear Information System (INIS)

    Iwamoto, Yukihide

    2007-01-01

    Ewing's sarcoma is a small round-cell tumor typically arising in the bones, rarely in soft tissues, of children and adolescents. Ewing's sarcoma has retained the most unfavorable prognosis of all primary musculoskeletal tumors. Prior to the use of multi-drug chemotherapy, long-term survival was less than 10%. The development of multi-disciplinary therapy with chemotherapy, irradiation, and surgery has increased current long-term survival rates in most clinical centers to greater than 50%. In addition, the preferred method of tumor resection has changed; limb salvage has nearly replaced amputation of the affected limb. Limb salvage procedures can be performed in place of amputation without compromising patient survival rates. Recent studies have revealed that the pathognomonic translocations involving the EWS gene on chromosome 22 and an ETS-type gene, which is most commonly the Fli1 gene on chromosome 11, are implicated in more than 95% of Ewing's sarcomas, primitive neuroectodermal tumors and Askin's tumors. Therefore, these lesions have become regarded as a single entity, dubbed the Ewing's family of tumors. Reverse transcription polymerase chain reaction (RT-PCR) to detect EWS-ETS gene arrangements is widely used to confirm the diagnosis of Ewing's family of tumors. Experimental results suggest that inhibition of the signaling pathway downstream of the EWS-ETS gene may lead to the development of molecularly targeted therapy in the future. (author)

  20. Multifocal osteogenic sarcoma in Paget's disease

    International Nuclear Information System (INIS)

    Vuillemin-Bodaghi, V.; Parlier-Cuau, C.; Laredo, J.D.; Cywiner-Golenzer, C.; Quillard, A.; Kaplan, G.

    2000-01-01

    The most serious complication of Paget's disease is sarcomatous degeneration of pagetic bone. Multifocal sarcomatous degeneration occurs mainly in polyostotic Paget's disease. Multifocal Paget's sarcoma is uncommon and can arise in any site. We report two cases of synchronous multifocal sarcomatous degeneration. The two patients were elderly women (aged 77 and 86 years, respectively) who developed sarcomatous lesions concomitantly, in the first case report in left ilium, left tibia, and first lumbar vertebra and in the second case report in the skull, right ilium, and sacrum. Whether these cases are due to the simultaneous development of several primaries or to metastases from a single primary remains unclear. (orig.)

  1. A case of sarcoma of the chest wall after radiation therapy for breast cancer

    International Nuclear Information System (INIS)

    Izumi, Junko; Nishi, Tsunehiro; Fukuuchi, Atsushi; Takanashi, Riichiro

    1998-01-01

    A case of radiation-induced sarcoma of the chest wall after radiation therapy for breast cancer is reported. A 69-year-old woman underwent mastectomy with axillary lymph node dissection followed by linac therapy of 50 Gy delivered to the left axilla, left supraclavicular area, and parasternal area. During therapy for bone and liver metastases, a tumor was noted in the left chest wall 15 years after radiation therapy. Incisional biopsy was performed. Histological diagnosis was spindle cell sarcoma. Radiation-induced sarcoma was suspected because the tumor developed 15 years after radiation therapy within the same area. Radiation-induced sarcoma is a rare tumor, but radiation therapy following breast-conserving therapy is widely employed. It is important to be aware of the possibility of radiation-induced sarcoma. (author)

  2. Granulocytic sarcoma in a patient with chronic myeloid leukaemia in complete haematological, cytogenetic and molecular remission.

    Science.gov (United States)

    Kittai, Adam; Yu, Eun-Mi; Tabbara, Imad

    2014-12-23

    Granulocytic sarcoma, also known as myeloid sarcoma, is an extramedullary tumour composed of immature myeloid cells. Granulocytic sarcoma is typically found in patients with acute myeloid leukaemia, accelerated phase or blast crisis of chronic myeloid leukaemia, myelodysplastic syndrome, or as an isolated event without bone marrow involvement. We present a case of granulocytic sarcoma in a patient with chronic myeloid leukaemia in the setting of complete haematological, molecular and cytogenetic remission. Our patient was first treated with imatinib for chronic-phase chronic myeloid leukaemia. After maintaining remission for 42 months, he developed a granulocytic sarcoma in his spine. In this case report, we describe our case, along with the three other cases reported in the literature. In addition to being a rare diagnosis, this case demonstrates the importance of being vigilant in diagnosing the cause of back pain and atypical symptoms in patients with a history of leukaemia. 2014 BMJ Publishing Group Ltd.

  3. A case of sarcoma of the chest wall after radiation therapy for breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Izumi, Junko; Nishi, Tsunehiro; Fukuuchi, Atsushi; Takanashi, Riichiro [Mitsui Memorial Hospital, Tokyo (Japan)

    1998-09-01

    A case of radiation-induced sarcoma of the chest wall after radiation therapy for breast cancer is reported. A 69-year-old woman underwent mastectomy with axillary lymph node dissection followed by linac therapy of 50 Gy delivered to the left axilla, left supraclavicular area, and parasternal area. During therapy for bone and liver metastases, a tumor was noted in the left chest wall 15 years after radiation therapy. Incisional biopsy was performed. Histological diagnosis was spindle cell sarcoma. Radiation-induced sarcoma was suspected because the tumor developed 15 years after radiation therapy within the same area. Radiation-induced sarcoma is a rare tumor, but radiation therapy following breast-conserving therapy is widely employed. It is important to be aware of the possibility of radiation-induced sarcoma. (author)

  4. Histamine combined with melphalan in isolated limb perfusion for the treatment of locally advanced soft tissue sarcomas: preclinical studies in rats Histamina combinada ao melfalano na perfusão de membro isolado para o tratamento de sarcomas de partes moles localmente avançado: estudos pré-clínicos em ratos

    Directory of Open Access Journals (Sweden)

    Flavia Brunstein

    2005-08-01

    Full Text Available PURPOSE: To evaluate the potential benefit of histamine combined with melphalan in the isolated limb perfusion (ILP as an alternative to TNF-alfa and melphalan combination, for the treatment of irressectable soft tissue sarcomas of the limbs in Brown Norway (BN rats. METHODS: 20 BN rats had small fragments of syngeneic BN-175 fibosarcoma inserted on the right hind limb. In 7-10 days the tumor reached a median diameter of 12-15 mm and they were randomly divided in four groups (sham, melphalan, histamine and escalating doses of histamine combined to melphalan being submitted to experimental ILP for 30 minutes. Tumors were measured daily with a caliper and the volume was calculated. RESULTS: Response curves showed a significant effect of the combination of histamine 200 mg/mL with melphalan, with 66% overall response, including 33% complete responses (pOBJETIVO: Avaliar o potencial benéfico da histamina combinada ao melfalano, na perfusão de membro isolado (PMI, como alternativa à combinação TNF-alfa mais melfalano, no tratamento de sarcomas de partes moles irressecaveis em extremidades, em ratos de linhagem Brown Norway (BN. MÉTODOS: 20 ratos BN foram submetidos a implantação de fragmentos de fibrosarcoma singênico BN-175 na pata traseira direita. Em cerca de 7-10 dias o tumor atingiu um diâmetro médio de 12-15 mm e foram aleatóriamente divididos em quatro grupos (controle, melfalano, histamina em doses progessivas combinada ao melfalano e histamina sendo submetidos a PMI experimental por 30 minutos. Os tumores foram então medidos diariamente com o uso de paquímetro e o volume tumoral calculado. RESULTADOS: As curvas de resposta mostram um efeito significativo da combinação de Histamina na concentração de 200 mg/mL ao melfalano, com 66% de resposta global incluindo 33% de respostas completas (p < 0.01. Não houve efeitos colaterais sistêmicos e localmente apenas edema leve e transitório nos animais tratados com histamine

  5. Primary hepatic sarcomas: CT findings

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Ri-Sheng; Chen, Ying; Jiang, Biao; Wang, Liu-Hong [Zhejiang University School of Medicine, Department of Radiology, Hangzhou (China); Xu, Xiu-Fang [Zhejiang Medical College, Teaching and Research Group of Radiology, Hangzhou (China)

    2008-10-15

    Primary hepatic sarcomas are rare tumors that are difficult to diagnose clinically. Different primary hepatic sarcomas may have different clinical, morphologic, and radiological features. In this pictorial review, we summarized computed tomography (CT) findings of some relatively common types of hepatic sarcomas, including angiosarcoma, epithelioid hemangioendothelioma (EHE), liposarcoma, undifferentiated embryonal sarcoma (UES), leiomyosarcoma, malignant fibrous histiocytoma (MFH), and carcinosarcoma (including cystadenocarcinosarcoma). To our knowledge, hepatic cystadenocarcinosarcoma has not been described in the English literature. The CT findings in our case are similar to that of cystadenocarcinoma, a huge, multilocular cystic mass with a large mural nodule and solid portion. The advent of CT has allowed earlier detection of primary hepatic sarcomas as well as more accurate diagnosis and characterization. In addition, we briefly discuss the MRI findings and diagnostic value of primary hepatic sarcomas. (orig.)

  6. Roentgenologic examination in Kaposi's sarcoma

    International Nuclear Information System (INIS)

    Kossovoj, A.L.

    1990-01-01

    Review of roentgenologic investigations into Kaposi's sarcoma is presented. It is shown that Kaposi's sarcoma is a disease injuring skin, osteal system, lungs and mediastinum, gastroeuteric tract and lymphatic nodes. Roentgenologic changes of soft tissues of limbs, osteal system, chest and gastroenteric tract organs are described. Manifestations of a tumor of any localization are quite different which makes it more difficult to perform roentgenologic diagnosis. An increase of Kaposi's sarcoma occurrence in patients suffering from aids as the disease increases is indicated

  7. Granulocytic sarcoma masquerading as Ewing′s sarcoma: A diagnostic dilemma

    Directory of Open Access Journals (Sweden)

    Haresh Kunhi

    2008-01-01

    Full Text Available An eleven-year-old boy presented with a swelling in his left elbow. Radiologically the features were that of an Ewing′s sarcoma involving the ulna. Histopathology showed small round cell tumor strongly positive for Monoclonal Imperial Cancer research fund 2 (MIC2 antigen. Similar cells in the bone marrow were involved with MIC2 positivity. The patient developed skin lesions, which on biopsy were found to be chloromas. The initial biopsies were reevaluated with special stains revealing granulocytic sarcomas in acute myeloid leukemia masquerading as Ewing′s due to its MIC2 positivity. The possibility of myeloid neoplasms should be considered routinely with known MIC2 positive round cell tumors.

  8. Uterine sarcoma – current perspectives

    Directory of Open Access Journals (Sweden)

    Benson C

    2017-08-01

    Full Text Available Charlotte Benson,1 Aisha B Miah1,2 1Sarcoma Unit, Royal Marsden Hospital, 2Department of Radiotherapy and Imaging, The Institute of Cancer Research, London, UK Abstract: Uterine sarcomas comprise a group of rare tumors with differing tumor biology, natural history and response to treatment. Diagnosis is often made following surgery for presumed benign disease. Currently, preoperative imaging does not reliably distinguish between benign leiomyomas and other malignant pathology. Uterine leiomyosarcoma is the most common sarcoma, but other subtypes include endometrial stromal sarcoma (low grade and high grade, undifferentiated uterine sarcoma and adenosarcoma. Clinical trials have shown no definite survival benefit of adjuvant radiotherapy or chemotherapy and have been hampered by the rarity and heterogeneity of these disease types. There is a role of adjuvant treatment in carefully selected cases following multidisciplinary discussion at sarcoma reference centers. In patients with metastatic disease, systemic chemotherapy can then be considered. There is activity of a number of agents, including doxorubicin, trabectedin, gemcitabine-based chemotherapy, eribulin and pazopanib. Patients should be considered for clinical trial entry where possible. Close international collaboration is important to allow progress in this group of diseases. Keywords: sarcoma, leiomyosarcoma, endometrial stromal sarcoma, undifferentiated uterine sarcoma, leiomyoma

  9. Primary pericardial synovial sarcoma

    OpenAIRE

    Muramatsu, Takashi; Takeshita, Shinji; Tanaka, Yoko; Morooka, Hiroaki; Higure, Ryota; Shiono, Motomi

    2015-01-01

    A 57-year-old man was admitted to our hospital with cardiomegaly on a chest roentgenogram. A mediastinal tumor was observed during a chest computed tomographic scan and the patient was diagnosed with pericardial synovial sarcoma as a result of a tumor biopsy. Surgery, radiotherapy and chemotherapy were carried out, and although the tumor temporarily decreased in size, it subsequently increased and the patient died approximately 3 years following the initial medical examination. Most synovial ...

  10. Primary mediastinal synovial sarcoma.

    Science.gov (United States)

    Jeganathan, Reubendra; Davis, Richard; Wilson, Lorraine; McGuigan, James; Sidhu, Pushpinder

    2007-05-01

    Synovial sarcoma occurs predominantly in the soft tissues of the extremities, but is exceedingly rare in the mediastinum. It has overlapping histological and immunophenotypic features with other tumours in the differential diagnosis. We report a case of a patient who had an incidental finding of such a tumour. Because of the rarity of this tumour in the mediastinum, optimal therapy is unknown and the prognosis remains guarded.

  11. Primary Mediastinal Synovial Sarcoma

    OpenAIRE

    Jeganathan, Reubendra; Davis, Richard; Wilson, Lorraine; McGuigan, James; Sidhu, Pushpinder

    2007-01-01

    Synovial sarcoma occurs predominantly in the soft tissues of the extremities, but is exceedingly rare in the mediastinum. It has overlapping histological and immunophenotypic features with other tumours in the differential diagnosis. We report a case of a patient who had an incidental finding of such a tumour. Because of the rarity of this tumour in the mediastinum, optimal therapy is unknown and the prognosis remains guarded.

  12. Ewing’s Sarcoma of Ilium, Presenting as Right Lower Quadrant Pain

    Directory of Open Access Journals (Sweden)

    Osama Saleh Alshaya

    2015-01-01

    Full Text Available Ewing’s sarcoma is a highly malignant tumor of bone and is more common in children in the age group of 10 to 20 years. Sometimes the classic clinical and radiological presentation of Ewing’s sarcoma may not be the norm and patient may have an atypical presentation leading to diagnostic confusion. This situation is especially true for Ewing’s sarcoma involving iliac bone. We report a case of Ewing’s sarcoma involving the right ilium in a patient presenting with right lower quadrant pain and nonspecific radiological changes. To the best of our knowledge, this scenario has not been reported in literature. We recommend early magnetic resonance imaging and computed tomography to diagnose the disease early when there is slightest suspicion of the disease.

  13. Clinical experience with intravenous radiosensitizers in unresectable sarcomas

    International Nuclear Information System (INIS)

    Kinsella, T.J.; Glatstein, E.

    1987-01-01

    Traditionally, adult bone and soft tissue sarcomas have been considered to be ''radioresistant.'' Because of this philosophy, patients who present with locally advanced, unresectable sarcomas often are treated in a palliative fashion, usually with low-dose radiotherapy. Over the last 6 years, 29 patients with unresectable primary or metastatic sarcomas were treated using a combination of intravenous chemical radiosensitizers and high-dose irradiation. Twenty-two of 29 patients achieved clinical local control, with six patients having a complete clinical response. The time to tumor response is often several months or longer, which is in contrast to other tumor histologies (carcinomas, lymphomas), where tumor response usually occurs over several weeks. Several large tumors have shown only a minimal tumor response, yet were found to be sterilized in posttreatment biopsy or autopsy examination. Of 15 patients with primary sarcomas without metastases, 11 patients (73%) remain free of local tumor progression from 12 to 83 months. Adult high-grade sarcomas can be controlled with high-dose radiotherapy and intravenous radiosensitizers, although the precise role of these agents is unclear

  14. Cystic synovial sarcomas: imaging features with clinical and histopathologic correlation

    Energy Technology Data Exchange (ETDEWEB)

    Nakanishi, Hirofumi; Araki, Nobuhito [Department of Orthopedic Surgery, Osaka Medical Center for Cancer and Cardiovascular Diseases, 1-3-3, Nakamichi, Higashinari-Ku, 537-8511, Osaka (Japan); Sawai, Yuka [Department of Radiology, Osaka Medical Center for Cancer and Cardiovascular Diseases, Osaka (Japan); Kudawara, Ikuo [Department of Orthopedic Surgery, Osaka National Hospital, Osaka (Japan); Mano, Masayuki; Ishiguro, Shingo [Department of Pathology, Osaka Medical Center for Cancer and Cardiovascular Diseases, Osaka (Japan); Ueda, Takafumi; Yoshikawa, Hideki [Department of Orthopedic Surgery, Osaka University Graduate School of Medicine, Suita, Osaka (Japan)

    2003-12-01

    To characterize the radiological and clinicopathologic features of cystic synovial sarcoma. Seven patients with primary cystic synovial sarcoma were evaluated. Computed tomography (CT) and magnetic resonance (MR) imaging were undertaken at the first presentation. The diagnosis of synovial sarcoma was made on the basis of histological examinations followed by molecular analysis. Radiological and clinicopathologic findings were reviewed. CT showed well-defined soft tissue mass without cortical bone erosion and invasion. Calcification was seen at the periphery of the mass in three cases. T2-weighted MR images showed multilocular inhomogeneous intensity mass in all cases, five of which showed fluid-fluid levels. On gross appearance, old and/or fresh hematomas were detected in six cases. In the one remaining case, microscopic hemorrhage in the cystic lumen was proven. Four cases had poorly differentiated areas. In five cases prominent hemangiopericytomatous vasculature was observed. Histologic grade was intermediate in one tumor and high in six. One case had a history of misdiagnosis for tarsal tunnel syndrome, one for lymphadenopathy, two for sciatica and two for hematoma. All cystic synovial sarcomas demonstrated multilocularity with well-circumscribed walls and internal septae. Synovial sarcoma should be taken into consideration in patients with deeply situated multicystic mass with triple signal intensity on T2-weighted MR imaging. (orig.)

  15. Diagnosis and management of Duchenne muscular dystrophy, part 2: respiratory, cardiac, bone health, and orthopaedic management

    Science.gov (United States)

    Birnkrant, David J; Bushby, Katharine; Bann, Carla M; Alman, Benjamin A; Apkon, Susan D; Blackwell, Angela; Case, Laura E; Cripe, Linda; Hadjiyannakis, Stasia; Olson, Aaron K; Sheehan, Daniel W; Bolen, Julie; Weber, David R; Ward, Leanne M

    2018-01-01

    A coordinated, multidisciplinary approach to care is essential for optimum management of the primary manifestations and secondary complications of Duchenne muscular dystrophy (DMD). Contemporary care has been shaped by the availability of more sensitive diagnostic techniques and the earlier use of therapeutic interventions, which have the potential to improve patients’ duration and quality of life. In part 2 of this update of the DMD care considerations, we present the latest recommendations for respiratory, cardiac, bone health and osteoporosis, and orthopaedic and surgical management for boys and men with DMD. Additionally, we provide guidance on cardiac management for female carriers of a disease-causing mutation. The new care considerations acknowledge the effects of long-term glucocorticoid use on the natural history of DMD, and the need for care guidance across the lifespan as patients live longer. The management of DMD looks set to change substantially as new genetic and molecular therapies become available. PMID:29395990

  16. Sarcomas: etiología y síntomas Sarcomas: etiology and symptoms

    Directory of Open Access Journals (Sweden)

    Roberto Gabriel Albín Cano

    2012-07-01

    Full Text Available Debido a la amplia diversidad de sarcomas, casi son inexistentes los textos que incluyen todas las variedades de este tipo de cáncer. Generalmente, su descripción y revisión se incluyen en las del sistema de órganos afectados específicamente, y la literatura que los aborda está muy fragmentada en las diferentes especialidades médicas. Se realiza una revisión bibliográfica sobre la etiología y síntomas de la mayor parte de los diferentes tipos de sarcomas. Es objetivo de esta revisión, lograr unir la información más actual disponible acerca de la etiología y síntomas de los sarcomas. Se han identificado diferentes factores de riesgo y factores etiológicos, tanto genéticos, infecciosos, como ambientales. Los grandes descubrimientos en relación con los mecanismos genéticos involucrados en los diferentes tipos de sarcoma, han abierto un camino de inestimable valor para introducir nuevos tratamientos, que incluyen ensayos con anticuerpos monoclonales y nuevos fármacos de terapia génica.

    Due to the wide diversity of sarcomas, almost no texts include all varieties of this type of cancer. Generally, their description and review is included in those of the specifically affected organ system, and the literature containing that information is very fragmented in different medical specialties. We performed a literature review on the etiology and symptoms of most types of sarcomas. It is aimed at achieving a recompilation of most current information available on the causes and symptoms of sarcomas. Different risks and etiologic factors have been identified regarding genetics, infections, and environment. The great discoveries regarding genetic mechanisms involved in different types of sarcomas, have opened an invaluable way to introduce new treatments, including monoclonal antibodies and new drugs of gene therapy.

  17. Kaposi Sarcoma After Allogeneic Hematopoietic Stem Cell Transplant: A Rare Complication.

    Science.gov (United States)

    Ramzi, Mani; Vojdani, Reza; Haghighinejad, Hourvash

    2018-01-02

    Kaposi sarcoma is a multicentric angioproliferative neoplasm of lymphatic endothelium-derived cells. Although this malignancy is relatively frequent after solid-organ transplant, it is extremely rare after bone marrow transplantation. Allogeneic stem cell transplantation is associated with severe prolonged immunosuppression; however, a few cases of Kaposi sarcoma after hematopoietic stem cell transplant were previously reported. Here, we report a case of Kaposi sarcoma after haploidentical allogeneic hematopoietic stem cell transplant. The patient was a known case of acute myelogenous leukemia and underwent transplant after relapse. Four months posttransplant, she presented with 3 dark blue or purplish small nodules on her face above the upper lip. Histopathologic study confirmed Kaposi sarcoma. Serum antibody against human herpes virus type 8 was positive. After discontinuation of immunosuppressive medication and cryotherapy for local control, Kaposi sarcoma skin nodules healed with residual pigmented skin lesions. The patient is currently in complete remission for Kaposi sarcoma and cured from acute myelogenous leukemia 36 months after stem cell transplant. Only 14 cases of Kaposi sarcoma after hematopoietic cell transplant have been previously reported in the literature (11 after allogeneic and 3 after autologous hematopoietic stem cell transplant). According to our knowledge from literature review, this case is the first report of Kaposi sarcoma after a haploidentical HLA match transplant.

  18. July/August 2009 25 Pattern of Bone Tumours Seen at Addis A

    African Journals Online (AJOL)

    jen

    Examples of benign bone tumors include osteoma, osteochondroma, aneurysmal bone cyst, and fibrous dysplasia. Malignant primary bone tumors include osteosarcoma, chondrosarcoma, Ewing's sarcoma, and other sarcoma types. Multiple myeloma is a Hematologic malignant tumor which also frequently presents as one ...

  19. Granulocytic Sarcoma in a Nonleukemic Patient: Place of Radiotherapy and Systemic Therapies

    Directory of Open Access Journals (Sweden)

    C. Chargari

    2011-01-01

    Full Text Available Granulocytic sarcoma is a rare extramedullary tumour, which most often occurs in the course of an acute or chronic leukaemia or myeloproliferative disorders. Rarely it is found before peripheral blood or bone marrow evidence of leukemia is present. We report an unusual case of acute paraplegia at first presentation of a spinal epidural granulocytic sarcoma without any haematological disorder. Therapeutic strategies are discussed in the light of the literature.

  20. Proximal-type epithelioid sarcoma - Case report Sarcoma epitelióide tipo proximal - Relato de caso

    Directory of Open Access Journals (Sweden)

    Luciana Mendes dos Santos

    2013-06-01

    Full Text Available Epithelioid sarcoma, first described by Enzinger in 1970, is a rare soft-tissue sarcoma typically presenting as a subcutaneous or deep dermal mass in distal portions of the extremities of adolescents and young adults. In 1997, Guillou et al. described a different type of epithelioid sarcoma, called proximal-type epithelioid sarcoma, which is found mostly in the pelvic and perineal regions and genital tracts of young to middle-aged adults. It is characterized by a proliferation of epithelioid-like cells with rhabdoid features and the absence of a granuloma-like pattern. In this paper we present a case of proximal-type epithelioid sarcoma with an aggressive clinical course, including distant metastasis and death nine months after diagnosis.O sarcoma epitelióide, primeiramente descrito por Enzinger, em 1970, é uma neoplasia de partes moles que ocorre principalmente nas extremidades distais de adolescentes e adultos jovens. Em 1997, Guillou e cols. descreveram um tipo diferente de sarcoma epitelióide, que afetava frequentemente a região pélvica, períneo e áreas genitais de pacientes de média idade, com exame histológico caracterizado pela proliferação de células com aspecto epitelióide. Neste trabalho, descreve-se caso de paciente que apresentava há três meses duas lesões na região glútea, cujo exame histológico confirmou diagnóstico de sarcoma epitelioide do tipo proximal, já com presença de metástases pulmonares e cerebrais e que foi a óbito nove meses após o diagnóstico.

  1. Metals for bone implants. Part 1. Powder metallurgy and implant rendering.

    Science.gov (United States)

    Andani, Mohsen Taheri; Shayesteh Moghaddam, Narges; Haberland, Christoph; Dean, David; Miller, Michael J; Elahinia, Mohammad

    2014-10-01

    New metal alloys and metal fabrication strategies are likely to benefit future skeletal implant strategies. These metals and fabrication strategies were looked at from the point of view of standard-of-care implants for the mandible. These implants are used as part of the treatment for segmental resection due to oropharyngeal cancer, injury or correction of deformity due to pathology or congenital defect. The focus of this two-part review is the issues associated with the failure of existing mandibular implants that are due to mismatched material properties. Potential directions for future research are also studied. To mitigate these issues, the use of low-stiffness metallic alloys has been highlighted. To this end, the development, processing and biocompatibility of superelastic NiTi as well as resorbable magnesium-based alloys are discussed. Additionally, engineered porosity is reviewed as it can be an effective way of matching the stiffness of an implant with the surrounding tissue. These porosities and the overall geometry of the implant can be optimized for strain transduction and with a tailored stiffness profile. Rendering patient-specific, site-specific, morphology-specific and function-specific implants can now be achieved using these and other metals with bone-like material properties by additive manufacturing. The biocompatibility of implants prepared from superelastic and resorbable alloys is also reviewed. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  2. Bone tissue in different parts of the edentulous maxilla and mandible.

    Science.gov (United States)

    Lindhe, Jan; Bressan, Eriberto; Cecchinato, Denis; Corrá, Enrico; Toia, Marco; Liljenberg, Birgitta

    2013-04-01

    The composition of the fully healed edentulous ridge of the posterior maxilla was recently examined and was found to contain about 50% mineralized bone and 16% bone marrow. The objective was to examine the composition of the tissue of the fully healed ridge in different portions of the maxilla and the mandible in partially dentate subjects. Eighty-seven healthy subjects were included. A trephine drill was used to harvest hard tissue specimens. The biopsies were decalcified, embedded in paraffin, sectioned, stained, and examined using a point-counting procedure. The marginal portion of the jaws almost consistently contained a cortical cap that was significantly wider in the mandible than in the maxilla and twice as wide in the anterior as in the posterior segments of the mandible. Lamellar bone and bone marrow were the dominating tissue elements. Lamellar bone occupied about 63% of the tissue in the mandible and 46% in the maxilla. The maxilla contained about 23% bone marrow as compared to 16% in the mandible. In the mandible, 70% (anterior) and 57% (posterior) were made up of lamellar bone. In the maxilla, the proportion of lamellar bone in the anterior and posterior segments was similar (about 45%). Bone marrow occupied close to 40% of the anterior maxilla, while in the posterior maxilla and the anterior and posterior mandible marrow comprised between 13 and 18%. Marked differences existed with respect to tissue composition of the edentulous ridge between the maxilla and the mandible. The cortical crest was wider in the mandible than in the maxilla, and widest in the symphysis region of the mandible. The proportion of bone marrow was greater in the maxilla than in the mandible. The maxillary front tooth region was poor in lamellar bone but rich in bone marrow, while the anterior mandible contained large amounts of mineralized bone but small amounts of bone marrow. © 2012 John Wiley & Sons A/S.

  3. Intracranial Ewing sarcoma: four pediatric examples.

    Science.gov (United States)

    Yang, Michael J; Whelan, Ros; Madden, Jennifer; Mulcahy Levy, Jean M; Kleinschmidt-DeMasters, B K; Hankinson, Todd C; Foreman, Nicholas K; Handler, Michael H

    2018-03-01

    Ewing sarcoma typically arises in bone and is unrelated to intraparenchymal small blue cell embryonal central nervous system (CNS) tumors previously designated primitive neuroectodermal tumors (PNETs). When the CNS is impacted, it is usually secondary to local extension from either the epidural space, skull, or intracranial or spinal metastases. Primary examples within the cranial vault are rare, usually dural-based, and are largely case reports in the literature. We detail four pediatric patients with solitary, primary intracranial Ewing sarcoma, all manifesting the archetypal EWRS1 gene rearrangement that confirms diagnosis. Neurosurgical Department records, spanning 21 years (1995-2016), were reviewed to identify patients. Demographics, clinical history, pathological/genetic features, and clinical course were retrieved from the medical record and personal files of the authors. Four patients, one male and three females, age 5 to 16 years, were identified. One presented in extremis from a large lesion, two with soft tissue masses, and the fourth as an incidental finding after being involved in a motor vehicle collision. Three had clear bony involvement: a 10-year-old girl with a large left temporal lesion had clear origin in the skull, with spiculated calcified striations throughout the mass; a 9-year-old girl presented with a bony left petrous apex mass; and a 16-year-old girl presented with a left temporal mass with extension to the dura and underlying bone erosion. Only the 5-year-old boy had a large left frontoparietal mass traversing the falx with no bony contact. All four tumors manifested the diagnostic EWSR1 mutation and were treated with an Ewing sarcoma regimen. Outcomes were variable, with one patient showing progressive metastatic disease and death 3 years after presentation, one patient with disease-free survival 10.5 years after completion of therapy, and one alive and well at the completion of therapy 1 year after diagnosis. One patient

  4. Variable expression of PIK3R3 and PTEN in Ewing Sarcoma impacts oncogenic phenotypes.

    Directory of Open Access Journals (Sweden)

    Brian F Niemeyer

    Full Text Available Ewing Sarcoma is an aggressive malignancy of bone and soft tissue affecting children and young adults. Ewing Sarcoma is driven by EWS/Ets fusion oncoproteins, which cause widespread alterations in gene expression in the cell. Dysregulation of receptor tyrosine kinase signaling, particularly involving IGF-1R, also plays an important role in Ewing Sarcoma pathogenesis. However, the basis of this dysregulation, including the relative contribution of EWS/Ets-dependent and independent mechanisms, is not well understood. In the present study, we identify variable expression of two modifiers of PI3K signaling activity, PIK3R3 and PTEN, in Ewing Sarcoma, and examine the consequences of this on PI3K pathway regulation and oncogenic phenotypes. Our findings indicate that PIK3R3 plays a growth-promotional role in Ewing Sarcoma, but suggest that this role is not strictly dependent on regulation of PI3K pathway activity. We further show that expression of PTEN, a well-established, potent tumor suppressor, is lost in a subset of Ewing Sarcomas, and that this loss strongly correlates with high baseline PI3K pathway activity in cell lines. In support of functional importance of PTEN loss in Ewing Sarcoma, we show that re-introduction of PTEN into two different PTEN-negative Ewing Sarcoma cell lines results in downregulation of PI3K pathway activity, and sensitization to the IGF-1R small molecule inhibitor OSI-906. Our findings also suggest that PTEN levels may contribute to sensitivity of Ewing Sarcoma cells to the microtubule inhibitor vincristine, a relevant chemotherapeutic agent in this cancer. Our studies thus identify PIK3R3 and PTEN as modifiers of oncogenic phenotypes in Ewing Sarcoma, with potential clinical implications.

  5. Variations in the squamous part of the occipital bone in medieval and contemporary cranial series from Bulgaria.

    Science.gov (United States)

    Nikolova, S; Toneva, D; Yordanov, Y; Lazarov, N

    2014-11-01

    The squamous part of the occipital bone is a place of many different variations. They are a result of faulty ossification in the occipital squama or due to the presence of sutural bones in the lambda region. As their differentiation is intricate because of the various criteria used, the issue of their recognition in the adult skull still remains difficult even though they can be clearly distinguished at a younger age. The aim of the present study was to compare the frequency of interparietal, preinterparietal and sutural bones in the lambda region in medieval male and female cranial series as well as between medieval and contemporary male series from Bulgaria. We also discuss the development of the occipital squama in order to set clearer criteria for further differentiation of such variations in the adult skull. In the reviewed 3 cranial series, the variations in the squamous portion of the occipital bone were observed with a low frequency. The incidence of preinterparietal bones was more common than the interparietal ones. The sutural bones in the lambda region were numerous in the series. No statistically significant sex or intergroup differences were established. So even if these anatomical variations are relatively rare, the understanding of them is of significance for many disciplines like anthropology, comparative and developmental anatomy, clinical and forensic medicine.

  6. CT imaging of primary pleuropulmonary synovial sarcoma

    International Nuclear Information System (INIS)

    Zhang, W.-D.; Guan, Y.-B.; Chen, Y.-F.; Li, C.-X.

    2012-01-01

    Aim: To evaluate the computed tomography (CT) imaging findings of primary pleuropulmonary synovial sarcoma. Materials and methods: Five cases of synovial sarcoma confirmed by histopathology and cytogenetic study were retrospectively analysed. All patients had undergone chest radiography and unenhanced and contrast-enhanced CT examinations, and three had also undergone multiphase CT enhancement examinations. Image characteristics, including shape, size, margin, and attenuation of each lesion before and after contrast enhancement, were analysed. Results: The chest radiographs of the five patients showed well-defined or partly well-defined masses, which were homogeneous and without associated calcification or lymphadenopathy. Pneumothorax was present in one patient. The unenhanced CT images showed well-defined, heterogeneous masses with patchy low density in all five patients. The contrast-enhanced CT images showed heterogeneous enhancement in all cases, three of which demonstrated cystic and necrotic areas. The tumour showed no prolonged or delayed enhancement in three cases using multiphase CT. There were small pleural effusions in four cases. No calcification was observed in any of the cases. There was no evidence of hilar or mediastinal lymphadenopathy. Conclusions: In these five patients, primary pleuropulmonary synovial sarcoma presented as a well-defined mass with patchy low density and heterogeneous enhancement, with no evidence of regional lymphadenopathy. It should be included in the differential diagnosis of regional tumours.

  7. CT imaging of primary pleuropulmonary synovial sarcoma.

    Science.gov (United States)

    Zhang, W-D; Guan, Y-B; Chen, Y-F; Li, C-X

    2012-09-01

    To evaluate the computed tomography (CT) imaging findings of primary pleuropulmonary synovial sarcoma. Five cases of synovial sarcoma confirmed by histopathology and cytogenetic study were retrospectively analysed. All patients had undergone chest radiography and unenhanced and contrast-enhanced CT examinations, and three had also undergone multiphase CT enhancement examinations. Image characteristics, including shape, size, margin, and attenuation of each lesion before and after contrast enhancement, were analysed. The chest radiographs of the five patients showed well-defined or partly well-defined masses, which were homogeneous and without associated calcification or lymphadenopathy. Pneumothorax was present in one patient. The unenhanced CT images showed well-defined, heterogeneous masses with patchy low density in all five patients. The contrast-enhanced CT images showed heterogeneous enhancement in all cases, three of which demonstrated cystic and necrotic areas. The tumour showed no prolonged or delayed enhancement in three cases using multiphase CT. There were small pleural effusions in four cases. No calcification was observed in any of the cases. There was no evidence of hilar or mediastinal lymphadenopathy. In these five patients, primary pleuropulmonary synovial sarcoma presented as a well-defined mass with patchy low density and heterogeneous enhancement, with no evidence of regional lymphadenopathy. It should be included in the differential diagnosis of regional tumours. Copyright © 2012 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

  8. MRI of spinal bone marrow: part I, techniques and normal age-related appearances.

    Science.gov (United States)

    Shah, Lubdha M; Hanrahan, Christopher J

    2011-12-01

    This article reviews MRI protocols, including routine and nonroutine pulse sequences as well as the normal MRI appearance of spinal marrow and expected age-related changes. Routine MRI of the spine provides useful evaluation of the spinal bone marrow, but nonroutine MRI pulse sequences are increasingly being used to evaluate bone marrow pathology. An understanding of MRI pulse sequences and the normal and age-related appearances of bone marrow is important for the practicing radiologist.

  9. Hemipelvectomy with laparoscopic abdominoperineal excision for epithelioid sarcoma treatment

    Directory of Open Access Journals (Sweden)

    Daniel Paulino Santana

    2017-07-01

    Full Text Available The epithelioid sarcoma (ES is an unusual variant of the sarcoma, not reaching 1% of all soft tissue sarcomas. Initially reported in 1970, it has a more aggressive variant, which was classified as the “proximal-type” in 1997. These are aggressive tumors with high rates of distant metastasis and local relapses. Isolated radio and chemotherapy responses are poor and free-margin surgical resection is the treatment of choice.This is the case report of a 25-year-old male patient diagnosed with “proximal-type” ES in the perineal region. He underwent surgical resection in another institution and was later admitted to our institution with local recurrence with rectal and left thigh muscle invasion. Neoadjuvant radio-chemotherapy was performed, followed by laparoscopic abdominoperineal rectal resection and partial left hemipelvectomy associated with left lower-limb amputation. The patient had no postoperative complications and is currently undergoing outpatient follow-up. The anatomopathological analysis showed tumor-free margins.The “proximal-type” ES is a rare soft-tissue sarcoma subtype. High local recurrence, as well as the metastasis rates, makes its treatment a challenging task. Resumo: O sarcoma epitelióide (SE é um subtipo incomum de sarcoma, não chegando a 1% dos sarcomas de partes moles. Foi inicialmente descrito em 1970, sendo que em 1997 uma variante mais agressiva foi classificada como “tipo proximal”. São tumores agressivos, com altas taxas de metástases e recidiva local, com resposta pobre à quimioterapia e radioterapia isoladas. A ressecção cirúrgica com margens livres é o tratamento padrão.Apresentamos o caso de um paciente de 25 anos com SE tipo proximal avançado em região perineal, submetido a ressecção em outro serviço, evoluindo com recidiva local com invasão do canal anal e musculatura da coxa esquerda. Foi realizado tratamento radioquimioterápico neoadjuvante seguido de ressecção cirúrgica com

  10. Intracardiac Low-grade Sarcoma Following Treatment for Ewing Sarcoma.

    Science.gov (United States)

    Ortiz, Michael V; Magnan, Heather; Slotkin, Emily K; Ambati, Srikanth R; Chou, Alexander J; Wexler, Leonard H; Meyers, Paul A; Walsh, Michael F; Heaton, Todd; Girardi, Leonard N; Wolden, Suzanne L; Price, Anita P; Kennedy, Jennifer A; Zehir, Ahmet; Hameed, Meera; Berger, Michael F; Kentsis, Alex; Shukla, Neerav

    2017-11-01

    A 16-year-old male was diagnosed with Ewing sarcoma of the ribcage with pulmonary metastases. Six months after completion of scheduled therapy, he was found to have a new intracardiac mass, presumed recurrent Ewing sarcoma. EWSR1 fusion was not detected by droplet digital polymerase chain reaction from blood plasma. After no improvement with salvage chemotherapy, he underwent surgical resection that identified a low-grade spindle cell sarcoma. Despite the near-synchronous presentation of 2 unrelated sarcomas, extensive genomic analyses did not reveal any unifying somatic or germline mutations nor any apparent cancer predisposition. This case also highlights the potential role of utilizing plasma cell-free DNA for diagnosing tumors in locations where biopsy confers high morbidity.

  11. Calcific bursitis mimicking a parosteal osteogenic sarcoma

    International Nuclear Information System (INIS)

    Slavin, J.D. Jr.; Vento, J.A.; Haugh, J.D.; Spencer, R.P.; Connecticut Univ., Farmington

    1986-01-01

    A 43-year-old woman with no history of trauma or major medical illness, presented with a ten day history of right hip and thigh pain. The pain was described as constant, dull, and aching. It was nonradiating and was not relieved by analgesics. Physical examination revealed diffuse tenderness over the right hip and right lateral thigh region; no mass was palpable. The CBC, serum electrolytes, calcium, phosphorus, and alkaline phosphatase determinations were all normal. Radiographs of the right hip demonstrated amorphous soft tissue calcification adjacent to the lateral aspect of the right femur as well as periosteal reaction and apparent destruction in the adjacent bone. Because of these suspicious X-rays findings, the initial working diagnosis was parosteal osteogenic sarcoma. A bone scan was performed two hours after the intravenous administration of 15 millicuries of Tc-99m-MDP. It showed focal uptake overlying the upper femur, approximately where the X-ray had shown periosteal reaction and apparent bony destruction. In addition, the bone images also demonstrated a linear band of activity extending through the soft tissues from the greater trochanter to the lower lateral thigh. Because of the unexpected and quite extensive soft tissue uptake seen on the scan, the possibility that a benign process was involved was then considered seriously for the first time. An open biopsy was then performed. It revealed acute calcific trochanteric bursitis; there was no evidence of bone involvement. The patient was treated conservatively and symptoms gradually resolved. (orig.) [de

  12. Osteogenic Sarcoma: A 21st Century Review.

    Science.gov (United States)

    Osasan, Stephen; Zhang, Mingyong; Shen, Fan; Paul, Paulose J; Persad, Sujata; Sergi, Consolato

    2016-09-01

    Compared to other bone tumors, bone osteogenic sarcoma (BOS) continues to confer a much grimmer prognosis as the survival benefit of traditional chemotherapy treatment regimens is still unsatisfactory. Chemotherapy was demonstrated to be effective in eradicating both primary tumor and pulmonary metastases in the last century, with effective agents used in various combination regimens having changed the survival rate from less than 10% to 75%. The most common primary bone cancer, BOS is conventionally a primary intramedullary high-grade malignant tumor characterized by malignant cells forming immature bone or osteoid. BOS is a disease with diverse morphological presentations. The treatment of all morphological variants seem to have been the same for over 30 years. The introduction of antiproliferative agents such as insulin growth factor-binding protein 3 hold promise of a potentially veritable therapeutic target. In this review, we highlight recent data on osteosarcoma to consolidate a platform able to connect bench and bedside. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  13. Post-radiation sarcomas: A review of the clinical and imaging features in 63 cases

    International Nuclear Information System (INIS)

    Sheppard, Declan G.; Libshitz, Hermann I.

    2001-01-01

    AIMS: The development of sarcomas is a recognized complication of radiation therapy. We set out to retrospectively review the clinical and therapeutic demographics, as well as the cross-sectional imaging findings in patients with post-radiation sarcomas. MATERIALS AND METHODS: Sixty-three patients with post-radiation sarcomas were identified at a single institution. Computed tomography and/or magnetic resonance imaging was available for all patients. The medical records were reviewed for the primary diagnoses, the radiation history, and the latency period to the development of the sarcoma. RESULTS: There were 43 women and 20 men with a mean age of 52.8 years. The mean radiation dose delivered was 50.1 Gy, with a mean latency period for the development of the sarcoma of 15.5 years. The most common primary diagnoses were breast cancer, lymphoma and head and neck cancer. The most common sarcoma histopathologies were osteosarcoma and malignant fibrous histiocytoma. The most common imaging findings were a soft tissue mass and bone destruction. CONCLUSIONS: Post-radiation sarcomas, while uncommon, are not rare. The imaging findings are not pathognomonic, but an appreciation of the expected latency period may help to suggest the diagnosis. Sheppard, D.G. and Libshitz, H.I. (2001)

  14. Postirradiation sarcoma in retinoblastoma. Induction or predisposition

    International Nuclear Information System (INIS)

    Schwarz, M.B.; Burgess, L.P.; Fee, W.E. Jr.; Donaldson, S.S.

    1988-01-01

    An alarmingly high rate of postirradiation sarcomas following treatment for retinoblastoma has been described in the literature. We present four new cases and report 57 others from the English literature. Osteogenic sarcoma was the predominant histologic type (58%), followed by fibrosarcoma (21%) and various other sarcomas (21%). The average latency period between irradiation and development of the second primary (sarcoma) was 12.4 years. Irrespective of irradiation, a genetic linkage between retinoblastoma and osteogenic sarcoma on the 13q14 chromosome is recognized. Through a pleiotropic effect of this same chromosome, a predisposition for other sarcomas may exist as well. Finally, a strong role for radiation induction is proposed for all of these postirradiation sarcomas. This is based on the increased number of sarcomas arising in the field of prior irradiation (sites uncharacteristic of spontaneously occurring primary sarcomas) and the prolonged latency periods.13 references

  15. Drugs Approved for Kaposi Sarcoma

    Science.gov (United States)

    This page lists cancer drugs approved by the Food and Drug Administration (FDA) for Kaposi sarcoma. The list includes generic names and brand names. The drug names link to NCI's Cancer Drug Information summaries.

  16. Primary Ewing's sarcoma of the skull: radical resection and immediate cranioplasty after chemotherapy. A technical note.

    Science.gov (United States)

    Castle, Maria; Rivero, Mónica; Marquez, Javier

    2013-02-01

    The current standard treatment of Ewing's sarcoma is chemotherapy followed by surgery, making an immediate cranial reconstruction in a one-step surgical procedure possible. We describe the technique used to repair a cranial defect after the resection of a primary Ewing's sarcoma of the skull in a one-step surgical procedure. Bone repair with a custom-made cranioplasty immediately after resection of a primary Ewing's sarcoma of the skull avoids deformities and late complications associated with reconstructive surgery after radiotherapy and not interfere with radiotherapy and neither with follow-up. A one-step surgical procedure after chemotherapy for primary Ewing's sarcoma of the skull could be safer, less aggressive and more radical; avoiding deformities and late complications.

  17. Extraskeletal Ewing’s Sarcoma Arising from the Sciatic Nerve: A Diagnostic Challenge

    Directory of Open Access Journals (Sweden)

    Aadhar Sharma

    2015-01-01

    Full Text Available Ewing’s sarcoma is a common bone tumour of childhood but is a rare occurrence in individuals over 20 years of age. Few cases are reported as originating from peripheral nerves. We present an unusual case of extraosseous Ewing’s sarcoma originating from the sciatic nerve in a 66-year-old patient which had the clinical hallmarks of a benign nerve sheath tumour. Following discussion at a multidisciplinary meeting, excision biopsy of the suspected benign nerve sheath tumour was planned. At operation, the mass had malignant features. Histology confirmed the presence of Ewing’s sarcoma. Due to the morbidity of nerve resection, radiotherapy and chemotherapy were commenced. Ewing’s sarcoma is known to mimic benign pathologies. In this case there were subtle signs of a malignant process in the form of unremitting pain. It is vital to keep in mind the less common tumours that can affect the peripheral nervous system in such cases.

  18. Synovial sarcoma of the kidney in a young patient with a review of the literature

    Directory of Open Access Journals (Sweden)

    Mahmoud Abbas

    2014-06-01

    Full Text Available Synovial sarcoma (SS is a soft tissue, generally deep seated neoplasms that occurs generally in the proximity of large joints. We report of a case of a 33-year-old man who was diagnosed with primary SS of the kidney which is an extremely rare tumor that accounts for less than 2% of malignant renal tumors. Contemporary management of renal synovial sarcoma includes surgical resection and ifosfamide-based chemotherapy and they remain the mainstay of therapy of synovial sarcoma, which is often applied, combined as part of an aggressive treatment approach. Fewer than 50 patients have been described in the English literature. Physicians should be aware of the possibility of malignancy in cystic renal masses and raise the suspicion of synovial sarcoma, especially when patients with renal masses are young adults. Along with the case report a literature review on primary synovial sarcomas of the kidney is provided with focus on the renal tumors’ differential diagnosis.

  19. MRI findings of central nervous system granulocytic sarcoma (chloroma)

    International Nuclear Information System (INIS)

    Lee, Chang Man; Kim, Myung Soon; Kim, Ik Soo; Cho, Kwan Soo

    1997-01-01

    To characterize MRI findings of central nervous system (CNS) granulocytic sarcoma (chloroma) and to analyse the points which differentiate it from other CNS tumors. We evaluated MRI in six patients with CNS granulocytic sarcoma proven by surgery or bone marrow biopsy (intracranical, one case and spine five cases). A 0.5T superconductive MR machine was used for diagnosis and, axial, coronal and sagittal T1- and T2-weighted spin echo images and Gd-DTPA enhanced T1-weighted images were obtained. We retrospectively analized the location, signal intensity, margin, contrast enhancement and homogeneity, and bony change around the tumor. MRI findings of CNS granulocytic sarcomas were as follows : one tumor was seen to be an extra-axial mass in the posterior fossa of the brain, four were epidural, and one was an epidural and presacral masses in the spine;tumor magins were lobulated and three were smooth. On T1-weighted images, all tumors were of isoignal intensity;on T2-weighted images, four were of isosignal intersity and two were of high signal intensity. Contrast enhancement was inhomogeneous in five of six cases. Bony change around the tumor was seen in two cases. On T1-weighted images, CNS granulocytic sarcomas (chloromas) were of isosignal intensity, relative to brain parenchyma or spinal cord;on T2-weighted images, they were of iso or high signal intensity, with relative contrast enhancement. These points could be useful in differentiating them from other CNS tumors

  20. MRI of spinal bone marrow: part 2, T1-weighted imaging-based differential diagnosis.

    Science.gov (United States)

    Hanrahan, Christopher J; Shah, Lubdha M

    2011-12-01

    The purpose of this article is to review the structure of bone marrow and the differential diagnosis of bone marrow pathology on the basis of T1-weighted MRI patterns. Bone marrow is an organ that is evaluated routinely during MRI of the spine, particularly lumbar spine evaluation. Thus, it is one of the most commonly performed MRI examinations. T1-weighted MRI is a fundamental sequence in evaluating spinal marrow, and an understanding of T1-weighted MR signal abnormalities is important for the practicing radiologist.

  1. Radiosensitivity of soft tissue sarcomas

    International Nuclear Information System (INIS)

    Hirano, Toru; Iwasaki, Katsuro; Suzuki, Ryohei; Monzen, Yoshio; Hombo, Zenichiro

    1989-01-01

    The correlation between the effectiveness of radiation therapy and the histology of soft tissue sarcomas was investigated. Of 31 cases with a soft tissue sarcoma of an extremity treated by conservative surgery and postoperative radiation of 3,000-6,000 cGy, local recurrence occurred in 12; 5 out of 7 synovial sarcomas, 4 of 9 MFH, one of 8 liposarcomas, none of 4 rhabdomyosarcomas and 2 of 3 others. As for the histological subtyping, the 31 soft tissue sarcomas were divided into spindle cell, pleomorphic cell, myxoid and round cell type, and recurrence rates were 75%, 33.3%, 16.7% and 0%, respectively. From the remarkable difference in recurrent rate, it was suggested that round cell and myxoid type of soft tissue sarcomas showed a high radiosensitivity compared to the spindle cell type with low sensitivity. Clarifying the degree of radiosensitivity is helpful in deciding on the management of limb salvage in soft tissue sarcomas of an extremity. (author)

  2. High-resolution computed tomography of the temporal bone. Part 2.: pathology

    International Nuclear Information System (INIS)

    Grzegorzewski, M.; Boron, Z.; Burzynska-Makuch, M.

    1995-01-01

    Selected cases of the temporal bone pathology on high resolution CT were demonstrated. Transverse and coronal sections of the cases were selected from 68 patients with various otological diseases. (author)

  3. Advanced oral HIV-associated Kaposi sarcoma with facial ...

    African Journals Online (AJOL)

    2012-02-14

    Feb 14, 2012 ... S Afr Fam Pract 2012;54(6):545-547. Advanced oral HIV-associated Kaposi sarcoma with facial lymphoedoema as an indicator of poor prognosis. Feller L, DMD, MDent, Head of Department; Essop R, BCom, BChD, Part-Time Lecturer. Department of Periodontology and Oral Medicine, School of Oral Health ...

  4. Bone morphogenetic proteins in tissue engineering: the road from laboratory to clinic, part II (BMP delivery).

    Science.gov (United States)

    Bessa, P C; Casal, M; Reis, R L

    2008-01-01

    Bone morphogenetic proteins (BMPs) are cytokines with a strong effect on bone and cartilage growth and with important roles during embryonic patterning and early skeletal formation. BMPs have promising potential for clinical bone and cartilage repair, working as powerful bone-inducing components in diverse tissue-engineering products. Synthetic polymers, natural origin polymers, inorganic materials and composites may be used as carriers for the delivery of BMPs. Carriers range from nanoparticles to complex three-dimensional (3D) scaffolds, membranes for tissue-guided regeneration, biomimetic surfaces and smart thermosensitive hydrogels. Current clinical uses include spinal fusion, healing of long bone defects and craniofacial and periodontal applications, amongst others. BMP-2 and BMP-7 have recently received approval by the US Food and Drug Administration (FDA) for specific clinical cases, delivered in absorbable collagen sponges. Considering the expanding number of publications in the field of BMPs, there are prospects of a brilliant future in the field of regenerative medicine of bone and cartilage with the use of BMPs.

  5. Like or Dislike? Impact of Facebook on Ewing Sarcoma Treatment.

    Science.gov (United States)

    Ruckenstuhl, Paul; Schippinger, Michael; Liebmann, Paul; Leithner, Andreas; Bernhardt, Gerwin

    2016-08-25

    ' and relatives' results. During the last 6 months most activities in the group concerned sharing destiny and handling the diagnosis. The Facebook group Ewing Sarcoma Awareness has a relevant impact on group members regarding their choice of treatment. Moreover, participants turn toward the group to receive mental and emotional support in everyday life. Statements made within the group are in part questionable from a medical point of view and the impact made by these statements on patients' care requires further evaluation. ©Paul Ruckenstuhl, Michael Schippinger, Paul Liebmann, Andreas Leithner, Gerwin Bernhardt. Originally published in JMIR Cancer (http://cancer.jmir.org), 25.08.2016.

  6. Sorafenib in Treating Patients With Metastatic, Locally Advanced, or Recurrent Sarcoma

    Science.gov (United States)

    2014-05-07

    Adult Angiosarcoma; Adult Epithelioid Sarcoma; Adult Leiomyosarcoma; Adult Malignant Fibrous Histiocytoma; Adult Neurofibrosarcoma; Adult Synovial Sarcoma; Ovarian Sarcoma; Recurrent Adult Soft Tissue Sarcoma; Recurrent Uterine Sarcoma; Stage III Adult Soft Tissue Sarcoma; Stage III Uterine Sarcoma; Stage IV Adult Soft Tissue Sarcoma; Stage IV Uterine Sarcoma; Uterine Carcinosarcoma; Uterine Leiomyosarcoma

  7. Stages of Adult Soft Tissue Sarcoma

    Science.gov (United States)

    ... Childhood Vascular Tumors Treatment Research Adult Soft Tissue Sarcoma Treatment (PDQ®)–Patient Version General Information About Adult Soft Tissue Sarcoma Go to Health Professional Version Key Points Adult ...

  8. Treatment Option Overview (Adult Soft Tissue Sarcoma)

    Science.gov (United States)

    ... Childhood Vascular Tumors Treatment Research Adult Soft Tissue Sarcoma Treatment (PDQ®)–Patient Version General Information About Adult Soft Tissue Sarcoma Go to Health Professional Version Key Points Adult ...

  9. General Information about Childhood Soft Tissue Sarcoma

    Science.gov (United States)

    ... Childhood Vascular Tumors Treatment Research Childhood Soft Tissue Sarcoma Treatment (PDQ®)–Patient Version General Information About Childhood Soft Tissue Sarcoma Go to Health Professional Version Key Points Childhood ...

  10. Treatment Options for Adult Soft Tissue Sarcoma

    Science.gov (United States)

    ... Childhood Vascular Tumors Treatment Research Adult Soft Tissue Sarcoma Treatment (PDQ®)–Patient Version General Information About Adult Soft Tissue Sarcoma Go to Health Professional Version Key Points Adult ...

  11. Treatment Option Overview (Childhood Soft Tissue Sarcoma)

    Science.gov (United States)

    ... Childhood Vascular Tumors Treatment Research Childhood Soft Tissue Sarcoma Treatment (PDQ®)–Patient Version General Information About Childhood Soft Tissue Sarcoma Go to Health Professional Version Key Points Childhood ...

  12. General Information about Adult Soft Tissue Sarcoma

    Science.gov (United States)

    ... Childhood Vascular Tumors Treatment Research Adult Soft Tissue Sarcoma Treatment (PDQ®)–Patient Version General Information About Adult Soft Tissue Sarcoma Go to Health Professional Version Key Points Adult ...

  13. Treatment Options for Childhood Soft Tissue Sarcoma

    Science.gov (United States)

    ... Childhood Vascular Tumors Treatment Research Childhood Soft Tissue Sarcoma Treatment (PDQ®)–Patient Version General Information About Childhood Soft Tissue Sarcoma Go to Health Professional Version Key Points Childhood ...

  14. Stages of Childhood Soft Tissue Sarcoma

    Science.gov (United States)

    ... Childhood Vascular Tumors Treatment Research Childhood Soft Tissue Sarcoma Treatment (PDQ®)–Patient Version General Information About Childhood Soft Tissue Sarcoma Go to Health Professional Version Key Points Childhood ...

  15. Drugs Approved for Soft Tissue Sarcoma

    Science.gov (United States)

    ... Your Treatment Research Drugs Approved for Soft Tissue Sarcoma This page lists cancer drugs approved by the ... not listed here. Drugs Approved for Soft Tissue Sarcoma Cosmegen (Dactinomycin) Dactinomycin Doxorubicin Hydrochloride Eribulin Mesylate Gleevec ( ...

  16. Osteogenic sarcoma of the breast arising in a cystosarcoma phyllodes: a case report and review of the literature

    Directory of Open Access Journals (Sweden)

    Chintamani

    2011-07-01

    Full Text Available Abstract Introduction Primary tumors of the breast containing bone and cartilage are extremely rare, and an osteogenic sarcoma arising from a cystosarcoma phyllodes is exceptional. Case presentation A 40-year-old Indian woman presented with a breast mass which was diagnosed as osteosarcoma of the breast on biopsy. Our patient was treated with a simple mastectomy after excluding the presence of skeletal primary and extra-mammary metastases. Final pathology showed a cystosarcoma phyllodes with signs of osteogenic sarcoma. Conclusion Although osteogenic sarcomas of the breast are rare, they need to be distinguished from carcinosarcomas and metaplastic carcinomas as the management of the two differ.

  17. Postirradiation sarcoma (malignant fibrous histiocytoma) of axilla

    International Nuclear Information System (INIS)

    Hardy, T.J.; An, T.; Brown, P.W.; Terz, J.J.

    1978-01-01

    A case is reported of a patient who developed a histologically unusual sarcoma in the axilla and chest wall 8 years after receiving radiation therapy (6500 rad) for carcinoma of the breast. This sarcoma showed light- and electron-microscopic features of a malignant fibrous histiocytoma, a tumor not documented among 24 previously reported cases of postirradiation sarcoma following the diagnosis of breast carcinoma. In addition, the literature is reviewed and discussed regarding postirradiation sarcoma in general following breast carcinoma

  18. Severe Bone Loss as Part of the Life History Strategy of Bowhead Whales.

    Directory of Open Access Journals (Sweden)

    John C George

    Full Text Available The evolution of baleen constituted a major evolutionary change that made it possible for baleen whales to reach enormous body sizes while filter feeding on tiny organisms and migrating over tremendous distances. Bowhead whales (Balaena mysticetus live in the Arctic where the annual cycle of increasing and decreasing ice cover affects their habitat, prey, and migration. During the nursing period, bowheads grow rapidly; but between weaning and approximately year 5, bowhead whales display sustained baleen and head growth while limiting growth in the rest of their bodies. During this period, they withdraw resources from the skeleton, in particular the ribs, which may lose 40% of bone mass. Such dramatic changes in bones of immature mammals are rare, although fossil cetaceans between 40 and 50 million years ago show an array of rib specializations that include bone loss and are usually interpreted as related to buoyancy control.

  19. Incidence and management of Kaposi sarcoma in renal transplant recipients: the Greek experience.

    Science.gov (United States)

    Zavos, G; Moris, D; Vernadakis, S; Bokos, J; Lionaki, S; Mamarelis, G; Panagiotellis, K; Zavvos, V; Boletis, I

    2014-11-01

    One of the most common malignancies in kidney transplant recipients is Kaposi sarcoma. The incidence of Kaposi sarcoma, which develops after renal transplantation, is 400-500 times higher than that in the general population. The aims of this study were to review the experience with Kaposi sarcoma in the highest-volume transplantation Unit in Greece and to analyze clinical characteristics and response to treatment, with respect to both the patients' survival and the renal graft function. The records of 2008 renal graft recipients between March 1983 and December 2012 were retrospectively reviewed. Kaposi sarcoma was diagnosed based on clinical, laboratory, radiological, endoscopic, and histopathologic examinations. The disease was staged according to the classification of Al-Khader et al. The prevalence of Kaposi sarcoma was 1.2% in our renal transplant population. Of these, 1006 recipients underwent living-donor renal transplantation, whereas 1002 received their graft from deceased donors. Post-transplantation malignancy developed in 153 patients, among which, Kaposi sarcoma has been found in 24 cases. Of the 24 cases of Kaposi sarcoma, lesions were mainly cutaneous in 14 cases, visceral and cutaneous in 8, and concomitant visceral and lymph node involvement was observed in 2 patients. With regard to the final outcome, 20 patients (83.3%) showed remission of the disease, whereas 4 patients with visceral involvement (16.6%) did not respond to chemotherapy and discontinuation of immunosuppression and died. Moreover, 8 deaths occurred due to apparently unrelated causes. Kaposi sarcoma is an important part (15.7%) of all post-transplantation neoplasias in our series. Furthermore, our findings confirmed the previously described close association between human herpesvirus-8 and post-transplantation Kaposi sarcoma. Reduction of immunosuppression or discontinuation of calcineurin inhibitors results in remission of the disease in most of the cases. Prognosis in patients with

  20. Synovial sarcoma | Vlok | SA Journal of Radiology

    African Journals Online (AJOL)

    Synovial sarcoma. SSC Vlok, GWW Wagener, D Zaharie. Abstract. Synovial sarcoma is a malignant, predominantly juxta-articular, soft-tissue tumour representing approximately 10% of all soft-tissue sarcomas. Frequently initially incorrectly diagnosed as a benign lesion, it should be considered as a diagnosis when a young ...

  1. Synovial sarcoma of the abdominal wall

    International Nuclear Information System (INIS)

    Matushita, J.P.K.; Matushita, J.S.

    1989-01-01

    A case report of synovial sarcoma arising in the abdominal wall is presented. A brief review of the clinical and radiological features of synovial sarcoma is made. Pre-operative diagnosis of an abdominal wall synovial sarcoma is virtually impossible, but should be considered when a soft tissue swelling is found to show amorphous stippled calcification X-ray. (author) [pt

  2. Tissue characteristics of high- and low-incidence plutonium-induced osteogenic sarcoma sites in life-span beagles

    International Nuclear Information System (INIS)

    Miller, S.C.; Jee, W.S.S.; Smith, J.M.; Wronski, T.J.

    1986-01-01

    On the basis of information gathered from the 239 Pu life-span study in beagles at the University of Utah, the tissue features were found to be characteristic of high-incidence bone-tumor sites compared to low-incidence sites included more hematopoietic tissues in the bone marrow; greater trabecular bone mass; greater bone remodeling rates; greater mineral apposition rates; greater density and activity of bone surface cells; greater density of putative bone-cell precursors; greater initial uptake of plutonium on bone surfaces; and greater marrow vascular volumes and a venous sinusoidal bed. Although most of these studies are not yet complete, the information being collected should contribute to our understanding of the mechanisms of radiation-induced osteogenic sarcomas. This should aid in predicting the types and characteristics of osseous tissues where radiation-induced osteogenic sarcomas may arise in humans. 25 refs., 4 figs., 3 tabs

  3. Uterine sarcoma – current perspectives

    Science.gov (United States)

    Benson, Charlotte; Miah, Aisha B

    2017-01-01

    Uterine sarcomas comprise a group of rare tumors with differing tumor biology, natural history and response to treatment. Diagnosis is often made following surgery for presumed benign disease. Currently, preoperative imaging does not reliably distinguish between benign leiomyomas and other malignant pathology. Uterine leiomyosarcoma is the most common sarcoma, but other subtypes include endometrial stromal sarcoma (low grade and high grade), undifferentiated uterine sarcoma and adenosarcoma. Clinical trials have shown no definite survival benefit of adjuvant radiotherapy or chemotherapy and have been hampered by the rarity and heterogeneity of these disease types. There is a role of adjuvant treatment in carefully selected cases following multidisciplinary discussion at sarcoma reference centers. In patients with metastatic disease, systemic chemotherapy can then be considered. There is activity of a number of agents, including doxorubicin, trabectedin, gemcitabine-based chemotherapy, eribulin and pazopanib. Patients should be considered for clinical trial entry where possible. Close international collaboration is important to allow progress in this group of diseases. PMID:28919822

  4. An anatomical study of wormian bones from the eastern part of India: is genetic influence a primary determinant of their morphogenesis?

    Science.gov (United States)

    Ghosh, Sanjib Kumar; Biswas, Sudipa; Sharma, Suranjali; Chakraborty, Soumya

    2017-06-01

    Over the years a number of investigators have analysed the morphology of wormian bones in different population groups across the world. There have been significant variations between findings reported in these studies, and this has prompted researchers to focus on the influence of genetic factors on the morphology of these bones. In the light of the above observation, we considered it justified to conduct anatomical studies on wormian bones in different population groups; hence, we undertook the present study to look into the morphological details of these bones among a population in the eastern part of India. We observed a total of 120 adult dry human skulls of unknown age and sex, and noted the anatomical details of wormian bones when present. It was observed that wormian bones were present in 45 % of skulls, and that 30 % of skulls had more than one wormian bone. We also found that 2.5 % of the skulls had ten or more wormian bones, which is considered as pathognomonic. Maximum incidence (53.33 %) was observed at the lambdoid suture and minimum incidence at the bregma and metopic suture (0.61 % in each case). We noted a high incidence (21.21 %) of Inca bone/lambdoid ossicle, and bilaterally symmetrical wormian bones were present in 12.5 % study skulls. There were statistically significant (P bones.

  5. Radiotherapy for Kaposi's sarcoma

    International Nuclear Information System (INIS)

    Lo, T.C.; Salzman, F.A.; Smedal, M.I.; Wright, K.A.

    1980-01-01

    Between 1954 and 1976, 60 patients with Kaposi's sarcoma were treated in the Department of Radiotherapy of the Lahey Clinic Foundation at the High Voltage Research Laboratory of Massachusetts Institute of Technology. Only 2 patients were free of clinical disease in the lower extremities at the time of initial presentation, and 40 patients (69%) had cutaneous lesions involving areas extending above the knees. Eight patients (13%) also presented with mucous membrane involvement in addition to skin disease. Twenty-one patients were treated only with megavoltage electrons during the initial course of radiotherapy, and 12 patients were treated with supervoltage photons alone. The remaining 27 patients were treated with a combination of electrons and photons; in 17 patients, the same tumor sites were irradiated with both modalities. Eleven patients received whole-body surface electron irradiation. The choice of treatment modalities was based on the extent and distribution of cutaneous disease and depth of the lesions. The overall response rate was 93% after a single fractionated course of radiotherapy. Twenty-five patients achieved complete regression and 18 were in remission for 2 to 13 years. Response rates were also analyzed with respect to the three subgroups in terms of treatment modalities. A single dose of 800 to 1200 rads or its equivalent was required to control local cutaneous lesions. Widespread visceral metastasis was the most common cause of failure and death; the incidence of second malignancies was increased. Trial of systemic chemotherapy and immunotherapy would seem to be a reasonable therapeutic adjunct

  6. Planning for corrective osteotomy of the femoral bone using 3D-modeling. Part I

    Directory of Open Access Journals (Sweden)

    Alexey G Baindurashvili

    2016-09-01

    Full Text Available Introduction. In standard planning for corrective hip osteotomy, a surgical intervention scheme is created on a uniplanar paper medium on the basis of X-ray images. However, uniplanar skiagrams are unable to render real spatial configuration of the femoral bone. When combining three-dimensional and uniplanar models of bone, human errors inevitably occur, causing the distortion of preset parameters, which may lead to glaring errors and, as a result, to repeated operations. Aims. To develop a new three-dimensional method for planning and performing corrective osteotomy of the femoral bone, using visualizing computer technologies. Materials and methods. A new method of planning for corrective hip osteotomy in children with various hip joint pathologies was developed. We examined the method using 27 patients [aged 5–18 years (32 hip joints] with congenital and acquired femoral bone deformation. The efficiency of the proposed method was assessed in comparison with uniplanar planning using roentgenograms. Conclusions. Computerized operation planning using three-dimensional modeling improves treatment results by minimizing the likelihood of human errors and increasing planning and surgical intervention  accuracy.

  7. Regenerating Mandibular Bone Using rhBMP-2: Part 1-Immediate Reconstruction of Segmental Mandibulectomies.

    Science.gov (United States)

    Arzi, Boaz; Verstraete, Frank J M; Huey, Daniel J; Cissell, Derek D; Athanasiou, Kyriacos A

    2015-05-01

    To describe a surgical technique using a regenerative approach and internal fixation for immediate reconstruction of critical size bone defects after segmental mandibulectomy in dogs. Prospective case series. Dogs (n = 4) that had reconstruction after segmental mandibulectomy for treatment of malignant or benign tumors. Using a combination of extraoral and intraoral approaches, a locking titanium plate was contoured to match the native mandible. After segmental mandibulectomy, the plate was secured and a compression resistant matrix (CRM) infused with rhBMP-2, implanted in the defect. The implant was then covered with a soft tissue envelope followed by intraoral and extraoral closure. All dogs that had mandibular reconstruction healed with intact gingival covering over the mandibular defect and had immediate return to normal function and occlusion. Mineralized tissue formation was observed clinically within 2 weeks and solid cortical bone formation within 3 months. CT findings at 3 months showed that the newly regenerated mandibular bone had ∼50% of the bone density and porosity compared to the contralateral side. No significant complications occurred. Mandibular reconstruction using internal fixation and CRM infused with rhBMP-2 is an excellent solution for immediate reconstruction of segmental mandibulectomy defects in dogs. © Copyright 2014 by The American College of Veterinary Surgeons.

  8. Epithelioid sarcoma in FNAB smears.

    Science.gov (United States)

    Pohar-Marinsek, Z; Zidar, A

    1994-12-01

    FNAB smears of eleven epithelioid sarcomas were reviewed and analysed. Ten cases had a very similar cytomorphologic picture composed predominantly of dissociated epithelioid-like cells with eccentrically placed nuclei. These tumors were clearly malignant but difficult to differentiate morphologically from melanoma, epithelioid leiomiosarcoma, and Schwannoma or adenocarcinoma. One case was composed of spindle cells and was reminiscent of a fibrohistiocytic tumor. Immunocytochemical reactions to vimentin and cytokeratin were performed in six cases on the Papanicolaou stained smears. The reactions to both antigens were positive in all six cases. Ultrastructural characteristics of eight of the tumors are also described. It seems that epithelioid sarcoma has a rather distinct cytomorphologic picture. Taking into consideration clinical data and using also immunocytochemistry, a definitive diagnosis of epithelioid sarcoma can probably be given from FNAB smears.

  9. Skin Ultrasound in Kaposi Sarcoma.

    Science.gov (United States)

    Carrascosa, R; Alfageme, F; Roustán, G; Suarez, M D

    2016-05-01

    The use of ultrasound imaging has recently been increasing in numerous dermatologic diseases. This noninvasive technique provides additional details on the structure and vascularization of skin lesions. Kaposi sarcoma is a vascular tumor that typically arises in the skin and mucosas. It can spread to lymph nodes and internal organs. We performed B-mode and color Doppler ultrasound studies in 3 patients with a clinical diagnosis of Kaposi sarcoma confirmed by histological examination. We found differences in the ultrasound pattern between nodular and plaque lesions, in both B-mode and color Doppler. We believe that skin ultrasound imaging could be a useful technique for studying cutaneous Kaposi sarcoma, providing additional information on the structural and vascular characteristics of the lesion. Copyright © 2015 Elsevier España, S.L.U. y AEDV. All rights reserved.

  10. External and internal hemipelvectomy for sarcomas of the pelvic girdle : consequences of limb-salvage treatment

    NARCIS (Netherlands)

    Ham, SJ; Veth, RPH; van Horn, [No Value; Eisma, WH; Hoekstra, HJ; Schraffordt Koops, H.

    1997-01-01

    The outcome of different Limb-saving treatment modalities for pelvic girdle sarcoma is controversial. The oncological and functional results after 11 external and 10 internal hemipelvectomies and the consequences of limb-salvage treatment were studied in 21 consecutive patients with primary bone (19

  11. Diagnosis of bone metastasis from thyroid carcinoma: a multidisciplinary approach

    International Nuclear Information System (INIS)

    Bechsgaard, Thor; Lelkaitis, Giedrius; Jensen, Karl E; Ewertsen, Caroline

    2015-01-01

    Sarcomas are rare tumors originating from soft tissue or bone. Diagnosis and treatment of sarcomas should be performed at specialized sarcoma centers, where patients are evaluated at a multidisciplinary tumor conference. We present a case where sarcoma was suspected from magnetic resonance imaging (MRI), but histology revealed a metastasis from thyroid carcinoma, although the patient had no previous history of thyroid malignancy and resection of the thyroid gland was without malignancy. Ultrasound-guided biopsy was possible due to cortical destruction and the multidisciplinary approach with re-evaluation of previous pathology and a thorough patient history enabled a final diagnosis

  12. Pseudoanaplastic tumors of bone

    International Nuclear Information System (INIS)

    Bahk, Won-Jong; Mirra, Joseph M.

    2004-01-01

    To discuss the concept of pseudoanaplastic tumors of bone, which pathologically show hyperchromatism and marked pleomorphism with quite enlarged, pleomorphic nuclei, but with no to extremely rare, typical mitoses, and to propose guidelines for their diagnosis. From a database of 4,262 bone tumors covering from 1971 to 2001, 15 cases of pseudoanaplastic bone tumors (0.35% of total) were retrieved for clinical, radiographic and pathologic review. Postoperative follow-up after surgical treatment was at least 3 years and a maximum of 7 years. There were eight male and seven female patients. Their ages ranged from 10 to 64 years with average of 29.7 years. Pathologic diagnoses of pseudoanaplastic variants of benign bone tumors included: osteoblastoma (4 cases), giant cell tumor (4 cases), chondromyxoid fibroma (3 cases), fibrous dysplasia (2 cases), fibrous cortical defect (1 case) and aneurysmal bone cyst (1 case). Radiography of all cases showed features of a benign bone lesion. Six cases, one case each of osteoblastoma, fibrous dysplasia, aneurysmal bone cyst, chondromyxoid fibroma, giant cell tumor and osteoblastoma, were initially misdiagnosed as osteosarcoma. The remaining cases were referred for a second opinion to rule out sarcoma. Despite the presence of significant cytologic aberrations, none of our cases showed malignant behavior following simple curettage or removal of bony lesions. Our observation justifies the concept of pseudoanaplasia in some benign bone tumors as in benign soft tissue tumors, especially in their late evolutionary stage when bizarre cytologic alterations strongly mimic a sarcoma. (orig.)

  13. Pseudoanaplastic tumors of bone

    Energy Technology Data Exchange (ETDEWEB)

    Bahk, Won-Jong [Uijongbu St. Mary Hospital, The Catholic University of Korea, Department of Orthopaedic Surgery, Gyunggido, 480-821 (Korea); Mirra, Joseph M. [Orthopaedic Hospital, Orthopedic Oncology, Los Angeles, California (United States)

    2004-11-01

    To discuss the concept of pseudoanaplastic tumors of bone, which pathologically show hyperchromatism and marked pleomorphism with quite enlarged, pleomorphic nuclei, but with no to extremely rare, typical mitoses, and to propose guidelines for their diagnosis. From a database of 4,262 bone tumors covering from 1971 to 2001, 15 cases of pseudoanaplastic bone tumors (0.35% of total) were retrieved for clinical, radiographic and pathologic review. Postoperative follow-up after surgical treatment was at least 3 years and a maximum of 7 years. There were eight male and seven female patients. Their ages ranged from 10 to 64 years with average of 29.7 years. Pathologic diagnoses of pseudoanaplastic variants of benign bone tumors included: osteoblastoma (4 cases), giant cell tumor (4 cases), chondromyxoid fibroma (3 cases), fibrous dysplasia (2 cases), fibrous cortical defect (1 case) and aneurysmal bone cyst (1 case). Radiography of all cases showed features of a benign bone lesion. Six cases, one case each of osteoblastoma, fibrous dysplasia, aneurysmal bone cyst, chondromyxoid fibroma, giant cell tumor and osteoblastoma, were initially misdiagnosed as osteosarcoma. The remaining cases were referred for a second opinion to rule out sarcoma. Despite the presence of significant cytologic aberrations, none of our cases showed malignant behavior following simple curettage or removal of bony lesions. Our observation justifies the concept of pseudoanaplasia in some benign bone tumors as in benign soft tissue tumors, especially in their late evolutionary stage when bizarre cytologic alterations strongly mimic a sarcoma. (orig.)

  14. Gemcitabine Hydrochloride, Docetaxel, and Radiation Therapy in Treating Patients With Uterine Sarcoma That Has Been Removed By Surgery

    Science.gov (United States)

    2015-01-16

    Stage IA Uterine Sarcoma; Stage IB Uterine Sarcoma; Stage IC Uterine Sarcoma; Stage IIA Uterine Sarcoma; Stage IIB Uterine Sarcoma; Stage IIIA Uterine Sarcoma; Stage IIIB Uterine Sarcoma; Stage IIIC Uterine Sarcoma; Stage IVA Uterine Sarcoma; Stage IVB Uterine Sarcoma; Uterine Corpus Leiomyosarcoma

  15. Osteosarcoma (Osteogenic sarcoma

    Directory of Open Access Journals (Sweden)

    Picci Piero

    2007-01-01

    Full Text Available Abstract Osteosarcoma is a primary malignant tumour of the skeleton characterised by the direct formation of immature bone or osteoid tissue by the tumour cells. The classic osteosarcoma is a rare (0.2% of all malignant tumours highly malignant tumour, with an estimated incidence of 3 cases/million population/year. Osteosarcoma arises predominantly in the long bones and rarely in the soft tissues. The age at presentation ranges from 10 to 25 years of age. Plain radiographs, computed tomography, magnetic resonance imaging, angiography and dynamic bone scintigraphy are used for diagnosis, evaluation the extent of tumour involvement and decision of the type of operation and, if necessary, the type of reconstruction. Years ago, all patients with osteosarcoma were treated by amputation but the cure rate was under 10% and almost all patients died within a year from diagnosis. Today, for localised osteosarcoma at onset (80% of cases treated in specialized bone tumour centres with pre- and postoperative chemotherapy associated with surgery, the percentage of patients cured varies between 60% and 70%. Surgery is conservative (limb salvage in more than 90% of patients. Prognosis is more severe (cure rate about 30% for tumours located in the axial skeleton and in patients with metastasis at onset.

  16. Regenerating mandibular bone using rhBMP-2: part 1 - immediate reconstruction of segmental mandibulectomies

    OpenAIRE

    Arzi, Boaz; Verstraete, Frank J.M.; Huey, Daniel J.; Cissell, Derek D.; Athanasiou, Kyriacos A.

    2014-01-01

    © 2014 by The American College of Veterinary Surgeons. Objective: To describe a surgical technique using a regenerative approach and internal fixation for immediate reconstruction of critical size bone defects after segmental mandibulectomy in dogs. Study Design: Prospective case series. Animals: Dogs (n=4) that had reconstruction after segmental mandibulectomy for treatment of malignant or benign tumors. Methods: Using a combination of extraoral and intraoral approaches, a locking titanium p...

  17. [Epidemiology of bone and soft-part tumors of the foot and knee].

    Science.gov (United States)

    Delgado Cedillo, Ernesto Andrés; Rico Martínez, Genaro; Linares González, Luis Miguel; Estrada Villaseñor, Eréndira; León Hernández, Saúl Renán; Ble Campos, Raul

    2007-01-01

    Report of cases. Review of the cases in a period of 10 years with bone and soft tumors in foot and ankle, to knowing epidemilogical, clinic and patologic anatomy parameters to describe the behavior. Review of 166 cases from 1991 to 2000 and been analyze with descriptive statistic, association measurment for inside stratum, with odds ratio, hipótesis test with chi square for qualitative date and t to Student for quantitative date. 166 patients within 2 years to 78 years old, 81 with bone tumors and 79 with soft tumors, mostly benign, the most frequent was in the soft tissue ganglion and oseal benign exostosis in bone, 6 different malignant tumors, the principal affected zone were the toes, as a difference to literature, the most affected age group was 10 to 20 years followed to the 30 to 40 years old, we report 42 different patological diagnostics results to soft tissue and osseous tissue. clinical features is not a useful parameter to differentiate between malign or benign tumors and does not allow to establish the biological behavior, we propose the diagnostic algorithm that includes the intentional clinical probe, comparative X-ray in three projections with soft technique, in suspicion to malignant lesion may require CT scan, MRI, osseous scan and finally biopsy which will improve the final outcome.

  18. Postradiation sarcoma from a free flap.

    Science.gov (United States)

    Bingol, Ugur Anil; Arslan, Hakan; Cinar, Can

    2013-11-01

    Postradiation sarcomas constitute approximately 0.5% to 5.5% of all sarcomas. They develop locally approximately 3 to 20 years after the administration of radiotherapy (RT). They are generally high-grade tumors. Osteosarcomas, fibrosarcomas, malignant fibrous histiocytoma, angiosarcomas, and leiomyosarcomas are the most frequently observed. It is rare for these tumors to originate from free flaps, and this patient report is one of the first in the literature. A 59-year-old man was operated on because of ethmoid sinus cancer in 2004, and the reconstruction was performed with a rectus abdominis free muscle flap. He received postoperative RT and subsequently presented to our clinic with a medially protruding mass on his upper jaw. A biopsy was performed. Its pathologic diagnosis was reported as malignant mesenchymal tumor. Computed tomography and magnetic resonance imaging were performed, demonstrating that the mass originated from the free muscle flap (m. rectus abdominis) at the front wall of the sphenoid sinus. A total excision of the free muscle flap and near-total maxillectomy were performed. The pathologic finding was reported as leiomyosarcoma with bone invasion. With the advancement of medical and pharmaceutical technologies, our patient's life expectancy is increasing. In long-living patients who have received RT, tumors can develop 20 years after the RT. The close follow-up of patients receiving RT is of utmost importance because treatment survival is linked to early diagnosis and resection with negative surgical margins. We must not forget that, even if years have passed since receiving RT, these patients may present with such tumors.

  19. Radiation-induced systemic and local bone tumors: Two types of late effects with possible different origins?

    International Nuclear Information System (INIS)

    Mueller, W.A.; Luz, A.; Linzner, U.

    1994-01-01

    Bone sarcomas may be induced throughout the skeleton (systemic) in mice by relatively low internal α-particle doses that are distributed over the whole skeleton. The induction of local (periosteal) bone sarcomas after paratibial deposition of insoluble radiocolloids required much higher doses, and in addition high energies of emitted particles. Paratibial deposition of α-particle-emitting radiocolloids of 227 Th and 228 Th resulted in formation of both local and systemic bone sarcomas. The latter were most probably induced by the released radium daughters of the thorium isotopes and were distributed about the skeleton. Paratibial injections with β-particle emitters 144 Ce+ 144 Pr (29 kBq per mouse) showed an incidence of local bone sarcomas of more than 80%. An estimation of the local effective doses led to values of more than 1000 Gy for the β-particle emitter 144 Ce and around 150 Gy for the thorium isotopes. Thus induction of local bone sarcomas required doses considerably greater than those needed for systemic bone sarcomas. The local induction of bone sarcomas has been reported for high-energy β particles using similar high doses of 144 Ce+ 144 Pr in rats and for external 90 Sr+ 90 Y irradiation in mice. We conclude that the processes involved in the induction of local and systemic bone sarcomas by radiation may be quite different. 35 refs., 1 fig., 3 tabs

  20. Radiation-induced systemic and local bone tumors: two types of late effects with possible different origins?

    Science.gov (United States)

    Müller, W A; Luz, A; Linzner, U

    1994-06-01

    Bone sarcomas may be induced throughout the skeleton (systemic) in mice by relatively low internal alpha-particle doses that are distributed over the whole skeleton. The induction of local (periosteal) bone sarcomas after paratibial deposition of insoluble radiocolloids required much higher doses, and in addition high energies of emitted particles. Paratibial deposition of alpha-particle-emitting radiocolloids of 227Th and 228Th resulted in formation of both local and systemic bone sarcomas. The latter were most probably induced by the released radium daughters of the thorium isotopes and were distributed about the skeleton. Paratibial injections with beta-particle emitters 144Ce+ 144Pr (29 kBq per mouse) showed an incidence of local bone sarcomas of more than 80%. An estimation of the local effective doses led to values of more than 1000 Gy for the beta-particle emitter 144Ce and around 150 Gy for the thorium isotopes. Thus induction of local bone sarcomas required doses considerably greater than those needed for systemic bone sarcomas. The local induction of bone sarcomas has been reported for high-energy beta particles using similar high doses of 144Ce+ 144Pr in rats and for external 90Sr+ 90Y irradiation in mice. We conclude that the processes involved in the induction of local and systemic bone sarcomas by radiation may be quite different.

  1. Para-oesophageal synovial sarcoma

    International Nuclear Information System (INIS)

    Pulpeiro, J.R.; Cruz, R.; Arenas, A.; Perez-Espejo, G.

    1988-01-01

    An unusual case of mediastinal synovial sarcoma with secondary invasion of the oesophagus simulating an intra-oesophageal mass is reported. The location and radiological appearance of this tumour are exceptional, and, to the authors' knowledge, have not been reported previously. (orig.)

  2. Sarcomas: etiología y síntomas

    Directory of Open Access Journals (Sweden)

    Roberto Gabriel Albín Cano

    2012-05-01

    Full Text Available Debido a la amplia diversidad de sarcomas, casi son inexistentes los textos que incluyen todas las variedades de este tipo de cáncer. Generalmente, su descripción y revisión se incluyen en las del sistema de órganos afectados específicamente, y la literatura que los aborda está muy fragmentada en las diferentes especialidades médicas. Se realiza una revisión bibliográfica sobre la etiología y síntomas de la mayor parte de los diferentes tipos de sarcomas. Es objetivo de esta revisión, lograr unir la información más actual disponible acerca de la etiología y síntomas de los sarcomas. Se han identificado diferentes factores de riesgo y factores etiológicos, tanto genéticos, infecciosos, como ambientales. Los grandes descubrimientos en relación con los mecanismos genéticos involucrados en los diferentes tipos de sarcoma, han abierto un camino de inestimable valor para introducir nuevos tratamientos, que incluyen ensayos con anticuerpos monoclonales y nuevos fármacos de terapia génica.

  3. NY-ESO-1 expression in synovial sarcoma and other mesenchymal tumors: significance for NY-ESO-1-based targeted therapy and differential diagnosis.

    Science.gov (United States)

    Lai, Jin-Ping; Robbins, Paul F; Raffeld, Mark; Aung, Phyu Phyu; Tsokos, Maria; Rosenberg, Steven A; Miettinen, Markku M; Lee, Chyi-Chia Richard

    2012-06-01

    A promising targeted therapy against NY-ESO-1 (CTAG 1B) using genetically modified T-cells in synovial sarcomas was recently demonstrated in a clinical trial at the NCI. To investigate the role of NY-ESO-1 immunohistochemistry in patient selection and gain better insight into the incidence of NY-ESO-1 expression in synovial sarcomas and other mesenchymal tumors, we evaluated NY-ESO-1 expression by immunohistochemistry in 417 tumors. This collection of samples included: 50 SS18/SSX1/2 fusion positive synovial sarcomas, 155 gastrointestinal stromal tumors (GIST), 135 other spindle cell sarcomas as well as 77 other sarcomas (chondrosarcoma, osteosarcoma, dedifferentiated liposarcoma, alveolar soft part sarcoma, rhabdomyosarcoma, angiosarcoma, malignant mesothelioma, and Ewing's sarcoma). We report that 76% of synovial sarcomas expressed NY-ESO-1 in a strong and diffuse pattern (2-3+, >50-70% of tumor cells). In contrast, only rare cases of other spindle cell mesenchymal tumor expressed NY-ESO-1 (GIST (2/155), malignant peripheral nerve sheath tumors (1/34), and dermatofibrosarcoma protuberans (2/20)). Individual cases of other sarcomas (angiosarcoma, malignant mesothelioma, chondrosarcoma, osteosarcoma, dedifferentiated liposarcoma, alveolar soft part sarcoma, and Ewing's sarcoma) were positive for NY-ESO-1. However, no positive cases were identified amongst our cohort of leiomyosarcomas (0/24), hemangiopericytoma/solitary fibrous tumors (0/40), and cellular schwannomas (0/17). In summary, we find that NY-ESO-1 is strongly and diffusely expressed in a majority of synovial sarcomas, but only rarely in other mesenchymal lesions. Beyond its role in patient selection for targeted therapy, immunohistochemistry for NY-ESO-1 may be diagnostically useful for the distinction of synovial sarcoma from other spindle cell neoplasms.

  4. Extra-skeletal Ewing's sarcoma resembling acute abdomen. Case report.

    Science.gov (United States)

    Valdivia Gómez, Gilberto Guzmán; Soto Guerrero, María Teresa; Cedillo de la Cruz, María Isabel

    2010-01-01

    Extraosseous Ewing's sarcoma is a rare tumor of neuroectodermal origin. It presents mainly in the soft tissue of the extremities and thorax. Histologically, it is similar to Ewing's sarcoma of the bone. We present the case of a male who arrived at the emergency room with acute abdomen, leucocytosis and imaging techniques (abdominal ultrasound and computed tomography) suggestive of complicated diverticular disease. He was treated with emergency surgery. Intraoperative findings were an unsuspected tumor (20 x 15 x 15 cm). Treatment consisted of extirpation of the tumor, separating it from the adjacent viscera and followed by chemotherapy based on epirubicin, cyclophosphamide and vincristine for six cycles. Because the control abdominal CT demonstrated tumor activity in the retroperitoneum adjacent to the ascending colon and cecum, further resection was decided upon. In a review of the literature, no previous reports of extraosseous Ewing's sarcoma were found presenting as acute abdomen. Due to the rarity of this tumor, only case reports or series have been found in the literature without randomized or comparative studies. Surgery was the cornerstone of treatment, without reports of preoperative chemotherapy. If the patient's condition permits, percutaneous needle biopsy is mandatory to obtain optimum treatment as well as to improve prognosis.

  5. Sarcomas primarios de mama Primary sarcomas of the breast

    Directory of Open Access Journals (Sweden)

    Ana M. Chirife

    2006-04-01

    Full Text Available Los sarcomas primarios de mama son extremadamente raros y representan menos del 1% de los tumores mamarios comunicados en la literatura. Entre los años 1999 y 2004 se diagnosticaron en nuestra institución 1315 tumores malignos de mama, entre ellos nueve correspondieron a sarcomas primarios: tres angiosarcomas, un leiomiosarcoma, un sarcoma fibromixoide de bajo grado, un dermatofibrosarcoma, un liposarcoma, un osteosarcoma y un tumor maligno de la vaina de los nervios periféricos. Se revisaron los preparados histológicos, teñidos con técnicas de rutina y de inmunoperoxidasa, estableciéndose la fracción de crecimiento (FC y sobre-expresión de proteína p53. Se estudiaron también las historias clínicas de las pacientes para determinar tipos de evolución (favorable y desfavorable. La incidencia observada (0.7% es similar a las ya publicadas por otros autores. La FC se correlacionó con la evolución, siendo un factor pronóstico desfavorable cuando fue mayor o igual al 30%. La mayoría de los tumores (67% mostró sobre-expresión de proteína p53 (mayor o igual al 20% de tinción nuclear pero esto no demostró tener una relación directa con la evolución de cada neoplasia.Primary sarcomas of the breast are extremely rare with less than 1% of all malignant tumours of the breast reported in literature. At our Institution 1315 malignant tumours of the breast were diagnosed between 1999-2004; nine of them corresponded to primary sarcomas: angiosarcoma (3, leiomyosarcoma (1, low-grade fibromyxoid sarcoma (1, dematofibrosarcoma protuberans (1, liposarcoma (1, osteosarcoma (1, malignant peripheral nerve sheath tumour (1. Histopathological specimens stained with routine techniques and immunoperoxidase were reviewed; proliferation index and p53 over-expression were also determined. Patients´ clinical reports were also reviewed to determine prognosis (favorable and unfavorable. The incidence observed (0.7% is similar to those already published

  6. A Case Report of Disseminated Canine Histiocytic Sarcoma in Trinidad and Tobago.

    Science.gov (United States)

    Rajh, Stacy; Acevedo, Karelma Frontera; Williams, Gillian; Pargass, Indira; Bally, Alissa; Suepaul, Rod

    2018-01-19

    Ocular histiocytic sarcomas (as a presenting part of disseminated histiocytic sarcoma) are not commonly diagnosed. A 10-year-old female intact Rottweiler presented to the School of Veterinary Medicine, Trinidad with buphthalmia and pain in the left eye. The cornea of the left eye appeared diffusely opaque with a conjunctival mucopurulent ocular discharge. A thorough ophthalmic assessment identified an intraocular proliferative tumor to which a unilateral enucleation was performed, however the animal died soon after. Post mortem examination and light microscopy revealed that the intraocular lesion with visceral macro-metastases was in fact a histiocytic sarcoma. Further to this, immune-phenotyping was performed to confirm the diagnosis of disseminated histiocytic sarcoma. This is the first time such a tumor has been diagnosed in Trinidad and Tobago.

  7. High Efficacy of Preoperative Low-Dose Radiotherapy with Sanazole (AK-2123 for Extraskeletal Ewing's Sarcoma: A Case Report

    Directory of Open Access Journals (Sweden)

    Tomoya Sakabe

    2011-01-01

    Full Text Available Extraskeletal Ewing's sarcoma is a rare soft tissue tumor that is morphologically indistinguishable from Ewing's sarcoma of bone. We report a case of extraskeletal Ewing's sarcoma with several systemic problems. A 69-year-old man presented with a 5-month history of a rapidly enlarging mass in the right thigh. Because preoperative radiotherapy with sanazole (AK-2123 contributed the tumor mass reduction down to 40% in size, the tumor was successfully resected with clear surgical margins and repaired with a musculocutaneous flap. The high efficacy of pre-operative low-dose radiotherapy with sanazole was histologically confirmed that the resected tumor specimen involved no viable tumor cells and showed 100% necrosis. Based on clinical outcomes in this case, the combined modality of pre-operative low-dose radiotherapy with hypoxic cell radiosensitizer and adequate surgical resection might provide for the useful clinical application of extraskeletal Ewing's sarcoma treatment.

  8. Calcium Phosphate Bone Cements Including Sugar Surfactants: Part Two-Injectability, Adhesive Properties and Biocompatibility.

    Science.gov (United States)

    Bercier, Ariane; Gonçalves, Stéphane; Autefage, Helène; Briand-Mesange, Fabienne; Lignon, Olivier; Fitremann, Juliette

    2010-12-02

    Addition of sugar surfactants, sucrose fatty acid esters and alkylpolyglucosides to a calcium phosphate cement, designed for bone reconstruction, is described. Thanks to their adsorption at the surface of the calcium phosphate particles, the sugar surfactants allowed a full injectability and brought a very good workability. Injectability was measured by monitoring force-distance curves. With some of the selected sugar surfactants adhesive properties of the cement pastes were also observed, which were measured by tack tests. Finally, some properties related to biological applications are described, including gentamicine release and osteoblast viability experiments. The whole study demonstrates that addition of these mild surfactants improved several properties of the calcium phosphate cement, without impairing function.

  9. Calcium Phosphate Bone Cements Including Sugar Surfactants: Part Two—Injectability, Adhesive Properties and Biocompatibility

    Directory of Open Access Journals (Sweden)

    Fabienne Briand-Mesange

    2010-12-01

    Full Text Available Addition of sugar surfactants, sucrose fatty acid esters and alkylpolyglucosides to a calcium phosphate cement, designed for bone reconstruction, is described. Thanks to their adsorption at the surface of the calcium phosphate particles, the sugar surfactants allowed a full injectability and brought a very good workability. Injectability was measured by monitoring force-distance curves. With some of the selected sugar surfactants adhesive properties of the cement pastes were also observed, which were measured by tack tests. Finally, some properties related to biological applications are described, including gentamicine release and osteoblast viability experiments. The whole study demonstrates that addition of these mild surfactants improved several properties of the calcium phosphate cement, without impairing function.

  10. Epithelioid sarcoma: clinical, MR imaging and pathologic findings

    International Nuclear Information System (INIS)

    Hanna, S.L.; Kaste, S.; Jenkins, J.J.; Hewan-Lowe, K.; Spence, J.V.; Gupta, M.; Monson, D.; Fletcher, B.D.

    2002-01-01

    Objective. To report and describe the MR imaging features of eight new cases of this rare soft tissue sarcoma and correlate them with the clinical and histologic findings.Design and patients. Retrospective analysis was carried out for the MR imaging characteristics and histologic findings of eight patients with pathologically proven epithelioid sarcoma and the literature was reviewed. Findings were correlated in each case with the patient's clinical presentation and eventual outcome.Results. The patients, whose primary tumors ranged from 2.5 cm to 19 cm in maximum dimension, were 1 to 90 years of age. Tumors involved the extremities (n=5), the scalp (n=2) and the paraspinal muscles (n=1). Five tumors presented as well-defined, frequently painful, deeply situated masses and three as subcutaneous nodules or cutaneous ulcers with no palpable mass. Four patients had associated regional lymphadenopathy and one had distant metastases at diagnosis. MR imaging showed tumor infiltration of adjacent tissues in seven patients. Signal characteristics reflected varying degrees of cellularity, and the presence of necrosis, hemorrhage, fibrosis, hyalinization and inflammation. Bone marrow involvement was demonstrated in one patient. Clinical outcomes were generally poor.Conclusions. Epithelioid sarcoma is an aggressive soft tissue sarcoma with a varied clinical presentation, growth pattern, MR signal characteristics and histologic picture. The tumor favors the distal extremities and is commonly infiltrative and accompanied by enlarged regional lymph nodes. This neoplasm may present as an intramuscular mass but should also be suspected in patients with ulcerating cutaneous nodules with or without regional lymphadenopathy. (orig.)

  11. Procholecystokinin as marker of human Ewing sarcomas

    DEFF Research Database (Denmark)

    Reubi, Jean Claude; Koefoed, Pernille; Hansen, Thomas von O

    2004-01-01

    PURPOSE: Ewing sarcoma is a rapidly growing mesenchymal tumor in young adults. Although it was shown previously to express the cholecystokinin (CCK) gene, it is unknown whether CCK gene expression is detectable at protein level in Ewing sarcoma tumor cell lines, in tumor tissue, and in plasma from...... Ewing sarcoma patients, and, if so, whether CCK peptides might play a role as tumor markers. EXPERIMENTAL DESIGN: CCK gene expression was evaluated with in situ hybridization or reverse transcription-PCR in tumor tissue. CCK precursors and bioactive CCK were measured with specific RIAs in tumor tissue......, in cell culture medium, and in plasma of Ewing sarcoma patients before and after chemotherapy as well as after tumor recurrence. RESULTS: CCK mRNA was identified in 12 Ewing sarcoma biopsies sampled in two series and in four Ewing sarcoma cell lines but not in unrelated neoplasia. Immunoreactive pro...

  12. Transition of endometrial stromal sarcoma into high-grade sarcoma.

    Science.gov (United States)

    Amant, Frederic; Woestenborghs, Heidi; Vandenbroucke, Vanessa; Berteloot, Patrick; Neven, Patrick; Moerman, Philippe; Vergote, Ignace

    2006-12-01

    Endometrial stromal sarcoma typically is of low grade and hormone-sensitive. Although these characteristics result in an indolent behavior, little data are available on the evolution over time. We report on two cases where microscopic and immunohistochemic assessment of the tumor on several occasions during 8 and 25 years of follow up enabled us to document a transition of a low-grade into a high-grade malignancy. These were mainly characterized by increased cellular atypia, absence of spiral arterioles and an increased mitotic index and proliferation index (MIB1). Since this transition was related to clinical loss of hormone sensitivity, the therapeutic approach consisting of hormonal treatment in combination with repetitive surgery was switched to chemotherapy only. These long-term follow up data provide insight in endometrial stromal sarcoma tumor biology and highlight the importance of sampling recurrent tumors to estimate biologic behavior in order to tailor subsequent treatment.

  13. Primary bone tumours in infants

    Energy Technology Data Exchange (ETDEWEB)

    Kozlowski, K.; Beluffi, G.; Cohen, D.H.; Padovani, J.; Tamaela, L.; Azouz, M.; Bale, P.; Martin, H.C.; Nayanar, V.V.; Arico, M.

    1985-09-01

    Ten cases of primary bone tumours in infants (1 osteosarcoma, 3 Ewing's sarcoma, 1 chondroblastoma and 5 angiomastosis) are reported. All cases of angiomatosis showed characteristic radiographic findings. In all the other tumours the X-ray appearances were different from those usually seen in older children and adolescents. In the auhtors' opinion the precise diagnosis of malignant bone tumours in infancy is very difficult as no characteristic X-ray features are present in this age period.

  14. The Role of Next-Generation Sequencing in Sarcomas: Evolution From Light Microscope to Molecular Microscope.

    Science.gov (United States)

    Groisberg, Roman; Roszik, Jason; Conley, Anthony; Patel, Shreyaskumar R; Subbiah, Vivek

    2017-10-13

    Sarcomas are rare, heterogeneous group of soft tissue and bone tumors. Precise diagnosis of specific subtypes is challenging using conventional methods. Herein, we review the role of next-generation sequencing (NGS) technology that is used for rapid sequencing of DNA and RNA. Recent sarcoma specific studies recommend that molecular genetic testing should be added at diagnosis for appropriate clinical management in addition to diagnosis by expert pathologists. NGS has already been used to identify potentially actionable mutations, copy number alterations, and gene fusions. Rationally, choosing a drug based on an individual patient profile aka: "precision oncology" has been so far limited to few case reports in sarcomas. As we improve our ability to deliver personalized medicine using all modalities including conventional therapy, more patients may eventually benefit. As the cost and capacity of NGS outpace Moore's law, so does the probability of success.

  15. Intraneural synovial sarcoma of the median nerve

    Directory of Open Access Journals (Sweden)

    Rahul Kasukurthi

    2010-06-01

    Full Text Available Synovial sarcomas are soft-tissue malignancies with a poor prognosis and propensity for distant metastases. Although originally believed to arise from the synovium, these tumors have been found to occur anywhere in the body. We report a rare case of synovial sarcoma arising from the median nerve. To our knowledge, this is the twelfth reported case of intraneural synovial sarcoma, and only the fourth arising from the median nerve. Because the diagnosis may not be apparent until after pathological examination of the surgical speci­men, synovial sarcoma should be kept in mind when dealing with what may seem like a benign nerve tumor.

  16. Stages of Uterine Sarcoma

    Science.gov (United States)

    ... diagnosed, tests are done to find out if cancer cells have spread within the uterus or to other parts of the body. The process used to find out if cancer has spread within the uterus or to other parts of the body is ...

  17. Diagnostic difficulties and delays with chest wall chondrosarcoma: a Swedish population based Scandinavian Sarcoma Group study of 106 patients.

    Science.gov (United States)

    Widhe, Björn; Bauer, Henrik C F

    2011-04-01

    Bone sarcomas in Sweden are generally referred to a multidisciplinary team at specialized sarcoma centers. This practice is strictly followed for sarcomas of long bones, but not for chest wall chondrosarcomas. Delay in diagnosis and treatment is often considerable for bone sarcomas. This report focuses on the symptoms and diagnostic problems of chest wall chondrosarcoma and factors related to long doctor's delay. The material included all 106 consecutive patients with chondrosarcoma of the chest wall diagnosed in Sweden 1980-2002. Pathological specimens were re-evaluated and graded by the Scandinavian Sarcoma Group pathology board. Files from the very first medical visit for symptoms related to the chondrosarcoma were traced and used to characterize the initial symptoms and calculate patient's and doctor's delay. The most prominent initial symptom for the chest wall chondrosarcomas was a palpable mass found in 69% (73/106) of the patients at the first visit. Two-thirds of the patients experienced no local chest pain. A tumor was suspected at the first visit in 83% of the patients. Patients delay was median 3 (0-118) months and doctor's delay was 4.5 (0.1-197) months. Doctor's delay was >6 months for 40% of the patients. Patients with an initial plain chest radiograph interpreted as normal (35 patients), and/or normal or inconclusive results of a fine-needle aspiration biopsy had longer doctor's delay. Fine-needle aspiration cytology done at non-specialty units resulted in only 26% correct malignant diagnoses; at sarcoma centers 94% were correctly diagnosed. Long total delay was unfavorable. Patients who died from the chondrosarcoma had longer total delay (pChest wall chondrosarcoma presents as a lump, usually painless. Plain chest radiographs and fine-needle aspiration cytology, when done at a non-specialty center, are often normal or inconclusive. Patients should be referred to sarcoma centers for diagnosis and treatment.

  18. Fibromyxoid sarcoma of the pancreas

    Directory of Open Access Journals (Sweden)

    Čolović Radoje

    2008-01-01

    Full Text Available Introduction Fibromyxoid sarcoma is a rare mesenchymal neoplasm, usually appearing in the soft tissue of the extremities, less frequently in the groin, trunk, neck, and upper extremities. Within the abdomen, the tumour is usually localised within the retroperitoneum. Case OutlineWe present a 56-year-old woman in whom, during the routinely performed investigation for atacks of choking with lots of bronchial secretion, and arterial hypertension, an ultrasonographer found a tumour within the head of the pancreas 6×6 cm in diameter. At operation, a dark pink, lobulated soft tumour, surrounded by a tiny capsule, clearly different from the completely normal pancreatic tissue of the posterior side of the head of the pancreas, was easily and ideally excised.The postoperative recovery was stormy. She developed postoperative pancreatitis, temporary biliary and duodenal fistula, which all settled by conservative treatment. The histology of the 80 g weighing tumour showed a circumscribed fibromyxoid sarcoma of low malignancy. Immunohistochemistry showed diffuse vimentin and CD34 strong positivity, as well as focal anti-SMA and anti-EMA immunopositivity. Six months after surgery, she died with signs of cerebrovascular insult, asthmatic status, and recurrent suppurative abdominal fistula, probably related to the previous pancreatitis. Ultrasonography showed a possible liver secondary. The exact cause of death was not confirmed as the autopsy was refused by the family. Conclusion Primary sarcomas of the pancreas are very rare, but should be considered in differential diagnosis of pancreatic neoplasms. To the best of our knowledge, there has been no previously described fibromyxoid sarcoma of the pancreas. .

  19. Lipo sarcoma in small intestine

    International Nuclear Information System (INIS)

    Rodriguez Iglesias, J.; Pineyro Gutierrez, A.; Taroco Medeiros, L.; Fein Kolodny, C.; Navarrete Pedocchi, H.

    1987-01-01

    A case is presented by primitive liposarcoma in small intestine , an extensive bibliographical review foreigner and national in this case. It detach the exceptional of the intestinal topography of the liposarcomas; and making stress in the relative value of the computerized tomography and ultrasonography in the diagnose of the small intestine tumors . As well as in the sarcomas of another topography, chemo and radiotherapy associated to the exeresis surgery, it can be of benefit [es

  20. Synovial sarcoma of the foot

    International Nuclear Information System (INIS)

    Beus, J.; Kreitner, K.F.; Rompe, J.D.; Riehle, H.M.

    1996-01-01

    The case of a 29 year-old female patient who had experienced pain in the right midfoot for 5 years which was diagnosed as a degenerative or rheumatic change and treated by physiotherapy and medication. By means of magnetic resonance imaging we identified a soft-tissue tumor of the midfoot. Histology provided the findings of a monophasic fibrous synovial sarcoma. The case history is reported together with a presentation of the disease and its radiological diagnosis. (orig.) [de

  1. Ewing sarcoma of the left big toe with trans-articular skip lesion

    Directory of Open Access Journals (Sweden)

    Ahmad F. Kamal

    2009-06-01

    Full Text Available We report the case of the patient who had Ewing Sarcoma in whom radiological and hystopathological appearances revealed a tumor mass in the left big toe along with trans-artikular skip lesion on the left diaphysis of tibia. In Cipto Mangunkusomo Hospital since 1995 until 2004 we have found 20 Ewing sarcoma cases, but only one skip lesion Ewing sarcoma was found. The diagnosis of transarticular skip lesion in association of Ewing sarcoma was confirmed in clinicopathological conferrence. The initial evaluation of all patients included the recording of the medical history, physical examination, and hematological studies. Radiographs of the chest and the site of the primary tumor were made routinely. Systemic staging was performed with use of total-body bone scan. Ray amputation of left big toe and open biopsy from mass of mid-shaft of tibia had been done to confirm the diagnosis. The patient underwent induction chemotherapy and above knee amputation. Ten months after diagnosis, he died because of advanced-distant metastasis. (Med J Indones 2008; 18: 139-44Key words: Ewing sarcoma, trans-articular skip lesion

  2. Definitive Brachytherapy for Kaposi's Sarcoma

    International Nuclear Information System (INIS)

    Williams, A.; Ezzell, G.; Zalupski, M.; Fontanesi, J.

    1996-01-01

    Purpose: To assess the efficacy and possible complications in patients diagnosed with Kaposi's sarcoma and treated with definitive brachytherapy. Methods and Materials: Between January, 1995 and December, 1995, four patients with Kaposi's sarcoma (KS) were treated with brachytherapy. Three patients, all with positive HIV status were treated using Iridium 192 (Ir-192) sources via a high-dose rate remote afterloader. One patient with endemic KS was treated using the application of catheters loaded with Californium 252. Eight sites were treated and included scalp, feet, nose, penis, hand, neck, and back. Dose rate for Ir-192 was 330cGy/fx to a total dose of 990cGy. The Californium was delivered as 100nGy/b.i.d. to a total dose of 900nGy. Follow-up as ranged from 2-6 months. Results: All four patients remain alive. Seven of eight sites have had complete clinical response and each patient has reported durable pain relief that has not subsided through last follow-up of 1/96. Two of eight sites, both treated with surface mold technique with Californium 252 developed moist desquamation. The remaining six sites did not demonstrate significant toxicity. Conclusion: Brachytherapy can offer Kaposi's sarcoma patients results that are equivalent to external beam radiation therapy, with minimal complications, a shorter treatment time and potential cost effectiveness

  3. The Findings of 99mTc-MDP Bone Scan in Primary malignant Bone Tumors

    International Nuclear Information System (INIS)

    Hyun, In Young; Lee, Kung Han; Lee, Dong Soo; Chung, June Key; Lee, Myung Chul; Koh, Chang Soon; Kang, Heung Sik; Lee, Sang Hoon; Lee, Han Koo

    1995-01-01

    Tc-99m-MDP bone scan was performed in 31 patients with primary malignant bone tumors, 22 patients with osteogenic sarcoma, 5 patients with chondrosarcoma and 4 patients with Ewing's sarcoma. The findings were classified by isotope intensity of accumulation in tumor as grade 1 to 3, overall pattern of isotope distribution in tumor as grade 1 to 3, and distortion of bony outline as grade 1 to 3. Histologic classifications were correlated with scan findings in 22 patients with osteogenic sarcoma. The results were as follows. 1) In 22 patients with osteogenic sarcoma, markedly increased isotope intensity higher than sacroiliac joint with patchy areas of decreased intensity and severe bony distortion were found in 16 patients. The correlations between histologic classification and scan findings were not discovered. 2) In 5 patients with chondrosarcoma, mildly increased isotope intensity with patchy areas of increased intensity and mild bony distortion were found in 4 patients. 3) In 4 patients with Ewing's sarcoma, markedly increased homogenous intensity with moderate bony distortion were found in 3 patients. Conclusively there were common findings in each 3 primary malignant bone tumors and Tc-99m-MDP bone scan was complemented with radiologic studies in differentiating primary malignant bone tumors.

  4. Preclinical activity of selinexor, an inhibitor of XPO1, in sarcoma.

    Science.gov (United States)

    Nakayama, Robert; Zhang, Yi-Xiang; Czaplinski, Jeffrey T; Anatone, Alex J; Sicinska, Ewa T; Fletcher, Jonathan A; Demetri, George D; Wagner, Andrew J

    2016-03-29

    Selinexor is an orally bioavailable selective inhibitor of nuclear export that has been demonstrated to have preclinical activity in various cancer types and that is currently in Phase I and II clinical trials for advanced cancers. In this study, we evaluated the effects of selinexor in several preclinical models of various sarcoma subtypes. The efficacy of selinexor was investigated in vitro and in vivo using 17 cell lines and 9 sarcoma xenograft models including gastrointestinal stromal tumor (GIST), liposarcoma (LPS), leiomyosarcoma, rhabdomyosarcoma, undifferentiated sarcomas, and alveolar soft part sarcoma (ASPS). Most sarcoma cell lines were sensitive to selinexor with IC50s ranging from 28.8 nM to 218.2 nM (median: 66.1 nM). Selinexor suppressed sarcoma tumor xenograft growth, including models of ASPS that were resistant in vitro. In GIST cells with KIT mutations, selinexor induced G1- arrest without attenuation of phosphorylation of KIT, AKT, or MAPK, in contrast to imatinib. In LPS cell lines with MDM2 and CDK4 amplification, selinexor induced G1-arrest and apoptosis irrespective of p53 expression or mutation and irrespective of RB expression. Selinexor increased p53 and p21 expression at the protein but not RNA level, indicating a post-transcriptional effect. These results indicate that selinexor has potent in vitro and in vivo activity against a wide variety of sarcoma models by inducing G1-arrest independent of known molecular mechanisms in GIST and LPS. These studies further justify the exploration of selinexor in clinical trials targeting various sarcoma subtypes.

  5. AZD0530 in Treating Patients With Recurrent Locally Advanced or Metastatic Soft Tissue Sarcoma

    Science.gov (United States)

    2015-07-02

    Adult Fibrosarcoma; Adult Leiomyosarcoma; Adult Liposarcoma; Adult Malignant Fibrous Histiocytoma; Adult Rhabdomyosarcoma; Dermatofibrosarcoma Protuberans; Endometrial Stromal Sarcoma; Recurrent Adult Soft Tissue Sarcoma; Recurrent Uterine Sarcoma; Stage III Adult Soft Tissue Sarcoma; Stage III Uterine Sarcoma; Stage IV Adult Soft Tissue Sarcoma; Stage IV Uterine Sarcoma; Uterine Carcinosarcoma; Uterine Leiomyosarcoma

  6. Langerhan’s cell sarcoma: two case reports

    Directory of Open Access Journals (Sweden)

    Tasneem A. Kaleem

    2016-04-01

    Full Text Available Langerhan’s cell sarcoma (LCS is a rare neoplasm with a poor prognosis. To our knowledge, only sixty-six cases have been published. We discuss two patients who presented very differently with LCS, as well as a recently published review of all sixty-six cases. Our first case had a complicated history of metastatic, high-grade myxofibrosarcomas and presented with a single skin lesion of LCS which was treated with resection to a positive margin and adjuvant radiotherapy. The LCS recurred locoregionally and was again resected. The patient is alive two years after initial diagnosis. The second case presented with bone marrow and splenic involvement, leukocytosis, and thrombocytopenia. This patient had an excellent response to etoposide, prednisone, oncovorin, cyclophosphamide, and adriamycin, with normalization of the complete blood count, negative bone marrow biopsy at follow up, and splenectomy without viable neoplasm. This patient is alive without signs of disease at 16 months after initial diagnosis.

  7. Sarcoma auricular izquierdo pleomórfico

    Directory of Open Access Journals (Sweden)

    Enrique Fulquet

    2006-07-01

    El estudio anatomopatológico muestra sarcoma de alto grado, áreas extensas de necrosis y un patrón variable de diferenciación. Se diagnostica sarcoma miofibroblástico con áreas diferenciadas de tumor de células gigantes (Fig. 2, izquierda y condrosarcoma (Fig. 2, derecha.

  8. Orbital Epithelioid Sarcoma: A Case Report

    NARCIS (Netherlands)

    Jurdy, Lama L.; Blank, Leo E.; Bras, Johannes; Saeed, Peerooz

    2016-01-01

    Epithelioid sarcoma is a rare but often aggressive malignancy of soft tissue that usually occurs in young adults as a superficial lesion in the distal upper limbs. To date, there are only 4 case reports of epithelioid sarcoma primarily occurring in the orbit. Two of these patients were treated with

  9. Cervical Synovial Sarcoma In a Young Boy

    African Journals Online (AJOL)

    Cervical Synovial Sarcoma. •. In a Young Boy. R. M. FISHER,. SUMMARY. Synovial sarcomas comprise about 8% of all tumours of somatic soft-tissues, and are the most common sar- comas of the 'hands and feet. Occasionally they may occur in the trunk, but they have rarely been reported in the neck. We present a case of ...

  10. Testicular granulocytic sarcoma without systemic leukemia

    NARCIS (Netherlands)

    Lagerveld, B. W.; Wauters, C. A. P.; Karthaus, H. F. M.

    2005-01-01

    This case report describes a unilateral testicular granulocytic sarcoma or chloroma. Because of the relatively immature nature of the tumor cells, the histological diagnosis can be difficult. Granulocytic sarcomas are well known in patients with systemic leukemia and can sometimes precede a systemic

  11. Iatrogenic colorectal Kaposi sarcoma complicating a refractory ...

    African Journals Online (AJOL)

    Kaposi sarcoma is a mesenchymal tumor associated to a human herpes virus-8. It often occurs in human immunodeficiency virus-positive subjects. Colorectal localization is rare. We report the case of a colorectal Kaposi sarcoma complicating a refractory ulcerative colitis treated with surgery after the failure of ...

  12. Bone marrow oedema associated with benign and malignant bone tumours

    Energy Technology Data Exchange (ETDEWEB)

    James, S.L.J. [Department of Radiology, Royal Orthopaedic Hospital, Birmingham, B31 2AP (United Kingdom)], E-mail: steven.james@roh.nhs.uk; Panicek, D.M. [Department of Radiology, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021 (United States); Davies, A.M. [Department of Radiology, Royal Orthopaedic Hospital, Birmingham, B31 2AP (United Kingdom)

    2008-07-15

    Bone marrow oedema is associated with a wide variety of pathological processes including both benign and malignant bone tumours. This imaging finding in relation to intraosseous tumours can aid in providing a more focused differential diagnosis. In this review, we will discuss the MR imaging of bone marrow oedema surrounding intraosseous neoplasms. The different pulse sequences used in differentiating underlying tumour from surrounding oedema are discussed along with the role of dynamic contrast enhanced MRI. Benign lesions commonly associated with bone marrow oedema include osteoid osteoma, osteoblastoma, chondroblastoma and Langerhan's cell histiocytosis. Metastases and malignant primary bone tumours such as osteosarcoma, Ewing's sarcoma and chondrosarcoma may also be surrounded by bone marrow oedema. The imaging findings of these conditions are reviewed and illustrated. Finally, the importance of bone marrow oedema in assessment of post chemotherapeutic response is addressed.

  13. Bone marrow oedema associated with benign and malignant bone tumours

    International Nuclear Information System (INIS)

    James, S.L.J.; Panicek, D.M.; Davies, A.M.

    2008-01-01

    Bone marrow oedema is associated with a wide variety of pathological processes including both benign and malignant bone tumours. This imaging finding in relation to intraosseous tumours can aid in providing a more focused differential diagnosis. In this review, we will discuss the MR imaging of bone marrow oedema surrounding intraosseous neoplasms. The different pulse sequences used in differentiating underlying tumour from surrounding oedema are discussed along with the role of dynamic contrast enhanced MRI. Benign lesions commonly associated with bone marrow oedema include osteoid osteoma, osteoblastoma, chondroblastoma and Langerhan's cell histiocytosis. Metastases and malignant primary bone tumours such as osteosarcoma, Ewing's sarcoma and chondrosarcoma may also be surrounded by bone marrow oedema. The imaging findings of these conditions are reviewed and illustrated. Finally, the importance of bone marrow oedema in assessment of post chemotherapeutic response is addressed

  14. Penile epithelioid sarcoma: MR imaging findings

    Energy Technology Data Exchange (ETDEWEB)

    Sirikci, A.; Bayram, M.; Demirci, M. [Department of Radiology, Faculty of Medicine, Gaziantep University, Kolejtepe, Gaziantep (Turkey); Bakir, K. [Department of Pathology, Faculty of Medicine, Gaziantep University, Kolejtepe, Gaziantep (Turkey); Sarica, K. [Department of Urology, Faculty of Medicine, Gaziantep University, Kolejtepe, Gaziantep (Turkey)

    1999-10-01

    Magnetic resonance imaging findings of a 38-year-old man with epithelioid sarcoma of the penis is presented. It started as a firm, painless and slowly growing nodule at the base of his penis 6 months previously which caused pain radiating to the testis during coitus. It has been well known that sarcomas may well mimic reactive processes. Initial presentation of epithelioid sarcoma may provoke considerable diagnostic difficulty, and its differentiation from benign lesions, such as Peyronie`s disease and chronic inflammation, may be a clinical problem. In our present report the MR findings are compared with those of the epithelioid sarcomas of various locations reported in the literature and differential diagnosis of the entity is discussed. To our knowledge, this is the first report regarding the MR findings of the epithelioid sarcoma of penis. (orig.) With 3 figs., 16 refs.

  15. Penile epithelioid sarcoma: MR imaging findings

    International Nuclear Information System (INIS)

    Sirikci, A.; Bayram, M.; Demirci, M.; Bakir, K.; Sarica, K.

    1999-01-01

    Magnetic resonance imaging findings of a 38-year-old man with epithelioid sarcoma of the penis is presented. It started as a firm, painless and slowly growing nodule at the base of his penis 6 months previously which caused pain radiating to the testis during coitus. It has been well known that sarcomas may well mimic reactive processes. Initial presentation of epithelioid sarcoma may provoke considerable diagnostic difficulty, and its differentiation from benign lesions, such as Peyronie's disease and chronic inflammation, may be a clinical problem. In our present report the MR findings are compared with those of the epithelioid sarcomas of various locations reported in the literature and differential diagnosis of the entity is discussed. To our knowledge, this is the first report regarding the MR findings of the epithelioid sarcoma of penis. (orig.)

  16. Synovial Sarcoma in the Rectovesical Space: A Case Report

    International Nuclear Information System (INIS)

    Kil, Min Chul; Cho, Bum Sang; Han, Gi Seok; Park, Kil Sun; Kim, Sung Jin; Cha, Sang Hoon; Lee, Seung Young; Kang, MIn Ho; Lee, Ok Jun

    2011-01-01

    Synovial sarcoma is an uncommon soft tissue malignancy usually arising in the extremities of young adults. Synovial sarcomas at unusual anatomic locations have been reported; however, to the best of our knowledge, there are no reports on primary synovial sarcoma in the rectovesical space. Here, we describe the radiologic findings of primary synovial sarcoma in the rectovesical space and review relevant literature.

  17. Paget's disease of bone: review with emphasis on radiologic features. Pt. 2

    International Nuclear Information System (INIS)

    Mirra, J.M.; Brien, E.W.; Tehranzadeh, J.

    1995-01-01

    Part I discusses the correlation between the clinical, radiologic and histologic features with the three phases (incipient, mid- and late phase) of Paget's disease. In this section, we will discuss in detail the radiologic features by location as well as aberrant radiographic presentations in addition to secondary tumors such as post radiation sarcomas and giant cell tumors which occur in Paget bone. Because Paget's disease generally affects people in their middle and late ages, the differential diagnosis often includes metastatic disease and the differentiation can often be quite challenging. Moreover, metastatic disease to bones afflicted with Paget's disease can further add diagnostic confusion. These critical aspects will be discussed in this section of Paget's disease of bone. (orig.)

  18. Mitogen-inducible gene-6 partly mediates the inhibitory effects of prenatal dexamethasone exposure on endochondral ossification in long bones of fetal rats.

    Science.gov (United States)

    Zhang, Xianrong; Shang-Guan, Yangfan; Ma, Jing; Hu, Hang; Wang, Linlong; Magdalou, Jacques; Chen, Liaobin; Wang, Hui

    2016-07-01

    Prenatal exposure to dexamethasone slows down fetal linear growth and bone mineralization but the regulatory mechanism remains unknown. Here we assessed how dexamethasone regulates bone development in the fetus. Dexamethasone (1 mg·kg(-1) ·day(-1) ) was injected subcutaneously every morning in pregnant rats from gestational day (GD)9 to GD20. Fetal femurs and tibias were harvested at GD20 for histological and gene expression analysis. Femurs of 12-week-old female offspring were harvested for microCT (μCT) measurement. Primary chondrocytes were treated with dexamethasone (10, 50, 250 and 1000 nM). Prenatal dexamethasone exposure resulted in accumulation of hypertrophic chondrocytes and delayed formation of the primary ossification centre in fetal long bone. The retardation was accompanied by reduced maturation of hypertrophic chondrocytes, decreased osteoclast number and down-regulated expression of osteocalcin and bone sialoprotein in long bone. In addition, the mitogen-inducible gene-6 (Mig6) and osteoprotegerin (OPG) expression were stimulated, and the receptor activator of NF-κB ligand (RANKL) expression was repressed. Moreover, dexamethasone activated OPG and repressed RANKL expression in both primary chondrocytes and primary osteoblasts, and the knockdown of Mig6 abolished the effect of dexamethasone on OPG expression. Further, μCT measurement showed loss of bone mass in femur of 12-week-old offspring with prenatal dexamethasone exposure. Prenatal dexamethasone exposure delays endochondral ossification by suppressing chondrocyte maturation and osteoclast differentiation, which may be partly mediated by Mig6 activation in bone. Bone development retardation in the fetus may be associated with reduced bone mass in later life. © 2016 The British Pharmacological Society.

  19. The Stable Isotopes of Carbon and Nitrogen in the Bones of Domestic Animals from three Cities of the European Part of Russia: First Results and Interpretations

    Directory of Open Access Journals (Sweden)

    Yavorskaya Liliya Vyacheslavovna

    2015-03-01

    Full Text Available The paper outlines the results of first purposeful research on isotopic composition (carbon 13С and nitrogen 15N in the bones collagen of domestic and wild animals from medieval towns at the European part of Russia. The published information about δ 13С и δ 15N was obtained from 61 samples of osteological collections of Yaroslavl, Rostov and Bolgar. The average values of carbon isotope in cattle bones are almost the same in all three cities. By contrast, these values for horses and pigs from Rostov and Bolgar are higher than for Yaroslavl animals. Unusual similarity for δ13С in the bones of sheep, camels and dogs among themselves from the Bolgar collection were fixed. The comparative analysis of the values δ13С in bones of domestic and wild animals allowed us to propose the hypothesis that sheep, camels and dogs appeared in Bolgar from the southern arid areas. The data on δ15N showed the inexplicably high accumulation of the nitrogen stable isotope in sheep and camel bones from the collection of Bolgar and in beaver bones from Rostov samples. This is probably due to the peculiarities of the diet of these dogs, enriched by the entrails of domestic ungulates or fish. The minimum values of δ15N in the bones of dogs from Bolgar reflect the specific diet of herding dogs with a minimal volume of meat. Simultaneously the data of 15N in sheep and camel bones from Bolgar collection and in beaver bones from Rostov samples howed the inexplicably high level of nitrogen stable isotope accumulation.

  20. Comparative evaluation of the effectiveness of the implantation in the lateral part of the mandible between short tissue level (TE) and bone level (BL) implant systems.

    Science.gov (United States)

    Hadzik, Jakub; Botzenhart, Ute; Krawiec, Maciej; Gedrange, Tomasz; Heinemann, Friedhelm; Vegh, Andras; Dominiak, Marzena

    2017-09-01

    Short dental implants can be an alternative method of treatment to a vertical bone augmentation procedure at sites of reduced alveolar height. However, for successful treatment, an implant system that causes a minimal marginal bone loss (MBL) should be taken into consideration. The aim of the study has been to evaluate implantation effectiveness for bone level and tissue level short implants provided in lateral aspects of partially edentulous mandible and limited alveolar ridge height. The MBL and primary as well as secondary implant stability were determined in the study. Patients were randomly divided into two groups according to the method of treatment provided. Sixteen short Bone Level Implants (OsseoSpeed TX, Astra tech) and 16 short Tissue Level Implants (RN SLActive ® , Straumann) were successfully placed in the edentulous part of the mandible. The determination of the marginal bone level was based on radiographic evaluation after 12 and 36 weeks. Implant stability was measured immediately after insertion and after 12 weeks. The marginal bone level of Bone Level Implants was significantly lower compared to Tissue Level Implants. Furthermore, the Bone Level Implants had greater primary and secondary stability in comparison with Tissue Level Implants (Primary: 77.8 ISQ versus 66.5 ISQ; Secondary: 78.9 ISQ versus 73.9 ISQ, respectively). Since short Bone Level Implants showed a significantly decreased MBL 12 and 36 weeks after implantation as well as better results for the primary stability compared to Tissue Level Implants, they should preferentially be used for this mentioned indication. Copyright © 2017 Elsevier GmbH. All rights reserved.

  1. Sarcomas other than Kaposi sarcoma occurring in immunodeficiency: interpretations from a systematic literature review.

    Science.gov (United States)

    Bhatia, Kishor; Shiels, Meredith S; Berg, Alexandra; Engels, Eric A

    2012-09-01

    In immunodeficiency, an increased sarcoma risk is confirmed for Kaposi's sarcoma. Whether rates of other sarcoma subtypes are elevated in the setting of immunodeficiency is not known. We therefore reviewed published case reports on HIV and AIDS patients and organ transplant recipients with sarcomas. For comparison, we assessed sarcomas in the U.S. general population using Surveillance Epidemiology End Results (SEER) data. A total of 176 non-Kaposi sarcoma were identified, 75 in people with HIV and AIDS and 101 in transplant recipients. Leiomyosarcomas (n = 101) were the most frequently reported sarcomas, followed by angiosarcomas (n = 23) and fibrohistiocytic tumors (n = 17). Leiomyosarcomas were reported with two age peaks, in children and young adults. Epstein-Barr virus (EBV) was detected in the tumor cells in 85 and 88% of leiomyosarcomas in HIV-infected people and transplant recipients, respectively. Angiosarcomas and fibrohistiocytic tumors were most frequently reported in men. Among kidney transplant recipients, 20% of sarcomas arose at the site of an arteriovenous fistula. In comparison, leiomyoscarcomas, angiosarcomas, and fibrohistiocytic tumors comprised 16.9, 3.8, and 18.7% of sarcomas in the U.S. general population. Leiomyosarcoma and angiosarcoma may occur disproportionately in immunodeficiency. Leiomyosarcomas appear causatively linked to EBV, whereas angiosarcomas might be correlated with an arteriovenous fistula. Additional studies are necessary to understand the contribution of immunodeficiency to the cause of these sarcomas.

  2. Sarcomas following radiation therapy for breast cancer: a report of three cases and a review of the literature

    International Nuclear Information System (INIS)

    Pendlebury, Susan C.; Bilous, Michael; Langlands, Allan O.

    1995-01-01

    Purpose: First to describe clinical and pathologic features of sarcomas arising after radiation therapy for breast cancer and to report three cases of sarcoma arising 7, 15, and 20 years following radiation therapy for breast cancer. Second, to review the literature on this treatment complication. Methods and Materials: Medline literature search. Results: The most frequent histology is osteosarcoma and bone is affected more commonly than soft tissue at a median latency of 11 years. The scapula is the most frequently affected bone. The most frequently affected soft tissue site is now the conserved breast with a median latency of 5.5 years. The aetiologic factors relating to these sarcomas are not fully defined with factors of beam energy, radiation dose, chemotherapy and regional edema being inconsistently reported. Conclusion: The frequency of radiation-induced sarcoma at 10 years of follow-up is approximately 0.2%. This is an overestimate by an unknown factor because of the description of sarcomas arising metachromously in breast cancer patients, in nonirradiated areas

  3. Wee1 inhibition by MK-1775 leads to tumor inhibition and enhances efficacy of gemcitabine in human sarcomas.

    Directory of Open Access Journals (Sweden)

    Jenny M Kreahling

    Full Text Available Sarcomas are rare and heterogeneous mesenchymal tumors affecting both pediatric and adult populations with more than 70 recognized histologies. Doxorubicin and ifosfamide have been the main course of therapy for treatment of sarcomas; however, the response rate to these therapies is about 10-20% in metastatic setting. Toxicity with the drug combination is high, response rates remain low, and improvement in overall survival, especially in the metastatic disease, remains negligible and new agents are needed. Wee1 is a critical component of the G2/M cell cycle checkpoint control and mediates cell cycle arrest by regulating the phosphorylation of CDC2. Inhibition of Wee1 by MK1775 has been reported to enhance the cytotoxic effect of DNA damaging agents in different types of carcinomas. In this study we investigated the therapeutic efficacy of MK1775 in various sarcoma cell lines, patient-derived tumor explants ex vivo and in vivo both alone and in combination with gemcitabine, which is frequently used in the treatment of sarcomas. Our data demonstrate that MK1775 treatment as a single agent at clinically relevant concentrations leads to unscheduled entry into mitosis and initiation of apoptotic cell death in all sarcomas tested. Additionally, MK1775 significantly enhances the cytotoxic effect of gemcitabine in sarcoma cells lines with different p53 mutational status. In patient-derived bone and soft tissue sarcoma samples we showed that MK1775 alone and in combination with gemcitabine causes significant apoptotic cell death. Magnetic resonance imaging (MRI and histopathologic studies showed that MK1775 induces significant cell death and terminal differentiation in a patient-derived xenograft mouse model of osteosarcoma in vivo. Our results together with the high safety profile of MK1775 strongly suggest that this drug can be used as a potential therapeutic agent in the treatment of both adult as well as pediatric sarcoma patients.

  4. Patho-morphology of bone tumors (radiology and histology)

    International Nuclear Information System (INIS)

    Meister, P.

    1982-01-01

    Using the example of osteosarcoma, the article shows some findings and phenomena which are interpreted as epiphenomena of tumours and could lead to a ''wrong-positive'' diagnosis due to the radiological findings as bone destruction is misinterpreted as tumour destruction and the reactive or degenerative mineralisation as tumour mineralisation. Histological findings are also shown, for example the differences in the tumour type and the maximal size of a bone tumour which cannot be recognized definitely by means of radiology. An important practical example of interdisciplinary cooperation is a patient with a Ewing-sarcoma: for the histological examination, a thin layer of bone tissue was chiselled off twice. Each time, only a reactive bone formation was recognized as the tumour located deeper was not detected. Here, the radiologist must know that the histological recognition of reactive bones does not exclude the Ewing sarcoma; the surgeon must know that, in accordance with the X-ray findings, deeper located tissue must be taken for histological examination and the pathologist, cooperating with the radiologist and knowing the radiological changes, must point out that reactive bone formations do not exclude a deeper-located sarcoma, especially a Ewing sarcoma, and that they can even be typical side symptoms of a Ewing sarcoma. (orig./APR) [de

  5. Chest wall resection for adult soft tissue sarcomas and chondrosarcomas: analysis of prognostic factors.

    Science.gov (United States)

    van Geel, Albertus N; Wouters, Michel W J M; Lans, Titia E; Schmitz, Paul I M; Verhoef, Cornelis

    2011-01-01

    Wide resection with tumor-free margins is necessary in soft-tissue sarcomas to minimize local recurrence and to contribute to long-term survival. Information about treatment outcome and prognostic factors of adult sarcoma requiring chest wall resection (CWR) is limited. Sixty consecutive patients were retrospectively studied for overall survival (OS), local recurrence-free survival (LRFS), and disease-free survival (DFS). Twenty-one prognostic factors regarding survival were analyzed by univariate analysis using the Kaplan-Meier method and the log-rank test. With a median survival of 2.5 years, the OS was 46% (33%) at 5 (10) years. The LRFS was 64% at 5 and 10 years, and the DFS was 30% and 25% at 5 and 10 years. At the end of the study period, 26 patients (43%) were alive, of which 20 patients (33%) had no evidence of disease and 40 patients (67%) had no chest wall recurrence. In the group of 9 patients with a radiation-induced soft-tissue sarcoma, the median survival was 8 months. Favorable outcome in univariate analysis in OS and LRFS applied for the low-grade sarcoma, bone invasion, and sternal resection. For OS only, age below 60 years and no radiotherapy were significant factors contributing to an improved survival. CWR was considered radical (R0) at the pathological examination in 43 patients. There were 52 patients with an uneventful recovery. There was one postoperative death. CWR for soft-tissue sarcoma is a safe surgical procedure with low morbidity and a mortality rate of less than 1%. With proper patient selection acceptable survival can be reached in a large group of patients. Care must be given to patients with radiation-induced soft-tissue sarcoma who have a significantly worse prognosis.

  6. Was He Murdered or Was He Not?Part II: Multi-Elemental Analyses of Hair and Bone Samples from Tycho Brahe and Histopathology of His Bones

    Czech Academy of Sciences Publication Activity Database

    Kučera, Jan; Rasmussen, K. L.; Kameník, Jan; Kubešová, Marie; Skytte, L.; Povýšil, C.; Karpenko, V.; Havránek, Vladimír; Velemínský, P.; Lynnerup, N.; Brůžek, J.; Smolík, Jiří; Vellev, J.

    2017-01-01

    Roč. 59, č. 5 (2017), s. 918-933 ISSN 0003-813X R&D Projects: GA ČR(CZ) GBP108/12/G108; GA MŠk LM2015056 Institutional support: RVO:61389005 ; RVO:67985858 Keywords : Tycho Brahe * hair * bones * trace elemental analysis * time trends * bone histopathology Subject RIV: CB - Analytical Chemistry, Separation; CF - Physical ; Theoretical Chemistry (UCHP-M) OBOR OECD: Analytical chemistry; Physical chemistry (UCHP-M) Impact factor: 1.470, year: 2016

  7. Synovial sarcoma: MR evaluation in 23 patients

    International Nuclear Information System (INIS)

    Galant, J.; Marti-Bonmati, L.; Lafuente, J.; Hernandez, L.; Soler, R.; Saez, F.

    1997-01-01

    The synovial sarcoma is one of the most common soft tissue sarcomas. MR is the technique of choice to determine to local extension of malignant soft tissue tumors. To assess the clinical and MR imaging parameters associated with synovial sarcomas that aid in establishing their diagnosis. We review the clinical findings and images of 23 histologically confirmed synovial sarcomas that were studied by MR. Synovial sarcomas usually develop in young adults as soft tissue tumors, preferentially in the deep tissues of an extremity in close proximity to a joint. They are characterized as having a lobulated contour and septa, frequently infiltrating neighboring tissues at some point, and are heterogeneous. The presence of hemorrhage, as well as infiltration of the fascia in subcutaneous tumors, suggests the diagnosis of synovial sarcoma. The development of perilesional edema is not uncommon. Although, logically, the clinical and radiological features of synovial sarcomas can overlap with those of other soft tissue tumors, the findings described here are fairly characteristic of these lesions: thus, when present, they should serve to orient the diagnostic process. (Author) 16 refs

  8. Primary osteogenic sarcoma of the breast

    Directory of Open Access Journals (Sweden)

    Akang Effiong E

    2006-12-01

    Full Text Available Abstract Background Primary extra-osseous osteogenic sarcomas have been reported in many tissues of the body but their occurrence in the breast is extremely rare. It can arise as a result of osseous metaplasia in a pre-existing benign or malignant neoplasm of the breast or as non-phylloides sarcoma from the soft tissue of a previously normal breast. Case presentation A 40 year-old Nigerian woman was clinically diagnosed to have carcinoma of the left breast. The histology report of core-needle biopsy of the mass showed a malignant neoplasm comprising islands of chondroblastic and osteoblastic stromal cells. This report changed the diagnosis from carcinoma to osteogenic sarcoma of the breast. She had a left modified radical mastectomy, however there was significant post surgery skin deficit. A latissimus dorsi musculocutaneous flap was used to cover the anterior chest wall defect. Sections from the mastectomy specimen confirmed the diagnosis of osteogenic sarcoma. She died six months after mastectomy. Conclusion A diagnosis of osteogenic sarcoma of the breast was made based on histology report and after excluding an osteogenic sarcoma arising from underlying ribs and sternum. This is the second documented case of primary osteogenic sarcoma of the breast coming from Nigeria

  9. Systemic Therapy Outcomes in Adult Patients with Ewing Sarcoma Family of Tumors

    OpenAIRE

    Valdes, Mario; Nicholas, Garth; Verma, Shailendra; Asmis, Timothy

    2017-01-01

    Background: The Ewing sarcoma family of tumors (ESFT) is a rare but curable bone neoplastic entity. The current standard of care involves chemotherapy and local disease control with surgery or radiation regardless of the extent of disease at presentation. Data that document the effectiveness of the current approach in the adult patient population are limited. Methods: We performed a retrospective review including all ESFT patients older than 19 years of age who received systemic therapy betwe...

  10. Chest wall sarcomas and induction therapy.

    Science.gov (United States)

    Kucharczuk, John C

    2012-02-01

    Chest wall sarcomas are uncommon tumors. The best patient outcomes likely result from a formalized multidisciplinary treatment plan in a specialized center. No clear guidelines exist to determine whether patients with chest wall sarcomas benefit from preoperative adjuvant therapy. Most decisions are made on a case-by-case basis with little available evidence. It is unclear whether established guidelines for the more commonly occurring extremity sarcomas can be appropriately extrapolated to the care of patients with chest wall disease. The single most important factor in local control and long-term survival is a wide, complete, R0 resection. Copyright © 2012. Published by Elsevier Inc.

  11. Pedicled Gastrocnemius Flap: Clinical Application in Limb Sparing Surgical Resection of Sarcoma Around the Knee Region and Popliteal Fossa

    International Nuclear Information System (INIS)

    EL-SHERBINY, M.

    2008-01-01

    To highlight on the versatility of superiorly based pedicled gastrocnemius muscle flap in the limb-sparing surgery for bone or soft tissue sarcoma around the knee and popliteal fossa. Patients and Methods: A total of 30 patients with localized bone or soft tissue sarcoma around the knee and popliteal fossa were treated with limb-salvage procedure. The study included 5 cases with bone sarcoma of the distal femur, 15 cases having bone sarcoma of proximal tibia and 10 cases having soft tissue sarcoma around the knee region and popliteal fossa. Routine preoperative staging studies were done for every patient and included local plain radiography, local MRI, isotopic bone scan and CT chest. Local MRA or angiography was done in selected cases. According to the Enneking staging system, 19 patients had stage IIB and 11 had stage IIA. Patients having bone sarcoma of the proximal tibia were subjected to wide resection, endo prosthetic reconstruction and reconstruction of the extensor mechanism by the medial gastrocnemius muscle flap. Patients having bone sarcoma of the distal femur were subjected to wide resection, endo prosthetic reconstruction and coverage of the prosthesis and re balance of the patellar tendon by the medial gas-trocnemius flap. Patients having soft tissue sarcoma were subjected to wide resection and soft tissue coverage with either medial or lateral myocutaneous gastrocnemius flap or muscle flap with grafting. Limb function was evaluated according to MSTS functional scores. Adjuvant chemotherapy or radiotherapy was given according to nationally agreed protocols. Results: There were 18 males and 12 females with a mean age of 29 years at the time of surgery (range 11-44 years). The mean follow-up period was 52 months (range 25-72 months). Resection with a negative bony and soft tissue margins could be achieved in all cases. A total of 30 flaps were used and included medial gastrocnemius muscle flaps in 21 cases (15 cases had proximal tibia endoprothesis, 5

  12. Ziv-aflibercept in Treating Patients With Locally Advanced, Unresectable, or Metastatic Gynecologic Soft Tissue Sarcoma

    Science.gov (United States)

    2015-12-03

    Fallopian Tube Cancer; Female Reproductive Cancer; Ovarian Carcinosarcoma; Ovarian Sarcoma; Recurrent Ovarian Epithelial Cancer; Recurrent Uterine Sarcoma; Stage III Ovarian Epithelial Cancer; Stage III Uterine Sarcoma; Stage IV Ovarian Epithelial Cancer; Stage IV Uterine Sarcoma; Uterine Carcinosarcoma; Uterine Leiomyosarcoma

  13. Pediatric rhabdomyosarcomas and nonrhabdomyosarcoma soft tissue sarcoma

    Directory of Open Access Journals (Sweden)

    Agarwala Sandeep

    2006-01-01

    Full Text Available Tumors arising from the soft tissues are uncommon in children, accounting for about 6% of all childhood malignancies. More than half (53% of these originate from the striated muscles and are called rhabdomyosarcomas (RMS the remaining are nonrhabdomyosarcoma soft tissue sarcomas (NRSTS. Almost two-thirds of RMS cases are diagnosed in children < 6 years of age. They can arise at varied locations like the head and neck region, genitourinary tract, extremities, trunk and retroperitoneum. Pathologically RMS is now classified as superior, intermediate and poor outcome histologies. For stratification of treatment and also comparison of results the RMS are now staged both by the clinical grouping and the TNM staging systems. The ultimate outcome depends on the site, extent of disease and histology. Currently, approximately 70% of the patients survive for 5 years or more and are probably cured. This is credited to the use of multi-modal, risk-adapted therapy, refinements in tumor grouping and better supportive care which has emerged out of cooperative studies like Intergroup Rhabdomyosarcoma Study (IRS and the International Society of Pediatric Oncology studies (SIOP. The treatment involves chemotherapy, radiotherapy and organ/function preserving surgery. The gold standard chemotherapy is still vincristine, actinomycin D and cyclophosphamide (VAC regime with high doses of intensity bone marrow rescue with colony stimulating factors. The NRSTS are rare and of heterogenous histologies and so it has been difficult to arrive at a treatment strategy for these. What is definitely understood is that these are usually immature and poorly differentiated tumors that respond poorly to chemotherapy and so surgical resection forms the mainstay of treatment with adjuvant radiotherapy and chemotherapy to prevent local recurrences. In all likelihood, the molecular analysis of RMS will further refine current classification schemes and knowledge of genetic features of

  14. Maxillo-orbital granulocytic sarcoma in acute myeloid leukemia

    Directory of Open Access Journals (Sweden)

    Chandana Chakraborti

    2016-01-01

    Full Text Available Granulocytic sarcoma or chloroma, a manifestation of acute myeloid leukemia (AML is a rare cause of childhood proptosis. A 14-year-old boy presented with progressively increasing unilateral proptosis and swelling of lower eyelid and face on the right side. Contrast enhanced computed tomographic images revealed enhancing infiltrates occupying the right orbit, maxillary antrum, and infratemporal fossa. Incisional biopsy from the orbital swelling and the bone marrow aspirate showing leukemic blast cells confirmed the diagnosis of AML. The peripheral smear was normal initially, but high total leukocytic count with immature blast cells was evident after 1-month of presentation. Chemotherapy brought about the remission of the disease. However, the delay in diagnosis because of negative peripheral blood smear examination and inconclusive fine-needle aspiration biopsy led to the loss of vision in right eye. Diagnosis of such case can be made by a combination of good clinical examination and relevant investigations. This case of maxillo-orbital granulocytic sarcoma is reported because of its rarity and to emphasize the clinical and cyto-histological features and problems concerning differential diagnosis.

  15. [Molecular biology for sarcoma: useful or necessary?].

    Science.gov (United States)

    Neuville, Agnès; Coindre, Jean-Michel; Chibon, Frédéric

    2015-01-01

    Sarcomas are a heterogeneous group of tumors. Their diagnosis is based on morphology and immunohistochemical profile, with categories of tumors according to the type of tissue that they resemble. Nevertheless, for several tumors, cellular origin is unknown. Molecular analysis performed in recent years allowed, combining histophenotype and genomics, better classifying such sarcomas, individualizing new entities and grouping some tumors. Simple and recurrent genetic alterations, such as translocation, mutation, amplification, can be identified in one of two sarcomas and appear as new diagnostic markers. Their identification in specialized laboratories in molecular pathology of sarcomas is often useful and sometimes necessary for a good diagnosis, leading to a heavy and multidisciplinary multi-step treatment. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  16. Delays in the management of retroperitoneal sarcomas

    DEFF Research Database (Denmark)

    Seinen, Jojanneke; Almquist, Martin; Styring, Emelie

    2010-01-01

    Retroperitoneal sarcomas are rare and treatment should optimally be centralized. Despite successful centralization with 90% of the patients referred prior to surgery, delays occur, which led us to assess lead times in a population-based series. Method. Patients diagnosed with retroperitoneal...... sarcoma in the southern Sweden health care region 2003-2009 were eligible for the study. Data on referrals and diagnostic investigations were collected from clinical files from primary health care, local hospitals, and from the sarcoma centre. Lead times were divided into patient delays and health care...... delays caused by primary health care, local hospitals, or procedures at the sarcoma centre. Results. Complete data were available from 33 patients and demonstrated a median patient delay of 23¿days (0-17¿months) and median health care delay of 94¿days (1-40¿months) with delays of median 15¿days...

  17. Delays in the management of retroperitoneal sarcomas

    DEFF Research Database (Denmark)

    Seinen, Jojanneke; Almquist, Martin; Styring, Emelie

    2010-01-01

    Retroperitoneal sarcomas are rare and treatment should optimally be centralized. Despite successful centralization with 90% of the patients referred prior to surgery, delays occur, which led us to assess lead times in a population-based series. Method. Patients diagnosed with retroperitoneal...... sarcoma in the southern Sweden health care region 2003-2009 were eligible for the study. Data on referrals and diagnostic investigations were collected from clinical files from primary health care, local hospitals, and from the sarcoma centre. Lead times were divided into patient delays and health care...... delays caused by primary health care, local hospitals, or procedures at the sarcoma centre. Results. Complete data were available from 33 patients and demonstrated a median patient delay of 23 days (0-17 months) and median health care delay of 94 days (1-40 months) with delays of median 15 days...

  18. Kaposi`s sarcoma; Sarcome de Kaposi

    Energy Technology Data Exchange (ETDEWEB)

    Kirova, Y.M.; Belembaogo, E.; Frikha, H.; Yu, S.J.; Le Bourgeois, J.P. [Hopital Henri-Mondor, 94 - Creteil (France)

    1997-09-01

    Moriz Kaposi was the first who, in 1872, described five patients presenting with `sarcoma idiopathicum multiple hemorrhagicum`. In 1912 Sternberg termed this disease Kaposi`s sarcoma. Since then various forms of this rare disease have been observed. In 1914 Hallenberg described the first cases of African or endemic Kaposi`s sarcoma. In the 1960`s the first reports discussing Kaposi`s sarcoma following organ transplantation and immunosuppressive therapy were published. After 1981, the epidemic form associated with the acquired immunodeficiency syndrome (AIDS) was described. All these forms, their history, treatment methods and the role of radiation therapy in the management of this rare malignancy are discussed, and the literature is reviewed. (authors)

  19. Kaposi sarcoma: review and medical management update.

    Science.gov (United States)

    Fatahzadeh, Mahnaz

    2012-01-01

    Despite recent advances in our understanding of pathogenic mechanisms involved, the true nature of Kaposi sarcoma remains an enigma. Four clinical variants have been described for the disease, differing in natural history, site of predilection, and prognosis. All forms of Kaposi sarcoma may manifest in the oral cavity and Kaposi sarcoma-associated virus appears essential to development of all clinical variants. The spectrum of therapeutic strategies is broad and selection of appropriate intervention mandates a thorough understanding of disease spread and the patient's symptomatology, as well as risks and benefits of therapy. This article provides an overview of epidemiology, subtypes, clinical course, pathogenesis, and management strategies for Kaposi sarcoma. Published by Mosby, Inc.

  20. Kaposi’s Sarcoma in Film

    Directory of Open Access Journals (Sweden)

    Richard F. WAGNER

    2016-04-01

    Full Text Available Kaposi’s sarcoma, a historically rare, indolent cutaneous malignancy of elderly men emerged as a frequent and easily recognizable cutaneous manifestation of Acquired Immunodeficiency Syndrome in the 1980s. Since these tumors were often visible to the public, Kaposi’s sarcoma quickly became a stigmatizing marker for those infected, and predicted the high mortality risk from comorbid opportunistic infections. English language films released from 1985-2008 are analyzed for their depictions of Kaposi’s sarcoma, and the role(s it played in these films. With the advent of highly active antiretroviral therapy for those with HIV infection, Kaposi’s sarcoma has once again become relatively rare.

  1. Bio-activated titanium surface utilizable for mimetic bone implantation in dentistry—Part III: Surface characteristics and bone implant contact formation

    Science.gov (United States)

    Strnad, Jakub; Strnad, Zdeněk; Šesták, Jaroslav; Urban, Karel; Povýšil, Ctibor

    2007-05-01

    This study was carried out to quantify the effect of an alkali-modified surface on the bone implant interface formation during healing using an animal model. A total of 24 screw-shaped, self-tapping, (c.p.) titanium dental implants, divided into test group B—implants with alkali-modified surface (Bio surface) and control group M—implants with turned, machined surface, were inserted without pre-tapping in the tibiae of three beagle dogs. The animals were sacrificed after 2, 5 and 12 weeks and the bone implant contact (BIC%) was evaluated histometrically. The surface characteristics that differed between the implant surfaces, i.e. specific surface area, contact angle, may represent factors that influence the rate of osseointegration and the secondary implant stability. The alkali-treated surface enhances the BIC formation during the first 2 5 weeks of healing compared to the turned, machined surface.

  2. Procholecystokinin as marker of human Ewing sarcomas

    DEFF Research Database (Denmark)

    Reubi, Jean Claude; Koefoed, Pernille; Hansen, Thomas von O

    2004-01-01

    Ewing sarcoma patients, and, if so, whether CCK peptides might play a role as tumor markers. EXPERIMENTAL DESIGN: CCK gene expression was evaluated with in situ hybridization or reverse transcription-PCR in tumor tissue. CCK precursors and bioactive CCK were measured with specific RIAs in tumor tissue...... in human cancer; Ewing sarcomas synthesize and secrete proCCK that can be identified in plasma as circulating tumor marker....

  3. Unusual postirradiation sarcoma of chest wall

    International Nuclear Information System (INIS)

    Travis, E.L.; Kreuther, A.; Young, T.; Gerald, W.L.

    1976-01-01

    A sarcoma of the chest wall following postoperative radiation therapy for breast carcinoma is reported. A total of 9346 rads was delivered at a 2-cm tissue depth from two treatment courses separated by a five-year interval. The sarcoma appeared 16 years following the initial radiation course. The existence of two mesenchymal elements in the lesion led to the final diagnosis of malignant mesenchymoma. Criteria for evaluating a possible radiation-induced malignancy are discussed

  4. Outcomes of surgery for chest wall sarcomas.

    Science.gov (United States)

    Putnam, Joe B

    2010-11-01

    Chest wall resection requires wide local excision, negative margins, and adequate reconstruction. Outcomes are generally good to excellent with wide local excision and negative margins. Mortality is nearly 0% to 1% with mild morbidity. Multispecialty surgical teams may be required for more complex situations. Early diagnosis of chest wall sarcomas, confirmation by an experienced sarcoma pathologist, and multidisciplinary discussion before treatment initiation, are all required for optimal and successful therapy.

  5. Technetium scanning in Kaposi's sarcoma and its simulators

    International Nuclear Information System (INIS)

    Gunnoe, R.; Kalivas, J.

    1982-01-01

    The clinical picture of ulcerated purple plaques on the legs often suggests several diagnoses: Kaposi's sarcoma, stasis dermatitis, atrophie blanche (livedoid vasculitis), and a poorly understood condition called acroangiodermatitis of Favre-Chaix (pseudo-Kaposi's sarcoma). Even the skin biopsy may not always be conclusive. We describe our experience with three patients with pseudo-Kaposi's sarcoma, one with true Kaposi's sarcoma and two with atrophie blanche. Clinical and histopathologic similarities among these three conditions pointed up the need for additional confirmatory studies, i.e., isotope scanning. The technetium scan was positive in both Kaposi's sarcoma and pseudo-Kaposi's sarcoma but negative in atrophie blanche

  6. Acroangiodermatitis (Pseudo-Kaposi sarcoma

    Directory of Open Access Journals (Sweden)

    Satyendra Kumar Singh

    2014-01-01

    Full Text Available Acroangiodermatitis or Pseudo-Kaposi sarcoma is a rare angioproliferative entity, related to chronic venous insufficiency or certain other vascular anomalies. It is often associated with chronic venous insufficiency, arteriovenous malformation of the legs, chronic renal failure treated with dialysis, paralyzed legs and amputation stumps. We hereby describe a case of 45 year old female presenting with pitting pedal edema, multiple ulcers over bilateral lower limbs with irregular margins with erythema and hyperpigmentation of the surrounding skin. Color Doppler study of bilateral lower limbs was normal. Histopathological examination from one of the lesions showed hyperplastic epidermis, proliferation of capillaries in dermis, hemosiderin deposits and lymphocytic infiltrate. These features thus confirmed the diagnosis of Acroangiodermatitis.

  7. Synovial sarcoma of the mandible

    Directory of Open Access Journals (Sweden)

    Maryam Khalili

    2012-01-01

    Full Text Available Synovial sarcoma (SS is a relatively common soft tissue tumor but only 6%-7% of cases are diagnosed in the head and neck region. It typically occurs in young adults and is slightly more common in males. The most common sites in the head and neck region are hypopharynx and parapharyngeal spaces. However, SS can also occur in tonsils, tongue, and orofacial soft tissues. It is not difficult to diagnose SS microscopically with its classic biphasic appearance, but the diagnosis of monophasic forms is more challenging especially in unusual locations. In this article, we report a rare case of monophasic SS of the mandible. The clinical, histopathological, and immunohistochemical features are discussed and compared with previously reported cases in the literature. To our knowledge, only six primary involvements have been reported in the jaws. Therefore, our case represents the seventh reported case of SS in the area.

  8. Synovial sarcoma of the mandible

    Science.gov (United States)

    Khalili, Maryam; Eshghyar, Nosratollah; Ensani, Fereshteh; Shakib, Pouyan Amini

    2012-01-01

    Synovial sarcoma (SS) is a relatively common soft tissue tumor but only 6%-7% of cases are diagnosed in the head and neck region. It typically occurs in young adults and is slightly more common in males. The most common sites in the head and neck region are hypopharynx and parapharyngeal spaces. However, SS can also occur in tonsils, tongue, and orofacial soft tissues. It is not difficult to diagnose SS microscopically with its classic biphasic appearance, but the diagnosis of monophasic forms is more challenging especially in unusual locations. In this article, we report a rare case of monophasic SS of the mandible. The clinical, histopathological, and immunohistochemical features are discussed and compared with previously reported cases in the literature. To our knowledge, only six primary involvements have been reported in the jaws. Therefore, our case represents the seventh reported case of SS in the area. PMID:23833586

  9. Undifferentiated embryonal sarcoma of liver

    Directory of Open Access Journals (Sweden)

    Avyakta Kallam

    2015-12-01

    Full Text Available Undifferentiated embryonal sarcoma of the liver (UESL is a rare malignant hepatic tumor. A 47 year old male presented with symptoms of sour taste in his mouth, occasional nausea, indigestion and 15-pound weight loss over two months. He had an unremarkable upper gastrointestinal endoscopy. Imaging showed a large liver mass in the left hepatic lobe that was resected and then reported as UESL. He went on to develop lung metastases and was initially treated with doxorubicin and ifosfamide followed by switching of therapy to gemcitabine and docetaxel due to progression of disease. He had a good response after two cycles and went on to receive four more cycles, achieving stable disease. We can therefore conclude that the combination of gemcitabine and docetaxel is a potential therapeutic option for patients with UESL.

  10. Undifferentiated Embryonal Sarcoma of Liver.

    Science.gov (United States)

    Kallam, Avyakta; Krishnamurthy, Jairam; Kozel, Jessica; Shonka, Nicole

    2015-12-29

    Undifferentiated embryonal sarcoma of the liver (UESL) is a rare malignant hepatic tumor. A 47 year old male presented with symptoms of sour taste in his mouth, occasional nausea, indigestion and 15-pound weight loss over two months. He had an unremarkable upper gastrointestinal endoscopy. Imaging showed a large liver mass in the left hepatic lobe that was resected and then reported as UESL. He went on to develop lung metastases and was initially treated with doxorubicin and ifosfamide followed by switching of therapy to gemcitabine and docetaxel due to progression of disease. He had a good response after two cycles and went on to receive four more cycles, achieving stable disease. We can therefore conclude that the combination of gemcitabine and docetaxel is a potential therapeutic option for patients with UESL.

  11. Clinicopathological guide to malignant bone tumours: A ...

    African Journals Online (AJOL)

    Clinicians correctly preliminarily diagnosed multiple myeloma, osteosarcoma, and ameloblastoma, but had inexperience with carcinomas and other types of sarcomas. Chronic osteomyelitis and metastatic lesions were mentioned frequently by radiologists as the diagnosis of some malignant bone tumours that turned out to ...

  12. Bone morphogenetic proteins in tissue engineering: the road from the laboratory to the clinic, part I (basic concepts).

    Science.gov (United States)

    Bessa, P C; Casal, M; Reis, R L

    2008-01-01

    Discovered in 1965, bone morphogenetic proteins (BMPs) are a group of cytokines from the transforming growth factor-beta (TGFbeta) superfamily with significant roles in bone and cartilage formation. BMPs are used as powerful osteoinductive components of diverse tissue-engineering products for the healing of bone. Several BMPs with different physiological roles have been identified in humans. The purpose of this review is to cover the biological function of the main members of BMP family, the latest research on BMPs signalling pathways and advances in the production of recombinant BMPs for tissue engineering purposes. Copyright (c) 2008 John Wiley & Sons, Ltd.

  13. Incidence of primary bone tumours and tumour like lesions in and around Dakshina Kannada district of Karnataka.

    Science.gov (United States)

    Rao, V S; Pai, M R; Rao, R C; Adhikary, M M

    1996-03-01

    A total of 523 cases of primary bone tumours and tumour like lesions in and around Dakshina Kannada district of Karnataka were diagnosed over a period of 36 years. About 39% of these tumours were malignant and the remaining benign. Among the malignant tumours the highest incidence was of osteosarcoma (45.7%) followed by Ewing's sarcoma (19.4%). Osteochondroma was the most frequent in the benign tumour category (30.3%). Peak incidence of tumour was in the 2nd and 3rd decade of life with a male preponderance. The most commonly affected bones were femur, tibia and humerus in that order. Results indicate a significantly higher incidence of primary bone tumours in this part of India.

  14. New Therapeutic Targets in Soft Tissue Sarcoma

    Science.gov (United States)

    Demicco, Elizabeth G; Maki, Robert G; Lev, Dina C.; Lazar, Alexander J

    2012-01-01

    Soft tissue sarcomas are an uncommon and diverse group of more than 50 mesenchymal malignancies. The pathogenesis of many of these is poorly understood, but others have begun to reveal the secrets of their inner workings. With considerable effort over recent years, soft tissue sarcomas have increasingly been classified on the basis of underlying molecular alterations. In turn, this has allowed the development and application of targeted agents in several specific, molecularly defined, sarcoma subtypes. This review will focus the rationale for targeted therapy in sarcoma, with emphasis on the relevance of specific molecular factors and pathways in both translocation-associated sarcomas and in genetically complex tumors. In addition, we will address some of the early successes in sarcoma targeted therapy as well as a few challenges and disappointments in this field. Finally we will discuss several possible opportunities represented by poorly understood, but potentially promising new therapeutic targets, as well as several novel biologic agents currently in preclinical and early phase I/II trials. This will provide the reader with context for understanding the current state this field and a sense of where it may be headed in the coming years. PMID:22498582

  15. Primary bone tumours of the hand

    International Nuclear Information System (INIS)

    Kozlowski, K.; Azouz, E.M.; Campbell, J.; Marton, D.; Morris, L.; Padovani, J.; Sprague, P.; Beluffi, G.; Berzero, G.F.; Cherubino, P.; Adelaide Children's Hospital; Hospital for Children, Perth; Montreal Children's Hospital, Quebec; Saint Justine Hospital, Montreal, Quebec; Children's Hospital, Denver, CO; Hopital des Enfants, 13 - Marseille; Pavia Univ.; Pavia Univ.

    1988-01-01

    Twenty-one primary bone tumours of the hand in children from 8 paediatric hospitals are reported. Osteochondromas and enchondromas were not included. Our material consisted of 16 patients with common tumours (3 Ewing's sarcoma, 5 aneurysmal bone cyst, 6 osteoid osteoma and 2 epithelioma) and 5 patients with uncommon tumours (osteoma, simple bone cyst, haemangiopericytoma, capillary angiomatous tumour and benign ossifying fibroma or osteoblastoma). The X-ray diagnosis of the common tumours should have high concordance with histology, whereas that of uncommon tumours in much more difficult and uncertain. The characteristic features of Ewing's sarcoma are stressed as all our children with this tumour had a delayed diagnosis and a fatal outcome. Differential diagnosis with other short tubular bone lesions of the hand - specifically osteomyelitis - is discussed and the posibilities of microscopic diagnosis are stressed. (orig.)

  16. Oncopig soft-tissue sarcomas recapitulate key transcriptional features of human sarcomas

    NARCIS (Netherlands)

    Schachtschneider, Kyle M.; Liu, Yingkai; Makelainen, Suvi; Madsen, Ole; Rund, Laurie A.; Groenen, Martien A.M.; Schook, Lawrence B.

    2017-01-01

    Human soft-tissue sarcomas (STS) are rare mesenchymal tumors with a 5-year survival rate of 50%, highlighting the need for further STS research. Research has been hampered by limited human sarcoma cell line availability and the large number of STS subtypes, making development of STS cell lines

  17. Proximal-type epithelioid sarcoma: a new case report and literature ...

    African Journals Online (AJOL)

    Proximal-type epithelioid sarcoma is a rare soft tissue neoplasm which arises from the more proximal part of body and occurs more often in young people; the definite diagnosis depends mainly on the pathological examination; early detection and complete excision remain the foundation of treatment. Due to its aggressive ...

  18. AIDS-associated Kaposi\\'s Sarcoma in Sokoto, Nigeria. | Mbah ...

    African Journals Online (AJOL)

    Background: Since the advent of the HIV/AIDS pandemic, Kaposi\\'s sarcoma (KS) is now seen in places not previously considered endemic for this disease. In Nigeria, the African-endemic KS had been known to be prevalent in the southern parts of the country, particularly the southeast. Until now, reports on the disease ...

  19. Multifocal osteogenic sarcoma in Paget's disease

    Energy Technology Data Exchange (ETDEWEB)

    Vuillemin-Bodaghi, V. [Dept. of Bone and Joint Radiology, Lariboisiere Teaching Hospital, Paris (France); Service de Radiologie Osteoarticulaire, Hopital Lariboisiere, Paris (France); Parlier-Cuau, C.; Laredo, J.D. [Dept. of Bone and Joint Radiology, Lariboisiere Teaching Hospital, Paris (France); Cywiner-Golenzer, C.; Quillard, A. [Dept. of Pathology, Lariboisiere Teaching Hospital, Paris (France); Kaplan, G. [Dept. of Rheumatology, Saint Antoine Teaching Hospital, Paris (France)

    2000-06-01

    The most serious complication of Paget's disease is sarcomatous degeneration of pagetic bone. Multifocal sarcomatous degeneration occurs mainly in polyostotic Paget's disease. Multifocal Paget's sarcoma is uncommon and can arise in any site. We report two cases of synchronous multifocal sarcomatous degeneration. The two patients were elderly women (aged 77 and 86 years, respectively) who developed sarcomatous lesions concomitantly, in the first case report in left ilium, left tibia, and first lumbar vertebra and in the second case report in the skull, right ilium, and sacrum. Whether these cases are due to the simultaneous development of several primaries or to metastases from a single primary remains unclear. (orig.)

  20. Bone marker gene expression in calvarial bones: different bone microenvironments.

    Science.gov (United States)

    Al-Amer, Osama

    2017-12-01

    In calvarial mice, mesenchymal stem cells (MSCs) differentiate into osteoprogenitor cells and then differentiate into osteoblasts that differentiate into osteocytes, which become embedded within the bone matrix. In this case, the cells participating in bone formation include MSCs, osteoprogenitor cells, osteoblasts and osteocytes. The calvariae of C57BL/KaLwRijHsD mice consist of the following five bones: two frontal bones, two parietal bones and one interparietal bone. This study aimed to analyse some bone marker genes and bone related genes to determine whether these calvarial bones have different bone microenvironments. C57BL/KaLwRijHsD calvariae were carefully excised from five male mice that were 4-6 weeks of age. Frontal, parietal, and interparietal bones were dissected to determine the bone microenvironment in calvariae. Haematoxylin and eosin staining was used to determine the morphology of different calvarial bones under microscopy. TaqMan was used to analyse the relative expression of Runx2, OC, OSX, RANK, RANKL, OPG, N-cadherin, E-cadherin, FGF2 and FGFR1 genes in different parts of the calvariae. Histological analysis demonstrated different bone marrow (BM) areas between the different parts of the calvariae. The data show that parietal bones have the smallest BM area compared to frontal and interparietal bones. TaqMan data show a significant increase in the expression level of Runx2, OC, OSX, RANKL, OPG, FGF2 and FGFR1 genes in the parietal bones compared with the frontal and interparietal bones of calvariae. This study provides evidence that different calvarial bones, frontal, parietal and interparietal, contain different bone microenvironments.

  1. Radiographic study of the sound navicular bone. Part 1: What about the canals on the distal border

    International Nuclear Information System (INIS)

    Gabriel, A.; Jolly, S.; Detilleux, J.; Snaps, F.; Serteyn, D.; Collin, B.

    1998-01-01

    The scoring system based on the different types of navicular distal border canals is a good method to quantify and relativise the anomalies in number, shape and localisation of the canals. The distal border score varies significantly with the limb (fore or rear), the morphological type, the gender and the age of the horse. These anatomical variations are of importance and must be taken into account when examining a suspect bone. The score is larger for the fore navicular bone than for the rear. It could be interesting to compare both scores: rear navicular bone score is generally equal to half (or slight less) that of the fore. The score is larger for heavy types of horses and ponies (drafthorse, heavy halfbreds and Fjords). This phenomenon could be related to a larger pressure within the distal interphalangeal joint. The score is lower for the athletic halfbred than for other half-breds. This could be the result of the changes in bone architecture induced by exercise and particularly bone densification. The score is lower for the female than for the male. We think that navicular bone quality is better for the female and this idea corroborates that of other authors that consider that the risk to develop navicular disease is smaller for the female than for the male. The score increases with age. It is particularly small in young horses less than two years old and then increases strongly. This phenomenon is to be related to the progressive development, in the first year of life, of the groove between articular cartilage and distal impar ligament, canals developping only later one. In athletic horses, the score is higher between 7 and 12 years of age. During this time, we also observe more degenerative changes within the navicular bone, which could mean that bone is of lesser quality

  2. Second malignancies after treatment for Ewing's sarcoma

    International Nuclear Information System (INIS)

    Ahrens, Susanne; Dunst, Juergen; Ruebe, Christian; Paulussen, Michael; Hoffmann, Christine; Juergens, Herbert

    1997-01-01

    Background: Some former retrospective studies have suggested that patients with Ewing's sarcoma might have a very high risk for developing secondary sarcomas if treated with radiotherapy. We have evaluated the risk of second malignancies (SM) in patients treated in the German Cooperative Ewing's Sarcoma Studies CESS 81 and CESS 86. Materials and methods: From January 1981 through June 1991, a total number of 674 patients was registered in the two multicentric Ewing's sarcoma trials CESS 81 (1981 through 1985) and CESS 86 (1986 through June 1991). The systemic treatment consisted in both studies of a four-drug-chemotherapy (VACA= vincristine, actinomycin D, cyclophosphamide and adriamycin; or VAIA= vincristine, actinomycin D, ifosfamide and adriamycin) and a total number of four courses, each lasting nine weeks, was recommended by the protocol. Local therapy was either complete surgery or surgery plus postoperative radiotherapy with 36-46Gy or definitive radiotherapy with 46 to 60Gy. The median follow-up at the time of this analysis was 7 years, the maximum follow-up 16 years. Results: Eight patients developed a SM, 4 were acute myelogenic leucemias, three sarcomas and one benign neurinoma. One of the sarcomas was considered as radiation-induced because of its location in the former radiation field. The interval between diagnosis of Ewing's sarcoma and the diagnosis of the SM was 17 to 78 months for the four AMLs and 82 to 136 months for the three sarcomas. All solid second tumors occurred in irradiated patients. The cumulative risk of a SM is given in table 1. Three patients (all with AML) died of their SM, the other five were salvage by subsequent treatment and are in clinical remission with a median follow-up of 1 to 10 years. Conclusions: The risk of leukemia after treatment for Ewing's sarcoma is probably low in the range of 1-2% or less and accounts for about 1% of all deaths. There was no risk of solid tumors in surgically treated patients. Irradiated

  3. Multifocal bone and bone marrow lesions in children - MRI findings

    Energy Technology Data Exchange (ETDEWEB)

    Raissaki, Maria; Demetriou, Stelios; Spanakis, Konstantinos; Skiadas, Christos; Karantanas, Apostolos H. [University of Crete, Faculty of Medicine, Department of Radiology, University Hospital of Heraklion, Heraklion, Crete (Greece); Katzilakis, Nikolaos; Stiakaki, Eftichia [University of Crete, Faculty of Medicine, Department of Pediatric Hematology-Oncology, University Hospital of Heraklion, Heraklion, Crete (Greece); Velivassakis, Emmanouil G. [University Hospital of Heraklion, Orthopedic Clinic, Heraklion, Crete (Greece)

    2017-03-15

    Polyostotic bone and bone marrow lesions in children may be due to various disorders. Radiographically, lytic lesions may become apparent after loss of more than 50% of the bone mineral content. Scintigraphy requires osteoblastic activity and is not specific. MRI may significantly contribute to the correct diagnosis and management. Accurate interpretation of MRI examinations requires understanding of the normal conversion pattern of bone marrow in childhood and of the appearances of red marrow rests and hyperplasia. Differential diagnosis is wide: Malignancies include metastases, multifocal primary sarcomas and hematological diseases. Benign entities include benign tumors and tumor-like lesions, histiocytosis, infectious and inflammatory diseases, multiple stress fractures/reactions and bone infarcts/ischemia. (orig.)

  4. Bilateral parietal extradural metastatic ewing's sarcoma simulating acute epidural hematoma

    International Nuclear Information System (INIS)

    Aslam, E.; Imran, M.; Faridi, N.M.

    2006-01-01

    Sarcomas usually metastasize to lugs. The following case report describes an unusual metastasis of Ewing's sarcoma to extradural parietal region bilaterally. The primary was found at lower end of ulna. (author)

  5. Soft tissue sarcoma - diagnosis and treatment

    International Nuclear Information System (INIS)

    Ruka, W.; Rutkowski, P.; Krzakowski, M.

    2009-01-01

    Significant progress in the treatment of soft tissue sarcoma (STS), both primary tumor and local recurrences/metastatic disease, has been achieved in recent years. Surgery is essential modality, but the use of combined treatment (standard combination of surgery with adjuvant radiotherapy, chemotherapy in selected cases and perioperative rehabilitation) in highly-experienced centers increased possibility of cure and limitations of extent of local surgery. Current combined therapy together with the use of reconstructive methods allows for limb-sparing surgery in majority of soft tissue sarcoma patients (amputation in 10% of cases as compared to approximately 50% in the 1960 - 70s). The slow, but constant, increase of rate of soft tissue sarcoma patients with long-term survival has been observed. Contemporary 5-year overall survival rate in patients with extremity soft tissue sarcomas is 55 -78%. In case of diagnosis of metastatic disease the prognosis is still poor (survival of approximately 1 year). Good results of local therapy may be expected only after planned (e.g., after preoperative biopsy - tru - cut or incisional) radical surgical excision of primary tumor with pathologically negative margins (R0 resection). Following appropriate diagnostic check-up, adjuvant radiotherapy is necessary in the majority of patients treated with radical surgery need, as well as long-term rehabilitation and follow-up examinations in treating center are needed for at least 5 years. The progress is due to the introduction of targeted therapy acting on molecular or genetic cellular disturbances detected during studies on etiopathogenetic mechanisms of sarcoma subtypes. In view of rarity of sarcomas and necessity of multidisciplinary therapy, the crucial issue is that management of these tumors should be hold in experienced oncological sarcoma centers. (authors)

  6. Intratumoral oxygen gradients mediate sarcoma cell invasion

    Science.gov (United States)

    Lewis, Daniel M.; Park, Kyung Min; Tang, Vitor; Xu, Yu; Pak, Koreana; Eisinger-Mathason, T. S. Karin; Simon, M. Celeste; Gerecht, Sharon

    2016-01-01

    Hypoxia is a critical factor in the progression and metastasis of many cancers, including soft tissue sarcomas. Frequently, oxygen (O2) gradients develop in tumors as they grow beyond their vascular supply, leading to heterogeneous areas of O2 depletion. Here, we report the impact of hypoxic O2 gradients on sarcoma cell invasion and migration. O2 gradient measurements showed that large sarcoma mouse tumors (>300 mm3) contain a severely hypoxic core [≤0.1% partial pressure of O2 (pO2)] whereas smaller tumors possessed hypoxic gradients throughout the tumor mass (0.1–6% pO2). To analyze tumor invasion, we used O2-controllable hydrogels to recreate the physiopathological O2 levels in vitro. Small tumor grafts encapsulated in the hydrogels revealed increased invasion that was both faster and extended over a longer distance in the hypoxic hydrogels compared with nonhypoxic hydrogels. To model the effect of the O2 gradient accurately, we examined individual sarcoma cells embedded in the O2-controllable hydrogel. We observed that hypoxic gradients guide sarcoma cell motility and matrix remodeling through hypoxia-inducible factor-1α (HIF-1α) activation. We further found that in the hypoxic gradient, individual cells migrate more quickly, across longer distances, and in the direction of increasing O2 tension. Treatment with minoxidil, an inhibitor of hypoxia-induced sarcoma metastasis, abrogated cell migration and matrix remodeling in the hypoxic gradient. Overall, we show that O2 acts as a 3D physicotactic agent during sarcoma tumor invasion and propose the O2-controllable hydrogels as a predictive system to study early stages of the metastatic process and therapeutic targets. PMID:27486245

  7. Different Expression and Localization of Phosphoinositide Specific Phospholipases C in Human Osteoblasts, Osteosarcoma Cell Lines, Ewing Sarcoma and Synovial Sarcoma

    Directory of Open Access Journals (Sweden)

    V.Vasco

    2017-06-01

    Full Text Available Background: Bone hardness and strength depends on mineralization, which involves a complex process in which calcium phosphate, produced by bone-forming cells, was shed around the fibrous matrix. This process is strictly regulated, and a number of signal transduction systems were interested in calcium metabolism, such as the phosphoinositide (PI pathway and related phospholipase C (PLC enzymes. Objectives: Our aim was to search for common patterns of expression in osteoblasts, as well as in ES and SS. Methods: We analysed the PLC enzymes in human osteoblasts and osteosarcoma cell lines MG-63 and SaOS-2. We compared the obtained results to the expression of PLCs in samples of patients affected with Ewing sarcoma (ES and synovial sarcoma (SS. Results: In osteoblasts, MG-63 cells and SaOS-2 significant differences were identified in the expression of PLC δ4 and PLC η subfamily isoforms. Differences were also identified regarding the expression of PLCs in ES and SS. Most ES and SS did not express PLCB1, which was expressed in most osteoblasts, MG-63 and SaOS-2 cells. Conversely, PLCB2, unexpressed in the cell lines, was expressed in some ES and SS. However, PLCH1 was expressed in SaOS-2 and inconstantly expressed in osteoblasts, while it was expressed in ES and unexpressed in SS. The most relevant difference observed in ES compared to SS regarded PLC ε and PLC η isoforms. Conclusion: MG-63 and SaOS-2 osteosarcoma cell lines might represent an inappropriate experimental model for studies about the analysis of signal transduction in osteoblasts

  8. Cutaneous myeloid sarcoma: natural history and biology of an uncommon manifestation of acute myeloid leukemia.

    Science.gov (United States)

    Hurley, M Yadira; Ghahramani, Grant K; Frisch, Stephanie; Armbrecht, Eric S; Lind, Anne C; Nguyen, Tudung T; Hassan, Anjum; Kreisel, Friederike H; Frater, John L

    2013-05-01

    We conducted a retrospective study of patients with cutaneous myeloid sarcoma, from 2 tertiary care institutions. Eighty-three patients presented, with a mean age of 52 years. Diagnosis of myeloid sarcoma in the skin was difficult due to the low frequency of myeloperoxidase and/or CD34+ cases (56% and 19% of tested cases, respectively). Seventy-one of the 83 patients (86%) had ≥ 1 bone marrow biopsy. Twenty-eight (39%) had acute myeloid leukemia with monocytic differentiation. Twenty-three had other de novo acute myeloid leukemia subtypes. Thirteen patients had other myeloid neoplasms, of which 4 ultimately progressed to an acute myeloid leukemia. Seven had no bone marrow malignancy. Ninety-eight percent of the patients received chemotherapy, and approximately 89% died of causes related to their disease. Cutaneous myeloid sarcoma in most cases represents an aggressive manifestation of acute myeloid leukemia. Diagnosis can be challenging due to lack of myeloblast-associated antigen expression in many cases, and difficulty in distinguishing monocyte-lineage blasts from neoplastic and non-neoplastic mature monocytes.

  9. Post-operative pulmonary and shoulder function after sternal reconstruction for patients with chest wall sarcomas.

    Science.gov (United States)

    Nishida, Yoshihiro; Tsukushi, Satoshi; Urakawa, Hiroshi; Toriyama, Kazuhiro; Kamei, Yuzuru; Yokoi, Kohei; Ishiguro, Naoki

    2015-12-01

    Sternal resection is occasionally required for patients with malignant tumors, particularly sarcomas, in the sternal region. Few reports have described post-operative respiratory and shoulder function after sternal resection for patients with bone and soft-tissue sarcomas. Eight consecutive patients with bone and soft tissue sarcomas requiring sternal resection were the focus of this study. Chest wall was reconstructed with a non-rigid or semi-rigid prosthesis combined, in most cases, with soft tissue flap reconstruction. Clinical outcomes investigated included complications, shoulder function, evaluated with Musculoskeletal Tumor Society-International Symposium of Limb Salvage system, and respiratory function, evaluated by use of spirometry. The anterior chest wall was reconstructed with non-rigid strings for 3 patients and with polypropylene mesh for 5. There were no severe post-operative complications, for example surgical site infection or pneumonia. All 3 patients with non-rigid reconstruction experienced paradoxical breathing, whereas none with polypropylene mesh did so. Post-operatively, FEV(1)% was unchanged but %VC was significantly reduced (p = 0.01), irrespective of the reconstruction method used (strings or polypropylene mesh). Shoulder function was not impaired. Among patients undergoing sternal resection, post-operative shoulder function was excellent. Pulmonary function was slightly restricted, but not sufficiently so to interfere with the activities of daily living (ADL). Paradoxical breathing is a slight concern for non-rigid reconstruction.

  10. Primary mediastinal synovial sarcoma: a report of 2 cases.

    Science.gov (United States)

    Kaira, Kyoichi; Ishizuka, Tamotsu; Sunaga, Noriaki; Hashimoto, Koshi; Yanagitani, Noriko; Nonaka, Tetsuo; Ebara, Takeshi; Hisada, Takeshi; Mori, Masatomo

    2008-01-01

    Synovial sarcoma is the third most common histological type of extremity soft tissue sarcoma. However, primary mediastinal synovial sarcoma is extremely rare. We present 2 cases of unresectable primary mediastinal synovial sarcoma. The radiographic imaging of our present cases was characteristic of a heterogeneously enhancing mass. They were treated with radiotherapy and chemotherapy. However, there was complete obstruction of esophagus resulting from progressive diseases. The radiographic findings and treatment were discussed.

  11. Thallium scintigraphy used in the evaluation of soft tissue sarcoma

    International Nuclear Information System (INIS)

    Pilloni, A.; Brooks, R.

    1998-01-01

    Full text: The use of thallium scintigraphy in tumour localisation is a promising diagnostic modality. Thallium has a good affinity for numerous tumour types including sarcomas. Its properties as a potassium analogue result in active uptake via the sodium- potassium ATP-ase pump enabling its use in evaluating tumour extent, viability, staging, localisation and treatment. This case illustrates the role of thallium in tumour staging. A 67-year-old woman with a fibrous histiocytoma resected from the right foot four months previously presented with pain in the ribs, lower back and feet. A bone scan was performed to assess the possibility of metastatic disease. Several abnormal foci were seen on the bone scan suggestive of metastatic disease. A thallium scan was performed to confirm the bone scan result after a subsequent CT scan showed no evidence of this extensive disease. Static images of the whole body were acquired on an Elscinct 400AG 20 minutes post i.v. injection of 3.5 mCi of thallium. Focal areas of increased thallium uptake were seen in the 11th rib posteriorly and in the left sacroiliac region corresponding with sites on the bone scan suggesting metastases. However, an extensive area of uptake was also observed in the right inguinal region which had no corresponding abnormalities in the bone study. This was thought to be tumour metastasis in an inguinal Iymph node, which was retrospectively confirmed on an earlier CT scan of the pelvis. This study demonstrates the usefulness of thallium in the detection of soft tissue tumours and metastases. Thallium also exhibits potential in the assessment of tumour extent and viability pre- and post-treatment. This potential needs to be explored further in patient management

  12. Superficial small round-cell tumors with special reference to the Ewing's sarcoma family of tumors and the spectrum of differential diagnosis.

    Science.gov (United States)

    Machado, Isidro; Traves, Victor; Cruz, Julia; Llombart, Beatriz; Navarro, Samuel; Llombart-Bosch, Antonio

    2013-02-01

    Superficial/cutaneous small round-cell tumors comprise a heterogeneous group of neoplasms including sarcoma, carcinoma, melanoma, and lymphomas. Among superficial sarcomas, the Ewing's sarcoma family of tumors (ESFT) represents a poorly understood rare variant, having a behavioral difference characterized by a relative favorable prognosis. Several problems are still to be resolved in superficial ESFT, including the differential diagnosis between ESFT of bone (intraosseous or periosteal) with superficial infiltration and superficial ESFT with bone infiltration, especially in the fingers. Our aim is to review the most common types of small round-cell tumors included in the differential diagnosis of superficial ESFT, analyzing the histopathology, phenotype, and molecular alterations of each entity. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Treatment of adolescent lumber spondylolysis with modified Boston brace. Selection of the patients with bone scintigraphy and repair of the part defects

    Energy Technology Data Exchange (ETDEWEB)

    Hino, Hiroyuki; Abumi, Kuniyoshi; Kaneda, Kiyoshi; Sato, Eishu [Hokkaido Univ., Sapporo (Japan). School of Medicine

    1996-06-01

    Results of brace treatment of 29 spondylolysis patients were reported. Patients were those who were diagnosed by scout roentgenography and accumulated {sup 99m}Tc at spondylolytic site by bone scintigraphy or by single photon emission computed tomography (SPECT) which being found more convenient to see the accumulation than the scintigraphy. Coaptation after brace treatment was observed by flat and tomographic roentgenography. Under limited sports activity, the hard brace was used for about 4 months and then soft one, for 2 months. Coaptation and repair were observed for 46 (79%) of 58 part defects in the 29 patients. Since lumber spine spondylolysis is mostly caused by fatigue fracture and bone metabolism is activated at the lesional site, {sup 99m}Tc accumulation can be seen at the spondylolytic site by bone scintigraphy with high frequency. Therefore, the rate of repair can be increased when brace treatment was applied for patients with positive bone scintigraphy findings. The scintigraphy was thus useful far selecting patients suitable for brace treatment. (K.H.)

  14. Treatment of adolescent lumber spondylolysis with modified Boston brace. Selection of the patients with bone scintigraphy and repair of the part defects

    International Nuclear Information System (INIS)

    Hino, Hiroyuki; Abumi, Kuniyoshi; Kaneda, Kiyoshi; Sato, Eishu

    1996-01-01

    Results of brace treatment of 29 spondylolysis patients were reported. Patients were those who were diagnosed by scout roentgenography and accumulated 99m Tc at spondylolytic site by bone scintigraphy or by single photon emission computed tomography (SPECT) which being found more convenient to see the accumulation than the scintigraphy. Coaptation after brace treatment was observed by flat and tomographic roentgenography. Under limited sports activity, the hard brace was used for about 4 months and then soft one, for 2 months. Coaptation and repair were observed for 46 (79%) of 58 part defects in the 29 patients. Since lumber spine spondylolysis is mostly caused by fatigue fracture and bone metabolism is activated at the lesional site, 99m Tc accumulation can be seen at the spondylolytic site by bone scintigraphy with high frequency. Therefore, the rate of repair can be increased when brace treatment was applied for patients with positive bone scintigraphy findings. The scintigraphy was thus useful far selecting patients suitable for brace treatment. (K.H.)

  15. Kaposi's sarcoma diagnosed at Mahimbili National Hospital during ...

    African Journals Online (AJOL)

    Kaposi's sarcoma has been strongly linked with HIV/AIDS epidemic in many countries. Data on Kaposi's sarcoma in Tanzania that has been published up to 1992 indicate a strong link withHIV/AIDS. No published reports on Kaposi's sarcoma for the period 1993 to date were available at the time of commencing this study.

  16. Microsatellite instability in sarcoma: fact or fiction?

    Science.gov (United States)

    Monument, Michael J; Lessnick, Stephen L; Schiffman, Joshua D; Randall, Rl Tx

    2012-01-01

    Microsatellite instability (MSI) is a unique molecular abnormality, indicative of a deficient DNA mismatch repair (MMR) system. Described and characterized in the colorectal cancer literature, the MSI-positive phenotype is predictive of disease susceptibility, pathogenesis, and prognosis. The clinical relevance of MSI in colorectal cancer has inspired similar inquisition within the sarcoma literature, although unfortunately, with very heterogeneous results. Evolving detection techniques, ill-defined sarcoma-specific microsatellite loci and small study numbers have hampered succinct conclusions. The literature does suggest that MSI in sarcoma is observed at a frequency similar to that of sporadic colorectal cancers, although there is little evidence to suggest that MSI-positive tumors share distinct biological attributes. Emerging evidence in Ewing sarcoma has demonstrated an intriguing mechanistic role of microsatellite DNA in the activation of key EWS/FLI-target genes. These findings provide an alternative perspective to the biological implications of microsatellite instability in sarcoma and warrant further investigation using sophisticated detection techniques, sensitive microsatellite loci, and appropriately powered study designs.

  17. Olaratumab for advanced soft tissue sarcoma.

    Science.gov (United States)

    Tobias, Alexander; O'brien, Michael P; Agulnik, Mark

    2017-07-01

    Olaratumab is a humanized IgG1 monoclonal antibody that blocks the platelet-derived growth factor receptor alpha (PDGFRα). Its antagonistic behavior inhibits the receptor's tyrosine kinase activity, thereby, turning off the downstream signaling cascades responsible for soft tissue sarcoma tumorigenesis. In October 2016, olaratumab received Food and Drug Administration (FDA) approval for its use in combination with doxorubicin for treatment of advanced soft tissue sarcoma. Areas covered: This drug profile takes a comprehensive look at the clinical studies leading to FDA approval of olaratumab as well as its safety and efficacy as a front-line treatment option for sarcoma patients. The literature search was primarily conducted using PubMed. Expert commentary: The combination of olaratumab plus doxorubicin has provided a new front-line therapeutic option for soft tissue sarcoma patients. An open-label phase Ib and randomized phase II trial in patients with advanced soft tissue sarcoma demonstrated that the addition of olaratumab to doxorubicin prolonged progression-free survival by 2.5 months and overall survival by 11.8 months when compared to doxorubicin alone. Of importance, this clinically meaningful increase in overall survival did not come at the expense of a significantly greater number of toxicities. A phase III confirmatory trial (ClinicalTrials.gov Identifier NCT02451943) will be completed in 2020.

  18. THE RESPONSE OF DISSEMINATED RETICULUM CELL SARCOMA TO THE INTRAVENOUS INJECTION OF COLLOIDAL RADIOACTIVE GOLD

    Energy Technology Data Exchange (ETDEWEB)

    Rubin, Philip; Levitt, Seymour H.

    1963-06-15

    Case histories of two patients treated with colloidal radiogold for diffuse reticulum cell sarcoma are presented. Further analysis of the method is suggested by the unusually long survival time of one of the patients. It was concluded that, although external radiotherapy remains the treatment of choice in localized reticulum cell sarcoma, intravenous colloidal radiogold may be a useful agent in lymphosarcomas with diffuse minute neoplastic liver and spleen involvements. Intravenous colloidal radiogold can produce bone marrow depression and thrombocytopenia which can lead to death. This factor tends to argue against therapeutic use of the agent. It is suggested that no more than 50 mC Au/sup 198/ intravenously should be used for treatment of this disease. (R.M.G.)

  19. Bone tumor

    Science.gov (United States)

    Tumor - bone; Bone cancer; Primary bone tumor; Secondary bone tumor; Bone tumor - benign ... The cause of bone tumors is unknown. They often occur in areas of the bone that grow rapidly. Possible causes include: Genetic defects ...

  20. Sarcomas mandibulares: experiencia quirúrgica en los últimos 10 años Mandibular sarcomas: surgical experience over the past 10 years

    Directory of Open Access Journals (Sweden)

    Javier Gutiérrez Santamaría

    2012-09-01

    Full Text Available Introducción: Los sarcomas mandibulares representan una entidad de difícil estudio por su escasa incidencia e histopatología. Pacientes y métodos: Presentamos la experiencia del servicio de Cirugía Oral y Maxilofacial del Hospital Vall d'Hebron de Barcelona en los últimos 10 años (2001-2010 en el manejo de los sarcomas mandibulares, realizando una revisión retrospectiva de 12 casos de pacientes afectos por este tipo de tumor. Resultados: La técnica más utilizada para la reconstrucción fue el colgajo microvascularizado (hueso peroné: 8/12, recibiendo tratamiento adyuvante (quimioterapia y/o radioterapia el 82% de los pacientes. Cinco pacientes fallecieron (42%, 2 se encuentran con progresión de la enfermedad (16% y 5 sobreviven libres de enfermedad (42% hasta la finalización del seguimiento. Conclusiones: Los casos descritos representan una serie singular debido a la localización mandibular, no antes publicadas en la literatura. Aún así, los resultados obtenidos en términos de supervivencia y factores pronóstico son similares a los descritos para los sarcomas de cabeza y cuello. La consecución de márgenes libres con la cirugía es la clave del tratamiento, siendo necesario el tratamiento complementario para mejorar el pronóstico.Introduction: Sarcomas located in the mandible are difficult to study due to their relatively rare appearance and histology. Patients and Methods: We present the experience of the Oral and Maxillofacial Surgery Department of the Vall d'Hebron Hospital in Barcelona over the last 10 years (2001-2010 in the management of jaw sarcomas, performing a retrospective review of 12 cases of patients affected by this type of tumour. Results: The technique mostly used for the reconstruction was the microvascularised bone graft (fibula: 8/12, with 82% of the patients receiving adjuvant therapy (chemotherapy and radiotherapy. Five of the patients died (42%, two were found with disease progression (16%, and 5

  1. The use of thallium-201 scintigraphy in the assessment and management of bone and soft tissue tumours

    International Nuclear Information System (INIS)

    Jong, I.; Schlicht, S.M.; Smith, P.; J Slavin; Powell, G.; Choong, P.F.M.

    2004-01-01

    Introduction: Thallium-201 scintigraphy is routinely performed on all patients presenting to the bone and soft tissue sarcoma service at St. Vincent's Hospital Melbourne. Methods: As part of the multimodality approach to patients presenting to the service, Thallium-201 planar images are obtained at 30 minutes following a resting injection of tracer with delayed planar and where possible SPECT images at 4 hours. Uptake is qualitatively assessed using adjacent muscle uptake at the time of the scan. All thallium-201 scans are read in conjunction with the correlative structural images performed. Results: High grade bone and soft tissue sarcomas typically show significant retention of tracer relative to background activity and adjacent anatomically structures. Benign lesions may show early activity but typically washout on the delayed images. However, some lesions may show marked thallium-201 activity which will be discussed. At our institution the thallium-201 scans are used for assessment of metabolic activity and tumour grade, planning of image guided pre-treatment biopsies and monitoring of treatment response particularly following radiotherapy. Conclusion: Thallium-201 scintigraphy plays a vital role in assessment and management of bone and soft tissue tumours at our institution. (authors)

  2. Sarcomas cutâneos primários Primary cutaneous sarcomas

    Directory of Open Access Journals (Sweden)

    Luiz Fernando Fróes Fleury Jr

    2006-06-01

    Full Text Available Os sarcomas com apresentação cutânea primária são tumores raros e de grande heterogeneidade histológica. Com a evolução da oncologia cutânea e da cirurgia dermatológica, os dermatologistas têm sido cada vez mais requisitados para o diagnóstico e orientação terapêutica de tumores menos freqüentes. Este artigo de revisão analisa os sarcomas cutâneos primários observando suas características clínicas, etiopatogênicas e histológicas, bem como aspectos do tratamento e evolução. Enfatiza os sarcomas de maior relevância para o dermatologista, como angiossarcoma, dermatofibrossarcoma protuberans, fibroxantoma atípico, leiomiossarcoma, lipossarcoma, tumor maligno de bainha de nervo periférico e sarcoma epitelióide. O sarcoma de Kaposi não é abordado devido a suas características individuais específicas.Soft tissue tumors represent a heterogeneous group of mesenchymal and neural lesions. The cutaneous presentation of these tumours is rare. With the evolution of dermatologic surgery and cutaneous oncology, dermatologists have emerged as specialists for skin cancer management. This article reviews primary cutaneous sarcomas with particular emphasis on the epidemiologic, clinical, and histological features of diagnosis, as well as treatment modalities and prognosis. The most frequent cutaneous sarcomas were reviewed, including angiosarcoma, dermatofibrosarcoma protuberans, atypical fibroxanthoma, leiomyosarcoma, liposarcoma, malignant nerve sheath tumor, and epithelioid sarcoma. Kaposi's sarcoma, due to specific characteristics, was omitted from this review.

  3. Kaposi sarcoma following postmastectomy lymphedema.

    Science.gov (United States)

    Montero Pérez, Iria; Rodríguez-Pazos, Laura; Álvarez-Pérez, Adriana; Ferreirós, M Mercedes Pereiro; Aliste, Carlos; Suarez-Peñaranda, Jose Manuel; Toribio, Jaime

    2015-11-01

    Classical Kaposi sarcoma (KS) usually appears on lower extremities accompanied or preceded by local lymphedema. However, the development in areas of chronic lymphedema of the arms following mastectomy, mimicking a Stewart-Treves syndrome, has rarely been described. We report an 81-year-old woman who developed multiple, erythematous to purple tumors, located on areas of post mastectomy lymphedema. Histopathological examination evidenced several dermal nodules formed by spindle-shaped cells that delimitated slit-like vascular spaces with some red cell extravasation. Immunohistochemically, the human herpesvirus type 8 (HHV-8) latent nuclear antigen-1 was detected in the nuclei of most tumoral cells confirming the diagnosis of KS. Lymphedema could promote the development of certain tumors by altering immunocompetence. Although angiosarcoma (AS) is the most frequent neoplasia arising in the setting of chronic lymphedema, other tumors such as benign lymphangiomatous papules (BLAP) or KS can also develop in lymphedematous limbs. It is important to establish the difference between AS and KS because their prognosis and treatment are very different. Identification by immunohistochemistry of HHV-8 is useful for the distinction between KS and AS or BLAP. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Generalized intramuscular granulocytic sarcoma mimicking polymyositis

    Energy Technology Data Exchange (ETDEWEB)

    Fritz, Jan; Claussen, Claus D.; Pereira, Philippe L.; Horger, Marius S. [Eberhard-Karls-University, Department of Diagnostic Radiology, Tuebingen (Germany); Vogel, Wichard [Eberhard-Karls-University, Department of Internal Medicine-Oncology, Tuebingen (Germany); Wehrmann, Martin [Eberhard-Karls-University, Department of Pathology, Tuebingen (Germany)

    2007-10-15

    We report a case of granulocytic sarcoma exclusively manifesting as diffuse intramuscular infiltration of the proximal upper and lower limb girdle and the torso muscles in a patient with previous history of acute myelogenous leukemia 5a. Whole-body CT showed widespread distribution of ill-defined intramuscular, homogeneously enhancing lesions. On whole-body MRI, lesions were homogeneously hyperintense on fat saturated T2-weighted images, isointense on T1-weighted images and strongly enhancing after intravenous gadolinium contrast administration. Histopathology revealed muscular infiltration of blast cells with identical immunochemistry to the initial manifestation of leukemia, diagnostic for an extramedullary relapse manifesting as granulocytic sarcoma. CT and MRI characteristics of this previously undocumented manifestation of granulocytic sarcoma should assist in the identification of such cases. (orig.)

  5. Synovial sarcoma of the chest wall.

    Science.gov (United States)

    Kawano, Daigo; Yoshino, Ichiro; Shoji, Fumihiro; Morodomi, Yosuke; Yano, Tokujiro; Maehara, Yoshihiko

    2010-02-01

    We here report a rare case of synovial sarcoma of the chest wall. A 71-year-old Japanese woman noticed a left anterior chest wall mass after twice having had surgery for lung cancer. An aspiration biopsy diagnosed synovial sarcoma. She then underwent a surgical resection. Pathology examination revealed a biphasic-type synovial sarcoma. When the prepared RNA from the tumor was subjected to a polymerase chain reaction, SYT-SSX1 fusion gene transcripts were demonstrated. Patients with the SYT-SSX1 fusion gene have a worse clinical outcome than patients with SYT-SSX2-positive tumors. After a second surgery, performed in 1 year later, there was no evidence of recurrence for 30 months; however, careful observation may be required.

  6. Primary mediastinal giant synovial sarcoma: A rare case report

    Directory of Open Access Journals (Sweden)

    Gaetano Rea

    2015-03-01

    Full Text Available Synovial sarcoma has been defined by the World Health Organization (WHO in 2002 as a type of mesenchymal tissue cell tumor that exhibits epithelial differentiation and represents the third most common soft-tissue sarcoma in adults, accounting for approximately 10% of soft-tissue sarcomas. To date, only few reports have focused on mediastinal synovial sarcoma imaging findings. Herein, we report a case of a 13 cm primary mediastinal giant synovial sarcoma, diagnosed in a 56-year-old patient admitted in our Department of Radiology with a six-month history of dyspnea and back pain.

  7. Primary mediastinal giant synovial sarcoma: A rare case report

    OpenAIRE

    Rea, Gaetano; Somma, Francesco; Valente, Tullio; Antinolfi, Giuseppe; Di Grezia, Graziella; Gatta, Gianluca

    2015-01-01

    Synovial sarcoma has been defined by the World Health Organization (WHO) in 2002 as a type of mesenchymal tissue cell tumor that exhibits epithelial differentiation and represents the third most common soft-tissue sarcoma in adults, accounting for approximately 10% of soft-tissue sarcomas. To date, only few reports have focused on mediastinal synovial sarcoma imaging findings. Herein, we report a case of a 13 cm primary mediastinal giant synovial sarcoma, diagnosed in a 56-year-old patient ad...

  8. Molecular piracy of Kaposi's sarcoma associated herpesvirus.

    Science.gov (United States)

    Choi, J; Means, R E; Damania, B; Jung, J U

    2001-01-01

    Kaposi's Sarcoma associated Herpesvirus (KSHV) is the most recently discovered human tumor virus and is associated with the pathogenesis of Kaposi's sarcoma, primary effusion lymphoma, and Multicentric Casttleman's disease. KSHV contains numerous open reading frames with striking homology to cellular genes. These viral gene products play a variety of roles in KSHV-associated pathogenesis by disrupting cellular signal transduction pathways, which include interferon-mediated anti-viral responses, cytokine-regulated cell growth, apoptosis, and cell cycle control. In this review, we will attempt to cover our understanding of how viral proteins deregulate cellular signaling pathways, which ultimately contribute to the conversion of normal cells to cancerous cells.

  9. Embryonal sarcoma of the liver: case report

    International Nuclear Information System (INIS)

    Moreno, Luz A; Garzon C, Julian G; Montoya Ruben D; Murcia Susana

    2009-01-01

    Embryonal hepatic sarcoma occupies the third place in frequency among hepatic tumors in the pediatric population. Its clinical symptoms are usually non specific, and its appearance in diagnostic images is of a solid mass with a cystic component. Even though a histological confirmation is necessary, the initial management is oriented based on the imaging findings. This article presents a case report of a 9 year old girl with the diagnosis of an embryonal hepatic sarcoma; a description is done of the main clinical, histological and imaging characteristics.

  10. Cellular immunotherapy for soft tissue sarcomas

    Science.gov (United States)

    Finkelstein, Steven Eric; Fishman, Mayer; Conley, Anthony P.; Gabrilovich, Dmitry; Antonia, Scott; Chiappori, Alberto

    2015-01-01

    SUMMARY Soft tissue sarcomas are rare neoplasms, with approximately 9,000 new cases in the United States every year. Unfortunately, there is little progress in the treatment of metastatic soft tissue sarcomas in the past two decades beyond the standard approaches of surgery, chemotherapy, and radiation. Immunotherapy is a modality complementary to conventional therapy,. It is appealing because functional anti-tumor activity could affect both local-regional and systemic disease and act over a prolonged period of time. In this report, we review immunotherapeutic investigative strategies being developed, including several tumor vaccine, antigen vaccine, and dendritic cell vaccine strategies. PMID:22401634

  11. A case of clear cell sarcoma

    DEFF Research Database (Denmark)

    Juel, Jacob; Ibrahim, Rami Mossad

    2017-01-01

    INTRODUCTION: Clear cell sarcoma (CCS) is a rare tumour of the soft tissue often misdiagnosed, as it shares characteristics with malignant melanoma (MM). Previously, CCS has been characterised, as malignant melanoma of the soft tissue, contemporary immunohistochemical techniques, however, have made...... this designation obsolete. The true incidence remains unknown, but CCS is believed to represent less than one percent of all sarcomas. PRESENTATION OF CASE: A 22-year-old patient presented with a mass sized 2.6×2.7×2.7cm of the left gluteal region, pain, and malaise. Initially, the symptoms were interpreted...

  12. Soft tissue sarcoma of the extremity.

    LENUS (Irish Health Repository)

    Cooper, T M

    2012-02-03

    A retrospective review of 33 cases of soft tissue sarcoma of the extremity presenting over a 10 year period was undertaken. The history, patterns of referral, diagnostic investigations, procedures undertaken and outcomes were studied. We found there was a frequent delay in diagnosis and sometimes misinterpretation of biopsy specimens. Patients were seen by a variety of specialists from disciplines such as general surgery, plastic surgery, orthopaedic surgery and rheumatology. Considerable progress has been made in the treatment of soft tissue sarcomas, often allowing local control of the tumour without amputation. We believe there should be early referral of patients having these tumours to a centre where a combined multidisciplinary approach can be undertaken.

  13. Targeting protein kinases to reverse multidrug resistance in sarcoma.

    Science.gov (United States)

    Chen, Hua; Shen, Jacson; Choy, Edwin; Hornicek, Francis J; Duan, Zhenfeng

    2016-02-01

    Sarcomas are a group of cancers that arise from transformed cells of mesenchymal origin. They can be classified into over 50 subtypes, accounting for approximately 1% of adult and 15% of pediatric cancers. Wide surgical resection, radiotherapy, and chemotherapy are the most common treatments for the majority of sarcomas. Among these therapies, chemotherapy can palliate symptoms and prolong life for some sarcoma patients. However, sarcoma cells can have intrinsic or acquired resistance after treatment with chemotherapeutics drugs, leading to the development of multidrug resistance (MDR). MDR attenuates the efficacy of anticancer drugs and results in treatment failure for sarcomas. Therefore, overcoming MDR is an unmet need for sarcoma therapy. Certain protein kinases demonstrate aberrant expression and/or activity in sarcoma cells, which have been found to be involved in the regulation of sarcoma cell progression, such as cell cycle, apoptosis, and survival. Inhibiting these protein kinases may not only decrease the proliferation and growth of sarcoma cells, but also reverse their resistance to chemotherapeutic drugs to subsequently reduce the doses of anticancer drugs and decrease drug side-effects. The discovery of novel strategies targeting protein kinases opens a door to a new area of sarcoma research and provides insight into the mechanisms of MDR in chemotherapy. This review will focus on the recent studies in targeting protein kinase to reverse chemotherapeutic drug resistance in sarcoma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. AIDS-related Kaposi sarcoma: findings on thallium-201 scintigraphy

    International Nuclear Information System (INIS)

    Lee, V.W.; Rosen, M.P.; Baum, A.; Cohen, S.E.; Cooley, T.P.; Liebman, H.A.

    1988-01-01

    No simple, noninvasive method is available for evaluating extracutaneous Kaposi sarcoma in AIDS patients or for following the tumor's response to treatment. We report our preliminary experience with thallium-201 scintigraphy in nine AIDS patients with proved Kaposi sarcoma. Eight of the nine had abnormal uptake of the radionuclide in skin, lymph nodes, oral cavity, vagina, and lungs. Only four of the nine had cutaneous Kaposi sarcoma at the time of scanning. All cutaneous and mucosal lesions were thallium avid. Two of the six patients with thallium-avid nodes underwent nodal biopsy. Both biopsies confirmed the diagnosis of Kaposi sarcoma. Cutaneous Kaposi sarcoma developed later in one of these patients, showing the efficacy of thallium scintigraphy for the early detection of extracutaneous lesions. These preliminary results show thallium avidity in Kaposi sarcoma involving the skin and various extracutaneous sites (lymph nodes, lung, mucosa, and vagina). Thallium scintigraphy is a potentially useful procedure for detecting extracutaneous Kaposi sarcoma in AIDS patients

  15. Autophagy as a potential target for sarcoma treatment.

    Science.gov (United States)

    Min, Li; Choy, Edwin; Pollock, Raphael E; Tu, Chongqi; Hornicek, Francis; Duan, Zhenfeng

    2017-08-01

    Autophagy is a constitutively active, evolutionary conserved, catabolic process for maintaining homeostasis in cellular stress responses and cell survival. Although its mechanism has not been fully illustrated, recent work on autophagy in various types of sarcomas has demonstrated that autophagy exerts an important role in sarcoma cell growth and proliferation, in pro-survival response to therapies and stresses, and in therapeutic resistance of sarcoma. Thus, the autophagic process is being seen as a possibly novel therapeutic target of sarcoma. Additionally, some co-regulators of autophagy have also been investigated as promising biomarkers for the diagnosis and prognosis of sarcoma. In this review, we summarize contemporary advances in the role of autophagy in sarcoma and discuss the potential of autophagy as a new target for sarcoma treatment. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Mathematical modeling of bone marrow--peripheral blood dynamics in the disease state based on current emerging paradigms, part I.

    Science.gov (United States)

    Afenya, Evans K; Ouifki, Rachid; Camara, Baba I; Mundle, Suneel D

    2016-04-01

    Stemming from current emerging paradigms related to the cancer stem cell hypothesis, an existing mathematical model is expanded and used to study cell interaction dynamics in the bone marrow and peripheral blood. The proposed mathematical model is described by a system of nonlinear differential equations with delay, to quantify the dynamics in abnormal hematopoiesis. The steady states of the model are analytically and numerically obtained. Some conditions for the local asymptotic stability of such states are investigated. Model analyses suggest that malignancy may be irreversible once it evolves from a nonmalignant state into a malignant one and no intervention takes place. This leads to the proposition that a great deal of emphasis be placed on cancer prevention. Nevertheless, should malignancy arise, treatment programs for its containment or curtailment may have to include a maximum and extensive level of effort to protect normal cells from eventual destruction. Further model analyses and simulations predict that in the untreated disease state, there is an evolution towards a situation in which malignant cells dominate the entire bone marrow - peripheral blood system. Arguments are then advanced regarding requirements for quantitatively understanding cancer stem cell behavior. Among the suggested requirements are, mathematical frameworks for describing the dynamics of cancer initiation and progression, the response to treatment, the evolution of resistance, and malignancy prevention dynamics within the bone marrow - peripheral blood architecture. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Primary Ewing's sarcoma of the vertebral column

    Energy Technology Data Exchange (ETDEWEB)

    Ilaslan, Hakan; Sundaram, Murali [Department of Radiology, Mayo Clinic, Ch2-290 200 First Street, SW, Rochester, 55905, MN (United States); Unni, K.Krishnan [Department of Laboratory Medicine and Pathology, Mayo Clinic, 200 First Street, SW, 55905, Rochester, MN (United States); Dekutoski, Mark B. [Department of Orthopedic Surgery, Mayo Clinic, 200 First Street, SW, 55905, Rochester, MN (United States)

    2004-09-01

    To determine the demographics, imaging findings, clinical symptoms, and prognosis of primary vertebral Ewing's sarcoma (PVES). A retrospective review of medical records and radiological studies of patients diagnosed with PVES from 1936 through 2001 in our institution and Department of Pathology consultation files was undertaken. Metastatic and soft tissue Ewing's sarcoma cases were excluded. From a total of 1,277 cases of Ewing's sarcoma, 125 (9.8%) had a primary vertebral origin. There were 48 females and 76 males. Patient ages ranged from 4 to 54 (mean 19.3, standard deviation 10.7, median 16) years. Vertebral column distribution was four cervical (3.2%), 13 thoracic (10.5%), 31 lumbar (25%), and 67 sacrum (53.2%). More than one vertebral segment was involved in ten cases (8%). Satisfactory imaging studies were available in 51 patients: 49 radiographs, 27 computerized tomography (CT), and 23 magnetic resonance imaging (MRI) studies. The majority of tumors were lytic (93%). Three cases were mixed lytic and sclerotic (6%) and one sclerotic. In the nonsacral spine, the majority of lesions (12/20) involved the posterior elements with extension into the vertebral body. Five cases were centered in the vertebral body with extension into the posterior elements. Two cases were limited to the posterior elements, and one case solely involved the vertebral body. Ala was the most frequently affected site in the sacrum (18/26). Spinal canal invasion was frequent (91%). Detailed clinical information was available in 53 patients. Duration of symptoms ranged from 1 to 30 (mean 7) months. Local pain was the first symptom and seen in all cases. Neurological deficits were present in 21 (40%) cases. All patients received radiation in various dosages; 70% additionally received chemotherapy. Twenty-five patients had surgery, and two patients received bone marrow transplantation. Forty-five patients had follow-up; the five-year disease-free survival probability is 0

  18. Adjuvant brachytherapy for treatment of chest wall sarcomas

    International Nuclear Information System (INIS)

    Wallner, K.E.; Nori, D.; Burt, M.; Bains, M.; McCormack, P.

    1991-01-01

    Thirty patients treated with surgical resection and brachytherapy for chest wall sarcoma at Memorial Sloan-Kettering Cancer Center from 1980 through 1987 were reviewed. Patients selected to receive adjuvant irradiation were those for whom there was doubt as to the completeness of surgical resection. Overall 5-year survival and locoregional control after brachytherapy were 65% and 54%, respectively. Locoregional control was similar for tumors treated at initial diagnosis (12 patients), at the time of recurrence (13 patients), or for tumors that were metastatic to the chest wall (five patients). Six patients with tumors larger than 10 cm in maximum dimension had a locoregional recurrence rate of 69% versus a recurrence rate of 39% for 18 patients with smaller tumors (p = 0.27). Fifty-four percent of high-grade tumors recurred locoregionally versus 28% of low-grade tumors (p = 0.37). Bone invasion or the presence of positive resection margins was not clearly associated with a higher locoregional failure rate. Only one patient (1/28; 7%) was known to have had recurrence within the irradiated area. Eight patients (8/28; 37%) had recurrence adjacent to the implanted area, and the precise failure site could not be determined for the remaining two patients. Because of the relatively high risk of regional versus in-field recurrence, patients with chest wall sarcoma who receive adjuvant treatment should be treated primarily with external-beam irradiation to allow more generous coverage of the tumor bed. Brachytherapy could be used as a tumor bed 'boost' treatment. In patients undergoing resection of recurrent tumor in a previously irradiated site, adjuvant brachytherapy, without external-beam irradiation, should be considered to reduce the risk of extensive soft tissue necrosis

  19. Comparative pathogenesis of radium-induced intracortical bone lesions in humans and beagles

    Energy Technology Data Exchange (ETDEWEB)

    Pool, R.R. (Univ. of California, Davis); Morgan, J.P.; Parks, N.J.; Farnham, J.E.; Littman, M.S.

    1983-01-01

    Morphologic changes resulting from the effects of chronic radionuclide toxicity (/sup 226/Ra) in the skeletons of workers in the radioluminescent dial painting industry with preterminal body burdens ranging from about 1.5 to 0.042 ..mu..Ci were compared with the pathologic alterations in the skeletons of a group of 38 beagle dogs injected with 1.12 ..mu..Ci/kg. Similarities observed in the skeletal responses of the two species were the presence of (1) dead bone tissue with delayed resolution, (2) a chronic disturbance in the remodeling mechanism of bone tissue, and (3) radiation-induced bone sarcomas. A detailed analysis of sequential changes in radiographic lesions arising in the beagle skeletons, complemented by histopathologic evaluation at the time of limb amputation or at necropsy, has enabled us to examine the disturbance in the bone remodeling process. The perturbation of critical importance in the generation of primary bone tumors appears to lie in the bone tissue formation and deposition phase of the bone remodeling process and gives rise to a spectrum of histologic patterns which we have termed ''radiation osteodystrophy.'' While some of the newly generated patterns demonstrate indolent behavior with fibrous tissue replacement and bone marrow refill, other sites of bone resorption are replaced by a unique fibro-osseous tissue response resembling fibrous dysplasia or osteoblastoma. Some of these proliferative lesions may undergo progressive malignant degeneration. While the more indolent part of the spectrum was also seen in human skeletal tissues, only premalignant and early sarcomatous stages were seen in canine tissues.

  20. Radiographic analysis of pasteurized autologous bone graft

    International Nuclear Information System (INIS)

    Ahmed, Adel Refaat; Manabe, Jun; Kawaguchi, Noriyoshi; Matsumoto, Seiichi; Matsushita, Yasushi

    2003-01-01

    Local malignant bone tumor excision followed by pasteurization and subsequent reimplantation is a unique technique for reconstruction after resection of primary bone sarcomas. The purpose of this investigation was to assess the normal and abnormal long-term radiographic findings of intercalary and osteo-chondral pasteurized bone graft/implant composite. The long-term radiographic findings of pasteurized bone grafts used in reconstruction after resection of bone and soft tissue sarcomas in relation to patients' clinical data were reviewed retrospectively. Thirty-one patients (18 females, 13 males; age range 7-77 years, mean 30 years) who underwent surgery between April 1990 and January 1997 at the authors' institute constituted the material of this study. They were followed up for at least 3 years or until the patient's death (mean 69 months). The International Society of Limb Salvage graft evaluation method that assesses the fusion, resorption, fracture, graft shortening, fixation, subluxation, joint narrowing and subchondral bone was used for evaluation of the radiographs. Twenty-one patients (68%) showed complete incorporation of graft and eight patients (26%) had partial incorporation. The overall radiographic evaluation rate was 81%. Fracture (10%) and infection (16%) were the main complications. No local recurrence was detected. These results indicate that pasteurization of bone is a useful option for reconstruction after resection of malignant bone tumors. (orig.)

  1. Radiographic analysis of pasteurized autologous bone graft.

    Science.gov (United States)

    Ahmed, Adel Refaat; Manabe, Jun; Kawaguchi, Noriyoshi; Matsumoto, Seiichi; Matsushita, Yasushi

    2003-08-01

    Local malignant bone tumor excision followed by pasteurization and subsequent reimplantation is a unique technique for reconstruction after resection of primary bone sarcomas. The purpose of this investigation was to assess the normal and abnormal long-term radiographic findings of intercalary and osteo-chondral pasteurized bone graft/implant composite. The long-term radiographic findings of pasteurized bone grafts used in reconstruction after resection of bone and soft tissue sarcomas in relation to patients' clinical data were reviewed retrospectively. Thirty-one patients (18 females, 13 males; age range 7-77 years, mean 30 years) who underwent surgery between April 1990 and January 1997 at the authors' institute constituted the material of this study. They were followed up for at least 3 years or until the patient's death (mean 69 months). The International Society of Limb Salvage graft evaluation method that assesses the fusion, resorption, fracture, graft shortening, fixation, subluxation, joint narrowing and subchondral bone was used for evaluation of the radiographs. Twenty-one patients (68%) showed complete incorporation of graft and eight patients (26%) had partial incorporation. The overall radiographic evaluation rate was 81%. Fracture (10%) and infection (16%) were the main complications. No local recurrence was detected. These results indicate that pasteurization of bone is a useful option for reconstruction after resection of malignant bone tumors.

  2. Radiographic analysis of pasteurized autologous bone graft

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, Adel Refaat [Department of Orthopedic Surgery, Cancer Institute Hospital, Japanese Foundation for Cancer Research, Kamiikebukuro 1-37-1, Toshima-ku, 170-0012, Tokyo (Japan); Department of Orthopedic Surgery, Alexandria University, Alexandria (Egypt); Manabe, Jun; Kawaguchi, Noriyoshi; Matsumoto, Seiichi; Matsushita, Yasushi [Department of Orthopedic Surgery, Cancer Institute Hospital, Japanese Foundation for Cancer Research, Kamiikebukuro 1-37-1, Toshima-ku, 170-0012, Tokyo (Japan)

    2003-08-01

    Local malignant bone tumor excision followed by pasteurization and subsequent reimplantation is a unique technique for reconstruction after resection of primary bone sarcomas. The purpose of this investigation was to assess the normal and abnormal long-term radiographic findings of intercalary and osteo-chondral pasteurized bone graft/implant composite. The long-term radiographic findings of pasteurized bone grafts used in reconstruction after resection of bone and soft tissue sarcomas in relation to patients' clinical data were reviewed retrospectively. Thirty-one patients (18 females, 13 males; age range 7-77 years, mean 30 years) who underwent surgery between April 1990 and January 1997 at the authors' institute constituted the material of this study. They were followed up for at least 3 years or until the patient's death (mean 69 months). The International Society of Limb Salvage graft evaluation method that assesses the fusion, resorption, fracture, graft shortening, fixation, subluxation, joint narrowing and subchondral bone was used for evaluation of the radiographs. Twenty-one patients (68%) showed complete incorporation of graft and eight patients (26%) had partial incorporation. The overall radiographic evaluation rate was 81%. Fracture (10%) and infection (16%) were the main complications. No local recurrence was detected. These results indicate that pasteurization of bone is a useful option for reconstruction after resection of malignant bone tumors. (orig.)

  3. Bone substitute biomaterials

    CERN Document Server

    Mallick, K

    2014-01-01

    Bone substitute biomaterials are fundamental to the biomedical sector, and have recently benefitted from extensive research and technological advances aimed at minimizing failure rates and reducing the need for further surgery. This book reviews these developments, with a particular focus on the desirable properties for bone substitute materials and their potential to encourage bone repair and regeneration. Part I covers the principles of bone substitute biomaterials for medical applications. One chapter reviews the quantification of bone mechanics at the whole-bone, micro-scale, and non-scale levels, while others discuss biomineralization, osteoductivization, materials to fill bone defects, and bioresorbable materials. Part II focuses on biomaterials as scaffolds and implants, including multi-functional scaffolds, bioceramics, and titanium-based foams. Finally, Part III reviews further materials with the potential to encourage bone repair and regeneration, including cartilage grafts, chitosan, inorganic poly...

  4. Molecular characterization of interdigitating dendritic cell sarcoma

    Directory of Open Access Journals (Sweden)

    Glen J. Weiss

    2010-08-01

    Full Text Available Interdigitating dendritic cell sarcoma is an extremely rare cancer that lacks a standard treatment approach. We report on a patient who was surgically resected and remains disease-free. The tumor was assessed for druggable targets using immunohistochemical staining to identify potential agents that could be used in the event of disease recurrence.

  5. Combination Therapy for Advanced Kaposi Sarcoma

    Science.gov (United States)

    In this clinical trial, adult patients with any form of advanced Kaposi sarcoma will be treated with liposomal doxorubicin and bevacizumab every 3 weeks for a maximum of six treatments.  Patients who respond to this therapy or have stable disease will rec

  6. Lymphadenopathic kaposi sarcoma in an immunocompetent young ...

    African Journals Online (AJOL)

    Kaposi's sarcoma (KS) is a vascular lesion that usually originates from several sites in the mid-dermis extending into the dermis. Infection from human herpes virus type 8 (HHV-8) is the mostly associated cause. Several articles reported cases of KS, first in Africa, then worldwide because of its close association with HIV ...

  7. Osteogenic sarcoma presenting with lung metastasis.

    Science.gov (United States)

    Staddon, Arthur P; Lackman, Richard; Robinson, Keith; Shrager, Joseph B; Warhol, Michael

    2002-01-01

    A patient with osteogenic sarcoma presenting with lung metastases is discussed with attention to appropriate diagnosis, staging, and treatment. Multimodality treatment options using chemotherapy, orthopedic surgery and thoracic surgery are presented. Physical medicine and rehabilitation evaluation and treatment are included. Current research options are discussed.

  8. The Value of Surgery for Retroperitoneal Sarcoma

    Directory of Open Access Journals (Sweden)

    Sepideh Gholami

    2009-01-01

    Full Text Available Introduction. Retroperitoneal sarcomas are uncommon large malignant tumors. Methods. Forty-one consecutive patients with localized retroperitoneal sarcoma were retrospectively studied. Results. Median age was 58 years (range 20–91 years. Median tumor size was 17.5 cm (range 4–41 cm. Only 2 tumors were <5 cm. Most were liposarcoma (44% and high-grade (59%. 59% were stage 3 and the rest was stage 1. Median followup was 10 months (range 1–106 months. Thirty-eight patients had an initial complete resection; 15 (37% developed recurrent sarcoma and 12 (80% had a second complete resection. Patients with an initial complete resection had a 5-year survival of 46%. For all patients, tumor grade affected overall survival (=.006. Complete surgical resection improved overall survival for high-grade tumors (=.03. Conclusions. Tumor grade/stage and complete surgical resection for high-grade tumors are important prognostic variables. Radiation therapy or chemotherapy had no significant impact on overall or recurrence-free survival. Complete surgical resection is the treatment of choice for patients with initial and locally recurrent retroperitoneal sarcoma.

  9. Treatment of classical Kaposi's sarcoma with gemcitabine

    NARCIS (Netherlands)

    Brambilla, L; Labianca, R; Ferrucci, SM; Taglioni, M; Boneschi, [No Value

    2001-01-01

    Background: Several drugs are active in aggressive classical Kaposi's sarcoma (CKS); chemotherapeutic agents with fewer side-effects, more rapid response and able to overcome resistance to previous treatment are advisable when treating patients in a second line. Gemcitabine, an analogue of

  10. Advantages of 18F FDG-PET/CT over Conventional Staging for Sarcoma Patients.

    Science.gov (United States)

    Németh, Zsuzsanna; Boér, Katalin; Borbély, Katalin

    2017-10-09

    The effective management of patients with sarcomas requires accurate diagnosis and staging. Imaging, such as ultrasonography (US), computed tomography (CT), magnetic resonance imaging (MRI) are the most freqently used methods for the detection of the lesion location, size, morphology and structural changes to adjacent tissues; however, these modalities provide little information about tumour biology. MRI is a robust and useful modality in tumour staging of sarcomas, however metabolic-fluorodeoxyglucose positron emission tomography/ computer tomography ( 18 F-FDG PET/CT) provides greater accuracy to overall staging in combination with MRI [1]. The advantages of 18 F-FDG PET/CT method compared with CT and MRI is that it provides a whole body imaging, maps the viability of the tumour or the metabolic activity of the tissue. Additionally, PET detects the most agressive part of the tumour, demonstrates the biological behaviour of the tumour and therefore has a predictive value. Little data ara available on the role of 18 F-FDG PET/CT in the management of sarcomas. The present manuscript aims to provide a review of the major indications of 18 F-FDG PET/CT for diagnosis, staging, restaging and monitoring response to therapy and to compare its usefulness with the conventional imaging modalities in the management of patients with sarcomas.

  11. Sarcomas primitivos do pulmão

    Directory of Open Access Journals (Sweden)

    F. Caeiro

    1998-07-01

    Full Text Available RESUMO: Os sarcomas primitivos do pulmão são raros, representando 0.1 % de todas as neoplasias pulmonares malignas.No presente trabalho os autores reveem 5 casos clinicos diagnosticodos no periodo compreendido entre 1985 e 1997.A série inclui 4 doentes do sexo musculino e l do sexo femimino, com idades entre os 21 e os 73 anos. Apenas um doente era fumador.A sintomatologia mais frequente foi a toracalgia, a tosse seca. a dispneia e a expeetoração hemoptoica.O diagnóstieo hislopatológico foi feito em 3 casos através da peça operatória e cm 2 por biópsia brôm quica. Os tipos histológicos encontrados foram: 2 leiomiossarcomas, I rabdomiossarcoma, 1 careinos-sarcoma e 1 sarcoma poueo diferenciado.No que sc refere à terapêutica, todos os doentes tratados foram submetidos a cirurgia, tendo efectua-do cm 3 casos terapêutica adjuvante com quimiote-rapia ou quimioterapia+radioterapia.Após o dingnóstieo, os doentes sobreviveram entre 6 dias e 49 meses. Apesar da maioria ter sido submetida a cirurgia. apenas um doente sobreviveu para além dos 3 anos, o que está de acordu cum a agressividade destas neoplasias.REV PORT PNEUMOL 1998; IV (4: 403-412 ABSTRACT: Primary pulmonary sarcomas represent 0.1% of all primary lung neoplasms.In this work w e reviewed a consecutive serie of patients with this diagnosis, treated al our department between the period of 1985 and 1997.Four patients were males and I female, aged between 21 and 72 years old. Only one was a smoker.The most frequent symptoms were chest pain, cough, dyspnea and hemoptoic sputum.The diagnosis was obtained by surgery in 3 patients and by bronchial biopsy in 2 cases. The histologic types observed w ere 2 leiomyossareomas. 1 rabdomyossarcoma, I carcinossarcoma and I low diferentiated sarcoma.Four patients were treated with pulmonary surgery and in 3 cases plus thoracic irradiation and chemotherapy or simply chemotherapy.After the diagnosis, patients had survived between 6 days and

  12. Productively infected murine Kaposi's sarcoma-like tumors define new animal models for studying and targeting KSHV oncogenesis and replication.

    Directory of Open Access Journals (Sweden)

    Brittany M Ashlock

    Full Text Available Kaposi's sarcoma (KS is an AIDS-defining cancer caused by the KS-associated herpesvirus (KSHV. KS tumors are composed of KSHV-infected spindle cells of vascular origin with aberrant neovascularization and erythrocyte extravasation. KSHV genes expressed during both latent and lytic replicative cycles play important roles in viral oncogenesis. Animal models able to recapitulate both viral and host biological characteristics of KS are needed to elucidate oncogenic mechanisms, for developing targeted therapies, and to trace cellular components of KS ontogeny. Herein, we describe two new murine models of Kaposi's sarcoma. We found that murine bone marrow-derived cells, whether established in culture or isolated from fresh murine bone marrow, were infectable with rKSHV.219, formed KS-like tumors in immunocompromised mice and produced mature herpesvirus-like virions in vivo. Further, we show in vivo that the histone deacetylase (HDAC inhibitor suberoylanilide hydroxamic acid (SAHA/Vorinostat enhanced viral lytic reactivation. We propose that these novel models are ideal for studying both viral and host contributions to KSHV-induced oncogenesis as well as for testing virally-targeted antitumor strategies for the treatment of Kaposi's sarcoma. Furthermore, our isolation of bone marrow-derived cell populations containing a cell type that, when infected with KSHV, renders a tumorigenic KS-like spindle cell, should facilitate systematic identification of KS progenitor cells.

  13. Differential Diagnosis of Isolated Myeloid Sarcoma: A Case Report and Review of the Literature.

    Science.gov (United States)

    Hagen, Patrick A; Singh, Charanjeet; Hart, Melissa; Blaes, Anne H

    2015-06-03

    Myeloid sarcoma (MS) is a rare disease entity identified as a variety of manifestations defined by the occurrence of extramedullary myeloid cell masses with or without bone marrow involvement. This case describes an unusual presentation of isolated MS in a 60-year-old otherwise healthy male, who initially presented to his primary care physician with vague abdominal pain. After extensive workup including three omental biopsies, umbilical core biopsy, and inguinal lymph node biopsy, he was ultimately diagnosed with isolated MS with extensive extramedullary tumor burden. Despite advanced extramedullary disease, peripheral cell counts were normal and bilateral bone marrow biopsies unremarkable with normal cellular lineages, morphology, and cytogenetics. The patient underwent induction chemotherapy and is now greater than 100 days post myeloablative unrelated donor marrow transplantation with no evidence of disease recurrence and 100% donor status with full chimerism. This case demonstrates that making a prompt diagnosis with rapid initiation of treatment in myeloid sarcoma can be challenging due to its varied clinical presentation, cytomorphology, cytochemistry, and cytogenetic overlap with other lymphoid malignancies. Once a diagnosis of MS has been made, moving quickly to induction therapy is important. Several studies have shown that improved overall survival is attained when MS is treated as acute myeloid leukemia and increased survival is noted for patients undergoing bone marrow transplantation. Further prospective studies are needed to elucidate the many remaining questions in regards to the natural history, prognosis, and optimal treatment strategies for this deadly disease.

  14. Primary Vaginal Myeloid Sarcoma: A Rare Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Gaurang Modi

    2015-01-01

    Full Text Available Myeloid sarcoma (chloroma, granulocytic sarcoma, or extramedullary myeloid tumour is an extramedullary mass forming neoplasm composed of myeloid precursor cells. It is usually associated with myeloproliferative disorders but very rarely may precede the onset of leukemia. Here, we are presenting a rare case of primary vaginal myeloid sarcoma in a geriatric female patient without initial presentation of acute myeloid leukemia (AML. A 68-year-old female patient with ECOG Performance Score of 1 presented with pervaginal bleeding for 20 days. On colposcopic examination, she was found to have mass in the anterior fornix of vagina. A punch biopsy specimen revealed chloromatous infiltration of the vagina. LCA (leukocyte common antigen, MPO (myeloperoxidase, and c-kit were strongly positive on IHC (immunohistochemistry. The patient’s routine blood investigations were normal including peripheral smear, lactose dehydrogenase, uric acid, 2D echocardiography, conventional cytogenetics, bone marrow aspiration, and biopsy. The patient was given 4 cycles of decitabine (Decitex, manufactured by Sun Pharmaceutical Industries Limited, India, 20 mg/m2 for 5 days at an interval of 28 days. There was a partial response to decitabine according to RECIST criteria. As decitabine therapy was well tolerated, we are continuing in the same way until disease progression without any complications. The patient is undergoing regular follow-up at our centre.

  15. Results of triple muscle (sartorius, tensor fascia latae and part of gluteus medius) pedicle bone grafting in neglected femoral neck fracture in physiologically active patients.

    Science.gov (United States)

    Mishra, Pankaj Kumar; Gupta, Anuj; Gaur, Suresh Chandra

    2014-09-01

    Femoral neck fractures are notorious for complications like avascular necrosis and nonunion. In developing countries, various factors such as illiteracy, low socioeconomic status, ignorance are responsible for the delay in surgery. Neglected fracture neck femur always poses a formidable challenge. The purpose of this study was to evaluate the results of triple muscle pedicle bone grafting using sartorius, tensor fasciae latae and part of gluteus medius in neglected femoral neck fracture. This is a retrospective study with medical record of 50 patients, who were operated by open reduction, internal fixation along with muscle pedicle bone grafting by the anterior approach. After open reduction, two to three cancellous screws (6.5 mm) were used for internal fixation in all cases. A bony chunk of the whole anterior superior iliac spine of 1 cm thickness, 1 cm width and 4.5 cm length, taken from the iliac crest comprised of muscle pedicle of sartorius, tensor fascia latae and part of gluteus medius. Then the graft with all three muscles mobilized and put in the trough made over the anterior or anterosuperior aspect of the femoral head. The graft was fixed with one or two 4.5 mm self-tapping cortical screw in anterior to posterior direction. 14 patients were lost to followup. The results were based on 36 patients. We observed that in our series, there was union in 34, out of 36 (94.4%) patients. All patients were within the age group of 15-51 years (average 38 years) with displaced neglected femoral neck fracture of ≥30 days. Mean time taken for full clinicoradiological union was 14 weeks (range-10-24 weeks). Triple muscle pedicle bone grafting gives satisfactory results for neglected femoral neck fracture in physiologically active patients.

  16. Results of triple muscle (sartorius, tensor fascia latae and part of gluteus medius pedicle bone grafting in neglected femoral neck fracture in physiologically active patients

    Directory of Open Access Journals (Sweden)

    Pankaj Kumar Mishra

    2014-01-01

    Full Text Available Background: Femoral neck fractures are notorious for complications like avascular necrosis and nonunion. In developing countries, various factors such as illiteracy, low socioeconomic status, ignorance are responsible for the delay in surgery. Neglected fracture neck femur always poses a formidable challenge. The purpose of this study was to evaluate the results of triple muscle pedicle bone grafting using sartorius, tensor fasciae latae and part of gluteus medius in neglected femoral neck fracture. Materials and Methods: This is a retrospective study with medical record of 50 patients, who were operated by open reduction, internal fixation along with muscle pedicle bone grafting by the anterior approach. After open reduction, two to three cancellous screws (6.5 mm were used for internal fixation in all cases. A bony chunk of the whole anterior superior iliac spine of 1 cm thickness, 1 cm width and 4.5 cm length, taken from the iliac crest comprised of muscle pedicle of sartorius, tensor fascia latae and part of gluteus medius. Then the graft with all three muscles mobilized and put in the trough made over the anterior or anterosuperior aspect of the femoral head. The graft was fixed with one or two 4.5 mm self-tapping cortical screw in anterior to posterior direction. Results: 14 patients were lost to followup. The results were based on 36 patients. We observed that in our series, there was union in 34, out of 36 (94.4% patients. All patients were within the age group of 15-51 years (average 38 years with displaced neglected femoral neck fracture of ≥30 days. Mean time taken for full clinicoradiological union was 14 weeks (range-10-24 weeks. Conclusion: Triple muscle pedicle bone grafting gives satisfactory results for neglected femoral neck fracture in physiologically active patients.

  17. Children's bone health

    NARCIS (Netherlands)

    I.M. van der Sluis (Inge)

    2002-01-01

    textabstractThe thesis can be divided in two main parts. In the first part (Chapter 2 to 5) bone mineral density, bone metabolism and body composition in healthy children and young adults have been evaluated, while in the second part (Chapter 6 to 10) these issues were studied in children

  18. Short-term followup after surgical treatment of Ewing′s sarcoma

    Directory of Open Access Journals (Sweden)

    Rastogi Shishir

    2010-01-01

    Full Text Available Background: Results of surgical treatment in Indian patients of Ewing′s sarcoma managed with multimodality treatment with chemotherapy and/or radiotherapy are insufficient. We report a retrospective evaluation of a series of cases of Ewing′s sarcoma managed with chemotherapy, surgery with or without radiotherapy. Materials and Methods: 54 patients of biopsy-proven Ewing′s sarcoma of the bone, except craniofacial and vertebral bones were included. The patients having recurrence or having previous treatment were excluded from the study. Local and systemic extent of the sarcoma was defined, staged, and patients were subjected to the chemotherapy, surgery, and in some cases radiotherapy. Patients were evaluated for results of surgery with respect to complications, recurrence, and metastases at 3, 6, 9, 12, 18 and 24 months of follow-up Results: Average age of patients was 15.6 years (range 7-26 years; average delay in treatment was 4.1 months (1-7 months; follow-up ranged from 2 to 5 years (median 3.1 years; 14 patients (25.9% had pulmonary metastases at their initial presentation. Twenty-one patients (38.9% underwent resection and intercalary reconstruction with bone grafting, fixed with locking plates. Allograft was also used in 11 of these. Sixteen patients underwent resection and reconstruction with endoprosthesis, while seven patients (13.0% underwent resection and arthrodesis. An above-knee amputation was required in 7.4% (four patients. Mesh was used for containing the graft longitudinally in five patients (femoral and tibial intercalary reconstructions and for soft tissue attachment in two patients (hip and shoulder endoprostheses. Two patients had deep wound infection. One patient presented 1 year later with implant failure. The disease-free survival at 2 years from the time of diagnosis was 57.5% (23 out of 40 for patients without preoperative metastases and 42.9% (6 out of 14 for those with preoperative metastases. Overall, the

  19. Evaluation of (241)Am deposited in different parts of the leg bones and skeleton to justify in vivo measurements of the knee for estimating total skeletal activity.

    Science.gov (United States)

    Khalaf, Majid; Brey, Richard R; Derryberry, DeWayne

    2013-01-01

    The percentage of Am deposited in different parts of leg bones relative to the total leg activity was calculated from radiochemical analysis results from six whole body donors participating in the U.S. Transuranium and Uranium Registries (USTUR). In five of these six USTUR cases, the percentage of Am deposited in the knee region as well as in the entire leg was separately calculated relative to total skeletal activity. The purpose of this study is to find a region in the leg that is both suitable for in vivo measurement of Am deposited in the bones and has a good correlation with the total skeletal Am burden. In all analyzed cases, the femur was the bone with the highest percentage of Am deposited in the leg (48.8%). In the five cases that have complete whole skeletal analysis, the percentage of Am activity in the knee relative to entire skeletal activity was 4.8%, and the average value of its coefficient of variation was 10.6%. The percentage of Am in the leg relative to total skeletal activity was 20% with an average coefficient of variation of 13.63%. The Am activity in the knee as well as in the leg was strongly correlated (R = 99.5% and R = 99.1%, respectively) with the amount of Am activity in the entire skeleton using a simple linear relationship. The highest correlation was found between the amount of Am deposited in the knee and the amount of Am deposited in the entire skeleton. This correlation is important because it might enable an accurate assessment of the total skeletal Am burden to be performed from in vivo monitoring of the knee region. In all analyzed cases, an excellent correlation (R = 99.9%) was found between the amount of Am activity in the knee and the amount of Am activity in the entire leg. The results of this study suggest three simple models: two models to predict the total skeletal activity based on either leg or knee activity, and the third model to predict the total leg activity based on knee activity. The results also suggest that the

  20. Mediastinal nonleukemic granulocytic sarcoma with cardiac infiltration Sarcoma granulocítico mediastinal não associado à leucemia com infiltração cardíaca

    Directory of Open Access Journals (Sweden)

    Gabrielle G. Lima

    2008-08-01

    Full Text Available We report on a case of mediastinal granulocytic sarcoma with cardiac infiltration in a young man with no evidence of leukemia involving the bone marrow or peripheral blood. Diagnosis was accomplished by immuno-histochemistry with expressions of myeloperoxidase and CD99 antigens. The patient achieved clinical remission, but evolved with febrile neutropenia during chemotherapy and died. Although subclinical cardiac infiltrations are commonly found at autopsy in patients with acute non-lymphoblastic leukemia, only one case of involvement of the heart with granulocytic sarcoma in the absence of bone marrow disease has been published in the literature. A diagnosis of granulocytic sarcoma should not be excluded when the biopsy of the bone marrow does not show any evidence of leukemic infiltration.Relata-se o caso de um adulto jovem com sarcoma granulocítico (SG mediastinal com infiltração cardíaca sem evidência de leucemia envolvendo medula óssea ou sangue periférico. O diagnóstico foi revelado pela imuno-histoquímica com positividade para mieloperoxidase e CD99. O paciente apresentou remissão clínica, porém evoluiu com neutropenia febril durante a quimioterapia e foi a óbito. Embora infiltrados cardíacos subclínicos sejam comumente detectados na autópsia em pacientes com leucemia aguda nãolinfoblástica, somente um caso de SG com envolvimento cardíaco na ausência de doença na medula óssea foi descrito na literatura. Um diagnóstico de SG não deve ser excluída quando a biópsia da medula óssea não mostrar nenhuma evidência de infiltração leucêmica.

  1. Lymphangiectatic Kaposi's sarcoma in a patient with AIDS*

    Science.gov (United States)

    Santos, Mônica; Vilasboas, Virginia; Mendes, Luciana; Talhari, Carolina; Talhari, Sinésio

    2013-01-01

    Kaposi's sarcoma is a malignant disease that originates in the lymphatic endothelium. It has a broad spectrum of clinical manifestations. Its four distinct clinical forms are: classic, endemic, iatrogenic and epidemic Kaposi's sarcoma. In non-HIV-associated Kaposi's sarcoma, the disease is typically limited to the lower extremities, but in immunodeficient patients, it is a multifocal systemic disease. The clinical course of the disease differs among patients, ranging from a single or a few indolent lesions to an aggressive diffuse disease. Advanced Kaposi's sarcoma lesions, typically those on the lower extremities, are often associated with lymphedema. In this paper, we report a case of a patient with a rare form of AIDS-associated Kaposi sarcoma called lymphangiectatic Kaposis's sarcoma. PMID:23739700

  2. Sarcomas of the head and neck at Kenyatta National Hospital.

    Science.gov (United States)

    Chindia, M L; Swaleh, S M; Godiah, P M

    2000-05-01

    To determine the pattern of occurrence of sarcomas afflicting the neck and craniofacial region. A retrospective study (1982-1991). Cancer Registry, Kenyatta National Hospital, Nairobi, Kenya. Examination was performed of the cancer records in the registry over the period 1982 to 1991 inclusive. Histopathological types of the sarcomas were then analysed to indicate the numbers that occurred per year; and also the pattern of occurrence according to age groups, gender and site. Of the 10,897 whole body neoplasms, 985 were sarcomas. Among these sarcomas, 160 (16%) were located in the neck and craniofacial region. The histopathological types of the neoplasms included Kaposi's sarcoma (39%), osteosarcoma (23%), rhabdomyosarcoma (21%), fibrosarcoma (13%), chondrosarcoma (two per cent), malignant fibrous histiocytoma (one per cent) and dermatofibrosarcoma protuberans (one per cent). The results of this investigation, in concordance with those of other series worldwide, indicate that the various sarcomas afflicting the neck and craniofacial area are generally rare.

  3. [Current Trends in Radiotherapy Following Surgical Resection of Soft-tissue Sarcoma of the Extremities and Trunk].

    Science.gov (United States)

    Kraus-Tiefenbacher, U S; Van Kampen, M

    2015-04-01

    Besides surgery, radiotherapy plays its well-established part in the multimodality treatment of soft-tissue sarcomas. It can be delivered before or after surgery with similar control rates. Adjuvant radiotherapy increases the local control rates as well as the overall survival in intermediate or high-grade soft-tissue sarcomas. Due to the complex and sophisticated nature of the treatment, patients should be referred to specialised centres where modern radiotherapeutic options like intensity modulated radiotherapy and image-guided radiotherapy can be offered. © Georg Thieme Verlag KG Stuttgart · New York.

  4. Osseous Kaposi sarcoma in an HIV-positive patient

    Energy Technology Data Exchange (ETDEWEB)

    Thanos, Loukas; Mylona, Sofia; Kalioras, Vasilios; Pomoni, Maria; Batakis, Nikolaos [Radiology Department, ' ' Korgialeneio-Benakeio' ' , Red Cross Hospital of Athens, 1 Athanasaki Street, 11526, Athens (Greece)

    2004-04-01

    A case of osseous Kaposi sarcoma in a 35-year-old man is described. The patient (HIV-positive for 8 years) suffered from cutaneous Kaposi sarcoma and presented with right-sided chest pain. He underwent a chest CT scan that revealed three osteolytic lesions involving rib and vertebra with large soft tissue masses, without cutaneous lesions at these sites. CT-guided core needle biopsy led to a histological diagnosis of Kaposi sarcoma. (orig.)

  5. Optimizing the interval between G-CSF therapy and F-18 FDG PET imaging in children and young adults receiving chemotherapy for sarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Trout, Andrew T.; Sharp, Susan E.; Gelfand, Michael J. [Cincinnati Children' s Hospital Medical Center, Department of Radiology, Cincinnati, OH (United States); Turpin, Brian K. [Cincinnati Children' s Hospital Medical Center, Cancer and Blood Diseases Institute, Division of Oncology, Cincinnati, OH (United States); Zhang, Bin [Cincinnati Children' s Hospital Medical Center, Division of Biostatistics and Epidemiology, Cincinnati, OH (United States)

    2015-07-15

    Granulocyte colony-stimulating factors (G-CSF) speed recovery from chemotherapy-induced myelosuppression but the marrow stimulation they cause can interfere with interpretation of F-18 fluorodeoxyglucose positron emission tomography (F-18 FDG PET) exams. To assess the frequency of interfering G-CSF-induced bone marrow activity on FDG PET imaging in children and young adults with Ewing sarcoma and rhabdomyosarcoma and to define an interval between G-CSF administration and FDG PET imaging that limits marrow interference. Blinded, retrospective review of FDG PET exams performed in patients treated with long-acting G-CSF as part of their chemotherapeutic regimen. Exams were subjectively scored by two reviewers (R1 and R2) who assessed the level of marrow uptake of FDG and measured standardized uptake values in the marrow, liver, spleen and blood pool. FDG PET findings were correlated with time since G-CSF administration and with blood cell counts. Thirty-eight FDG PET exams performed in 17 patients were reviewed with 47.4% (18/38) of exams having marrow uptake of FDG sufficient to interfere with image interpretation. Primary predictors of marrow uptake of FDG were patient age (P = 0.0037) and time since G-CSF exposure (P = 0.0028 for subjective marrow uptake of FDG, P = 0.008 [R1] and P = 0.004 [R2] for measured maximum standardized uptake value (SUVmax)). The median interval between G-CSF administration and PET imaging in cases with marrow activity considered normal or not likely to interfere was 19.5 days (range: 7-55 days). In pediatric and young adult patients with Ewing sarcoma and rhabdomyosarcoma, an interval of 20 days between administration of the long-acting form of G-CSF and FDG PET imaging should limit interference by stimulated marrow. (orig.)

  6. Optimizing the interval between G-CSF therapy and F-18 FDG PET imaging in children and young adults receiving chemotherapy for sarcoma

    International Nuclear Information System (INIS)

    Trout, Andrew T.; Sharp, Susan E.; Gelfand, Michael J.; Turpin, Brian K.; Zhang, Bin

    2015-01-01

    Granulocyte colony-stimulating factors (G-CSF) speed recovery from chemotherapy-induced myelosuppression but the marrow stimulation they cause can interfere with interpretation of F-18 fluorodeoxyglucose positron emission tomography (F-18 FDG PET) exams. To assess the frequency of interfering G-CSF-induced bone marrow activity on FDG PET imaging in children and young adults with Ewing sarcoma and rhabdomyosarcoma and to define an interval between G-CSF administration and FDG PET imaging that limits marrow interference. Blinded, retrospective review of FDG PET exams performed in patients treated with long-acting G-CSF as part of their chemotherapeutic regimen. Exams were subjectively scored by two reviewers (R1 and R2) who assessed the level of marrow uptake of FDG and measured standardized uptake values in the marrow, liver, spleen and blood pool. FDG PET findings were correlated with time since G-CSF administration and with blood cell counts. Thirty-eight FDG PET exams performed in 17 patients were reviewed with 47.4% (18/38) of exams having marrow uptake of FDG sufficient to interfere with image interpretation. Primary predictors of marrow uptake of FDG were patient age (P = 0.0037) and time since G-CSF exposure (P = 0.0028 for subjective marrow uptake of FDG, P = 0.008 [R1] and P = 0.004 [R2] for measured maximum standardized uptake value (SUVmax)). The median interval between G-CSF administration and PET imaging in cases with marrow activity considered normal or not likely to interfere was 19.5 days (range: 7-55 days). In pediatric and young adult patients with Ewing sarcoma and rhabdomyosarcoma, an interval of 20 days between administration of the long-acting form of G-CSF and FDG PET imaging should limit interference by stimulated marrow. (orig.)

  7. Clinical activity of pazopanib in metastatic extraosseous Ewing sarcoma

    Directory of Open Access Journals (Sweden)

    Steven Attia

    2015-05-01

    Full Text Available We report a response to pazopanib in a 69-year-old man with heavily pre-treated metastatic extraosseous Ewing sarcoma in addition to molecular profiling of his tumor. To our knowledge, this case is the earliest to demonstrate activity of an oral multi-targeted kinase inhibitor in Ewing sarcoma. This case provides rationale for adding a Ewing sarcoma arm to SARC024, a phase II study of regorafenib, another multi-targeted kinase inhibitor, in patients with liposarcoma, osteosarcoma and Ewing and Ewing-like sarcomas (NCT02048371. This national multi-institutional study is ongoing.

  8. Primary Intimal Sarcoma of Thoracic Aorta Presenting as Hypertensive Crisis.

    Science.gov (United States)

    Lin, Shu-I; Su, Min-I; Tsai, Cheng-Ting

    2015-11-01

    We report a 45-year-old woman who presented to our facility in a hypertensive crisis. Computed tomography (CT) revealed a thoracic aortic tumor, and tissues obtained via endovascular biopsy revealed undifferentiated sarcoma. A final diagnosis of intimal sarcoma was made by intra-operative pathological examination. Despite undergoing surgical resection followed by adjuvant chemotherapy, the patient died from progressive multiple metastasis and severe sepsis. Although aortic sarcoma is rarely diagnosed, it should be considered a possible etiology of hypertensive crisis. Aortic tumor; Endovascular biopsy; Hypertension crisis; Intimal sarcoma.

  9. Primary pulmonary synovial sarcoma: a rare primary pulmonary tumor.

    Science.gov (United States)

    Falkenstern-Ge, Roger Fei; Kimmich, Martin; Grabner, Andreas; Horn, Heike; Friedel, Godehard; Ott, German; Kohlhäufl, Martin

    2014-02-01

    Pulmonary sarcomas overall are very uncommon and comprise only 0.5 % of all primary lung malignancies. The diagnosis is established only after sarcoma-like primary lung malignancies and a metastatic extrathoracic sarcoma have been excluded. Synovial sarcoma accounts for ~8 % of soft-tissue sarcomas. Synovial sarcoma arising from the pleura has rarely been reported. We report a case of a 58-year-old woman who complained of right-sided chest pain and shortness of breath. Chest CT scan revealed a large heterogeneous mass, occupying most of the right hemithorax. Histologic diagnosis was supplemented by interphase cytogenetic (FISH) analysis. Computed tomography guided Tru-cut biopsy was suspicious for a sarcomatous or fibrous malignancy. However, intraoperative frozen-section diagnostics confirmed the diagnosis of a sarcoma. Immunohistochemistry showed that tumor cells expressed epithelial membrane antigen, CD99 and BCL2. Based on immunohistochemistry, the diagnosis of synovial sarcoma was suspected and was confirmed by FISH analysis. The patient was treated with right upper bilobectomy. Due to R1-resection status, postsurgical systemic chemotherapy was administered. Primary pulmonary synovial sarcoma is a rare primary lung tumor. Due to extensive size of the tumor with pleural and mediastinal invasion only a R1-resection status could be achieved by thoracic surgery.

  10. Primary synovial sarcoma of the posterior chest wall.

    Science.gov (United States)

    Hung, Jung-Jyh; Chou, Teh-Ying; Sun, Chih-Hao; Liu, Jung-Sen; Hsu, Wen-Hu

    2008-06-01

    Synovial sarcoma is a malignant soft-tissue tumor that most commonly occurs in the extremities of young adults. Only several cases of synovial sarcomas of the chest wall and pleura had been reported. We present a 24-year-old man who had right back pain, chest pain, dyspnea, and intermittent fever from a huge primary synovial sarcoma of the right posterior chest wall. Multimodality therapies, including surgical resection, and chemotherapy and radiation therapy were applied, but the tumor progressed rapidly and the patient died 6 months after diagnosis. Prompt diagnosis and aggressive surgical resection is mandatory for primary synovial sarcoma of the chest wall because of its aggressive behavior.

  11. Treatment Option Overview (Uterine Sarcoma)

    Science.gov (United States)

    ... diagnosed, tests are done to find out if cancer cells have spread within the uterus or to other parts of the body. The process used to find out if cancer has spread within the uterus or to other parts of the body is ...

  12. General Information About Uterine Sarcoma

    Science.gov (United States)

    ... diagnosed, tests are done to find out if cancer cells have spread within the uterus or to other parts of the body. The process used to find out if cancer has spread within the uterus or to other parts of the body is ...

  13. Primary bone tumours of the hand. Report of 21 cases

    Energy Technology Data Exchange (ETDEWEB)

    Kozlowski, K.; Azouz, E.M.; Campbell, J.; Marton, D.; Morris, L.; Padovani, J.; Sprague, P.; Beluffi, G.; Berzero, G.F.; Cherubino, P.

    1988-02-01

    Twenty-one primary bone tumours of the hand in children from 8 paediatric hospitals are reported. Osteochondromas and enchondromas were not included. Our material consisted of 16 patients with common tumours (3 Ewing's sarcoma, 5 aneurysmal bone cyst, 6 osteoid osteoma and 2 epithelioma) and 5 patients with uncommon tumours (osteoma, simple bone cyst, haemangiopericytoma, capillary angiomatous tumour and benign ossifying fibroma or osteoblastoma). The X-ray diagnosis of the common tumours should have high concordance with histology, whereas that of uncommon tumours in much more difficult and uncertain. The characteristic features of Ewing's sarcoma are stressed as all our children with this tumour had a delayed diagnosis and a fatal outcome. Differential diagnosis with other short tubular bone lesions of the hand - specifically osteomyelitis - is discussed and the posibilities of microscopic diagnosis are stressed.

  14. Bone Diseases

    Science.gov (United States)

    ... avoid smoking and drinking too much alcohol. Bone diseases can make bones easy to break. Different kinds ... break Osteogenesis imperfecta makes your bones brittle Paget's disease of bone makes them weak Bones can also ...

  15. Evaluation of therapeutic results in Ewing's sarcoma

    International Nuclear Information System (INIS)

    Johnson, R.E.; Pomeroy, T.C.

    1975-01-01

    The philosophy pervading the treatment approach to Ewing's sarcoma was to have therapy encompass all foci of disease, including sites of occult or potential involvement in addition to obvious clinical manifestations. The experience with integrated methods of treatment in 66 consecutive patients at the National Cancer Institute is reviewed. A median survival of 18 months (44 percent 2 year survival rate) for patients with recognizable metastases on admission bears impressive witness to the value of adjuvant therapy in Ewing's sarcoma. Even more encouraging, an uncorrected 5 year survival rate of 53 percent (42 percent continuously free of disease) for patients given ''pyrophylactic'', adjuvant therapy indicates the potential for permanent control of disease in a significant fraction of cases with clinically localized primary tumors. (U.S.)

  16. Endometrial Stromal Sarcoma: A Rare Entity

    International Nuclear Information System (INIS)

    Jabeen, S.; Anwar, S.; Fatima, N.

    2015-01-01

    Endometrial Stromal Sarcoma (ESS) is a hormone sensitive tumor. It is a rare gynecological tumor and is considered to occur more often in pre-menopausal women. A proper pre-operative diagnosis is difficult and confirmed in most cases after hysterectomy for a presumed benign disease. Endometrial sampling, ultrasound, and magnetic resonance imaging can provide diagnostic clues. For early disease complete surgical cure is possible, however, adjuvant therapy is available for recurrence. This case of Low Grade Endometrial Stromal Sarcoma (LGESS) in a 21 years old woman was presented as irregular vaginal bleeding. Clinical diagnosis of fibroid was made but analysis of endometrium showed ESS confirmed on hysterectomy specimen. One should consider it in any case with rapid fibroid enlargement. (author)

  17. Thyroid carcino-sarcoma in a dog

    Directory of Open Access Journals (Sweden)

    Antonio Giuliano

    2013-04-01

    Full Text Available An adult male greyhound was diagnosed with a thyroid carcino-sarcoma by means of histopathology and positive immuno-histochemistry staining for cytokeratin and vimentin. Surgery and radiotherapy of the area were successful in local tumour control. Adjuvant chemotherapy was recommended to treat and prevent further metastasis. The use of carboplatin, metronomic cyclophosphamide chemotherapy and toceranib failed to control the progression of distant metastasis. The survival time was seven months from the time of diagnosis. This is the eighth case of carcino-sarcoma of the thyroid documented in veterinary medicine and the first one treated with a multimodal approach based on surgery, radiotherapy and chemotherapy. As documented in human medicine, chemotherapy appeared to be ineffective to prevent or delay the progression of the metastatic disease in this case.

  18. Lymphangiectatic Kaposi's sarcoma in a patient with AIDS Sarcoma de Kaposi linfangiectásico em paciente com Aids

    Directory of Open Access Journals (Sweden)

    Mônica Santos

    2013-04-01

    Full Text Available Kaposi's sarcoma is a malignant disease that originates in the lymphatic endothelium. It has a broad spectrum of clinical manifestations. Its four distinct clinical forms are: classic, endemic, iatrogenic and epidemic Kaposi's sarcoma. In non-HIV-associated Kaposi's sarcoma, the disease is typically limited to the lower extremities, but in immunodeficient patients, it is a multifocal systemic disease. The clinical course of the disease differs among patients, ranging from a single or a few indolent lesions to an aggressive diffuse disease. Advanced Kaposi's sarcoma lesions, typically those on the lower extremities, are often associated with lymphedema. In this paper, we report a case of a patient with a rare form of AIDS-associated Kaposi sarcoma called lymphangiectatic Kaposis's sarcoma.O sarcoma de Kaposi é uma neoplasia originária do endotélio linfatico, que apresenta um amplo espectro de manifestações, com quatro formas clínicas: sarcoma de Kaposi clássico, endêmico, iatrogêncio e epidêmico ou associado ao HIV. Em pacientes imunocompetentes, a doença é tipicamente limitada às extremidades. Porém em pacientes imunideprimidos, o sarcoma de Kaposi é uma doença sistêmica multifocal. Apresenta cursos clínicos diferentes, desde simples lesões cutâneas isoladas até lesões agressivas e difusas, com ou sem envolvimento sistêmico. Lesões avançadas de sarcoma de Kaposi, principalmente as localizadas nas extremidades, podem apresentar linfedema. Neste trabalho, reportamos caso de paciente com forma rara de Sarcoma de Kaposi associado a Aids, chamada de sarcoma de Kaposi linfangiectásico.

  19. Unsuspected Widespread Cardiac Sarcoma in a Child

    OpenAIRE

    Spieth, Michael E.; Kasner, Darcy I.; Prasannan, Latha

    2003-01-01

    The case of a patient with an undifferentiated metastatic cardiac sarcoma is presented. A thallium-201 tumor study was performed to evaluate lung nodules. Thallium-201 chloride was injected intravenously and whole body images, as well as single photon emission computer tomography (SPECT) imaging of the chest, were obtained and reconstructed. They were displayed in three planes and then reconstructed again in cardiac planes. Multiple unsuspected metastases were found in the lower extremities. ...

  20. Extragenital endometrial stromal sarcoma arising in endometriosis.

    Science.gov (United States)

    Alcázar, Juan Luis; Guerriero, Stefano; Ajossa, Silvia; Parodo, Giuseppina; Piras, Bruno; Peiretti, Michele; Jurado, Matías; Idoate, Miguel Ángel

    2012-01-01

    The diagnosis rate of deep pelvic endometriosis is increasing. Endometrial stromal sarcoma (ESS) is a rare neoplasm. Extragenital ESS is an extremely uncommon event. Very few cases of extragenital ESS have been reported to date. The diagnosis of this entity is very difficult in some instances. Knowledge about its management is also limited. In this paper, we review the current literature on the clinical management, histology, immunohistochemistry, treatment and outcome of ESS arising in pelvic endometriosis. Copyright © 2012 S. Karger AG, Basel.

  1. Sarcoma of the vena cava inferior

    International Nuclear Information System (INIS)

    Leon Alvarez, Jorge Luis; Rosello Silva, Nelson; Llorens Nunnez, Martha; Ochoa Montes, Luis Alberto

    2010-01-01

    Authors present an infrequent case of a female patient with abdominal tumor a great superficial collateral circulation type cava-cava, the abdominal ultrasound, the transthoracic and transesophageal echocardiogram and the computerized axial tomography (CAT) identified a tumor of the vena cava inferior. The fine-needle aspiration cytology of lesion confirmed the presence of primary fusopleomorphous sarcoma of high degree of malignancy of vena cava inferior

  2. Late complications of rxtherapy: actinic sarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Buffat, J.D.

    1975-09-09

    Relation of two cases of benign tumors: a vertebral osteoblastoma and a cerebellar medulloblastoma which, after operation, have had radiotherapy. 20 years later for one case and 14 years for the other one actinic sarcomas will appear, and, in spite of usual therapy, the death is coming rapidly. We are certainly in presence of two exceptional cases, but each physician must be conscious, before to attempt a treatment, that very distant complication can eventually occur.

  3. Carbon Ion Radiotherapy for Unresectable Retroperitoneal Sarcomas

    International Nuclear Information System (INIS)

    Serizawa, Itsuko; Kagei, Kenji; Kamada, Tadashi; Imai, Reiko; Sugahara, Shinji; Okada, Tohru; Tsuji, Hiroshi; Ito, Hisao; Tsujii, Hirohiko

    2009-01-01

    Purpose: To evaluate the applicability of carbon ion radiotherapy (CIRT) for unresectable retroperitoneal sarcomas with regard to normal tissue morbidity and local tumor control. Methods and Materials: From May 1997 to February 2006, 24 patients (17 male and 7 female) with unresectable retroperitoneal sarcoma received CIRT. Age ranged from 16 to 77 years (median, 48.6 years). Of the patients, 16 had primary disease and 8 recurrent disease. Histologic diagnoses were as follows: malignant fibrous histiocytoma in 6, liposarcoma in 3, malignant peripheral nerve sheath tumor in 3, Ewing/primitive neuroectodermal tumor (PNET) in 2, and miscellaneous in 10 patients. The histologic grades were as follows: Grade 3 in 15, Grade 2-3 in 2, Grade 2 in 3, and unknown in 4. Clinical target volumes ranged between 57 cm 3 and 1,194 cm 3 (median 525 cm 3 ). The delivered carbon ion dose ranged from 52.8 to 73.6 GyE in 16 fixed fractions over 4 weeks. Results: The median follow-up was 36 months (range, 6-143 months). The overall survival rates at 2 and 5 years were 75% and 50%, respectively. The local control rates at 2 and 5 years were 77% and 69%. No complications of the gastrointestinal tract were encountered. No other toxicity greater than Grade 2 was observed. Conclusions: Use of CIRT is suggested to be effective and safe for retroperitoneal sarcomas. The results obtained with CIRT were a good overall survival rate and local control, notwithstanding the fact that most patients were not eligible for surgical resection and had high-grade sarcomas.

  4. Pediatric rhabdomyosarcomas and nonrhabdomyosarcoma soft tissue sarcoma

    OpenAIRE

    Agarwala Sandeep

    2006-01-01

    Tumors arising from the soft tissues are uncommon in children, accounting for about 6% of all childhood malignancies. More than half (53%) of these originate from the striated muscles and are called rhabdomyosarcomas (RMS) the remaining are nonrhabdomyosarcoma soft tissue sarcomas (NRSTS). Almost two-thirds of RMS cases are diagnosed in children < 6 years of age. They can arise at varied locations like the head and neck region, genitourinary tract, extremities, trunk and retrope...

  5. Ewing sarcoma of the thoracic wall

    International Nuclear Information System (INIS)

    Weigel, W.

    1978-01-01

    Ewing's sarcomas in the chest wall have in common the facts that the ribs are mainly changed asteolytically; sclerosing is initially seen very seldom, it usually occurs after the therapy; and periosteal detachment with stratification or spicula formation was not observed. All our children had considerably larger intrathoracic tumors than tumors palpable at the chest wall and a notably low number of symptoms in regard of the partially gigantic tumors. (orig.) [de

  6. Resection followed by vascularized bone autograft in patients with possible recurrence of malignant bone tumors after conservative treatment

    International Nuclear Information System (INIS)

    Metaizeau, J.P.; Olive, D.; Bey, P.; Bordigoni, P.; Plenat, F.; Prevot, J.

    1984-01-01

    In conservative treatment of malignant bone tumors, assessment of the local condition is difficult. The radiological changes seen in the irradiated tumor and the frequent occurrence of pathological fractures at this site may give rise to the fear that the tumor has relapsed. Resection of the whole of the involved bone is the best way to assure adequate local control but the extent of the bone defect and the bad local conditions secondary to irradiation make reconstruction hazardous. In two patients (one with Ewing's sarcoma of the femur and one with osteogenic sarcoma of the humerus) the authors used a free, vascularized fibular graft for the reconstruction having obtained consolidation of the limb after resection of the irradiated tumor, with preservation of its function. The encouraging results obtained have suggested a conservative attitude as primary treatment of specific malignant bone tumors

  7. Bone marrow mesenchymal stem cells (BMSCs) improved functional recovery of spinal cord injury partly by promoting axonal regeneration.

    Science.gov (United States)

    Lin, Liya; Lin, Hefeng; Bai, Shi; Zheng, Lianshun; Zhang, Xiaoming

    2018-05-01

    Spinal cord injury (SCI) disrupts the spinal cord and results in the loss of sensory and motor function below the lesion site. The treatment of SCI became a challenge because the injured neurons fail to axon regenerate and repair after injury. Promoting axonal regeneration plays a key role in the treatment strategies for SCI. It would meet the goal of reconstruction the injured spinal cord and improving the functional recovery. Bone marrow mesenchymal stem cells (BMSCs) are attractive therapeutic potential cell sources for SCI, and it could rebuild the injured spinal cord through neuroprotection, neural regeneration and remyelinating. Evidence has demonstrated that BMSCs play important roles in mediating axon regeneration, and glial scar formation after SCI in animal experiments and some clinical trials. We reviewed the role of BMSCs in regulating axon regeneration and glial scar formation after SCI. BMSCs based therapies may provide a therapeutic potential for the injured spinal cord by promoting axonal regeneration and repair. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Polyurethane/fluor-hydroxyapatite nanocomposite scaffolds for bone tissue engineering. Part I: morphological, physical, and mechanical characterization

    Directory of Open Access Journals (Sweden)

    Azadeh Asefnejad

    2011-01-01

    Full Text Available Azadeh Asefnejad1, Aliasghar Behnamghader2, Mohammad Taghi Khorasani3, Babak Farsadzadeh11Department of Biomedical Engineering, Science and Research Branch, Islamic Azad University, Tehran, Iran; 2Materials and Energy Research Center, Tehran, Iran; 3Iran Polymer and Petrochemical Institute, Tehran, IranAbstract: In this study, new nano-fluor-hydroxyapatite (nFHA/polyurethane composite scaffolds were fabricated for potential use in bone tissue engineering. Polyester urethane samples were synthesized from polycaprolactone, hexamethylene diisocyanate, and 1,4-butanediol as chain extender. Nano fluor-hydroxyapatite (nFHA was successfully synthesized by sol-gel method. The solid–liquid phase separation and solvent sublimation methods were used for preparation of the porous composites. Mechanical properties, chemical structure, and morphological characteristics of the samples were investigated by compressive test, Fourier transform infrared, and scanning electron microscopy (SEM techniques, respectively. The effect of nFHA powder content on porosity and pore morphology was investigated. SEM images demonstrated that the scaffolds were constituted of interconnected and homogeneously distributed pores. The pore size of the scaffolds was in the range 50–250 µm. The result obtained in this research revealed that the porosity and pore average size decreased and compressive modulus increased with nFHA percentage. Considering morphological, physical, and mechanical properties, the scaffold with a higher ratio of nFHA has suitable potential use in tissue regeneration.Keywords: polyester urethane, composite, fluor-hydroxyapatite, scaffold

  9. Polyurethane/fluor-hydroxyapatite nanocomposite scaffolds for bone tissue engineering. Part I: morphological, physical, and mechanical characterization.

    Science.gov (United States)

    Asefnejad, Azadeh; Behnamghader, Aliasghar; Khorasani, Mohammad Taghi; Farsadzadeh, Babak

    2011-01-06

    In this study, new nano-fluor-hydroxyapatite (nFHA)/polyurethane composite scaffolds were fabricated for potential use in bone tissue engineering. Polyester urethane samples were synthesized from polycaprolactone, hexamethylene diisocyanate, and 1,4-butanediol as chain extender. Nano fluor-hydroxyapatite (nFHA) was successfully synthesized by sol-gel method. The solid-liquid phase separation and solvent sublimation methods were used for preparation of the porous composites. Mechanical properties, chemical structure, and morphological characteristics of the samples were investigated by compressive test, Fourier transform infrared, and scanning electron microscopy (SEM) techniques, respectively. The effect of nFHA powder content on porosity and pore morphology was investigated. SEM images demonstrated that the scaffolds were constituted of interconnected and homogeneously distributed pores. The pore size of the scaffolds was in the range 50-250 μm. The result obtained in this research revealed that the porosity and pore average size decreased and compressive modulus increased with nFHA percentage. Considering morphological, physical, and mechanical properties, the scaffold with a higher ratio of nFHA has suitable potential use in tissue regeneration.

  10. Extremity preservation by combined modality therapy in sarcomas of the hand and foot: an analysis of local control, disease free survival and functional result

    International Nuclear Information System (INIS)

    Kinsella, T.J.; Loeffler, J.S.; Fraass, B.A.; Tepper, J.

    1983-01-01

    A primary tumor arising in the hand or foot represents an uncommon presentation for patients with Ewing's sarcoma (ES) or soft tissue sarcoma (STS). While there exists considerable literature on the treatment of extremity sarcomas, very little deals specifically with lesions of the hand or foot. It remains controversial whether these lesions can be successfully treated with combined modality therapy which preserves the extremity and maintains function. From 1972 to 1979, 10 patients with sarcomas arising in the hand or foot were treated with combined modality therapy at the National Cancer Institute. Seven patients with ES of bone received local irradiation to 5000 rad and combination chemotherapy following an incisional biopsy. Three patients with STS received a gross tumor excision and local irradiation to 6000 rad. Local control was achieved in nine patients (90%) with a follow-up of 30 to 119 months (median 56 months). These patients have complete or almost complete function of the treated extremity. Nine patients are alive with five patients remaining disease-free following the initial combined modality treatment. We conclude that for selected patients with sarcomas arising in the hand or foot, combined modality therapy which leaves the extremity intact results in excellent local tumor control and preserves function. Careful treatment planning is an essential aspect of successful radiation therapy of a hand or foot primary. Our treatment recommendations are outlined. This approach is a viable alternative to amputation in these patients

  11. Sarcoma Immunotherapy: Past Approaches and Future Directions

    Science.gov (United States)

    D'Angelo, S. P.; Tap, W. D.; Schwartz, G. K.; Carvajal, R. D.

    2014-01-01

    Sarcomas are heterogeneous malignant tumors of mesenchymal origin characterized by more than 100 distinct subtypes. Unfortunately, 25–50% of patients treated with initial curative intent will develop metastatic disease. In the metastatic setting, chemotherapy rarely leads to complete and durable responses; therefore, there is a dire need for more effective therapies. Exploring immunotherapeutic strategies may be warranted. In the past, agents that stimulate the immune system such as interferon and interleukin-2 have been explored and there has been evidence of some clinical activity in selected patients. In addition, many cancer vaccines have been explored with suggestion of benefit in some patients. Building on the advancements made in other solid tumors as well as a better understanding of cancer immunology provides hope for the development of new and exciting therapies in the treatment of sarcoma. There remains promise with immunologic checkpoint blockade antibodies. Further, building on the success of autologous cell transfer in hematologic malignancies, designing chimeric antigen receptors that target antigens that are over-expressed in sarcoma provides a great deal of optimism. Exploring these avenues has the potential to make immunotherapy a real therapeutic option in this orphan disease. PMID:24778572

  12. Isolated granulocytic sarcoma of the nasopharynx: a case report and review of the literature

    Directory of Open Access Journals (Sweden)

    Vishnu P

    2013-12-01

    Full Text Available Prakash Vishnu,1 Ravindra Reddy Chuda,2 Dick G Hwang,3 David M Aboulafia1,4 1Floyd and Delores Jones Cancer Institute at Virginia Mason Medical Center, Seattle, WA, USA; 2Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS, USA; 3Department of Pathology, Virginia Mason Medical Center, 4Division of Hematology, University of Washington, Seattle, WA, USA Abstract: Granulocytic sarcoma (GS is a rare extramedullary manifestation of acute myeloid leukemia (AML. It may also represent blastic transformation of myelodysplastic syndromes or myeloproliferative neoplasms. Although usually seen in the context of advanced and poorly controlled disease, it may also present as the first manifestation of illness, without concurrent bone marrow or blood involvement. In the medical literature, chloroma and GS are terms that have been used interchangeably with myeloid sarcoma. GS usually manifests as soft tissue or bony masses in several extracranial sites, such as bone, periosteum, and lymph nodes; involvement of the head and neck region is uncommon. We report a case of a woman with insidious onset of progressive nasal congestion and diminished hearing who was diagnosed with an isolated GS of the nasopharynx. With involved field radiotherapy, she achieved a complete remission of 12-months duration before being diagnosed with overt AML. She has remained disease-free for greater than 18 months following induction and consolidation chemotherapy. Through a MEDLINE®/PubMed® search we identified an additional 13 cases of nasopharyngeal GS. The median age was 37 years (range 1 to 81 years. The cases were equally distributed among the sexes. The most common presenting symptoms were conductive hearing loss and sinonasal congestion. Isolated GS was identified in six cases, and the median time from diagnosis of GS to AML was 12 months (range 3 to 48 months. The treatment varied, but responses were seen in all the patients who received

  13. The role of Kaposi sarcoma-associated herpesvirus in the pathogenesis of Kaposi sarcoma.

    Science.gov (United States)

    Gramolelli, Silvia; Schulz, Thomas F

    2015-01-01

    Kaposi sarcoma (KS) is an unusual vascular tumour caused by an oncogenic-herpesvirus, Kaposi sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus 8 (HHV 8). KS lesions are characterized by an abundant inflammatory infiltrate, the presence of KSHV-infected endothelial cells that show signs of aberrant differentiation, as well as faulty angiogenesis/ vascularization. Here we discuss the molecular mechanisms that lead to the development of these histological features of KS, with an emphasis on the viral proteins that are responsible for their development. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  14. Targeting the DNA repair pathway in Ewing sarcoma.

    Science.gov (United States)

    Stewart, Elizabeth; Goshorn, Ross; Bradley, Cori; Griffiths, Lyra M; Benavente, Claudia; Twarog, Nathaniel R; Miller, Gregory M; Caufield, William; Freeman, Burgess B; Bahrami, Armita; Pappo, Alberto; Wu, Jianrong; Loh, Amos; Karlström, Åsa; Calabrese, Chris; Gordon, Brittney; Tsurkan, Lyudmila; Hatfield, M Jason; Potter, Philip M; Snyder, Scott E; Thiagarajan, Suresh; Shirinifard, Abbas; Sablauer, Andras; Shelat, Anang A; Dyer, Michael A

    2014-11-06

    Ewing sarcoma (EWS) is a tumor of the bone and soft tissue that primarily affects adolescents and young adults. With current therapies, 70% of patients with localized disease survive, but patients with metastatic or recurrent disease have a poor outcome. We found that EWS cell lines are defective in DNA break repair and are sensitive to PARP inhibitors (PARPis). PARPi-induced cytotoxicity in EWS cells was 10- to 1,000-fold higher after administration of the DNA-damaging agents irinotecan or temozolomide. We developed an orthotopic EWS mouse model and performed pharmacokinetic and pharmacodynamic studies using three different PARPis that are in clinical development for pediatric cancer. Irinotecan administered on a low-dose, protracted schedule previously optimized for pediatric patients was an effective DNA-damaging agent when combined with PARPis; it was also better tolerated than combinations with temozolomide. Combining PARPis with irinotecan and temozolomide gave complete and durable responses in more than 80% of the mice. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Targeting the DNA Repair Pathway in Ewing Sarcoma

    Directory of Open Access Journals (Sweden)

    Elizabeth Stewart

    2014-11-01

    Full Text Available Ewing sarcoma (EWS is a tumor of the bone and soft tissue that primarily affects adolescents and young adults. With current therapies, 70% of patients with localized disease survive, but patients with metastatic or recurrent disease have a poor outcome. We found that EWS cell lines are defective in DNA break repair and are sensitive to PARP inhibitors (PARPis. PARPi-induced cytotoxicity in EWS cells was 10- to 1,000-fold higher after administration of the DNA-damaging agents irinotecan or temozolomide. We developed an orthotopic EWS mouse model and performed pharmacokinetic and pharmacodynamic studies using three different PARPis that are in clinical development for pediatric cancer. Irinotecan administered on a low-dose, protracted schedule previously optimized for pediatric patients was an effective DNA-damaging agent when combined with PARPis; it was also better tolerated than combinations with temozolomide. Combining PARPis with irinotecan and temozolomide gave complete and durable responses in more than 80% of the mice.

  16. FOXM1 is an oncogenic mediator in Ewing Sarcoma.

    Directory of Open Access Journals (Sweden)

    Laura Christensen

    Full Text Available Ewing Family Tumors (Ewing Sarcoma and peripheral Primitive Neuroectodermal Tumor are common bone and soft tissue malignancies of childhood, adolescence and young adulthood. Chromosomal translocation in these tumors produces fusion oncogenes of the EWS/ETS class, with EWS/FLI1 being by far the most common. EWS/ETS chimera are the only well established driver mutations in these tumors and they function as aberrant transcription factors. Understanding the downstream genes whose expression is modified has been a central approach to the study of these tumors. FOXM1 is a proliferation associated transcription factor which has increasingly been found to play a role in the pathogenesis of a wide range of human cancers. Here we demonstrate that FOXM1 is expressed in Ewing primary tumors and cell lines. Reduction in FOXM1 expression in Ewing cell lines results in diminished potential for anchorage independent growth. FOXM1 expression is enhanced by EWS/FLI1, though, unlike other tumor systems, it is not driven by expression of the EWS/FLI1 target GLI1. Thiostrepton is a compound known to inhibit FOXM1 by direct binding. We show that Thiostrepton diminishes FOXM1 expression in Ewing cell lines and this reduction reduces cell viability through an apoptotic mechanism. FOXM1 is involved in Ewing tumor pathogenesis and may prove to be a useful therapeutic target in Ewing tumors.

  17. Management Head and Neck Ewing's Sarcoma Family of tumors: Experience of the National Cancer Institute, Cairo University

    International Nuclear Information System (INIS)

    Abdel Rahman, M.; El-Baradie, T.; Bahaa, Sh.; Shalan, M.; El-Baradie, M.

    2010-01-01

    Ewing's sarcoma accounts for 4-6% of primary malignant bone tumors and it affects the head and neck in only 1-4% of cases. The purpose of this study was to review the NCI experience with Ewing's sarcoma of the head and neck in children. Patients and Methods: A retrospective analysis of patient files with head and neck Ewing's sarcoma treated at the National Cancer Institute, Cairo University, Egypt, during the period from 1997 to 2008 was done. Files were reviewed and data for patients, tumor and treatment profile were extracted. Results: Twenty patients out of 280 with Ewing's sarcoma were identified during an 11 -year period. Patients had a median age of 11.5 years (range 5 months - 22 years) with a male to female ratio of 1:1. The most common tumor site was in the mandible (9/20, 45%) followed by a neck mass (4/20, 20%) and a clavicular mass (3/20, 15%). Six patients (30%) were metastatic at presentation. Most of the patients (19/20, 95%) received chemotherapy. Local therapy was in the form of radical radiotherapy for 8 patients (40%), 2 patients (10%) had surgery alone, while five patients (25%) had surgical resection and postoperative radiotherapy. Overall survival ranged from 1 to 128 months, with a median of 36 months. At the end of the study, 9 patients (45%) were alive in CR, 6 (30%) were lost to FU in disease progression, while 5 patients died from disease progression. Conclusion: Ewing's sarcoma of the head and neck is a disease of a rare incidence with debate about the optimum local therapy. Small non-metastatic tumors with good response to chemotherapy have abetter outcome.

  18. A zebrafish transgenic model of Ewing’s sarcoma reveals conserved mediators of EWS-FLI1 tumorigenesis

    Directory of Open Access Journals (Sweden)

    Stefanie W. Leacock

    2012-01-01

    Ewing’s sarcoma, a malignant bone tumor of children and young adults, is a member of the small-round-blue-cell tumor family. Ewing’s sarcoma family tumors (ESFTs, which include peripheral primitive neuroectodermal tumors (PNETs, are characterized by chromosomal translocations that generate fusions between the EWS gene and ETS-family transcription factors, most commonly FLI1. The EWS-FLI1 fusion oncoprotein represents an attractive therapeutic target for treatment of Ewing’s sarcoma. The cell of origin of ESFT and the molecular mechanisms by which EWS-FLI1 mediates tumorigenesis remain unknown, and few animal models of Ewing’s sarcoma exist. Here, we report the use of zebrafish as a vertebrate model of EWS-FLI1 function and tumorigenesis. Mosaic expression of the human EWS-FLI1 fusion protein in zebrafish caused the development of tumors with histology strongly resembling that of human Ewing’s sarcoma. The incidence of tumors increased in a p53 mutant background, suggesting that the p53 pathway suppresses EWS-FLI1-driven tumorigenesis. Gene expression profiling of the zebrafish tumors defined a set of genes that might be regulated by EWS-FLI1, including the zebrafish ortholog of a crucial EWS-FLI1 target gene in humans. Stable zebrafish transgenic lines expressing EWS-FLI1 under the control of the heat-shock promoter exhibit altered embryonic development and defective convergence and extension, suggesting that EWS-FLI1 interacts with conserved developmental pathways. These results indicate that functional targets of EWS-FLI1 that mediate tumorigenesis are conserved from zebrafish to human and provide a novel context in which to study the function of this fusion oncogene.

  19. Therapy of Ewing's sarcoma. Therapie des Ewing-Sarkoms

    Energy Technology Data Exchange (ETDEWEB)

    Dunst, J. (Strahlentherapeutische Klinik und Poliklinik, Univ. Erlangen-Nuernberg, Erlangen (Germany)); Sauer, R. (Strahlentherapeutische Klinik und Poliklinik, Univ. Erlangen-Nuernberg, Erlangen (Germany))

    1993-12-01

    Therapy of Ewing's sarcoma requires a qualified clinical, radiological, and pathohistological diagnosis and, in particular, an optimal therapy by an experienced team of oncological specialists. Important prognostic factors are the presence of hematogenous metastases at diagnosis, the initial tumor volume, the response to chemotherapy, and adequate local therapy. Presently, cure rates of more than 60% can be achieved for localized Ewing's sarcoma by combination of local therapy and chemotherapy. The four-drug combination VACA (vincristin, actinomycin D, cyclophosphamide, adriamycin) can be considered as cytostatic gold standard. More aggressive regimens (VAIA, EVAIA, autologous bone marrow transplant) may be beneficial in subgroups and are under investigation. Concerning local therapy adequate radiotherapy plays a major role and achieves the same survival rates as radical surgery, comparable patient selection provided. Several factors have impact on radiotherapeutic results, especially total dose (45 Gy large volume, 55 Gy to the primary tumor), target volume (safety margin at least 2 cm according to the pretreatment volume, at least 5 cm in proximal and distal extension of long bones), timing of radiotherapy (as early as possible) and quality of treatment. Radiotherapy as sole local treatment is indicated in inoperable lesions (spine, sacrum, skull) and in small, good-responding tumors. High-risk patients should receive combined radiotherapeutic-surgical treatment, preferably as pre-operative irradiation. The value of hyperfractionation is not yet proven despite theoretical advantages. (orig.)

  20. Molecular Analysis of a Recurrent Sarcoma Identifies a Mutation in FAF1

    Directory of Open Access Journals (Sweden)

    Georg F. Weber

    2015-01-01

    Full Text Available A patient presented with a recurrent sarcoma (diagnosed as leiomyosarcoma 12 years after the removal of an initial cancer (diagnosed as extracompartmental osteosarcoma distally on the same limb. Following surgery, the sarcoma and unaffected muscle and bone were subjected to measurements of DNA exome sequence, RNA and protein expression, and transcription factor binding. The investigation provided corroboration of the diagnosis leiomyosarcoma, as the major upregulations in this tumor comprise muscle-specific gene products and calcium-regulating molecules (calcium is an important second messenger in smooth muscle cells. A likely culprit for the disease is the point mutation S181G in FAF1, which may cause a loss of apoptotic function consecutive to transforming DNA damage. The RNA levels of genes for drug transport and metabolism were extensively skewed in the tumor tissue as compared to muscle and bone. The results suggest that the tumor represents a recurrence of a dormant metastasis from an originally misdiagnosed neoplasm. A loss of FAF1 function could cause constitutive WNT pathway activity (consistent with the downstream inductions of IGF2BP1 and E2F1 in this cancer. While the study has informed on drug transport and drug metabolism pharmacogenetics, it has fallen short of identifying a suitable target for molecular therapy.

  1. Clear cell sarcoma of soft tissue in right parapharyngeal region: report of a rare case.

    Science.gov (United States)

    Fan, Chuifeng; Yu, Juanhan; Yang, Lianhe; Lin, Xuyong; Wang, Enhua

    2015-01-01

    Clear cell sarcoma (CCS), initially named malignant melanoma of soft parts, is a rare malignant neoplasm typically involving deep soft tissue of the extremities, in close proximity to tendons and aponeuroses. Here we describe a case of clear cell sarcoma of the right parapharyngeal region in a young female aged 20 years. MRI detected a mass about 4.4 cm×3.4 cm×3.0 cm, located in the right parapharyngeal area and between the external pterygoid and the medial pterygoid. Microscopically, most of the tumor cells were epithelioid with palely eocinophilic cytoplasm arranged in sheets. Pleophorism of tumor cells were not marked. Immunohistochemical analysis shows that the tumor cells were positive for vimentin, S-100, HMB45 and MelanA, and negative for AE1/AE3, actin-sm, desmin, CD117, TFE-3, and P63. Ki67 index was about 5%.

  2. [Clear cell sarcoma of the chest wall; report of a case].

    Science.gov (United States)

    Fujiwara, K; Nanjou, S; Ishihara, S

    2006-11-01

    Clear cell sarcoma is a rare malignant soft tissue neoplasm that usually arises adjacent to tendons or aponeuroses. The principal sites of this neoplasm are the extremities, but tumors do occur in the trunk on rare occasions. A case had a checkup for chest bachache with a 21-year-old woman, and it was diagnosed as the right chest wall tumor. We performed the en bloc resection of parts of the 7th and 8th ribs. Composix mesh was fixed to cover a deficit in the chest wall. The pathological diagnosis was clear cell sarcoma of the chest wall. The postoperative course was uneventful. She has shown no symptoms or signs of recurrence during 14 months of follow-up.

  3. Soft tissue sarcoma: role of imaging for initial diagnosis and treatment

    International Nuclear Information System (INIS)

    Taieb, S.; Ceugnart, L.; Gauthier, H.; Penel, N.; Vanseymortier, L.

    2006-01-01

    Soft tissue sarcomas are uncommon heterogeneous group of tumour derived from mesenchyme. The most common location is the lower extremity, but they can occur in the upper extremity, and abdominal and chest walls. The first radiological evaluation may include plain films and ultrasonography in viewing to assess the probability of soft tissue sarcomas. MRI with contrast is the main modality to evaluate these lesions and choose which part of tumour must be biopsied. Computer tomography (CT) is secondary used to perform core needle biopsy and detect lung metastases. The role of PET begins to be more clear in case of need global assessment before radical surgery. A multidisciplinary approach is essential to perform rational treatment planning and avoid partial surgery. (author)

  4. NGF blockade at early times during bone cancer development attenuates bone destruction and increases limb use.

    Science.gov (United States)

    McCaffrey, Gwen; Thompson, Michelle L; Majuta, Lisa; Fealk, Michelle N; Chartier, Stephane; Longo, Geraldine; Mantyh, Patrick W

    2014-12-01

    Studies in animals and humans show that blockade of nerve growth factor (NGF) attenuates both malignant and nonmalignant skeletal pain. While reduction of pain is important, a largely unanswered question is what other benefits NGF blockade might confer in patients with bone cancer. Using a mouse graft model of bone sarcoma, we demonstrate that early treatment with an NGF antibody reduced tumor-induced bone destruction, delayed time to bone fracture, and increased the use of the tumor-bearing limb. Consistent with animal studies in osteoarthritis and head and neck cancer, early blockade of NGF reduced weight loss in mice with bone sarcoma. In terms of the extent and time course of pain relief, NGF blockade also reduced pain 40% to 70%, depending on the metric assessed. Importantly, this analgesic effect was maintained even in animals with late-stage disease. Our results suggest that NGF blockade immediately upon detection of tumor metastasis to bone may help preserve the integrity and use, delay the time to tumor-induced bone fracture, and maintain body weight. ©2014 American Association for Cancer Research.

  5. EWS-FLI1 inhibits TNFα-induced NFκB-dependent transcription in Ewing sarcoma cells

    International Nuclear Information System (INIS)

    Lagirand-Cantaloube, Julie; Laud, Karine; Lilienbaum, Alain; Tirode, Franck; Delattre, Olivier; Auclair, Christian; Kryszke, Marie-Helene

    2010-01-01

    Research highlights: → EWS-FLI1 interferes with TNF-induced activation of NFκB in Ewing sarcoma cells. → EWS-FLI1 knockdown in Ewing sarcoma cells increases TNF-induced NFκB binding to DNA. → EWS-FLI1 reduces TNF-stimulated NFκB-dependent transcriptional activation. → Constitutive NFκB activity is not affected by EWS-FLI1. → EWS-FLI1 physically interacts with NFκB p65 in vivo. -- Abstract: Ewing sarcoma is primarily caused by a t(11;22) chromosomal translocation encoding the EWS-FLI1 fusion protein. To exert its oncogenic function, EWS-FLI1 acts as an aberrant transcription factor, broadly altering the gene expression profile of tumor cells. Nuclear factor-kappaB (NFκB) is a tightly regulated transcription factor controlling cell survival, proliferation and differentiation, as well as tumorigenesis. NFκB activity is very low in unstimulated Ewing sarcoma cells, but can be induced in response to tumor necrosis factor (TNF). We wondered whether NFκB activity could be modulated by EWS-FLI1 in Ewing sarcoma. Using a knockdown approach in Ewing sarcoma cells, we demonstrated that EWS-FLI1 has no influence on NFκB basal activity, but impairs TNF-induced NFκB-driven transcription, at least in part through inhibition of NFκB binding to DNA. We detected an in vivo physical interaction between the fusion protein and NFκB p65, which could mediate these effects. Our findings suggest that, besides directly controlling the activity of its primary target promoters, EWS-FLI1 can also indirectly influence gene expression in tumor cells by modulating the activity of key transcription factors such as NFκB.

  6. EWS-FLI1 inhibits TNF{alpha}-induced NF{kappa}B-dependent transcription in Ewing sarcoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Lagirand-Cantaloube, Julie, E-mail: julie.cantaloube@crbm.cnrs.fr [UMR8113 CNRS, LBPA, Ecole Normale Superieure, Cachan (France); Laud, Karine, E-mail: karine.laud@curie.fr [U830 INSERM, Institut Curie, Paris (France); Institut Curie, Genetique et biologie des cancers, Paris (France); Lilienbaum, Alain, E-mail: alain.lilienbaum@univ-paris-diderot.fr [EA300 Universite Paris 7, Stress et pathologies du cytosquelette, Paris (France); Tirode, Franck, E-mail: franck.tirode@curie.fr [U830 INSERM, Institut Curie, Paris (France); Institut Curie, Genetique et biologie des cancers, Paris (France); Delattre, Olivier, E-mail: olivier.delattre@curie.fr [U830 INSERM, Institut Curie, Paris (France); Institut Curie, Genetique et biologie des cancers, Paris (France); Auclair, Christian, E-mail: auclair@lbpa.ens-cachan.fr [UMR8113 CNRS, LBPA, Ecole Normale Superieure, Cachan (France); Kryszke, Marie-Helene, E-mail: kryszke@lbpa.ens-cachan.fr [UMR8113 CNRS, LBPA, Ecole Normale Superieure, Cachan (France)

    2010-09-03

    Research highlights: {yields} EWS-FLI1 interferes with TNF-induced activation of NF{kappa}B in Ewing sarcoma cells. {yields} EWS-FLI1 knockdown in Ewing sarcoma cells increases TNF-induced NF{kappa}B binding to DNA. {yields} EWS-FLI1 reduces TNF-stimulated NF{kappa}B-dependent transcriptional activation. {yields} Constitutive NF{kappa}B activity is not affected by EWS-FLI1. {yields} EWS-FLI1 physically interacts with NF{kappa}B p65 in vivo. -- Abstract: Ewing sarcoma is primarily caused by a t(11;22) chromosomal translocation encoding the EWS-FLI1 fusion protein. To exert its oncogenic function, EWS-FLI1 acts as an aberrant transcription factor, broadly altering the gene expression profile of tumor cells. Nuclear factor-kappaB (NF{kappa}B) is a tightly regulated transcription factor controlling cell survival, proliferation and differentiation, as well as tumorigenesis. NF{kappa}B activity is very low in unstimulated Ewing sarcoma cells, but can be induced in response to tumor necrosis factor (TNF). We wondered whether NF{kappa}B activity could be modulated by EWS-FLI1 in Ewing sarcoma. Using a knockdown approach in Ewing sarcoma cells, we demonstrated that EWS-FLI1 has no influence on NF{kappa}B basal activity, but impairs TNF-induced NF{kappa}B-driven transcription, at least in part through inhibition of NF{kappa}B binding to DNA. We detected an in vivo physical interaction between the fusion protein and NF{kappa}B p65, which could mediate these effects. Our findings suggest that, besides directly controlling the activity of its primary target promoters, EWS-FLI1 can also indirectly influence gene expression in tumor cells by modulating the activity of key transcription factors such as NF{kappa}B.

  7. Rapidly progressive course of primary renal synovial sarcoma: Case report

    Directory of Open Access Journals (Sweden)

    Marković-Lipkovski Jasmina

    2013-01-01

    Full Text Available Introduction. Primary kidney sarcoma, especially synovial sarcoma (SS, is a very rare neoplasm. Pre-operative signs and symptoms are very similar to renal cell carcinoma, therefore, the proper diagnosis is very difficult and usually made after nephrectomy. This is a case report of primary renal SS. Case Outline. A 38-year-old man presented with a history of fever and hematuria, and right flank pain 3 weeks ago. Abdominal computerized tomography revealed a heterogeneous well-marginated soft tissue mass arising in the lower part of the right kidney. Right nephrectomy was performed. A cystic tumor of 120x85 mm in size with soft solid growth, and with the extensive areas of hemorrhage and necrosis was seen on gross examination. Histopathology revealed a neoplasm composed of solid monomorphic sheets of spindle cells. Immunohistochemistry showed tumor cells strongly positive for BCL2, CD99, CD56 and vimentin, and focally positive for epithelial membrane antigen (EMA. The histological diagnosis of primary renal SS was based on morphology and immunohistochemistry. FISH analysis and RT-PCR was carried out on formalin-fixed paraffin-embedded tissue sections. The molecular analysis demonstrated translocation of SYT gene on chromosome 18 and SSX2 gene on chromosome X. The findings were consistent with diagnosis of SS. Conclusion. Our case shows that histopathological diagnosis of primary kidney SS, although difficult, is possible to be made on the basis of morphological and immunohistochemical analysis. However, this diagnosis should be corroborated by molecular techniques confirming SYT-SSX translocation on chromosome 18 and chromosome X. Here we present visceral monophasic SS with aggressive clinical course and poor outcome. [Projekat Ministarstva nauke Republike Srbije, br. OI 175047

  8. Imaging findings of primary synovial sarcoma of the lung

    International Nuclear Information System (INIS)

    Guan Yubao; Chen Ling; Zeng Qingsi; Zheng Xiaotao; Chen Huai; Zhang Chaoliang; Cen Renli; Gu Yingying

    2009-01-01

    Objective: To evaluate the imaging characteristics of primary pulmonary synovial sarcoma and improve its diagnosis and differential diagnosis. Methods: The clinical, imaging and pathology findings of 5 patients were retrospectively analyzed. All 5 patients received X-ray and CT scan, 1 case had MRI and PET-CT examination. SYT-SSX fusion gene was analyzed in 4 patients using reverse transcriptase- polymerase chain reaction (RT-PCR). Results: All the 5 patients had solid mass in the lungs and their diameter were 5.3 to 15.7 cm. One was associated with pneumothorax and the others were with moderate pleural effusion. Peripheral tumors, which showed clear margin partly with inhomogeneous density, was found in CT scan. On the contrast-enhanced CT scan, 3 cases were inhomogeneous enhancement and 2 were circular enhancement. Pleural invasion or conglutination was detected in 5 patients. No hilar or mediastinal lymph nodes metastasis were seen in all eases. MRI showed intermediate signal on T 1 WI and heterogeneous on T 2 WI of one case with right upper lobe lesion and showed thick mural enhancement after Gadolinium enhancement. The adjacent chest wall, rib thoracic vertebra, vertebral canal and thoracic cord were invaded. PET-CT showed increased uptake of FDG (SUV=12.3) in tumors. The immunohistochemical examination of Vim, CK and EMA were positive and SYT-SSX gene was detected in 4 patients. Conclusions: There are some relatively specific imaging findings of primary pulmonary synovial sarcoma. However it is necessary for diagnosing the disease to combine pathology, immunohistochemistry and SYT-SSX gene detection. (authors)

  9. Kaposi's sarcoma involving the thyroid in a patient with AIDS

    International Nuclear Information System (INIS)

    Krauth, P.H.; Katz, J.F.

    1987-01-01

    A 30-year-old man with acquired immune deficiency syndrome (AIDS) and Kaposi's sarcoma had a palpable thyroid mass and cervical lymphadenopathy. Nuclear medicine and ultrasound scans revealed multiple thyroid nodules. Results of biopsy showed Kaposi's sarcoma metastatic to the thyroid

  10. Tumor - host immune interactions in Ewing sarcoma : implications for therapy

    NARCIS (Netherlands)

    Berghuis, Dagmar

    2012-01-01

    In this thesis, we report on various aspects of tumor - host (immune) interactions in Ewing sarcoma patients with the aim to obtain leads for immunotherapeutic or targeted treatment strategies. We demonstrate a key role for interferon gamma (IFNg) in enhancing both Ewing sarcoma immunogenicity and

  11. Cutaneous myeloid sarcoma associated with chronic myeloid leukemia*

    OpenAIRE

    Vasconcelos, Erica Rodrigues de Araujo; Bauk, Alexander Richard; Rochael, Mayra Carrijo

    2017-01-01

    Abstract: Myeloid sarcoma is an extramedullary tumor of malignant myeloid cells often associated with acute myeloid leukemia, chronic myeloproliferative disorders and myelodysplastic syndromes. The skin is one of the most commonly affected sites. We report a rare case of cutaneous myeloid sarcoma associated with chronic myeloid leukemia.

  12. A Rare Case of Synovial Sarcoma of the Prostate

    African Journals Online (AJOL)

    Department of Urology, KEM Hospital, Mumbai, India. AbStRACt. Prostatic synovial sarcomas are exceedingly rare. To our knowledge, only six primary cases have been reported so far. We herein describe a primary synovial sarcoma of the prostate seen in a 25- year-old male patient, the youngest patient seen with this ...

  13. Synovial sarcoma of the shoulder: A series of 14 cases.

    Science.gov (United States)

    Verbeek, Bianca M; Kaiser, Courtney L; Larque, Ana B; Hornicek, Francis J; Raskin, Kevin A; Schwab, Joseph H; Chen, Yen-Lin; Lozano Calderón, Santiago A

    2018-03-01

    Synovial sarcoma is a rare soft tissue sarcoma with poor long-term prognosis due to late recurrence and metastasis. Synovial sarcoma arises in less than 6% from the shoulder. As a result, there is limited information in the literature about synovial sarcoma of the shoulder (SSS). We included all patients treated for SSS at our institution between 1985 and 2013. Medical charts were retrospectively reviewed to collect demographics, information about the clinical course, and outcome. This subgroup was compared to our institution's entire synovial sarcoma patient cohort and the data in the published literature. SSS Patients presented most commonly with pain and a growing mass; the majority of tumors were grade 2 and measured greater than 5 cm. 43% (7) of SSS patients developed metastatic disease and 36% (5) had died at a median follow-up of 64 months (36-127); SSS 5-year survival (83.3%) was higher in our series than in the general literature (57-75%). We found better prognosis in patients with synovial sarcoma of the shoulder than expected based on the current literature. The clinical behavior of synovial sarcoma in the shoulder is closer to that of synovial sarcoma in the extremities than the trunk. Level IV, Case Series. © 2017 Wiley Periodicals, Inc.

  14. Kaposi's Sarcoma Of The Lung: A Case Report.

    African Journals Online (AJOL)

    user

    2004-12-02

    Dec 2, 2004 ... E-mail: eussiri@yahoo.com. Pulmonary Kaposi's sarcoma is a rare condition. Its diagnosis may be tricky due to its similarities in clinical and radiological features with pulmonary opportunistic infections as well as other lung lesions. Treatment for Kaposi's sarcoma include radiotherapy, chemotherapy and/or.

  15. Therapeutic applications of histone deacetylase inhibitors in sarcoma.

    Science.gov (United States)

    Tang, Fan; Choy, Edwin; Tu, Chongqi; Hornicek, Francis; Duan, Zhenfeng

    2017-09-01

    Sarcomas are a rare group of malignant tumors originating from mesenchymal stem cells. Surgery, radiation and chemotherapy are currently the only standard treatments for sarcoma. However, their response rates to chemotherapy are quite low. Toxic side effects and multi-drug chemoresistance make treatment even more challenging. Therefore, better drugs to treat sarcomas are needed. Histone deacetylase inhibitors (HDAC inhibitors, HDACi, HDIs) are epigenetic modifying agents that can inhibit sarcoma growth in vitro and in vivo through a variety of pathways, including inducing tumor cell apoptosis, causing cell cycle arrest, impairing tumor invasion and preventing metastasis. Importantly, preclinical studies have revealed that HDIs can not only sensitize sarcomas to chemotherapy and radiotherapy, but also increase treatment responses when combined with other chemotherapeutic drugs. Several phase I and II clinical trials have been conducted to assess the efficacy of HDIs either as monotherapy or in combination with standard chemotherapeutic agents or targeted therapeutic drugs for sarcomas. Combination regimen for sarcomas appear to be more promising than monotherapy when using HDIs. This review summarizes our current understanding and therapeutic applications of HDIs in sarcomas. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Management of HIV associated Kaposi's Sarcoma in Malawi ...

    African Journals Online (AJOL)

    Kaposi's sarcoma is a common malignancy in Malawi and is often managed with single agent vincristine. This article outlines feasible combination chemotherapy for Kaposi's sarcoma in Malawi which should be made more widely available. Malawi Medical Journal Vol. 20 (4) 2008: pp. 129-132.

  17. Giant primary synovial sarcoma of the anterior mediastinum: A case ...

    African Journals Online (AJOL)

    2015-06-11

    Jun 11, 2015 ... Primary synovial sarcoma is a very rare tumor of the mediastinum, which is unreported in the entire subcontinent of West. Africa, and presents daunting challenges from diagnosis to management with lack of standard management strategies. We present a case of primary monophasic synovial sarcoma of ...

  18. Extremity Soft Tissue Sarcoma: A Review of 19 Cases. | Eyesan ...

    African Journals Online (AJOL)

    Background: Although soft tissue sarcoma is a rare tumour, it accounts for a significant proportion of malignancies seen in many orthopaedic practices. The objectives of this study are to evaluate the pattern of presentation of extremity soft tissue sarcoma and the treatment outcome in our patients. Method: This is a 3 year ...

  19. Advanced oral HIV-associated Kaposi sarcoma with facial ...

    African Journals Online (AJOL)

    Rapidly progressive facial lymphoedoema that develops concurrently with or immediately after rapid enlargement of oral Kaposi sarcoma in human immunodeficiency virus (HIV) -seropositive persons forebodes death. Previously, we reported on three patients with HIV-associated Kaposi sarcoma who had not been ...

  20. Giant primary synovial sarcoma of the anterior mediastinum: A case ...

    African Journals Online (AJOL)

    Primary synovial sarcoma is a very rare tumor of the mediastinum, which is unreported in the entire subcontinent of West Africa, and presents daunting challenges from diagnosis to management with lack of standard management strategies. We present a case of primary monophasic synovial sarcoma of the anterior ...