WorldWideScience

Sample records for bone marrow cells

  1. Karyotype of cryopreserved bone marrow cells

    Directory of Open Access Journals (Sweden)

    M.L.L.F. Chauffaille

    2003-07-01

    Full Text Available The analysis of chromosomal abnormalities is important for the study of hematological neoplastic disorders since it facilitates classification of the disease. The ability to perform chromosome analysis of cryopreserved malignant marrow or peripheral blast cells is important for retrospective studies. In the present study, we compared the karyotype of fresh bone marrow cells (20 metaphases to that of cells stored with a simplified cryopreservation method, evaluated the effect of the use of granulocyte-macrophage colony-stimulating factor (GM-CSF as an in vitro mitotic index stimulator, and compared the cell viability and chromosome morphology of fresh and cryopreserved cells whenever possible (sufficient metaphases for analysis. Twenty-five bone marrow samples from 24 patients with hematological disorders such as acute myeloid leukemia, acute lymphoblastic leukemia, myelodysplastic syndrome, chronic myeloid leukemia, megaloblastic anemia and lymphoma (8, 3, 3, 8, 1, and 1 patients, respectively were selected at diagnosis, at relapse or during routine follow-up and one sample was obtained from a bone marrow donor after informed consent. Average cell viability before and after freezing was 98.8 and 78.5%, respectively (P < 0.05. Cytogenetic analysis was successful in 76% of fresh cell cultures, as opposed to 52% of cryopreserved samples (P < 0.05. GM-CSF had no proliferative effect before or after freezing. The morphological aspects of the chromosomes in fresh and cryopreserved cells were subjectively the same. The present study shows that cytogenetic analysis of cryopreserved bone marrow cells can be a reliable alternative when fresh cell analysis cannot be done, notwithstanding the reduced viability and lower percent of successful analysis that are associated with freezing.

  2. Extraskeletal and intraskeletal new bone formation induced by demineralized bone matrix combined with bone marrow cells

    International Nuclear Information System (INIS)

    Lindholm, T.S.; Nilsson, O.S.; Lindholm, T.C.

    1982-01-01

    Dilutions of fresh autogenous bone marrow cells in combination with allogeneic demineralized cortical bone matrix were tested extraskeletally in rats using roentgenographic, histologic, and 45 Ca techniques. Suspensions of bone marrow cells (especially diluted 1:2 with culture media) combined with demineralized cortical bone seemed to induce significantly more new bone than did demineralized bone, bone marrow, or composite grafts with whole bone marrow, respectively. In a short-term spinal fusion experiment, demineralized cortical bone combined with fresh bone marrow produced new bone and bridged the interspace between the spinous processes faster than other transplantation procedures. The induction of undifferentiated host cells by demineralized bone matrix is further complemented by addition of autogenous, especially slightly diluted, bone marrow cells

  3. The Bone Marrow-Derived Stromal Cells

    DEFF Research Database (Denmark)

    Tencerova, Michaela; Kassem, Moustapha

    2016-01-01

    diseases. BM stromal cells (also known as skeletal or mesenchymal stem cells) [bone marrow stromal stem cell (BMSC)] are multipotent stem cells located within BM stroma and give rise to osteoblasts and adipocytes. However, cellular and molecular mechanisms of BMSC lineage commitment to adipocytic lineage...... and regulation of BM adipocyte formation are not fully understood. In this review, we will discuss recent findings pertaining to identification and characterization of adipocyte progenitor cells in BM and the regulation of differentiation into mature adipocytes. We have also emphasized the clinical relevance...

  4. Bone marrow laminins influence hematopoietic stem and progenitor cell cycling and homing to the bone marrow.

    Science.gov (United States)

    Susek, Katharina Helene; Korpos, Eva; Huppert, Jula; Wu, Chuan; Savelyeva, Irina; Rosenbauer, Frank; Müller-Tidow, Carsten; Koschmieder, Steffen; Sorokin, Lydia

    2018-01-31

    Hematopoietic stem and progenitor cell (HSPC) functions are regulated by a specialized microenvironment in the bone marrow - the hematopoietic stem cell niche - of which the extracellular matrix (ECM) is an integral component. We describe here the localization of ECM molecules, in particular the laminin α4, α3 and α5 containing isoforms in the bone marrow. Laminin 421 (composed of laminin α4, β2, γ1 chains) is identified as a major component of the bone marrow ECM, occurring abundantly surrounding venous sinuses and in a specialized reticular fiber network of the intersinusoidal spaces of murine bone marrow (BM) in close association with HSPC. Bone marrow from Lama4 -/- mice is significantly less efficient in reconstituting the hematopoietic system of irradiated wildtype (WT) recipients in competitive bone marrow transplantation assays and shows reduced colony formation in vitro. This is partially due to retention of Lin - c-kit + Sca-1 + CD48 - long-term and short-term hematopoietic stem cells (LT-HSC/ST-HSC) in the G0 phase of the cell cycle in Lama4 -/- bone marrow and hence a more quiescent phenotype. In addition, the extravasation of WT BM cells into Lama4 -/- bone marrow is impaired, influencing the recirculation of HSPC. Our data suggest that these effects are mediated by a compensatory expression of laminin α5 containing isoforms (laminin 521/522) in Lama4 -/- bone marrow. Collectively, these intrinsic and extrinsic effects lead to reduced HSPC numbers in Lama4 -/- bone marrow and reduced hematopoietic potential. Copyright © 2018 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.

  5. Bone marrow aspiration

    Science.gov (United States)

    Iliac crest tap; Sternal tap; Leukemia - bone marrow aspiration; Aplastic anemia - bone marrow aspiration; Myelodysplastic syndrome - bone marrow aspiration; Thrombocytopenia - bone marrow aspiration; Myelofibrosis - bone marrow aspiration

  6. Cell fusion of bone marrow cells and somatic cell reprogramming by embryonic stem cells

    OpenAIRE

    Bonde, Sabrina; Pedram, Mehrdad; Stultz, Ryan; Zavazava, Nicholas

    2010-01-01

    Bone marrow transplantation is a curative treatment for many diseases, including leukemia, autoimmune diseases, and a number of immunodeficiencies. Recently, it was claimed that bone marrow cells transdifferentiate, a much desired property as bone marrow cells are abundant and therefore could be used in regenerative medicine to treat incurable chronic diseases. Using a Cre/loxP system, we studied cell fusion after bone marrow transplantation. Fused cells were chiefly Gr-1+, a myeloid cell mar...

  7. Identification of resident and inflammatory bone marrow derived cells in the sclera by bone marrow and haematopoietic stem cell transplantation.

    Science.gov (United States)

    Hisatomi, Toshio; Sonoda, Koh-hei; Ishikawa, Fumihiko; Qiao, Hong; Nakazawa, Takahiro; Fukata, Mitsuhiro; Nakamura, Toru; Noda, Kousuke; Miyahara, Shinsuke; Harada, Mine; Kinoshita, Shigeru; Hafezi-Moghadam, Ali; Ishibashi, Tatsuro; Miller, Joan W

    2007-04-01

    To characterise bone marrow derived cells in the sclera under normal and inflammatory conditions, we examined their differentiation after transplantation from two different sources, bone marrow and haematopoietic stem cells (HSC). Bone marrow and HSC from green fluorescent protein (GFP) transgenic mice were transplanted into irradiated wild-type mice. At 1 month after transplantation, mice were sacrificed and their sclera examined by histology, immunohistochemistry (CD11b, CD11c, CD45), and transmission and scanning electron microscopy. To investigate bone marrow derived cell recruitment under inflammatory conditions, experimental autoimmune uveitis (EAU) was induced in transplanted mice. GFP positive cells were distributed in the entire sclera and comprised 22.4 (2.8)% (bone marrow) and 28.4 (10.9)% (HSC) of the total cells in the limbal zone and 18.1 (6.7)% (bone marrow) and 26.3 (3.4)% (HSC) in the peripapillary zone. Immunohistochemistry showed that GFP (+) CD11c (+), GFP (+) CD11b (+) cells migrated in the sclera after bone marrow and HSC transplantation. Transmission and scanning electron microscopy revealed antigen presenting cells among the scleral fibroblasts. In EAU mice, vast infiltration of GFP (+) cells developed into the sclera. We have provided direct and novel evidence for the migration of bone marrow and HSC cells into the sclera differentiating into macrophages and dendritic cells. Vast infiltration of bone marrow and HSC cells was found to be part of the inflammatory process in EAU.

  8. Differentiation of bone marrow cells with irradiated bone in vitro

    International Nuclear Information System (INIS)

    Toshiyuki Tominaga; Moritoshi Itoman; Izumi, T.; Wakita, R.; Uchino, M.

    1999-01-01

    Disease transmission or infection is an important issue in bone allograft, and irradiation is used for sterilization of graft bones. One of the advantages of bone allograft over biomaterials is that graft bones have osteoinductive factors such as growth factors. Irradiation is reported to decrease the osteoinductive activity in vivo. We investigated the osteoinductive activity of irradiated bone by alkaline phosphatase (ALP) activity in rat bone marrow cell culture. Bones (tibias and femurs of 12-week-old Wistar rats) were cleaned of adhering soft tissue, and the marrow was removed by washing. The bones were defatted, lyophilized, and cut into uniform 70 mg fragments. Then the Bone fragments were irradiated at either 10, 20, 25, 30, 40, or 50 kGy at JAERI. Bone marrow cells were isolated from tibias and femurs of 4-week-old Wistar rats. Cells were plated in tissue culture flask. When primary cultures reached confluence, cells were passaged (4 x 103 cell / cm2) to 6 wells plates. The culture medium consisted of minimum essential medium, 10% fetal bovine serum, ascorbic acid, and antibiotics. At confluence, a cell culture insert was set in the well, and an irradiated bone fragment was placed in it. Then, medium was supplemented with 10 mM ?-glycerophosphate and 1 x 10-8 M dexamethasone. Culture wells were stained by naphthol AS-MX phosphate, N,N-dimethyl formamide, Red violet LB salt on day 0, 7, 14. The density of ALP staining was analyzed by a personal computer. Without bones, ALP staining increased by 50% on day 7 and by 100% on day 14, compared with that on day 0. The other side, with bones irradiated at 30 kGy or lower, ALP staining increased by 150% on day 7, and by 180% on day 14, compared with that on day 0. In the groups of irradiated bones of 40 kGy or higher, the increase in ALP staining was less prominent compared with the groups of irradiated bones of 30 kGy or lower. In the groups of 0-30 kGy irradiation, ALP staining increased in the early period

  9. Bone marrow transplantations to study gene function in hematopoietic cells

    NARCIS (Netherlands)

    de Winther, Menno P. J.; Heeringa, Peter

    2011-01-01

    Immune cells are derived from hematopoietic stem cells in the bone marrow. Experimental replacement of bone marrow offers the unique possibility to replace immune cells, to study gene function in mouse models of disease. Over the past decades, this technique has been used extensively to study, for

  10. Bone marrow stromal cell : mediated neuroprotection for spinal cord repair

    NARCIS (Netherlands)

    Ritfeld, Gaby Jane

    2014-01-01

    Currently, there is no treatment available that restores anatomy and function after spinal cord injury. This thesis explores transplantation of bone marrow-derived mesenchymal stem cells (bone marrow stromal cells; BMSCs) as a therapeutic approach for spinal cord repair. BMSCs secrete neurotrophic

  11. Role of whole bone marrow, whole bone marrow cultured cells, and mesenchymal stem cells in chronic wound healing.

    Science.gov (United States)

    Rodriguez-Menocal, Luis; Shareef, Shahjahan; Salgado, Marcela; Shabbir, Arsalan; Van Badiavas, Evangelos

    2015-03-13

    Recent evidence has shown that bone marrow cells play critical roles during the inflammatory, proliferative and remodeling phases of cutaneous wound healing. Among the bone marrow cells delivered to wounds are stem cells, which can differentiate into multiple tissue-forming cell lineages to effect, healing. Gaining insight into which lineages are most important in accelerating wound healing would be quite valuable in designing therapeutic approaches for difficult to heal wounds. In this report we compared the effect of different bone marrow preparations on established in vitro wound healing assays. The preparations examined were whole bone marrow (WBM), whole bone marrow (long term initiating/hematopoietic based) cultured cells (BMC), and bone marrow derived mesenchymal stem cells (BM-MSC). We also applied these bone marrow preparations in two murine models of radiation induced delayed wound healing to determine which had a greater effect on healing. Angiogenesis assays demonstrated that tube formation was stimulated by both WBM and BMC, with WBM having the greatest effect. Scratch wound assays showed higher fibroblast migration at 24, 48, and 72 hours in presence of WBM as compared to BM-MSC. WBM also appeared to stimulate a greater healing response than BMC and BM-MSC in a radiation induced delayed wound healing animal model. These studies promise to help elucidate the role of stem cells during repair of chronic wounds and reveal which cells present in bone marrow might contribute most to the wound healing process.

  12. Bone Marrow Diseases

    Science.gov (United States)

    ... that help with blood clotting. With bone marrow disease, there are problems with the stem cells or ... marrow makes too many white blood cells Other diseases, such as lymphoma, can spread into the bone ...

  13. Bone marrow cells other than stem cells seed the bone marrow after rescue transfusion of fatally irradiated mice

    International Nuclear Information System (INIS)

    Cronkite, E.P.; Inoue, T.; Bullis, J.E.

    1987-01-01

    In a previous publication, iodinated deoxyuridine ( 125 IUdR) incorporation data were interpreted as indicating that spleen colony-forming units (CFU-S) in DNA synthesis preferentially seeded bone marrow. In the present studies, the CFU-S content of marrow from irradiated, bone-marrow transfused mice was directly determined. Pretreatment of the transfused cells with cytocidal tritiated thymidine resulted in an insignificant diminution in CFU-S content when compared with nontritiated thymidine pretreatment, implying that there is no preferential seeding. The 125 IUdR incorporation data have been reinterpreted as being a result of the proliferation of other progenitor cells present that have seeded the bone marrow

  14. Metastatic basal cell carcinoma to the bone and bone marrow.

    Science.gov (United States)

    Elghissassi, Ibrahim; Mikou, Asmaa; Inrhaoun, Hanane; Ennouhi, Amine; Gamra, Lamiae; Errihani, Hassan

    2009-05-01

    Basal cell carcinoma (BCC) is the most common carcinoma in the community, but the incidence of metastatic events is exceedingly low. The few reported cases most often appear in regional nodes or the lungs, and patients usually exhibit multiple concurrent organs of spread at the time of diagnosis. We report a case of primary BCC located on the left forehead of a 48-year-old man, which metastasized exclusively to the bone and bone marrow, associated with hematologic disorders. A short review of the literature is included. Pathologic examination of the tumor located on the left forehead showed BCC. The patient underwent two surgical excisions because of local recurrence. Three years later, the patient developed a bicytopenia (anemia and thrombocytopenia). The bone marrow biopsy revealed metastasis of BCC. There were no abnormal findings in the other routine laboratory tests and radiologic investigations, except for the bone scan which showed multifocal skeletal metastases. The patient received two cycles of chemotherapy with cisplatin 75 mg/m(2) before he died as a result of hemorrhagic complications and progressive disease. Metastasis of BCC is a very rare condition that should not be overlooked. The prognosis remains very poor. We emphasize the importance of long-term follow-up of such patients.

  15. A method for generation of bone marrow-derived macrophages from cryopreserved mouse bone marrow cells.

    Directory of Open Access Journals (Sweden)

    Fernanda M Marim

    Full Text Available The broad use of transgenic and gene-targeted mice has established bone marrow-derived macrophages (BMDM as important mammalian host cells for investigation of the macrophages biology. Over the last decade, extensive research has been done to determine how to freeze and store viable hematopoietic human cells; however, there is no information regarding generation of BMDM from frozen murine bone marrow (BM cells. Here, we establish a highly efficient protocol to freeze murine BM cells and further generate BMDM. Cryopreserved murine BM cells maintain their potential for BMDM differentiation for more than 6 years. We compared BMDM obtained from fresh and frozen BM cells and found that both are similarly able to trigger the expression of CD80 and CD86 in response to LPS or infection with the intracellular bacteria Legionella pneumophila. Additionally, BMDM obtained from fresh or frozen BM cells equally restrict or support the intracellular multiplication of pathogens such as L. pneumophila and the protozoan parasite Leishmania (L. amazonensis. Although further investigation are required to support the use of the method for generation of dendritic cells, preliminary experiments indicate that bone marrow-derived dendritic cells can also be generated from cryopreserved BM cells. Overall, the method described and validated herein represents a technical advance as it allows ready and easy generation of BMDM from a stock of frozen BM cells.

  16. Cell Fate and Differentiation of Bone Marrow Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Shoichiro Kokabu

    2016-01-01

    Full Text Available Osteoblasts and bone marrow adipocytes originate from bone marrow mesenchymal stem cells (BMMSCs and there appears to be a reciprocal relationship between adipogenesis and osteoblastogenesis. Alterations in the balance between adipogenesis and osteoblastogenesis in BMMSCs wherein adipogenesis is increased relative to osteoblastogenesis are associated with decreased bone quality and quantity. Several proteins have been reported to regulate this reciprocal relationship but the exact nature of the signals regulating the balance between osteoblast and adipocyte formation within the bone marrow space remains to be determined. In this review, we focus on the role of Transducin-Like Enhancer of Split 3 (TLE3, which was recently reported to regulate the balance between osteoblast and adipocyte formation from BMMSCs. We also discuss evidence implicating canonical Wnt signalling, which plays important roles in both adipogenesis and osteoblastogenesis, in regulating TLE3 expression. Currently, there is demand for new effective therapies that target the stimulation of osteoblast differentiation to enhance bone formation. We speculate that reducing TLE3 expression or activity in BMMSCs could be a useful approach towards increasing osteoblast numbers and reducing adipogenesis in the bone marrow environment.

  17. Glucocorticoids induce autophagy in rat bone marrow mesenchymal stem cells

    DEFF Research Database (Denmark)

    Wang, L.; Fan, J.; Lin, Y. S.

    2015-01-01

    and their responses to diverse stimuli, however, the role of autophagy in glucocorticoidinduced damage to bone marrow mesenchymal stem cells (BMSCs) remains unclear. The current study confirmed that glucocorticoid administration impaired the proliferation of BMSCs. Transmission electron microscopy...

  18. Autologous bone marrow mononuclear cell delivery to dilated ...

    African Journals Online (AJOL)

    Autologous bone marrow mononuclear cell delivery to dilated cardiomyopathy patients: A clinical trial. PLN Kaparthi, G Namita, LK Chelluri, VSP Rao, PK Shah, A Vasantha, SK Ratnakar, K Ravindhranath ...

  19. Local chemical sympathectomy of rat bone marrow and its effect on marrow cell composition.

    Science.gov (United States)

    Dubový, P; Klusáková, I; Kučera, L; Osičková, J; Chovancová, J; Loja, T; Mayer, J; Doubek, M; Joukal, M

    2017-09-01

    Existing experimental studies of the effect of sympathetic nerve fibers on bone marrow cells are based on the systemic administration of neurotoxic 6-hydroxydopamine. The method of global chemical sympathectomy has some serious disadvantages and could lead to questionable results. We describe a new method of local chemical sympathectomy of rat femoral bone marrow using guanethidine (Ismelin) delivery using an osmotic mini pump. Local guanethidine treatment for 14days led to complete elimination of sympathetic fibers in femoral bone marrow in contrast to bone marrow of contralateral or naïve femurs. Ablation of sympathetic fibers was associated with a loss of rat endothelial cell marker (RECA) indicating immunophenotype changes in blood vessel endothelial cells, but no significant effect of guanethidine was found on the survival of endothelial cells and mesenchymal stem cells in vitro. Moreover, local guanethidine treatment also elicited a significant reduction of Nestin+/SDF1+ mesenchymal stem cells and c-Kit+/CD90+ hematopoietic stem cells in femoral bone marrow. Tissue-specific chemical sympathectomy of rat bone marrow by guanethidine overcomes some of the drawbacks of systemic administration of neurotoxic compounds like 6-hydroxydopamine and delivers unequivocal evidence on the effects of sympathetic innervation on the cell content of bone marrow. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Bone Marrow Transplantation

    Science.gov (United States)

    Bone marrow is the spongy tissue inside some of your bones, such as your hip and thigh bones. It contains immature cells, called stem cells. The ... platelets, which help the blood to clot. A bone marrow transplant is a procedure that replaces a ...

  1. Advances in Bone Marrow Stem Cell Therapy for Retinal Dysfunction

    Science.gov (United States)

    Park, Susanna S.; Moisseiev, Elad; Bauer, Gerhard; Anderson, Johnathon D.; Grant, Maria B.; Zam, Azhar; Zawadzki, Robert J.; Werner, John S.; Nolta, Jan A.

    2016-01-01

    The most common cause of untreatable vision loss is dysfunction of the retina. Conditions, such as age-related macular degeneration, diabetic retinopathy and glaucoma remain leading causes of untreatable blindness worldwide. Various stem cell approaches are being explored for treatment of retinal regeneration. The rationale for using bone marrow stem cells to treat retinal dysfunction is based on preclinical evidence showing that bone marrow stem cells can rescue degenerating and ischemic retina. These stem cells have primarily paracrine trophic effects although some cells can directly incorporate into damaged tissue. Since the paracrine trophic effects can have regenerative effects on multiple cells in the retina, the use of this cell therapy is not limited to a particular retinal condition. Autologous bone marrow-derived stem cells are being explored in early clinical trials as therapy for various retinal conditions. These bone marrow stem cells include mesenchymal stem cells, mononuclear cells and CD34+ cells. Autologous therapy requires no systemic immunosuppression or donor matching. Intravitreal delivery of CD34+ cells and mononuclear cells appears to be tolerated and is being explored since some of these cells can home into the damaged retina after intravitreal administration. The safety of intravitreal delivery of mesenchymal stem cells has not been well established. This review provides an update of the current evidence in support of the use of bone marrow stem cells as treatment for retinal dysfunction. The potential limitations and complications of using certain forms of bone marrow stem cells as therapy are discussed. Future directions of research include methods to optimize the therapeutic potential of these stem cells, non-cellular alternatives using extracellular vesicles, and in vivo high-resolution retinal imaging to detect cellular changes in the retina following cell therapy. PMID:27784628

  2. Cells derived from young bone marrow alleviate renal aging.

    Science.gov (United States)

    Yang, Hai-Chun; Rossini, Michele; Ma, Li-Jun; Zuo, Yiqin; Ma, Ji; Fogo, Agnes B

    2011-11-01

    Bone marrow-derived stem cells may modulate renal injury, but the effects may depend on the age of the stem cells. Here we investigated whether bone marrow from young mice attenuates renal aging in old mice. We radiated female 12-mo-old 129SvJ mice and reconstituted them with bone marrow cells (BMC) from either 8-wk-old (young-to-old) or 12-mo-old (old-to-old) male mice. Transfer of young BMC resulted in markedly decreased deposition of collagen IV in the mesangium and less β-galactosidase staining, an indicator of cell senescence. These changes paralleled reduced expression of plasminogen activator inhibitor-1 (PAI-1), PDGF-B (PDGF-B), the transdifferentiation marker fibroblast-specific protein-1 (FSP-1), and senescence-associated p16 and p21. Tubulointerstitial and glomerular cells derived from the transplanted BMC did not show β-galactosidase activity, but after 6 mo, there were more FSP-1-expressing bone marrow-derived cells in old-to-old mice compared with young-to-old mice. Young-to-old mice also exhibited higher expression of the anti-aging gene Klotho and less phosphorylation of IGF-1 receptor β. Taken together, these data suggest that young bone marrow-derived cells can alleviate renal aging in old mice. Direct parenchymal reconstitution by stem cells, paracrine effects from adjacent cells, and circulating anti-aging molecules may mediate the aging of the kidney.

  3. Effects of Spaceflight on Cells of Bone Marrow Origin

    Directory of Open Access Journals (Sweden)

    Engin Özçivici

    2013-03-01

    Full Text Available Once only a subject for science fiction novels, plans for establishing habitation on space stations, the Moon, and distant planets now appear among the short-term goals of space agencies. This article reviews studies that present biomedical issues that appear to challenge humankind for long-term spaceflights. With particularly focus on cells of bone marrow origin, studies involving changes in bone, immune, and red blood cell populations and their functions due to extended weightlessness were reviewed. Furthermore, effects of mechanical disuse on primitive stem cells that reside in the bone marrow were also included in this review. Novel biomedical solutions using space biotechnology will be required in order to achieve the goal of space exploration without compromising the functions of bone marrow, as spaceflight appears to disrupt homeostasis for all given cell types.

  4. Bone marrow-derived cells in palatal wound healing.

    NARCIS (Netherlands)

    Verstappen, J.; Katsaros, C.; Torensma, R.; Hoff, J.W. Von den

    2010-01-01

    OBJECTIVE: Myofibroblasts are responsible for contraction and scarring after cleft palate repair. This leads to growth disturbances in the upper jaw. We hypothesized that cells from the bone marrow are recruited to palatal wounds and differentiate into myofibroblasts. METHODS: We transplanted bone

  5. Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells

    Science.gov (United States)

    2016-10-01

    mouse hematopoietic stem cells ex vivo by reprogramming cellular metabolism. Blood. 2015;125(10):1562-1565. 54. Nath N, Khan M, Paintlia MK, Singh I...Award Number: W81XWH-14-1-0297 TITLE: Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells PRINCIPAL INVESTIGATOR: Raymond J...Molecule Protection of Bone Marrow Hematopoietic Stem Cells Stem Cells ’ 5a. CONTRACT NUMBER W81XWH-14-1-0297 W81XWH-14-1-0297 W81XWH-14-1-0297 5b

  6. Rat bone marrow stem cells isolation and culture as a bone formative experimental system

    Directory of Open Access Journals (Sweden)

    Amer Smajilagić

    2013-02-01

    Full Text Available Bone marrow mesenchymal cells have been identified as a source of pluripotent stem cells with multipotential potential and differentiation in to the different cells types such as are osteoblast, chondroblast, adipoblast. In this research we describe pioneering experiment of tissue engineering in Bosnia and Herzegovina, of the isolation and differentiation rat bone marrow stromal cells in to the osteoblast cells lineages. Rat bone marrow stromal cells were isolated by method described by Maniatopulos using their plastic adherence capatibility. The cells obtained by plastic adherence were cultured and serially passaged in the osteoinductive medium to differentiate into the osteocytes. Bone marrow samples from rats long bones used for isolation of stromal cells (BMSCs. Under determinate culture conditions BMSCs were differentiated in osteogenic cell lines detected by Alizarin red staining three weeks after isolation. BMSCs as autologue cells model showed high osteogenetic potential and calcification capatibility in vitro. In future should be used as alternative method for bone transplantation in Regenerative Medicine.

  7. Factors controlling the engraftment of transplanted dog bone marrow cells

    International Nuclear Information System (INIS)

    Vriesendorp, H.M.; Klapwyk, W.M.; Heidt, P.J.; Hogeweg, B.; Zurcher, C.; Bekkum, D.W. van

    1982-01-01

    The LD50 of total body irradiation (TBI) for the bone marrow (BM) syndrome and the gastrointestinal (GI) syndrme was determined in dogs as 3.7 Gy, and 8.5 Gy respectively. Five Gy TBI was adequate conditioning for BM cells of littermate donors identical for the major histocompatibility comples (MHC). The maximum tolerated TBI (about 7.5 Gy) caused more side effects than 5.0 Gy TBI and was insufficient for engraftment of realistic numbers of BM cells of MHC mismatched donors. In autologous and MHC matched transplants, the rateof hemopoietic recovery correlated with the number of BM cells given. Approximtely 2 x 10 7 autologous and 1 x 10 8 MHC identical BM cells.kg -1 were needed for radiation protection. Platelet recovery was significantly more rapid in allogeneic combinations in comparison to autologous transplants. Low numbers of autologous cryopreserved bone marrow cells were as effective as fresh bone marrow cells in rescuing animals after lethal TBI. Other factors that influence BM cell engraftment were confirmed (prior sensitization of the recipient, donor selection) or identified (purification of BM cells on density gradient and selective gastrointestinal decontamination of the recipient). Consistent engraftment of gradient separated, MHC identical, BM cells was found after conditioning with two fractions of 6.0 Gy TBI, separated by 72 h. One MHC haplotype mismatched marrow did engraft after two TBI fractions of 6.0 Gy. Engraftment no longer occurred with gradient purified bone marrow cells from this type of donor. Late effects of TBI were early greying in all animals, and secondary uterine inertia in female dogs after 7.5 GY TBI. Fertility in males or females was not changed by radiation. An increase of pancreas fibrosis was noted in dogs receiving fractions of 6.0 Gy TBI. (author)

  8. Can yoga therapy stimulate stem cell trafficking from bone marrow?

    Directory of Open Access Journals (Sweden)

    Nitya Shree

    2016-07-01

    Full Text Available It has been established that mesenchymal stromal cells (MSCs from bone marrow enter the peripheral circulation intermittently for possible tissue regeneration, repair and to take care of daily wear and tear. This is evident from the detection of MSCs from peripheral blood. The factors governing this migration remain elusive. These MSCs carry out the work of policing and are supposed to repair the injured tissues. Thus, these cells help in maintaining the tissue and organ homeostasis. Yoga and pranayama originated in India and is now being practiced all over the world for positive health. So far, the chemical stimulation of bone marrow has been widely used employing injection of colony stimulating factor. However, the role of physical factors such as mechanical stimulation and stretching has not been substantiated. It is claimed that practicing yoga delays senescence, improves the physiological functions of heart and lung and yoga postures make the body elastic. It remains to be seen whether the yoga therapy promotes trafficking of the stem cells from bone marrow for possible repair and regeneration of worn out and degenerating tissues. We cover in this short review, mainly the role of physical factors especially the yoga therapy on stem cells trafficking from bone marrow.

  9. Can yoga therapy stimulate stem cell trafficking from bone marrow?

    Science.gov (United States)

    Shree, Nitya; Bhonde, Ramesh R

    It has been established that mesenchymal stromal cells (MSCs) from bone marrow enter the peripheral circulation intermittently for possible tissue regeneration, repair and to take care of daily wear and tear. This is evident from the detection of MSCs from peripheral blood. The factors governing this migration remain elusive. These MSCs carry out the work of policing and are supposed to repair the injured tissues. Thus, these cells help in maintaining the tissue and organ homeostasis. Yoga and pranayama originated in India and is now being practiced all over the world for positive health. So far, the chemical stimulation of bone marrow has been widely used employing injection of colony stimulating factor. However, the role of physical factors such as mechanical stimulation and stretching has not been substantiated. It is claimed that practicing yoga delays senescence, improves the physiological functions of heart and lung and yoga postures make the body elastic. It remains to be seen whether the yoga therapy promotes trafficking of the stem cells from bone marrow for possible repair and regeneration of worn out and degenerating tissues. We cover in this short review, mainly the role of physical factors especially the yoga therapy on stem cells trafficking from bone marrow. Copyright © 2016 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

  10. Shifts in bone marrow cell phenotypes caused by spaceflight.

    Science.gov (United States)

    Ortega, M Teresa; Pecaut, Michael J; Gridley, Daila S; Stodieck, Louis S; Ferguson, Virginia; Chapes, Stephen K

    2009-02-01

    Bone marrow cells were isolated from the humeri of C57BL/6 mice after a 13-day flight on the space shuttle Space Transportation System (STS)-118 to determine how spaceflight affects differentiation of cells in the granulocytic lineage. We used flow cytometry to assess the expression of molecules that define the maturation/activation state of cells in the granulocytic lineage on three bone marrow cell subpopulations. These molecules included Ly6C, CD11b, CD31 (platelet endothelial cell adhesion molecule-1), Ly6G (Gr-1), F4/80, CD44, and c-Fos. The three subpopulations were small agranular cells [region (R)1], larger granular cells (R2), which were mostly neutrophils, and very large, very granular cells (R3), which had properties of macrophages. Although there were no composite phenotypic differences between total bone marrow cells isolated from spaceflight and ground-control mice, there were subpopulation differences in Ly6C (R1 and R3), CD11b (R2), CD31 (R1, R2, and R3), Ly6G (R3), F4/80 (R3), CD44(high) (R3), and c-Fos (R1, R2, and R3). In particular, the elevation of CD11b in the R2 subpopulation suggests neutrophil activation in response to landing. In addition, decreases in Ly6C, c-Fos, CD44(high), and Ly6G and an increase in F4/80 suggest that the cells in the bone marrow R3 subpopulation of spaceflight mice were more differentiated compared with ground-control mice. The presence of more differentiated cells may not pose an immediate risk to immune resistance. However, the reduction in less differentiated cells may forebode future consequences for macrophage production and host defenses. This is of particular importance to considerations of future long-term spaceflights.

  11. Identifying A Molecular Phenotype for Bone Marrow Stromal Cells With In Vivo Bone Forming Capacity

    DEFF Research Database (Denmark)

    Larsen, Kenneth H; Frederiksen, Casper M; Burns, Jorge S

    2009-01-01

    Abstract The ability of bone marrow stromal cells (BMSCs) to differentiate into osteoblasts is being exploited in cell-based therapy for repair of bone defects. However, the phenotype of ex vivo cultured BMSCs predicting their bone forming capacity is not known. Thus, we employed DNA microarrays...... comparing two human bone marrow stromal cell (hBMSC) populations: one is capable of in vivo heterotopic bone formation (hBMSC-TERT(+Bone)) and the other is not (hBMSC-TERT(-Bone)). Compared to hBMSC-TERT(-Bone), the hBMSC-TERT(+Bone) cells had an increased over-representation of extracellular matrix genes...... (17% versus 5%) and a larger percentage of genes with predicted SP3 transcription factor binding sites in their promoter region (21% versus 8%). On the other hand, hBMSC-TERT(-Bone) cells expressed a larger number of immune-response related genes (26% versus 8%). In order to test for the predictive...

  12. Effects of smoke and tea on radiation-induced bone marrow cell mutation and marrow inhibition

    International Nuclear Information System (INIS)

    Gao Yong; Zhang Weiguang

    2004-01-01

    Objective: To provide scientific information for the prevention and treatment of the radiation damage by analyzing the effects of smoke and tea on radiation-induced bone marrow cell mutation and marrow inhibition. Methods: 7 group mice were exposed to smoke and/or tea and/or radiation respectively. There were also b blank control group and a cyclophosphamide positive control group. The frequencies of micronucleated polychromatic erythrocytes (MPCE), the ratio of polychromatic erythrocytes (PCE) to mature erythrocytes (RBC) in marrow, and the count of peripheral blood hemoleukocyte were observed. Results: The frequencies of MPCE in the groups irradiated with γ-rays were significantly higher than that in the blank control group (P<0.05 or 0.01). The smoke + radiation group's frequency was significantly higher than single radiation group (P<0.05). The ratios of PCE to RBC in the groups irradiated were significantly lower than that in the blank control group (P<0.01). The counts of peripheral blood hemoleukocyte in the groups irradiated were significantly lower than the blank control group (P<0.01). Conclusion: Radiation were able to cause marrow cell mutation and induce marrow inhibition. Smoke increases the effect of radiation-induced marrow cell mutation. Tea and smoke could not affect radiation-induced bone marrow inhibition

  13. Transplantation? Peripheral Stem Cell/Bone Marrow/Cord Blood

    Directory of Open Access Journals (Sweden)

    Itır Sirinoglu Demiriz

    2012-01-01

    Full Text Available The introduction of peripheral stem cell (PSC and cord blood (CB as an alternative to bone marrow (BM recently has caused important changes on hematopoietic stem cell transplantation (HSCT practice. According to the CIBMTR data, there has been a significant decrease in the use of bone marrow and increase in the use of PSC and CB as the stem cell source for HSCT performed during 1997–2006 period for patients under the age of 20. On the other hand, the stem cell source in 70% of the HSCT procedures performed for patients over the age of 20 was PSC and the second most preferred stem cell source was bone marrow. CB usage is very limited for the adult population. Primary disease, stage, age, time and urgency of transplantation, HLA match between the patient and the donor, stem cell quantity, and the experience of the transplantation center are some of the associated factors for the selection of the appropriate stem cell source. Unfortunately, there is no prospective randomized study aimed to facilitate the selection of the correct source between CB, PSC, and BM. In this paper, we would like to emphasize the data on stem cell selection in light of the current knowledge for patient populations according to their age and primary disease.

  14. Bone marrow biopsy

    Science.gov (United States)

    ... test is used to diagnose leukemia, infections, some types of anemia, and other blood disorders. It may also be ... the bone marrow contains the proper number and types of blood-forming (hematopoietic) cells, fat cells, and connective tissues.

  15. CD34 defines an osteoprogenitor cell population in mouse bone marrow stromal cells

    DEFF Research Database (Denmark)

    Abdallah, Basem M; Al-Shammary, Asma; Skagen, Peter

    2015-01-01

    Bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells) and their progenitors have been identified based on retrospective functional criteria. CD markers are employed to define cell populations with distinct functional characteristics. However, defining and pro...

  16. Effects of ionizing radiation on differentiation of murine bone marrow cells into mast cells

    International Nuclear Information System (INIS)

    Murakami, Sho; Yoshino, Hironori; Ishikawa, Junya; Yamaguchi, Masaru; Tsujiguchi, Takakiyo; Nishiyama, Ayaka; Yokoyama, Kouki; Kashiwakura, Ikuo

    2015-01-01

    Mast cells, immune effector cells produced from bone marrow cells, play a major role in immunoglobulin E–mediated allergic responses. Ionizing radiation affects the functions of mast cells, which are involved in radiation-induced tissue damage. However, whether ionizing radiation affects the differential induction of mast cells is unknown. Here we investigated whether bone marrow cells of X-irradiated mice differentiated into mast cells. To induce mast cells, bone marrow cells from X-irradiated and unirradiated mice were cultured in the presence of cytokines required for mast cell induction. Although irradiation at 0.5 Gy and 2 Gy decreased the number of bone marrow cells 1 day post-irradiation, the cultured bone marrow cells of X-irradiated and unirradiated mice both expressed mast cell–related cell-surface antigens. However, the percentage of mast cells in the irradiated group was lower than in the unirradiated group. Similar decreases in the percentage of mast cells induced in the presence of X-irradiation were observed 10 days post irradiation, although the number of bone marrow cells in irradiated mice had recovered by this time. Analysis of mast cell function showed that degranulation of mast cells after immunoglobulin E–mediated allergen recognition was significantly higher in the X-irradiated group compared with in the unirradiated group. In conclusion, bone marrow cells of X-irradiated mice differentiated into mast cells, but ionizing radiation affected the differentiation efficiency and function of mast cells. (author)

  17. Migration of bone marrow cells to the thymus in sublethally irradiated mice

    International Nuclear Information System (INIS)

    Varlet, Andree; Lenaerts, Patrick; Houben-Defresne, M.P.; Boniver, Jacques

    1982-01-01

    In sublethally irradiated mice, thymus repopulation is due first to the proliferation of surviving thymocytes followed by the multiplication of bone marrow derived prothymocytes. The migration of bone marrow cells to the thymus after a single sublethal whole-body X irradiation was studied by using fluorescein isothiocyanate as a cell marker. Irradiation increases the permissiveness of the thymus to the immigration of bone marrow cells. Furthermore, the post-Rx regenerating bone marrow cells exhibit migration capacities greater than the normal ones. The radiation induced changes in the bone marrow thymus interaction might play an important role in thymus regeneration after sublethal irradiation [fr

  18. Quantification of bone marrow plasma cell infiltration in multiple myeloma : Usefulness of bone marrow aspirate clot with CD138 immunohistochemistry

    NARCIS (Netherlands)

    Matsue, Kosei; Matsue, Yuya; Kumata, Kaoru; Usui, Yoshiaki; Suehara, Yasuhito; Fukumoto, Kota; Fujisawa, Manabu; Narita, Kentaro; Takeuchi, Masami

    Accurate quantification of plasma cells (PCs) in bone marrow (BM) is critical for diagnosis and assessment of treatment response in patients with multiple myeloma (MM). We compared the % of BM PC quantified by 250 cell differential count on May–Giemsa-stained BM smears, by counting 500 – 2500 cells

  19. Blood and Bone MarrowTransplant?

    Science.gov (United States)

    ... Topics / Blood and Bone Marrow Transplant Blood and Bone Marrow Transplant Also known as Hematopoietic Stem Cell Transplant , Hematopoietic Cell Transplant , Autologous Transplant , Allogeneic Transplant A blood or bone marrow ...

  20. Low-frequency vibration treatment of bone marrow stromal cells induces bone repair in vivo.

    Science.gov (United States)

    He, Shengwei; Zhao, Wenzhi; Zhang, Lu; Mi, Lidong; Du, Guangyu; Sun, Chuanxiu; Sun, Xuegang

    2017-01-01

    To study the effect of low-frequency vibration on bone marrow stromal cell differentiation and potential bone repair in vivo . Forty New Zealand rabbits were randomly divided into five groups with eight rabbits in each group. For each group, bone defects were generated in the left humerus of four rabbits, and in the right humerus of the other four rabbits. To test differentiation, bones were isolated and demineralized, supplemented with bone marrow stromal cells, and implanted into humerus bone defects. Varying frequencies of vibration (0, 12.5, 25, 50, and 100 Hz) were applied to each group for 30 min each day for four weeks. When the bone defects integrated, they were then removed for histological examination. mRNA transcript levels of runt-related transcription factor 2, osteoprotegerin, receptor activator of nuclear factor κ-B ligan, and pre-collagen type 1 α were measured. Humeri implanted with bone marrow stromal cells displayed elevated callus levels and wider, more prevalent, and denser trabeculae following treatment at 25 and 50 Hz. The mRNA levels of runt-related transcription factor 2, osteoprotegerin, receptor activator of nuclear factor κ-B ligand, and pre-collagen type 1 α were also markedly higher following 25 and 50 Hz treatment. Low frequency (25-50 Hz) vibration in vivo can promote bone marrow stromal cell differentiation and repair bone injury.

  1. Low-frequency vibration treatment of bone marrow stromal cells induces bone repair in vivo

    Directory of Open Access Journals (Sweden)

    Shengwei He

    2017-01-01

    Full Text Available Objective(s:To study the effect of low-frequency vibration on bone marrow stromal cell differentiation and potential bone repair in vivo. Materials and Methods:Forty New Zealand rabbits were randomly divided into five groups with eight rabbits in each group. For each group, bone defects were generated in the left humerus of four rabbits, and in the right humerus of the other four rabbits. To test differentiation, bones were isolated and demineralized, supplemented with bone marrow stromal cells, and implanted into humerus bone defects. Varying frequencies of vibration (0, 12.5, 25, 50, and 100 Hz were applied to each group for 30 min each day for four weeks. When the bone defects integrated, they were then removed for histological examination. mRNA transcript levels of runt-related transcription factor 2, osteoprotegerin, receptor activator of nuclear factor k-B ligan, and pre-collagen type 1 a were measured. Results:Humeri implanted with bone marrow stromal cells displayed elevated callus levels and wider, more prevalent, and denser trabeculae following treatment at 25 and 50 Hz. The mRNA levels of runt-related transcription factor 2, osteoprotegerin, receptor activator of nuclear factor k-B ligand, and pre-collagen type 1 a were also markedly higher following 25 and 50 Hz treatment. Conclusion:Low frequency (25–50 Hz vibration in vivo can promote bone marrow stromal cell differentiation and repair bone injury.

  2. Hyaluronan scaffold supports osteogenic differentiation of bone marrow concentrate cells.

    Science.gov (United States)

    Cavallo, C; Desando, G; Ferrari, A; Zini, N; Mariani, E; Grigolo, B

    2016-01-01

    Osteochondral lesions are considered a challenge for orthopedic surgeons. Currently, the treatments available are often unsatisfactory and unable to stimulate tissue regeneration. Tissue engineering offers a new therapeutic strategy, taking into account the role exerted by cells, biomaterial and growth factors in restoring tissue damage. In this light, Mesenchymal Stem Cells (MSCs) have been indicated as a fascinating tool for regenerative medicine thanks to their ability to differentiate into bone, cartilage and adipose tissue. However, in vitro-cultivation of MSCs could be associated with some risks such as de-differentiation/reprogramming, infection and contaminations of the cells. To overcome these shortcomings, a new approach is represented by the use of Bone Marrow Concentrate (BMC), that could allow the delivery of cells surrounded by their microenvironment in injured tissue. For this purpose, cells require a tridimensional scaffold that can support their adhesion, proliferation and differentiation. This study is focused on the potentiality of BMC seeded onto a hyaluronan-based scaffold (Hyaff-11) to differentiate into osteogenic lineage. This process depends on the specific interaction between cells derived from bone marrow (surrounded by their niche) and scaffold, that create an environment able to support the regeneration of damaged tissue. The data obtained from the present study demonstrate that BMC grown onto Hyaff-11 are able to differentiate toward osteogenic sense, producing specific osteogenic genes and matrix proteins.

  3. Remodeling of the thoracic aorta after bone marrow cell transplantation

    OpenAIRE

    Felix, Alyne; Monteiro, Nemesis; Rocha, Vinícius Novaes; Oliveira, Genilza; Moraes, Alan Cesar; Andrade, Cherley; Nascimento, Ana Lucia; de Carvalho, Laís; Thole, Alessandra; Carvalho, Jorge

    2014-01-01

    Stem cells are characterized by their ability to differentiate into multiple cell lineages and display the paracrine effect. The aim of this work was to evaluate the effect of therapy with bone marrow cells (BMCs) on blood glucose, lipid metabolism and aortic wall remodeling in mice through the administration of a high fat diet and subsequent BMCs transplantation. C57BL/6 mice were fed a control diet (CO group) or an atherogenic diet (AT group). After 16 weeks, the AT group was divided into f...

  4. Human bone-marrow-derived mesenchymal stem cells

    DEFF Research Database (Denmark)

    Kassem, Moustapha; Abdallah, Basem M

    2008-01-01

    Mesenchymal stem cells (MSC) are a group of cells present in bone-marrow stroma and the stroma of various organs with the capacity for mesoderm-like cell differentiation into, for example, osteoblasts, adipocytes, and chondrocytes. MSC are being introduced in the clinic for the treatment...... of a variety of clinical conditions. The aim of this review is to provide an update regarding the biology of MSC, their identification and culture, and mechanisms controlling their proliferation and differentiation. We also review the current status of their clinical use. Areas in which research is needed...

  5. Hemopoietic stem cell niches, recovery from radiation and bone marrow transfusions

    International Nuclear Information System (INIS)

    Cronkite, E.P.; Carsten, A.L.; Brecher, G.; Feinendegen, L.

    1979-01-01

    Studies were conducted on the appearance of cells in recipient bone marrow with chromosome markers after bone marrow transfusion to recipients that had different treatments. Investigators tried to replete the bone marrow CFV spleen at various times after recovery from maximal sublethal doses of x radiation or during continuous exposure to tritiated water. Studies were made on the effect of diverse treatments on the acceptance of bone marrow transfusions as shown by chromosomal markers. Results showed that the bone marrow of animals rescued by transfusion of 4 x 10 6 bone marrow cells will accept from 0 to 25% of the second transfusion of bone marrow cells given one to 4 months after the first transfusion and examined 2 to 3 weeks after the second transfusion. This may be due to the second transfusion filling up empty niches

  6. Incorporation of bone marrow cells in pancreatic pseudoislets improves posttransplant vascularization and endocrine function.

    Directory of Open Access Journals (Sweden)

    Christine Wittig

    Full Text Available Failure of revascularization is known to be the major reason for the poor outcome of pancreatic islet transplantation. In this study, we analyzed whether pseudoislets composed of islet cells and bone marrow cells can improve vascularization and function of islet transplants. Pancreatic islets isolated from Syrian golden hamsters were dispersed into single cells for the generation of pseudoislets containing 4×10(3 cells. To create bone marrow cell-enriched pseudoislets 2×10(3 islet cells were co-cultured with 2×10(3 bone marrow cells. Pseudoislets and bone marrow cell-enriched pseudoislets were transplanted syngeneically into skinfold chambers to study graft vascularization by intravital fluorescence microscopy. Native islet transplants served as controls. Bone marrow cell-enriched pseudoislets showed a significantly improved vascularization compared to native islets and pseudoislets. Moreover, bone marrow cell-enriched pseudoislets but not pseudoislets normalized blood glucose levels after transplantation of 1000 islet equivalents under the kidney capsule of streptozotocin-induced diabetic animals, although the bone marrow cell-enriched pseudoislets contained only 50% of islet cells compared to pseudoislets and native islets. Fluorescence microscopy of bone marrow cell-enriched pseudoislets composed of bone marrow cells from GFP-expressing mice showed a distinct fraction of cells expressing both GFP and insulin, indicating a differentiation of bone marrow-derived cells to an insulin-producing cell-type. Thus, enrichment of pseudoislets by bone marrow cells enhances vascularization after transplantation and increases the amount of insulin-producing tissue. Accordingly, bone marrow cell-enriched pseudoislets may represent a novel approach to increase the success rate of islet transplantation.

  7. The effect of autologous bone marrow stromal cells differentiated on scaffolds for canine tibial bone reconstruction.

    Science.gov (United States)

    Özdal-Kurt, F; Tuğlu, I; Vatansever, H S; Tong, S; Deliloğlu-Gürhan, S I

    2015-01-01

    Bone marrow contains mesenchymal stem cells that form many tissues. Various scaffolds are available for bone reconstruction by tissue engineering. Osteoblastic differentiated bone marrow stromal cells (BMSC) promote osteogenesis on scaffolds and stimulate bone regeneration. We investigated the use of cultured autologous BMSC on different scaffolds for healing defects in tibias of adult male canines. BMSC were isolated from canine humerus bone marrow, differentiated into osteoblasts in culture and loaded onto porous ceramic scaffolds including hydroxyapatite 1, hydroxyapatite gel and calcium phosphate. Osteoblast differentiation was verified by osteonectine and osteocalcine immunocytochemistry. The scaffolds with stromal cells were implanted in the tibial defect. Scaffolds without stromal cells were used as controls. Sections from the defects were processed for histological, ultrastructural, immunohistochemical and histomorphometric analyses to analyze the healing of the defects. BMSC were spread, allowed to proliferate and differentiate to osteoblasts as shown by alizarin red histochemistry, and osteocalcine and osteonectine immunostaining. Scanning electron microscopy showed that BMSC on the scaffolds were more active and adhesive to the calcium phosphate scaffold compared to the others. Macroscopic bone formation was observed in all groups, but scaffolds with stromal cells produced significantly better results. Bone healing occurred earlier and faster with stromal cells on the calcium phosphate scaffold and produced more callus compared to other scaffolds. Tissue healing and osteoblastic marker expression also were better with stromal cells on the scaffolds. Increased trabecula formation, cell density and decreased fibrosis were observed in the calcium phosphate scaffold with stromal cells. Autologous cultured stromal cells on the scaffolds were useful for healing of canine tibial bone defects. The calcium phosphate scaffold was the best for both cell

  8. CD146 expression on primary nonhematopoietic bone marrow stem cells is correlated with in situ localization

    DEFF Research Database (Denmark)

    Tormin, Ariane; Li, Ou; Brune, Jan Claas

    2011-01-01

    Nonhematopoietic bone marrow mesenchymal stem cells (BM-MSCs) are of central importance for bone marrow stroma and the hematopoietic environment. However, the exact phenotype and anatomical distribution of specified MSC populations in the marrow are unknown. We characterized the phenotype of prim...

  9. Antibody formation in mouse bone marrow. IV. The influence of splenectomy on the bone marrow plaque-forming cell response to sheep red blood cells

    International Nuclear Information System (INIS)

    Benner, R.; Oudenaren, A. van

    1975-01-01

    Mouse bone marrow is barely capable of plaque-forming cell (PFC) activity during the primary response to sheep red blood cells (SRBC). However, during the secondary response, it becomes the major center of activity containing IgM-, IgG- and IgA-PFC. In the present paper the influence of splenectomy was studied on primary and secondary PFC activity in the bone marrow. Differences in primary and secondary bone marrow PFC responses are probably related to the presence of B and T memory cells in situ. Therefore the effect of splenectomy on the appearance of B and T memory cells in the bone marrow was also investigated. iv.plenectomy before intravenous (iv) immunization with 4 x 10 8 SRBC prevented any primary PFC activity in the bone marrow. The influence of splenectomy before priming on secondary PFC activity in the bone marrow depended on the priming dose of SRBC. Splenectomy before priming with 10 7 SRBC iv completely prevented IgM-, IgG-, and IgA-PFC activity in the bone marrow upon subsequent boosting with 4 x 10 8 SRBC iv. By means of cell transfer experiments it was shown that after splenectomy no B or T memory cells appeared in the bone marrow after priming with 10 7 SRBC iv. Cell transfer experiments showed that splenectomy before priming with 10 7 SRBC iv not only interfered with the appearance of B and T memory cells in the bone marrow, but also with the appearance of B memory cells in peripheral lymph nodes, mesenteric lymph node, Peyer's patches, thymus, and blood. Immunization of spenectomized mice with 4 x 10 8 SRBC iv induced the appearance of B memory cells in peripheral lymph nodes, mesenteric lymph node, Peyer's patches, thymus, and blood

  10. [Bone marrow involvement in primary mediastinal B-cell lymphoma].

    Science.gov (United States)

    Magomedova, A U; Fastova, E A; Kovrigina, A M; Obukhova, T N; Skidan, N I; Mangasarova, Ya K; Vorobyev, A I; Kravchenko, S K

    Primary mediastinal large B-cell lymphoma (PMBCL) is a distinct type of large B-cell lymphoma. In this type of the disease, the neoplastic process is located in the anterior and superior mediastinum, frequently with compression of the superior vena cava and with tumor invasion into the adjacent organs and tissues: the pericardium, lung, pleura, etc. Despite the fact that in PMBCL progression, there may be involvement of extranodal organs, such as the kidney, adrenal glands, liver, and central nervous system, bone marrow (BM) injury is generally absent. Since BM injury in patients with diffuse large B-cell lymphoma is an independent poor prognostic indicator, there is reason to believe that BM involvement in PMBCL affects the prognosis. These cases may need intensified induction therapy followed by autologous hematopoietic stem cell transplantation; and BM injury should be monitored during the therapy. The paper gives reports of clinical cases of bone marrow involvement in 2 PMBCL patients treated at the National Research Center for Hematology, Ministry of Health of the Russian Federation.

  11. Bone marrow mesenchymal stem cell therapy in ischemic stroke: mechanisms of action and treatment optimization strategies

    Directory of Open Access Journals (Sweden)

    Guihong Li

    2016-01-01

    Full Text Available Animal and clinical studies have confirmed the therapeutic effect of bone marrow mesenchymal stem cells on cerebral ischemia, but their mechanisms of action remain poorly understood. Here, we summarize the transplantation approaches, directional migration, differentiation, replacement, neural circuit reconstruction, angiogenesis, neurotrophic factor secretion, apoptosis, immunomodulation, multiple mechanisms of action, and optimization strategies for bone marrow mesenchymal stem cells in the treatment of ischemic stroke. We also explore the safety of bone marrow mesenchymal stem cell transplantation and conclude that bone marrow mesenchymal stem cell transplantation is an important direction for future treatment of cerebral ischemia. Determining the optimal timing and dose for the transplantation are important directions for future research.

  12. Bone marrow-derived mesenchymal cells can rescue osteogenic capacity of devitalized autologous bone.

    Science.gov (United States)

    Tohma, Yasuaki; Ohgushi, Hajime; Morishita, Toru; Dohi, Yoshiko; Tadokoro, Mika; Tanaka, Yasuhito; Takakura, Yoshinori

    2008-01-01

    In clinical cases, many orthopaedists have been troubled with bone fragility, such as fractures after devitalization therapy for bone tumour, pathological fractures and metastatic tumours. The aim of this study was to determine whether loss of osteogenic capacity of devitalized autologous bones can be rescued using cultured bone marrow-derived mesenchymal cells. A devitalized bone model was produced from rat femur by irradiation and three groups were prepared: intact bone, irradiated bone and irradiated bone combined with cultured mesenchymal cells. Each bone was transplanted subcutaneously into a syngeneic rat. At 2 or 4 weeks after transplantation, biochemical analyses [alkaline phosphatase (ALP) activity and osteocalcin mRNA expression] and histological measurement were performed. Moreover, we verified the origin of newly formed bone, using the sex-determining region Y (sry) gene as a marker to distinguish between donor and recipient. In both intact bone and irradiated bone with mesenchymal cells, ALP activity and osteocalcin mRNA expression were detected and living osteoblasts together with newly formed bone were clearly seen histologically. Furthermore, analysis of the origin of de novo formed bone indicated that newly formed bone in irradiated bone with mesenchymal cells was derived from cultured bone marrow-derived mesenchymal cells. These results proved that the osteogenic capacity of devitalized autologous bone can be rescued using tissue-engineering techniques. This procedure should contribute to various clinical treatments, such as local metastatic tumours, pathological fracture after devitalization therapy and reconstruction after wide-margin tumour resection. The benefits would be applicable to all types of devitalized bone. Copyright (c) 2008 John Wiley & Sons, Ltd.

  13. Complexity of bone marrow hematopoietic stem cell niche.

    Science.gov (United States)

    Asada, Noboru; Takeishi, Shoichiro; Frenette, Paul S

    2017-07-01

    Hematopoietic stem cells (HSCs) that produce a variety of hematopoietic lineage cells throughout the life reside in specialized microenvironment called "niche" in the bone marrow (BM) where they are tightly regulated. With the recent advances in experimental technologies enabling the selective deletion of molecules, various types of cells in the BM have been proposed to contribute to HSC niche activity. Among these are stromal cells closely associated with the vasculature. In this review, we provide an overview of recent advances in HSC niche research, and focus on the studies describing the functional roles of perivascular cells for HSC maintenance and mobilization. Not only for physiologic state, we also discuss the recent evidences suggesting the importance of microenvironment for emergence of malignant hematopoietic diseases.

  14. Adult bone marrow: which stem cells for cellular therapy protocols in neurodegenerative disorders?

    Science.gov (United States)

    Wislet-Gendebien, Sabine; Laudet, Emerence; Neirinckx, Virginie; Rogister, Bernard

    2012-01-01

    The generation of neuronal cells from stem cells obtained from adult bone marrow is of significant clinical interest in order to design new cell therapy protocols for several neurological disorders. The recent identification in adult bone marrow of stem cells derived from the neural crests (NCSCs) might explain the neuronal phenotypic plasticity shown by bone marrow cells. However, little information is available about the nature of these cells compared to mesenchymal stem cells (MSCs). In this paper, we will review all information available concerning NCSC from adult tissues and their possible use in regenerative medicine. Moreover, as multiple recent studies showed the beneficial effect of bone marrow stromal cells in neurodegenerative diseases, we will discuss which stem cells isolated from adult bone marrow should be more suitable for cell replacement therapy.

  15. Involvement of bone marrow stem cells in periodontal wound healing.

    Science.gov (United States)

    Zhou, Li Li; Liu, Hong Wei; Wen, Xin Xin; Xie, Han

    2014-01-01

    To test the hypothesis whether bone marrow stem cells (BMSCs) could migrate into the periodontium as the precursor available for the repair of tissue injury. A chimeric mouse model was established by transplanting BMSCs derived from red fluorescent protein mouse into irradiated BALB/c mice. Subsequently, a periodontal defect was created beside the maxillary first molar and filled with ceramic bovine bone. Finally, the chimeric mice were divided into three groups and were observed 3, 14 and 28 days later respectively. The involvement of BMSCs in periodontal defects was analysed using an in vivo imaging system and immunohistochemical staining of CD45, CD105 and CD31. Cell surface marker expression in injured tissue was also compared with that in normal tissue. Increasing numbers of BMSCs migrated into the periodontal defect with time. The distribution was initially limited to ceramic bovine bone and then around blood vessels and near alveolar bone. Furthermore, expression of CD105 and CD31 was much higher in injured periodontal tissue than that in healthy periodontium, although CD45 was not expressed in either of these tissues. BMSCs, but not haemopoietic stem cells, were involved in periodontal defect; they entered the periodontium probably via blood vessels.

  16. Differential Cell Count of Bone Marrow Aspirates in Steady-state ...

    African Journals Online (AJOL)

    Bone marrow was aspirated from the posterior superior iliac spine. Slides were stained with MayGrünwald-Giemsa stain. Proportions of erythroid, myeloid, lymphoid and megakaryocytic cells out of 250 nucleated bone marrow cells were determined. Results: Steady state mean packed cell volume (PCV) was 0.2 ± 0.017 L/L.

  17. Cell Cycle Related Differentiation of Bone Marrow Cells into Lung Cells

    Energy Technology Data Exchange (ETDEWEB)

    Dooner, Mark; Aliotta, Jason M.; Pimental, Jeffrey; Dooner, Gerri J.; Abedi, Mehrdad; Colvin, Gerald; Liu, Qin; Weier, Heinz-Ulli; Dooner, Mark S.; Quesenberry, Peter J.

    2007-12-31

    Green-fluorescent protein (GFP) labeled marrow cells transplanted into lethally irradiated mice can be detected in the lungs of transplanted mice and have been shown to express lung specific proteins while lacking the expression of hematopoietic markers. We have studied marrow cells induced to transit cell cycle by exposure to IL-3, IL-6, IL-11 and steel factor at different times of culture corresponding to different phases of cell cycle. We have found that marrow cells at the G1/S interface have a 3-fold increase in cells which assume a lung phenotype and that this increase is no longer seen in late S/G2. These cells have been characterized as GFP{sup +} CD45{sup -} and GFP{sup +} cytokeratin{sup +}. Thus marrow cells with the capacity to convert into cells with a lung phenotype after transplantation show a reversible increase with cytokine induced cell cycle transit. Previous studies have shown the phenotype of bone marrow stem cells fluctuates reversibly as these cells traverse cell cycle, leading to a continuum model of stem cell regulation. The present studies indicate that marrow stem cell production of nonhematopoietic cells also fluctuates on a continuum.

  18. Ex vivo expansion of Primate CD34+ Cells isolated from Bone Marrow and Human Bone Marrow Mononuclear Cells using a Novel Scaffold

    Directory of Open Access Journals (Sweden)

    Devaprasad D

    2009-01-01

    Full Text Available Bone marrow derived CD34+ cells have been in clinical application in patients with haematological malignancies. One of the major problems with this treatment is the non-availability of matched donors or the necessity of multiple transfusions depending upon the pathology. Recently evidences have been accumulating to prove the safety and efficacy of autologous CD34+ cells in diseases such as myocardial dysfunction, peripheral vascular diseases and neurological certain conditions. However there are only a few reports in the literature on ex vivo expansion of the bone marrow derived CD34+ cells. We have in two different studies proven that isolated CD34+ cells from baboon bone marrow and non-isolated BMMNCs from human bone marrow could be expanded with increase in percentage of CD34+ cells using a novel scaffold.

  19. Megakaryocytopoiesis and the number of thrombocytes after bone marrow cell transplantation in lethally irradiated mice

    International Nuclear Information System (INIS)

    Viktora, L.; Hermanova, E.; Zoubkova, M.

    1977-01-01

    Changes were studied in the number of thrombocytes in the peripheral blood and megakaryocytes in the bone marrow and spleen in lethally irradiated mice after the transplantation of bone marrow cells. It was found that the thrombocytes increased in dependence on time after transplantation with the maximal values around the 20th day. An increased megakaryocytopoiesis was observed not only in the bone marrow but also in the spleen. These ascertainments suggest the importance of the transplantation of bone marrow cells and the role of thrombocytes for the survival of the organism after irradiation. (author)

  20. Discrepancy of biologic behavior influenced by bone marrow derived cells in lung cancer.

    Science.gov (United States)

    Zhang, Jie; Niu, Xiao-Min; Liao, Mei-Lin; Liu, Yun; Sha, Hui-Fang; Zhao, Yi; Yu, Yong-Feng; Tan, Qiang; Xiang, Jia-Qing; Fang, Jing; Lv, Dan-Dan; Li, Xue-Bing; Lu, Shun; Chen, Hai-Quan

    2010-11-01

    Disseminated cancer cells may initially require local nutrients and growth factors to thrive and survive in bone marrow. However, data on the influence of bone marrow derived cells (BMDC, also called bone stromal cells in some publications) on lung cancer cells is largely unexplored. This study explored the mechanism of how bone stromal factors contribute to the bone tropism in lung cancer. The difference among lung cancer cell lines in their abilities to metastasize to bone was found using the SCID animal model. Supernatant of bone marrow aspiration (BM) and condition medium from human bone stromal cells (BSC) were used to study the activity of bone stromal factors. We found bone stromal factors significantly increased the proliferation, invasion, adhesion and expression of angiogenosis-related factors, and inhibited the apoptosis for high bone metastasis H460 lung cancer cells. These biologic effects were not seen in SPC-A1 or A549 cells, which are low bone metastasis lung cancer cells. Adhesion of H460 cells to surface coated with bone stromal cells can activate some signal transduction pathways, and alter the expression of adhesion associated factors, including integrin β 3 and ADAMTS-1, two potential targets related with bone metastasis. We concluded that bone marrow derived cells had a profound effect on biological behavior of lung cancers, therefore favoring the growth of lung cancer cells in bone.

  1. Autologous bone marrow mononuclear cells transplant in patients with critical leg ischemia: preliminary clinical results.

    Science.gov (United States)

    Li, Min; Zhou, Hua; Jin, Xing; Wang, Mo; Zhang, Shiyi; Xu, Lei

    2013-10-01

    Stem cell transplant can induce vasculogenesis and improve the blood supply to an ischemic region, offering hope for chronic lower extremity ischemic diseases. Bone marrow mononuclear cells are one of the sources for stem cell transplants. We sought to observe the safety and efficacy of autologous bone marrow mononuclear cells transplant for treating critical limb ischemia. Eligible patients were randomized 1:1 to receive placebo (0.9% NaCl) or 1 × 107 piece/mL bone marrow mononuclear cell transplant. For 6 months, patients' skin ulcers, ankle-brachial index, and rest pain were examined and recorded before and after treatment. Six months after the bone marrow mononuclear cells transplant, clinical symptoms like rest pain and skin ulcers gradually abated (P transplant (P Autologous bone marrow mononuclear cells transplant for treatment of patients with chronic limb ischemia is safe, effective, and feasible.

  2. Treatment of Adult Severe Traumatic Brain Injury Using Autologous Bone Marrow Mononuclear Cells

    Science.gov (United States)

    2014-12-01

    Our primary hypothesis is that bone marrow mononuclear cell (BMMNC) autologous transplantation after TBI is safe. Our secondary hypothesis is that...AD_________________ Award Number: W81XWH-11-1-0460 TITLE: TREATMENT OF ADULT SEVERE TRAUMATIC BRAIN INJURY USING AUTOLOGOUS BONE MARROW ... AUTOLOGOUS BONE MARROW MONONUCLEAR CELLS” 5a. CONTRACT NUMBER 5b. GRANT NUMBER: W81XWH-11-1-0460 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Charles S. Cox

  3. LIVER AND BONE MARROW STEM/PROGENITOR CELLS AS REGULATORS OF REPARATIVE REGENERATION OF DAMAGED LIVER

    Directory of Open Access Journals (Sweden)

    А. V. Lundup

    2010-01-01

    Full Text Available In this review the modern information about effectiveness of liver insufficiency treatment by stem/ progenitor cells of liver (oval cells and bone marrow (hemopoietic cells and mesenchymal cells was presented. It is shown that medical action of these cells is referred on normalization of liver cell interaction and reorganization of processes of a reparative regeneration in damaged liver. It is believed that application of mesenchymal stromal cells from an autological bone marrow is the most perspective strategy. However, for definitive judgement about regenerative possibilities of the autological bone marrow cells it is necessary to carry out large-scale double blind clinical researches. 

  4. Differentiating Functional Roles of Gene Expression from Immune and Non-immune Cells in Mouse Colitis by Bone Marrow Transplantation

    Science.gov (United States)

    Koon, Hon Wai; Ho, Samantha; Cheng, Michelle; Ichikawa, Ryan; Pothoulakis, Charalabos

    2012-01-01

    To understand the role of a gene in the development of colitis, we compared the responses of wild-type mice and gene-of-interest deficient knockout mice to colitis. If the gene-of-interest is expressed in both bone marrow derived cells and non-bone marrow derived cells of the host; however, it is possible to differentiate the role of a gene of interest in bone marrow derived cells and non- bone marrow derived cells by bone marrow transplantation technique. To change the bone marrow derived cell genotype of mice, the original bone marrow of recipient mice were destroyed by irradiation and then replaced by new donor bone marrow of different genotype. When wild-type mice donor bone marrow was transplanted to knockout mice, we could generate knockout mice with wild-type gene expression in bone marrow derived cells. Alternatively, when knockout mice donor bone marrow was transplanted to wild-type recipient mice, wild-type mice without gene-of-interest expressing from bone marrow derived cells were produced. However, bone marrow transplantation may not be 100% complete. Therefore, we utilized cluster of differentiation (CD) molecules (CD45.1 and CD45.2) as markers of donor and recipient cells to track the proportion of donor bone marrow derived cells in recipient mice and success of bone marrow transplantation. Wild-type mice with CD45.1 genotype and knockout mice with CD45.2 genotype were used. After irradiation of recipient mice, the donor bone marrow cells of different genotypes were infused into the recipient mice. When the new bone marrow regenerated to take over its immunity, the mice were challenged by chemical agent (dextran sodium sulfate, DSS 5%) to induce colitis. Here we also showed the method to induce colitis in mice and evaluate the role of the gene of interest expressed from bone-marrow derived cells. If the gene-of-interest from the bone derived cells plays an important role in the development of the disease (such as colitis), the phenotype of the

  5. Propofol promotes spinal cord injury repair by bone marrow mesenchymal stem cell transplantation.

    Science.gov (United States)

    Zhou, Ya-Jing; Liu, Jian-Min; Wei, Shu-Ming; Zhang, Yun-Hao; Qu, Zhen-Hua; Chen, Shu-Bo

    2015-08-01

    Propofol is a neuroprotective anesthetic. Whether propofol can promote spinal cord injury repair by bone marrow mesenchymal stem cells remains poorly understood. We used rats to investigate spinal cord injury repair using bone marrow mesenchymal stem cell transplantation combined with propofol administration via the tail vein. Rat spinal cord injury was clearly alleviated; a large number of newborn non-myelinated and myelinated nerve fibers appeared in the spinal cord, the numbers of CM-Dil-labeled bone marrow mesenchymal stem cells and fluorogold-labeled nerve fibers were increased and hindlimb motor function of spinal cord-injured rats was markedly improved. These improvements were more prominent in rats subjected to bone marrow mesenchymal cell transplantation combined with propofol administration than in rats receiving monotherapy. These results indicate that propofol can enhance the therapeutic effects of bone marrow mesenchymal stem cell transplantation on spinal cord injury in rats.

  6. Propofol promotes spinal cord injury repair by bone marrow mesenchymal stem cell transplantation

    Science.gov (United States)

    Zhou, Ya-jing; Liu, Jian-min; Wei, Shu-ming; Zhang, Yun-hao; Qu, Zhen-hua; Chen, Shu-bo

    2015-01-01

    Propofol is a neuroprotective anesthetic. Whether propofol can promote spinal cord injury repair by bone marrow mesenchymal stem cells remains poorly understood. We used rats to investigate spinal cord injury repair using bone marrow mesenchymal stem cell transplantation combined with propofol administration via the tail vein. Rat spinal cord injury was clearly alleviated; a large number of newborn non-myelinated and myelinated nerve fibers appeared in the spinal cord, the numbers of CM-Dil-labeled bone marrow mesenchymal stem cells and fluorogold-labeled nerve fibers were increased and hindlimb motor function of spinal cord-injured rats was markedly improved. These improvements were more prominent in rats subjected to bone marrow mesenchymal cell transplantation combined with propofol administration than in rats receiving monotherapy. These results indicate that propofol can enhance the therapeutic effects of bone marrow mesenchymal stem cell transplantation on spinal cord injury in rats. PMID:26487860

  7. Late Adherent Human Bone Marrow Stromal Cells Form Bone and Restore the Hematopoietic Microenvironment In Vivo

    Directory of Open Access Journals (Sweden)

    Verônica Fernandes Vianna

    2013-01-01

    Full Text Available Bone marrow stromal cells (BMSCs are a valuable resource for skeletal regenerative medicine because of their osteogenic potential. In spite of the very general term “stem cell,” this population of cells is far from homogeneous, and different BMSCs clones have greatly different phenotypic properties and, therefore, potentially different therapeutic potential. Adherence to a culture flask surface is a primary defining characteristic of BMSCs. We hypothesized that based on the adherence time we could obtain an enriched population of cells with a greater therapeutic potential. We characterized two populations of bone marrow-derived cells, those that adhered by three days (R-cells and those that did not adhere by three days but did by six days (L-cells. Clones derived from L-cells could be induced into adipogenic, chondrogenic, and osteogenic differentiation in vitro. L-cells appeared to have greater proliferative capacity, as manifested by larger colony diameter and clones with higher CD146 expression. Only clones from L-cells developed bone marrow stroma in vivo. We conclude that the use of late adherence of BMSCs is one parameter that can be used to enrich for cells that will constitute a superior final product for cell therapy in orthopedics.

  8. Bone Marrow Vascular Niche: Home for Hematopoietic Stem Cells

    Directory of Open Access Journals (Sweden)

    Ningning He

    2014-01-01

    Full Text Available Though discovered later than osteoblastic niche, vascular niche has been regarded as an alternative indispensable niche operating regulation on hematopoietic stem cells (HSCs. As significant progresses gained on this type niche, it is gradually clear that the main work of vascular niche is undertaking to support hematopoiesis. However, compared to what have been defined in the mechanisms through which the osteoblastic niche regulates hematopoiesis, we know less in vascular niche. In this review, based on research data hitherto we will focus on component foundation and various functions of vascular niche that guarantee the normal hematopoiesis process within bone marrow microenvironments. And the possible pathways raised by various research results through which this environment undergoes its function will be discussed as well.

  9. Processing of equine bone marrow using the automated MarrowXpress System: RBC depletion, volume reduction, and mononuclear cell recovery.

    Science.gov (United States)

    Owens, Sean D; Burges, Julie; Johns, Jennifer L; Carrade, Danielle D; Galuppo, Larry D; Librach, Fred; Borjesson, Dori L

    2011-12-01

    The therapeutic use of bone marrow-derived mononuclear cells (MNCs) and mesenchymal stem cells for the treatment of soft tissue and orthopedic injuries in equine patients is expanding. After collection, bone marrow must be reduced in volume and depleted of RBCs for immediate therapeutic use or to prepare cells for culture or cryopreservation and storage. The MarrowXpress (MXP) System is an automated, closed, sterile system designed to process human bone marrow samples. The purpose of this study was to evaluate the capacity of the MXP System to process equine bone marrow to reduce volume, deplete RBCs, and enhance recovery of MNCs. Bone marrow was collected from 47 horses into 2 60-mL syringes containing heparin and processed using the MXP System. HCT, total nucleated cell (TNC) count, and MNC count were obtained for each sample before and after processing using an Advia 120 hematology analyzer. Volume reduction, RBC depletion, and recovery of TNCs and MNCs were calculated. For equine bone marrow samples, mean values were 73.2% for RBC depletion and 78.0% for volume reduction. TNC count before processing was 2.5 ± 1.2 × 10(7) and after processing was significantly higher at 7.8 ± 3.3 × 10(7) (P recovery of 68.5 ± 24.5% (mean ± SD). MNC count before processing was 1.1 ± 0.9 × 10(7) and after processing was significantly higher at 3.8 ± 1.9 × 10(7) (P recovery 73.0 ± 31.5%. The MXP System can reliably reduce volume and deplete RBCs from aspirates of equine bone marrow aspirates. MNCs can be recovered in a reproducible and sterile manner. Further studies evaluating the effects of the MXP System on cell viability, identification of mesenchymal stem cells (MSCs), and the efficacy of MSC expansion are warranted. © 2011 American Society for Veterinary Clinical Pathology.

  10. Diffusion chamber culture of mouse bone marrow cells, (1)

    International Nuclear Information System (INIS)

    Sigeta, Chiharu; Tanaka, Kimio; Kawakami, Masahito; Takahashi, Hiroshi; Ohkita, Takeshi

    1980-01-01

    Mouse bone marrow cells were cultured in diffusion chambers (DC) implanted in the peritoneal cavity of host mice. Host mice were subjected to (1) irradiation ( 60 Co 800 rad) and/or (2) phenylhydrazine induced anemia and then receiving irradiation ( 60 Co 600 rad). After culture periods of 3-7 days, the total number of cells in DC was increased. A marked increase in DC is due to the proliferation of granulocyte series. When host mice were subjected to anemia and irradiation, the start of cell proliferation in DC was delay about two days. On the whole, anemia and irradiation host reduced a little cell growth in DC. The number of immature granulocytes grown in DC in irradiated hosts or anemia and irradiated hosts increased and reached a plateu at day 5. During the plateu period, the proportions between immature and mature granulocytes in DC were kept constantly. The number of macrophages showed a two-phase increasing. Erythroid cells and lymphocytes rapidly disappeared from the chambers during 3 days. The number of erythroid cells was not significantly influenced even in anemia and irradiation hosts. (author)

  11. Formation of Cell-To-Cell Connection between Bone Marrow Cells and Isolated Rat Cardiomyocytes in a Cocultivation Model

    Czech Academy of Sciences Publication Activity Database

    Skopalík, J.; Pásek, Michal; Rychtárik, M.; Koristek, Z.; Gabrielová, E.; Sheer, P.; Matejovič, P.; Modrianský, M.; Klabusay, M.

    2014-01-01

    Roč. 5, č. 5 (2014), s. 1000185 ISSN 2157-7013 Institutional support: RVO:61388998 Keywords : bone marrow * mononuclear cells * isolated cardiomyocytes * cocultivation Subject RIV: BO - Biophysics http://omicsonline.org/ open - access /formation-of-celltocell-connection-between-bone-marrow-cells- and -isolated-rat-cardiomyocytes-2157-7013.1000185.php?aid=33364

  12. Periarteriolar Glioblastoma Stem Cell Niches Express Bone Marrow Hematopoietic Stem Cell Niche Proteins

    NARCIS (Netherlands)

    Hira, Vashendriya V. V.; Wormer, Jill R.; Kakar, Hala; Breznik, Barbara; van der Swaan, Britt; Hulsbos, Renske; Tigchelaar, Wikky; Tonar, Zbynek; Khurshed, Mohammed; Molenaar, Remco J.; van Noorden, Cornelis J. F.

    2018-01-01

    In glioblastoma, a fraction of malignant cells consists of therapy-resistant glioblastoma stem cells (GSCs) residing in protective niches that recapitulate hematopoietic stem cell (HSC) niches in bone marrow. We have previously shown that HSC niche proteins stromal cell-derived factor-1α (SDF-1α),

  13. Transfer of immunity by transfer of bone marrow cells: T-cell dependency

    International Nuclear Information System (INIS)

    Marusic, M.

    1978-01-01

    Thymectomized, lethally irradiated mice reconstituted with normal bone marrow cells succumbed when challenged ip with rat Yoshida ascites sarcoma (YAS) cells 40 days after irradiation and reconstitution. In contrast, thymectomized irradiated mice reconstituted with bone marrow cells from YAS-immune donors rejected the subsequent tumor challenge. Pretreatment of the bone marrow cells from immune donors with anti-Thy 1.2 antiserum and complement completely abolished the transfer of anti-YAS resistance. Bone marrow cells from donors thymectomized 2 months before immunization enabled almost all recipients to reject YAS, but bone marrow cells from donors thymectomized 8 months before immunization protected only 50 percent of the recipients. Further analysis showed that mice thymectomized 8 months before immunization failed to generate anti-YAS antibody response, whereas the antibody response of mice thymectomized 2 months before immunization did not differ from that of non-thymectomized age-matched control mice. The data suggest that the immune reaction of mice against xenogeneic YAS requires long-lived T 2 lymphocytes

  14. Effect of bone marrow-derived stem cells on chondrocytes from patients with osteoarthritis.

    Science.gov (United States)

    Zhang, Qiangzhi; Chen, Yong; Wang, Qiang; Fang, Chaoyong; Sun, Yu; Yuan, Tao; Wang, Yuebei; Bao, Rongni; Zhao, Ningjian

    2016-02-01

    Increasing numbers of individuals are suffering from osteoarthritis every year, and the directed intra-articular injection of bone marrow stem cells has provided a promising treatment strategy for osteoarthritis. Although a number of studies have demonstrated that intra-articular injection of bone marrow stem cells produced desirable results, the mechanism underlying this effect has not been elucidated. In the current study, the effect of bone marrow stem cells on chondrocytes from patients with osteoarthritis was observed in a co-culture system. Human chondrocytes were obtained from patients with osteoarthritis who underwent surgical procedures and bone marrow stem cells were obtained from bone marrow aspirates, and then the chondrocytes were then cultured alone or cocultured with bone marrow stem cells in 0.4-µm Transwell inserts. The differentiation and biological activity of chondrocytes in the culture system were measured, and the inflammatory factors and OA-associated markers were also measured. The results indicated that coculture with human bone marrow stem cells increases cell proliferation of chondrocytes and inhibits inflammatory activity in osteoarthritis.

  15. Characterization of Cellular and Molecular Heterogeneity of Bone Marrow Stromal Cells

    DEFF Research Database (Denmark)

    Elsafadi, Mona; Manikandan, Muthurangan; Atteya, Muhammad

    2016-01-01

    Human bone marrow-derived stromal stem cells (hBMSC) exhibit multiple functions, including differentiation into skeletal cells (progenitor function), hematopoiesis support, and immune regulation (nonprogenitor function). We have previously demonstrated the presence of morphological and functional...

  16. Autologous Bone Marrow Mononuclear Cells Intrathecal Transplantation in Chronic Stroke

    Directory of Open Access Journals (Sweden)

    Alok Sharma

    2014-01-01

    Full Text Available Cell therapy is being widely explored in the management of stroke and has demonstrated great potential. It has been shown to assist in the remodeling of the central nervous system by inducing neurorestorative effect through the process of angiogenesis, neurogenesis, and reduction of glial scar formation. In this study, the effect of intrathecal administration of autologous bone marrow mononuclear cells (BMMNCs is analyzed on the recovery process of patients with chronic stroke. 24 patients diagnosed with chronic stroke were administered cell therapy, followed by multidisciplinary neurorehabilitation. They were assessed on functional independence measure (FIM objectively, along with assessment of standing and walking balance, ambulation, and hand functions. Out of 24 patients, 12 improved in ambulation, 10 in hand functions, 6 in standing balance, and 9 in walking balance. Further factor analysis was done. Patients of the younger groups showed higher percentage of improvement in all the areas. Patients who underwent cell therapy within 2 years after the stroke showed better changes. Ischemic type of stroke had better recovery than the hemorrhagic stroke. This study demonstrates the potential of autologous BMMNCs intrathecal transplantation in improving the prognosis of functional recovery in chronic stage of stroke. Further clinical trials are recommended. This trial is registered with NCT02065778.

  17. Cytokines inducing bone marrow SCA+ cells migration into pancreatic islet and conversion into insulin-positive cells in vivo.

    Directory of Open Access Journals (Sweden)

    LuGuang Luo

    Full Text Available We hypothesize that specific bone marrow lineages and cytokine treatment may facilitate bone marrow migration into islets, leading to a conversion into insulin producing cells in vivo. In this study we focused on identifying which bone marrow subpopulations and cytokine treatments play a role in bone marrow supporting islet function in vivo by evaluating whether bone marrow is capable of migrating into islets as well as converting into insulin positive cells. We approached this aim by utilizing several bone marrow lineages and cytokine-treated bone marrow from green fluorescent protein (GFP positive bone marrow donors. Sorted lineages of Mac-1(+, Mac-1(-, Sca(+, Sca(-, Sca(-/Mac-1(+ and Sca(+/Mac-1(- from GFP positive mice were transplanted to irradiated C57BL6 GFP negative mice. Bone marrow from transgenic human ubiquitin C promoter GFP (uGFP, with strong signal C57BL6 mice was transplanted into GFP negative C57BL6 recipients. After eight weeks, migration of GFP positive donor' bone marrow to the recipient's pancreatic islets was evaluated as the percentage of positive GFP islets/total islets. The results show that the most effective migration comes from the Sca(+/Mac(- lineage and these cells, treated with cytokines for 48 hours, were found to have converted into insulin positive cells in pancreatic islets in vivo. This study suggests that bone marrow lineage positive cells and cytokine treatments are critical factors in determining whether bone marrow is able to migrate and form insulin producing cells in vivo. The mechanisms causing this facilitation as well as bone marrow converting to pancreatic beta cells still need to be investigated.

  18. Characterization of vascular endothelial progenitor cells from chicken bone marrow

    Directory of Open Access Journals (Sweden)

    Bai Chunyu

    2012-05-01

    Full Text Available Abstract Background Endothelial progenitor cells (EPC are a type of stem cell used in the treatment of atherosclerosis, vascular injury and regeneration. At present, most of the EPCs studied are from human and mouse, whereas the study of poultry-derived EPCs has rarely been reported. In the present study, chicken bone marrow-derived EPCs were isolated and studied at the cellular level using immunofluorescence and RT-PCR. Results We found that the majority of chicken EPCs were spindle shaped. The growth-curves of chicken EPCs at passages (P 1, -5 and -9 were typically “S”-shaped. The viability of chicken EPCs, before and after cryopreservation was 92.2% and 81.1%, respectively. Thus, cryopreservation had no obvious effects on the viability of chicken EPCs. Dil-ac-LDL and FITC-UAE-1 uptake assays and immunofluorescent detection of the cell surface markers CD34, CD133, VEGFR-2 confirmed that the cells obtained in vitro were EPCs. Observation of endothelial-specific Weibel-Palade bodies using transmission electron microscopy further confirmed that the cells were of endothelial lineage. In addition, chicken EPCs differentiated into endothelial cells and smooth muscle cells upon induction with VEGF and PDGF-BB, respectively, suggesting that the chicken EPCs retained multipotency in vitro. Conclusions These results suggest that chicken EPCs not only have strong self-renewal capacity, but also the potential to differentiate into endothelial and smooth muscle cells. This research provides theoretical basis and experimental evidence for potential therapeutic application of endothelial progenitor cells in the treatment of atherosclerosis, vascular injury and diabetic complications.

  19. Characterization of conditioned medium of cultured bone marrow stromal cells.

    Science.gov (United States)

    Nakano, Norihiko; Nakai, Yoshiyasu; Seo, Tae-Boem; Yamada, Yoshihiro; Ohno, Takayuki; Yamanaka, Atsuo; Nagai, Yoji; Fukushima, Masanori; Suzuki, Yoshiyuki; Nakatani, Toshio; Ide, Chizuka

    2010-10-08

    It has been recognized that bone marrow stromal cell (BMSC) transplantation has beneficial effects on spinal cord injury in animal models and therapeutic trials. It is hypothesized that BMSCs provide microenvironments suitable for axonal regeneration and secrete some trophic factors to rescue affected cells from degeneration. However, the molecular and cellular mechanisms of the trophic factors involved remain unclear. In the present study, we examined the effects of trophic factors secreted by rat BMSCs using bioassays involving cultured hippocampal neurons. The conditioned medium (CM) as well as non-contact co-culture of BMSCs promoted neurite outgrowth and suppressed TUNEL-positive cells compared to serum-free D-MEM. Protein analyses of the CM by antibody-based protein array analysis and ELISA revealed that the CM contained insulin-like growth factor (IGF)-1, hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), and transforming growth factor (TGF)-beta1. DNA microarray analysis revealed that neurons highly expressed receptors of IGF-1 and TGF-beta1. However, their expression indices remained unchanged even after the CM treatment. The individual trophic factors mentioned above or their combinations were less effective at promoting neuronal survival and neurite outgrowth than the CM. The present study showed that BMSCs secreted various kinds of molecules into the culture medium including trophic factors to promote neuronal survival and neurite outgrowth. The main trophic factors responsible remain to be elucidated. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  20. Ectopic osteogenesis and hematopoiesis after implantantion of bone marrow cells seeded on HAP/PLLA scaffold

    Directory of Open Access Journals (Sweden)

    Vasiljević Perica J.

    2009-01-01

    Full Text Available Bone tissue reconstruction and reparation is a big challenge in medicine. Biocomposite materials based on hidroxyapatite are widely used in reparation of bone defects. Adult bone marrow-derived stem cells may be considered in two categories: hematopoietic stem cells (HSC from the bone marrow and mesenchymal stem cells from the bone marrow stroma (BMSC. HSC and BMSC do not only coexist in one organ, but functionally cooperate. BMSC have a critical role in the formation of hematopoietic microenvironment (HME. The aim of this study was to investigate the interactions between bone marrow cells and biocomposites based on HAp/PLLA (hidroxyapatite/poly-L-lactide after subcutaneous implantation in Balb/c mice. In that purpose, bone marrow cells of Balb/c mice were seeded in HAp/PLLA tubes (15 mm×1,5 mm. The HAp/PLLA tubes with BMC was subcutaneously implanted with a needle into the intrascapsular region of the mouse. Implants were extracted after 2, 6 and 12 weeks. In implants after 2 and 6 weeks we found angiogenesis, collagenogenesis and new bone. Ectopic hematopoiesis was seen in implants after 12 weeks from implantation. As a good scaffold in the role of supporting osteogenesis and hematopoiesis, biocomposites HAp/PLLA can be good bone substitute materials in the bone reparation process. These results showed that the HAp/PLLA scaffold owned biological properties comparable to natural bone.

  1. Different radiosensitivities of mast-cell precursors in the bone marrow and skin of mice

    Energy Technology Data Exchange (ETDEWEB)

    Kitamura, Y.; Yokoyama, M.; Sonoda, T.; Mori, K.J.

    1983-01-01

    Although tissue mast cells are derived from the bone marrow, some descendants of bone marrow-derived precursors retain the ability to proliferate and differentiate into mast cells even after localization in the skin. The purpose of the present study was to determine the D0 values for mast-cell precursors in the bone marrow and those localized in the skin. Bone marrow cells were removed from (WB X C57BL/6)F1-+/+ mice after various doses of irradiation and injected into the skin of the congenic W/Wv mice which were genetically without mast cells. Radiosensitivity of mast-cell precursors in the bone marrow was evaluated by determining the proportion of the injection sites at which mast cells did not appear. For the assay of the radiosensitivity of mast-cell precursors localized in the skin, pieces of skin were removed from beige C57BL/6 (bgJ/bgJ. Chediak-Higashi syndrome) mice after various doses of irradiation and grafted onto the back of the normal C57BL/6 mice. Radiosensitivity of mast-cell precursors in the skin was evaluated by determining the decrease of beige-type mast cells which possessed giant granules. Mast-cell precursors in the bone marrow were much more radiosensitive than those localized in the skin. D0 value was about 100 rad for the former and about 800 rad for the latter.

  2. Different radiosensitivities of mast-cell precursors in the bone marrow and skin of mice

    Energy Technology Data Exchange (ETDEWEB)

    Kitamura, Y.; Yokoyama, M.; Sonoda, T.; Mori, K.J.

    1983-01-01

    Although tissue mast cells are derived from the bone marrow, some descendants of bone marrow-derived precursors retain the ability to proliferate and differentiate into mast cells even after localization in the skin. The purpose of the present study was to determine the D/sub 0/ values for mast-cell precursors in the bone marrow and those localized in the skin. Bone marrow cells were removed from (WB X C57BL/6)F/sub 1/+/+ mice after various doses of irradiation and injected into the skin of the congenic W/W/sup v/ mice which were genetically without mast cells. Radiosensitivity of mast-cell precursors in the bone marrow was evaluated by determining the proportion of the injection sites at which mast cells did not appear. For the assay of the radiosensitivity of mast-cell precursors localized in the skin, pieces of skin were removed from beige C57BL/6 (bg/sup J//bg/sup J/, Chediak-Higashi syndrome) mice after various doses of irradiation and grafted onto the backs of the normal C57BL/6 mice. Radiosensitivity of mast-cell precursors in the skin was evaluated by determining the decrease of beige-type mast cells which possessed giant granules. Mast-cell precursors in the bone marrow were much more radiosenitive than those localized in the skin. D/sup 0/ value was about 100 rad for the former and about 800 rad for the latter.

  3. Different radiosensitivities of mast-cell precursors in the bone marrow and skin of mice

    International Nuclear Information System (INIS)

    Kitamura, Y.; Yokoyama, M.; Sonoda, T.; Mori, K.J.

    1983-01-01

    Although tissue mast cells are derived from the bone marrow, some descendants of bone marrow-derived precursors retain the ability to proliferate and differentiate into mast cells even after localization in the skin. The purpose of the present study was to determine the D0 values for mast-cell precursors in the bone marrow and those localized in the skin. Bone marrow cells were removed from (WB X C57BL/6)F1-+/+ mice after various doses of irradiation and injected into the skin of the congenic W/Wv mice which were genetically without mast cells. Radiosensitivity of mast-cell precursors in the bone marrow was evaluated by determining the proportion of the injection sites at which mast cells did not appear. For the assay of the radiosensitivity of mast-cell precursors localized in the skin, pieces of skin were removed from beige C57BL/6 (bgJ/bgJ. Chediak-Higashi syndrome) mice after various doses of irradiation and grafted onto the back of the normal C57BL/6 mice. Radiosensitivity of mast-cell precursors in the skin was evaluated by determining the decrease of beige-type mast cells which possessed giant granules. Mast-cell precursors in the bone marrow were much more radiosensitive than those localized in the skin. D0 value was about 100 rad for the former and about 800 rad for the latter

  4. Different radiosensitivities of mast-cell precursors in the bone marrow and skin of mice

    International Nuclear Information System (INIS)

    Kitamura, Y.; Yokoyama, M.; Sonoda, T.; Mori, K.J.

    1983-01-01

    Although tissue mast cells are derived from the bone marrow, some descendants of bone marrow-derived precursors retain the ability to proliferate and differentiate into mast cells even after localization in the skin. The purpose of the present study was to determine the D 0 values for mast-cell precursors in the bone marrow and those localized in the skin. Bone marrow cells were removed from (WB X C57BL/6)F 1 +/+ mice after various doses of irradiation and injected into the skin of the congenic W/W/sup v/ mice which were genetically without mast cells. Radiosensitivity of mast-cell precursors in the bone marrow was evaluated by determining the proportion of the injection sites at which mast cells did not appear. For the assay of the radiosensitivity of mast-cell precursors localized in the skin, pieces of skin were removed from beige C57BL/6 (bg/sup J//bg/sup J/, Chediak-Higashi syndrome) mice after various doses of irradiation and grafted onto the backs of the normal C57BL/6 mice. Radiosensitivity of mast-cell precursors in the skin was evaluated by determining the decrease of beige-type mast cells which possessed giant granules. Mast-cell precursors in the bone marrow were much more radiosenitive than those localized in the skin. D 0 value was about 100 rad for the former and about 800 rad for the latter

  5. Bone marrow stromal cells of the vervet monkey: characterization and ability to support simian cytomegalovirus replication

    International Nuclear Information System (INIS)

    Kramvis, A.

    1986-01-01

    The main objective of the initial phase of experimentation was to establish the optimal conditions which would allow the reproduceable and reliable culture of vervet monkey bone marrow stromal cells. The effect of the medium compositions on the growth of monkey bone marrow. Stromal cells as well as the effect of varying initial densities on the establishment of the culture were studied. The morphology of the stromal cells was observed and studied using light microscopy and both transmission and scanning electron microscopy. Two cell shapes were determined and their ability to incorporate tritiated thymidine into DNA, when cultured, was studied using autoradiagraphy. The monkey bone marrow stromal cells were characterized according to their cytochemical and growth characteristics and their ability to support the myeloid lineage. The second phase of the research had three aims. Firstly to determine whether vervet cytomegalovirus (VCMV) can replicate in monkey bone marrow stromal cells. Secondly, to determine whether the phase of the cell cycle at which the cells were infected, affected the production of virus. Thirdly, to determine whether VCMV infection of the bone marrow stromal cells interferes with their ability to produce colony stimulating activity. The radiosensitivity of bone marrow stromal cells was measured by the suppression of colony formation after irradiation of the primary cell suspension

  6. Autologous bone marrow cell therapy for peripheral arterial disease

    Directory of Open Access Journals (Sweden)

    Botti C

    2012-09-01

    clinical trials have been not registered on databases such as ClinicalTrials.gov or EudraCT. Therefore, more rigorous clinical trials are required to confirm the first hopeful results and to address the challenging issues.Keywords: adult stem cells, critical limb ischemia, bone marrow transplantation, therapeutic angiogenesis

  7. Bone marrow concentrate for autologous transplantation in minipigs. Characterization and osteogenic potential of mesenchymal stem cells.

    Science.gov (United States)

    Herten, M; Grassmann, J P; Sager, M; Benga, L; Fischer, J C; Jäger, M; Betsch, M; Wild, M; Hakimi, M; Jungbluth, P

    2013-01-01

    Autologous bone marrow plays an increasing role in the treatment of bone, cartilage and tendon healing disorders. Cell-based therapies display promising results in the support of local regeneration, especially therapies using intra-operative one-step treatments with autologous progenitor cells. In the present study, bone marrow-derived cells were concentrated in a point-of-care device and investigated for their mesenchymal stem cell (MSC) characteristics and their osteogenic potential. Bone marrow was harvested from the iliac crest of 16 minipigs. The mononucleated cells (MNC) were concentrated by gradient density centrifugation, cultivated, characterized by flow cytometry and stimulated into osteoblasts, adipocytes, and chondrocytes. Cell differentiation was investigated by histological and immunohistological staining of relevant lineage markers. The proliferation capacity was determined via colony forming units of fibroblast and of osteogenic alkaline-phosphatase-positive-cells. The MNC could be enriched 3.5-fold in nucleated cell concentrate in comparison to bone marrow. Flow cytometry analysis revealed a positive signal for the MSC markers. Cells could be differentiated into the three lines confirming the MSC character. The cellular osteogenic potential correlated significantly with the percentage of newly formed bone in vivo in a porcine metaphyseal long-bone defect model. This study demonstrates that bone marrow concentrate from minipigs display cells with MSC character and their osteogenic differentiation potential can be used for osseous defect repair in autologous transplantations.

  8. Establishment of donor Chimerism Using Allogeneic Bone Marrow with AMP Cell Co-infusion

    Science.gov (United States)

    2017-09-01

    AWARD NUMBER: W81XWH-15-1-0234 TITLE: Establishment of donor Chimerism Using Allogeneic Bone Marrow with AMP Cell Co-infusion PRINCIPAL...14/2017 4. TITLE AND SUBTITLE Establishment of donor Chimerism Using Allogeneic Bone Marrow with AMP Cell Co-infusion 5a. CONTRACT NUMBER 5b. GRANT...tolerance induction of all types of allografts. In this study, we investigate whether co-infusion of amnion- derived multipotent progenitor ( AMP ) cells

  9. Route of delivery influences biodistribution of human bone marrow-derived mesenchymal stromal cells following experimental bone marrow transplantation

    Directory of Open Access Journals (Sweden)

    Wang FJ

    2015-12-01

    Full Text Available Mesenchymal stromal cells (MSCs have shown promise as treatment for graft-versus-host disease (GvHD following allogeneic bone marrow transplantation (alloBMT. Mechanisms mediating in vivo effects of MSCs remain largely unknown, including their biodistribution following infusion. To this end, human bone-marrow derived MSCs (hMSCs were injected via carotid artery (IA or tail vein (TV into allogeneic and syngeneic BMT recipient mice. Following xenogeneic transplantation, MSC biodistribution was measured by bioluminescence imaging (BLI using hMSCs transduced with a reporter gene system containing luciferase and by scintigraphic imaging using hMSCs labeled with [99mTc]-HMPAO. Although hMSCs initially accumulated in the lungs in both transplant groups, more cells migrated to organs in alloBMT recipient as measured by in vivo BLI and scintigraphy and confirmed by ex vivo BLI imaging, immunohistochemistry and quantitative RT-PCR. IA injection resulted in persistent whole–body hMSC distribution in alloBMT recipients, while hMSCs were rapidly cleared in the syngeneic animals within one week. In contrast, TV-injected hMSCs were mainly seen in the lungs with fewer cells traveling to other organs. Summarily, these results demonstrate the potential use of IA injection to alter hMSC biodistribution in order to more effectively deliver hMSCs to targeted tissues and microenvironments.

  10. Evidences of early senescence in multiple myeloma bone marrow mesenchymal stromal cells.

    Directory of Open Access Journals (Sweden)

    Thibaud André

    Full Text Available BACKGROUND: In multiple myeloma, bone marrow mesenchymal stromal cells support myeloma cell growth. Previous studies have suggested that direct and indirect interactions between malignant cells and bone marrow mesenchymal stromal cells result in constitutive abnormalities in the bone marrow mesenchymal stromal cells. DESIGN AND METHODS: The aims of this study were to investigate the constitutive abnormalities in myeloma bone marrow mesenchymal stromal cells and to evaluate the impact of new treatments. RESULTS: We demonstrated that myeloma bone marrow mesenchymal stromal cells have an increased expression of senescence-associated β-galactosidase, increased cell size, reduced proliferation capacity and characteristic expression of senescence-associated secretory profile members. We also observed a reduction in osteoblastogenic capacity and immunomodulatory activity and an increase in hematopoietic support capacity. Finally, we determined that current treatments were able to partially reduce some abnormalities in secreted factors, proliferation and osteoblastogenesis. CONCLUSIONS: We showed that myeloma bone marrow mesenchymal stromal cells have an early senescent profile with profound alterations in their characteristics. This senescent state most likely participates in disease progression and relapse by altering the tumor microenvironment.

  11. Fusion of intestinal epithelial cells with bone marrow derived cells is dispensable for tissue homeostasis

    NARCIS (Netherlands)

    de Jong, Joan H.; Rodermond, Hans M.; Zimberlin, Cheryl D.; Lascano, Valeria; de Sousa E Melo, Felipe; Richel, Dick J.; Medema, Jan Paul; Vermeulen, Louis

    2012-01-01

    The epithelial lining of the intestine is characterized by an immense cellular turn-over ascertaining an extensive regenerative capacity. Multiple reports suggest that besides the local intestinal stem cell pool, circulating cells of bone marrow origin (BMDCs) contribute to this process by fusing

  12. Autologous bone marrow stromal cells are promising candidates for cell therapy approaches to treat bone degeneration in sickle cell disease.

    Science.gov (United States)

    Lebouvier, Angélique; Poignard, Alexandre; Coquelin-Salsac, Laura; Léotot, Julie; Homma, Yasuhiro; Jullien, Nicolas; Bierling, Philippe; Galactéros, Frédéric; Hernigou, Philippe; Chevallier, Nathalie; Rouard, Hélène

    2015-11-01

    Osteonecrosis of the femoral head is a frequent complication in adult patients with sickle cell disease (SCD). To delay hip arthroplasty, core decompression combined with concentrated total bone marrow (BM) treatment is currently performed in the early stages of the osteonecrosis. Cell therapy efficacy depends on the quantity of implanted BM stromal cells. For this reason, expanded bone marrow stromal cells (BMSCs, also known as bone marrow derived mesenchymal stem cells) can be used to improve osteonecrosis treatment in SCD patients. In this study, we quantitatively and qualitatively evaluated the function of BMSCs isolated from a large number of SCD patients with osteonecrosis (SCD-ON) compared with control groups (patients with osteonecrosis not related to SCD (ON) and normal donors (N)). BM total nuclear cells and colony-forming efficiency values (CFE) were significantly higher in SCD-ON patients than in age and sex-matched controls. The BMSCs from SCD-ON patients were similar to BMSCs from the control groups in terms of their phenotypic and functional properties. SCD-ON patients have a higher frequency of BMSCs that retain their bone regeneration potential. Our findings suggest that BMSCs isolated from SCD-ON patients can be used clinically in cell therapy approaches. This work provides important preclinical data that is necessary for the clinical application of expanded BMSCs in advanced therapies and medical products.

  13. Stem cell niche-specific Ebf3 maintains the bone marrow cavity.

    Science.gov (United States)

    Seike, Masanari; Omatsu, Yoshiki; Watanabe, Hitomi; Kondoh, Gen; Nagasawa, Takashi

    2018-03-01

    Bone marrow is the tissue filling the space between bone surfaces. Hematopoietic stem cells (HSCs) are maintained by special microenvironments known as niches within bone marrow cavities. Mesenchymal cells, termed CXC chemokine ligand 12 (CXCL12)-abundant reticular (CAR) cells or leptin receptor-positive (LepR + ) cells, are a major cellular component of HSC niches that gives rise to osteoblasts in bone marrow. However, it remains unclear how osteogenesis is prevented in most CAR/LepR + cells to maintain HSC niches and marrow cavities. Here, using lineage tracing, we found that the transcription factor early B-cell factor 3 (Ebf3) is preferentially expressed in CAR/LepR + cells and that Ebf3-expressing cells are self-renewing mesenchymal stem cells in adult marrow. When Ebf3 is deleted in CAR/LepR + cells, HSC niche function is severely impaired, and bone marrow is osteosclerotic with increased bone in aged mice. In mice lacking Ebf1 and Ebf3 , CAR/LepR + cells exhibiting a normal morphology are abundantly present, but their niche function is markedly impaired with depleted HSCs in infant marrow. Subsequently, the mutants become progressively more osteosclerotic, leading to the complete occlusion of marrow cavities in early adulthood. CAR/LepR + cells differentiate into bone-producing cells with reduced HSC niche factor expression in the absence of Ebf1/Ebf3 Thus, HSC cellular niches express Ebf3 that is required to create HSC niches, to inhibit their osteoblast differentiation, and to maintain spaces for HSCs. © 2018 Seike et al.; Published by Cold Spring Harbor Laboratory Press.

  14. Reducing macrophages to improve bone marrow stromal cell survival in the contused spinal cord.

    NARCIS (Netherlands)

    Ritfeld, G.J.; Nandoe Tewarie, R.D.S.; Rahiem, S.T.; Hurtado, A.; Roos, R.A.; Grotenhuis, A.; Oudega, M.

    2010-01-01

    We tested whether reducing macrophage infiltration would improve the survival of allogeneic bone marrow stromal cells (BMSC) transplanted in the contused adult rat thoracic spinal cord. Treatment with cyclosporine, minocycline, or methylprednisolone all resulted in a significant decrease in

  15. Low Oxygen Tension Maintains Multipotency, Whereas Normoxia Increases Differentiation of Mouse Bone Marrow Stromal Cells

    OpenAIRE

    Berniakovich, Ina; Giorgio, Marco

    2013-01-01

    Optimization of mesenchymal stem cells (MSC) culture conditions is of great importance for their more successful application in regenerative medicine. O2 regulates various aspects of cellular biology and, in vivo, MSC are exposed to different O2 concentrations spanning from very low tension in the bone marrow niche, to higher amounts in wounds. In our present work, we isolated mouse bone marrow stromal cells (BMSC) and showed that they contained a population meeting requirements for MSC defin...

  16. Propofol promotes spinal cord injury repair by bone marrow mesenchymal stem cell transplantation

    OpenAIRE

    Zhou, Ya-jing; Liu, Jian-min; Wei, Shu-ming; Zhang, Yun-hao; Qu, Zhen-hua; Chen, Shu-bo

    2015-01-01

    Propofol is a neuroprotective anesthetic. Whether propofol can promote spinal cord injury repair by bone marrow mesenchymal stem cells remains poorly understood. We used rats to investigate spinal cord injury repair using bone marrow mesenchymal stem cell transplantation combined with propofol administration via the tail vein. Rat spinal cord injury was clearly alleviated; a large number of newborn non-myelinated and myelinated nerve fibers appeared in the spinal cord, the numbers of CM-Dil-l...

  17. Remodeling of the thoracic aorta after bone marrow cell transplantation

    Science.gov (United States)

    Felix, Alyne; Monteiro, Nemesis; Rocha, Vinícius Novaes; Oliveira, Genilza; Moraes, Alan Cesar; Andrade, Cherley; Nascimento, Ana Lucia; de Carvalho, Laís; Thole, Alessandra; Carvalho, Jorge

    2014-01-01

    Stem cells are characterized by their ability to differentiate into multiple cell lineages and display the paracrine effect. The aim of this work was to evaluate the effect of therapy with bone marrow cells (BMCs) on blood glucose, lipid metabolism and aortic wall remodeling in mice through the administration of a high fat diet and subsequent BMCs transplantation. C57BL/6 mice were fed a control diet (CO group) or an atherogenic diet (AT group). After 16 weeks, the AT group was divided into four groups: an AT 14 days group and AT 21 days group, that were given an injection of vehicle and sacrificed at 14 and 21 days after, respectively; AT-BMC 14 days group and AT-BMC 21 days group that was given an injection of BMCs and sacrificed at 14 and 21 days after. The CO group was sacrificed along with other groups. The BMCs transplant had reduced blood glucose, triglycerides and total cholesterol. The Qa (1/mm2) was quantitatively reduced in AT 14 days group, AT 21 days group and was high in AT-BMC 21 days group. The AT 21 days group exhibited increased tunica media and elastic system fibers. The immunolabeling for α-SMA and VEGF showed less immunolabeling in transplanted groups with BMCs. The immunostaining for PCNA seems to be more expressive in the group AT-BMC 21 days group. To conclude, our results support the concept that in mice, the injection of BMCs improve glucose levels, lipid metabolism and remodeling of the aortic wall in animals using atherogenic diet. PMID:25337194

  18. Combined scintigraphic identification of acute bone marrow infarction in sickle cell disease

    International Nuclear Information System (INIS)

    Ortiz, S.S.; Miller, J.H.; Allwright, S.J.; Gordon, E.M.

    1990-01-01

    This paper identifies acute bone marrow infarction in symptomatic patients with sickle cell hemoglobinopathy presenting with a clinical picture in which infarction and osteomyelitis were indistinguishable. The authors evaluated 25 patients, 14 females and 11 males, with a combination of Tc-99 sulfur colloid bone marrow and tc-99m MDP scintigraphy performed consecutively within a 24-h period, for a total of 36 combined studies. Sixty-seven sites of bone marrow infarction corresponding to sites of clinical symptoms were revealed by combined scintigraphy

  19. Regulation of heme metabolism in normal and sideroblastic bone marrow cells in culture

    International Nuclear Information System (INIS)

    Ibraham, N.G.; Lutton, J.D.; Hoffman, R.; Levere, R.D.

    1985-01-01

    Heme metabolism was examined in developing in vitro erythroid colonies (CFUE) and in bone marrow samples taken directly from four normal donors and four patients with sideroblastic anemia. Maximum activities of delta-aminolevulinic acid synthase (ALAS), ALA dehydratase (ALAD), and 14 C-ALA incorporation into heme were achieved in normal marrow CFUE after 8 days of culture, whereas heme oxygenase progressively decreased to low levels of activity during the same period. Assays on nucleated bone marrow cells taken directly from patients revealed that ALAS activity was considerably reduced in idiopathic sideroblastic anemia (IASA) and X-linked sideroblastic anemia (X-SA) bone marrow specimens, whereas the activity increased more than twofold (normal levels) when cells were assayed from 8-day CFUE. In all cases, ALAD activity appeared to be within normal levels. Measurement of heme synthesis revealed that normal levels of 14 C-ALA incorporation into heme were achieved in IASA cells but were reduced in X-SA cells. In marked contrast to levels in normal cells, heme oxygenase was found to be significantly elevated (two- to fourfold) in bone marrow cells taken directly from patients with IASA and X-SA. Results from this study demonstrate that IASA and X-SA bone marrow cells have disturbances in ALAS and heme metabolism, and that erythropoiesis (CFUE) can be restored to normal levels when cells are cultured in methylcellulose

  20. Allogeneic Th1 Cells Home to Host Bone Marrow and Spleen and Mediate IFNγ-Dependent Aplasia

    Science.gov (United States)

    Chewning, Joseph H.; Zhang, Weiwei; Randolph, David A.; Swindle, C. Scott; Schoeb, Trenton R.; Weaver, Casey T.

    2013-01-01

    Bone marrow graft failure and poor graft function are frequent complications following hematopoietic stem cell transplantation and result in significant morbidity and mortality. Both conditions are associated with graft versus host disease (GVHD), although the mechanism remains undefined. Here we show in two distinct murine models of GVHD (complete MHC- and class II-disparate) that mimic human peripheral blood stem cell transplantation that Th1 CD4+ cells induce bone marrow failure in allogeneic recipients. Bone marrow failure following transplant of allogeneic naïve CD4+ T cells was associated with increased CD4+ Th1 cell development within bone marrow and lymphoid tissues. Using IFNγ-reporter mice, we found that Th1 cells generated during GVHD induced bone marrow failure following transfers into secondary recipients. Homing studies demonstrated that transferred Th1 cells express CXCR4, which was associated with accumulation within bone marrow and spleen. Allogeneic Th1 cells were activated by radiation-resistant host bone marrow cells and induced bone marrow failure through an IFNγ-dependent mechanism. Thus, allogeneic Th1 CD4+ cells generated during GVHD traffic to hematopoietic sites and induce bone marrow failure via IFNγ-mediated toxicity. These results have important implications for prevention and treatment of bone marrow graft failure following hematopoietic stem cell transplantation. PMID:23523972

  1. Porous PEOT/PBT scaffolds for bone tissue engineering: preparation, characterization, and in vitro bone marrow cell culturing

    NARCIS (Netherlands)

    Claase, M.B.; Grijpma, Dirk W.; Mendes, S.C.; Mendes, Sandra C.; de Bruijn, Joost Dick; Feijen, Jan

    2003-01-01

    The preparation, characterization, and in vitro bone marrow cell culturing on porous PEOT/PBT copolymer scaffolds are described. These scaffolds are meant for use in bone tissue engineering. Previous research has shown that PEOT/PBT copolymers showed in vivo degradation, calcification, and bone

  2. Use of bone marrow derived stem cells in a fracture non-union

    Directory of Open Access Journals (Sweden)

    Binod C. Raulo

    2012-01-01

    Full Text Available This is an attempt of using in vitro cultured mesenchymal stem cells (MSCs from bone marrow in joining of a fracture non-union. Bone marrow cells were obtained and differentially centrifuged for MSCs that were grown in vitro in mesenchymal stem cell basal medium aseptically, for 10 d. The cell mass was injected around the fracture non-union. Healthy conditions of development of tissue regeneration at the trauma site and due bone joining were recorded. It is concluded that in vitro cultured MSCs had a blithesome effect on the fracture non-union.

  3. Stimulation and support of haemopoietic stem cell proliferation by irradiated stroma cell colonies in bone marrow cell culture in vitro

    International Nuclear Information System (INIS)

    Mori, K.J.; Izumi, Hiroko; Seto, Akira

    1981-01-01

    A culture system was established in which haemopoietic stem cells can undergo a recovery proliferation after a depletion of the stem cells, completely in vitro. To elucidate the source of the stimulatory factors, normal bone marrow cells were overlayed on top of the irradiated adherent 'stromal' cell colonies in the bone marrow cell culture. This stimulated the proliferation of haemopoietic stem cells in the cultured cells in suspension. The present results indicate that the stromal cells produce factors which stimulate stem cell proliferation. Whether the stimulation is evoked by direct cell-cell interactions or by humoral factors is as yet to be studied. (author)

  4. Factors affecting directional migration of bone marrow mesenchymal stem cells to the injured spinal cord.

    Science.gov (United States)

    Xia, Peng; Pan, Su; Cheng, Jieping; Yang, Maoguang; Qi, Zhiping; Hou, Tingting; Yang, Xiaoyu

    2014-09-15

    Microtubule-associated protein 1B plays an important role in axon guidance and neuronal migration. In the present study, we sought to discover the mechanisms underlying microtubule-associated protein 1B mediation of axon guidance and neuronal migration. We exposed bone marrow mesenchymal stem cells to okadaic acid or N-acetyl-D-erythro-sphingosine (an inhibitor and stimulator, respectively, of protein phosphatase 2A) for 24 hours. The expression of the phosphorylated form of type I microtubule-associated protein 1B in the cells was greater after exposure to okadaic acid and lower after N-acetyl-D-erythro-sphingosine. We then injected the bone marrow mesenchymal stem cells through the ear vein into rabbit models of spinal cord contusion. The migration of bone marrow mesenchymal stem cells towards the injured spinal cord was poorer in cells exposed to okadaic acid- and N-acetyl-D-erythro-sphingosine than in non-treated bone marrow mesenchymal stem cells. Finally, we blocked phosphatidylinositol 3-kinase (PI3K) and extracellular signal-regulated kinase 1/2 (ERK1/2) pathways in rabbit bone marrow mesenchymal stem cells using the inhibitors LY294002 and U0126, respectively. LY294002 resulted in an elevated expression of phosphorylated type I microtubule-associated protein 1B, whereas U0126 caused a reduction in expression. The present data indicate that PI3K and ERK1/2 in bone marrow mesenchymal stem cells modulate the phosphorylation of microtubule-associated protein 1B via a cross-signaling network, and affect the migratory efficiency of bone marrow mesenchymal stem cells towards injured spinal cord.

  5. Factors affecting directional migration of bone marrow mesenchymal stem cells to the injured spinal cord

    Science.gov (United States)

    Xia, Peng; Pan, Su; Cheng, Jieping; Yang, Maoguang; Qi, Zhiping; Hou, Tingting; Yang, Xiaoyu

    2014-01-01

    Microtubule-associated protein 1B plays an important role in axon guidance and neuronal migration. In the present study, we sought to discover the mechanisms underlying microtubule-associated protein 1B mediation of axon guidance and neuronal migration. We exposed bone marrow mesenchymal stem cells to okadaic acid or N-acetyl-D-erythro-sphingosine (an inhibitor and stimulator, respectively, of protein phosphatase 2A) for 24 hours. The expression of the phosphorylated form of type I microtubule-associated protein 1B in the cells was greater after exposure to okadaic acid and lower after N-acetyl-D-erythro-sphingosine. We then injected the bone marrow mesenchymal stem cells through the ear vein into rabbit models of spinal cord contusion. The migration of bone marrow mesenchymal stem cells towards the injured spinal cord was poorer in cells exposed to okadaic acid- and N-acetyl-D-erythro-sphingosine than in non-treated bone marrow mesenchymal stem cells. Finally, we blocked phosphatidylinositol 3-kinase (PI3K) and extracellular signal-regulated kinase 1/2 (ERK1/2) pathways in rabbit bone marrow mesenchymal stem cells using the inhibitors LY294002 and U0126, respectively. LY294002 resulted in an elevated expression of phosphorylated type I microtubule-associated protein 1B, whereas U0126 caused a reduction in expression. The present data indicate that PI3K and ERK1/2 in bone marrow mesenchymal stem cells modulate the phosphorylation of microtubule-associated protein 1B via a cross-signaling network, and affect the migratory efficiency of bone marrow mesenchymal stem cells towards injured spinal cord. PMID:25374590

  6. Precursor T-cell acute lymphoblastic leukemia presenting with bone marrow necrosis: a case report

    Directory of Open Access Journals (Sweden)

    Khoshnaw Najmaddin SH

    2012-10-01

    Full Text Available Abstract Introduction Bone marrow necrosis is a clinicopathological condition diagnosed most often at postmortem examination, but it is also seen during the course of malignancy and is not always associated with a poor prognosis. The morphological features of bone marrow necrosis are disruption of the normal marrow architecture and necrosis of myeloid tissue and medullary stroma. Non-malignant conditions associated with bone marrow necrosis are sickle cell anemia, infections, drugs (sulfasalazine, interferon α, all-trans retinoic acid, granulocyte colony-stimulating factor and fludarabine, disseminated intravascular coagulation, antiphospholipid antibody syndrome and acute graft versus host diseases. The malignant causes are leukemia, lymphoma and metastatic carcinomas. Herein we report the case of a patient with precursor T-cell acute lymphoblastic leukemia and bone marrow necrosis at initial presentation. Case presentation A 10-year-old Kurdish boy was presented with generalized bone pain and fever of 1 month’s duration which was associated with sweating, easy fatigability, nose bleeding, breathlessness and severe weight loss. On examination, we observed pallor, tachypnea, tachycardia, low blood pressure, fever, petechial hemorrhage, ecchymoses, tortuous dilated veins over the chest and upper part of abdomen, multiple small cervical lymph node enlargements, mildly enlarged spleen, palpable liver and gross abdominal distention. Blood analysis revealed pancytopenia and elevated lactate dehydrogenase and erythrocyte sedimentation rate. Imaging results showed mediastinal widening on a planar chest X-ray and diffuse focal infiltration of the axial bone marrow on magnetic resonance imaging of the lumbosacral vertebrae. Bone marrow aspiration and biopsy examination showed extensive bone marrow necrosis. Immunophenotyping analysis of the bone marrow biopsy confirmed T-cell acute lymphoblastic leukemia, as CD3 and terminal deoxynucleotidyl

  7. Sesamol attenuates cytogenetic damages in bone marrow cells of whole body gamma irradiated mice

    International Nuclear Information System (INIS)

    Kumar, Arun; Tamizh Selvan, G.; Adhikari, Jawahar S.; Chaudhury, N.K.

    2014-01-01

    Whole body radiation exposure cause damages to all vital organs and bone marrow is the most sensitive. Pre-treatment with antioxidant as single prophylactic dose is expected to lower induction of damages in bone marrow. In the present study we have focused on sesamol, a dietary antioxidant mediated radioprotection in bone marrow cells of gamma irradiated mice and compared with melatonin. Male C57BL/6 mice were intraperitoneally administered with sesamol (10 and 20 mg/kg body) and after 30 minutes exposed to whole body gamma radiation using 60 Co Teletherapy unit. Mice were injected with 0.2 ml of a metaphase arresting agent (0.05% colchicine) intra-peritoneally 3 hours prior to sacrifice (24 hrs. post-irradiation). Bone marrow cells were flushed out from femurs of each animal and processed for chromosomal aberration assay. Another set of experiment without colchicine injection was performed to access the DNA damage in bone marrow using alkaline comet assay. At least 100 metaphases per animal were scored under light microscope to record various aberrations and total chromosomal aberrations (TCA) was calculated. Similar measurements were performed with melatonin for comparing the efficacy of sesamol. Gamma irradiation has increased the chromatid type aberrations (break formation, fragment) and chromosomal type aberrations (ring formation, acentric) in bone marrow cells. The results have shown significant (p< 0.001) increase in TCA of irradiated mice than control. While pre-treatment of sesamol and melatonin 10 mg/kg significantly (p<0.05) reduced the TCA. The extend of protection has increased at 20 mg/kg significantly (p<0.001) as evident from the reduced TCA compared to irradiated group. Interestingly, sesamol and melatonin have shown similar extent of reduction of TCA. Thus sesamol has demonstrated strong ability to protect bone marrow at low dosage. These investigations on sesamol mediated protection in bone marrow are likely to benefit development of

  8. 12 hours after cerebral ischemia is the optimal time for bone marrow mesenchymal stem cell transplantation

    Directory of Open Access Journals (Sweden)

    Seyed Mojtaba Hosseini

    2015-01-01

    Full Text Available Cell therapy using stem cell transplantation against cerebral ischemia has been reported. However, it remains controversial regarding the optimal time for cell transplantation and the transplantation route. Rat models of cerebral ischemia were established by occlusion of the middle cerebral artery. At 1, 12 hours, 1, 3, 5 and 7 days after cerebral ischemia, bone marrow mesenchymal stem cells were injected via the tail vein. At 28 days after cerebral ischemia, rat neurological function was evaluated using a 6-point grading scale and the pathological change of ischemic cerebral tissue was observed by hematoxylin-eosin staining. Under the fluorescence microscope, the migration of bone marrow mesenchymal stem cells was examined by PKH labeling. Caspase-3 activity was measured using spectrophotometry. The optimal neurological function recovery, lowest degree of ischemic cerebral damage, greatest number of bone marrow mesenchymal stem cells migrating to peri-ischemic area, and lowest caspase-3 activity in the ischemic cerebral tissue were observed in rats that underwent bone marrow mesenchymal stem cell transplantation at 12 hours after cerebral ischemia. These findings suggest that 12 hours after cerebral ischemia is the optimal time for tail vein injection of bone marrow mesenchymal stem cell transplantation against cerebral ischemia, and the strongest neuroprotective effect of this cell therapy appears at this time.

  9. Fusion of intestinal epithelial cells with bone marrow derived cells is dispensable for tissue homeostasis

    OpenAIRE

    de Jong, Joan H.; Rodermond, Hans M.; Zimberlin, Cheryl D.; Lascano, Valeria; De Sousa E Melo, Felipe; Richel, Dick J.; Medema, Jan Paul; Vermeulen, Louis

    2012-01-01

    The epithelial lining of the intestine is characterized by an immense cellular turn-over ascertaining an extensive regenerative capacity. Multiple reports suggest that besides the local intestinal stem cell pool, circulating cells of bone marrow origin (BMDCs) contribute to this process by fusing with the epithelial lineage. However, the functional relevance of these observations is unknown. In the present study we employ a model system in which we cannot only detect cell fusion but also exam...

  10. Fabrication of bone marrow-like tissue in vitro from dispersed-state bone marrow cells

    Directory of Open Access Journals (Sweden)

    Kanae Sayo

    2016-03-01

    Full Text Available A three-dimensional (3D bone marrow (BM culture system may facilitate research into the molecular mechanisms involved in hematopoiesis and BM diseases. However, because >90% of BM cells are composed of non-adherent blood cells, it is difficult to organize the dispersed BM cells into 3D multicellular spheroids using conventional aggregation methods such as hanging drop, and rotary shaking culture. The objective of this study was to reproduce BM-like tissue. We reported successful formation of BM aggregates using a 3% methylcellulose (MC medium. This medium could aggregate even non-adherent materials. In MC medium, BM cells formed tissue-like aggregates within 24 h. Although the cell density of the BM-like tissue is slightly low, sections of the organoids resembled those of intact BM tissue. Cells of the BM-like tissue were approximately 70% viable after 7 days in culture. Staining for CD68, PDGFRα, and CXCL12 indicated that the BM-like tissue contained macrophages, and mesenchymal cells including CXCL12-abundant reticular cells. These results indicated that the method using MC medium effectively reconstitutes the BM-like tissue.

  11. Legumain Regulates Differentiation Fate of Human Bone Marrow Stromal Cells and Is Altered in Postmenopausal Osteoporosis

    Directory of Open Access Journals (Sweden)

    Abbas Jafari

    2017-02-01

    Full Text Available Secreted factors are a key component of stem cell niche and their dysregulation compromises stem cell function. Legumain is a secreted cysteine protease involved in diverse biological processes. Here, we demonstrate that legumain regulates lineage commitment of human bone marrow stromal cells and that its expression level and cellular localization are altered in postmenopausal osteoporotic patients. As shown by genetic and pharmacological manipulation, legumain inhibited osteoblast (OB differentiation and in vivo bone formation through degradation of the bone matrix protein fibronectin. In addition, genetic ablation or pharmacological inhibition of legumain activity led to precocious OB differentiation and increased vertebral mineralization in zebrafish. Finally, we show that localized increased expression of legumain in bone marrow adipocytes was inversely correlated with adjacent trabecular bone mass in a cohort of patients with postmenopausal osteoporosis. Our data suggest that altered proteolytic activity of legumain in the bone microenvironment contributes to decreased bone mass in postmenopausal osteoporosis.

  12. Visual bone marrow mesenchymal stem cell transplantation in the repair of spinal cord injury.

    Science.gov (United States)

    Zhang, Rui-Ping; Xu, Cheng; Liu, Yin; Li, Jian-Ding; Xie, Jun

    2015-03-01

    An important factor in improving functional recovery from spinal cord injury using stem cells is maximizing the number of transplanted cells at the lesion site. Here, we established a contusion model of spinal cord injury by dropping a weight onto the spinal cord at T7-8. Superparamagnetic iron oxide-labeled bone marrow mesenchymal stem cells were transplanted into the injured spinal cord via the subarachnoid space. An outer magnetic field was used to successfully guide the labeled cells to the lesion site. Prussian blue staining showed that more bone marrow mesenchymal stem cells reached the lesion site in these rats than in those without magnetic guidance or superparamagnetic iron oxide labeling, and immunofluorescence revealed a greater number of complete axons at the lesion site. Moreover, the Basso, Beattie and Bresnahan (BBB) locomotor rating scale scores were the highest in rats with superparamagnetic labeling and magnetic guidance. Our data confirm that superparamagnetic iron oxide nanoparticles effectively label bone marrow mesenchymal stem cells and impart sufficient magnetism to respond to the external magnetic field guides. More importantly, superparamagnetic iron oxide-labeled bone marrow mesenchymal stem cells can be dynamically and non-invasively tracked in vivo using magnetic resonance imaging. Superparamagnetic iron oxide labeling of bone marrow mesenchymal stem cells coupled with magnetic guidance offers a promising avenue for the clinical treatment of spinal cord injury.

  13. Characterization, Quantification, and Determination of the Toxicity of Iron Oxide Nanoparticles to the Bone Marrow Cells

    Directory of Open Access Journals (Sweden)

    Sae-Yeol-Rim Paik

    2015-09-01

    Full Text Available Iron oxide nanoparticles (IONPs have been used to develop iron supplements for improving the bioavailability of iron in patients with iron deficiency, which is one of the most serious nutritional deficiencies in the world. Accurate information about the characteristics, concentration, and cytotoxicity of IONPs to the developmental and reproductive cells enables safe use of IONPs in the supplement industry. The objective of this study was to analyze the physicochemical properties and cytotoxicity of IONPs in bone marrow cells. We prepared three different types of iron samples (surface-modified iron oxide nanoparticles (SMNPs, IONPs, and iron citrate and analyzed their physicochemical properties such as particle size distribution, zeta potential, and morphology. In addition, we examined the cytotoxicity of the IONPs in various kinds of bone marrow cells. We analyzed particle size distribution, zeta potential, iron levels, and subcellular localization of the iron samples in bone marrow cells. Our results showed that the iron samples were not cytotoxic to the bone marrow cells and did not affect the expression of cell surface markers and lipopolysaccharide (LPS-induced the secretion of cytokines by murine bone marrow-derived dendritic cells (BMDCs. Our results may be used to investigate the interactions between nanoparticles and cells and tissues and the developmental toxicity of nanoparticles.

  14. T-lymphocyte interaction with stromal, bone and hematopoietic cells in the bone marrow.

    Science.gov (United States)

    Di Rosa, Francesca

    2009-01-01

    Mature T cells in the bone marrow (BM) are in constant exchange with the blood pool. Within the BM, T-cell recognition of antigen presented by dendritic cell (DC) can occur, nevertheless it is thought that BM T cells mostly receive non-antigenic signals by either stimulatory, for example, interleukin (IL)-7, IL-15, tumor necrosis factor family members, or inhibitory molecules, for example, transforming growth factor-beta. The net balance is in favor of T-cell proliferation. Indeed, the percentage of proliferating T cells is higher in the BM than in spleen and lymph nodes, both within CD4 and CD8 T cells. High numbers of memory T cells proliferate in the BM, as they preferentially home to the BM and have an increased turnover as compared with naive T cells. I propose here that the BM plays an essential role in maintaining normal peripheral T-lymphocyte numbers and antigen-specific memory for both CD4 and CD8 T cells. I also discuss BM T-cell contribution to the homeostasis of bone metabolism as well as of hematopoiesis. It emerges that BM T cells play unexpected roles in several diseases, for example AIDS and osteoporosis. A better knowledge on BM T cells has implications for currently used clinical interventions, for example, vaccination, BM transplantation, mesenchymal stem cell-based therapies.

  15. Bone marrow-derived SP cells can contribute to the respiratory tract of mice in vivo.

    Science.gov (United States)

    Macpherson, Heather; Keir, Pamela; Webb, Sheila; Samuel, Kay; Boyle, Shelagh; Bickmore, Wendy; Forrester, Lesley; Dorin, Julia

    2005-06-01

    Recent work has indicated that adult bone marrow-derived cells have the ability to contribute to both the haematopoietic system and other organs. Haematopoietic reconstitution by whole bone marrow and selected but not fully characterised cell populations have resulted in reports indicating high-level repopulation of lung epithelia. The well-characterised cells from the side population have a robust ability for haematopoietic reconstitution. We have used freshly isolated side population cells derived from ROSA26 adult bone marrow and demonstrate that despite being unable to contribute to embryos following blastocyst injection, or air liquid interface cultures or denuded tracheal xenografts, they could contribute to the tracheal epithelium in vivo. Epithelial damage is reported to be important in encouraging the recruitment of marrow-derived stem cells into non-haematopoietic organs. Here we demonstrate that mice engrafted with side population cells have donor-derived cells present in the epithelial lining of the trachea following damage and repair. Donor-derived cells were found at a frequency of 0.83%. Widefield and confocal microscopy revealed donor cells that expressed cytokeratins, indicative of cells of an epithelial nature. These results imply that SP haematopoietic stem cells from the bone marrow do not have the ability to contribute to airway epithelia themselves but require factors present in vivo to allow them to acquire characteristics of this tissue.

  16. CHIP regulates bone mass by targeting multiple TRAF family members in bone marrow stromal cells.

    Science.gov (United States)

    Wang, Tingyu; Li, Shan; Yi, Dan; Zhou, Guang-Qian; Chang, Zhijie; Ma, Peter X; Xiao, Guozhi; Chen, Di

    2018-01-01

    Carboxyl terminus of Hsp70-interacting protein (CHIP or STUB1) is an E3 ligase and regulates the stability of several proteins which are involved in different cellular functions. Our previous studies demonstrated that Chip deficient mice display bone loss phenotype due to increased osteoclast formation through enhancing TRAF6 activity in osteoclasts. In this study we provide novel evidence about the function of CHIP. We found that osteoblast differentiation and bone formation were also decreased in Chip KO mice. In bone marrow stromal (BMS) cells derived from Chip -/- mice, expression of a panel of osteoblast marker genes was significantly decreased. ALP activity and mineralized bone matrix formation were also reduced in Chip- deficient BMS cells. We also found that in addition to the regulation of TRAF6, CHIP also inhibits TNFα-induced NF-κB signaling through promoting TRAF2 and TRAF5 degradation. Specific deletion of Chip in BMS cells downregulated expression of osteoblast marker genes which could be reversed by the addition of NF-κB inhibitor. These results demonstrate that the osteopenic phenotype observed in Chip -/- mice was due to the combination of increased osteoclast formation and decreased osteoblast differentiation. Taken together, our findings indicate a significant role of CHIP in bone remodeling.

  17. An innovative approach to bone marrow collection and transplantation in a patient with beta-thalassemia major: marrow collection using a perfusion method followed by intra-bone marrow injection of collected bone marrow cells.

    Science.gov (United States)

    Li, Chunfu; He, Yuelin; Feng, Xiaoqin; Inaba, Muneo; Adachi, Yasushi; Takada, Keizo; Zhang, Yuming; Yamamoto, Yoshihisa; Wu, Xuedong; Cui, Yunze; Iwasaki, Masayoshi; Hisha, Hiroko; Hosaka, Naoki; Taira, Mitsuru; Minamino, Keizo; Suzuki, Yasuhiro; Nakano, Keiji; Fukui, Junichi; Ueda, Yusuke; Koike, Yasushi; Tsuda, Masanobu; Ikehara, Susumu

    2007-01-01

    Using small animals (mice and rats) and monkeys, we have found that the combination of bone marrow collection using the perfusion method (PM) and intra-bone marrow-bone marrow transplantation (IBM-BMT) of the collected cells is safe and effective in treating various intractable diseases. Based on these findings, we attempted to apply this method to humans. We report here the first case of a patient (6 years old) with beta-thalassemia major who underwent allogeneic BMT using this new PM + IBM-BMT method. The white blood cell counts of the patient gradually increased to more than 1500/microL by day 47 and continued to increase, reaching the highest level (8600/microL) on day +55. Fluorescence in situ hybridization data on day +33 showed that 98% of the peripheral blood cells were from the donor. Notably, there were no symptoms of graft-versus-host disease (GvHD). However, on day +56, the patient regrettably died of asphyxia resulting from sticky sputum. There was no evidence of infection (in the lung or liver) or GvHD (in the skin) by necropsy. We hope that this case report will help make our new strategies more readily available for the treatment of patients with various intractable diseases.

  18. Human bone marrow stem cell-encapsulating calcium phosphate scaffolds for bone repair

    Science.gov (United States)

    Weir, Michael D.; Xu, Hockin H.K.

    2010-01-01

    Due to its injectability and excellent osteoconductivity, calcium phosphate cement (CPC) is highly promising for orthopedic applications. However, a literature search revealed no report on human bone marrow mesenchymal stem cell (hBMSC) encapsulation in CPC for bone tissue engineering. The aim of this study was to encapsulate hBMSCs in alginate hydrogel beads and then incorporate them into CPC, CPC–chitosan and CPC–chitosan–fiber scaffolds. Chitosan and degradable fibers were used to mechanically reinforce the scaffolds. After 21 days, that the percentage of live cells and the cell density of hBMSCs inside CPC-based constructs matched those in alginate without CPC, indicating that the CPC setting reaction did not harm the hBMSCs. Alkaline phosphate activity increased by 8-fold after 14 days. Mineral staining, scanning electron microscopy and X-ray diffraction confirmed that apatitic mineral was deposited by the cells. The amount of hBMSC-synthesized mineral in CPC–chitosan–fiber matched that in CPC without chitosan and fibers. Hence, adding chitosan and fibers, which reinforced the CPC, did not compromise hBMSC osteodifferentiation and mineral synthesis. In conclusion, hBMSCs were encapsulated in CPC and CPC–chitosan–fiber scaffolds for the first time. The encapsulated cells remained viable, osteodifferentiated and synthesized bone minerals. These self-setting, hBMSC-encapsulating CPC-based constructs may be promising for bone tissue engineering applications. PMID:20451676

  19. Bone marrow cells from allogeneic bone marrow chimeras inhibit the generation of cytotoxic lymphocyte responses against both donor and recipient cells

    International Nuclear Information System (INIS)

    Ogasawara, M.; Iwabuchi, K.; Good, R.A.; Onoe, K.

    1988-01-01

    When added to a mixed lymphocyte culture, bone marrow cells suppress the generation of CTL activity against H-2 Ag shared by the BM cells and the stimulator cells. These cells have been referred to as veto cells and are thought to play a role in maintaining self-tolerance. We analyzed the H-2 specificity of the suppression expressed by the veto cells from H-2 incompatible bone marrow chimeras, because lymphocytes of such chimeras had been shown to be tolerant to both donor and recipient Ag when tested by CTL responses. We found that the bone marrow cells of such chimeras which were featured by non-T and non-B cell characteristics inhibited the generation of CTL directed against either donor or recipient Ag, but not against third-party Ag. These observations suggest that in allogeneic chimeras the veto or veto-like cells alter the inhibitory specificity exhibited in the recipient microenvironment and indicate that these cells are directly involved in the induction and maintenance of self-tolerance

  20. Encapsulated Whole Bone Marrow Cells Improve Survival in Wistar Rats after 90% Partial Hepatectomy

    Directory of Open Access Journals (Sweden)

    Carolina Uribe-Cruz

    2016-01-01

    Full Text Available Background and Aims. The use of bone marrow cells has been suggested as an alternative treatment for acute liver failure. In this study, we investigate the effect of encapsulated whole bone marrow cells in a liver failure model. Methods. Encapsulated cells or empty capsules were implanted in rats submitted to 90% partial hepatectomy. The survival rate was assessed. Another group was euthanized at 6, 12, 24, 48, and 72 hours after hepatectomy to study expression of cytokines and growth factors. Results. Whole bone marrow group showed a higher than 10 days survival rate compared to empty capsules group. Gene expression related to early phase of liver regeneration at 6 hours after hepatectomy was decreased in encapsulated cells group, whereas genes related to regeneration were increased at 12, 24, and 48 hours. Whole bone marrow group showed lower regeneration rate at 72 hours and higher expression and activity of caspase 3. In contrast, lysosomal-β-glucuronidase activity was elevated in empty capsules group. Conclusions. The results show that encapsulated whole bone marrow cells reduce the expression of genes involved in liver regeneration and increase those responsible for ending hepatocyte division. In addition, these cells favor apoptotic cell death and decrease necrosis, thus increasing survival.

  1. Transplantation of neurotrophin-3-transfected bone marrow mesenchymal stem cells for the repair of spinal cord injury

    OpenAIRE

    Dong, Yuzhen; Yang, Libin; Yang, Lin; Zhao, Hongxing; Zhang, Chao; Wu, Dapeng

    2014-01-01

    Bone marrow mesenchymal stem cell transplantation has been shown to be therapeutic in the repair of spinal cord injury. However, the low survival rate of transplanted bone marrow mesenchymal stem cells in vivo remains a problem. Neurotrophin-3 promotes motor neuron survival and it is hypothesized that its transfection can enhance the therapeutic effect. We show that in vitro transfection of neurotrophin-3 gene increases the number of bone marrow mesenchymal stem cells in the region of spinal ...

  2. Selective Retention of Bone Marrow-Derived Cells to Enhance Spinal Fusion

    Science.gov (United States)

    Matsukura, Yoichi; Nitto, Hironori; Boehm, Cynthia A.; Valdevit, Antonio D.; Kambic, Helen E.; Davros, William J.; Easley, Kirk A.; Powell, Kimerly A.

    2005-01-01

    Connective tissue progenitors can be concentrated rapidly from fresh bone marrow aspirates using some porous matrices as a surface for cell attachment and selective retention, and for creating a cellular graft that is enriched with respect to the number of progenitor cells. We evaluated the potential value of this method using demineralized cortical bone powder as the matrix. Matrix alone, matrix plus marrow, and matrix enriched with marrow cells were compared in an established canine spinal fusion model. Fusions were compared based on union score, fusion mass, fusion volume, and by mechanical testing. Enriched matrix grafts delivered a mean of 2.3 times more cells and approximately 5.6 times more progenitors than matrix mixed with bone marrow. The union score with enriched matrix was superior to matrix alone and matrix plus marrow. Fusion volume and fusion area also were greater with the enriched matrix. These data suggest that the strategy of selective retention provides a rapid, simple, and effective method for concentration and delivery of marrow-derived cells and connective tissue progenitors that may improve the outcome of bone grafting procedures in various clinical settings. PMID:15738828

  3. Stimulation of porcine bone marrow stromal cells by hyaluronan, dexamethasone and rhBMP-2

    DEFF Research Database (Denmark)

    Zou, Xuenong; Li, Haisheng; Chen, Li

    2004-01-01

    In the interest of optimizing osteogenesis in in vitro, the present study sought to determine how porcine bone marrow stromal cell (BMSc) would respond to different concentrations of hyaluronan (HY) and its different combinations with dexamethasone (Dex) and recombinant human bone morphogenic pro...

  4. Quantitation of Monoclonal Plasma Cells in Bone Marrow Biopsies in Plasma Cell Dyscrasia

    Directory of Open Access Journals (Sweden)

    G. M. Markey

    2003-01-01

    Full Text Available Direct measurement of monoclonal plasma cell mass in bone marrow biopsies may be a useful parameter to establish in plasma cell dyscrasia. In this study monoclonal plasma cells/mm2 in light chain immunoglobulin immunostained archival bone marrow sections from 22 patients in whom a diagnosis of multiple myeloma (MM had been excluded but who had monoclonal proteins were counted by two observers at light microscopic level. There was good correlation between the counts of the two observers. The levels of monoclonal plasma cells/mm2 in biopsies were not related to the % counts in the aspirates taken at the same time as the biopsies. Three of seven patients with biopsy levels in excess of the polyclonal levels in patients without plasma cell dyscrasia developed progressive MM within the observation time. Monoclonal plasma cell levels/mm2 of bone marrow biopsies can be measured and they provide a useful parameter for the assessment of patients with low volume plasma cell dyscrasia. Colour figure can be viewed on http://www.esacp.org/acp/2003/25‐4/markey.htm.

  5. Effects of autologous stromal cells and cytokines on differentiation of equine bone marrow-derived progenitor cells.

    Science.gov (United States)

    Schwab, Ute E; Tallmadge, Rebecca L; Matychak, Mary Beth; Felippe, M Julia B

    2017-10-01

    OBJECTIVE To develop an in vitro system for differentiation of equine B cells from bone marrow hematopoietic progenitor cells on the basis of protocols for other species. SAMPLE Bone marrow aspirates aseptically obtained from 12 research horses. PROCEDURES Equine bone marrow CD34 + cells were sorted by use of magnetic beads and cultured in medium supplemented with cytokines (recombinant human interleukin-7, equine interleukin-7, stem cell factor, and Fms-like tyrosine kinase-3), murine OP9 stromal cell preconditioned medium, and equine fetal bone marrow mesenchymal stromal cell preconditioned medium. Cells in culture were characterized by use of flow cytometry, immunocytofluorescence microscopy, and quantitative reverse-transcriptase PCR assay. RESULTS For these culture conditions, bone marrow-derived equine CD34 + cells differentiated into CD19 + IgM + B cells that expressed the signature transcription factors early B-cell factor and transcription factor 3. These conditions also supported the concomitant development of autologous stromal cells, and their presence was supportive of B-cell development. CONCLUSIONS AND CLINICAL RELEVANCE Equine B cells were generated from bone marrow aspirates by use of supportive culture conditions. In vitro generation of equine autologous B cells should be of use in studies on regulation of cell differentiation and therapeutic transplantation.

  6. Hemopoietic stem cell niches, recovery from radiation and bone marrow transfusions

    International Nuclear Information System (INIS)

    Cronkite, E.P.; Carsten, A.L.; Brecher, G.

    1979-01-01

    The long term hematologic effects of single whole body sublethal X-ray exposure, 525 rad, and the low level chronic exposure from 137 Cs gamma ray and ingested HTO were investigated in mice. The single X-ray exposure had early severe effect on bone marrows both in terms of total cellularity and the number of pluripotent stem cells. How do animals maintain normal cellularity in the absence of a normal number of the pluripotent stem cells[ The following 3 different mechanisms may be involved: additional division in the cytologically identifiable divisible pool of bone marrows; shortening of cycle time allowing more divisions in the same time with great amplification of a small number of colony-forming unit spleens; and the recruitment of G 0 stem cells into proliferation. The reduction in the number of bone marrow stem cells might be attributed to stromal injury in the marrows such that they cannot support as many stem cells as those before the radiation exposure. As an alternate to the ''niche'' hypothesis, the injury to the stem cell pool such that self-replication was not sufficient to restore normal cell concentration is a possibility. The time sequence of the transfusion of marrows may be important to the ultimate effect. Attempts to fill empty niches 10 and 12 weeks after a single and severe radiation injury may be impossible due to stromal changes which in effect have eliminated the niches. The bone marrows of animals rescued by the transfusion of 4 x 10 6 bone marrow cells will accept 0 to 25% of the second transfusion of 4 x 10 7 cells. (Yamashita, S.)

  7. [Protective effects of human bone marrow mesenchymal stem cells on hematopoietic organs of irradiated mice].

    Science.gov (United States)

    Chen, Ling-Zhen; Yin, Song-Mei; Zhang, Xiao-Ling; Chen, Jia-Yu; Wei, Bo-Xiong; Zhan, Yu; Yu, Wei; Wu, Jin-Ming; Qu, Jia; Guo, Zi-Kuan

    2012-12-01

    The objective of this study was to explore the protective effects of human bone marrow mesenchymal stem cells (MSC) on hematopoietic organs of irradiated mice. Human bone marrow MSC were isolated, ex vivo expanded, and identified by cell biological tests. Female BALB/c mice were irradiated with (60)Co γ-ray at a single dose of 6 Gy, and received different doses of human MSC and MSC lysates or saline via tail veins. The survival of mice was record daily, and the femurs and spleens were harvested on day 9 and 16 for pathologic examination. The histological changes were observed and the cellularity was scored. The results showed that the estimated survival time of MSC- and MSC lysate-treated mice was comparable to that of controls. The hematopoiesis in the bone marrow of mice that received high-dose (5×10(6)) of MSC or MSC lysates was partially restored on day 9 and the capacity of hemopoietic tissue and cellularity scorings were significantly elevated as compared with that of controls (P nudes were also obviously observed in the spleens of mice that received high-dose of MSC or MSC lysates on d 9 after irradiation. The histological structures of the spleen and bone marrow of the mice that received high-doses (5×10(6)) of MSC or MSC lysates were restored to normal, the cell proliferation displayed extraordinarily active. Further, the cellularity scores of the bone marrow were not significantly different between the high-dose MSC and MSC lysate-treated mice. It is concluded that the bone marrow MSC can promote the hematopoietic recovery of the irradiated mice, which probably is associated with the bioactive materials inherently existed in bone marrow cells.

  8. Bone marrow-derived cells are differentially involved in pathological and physiological retinal angiogenesis in mice

    International Nuclear Information System (INIS)

    Zou, He; Otani, Atsushi; Oishi, Akio; Yodoi, Yuko; Kameda, Takanori; Kojima, Hiroshi; Yoshimura, Nagahisa

    2010-01-01

    Purpose: Bone marrow-derived cells have been shown to play roles in angiogenesis. Although these cells have been shown to promote angiogenesis, it is not yet clear whether these cells affect all types of angiogenesis. This study investigated the involvement of bone marrow-derived cells in pathological and physiological angiogenesis in the murine retina. Materials and methods: The oxygen-induced retinopathy (OIR) model was used as a retinal angiogenesis model in newborn mice. To block the influence of bone marrow-derived cells, the mice were irradiated with a 4-Gy dose of radiation from a 137 Cs source. Irradiation was performed in four different conditions with radio dense 2-cm thick lead disks; (1) H group, the head were covered with these discs to protect the eyes from radiation; (2) A group, all of the body was covered with these discs; (3) N group, mice were completely unshielded; (4) C group, mice were put in the irradiator but were not irradiated. On P17, the retinal areas showing pathological and physiological retinal angiogenesis were measured and compared to the retinas of nonirradiated mice. Results: Although irradiation induced leukocyte depletion, it did not affect the number of other cell types or body weight. Retinal nonperfusion areas were significantly larger in irradiated mice than in control mice (P < 0.05), indicating that physiological angiogenesis was impaired. However, the formation of tuft-like angiogenesis processes was more prominent in the irradiated mice (P < 0.05), indicating that pathological angiogenesis was intact. Conclusions: Bone marrow-derived cells seem to be differentially involved in the formation of physiological and pathological retinal vessels. Pathological angiogenesis in the murine retina does not require functional bone marrow-derived cells, but these cells are important for the formation of physiological vessels. Our results add a new insight into the pathology of retinal angiogenesis and bolster the hypothesis that bone

  9. COMPARISON OF HUMAN ADIPOSE-DERIVED STEM CELLS AND BONE MARROW-DERIVED STEM CELLS IN A MYOCARDIAL INFARCTION MODEL

    DEFF Research Database (Denmark)

    Rasmussen, Jeppe Grøndahl; Frøbert, Ole; Holst-Hansen, Claus

    2012-01-01

    Background: Treatment of myocardial infarction with bone marrow-derived mesenchymal stem cells and recently also adipose-derived stem cells has shown promising results. In contrast to clinical trials and their use of autologous bone marrow-derived cells from the ischemic patient, the animal...... myocardial infarction models are often using young donors and young, often immune-compromised, recipient animals. Our objective was to compare bone marrow-derived mesenchymal stem cells with adipose-derived stem cells from an elderly ischemic patient in the treatment of myocardial infarction, using a fully...... randomised to receive intramyocardial injections of adipose-derived stem cells, bone marrow derived mesenchymal stem cells or phosphate-buffered saline one week following induction of myocardial infarction. Results: After four weeks, left ventricular ejection fraction was improved in the adipose-derived stem...

  10. Recruitment of Bone Marrow-Derived Valve Interstitial Cells is a Normal Homeostatic Process

    Science.gov (United States)

    Hajdu, Zoltan; Romeo, Stephen J.; Fleming, Paul A.; Markwald, Roger R.; Visconti, Richard P.; Drake, Christopher J.

    2011-01-01

    Advances in understanding of the maintenance of the cardiac valves during normal cardiac function and response to injury have lead to several novel findings, including that there is contribution of extra-cardiac cells to the major cellular population of the valve: the valve interstitial cell (VIC). While suggested to occur in human heart studies, we have been able to experimentally demonstrate, using a mouse model, that cells of bone marrow hematopoietic stem cell origin engraft into the valves and synthesize collagen type I. Based on these initial findings, we sought to further characterize this cell population in terms of its similarity to VICs and begin to elucidate its contribution to valve homeostasis. To accomplish this, chimeric mice whose bone marrow was repopulated with enhanced green fluorescent protein (EGFP) expressing total nucleated bone marrow cells were used to establish a profile of EGFP+ valve cells in terms of their expression of hematopoietic antigens, progenitor markers, fibroblast- and myofibroblast-related molecules, as well as their distribution within the valves. Using this profile, we show that normal (non-irradiated, non-transplanted) mice have BM-derived cell populations that exhibit identical morphology and phenotype to those observed in transplanted mice. Collectively, our findings establish that the engraftment of bone marrow-derived cells occurs as part of normal valve homeostasis. Further, our efforts demonstrate that the use of myeloablative irradiation, which is commonly employed in studies involving bone marrow transplantation, does not elicit changes in the bone marrow-derived VIC phenotype in recipient mice. PMID:21871458

  11. Accelerated Functional Recovery after Skeletal Muscle Ischemia-reperfusion Injury using Freshly Isolated Bone Marrow Cells

    Science.gov (United States)

    2014-01-03

    Invest 2010;90(5):685. [12] van Ramshorst J, Bax JJ, Beeres SL, et al. Intramyocardial bone marrow cell injection for chronic myocardial ischemia: a...Cell Transpl 2010;19(2):193. [31] Lamoury FM, Croitoru Lamoury J, Brew BJ. Undifferentiated mouse mesenchymal stem cells spontaneously express neural and

  12. Legumain Regulates Differentiation Fate of Human Bone Marrow Stromal Cells and Is Altered in Postmenopausal Osteoporosis

    DEFF Research Database (Denmark)

    Jafari, Abbas; Qanie, Diyako; Levin Andersen, Thomas

    2017-01-01

    Secreted factors are a key component of stem cell niche and their dysregulation compromises stem cell function. Legumain is a secreted cysteine protease involved in diverse biological processes. Here, we demonstrate that legumain regulates lineage commitment of human bone marrow stromal cells...

  13. Bone marrow-derived mononuclear cell transplantation in spinal cord injury patients by lumbar puncture.

    Science.gov (United States)

    Suzuki, Yoshihisa; Ishikawa, Namiko; Omae, Kaoru; Hirai, Tatsuya; Ohnishi, Katsunori; Nakano, Norihiko; Nishida, Hidetaka; Nakatani, Toshio; Fukushima, Masanori; Ide, Chizuka

    2014-01-01

    This study was conducted to assess the safety and feasibility of intrathecal transplantation of autologous bone marrow-derived mononuclear cells for the treatment of patients with spinal cord injury. Ten patients were included in the study. Approximately 120 ml of bone marrow aspirate was obtained from bilateral iliac bone of patients with spinal cord injury. Isolation of mononuclear cells was performed using Ficoll density-gradient centrifugation. Bone marrow mononuclear cells were transplanted into cerebrospinal fluid by lumbar puncture. Functional tests were performed prior to the cell transplantation and six months after cell transplantation. The patients were carefully observed for up to six months. In 5 patients with AIS A prior to cell transplantation, 1 patient converted to AIS B six months after cell transplantation. In 5 patients with AIS B, 1 patient converted to AIS D and 2 patients to AIS C. MRI did not show any complication. Two patients showed slight anemia after aspiration of bone-marrow cells, which returned to normal level within a several weeks. The results of this study suggest that this method may be safe and feasible.

  14. Polyamines affect histamine synthesis during early stages of IL-3-induced bone marrow cell differentiation.

    Science.gov (United States)

    García-Faroldi, Gianni; Correa-Fiz, Florencia; Abrighach, Hicham; Berdasco, María; Fraga, Mario F; Esteller, Manel; Urdiales, José L; Sánchez-Jiménez, Francisca; Fajardo, Ignacio

    2009-09-01

    Mast cells synthesize and store histamine, a key immunomodulatory mediator. Polyamines are essential for every living cell. Previously, we detected an antagonistic relationship between the metabolisms of these amines in established mast cell and basophilic cell lines. Here, we used the IL-3-driven mouse bone marrow-derived mast cell (BMMC) culture system to further investigate this antagonism in a mast cell model of deeper physiological significance. Polyamines and histamine levels followed opposite profiles along the bone marrow cell cultures leading to BMMCs. alpha-Difluoromethylornithine (DFMO)-induced polyamine depletion resulted in an upregulation of histidine decarboxylase (HDC, the histamine-synthesizing enzyme) expression and activity, accompanied by increased histamine levels, specifically during early stages of these cell cultures, where an active histamine synthesis process occurs. In contrast, DFMO did not induce any effect in either HDC activity or histamine levels of differentiated BMMCs or C57.1 mast cells, that exhibit a nearly inactive histamine synthesis rate. Sequence-specific DNA methylation analysis revealed that the DFMO-induced HDC mRNA upregulation observed in early bone marrow cell cultures is not attributable to a demethylation of the gene promoter caused by the pharmacological polyamine depletion. Taken together, the results support an inverse relationship between histamine and polyamine metabolisms during the bone marrow cell cultures leading to BMMCs and, moreover, suggest that the regulation of the histamine synthesis occurring during the early stages of these cultures depends on the concentrations of polyamines. (c) 2009 Wiley-Liss, Inc.

  15. Quantification of bone marrow plasma cell infiltration in multiple myeloma: usefulness of bone marrow aspirate clot with CD138 immunohistochemistry.

    Science.gov (United States)

    Matsue, Kosei; Matsue, Yuya; Kumata, Kaoru; Usui, Yoshiaki; Suehara, Yasuhito; Fukumoto, Kota; Fujisawa, Manabu; Narita, Kentaro; Takeuchi, Masami

    2017-09-01

    Accurate quantification of plasma cells (PCs) in bone marrow (BM) is critical for diagnosis and assessment of treatment response in patients with multiple myeloma (MM). We compared the % of BM PC quantified by 250 cell differential count on May-Giemsa-stained BM smears, by counting 500 - 2500 cells in 2 - 5 representative microscopy fields in CD138-immunostained BM clot and biopsy sections, and CD38/CD45/CD138 gated BM PCs on flow cytometry (FCM) in 150 sets of BM samples from 120 patients. Percentages of PC were significantly correlated between BM biopsy and clot, and between smear and FCM (r = 0.96, 0.93, respectively). However, quantification by smear and FCM significantly underestimated the PC compared to biopsy or clot, and the degree of underestimation increased with blood dilution. FCM consistently showed lower % of PC compared to aspirate smears. Fifty-nine of 103 patients with M-protein level smoldering MM when reassessed using CD138-stained biopsy/clot sections. Among the 72 patients with sMM diagnosed by BM biopsy and/clot, three patients (4.2%) had extensive BM infiltration of PC (≥ 60%) and required treatment. Our data clearly showed the necessity of CD138 immunostaining of BM biopsy/clot specimens for correct diagnosis of MM and related disorders. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  16. An improved protocol for isolation and culture of mesenchymal stem cells from mouse bone marrow

    Directory of Open Access Journals (Sweden)

    Shuo Huang

    2015-01-01

    Full Text Available Mesenchymal stem cells (MSCs from bone marrow are main cell source for tissue repair and engineering, and vehicles of cell-based gene therapy. Unlike other species, mouse bone marrow derived MSCs (BM-MSCs are difficult to harvest and grow due to the low MSCs yield. We report here a standardised, reliable, and easy-to-perform protocol for isolation and culture of mouse BM-MSCs. There are five main features of this protocol. (1 After flushing bone marrow out of the marrow cavity, we cultured the cells with fat mass without filtering and washing them. Our method is simply keeping the MSCs in their initial niche with minimal disturbance. (2 Our culture medium is not supplemented with any additional growth factor. (3 Our method does not need to separate cells using flow cytometry or immunomagnetic sorting techniques. (4 Our method has been carefully tested in several mouse strains and the results are reproducible. (5 We have optimised this protocol, and list detailed potential problems and trouble-shooting tricks. Using our protocol, the isolated mouse BM-MSCs were strongly positive for CD44 and CD90, negative CD45 and CD31, and exhibited tri-lineage differentiation potentials. Compared with the commonly used protocol, our protocol had higher success rate of establishing the mouse BM-MSCs in culture. Our protocol may be a simple, reliable, and alternative method for culturing MSCs from mouse bone marrow tissues.

  17. HGF Expressing Stem Cells in Usual Interstitial Pneumonia Originate from the Bone Marrow and Are Antifibrotic.

    Directory of Open Access Journals (Sweden)

    Amiq Gazdhar

    Full Text Available Pulmonary fibrosis may result from abnormal alveolar wound repair after injury. Hepatocyte growth factor (HGF improves alveolar epithelial wound repair in the lung. Stem cells were shown to play a major role in lung injury, repair and fibrosis. We studied the presence, origin and antifibrotic properties of HGF-expressing stem cells in usual interstitial pneumonia.Immunohistochemistry was performed in lung tissue sections and primary alveolar epithelial cells obtained from patients with usual interstitial pneumonia (UIP, n = 7. Bone marrow derived stromal cells (BMSC from adult male rats were transfected with HGF, instilled intratracheally into bleomycin injured rat lungs and analyzed 7 and 14 days later.In UIP, HGF was expressed in specific cells mainly located in fibrotic areas close to the hyperplastic alveolar epithelium. HGF-positive cells showed strong co-staining for the mesenchymal stem cell markers CD44, CD29, CD105 and CD90, indicating stem cell origin. HGF-positive cells also co-stained for CXCR4 (HGF+/CXCR4+ indicating that they originate from the bone marrow. The stem cell characteristics were confirmed in HGF secreting cells isolated from UIP lung biopsies. In vivo experiments showed that HGF-expressing BMSC attenuated bleomycin induced pulmonary fibrosis in the rat, indicating a beneficial role of bone marrow derived, HGF secreting stem cells in lung fibrosis.HGF-positive stem cells are present in human fibrotic lung tissue (UIP and originate from the bone marrow. Since HGF-transfected BMSC reduce bleomycin induced lung fibrosis in the bleomycin lung injury and fibrosis model, we assume that HGF-expressing, bone-marrow derived stem cells in UIP have antifibrotic properties.

  18. BONE MARROW TRANSPLANTATION

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. BONE MARROW TRANSPLANTATION. AUTOLOGOUS TRANSPLANTS: Oct 1986 - Dec 2007. Multiple Myeloma 90. NHL 39. Hodgkins lymphoma 19. AML 36. APML 9. ALL 2. Amyloidosis 2. Granulocytic Sarcoma 1.

  19. Bone marrow transplant - discharge

    Science.gov (United States)

    ... lymphoblastic leukemia (ALL) Acute myeloid leukemia - adult Aplastic anemia Bone marrow transplant Chronic lymphocytic leukemia (CLL) Chronic myelogenous leukemia (CML) Graft-versus-host disease Hodgkin lymphoma Multiple myeloma Non-Hodgkin lymphoma Patient ...

  20. Modeling invasion of metastasizing cancer cells to bone marrow utilizing ecological principles.

    Science.gov (United States)

    Chen, Kun-Wan; Pienta, Kenneth J

    2011-10-03

    The invasion of a new species into an established ecosystem can be directly compared to the steps involved in cancer metastasis. Cancer must grow in a primary site, extravasate and survive in the circulation to then intravasate into target organ (invasive species survival in transport). Cancer cells often lay dormant at their metastatic site for a long period of time (lag period for invasive species) before proliferating (invasive spread). Proliferation in the new site has an impact on the target organ microenvironment (ecological impact) and eventually the human host (biosphere impact). Tilman has described mathematical equations for the competition between invasive species in a structured habitat. These equations were adapted to study the invasion of cancer cells into the bone marrow microenvironment as a structured habitat. A large proportion of solid tumor metastases are bone metastases, known to usurp hematopoietic stem cells (HSC) homing pathways to establish footholds in the bone marrow. This required accounting for the fact that this is the natural home of hematopoietic stem cells and that they already occupy this structured space. The adapted Tilman model of invasion dynamics is especially valuable for modeling the lag period or dormancy of cancer cells. The Tilman equations for modeling the invasion of two species into a defined space have been modified to study the invasion of cancer cells into the bone marrow microenvironment. These modified equations allow a more flexible way to model the space competition between the two cell species. The ability to model initial density, metastatic seeding into the bone marrow and growth once the cells are present, and movement of cells out of the bone marrow niche and apoptosis of cells are all aspects of the adapted equations. These equations are currently being applied to clinical data sets for verification and further refinement of the models.

  1. The role of bone marrow-derived cells in bone fracture repair in a green fluorescent protein chimeric mouse model

    International Nuclear Information System (INIS)

    Taguchi, Kazuhiro; Ogawa, Rei; Migita, Makoto; Hanawa, Hideki; Ito, Hiromoto; Orimo, Hideo

    2005-01-01

    We investigated the role of bone marrow cells in bone fracture repair using green fluorescent protein (GFP) chimeric model mice. First, the chimeric model mice were created: bone marrow cells from GFP-transgenic C57BL/6 mice were injected into the tail veins of recipient wild-type C57BL/6 mice that had been irradiated with a lethal dose of 10 Gy from a cesium source. Next, bone fracture models were created from these mice: closed transverse fractures of the left femur were produced using a specially designed device. One, three, and five weeks later, fracture lesions were extirpated for histological and immunohistochemical analyses. In the specimens collected 3 and 5 weeks after operation, we confirmed calluses showing intramembranous ossification peripheral to the fracture site. The calluses consisted of GFP- and osteocalcin-positive cells at the same site, although the femur consisted of only osteocalcin-positive cells. We suggest that bone marrow cells migrated outside of the bone marrow and differentiated into osteoblasts to make up the calluses

  2. Bone and marrow imaging in sickle cell disease: diagnosis of infarction

    International Nuclear Information System (INIS)

    Lutzker, L.G.; Alavi, A.

    1976-01-01

    Sickling of erythrocytes in patients with S-hemoglobin causes marrow and bone infarction. The former can be demonstrated as a lack of /sup 99m/Tc-sulfur colloid uptake on marrow imaging examination. These defects may resolve or persist long after the acute episode. If the bone is involved in the acute episode, imaging within the first few days of onset of symptoms can show lack of /sup 99m/Tc-labeled phosphate uptake, usually in a smaller area than that shown by marrow scanning. Follow-up bone imaging shows increased activity, particularly along the circumference of the bone where periosteal reaction can be demonstrated radiographically. Magnification by use of the pinhole collimator provides better definition of the uptake defect and the distribution of the increased reactive uptake. Timing of examination is important. If marrow imaging is performed in an asymptomatic period, the repeat examination during a painful crisis permits differentiation of old and acute marrow infarction. If /sup 99m/Tc-phosphate imaging is performed after about 2 days of symptoms, acute infarction can be differentiated from osteomyelitis, which it may mimic clinically. To assist in differentiating bone infection in a site of marrow infarction demonstrated by marrow imaging, serial bone imaging with magnification may be useful. The uptake defect, followed in several days to 2 weeks, by circumferential increased activity, is a different pattern than the homogeneously intense activity of osteomyelitis, but the peripheral distribution may not be apparent on routine imaging. It is hoped that the utilization of these techniques can decrease the emotional and economic costs of prolonged hospitalization for suspected infection and can also expand our knowledge of the complex pathophysiologic changes of sickle cell bone disease

  3. Modeling Dynamics and Function of Bone Marrow Cells in Mouse Liver Regeneration

    NARCIS (Netherlands)

    Pedone, Elisa; Olteanu, Vlad-Aris; Marucci, Lucia; Muñoz-Martin, Maria Isabel; Youssef, Sameh A; de Bruin, Alain; Cosma, Maria Pia

    2017-01-01

    In rodents and humans, the liver can efficiently restore its mass after hepatectomy. This is largely attributed to the proliferation and cell cycle re-entry of hepatocytes. On the other hand, bone marrow cells (BMCs) migrate into the liver after resection. Here, we find that a block of BMC

  4. Iron deposition in cranial bone marrow with sickle cell disease: MR assessment using a fat suppression technique

    Energy Technology Data Exchange (ETDEWEB)

    Kaneko, K. (Dept. of Radiology, Tulane Univ. Medical Center, New Orleans, LA (United States)); Humbert, J.H. (Dept. of Pediatrics, Tulane Univ. Medical Center, New Orleans, LA (United States)); Kogutt, M.S. (Dept. of Radiology, Tulane Univ. Medical Center, New Orleans, LA (United States)); Robinson, A.E. (Dept. of Radiology, Tulane Univ. Medical Center, New Orleans, LA (United States))

    1993-10-01

    Thirteen patients with sickle cell disease (SCD) undergoing transfusion therapy and 8 control patients were examined by magnetic resonance imaging to discriminate bone marrow change due to iron deposition from hematologic marrow hyperplasia. Using T1-weighted spin echo images, only two subjects showed extremely low signal intensity marrow compatible with iron deposition. However, using T2-weighted fast spin echo images with fat suppression, cranial bone marrow in SCD patients with transfusion therapy showed considerably lower signal than that of controls. The main cause of marrow signal decrease in SCD patients with transfusion therapy was considered to be iron deposition due to repeated transfusion therapy rather than red marrow hyperplasia. (orig.)

  5. Iron deposition in cranial bone marrow with sickle cell disease: MR assessment using a fat suppression technique

    International Nuclear Information System (INIS)

    Kaneko, K.; Humbert, J.H.; Kogutt, M.S.; Robinson, A.E.

    1993-01-01

    Thirteen patients with sickle cell disease (SCD) undergoing transfusion therapy and 8 control patients were examined by magnetic resonance imaging to discriminate bone marrow change due to iron deposition from hematologic marrow hyperplasia. Using T1-weighted spin echo images, only two subjects showed extremely low signal intensity marrow compatible with iron deposition. However, using T2-weighted fast spin echo images with fat suppression, cranial bone marrow in SCD patients with transfusion therapy showed considerably lower signal than that of controls. The main cause of marrow signal decrease in SCD patients with transfusion therapy was considered to be iron deposition due to repeated transfusion therapy rather than red marrow hyperplasia. (orig.)

  6. Quantitative and Qualitative Analysis of Bone Marrow CD8(+) T Cells from Different Bones Uncovers a Major Contribution of the Bone Marrow in the Vertebrae.

    Science.gov (United States)

    Geerman, Sulima; Hickson, Sarah; Brasser, Giso; Pascutti, Maria Fernanda; Nolte, Martijn A

    2015-01-01

    Bone marrow (BM) plays an important role in the long-term maintenance of memory T cells. Yet, BM is found in numerous bones throughout the body, which are not equal in structure, as they differ in their ratio of cortical and trabecular bone. This implies that BM cells within different bones are subjected to different microenvironments, possibly leading to differences in their frequencies and function. To address this, we examined BM from murine tibia, femur, pelvis, sternum, radius, humerus, calvarium, and the vertebrae and analyzed the presence of effector memory (TEM), central memory (TCM), and naïve (TNV) CD8(+) T cells. During steady-state conditions, the frequency of the total CD8(+) T cell population was comparable between all bones. Interestingly, most CD8(+) T cells were located in the vertebrae, as it contained the highest amount of BM cells. Furthermore, the frequencies of TEM, TCM, and TNV cells were similar between all bones, with a majority of TNV cells. Additionally, CD8(+) T cells collected from different bones similarly expressed the key survival receptors IL-7Rα and IL-15Rβ. We also examined BM for memory CD8(+) T cells with a tissue-resident memory phenotype and observed that approximately half of all TEM cells expressed the retention marker CD69. Remarkably, in the memory phase of acute infection with the lymphocytic choriomeningitis virus (LCMV), we found a massive compositional change in the BM CD8(+) T cell population, as the TEM cells became the dominant subset at the cost of TNV cells. Analysis of Ki-67 expression established that these TEM cells were in a quiescent state. Finally, we detected higher frequencies of LCMV-specific CD8(+) T cells in BM compared to spleen and found that BM in its entirety contained fivefold more LCMV-specific CD8(+) T cells. In conclusion, although infection with LCMV caused a dramatic change in the BM CD8(+) T cell population, this did not result in noticeable differences between BM collected from different

  7. Minor histocompatibility antigens on transfused leukoreduced units of red blood cells induce bone marrow transplant rejection in a mouse model

    OpenAIRE

    Desmarets, Maxime; Cadwell, Chantel M.; Peterson, Kenneth R.; Neades, Renee; Zimring, James C.

    2009-01-01

    When successful, human leukocyte antigen (HLA)–matched bone marrow transplantation with reduced-intensity conditioning is a cure for several nonmalignant hematologic disorders that require chronic transfusion, such as sickle cell disease and aplastic anemia. However, there are unusually high bone marrow transplant (BMT) rejection rates in these patients. Rejection correlates with the number of transfusions before bone marrow transplantation, and it has been hypothesized that preimmunization t...

  8. Apoptosis of bone marrow leukemia cells in mice after low dose radiation at different time

    International Nuclear Information System (INIS)

    Li Guangyu; Yu Mingming; Li Xianjun; Liu Zhixiang

    2007-01-01

    Objective: To investigate the apoptosis of bone marrow leukemia cell in mice after low dose radiation (LDR) at different time and the experimental basis for LDR auxiliary therapy on leukemia. Methods: WEHI-3 cells were injected into BALB/c mice through tail veins to make an experimental mice model of myelornonocytic leukemia. 60 leukemia mice models were divided half-and half. 30 mice models in experimental group were irradiated with LDR of 75mGy at the same time while the others 30 in the control group were not. 6 mice models with LDR and 6 mice models without LDR would be killed at the time the 1st day, the 2nd day, the 3rd day, the 5th day- and the l0th day after LDR in order to extract bone marrow samples. The apoptosis percentage of leukemia cells in bone marrow was examined. Results: The apoptosis percentage of leukemia cells in experimental group was increasing after LDR and went to top on the 2nd day and the 3rd day. The apoptosis percentage of leukemia cells was remarkably different between experimental and control group, all P<0.05. Conclusion: LDR could significantly increase the apoptosis percentage of bone marrow leukemia cells in mice. Its mechanism is remarkably different in kill and wound of big dose radiation to tumour cells. It is probably related to of the increase immune exciting response as to promote some cytokine secretion, in leukemia mice. (authors)

  9. Spontaneous and induced chromosomal aberrations in bone marrow cells of mice of different strain and age

    Energy Technology Data Exchange (ETDEWEB)

    Lil' p, J.G.; Korogodina, Yu.V. (Akademiya Meditsinskikh Nauk SSSR, Moscow. Inst. Meditsinskoj Genetiki)

    1981-01-01

    The sensitivity of bone marrow cell chromosomes both to an alkylating agent thiophosphamide and ..gamma..-irradiation in 101/H, A/He, CBA, BALB/c and C57BL/6 aging mice has been studied. Changes in the sensitivity of bone marrow cell chromosomes with age are shown to depend both on mutagenic effect type and animal's genotype. The age dependent yield of chromosomal aberrations did not change in mice of all studied strains after ..gamma..-irradiation under conditions of our experiments. After the thiophosphamide effect, an increased sensitivity of bone marrow cell chromosomes was observed in the old 101/H, A/He and CBA mice as compared to the young ones. The level of induced chromosomal aberrations in C57BL/6 mice did not vary with age. Cells exhibiting multiple damages to chromosomes occurred in the bone marrow following the thiophosphamide effect. An increased sensitivity of old animals of certain strains resulted mainly from a sharp numerical growth of such cells. No increase in the number of cells in intact animals of all strains related to age dependent chromosomal structural damages was observed, whereas the accumulation of aneuploid cells probably depended on the genotype.

  10. Stromal cell-associated hematopoiesis: immortalization and characterization of a primate bone marrow-derived stromal cell line.

    Science.gov (United States)

    Paul, S R; Yang, Y C; Donahue, R E; Goldring, S; Williams, D A

    1991-04-15

    An elucidation of the interaction between the bone marrow microenvironment and hematopoietic stem cells is critical to the understanding of the molecular basis of stem cell self renewal and differentiation. This interaction is dependent, at least in part, on direct cell to cell contact or cellular adhesion to extracellular matrix proteins. Long-term bone marrow cultures (LTMC) provide an appropriate microenvironment for maintenance of primitive hematopoietic stem cells and a means of analyzing this stem cell-stromal cell interaction in vitro. Although LTMC have been successfully generated from murine and human bone marrow, only limited success has been reported in a primate system. In addition, few permanent stromal cell lines are available from nonmurine bone marrow. Because the primate has become a useful model for large animal bone marrow transplant studies and, more specifically, retroviral-mediated gene transfer analysis, we have generated immortalized bone marrow stromal cell lines from primate bone marrow using gene transfer of the Simian virus large T (SV40 LT) antigen. At least one stromal cell line has demonstrated the capacity to maintain early hematopoietic cells in long-term cultures for up to 4 weeks as measured by in vitro progenitor assays. Studies were undertaken to characterize the products of extracellular matrix biosynthesis and growth factor synthesis of this cell line, designated PU-34. In contrast to most murine bone marrow-derived stromal cell lines capable of supporting hematopoiesis in vitro that have been examined, the extracellular matrix produced by this primate cell line includes collagen types I, laminin. Growth factor production analyzed through RNA blot analysis, bone marrow cell culture data, and factor-dependent cell line proliferation assays includes interleukin-6 (IL-6), IL-7, granulocyte-macrophage colony-stimulating factor (GM-CSF), G-CSF, M-CSF, leukemia inhibitory factor, and a novel cytokine designated IL-11. This

  11. Bone Marrow Therapies for Chronic Heart Disease.

    Science.gov (United States)

    Behbahan, Iman Saramipoor; Keating, Armand; Gale, Robert Peter

    2015-11-01

    Chronic heart failure is a leading cause of death. The demand for new therapies and the potential regenerative capacity of bone marrow-derived cells has led to numerous clinical trials. We critically discuss current knowledge of the biology and clinical application of bone marrow cells. It appears unlikely that bone marrow cells can develop into functional cardiomyocyte after infusion but may have favorable paracrine effects. Most, but not all, clinical trials report a modest short- but not long-term benefit of infusing bone marrow-derived cells. Effect size appears to correlate with stringency of study-design: the most stringent trials report the smallest effect-sizes. We conclude there may be short- but not substantial long-term benefit of infusing bone marrow-derived cells into persons with chronic heart failure and any benefit observed is unlikely to result from trans-differentiation of bone marrow-derived cells into functioning cardiomyocytes. © 2015 AlphaMed Press.

  12. Special proliferative sites are not needed for seeding and proliferation of transfused bone marrow cells in normal syngeneic mice

    International Nuclear Information System (INIS)

    Brecher, G.; Ansell, J.D.; Micklem, H.S.; Tjio, J.H.; Cronkite, E.P.

    1982-01-01

    The widely held view that transfused bone marrow cells will not proliferate in normal mice, not exposed to irradiation or other forms of bone marrow ablation, was reinvestigated. Forty million bone marrow cells from male donors were given to female recipients on each of 5 consecutive days, 5 to 10 times the number customarily used in the past. When the recipients were examined 2-13 weeks after the last transfusion, donor cells were found to average 16-25% of total marrow cells. Similar percentages of donor cells were found when variants of the enzyme phosphoglycerate kinase determined electrophoretically were used for identification of donor and recipient cells. Evidence is presented that the proportion of donor cells is compatible with a nonlinear dependence on the number of cells transfused over the range tested - i.e., 20-200 million bone marrow cells injected intravenously. Special proliferative sites thus do not appear to be required

  13. Bone marrow mesenchymal stem cells repair spinal cord ischemia/reperfusion injury by promoting axonal growth and anti-autophagy.

    Science.gov (United States)

    Yin, Fei; Meng, Chunyang; Lu, Rifeng; Li, Lei; Zhang, Ying; Chen, Hao; Qin, Yonggang; Guo, Li

    2014-09-15

    Bone marrow mesenchymal stem cells can differentiate into neurons and astrocytes after transplantation in the spinal cord of rats with ischemia/reperfusion injury. Although bone marrow mesenchymal stem cells are known to protect against spinal cord ischemia/reperfusion injury through anti-apoptotic effects, the precise mechanisms remain unclear. In the present study, bone marrow mesenchymal stem cells were cultured and proliferated, then transplanted into rats with ischemia/reperfusion injury via retro-orbital injection. Immunohistochemistry and immunofluorescence with subsequent quantification revealed that the expression of the axonal regeneration marker, growth associated protein-43, and the neuronal marker, microtubule-associated protein 2, significantly increased in rats with bone marrow mesenchymal stem cell transplantation compared with those in rats with spinal cord ischemia/reperfusion injury. Furthermore, the expression of the autophagy marker, microtubule-associated protein light chain 3B, and Beclin 1, was significantly reduced in rats with the bone marrow mesenchymal stem cell transplantation compared with those in rats with spinal cord ischemia/reperfusion injury. Western blot analysis showed that the expression of growth associated protein-43 and neurofilament-H increased but light chain 3B and Beclin 1 decreased in rats with the bone marrow mesenchymal stem cell transplantation. Our results therefore suggest that bone marrow mesenchymal stem cell transplantation promotes neurite growth and regeneration and prevents autophagy. These responses may likely be mechanisms underlying the protective effect of bone marrow mesenchymal stem cells against spinal cord ischemia/reperfusion injury.

  14. Bone marrow mesenchymal stem cells repair spinal cord ischemia/reperfusion injury by promoting axonal growth and anti-autophagy

    Science.gov (United States)

    Yin, Fei; Meng, Chunyang; Lu, Rifeng; Li, Lei; Zhang, Ying; Chen, Hao; Qin, Yonggang; Guo, Li

    2014-01-01

    Bone marrow mesenchymal stem cells can differentiate into neurons and astrocytes after transplantation in the spinal cord of rats with ischemia/reperfusion injury. Although bone marrow mesenchymal stem cells are known to protect against spinal cord ischemia/reperfusion injury through anti-apoptotic effects, the precise mechanisms remain unclear. In the present study, bone marrow mesenchymal stem cells were cultured and proliferated, then transplanted into rats with ischemia/reperfusion injury via retro-orbital injection. Immunohistochemistry and immunofluorescence with subsequent quantification revealed that the expression of the axonal regeneration marker, growth associated protein-43, and the neuronal marker, microtubule-associated protein 2, significantly increased in rats with bone marrow mesenchymal stem cell transplantation compared with those in rats with spinal cord ischemia/reperfusion injury. Furthermore, the expression of the autophagy marker, microtubule-associated protein light chain 3B, and Beclin 1, was significantly reduced in rats with the bone marrow mesenchymal stem cell transplantation compared with those in rats with spinal cord ischemia/reperfusion injury. Western blot analysis showed that the expression of growth associated protein-43 and neurofilament-H increased but light chain 3B and Beclin 1 decreased in rats with the bone marrow mesenchymal stem cell transplantation. Our results therefore suggest that bone marrow mesenchymal stem cell transplantation promotes neurite growth and regeneration and prevents autophagy. These responses may likely be mechanisms underlying the protective effect of bone marrow mesenchymal stem cells against spinal cord ischemia/reperfusion injury. PMID:25374587

  15. Immunophenotypic Characterization of Human Bone Marrow Mast Cells. A Flow Cytometric Study of Normal and Pathological Bone Marrow Samples

    Directory of Open Access Journals (Sweden)

    Luis Escribano

    1998-01-01

    Full Text Available The goal of the present paper was to define the immunophenotype of bone marrow mast cells (BMMC from healthy controls and patients with hematologic malignancies (HM based on the use of multiple stainings with monoclonal antibodies analyzed by flow cytometry. Our results show that BMMC from both groups of individuals display a similar but heterogenous immunophenotype. The overall numbers of BMMC are higher in the HM group of individuals (p = 0.08. Three patterns of antigen expression were detected: (1 markers constantly positive in all cases analyzed (CD9, CD29, CD33, CD43, CD44, CD49d, CD49e, CD51, CD71, CD117, and FcεRI, (2 antigens that were constantly negative (CD1a, CD2, CD3, CD5, CD6, CD11a, CD14, CD15, CD16, CD19, CD20, CD21, CD23, CD25, CD30, CD34, CD38, CD41a, CD42b, CD65, CD66b, HLA-DR, and CD138, and (3 markers that were positive in a variable proportion of cases – CD11b (50%, CD11c (77%, CD13 (40%, CD18 (20%, CD22 (68%, CD35 (27%, CD40 (67%, CD54 (88% and CD61 (40%. In addition, BMMC from all cases explored were CD45+, and this antigen was expressed at an intensity similar to that of mature granulocytes.

  16. In vitro induction of alkaline phosphatase levels predicts in vivo bone forming capacity of human bone marrow stromal cells

    Directory of Open Access Journals (Sweden)

    Henk-Jan Prins

    2014-03-01

    Full Text Available One of the applications of bone marrow stromal cells (BMSCs that are produced by ex vivo expansion is for use in in vivo bone tissue engineering. Cultured stromal cells are a mixture of cells at different stages of commitment and expansion capability, leading to a heterogeneous cell population that each time can differ in the potential to form in vivo bone. A parameter that predicts for in vivo bone forming capacity is thus far lacking. We employed single colony-derived BMSC cultures to identify such predictive parameters. Using limiting dilution, we have produced sixteen single CFU-F derived BMSC cultures from human bone marrow and found that only five of these formed bone in vivo. The single colony-derived BMSC strains were tested for proliferation, osteogenic-, adipogenic- and chondrogenic differentiation capacity and the expression of a variety of associated markers. The only robust predictors of in vivo bone forming capacity were the induction of alkaline phosphatase, (ALP mRNA levels and ALP activity during in vitro osteogenic differentiation. The predictive value of in vitro ALP induction was confirmed by analyzing “bulk-cultured” BMSCs from various bone marrow biopsies. Our findings show that in BMSCs, the additional increase in ALP levels over basal levels during in vitro osteogenic differentiation is predictive of in vivo performance.

  17. Legumain Regulates Differentiation Fate of Human Bone Marrow Stromal Cells and Is Altered in Postmenopausal Osteoporosis

    DEFF Research Database (Denmark)

    Jafari Kermani, Abbas; Qanie, Diyako; Andersen, Thomas L

    2017-01-01

    and that its expression level and cellular localization are altered in postmenopausal osteoporotic patients. As shown by genetic and pharmacological manipulation, legumain inhibited osteoblast (OB) differentiation and in vivo bone formation through degradation of the bone matrix protein fibronectin....... In addition, genetic ablation or pharmacological inhibition of legumain activity led to precocious OB differentiation and increased vertebral mineralization in zebrafish. Finally, we show that localized increased expression of legumain in bone marrow adipocytes was inversely correlated with adjacent......Secreted factors are a key component of stem cell niche and their dysregulation compromises stem cell function. Legumain is a secreted cysteine protease involved in diverse biological processes. Here, we demonstrate that legumain regulates lineage commitment of human bone marrow stromal cells...

  18. Daily variation in radiosensitivity of circulating blood cells and bone marrow cell density in mice

    International Nuclear Information System (INIS)

    Tabatabai, R.N.

    1984-01-01

    Mice on a 12/12 light/dark cycle were bled during a twenty-four hour period each week for eight weeks to establish daily values of circulating blood cells. No significant daily variation was found in total red blood cells, hematocrit, or percentage of reticulocytes. A significant (P < 0.001) daily variation was found in total white blood cells, with the minimum occurring at 8 PM and the maximum occurring during the daylight hours from 8 a.m. to 2 p.m. Mice were then exposed to 0 R, 20 R, 50 R, or 100 R of x-radiation to determine what dose significantly reduces the total white cell count in circulating blood. It was found that 100 R significantly (P < .05) reduces the total white cell count over a four week period post-exposure. To determine if circulating blood cells and bone marrow cells show a diurnal radiosensitivity, mice were exposed to 100 R or 200 R of x-radiation at noon or midnight. Hematocrits, reticulocyte and white blood cell counts, daily white blood cell rhythm, and bone marrow cell density indicate that these mice were more radiosensitive at night

  19. PCR-positivity in harvested bone marrow predicts relapse after transplantation with autologous purged bone marrow in children in second remission of precursor B-cell acute leukaemia

    NARCIS (Netherlands)

    Vervoordeldonk, S. F.; Merle, P. A.; Behrendt, H.; Steenbergen, E. J.; van den Berg, H.; van Wering, E. R.; von dem Borne, A. E.; van der Schoot, C. E.; van Leeuwen, E. F.; Slaper-Cortenbach, I. C.

    1997-01-01

    Purging of autologous bone marrow (BM) grafts of children in second remission after a relapse of precursor B acute lymphoblastic leukaemia (ALL) in the BM has been carried out in our laboratory since 1987, initially by complement mediated cell lysis. This protocol was extended by performing an

  20. Neural Crest Cells Isolated from the Bone Marrow of Transgenic Mice Express JCV T-Antigen.

    Directory of Open Access Journals (Sweden)

    Jennifer Gordon

    Full Text Available JC virus (JCV, a common human polyomavirus, is the etiological agent of the demyelinating disease, progressive multifocal leukoencephalopathy (PML. In addition to its role in PML, studies have demonstrated the transforming ability of the JCV early protein, T-antigen, and its association with some human cancers. JCV infection occurs in childhood and latent virus is thought to be maintained within the bone marrow, which harbors cells of hematopoietic and non-hematopoietic lineages. Here we show that non-hematopoietic mesenchymal stem cells (MSCs isolated from the bone marrow of JCV T-antigen transgenic mice give rise to JCV T-antigen positive cells when cultured under neural conditions. JCV T-antigen positive cells exhibited neural crest characteristics and demonstrated p75, SOX-10 and nestin positivity. When cultured in conditions typical for mesenchymal cells, a population of T-antigen negative cells, which did not express neural crest markers arose from the MSCs. JCV T-antigen positive cells could be cultured long-term while maintaining their neural crest characteristics. When these cells were induced to differentiate into neural crest derivatives, JCV T-antigen was downregulated in cells differentiating into bone and maintained in glial cells expressing GFAP and S100. We conclude that JCV T-antigen can be stably expressed within a fraction of bone marrow cells differentiating along the neural crest/glial lineage when cultured in vitro. These findings identify a cell population within the bone marrow permissible for JCV early gene expression suggesting the possibility that these cells could support persistent viral infection and thus provide clues toward understanding the role of the bone marrow in JCV latency and reactivation. Further, our data provides an excellent experimental model system for studying the cell-type specificity of JCV T-antigen expression, the role of bone marrow-derived stem cells in the pathogenesis of JCV-related diseases

  1. Long bone nonunions treated with autologous concentrated bone marrow-derived cells combined with dried bone allograft.

    Science.gov (United States)

    Scaglione, M; Fabbri, L; Dell'Omo, D; Gambini, F; Guido, G

    2014-08-01

    Nowadays the treatment of long bone nonunion continues to be one of the most complex and debated topics due to the large number of failures. For several years, in the relevant literature three factors have been considered essential in the healing process: growth factors and hormones, osteoprogenitor cells (mesenchymal stem cells), and extracellular matrix. The mechanical stability of the fracture site is considered the fourth element of the "Diamond concept theory." The aim of our study was to evaluate the validity of biological adjuvants of mechanical synthesis allowing a faster healing process of nonunions. We dealt with 19 patients with long bone nonunion. All patients have been treated with concentrated mesenchymal stem cells without bone autologous transplant. We used the Extracell BMC-marrow aspirate protocol of Regen Lab. The radiographic parameters taken into account for the diagnosis of successful healing were the presence of a bridge callus, obliteration of the fracture line and bone cortical continuity. Clinically, the pain was investigated with VAS score (visual analogue scale), where zero means no pain and 10 the worst possible pain. Radiographic investigation shows complete healing in 78.9 % (15 cases) with an average time to healing of 6.5 months (minimum healing time 80 days) corresponding also in complete remission of clinical symptoms. The use of growth factors and autologous mesenchymal stem cells through the enforcement of system for tissue regeneration is a valid and innovative biotechnology technique for the treatment long bone nonunions.

  2. Biological conduits combining bone marrow mesenchymal stem cells and extracellular matrix to treat long-segment sciatic nerve defects

    Directory of Open Access Journals (Sweden)

    Yang Wang

    2015-01-01

    Full Text Available The transplantation of polylactic glycolic acid conduits combining bone marrow mesenchymal stem cells and extracellular matrix gel for the repair of sciatic nerve injury is effective in some respects, but few data comparing the biomechanical factors related to the sciatic nerve are available. In the present study, rabbit models of 10-mm sciatic nerve defects were prepared. The rabbit models were repaired with autologous nerve, a polylactic glycolic acid conduit + bone marrow mesenchymal stem cells, or a polylactic glycolic acid conduit + bone marrow mesenchymal stem cells + extracellular matrix gel. After 24 weeks, mechanical testing was performed to determine the stress relaxation and creep parameters. Following sciatic nerve injury, the magnitudes of the stress decrease and strain increase at 7,200 seconds were largest in the polylactic glycolic acid conduit + bone marrow mesenchymal stem cells + extracellular matrix gel group, followed by the polylactic glycolic acid conduit + bone marrow mesenchymal stem cells group, and then the autologous nerve group. Hematoxylin-eosin staining demonstrated that compared with the polylactic glycolic acid conduit + bone marrow mesenchymal stem cells group and the autologous nerve group, a more complete sciatic nerve regeneration was found, including good myelination, regularly arranged nerve fibers, and a completely degraded and resorbed conduit, in the polylactic glycolic acid conduit + bone marrow mesenchymal stem cells + extracellular matrix gel group. These results indicate that bridging 10-mm sciatic nerve defects with a polylactic glycolic acid conduit + bone marrow mesenchymal stem cells + extracellular matrix gel construct increases the stress relaxation under a constant strain, reducing anastomotic tension. Large elongations under a constant physiological load can limit the anastomotic opening and shift, which is beneficial for the regeneration and functional reconstruction of sciatic nerve. Better

  3. Bone marrow biopsy in diffuse large B-cell lymphoma : Useful or redundant test?

    NARCIS (Netherlands)

    Adams, Hugo J A; De Klerk, John M H; Fijnheer, Rob; Heggelman, Ben G F; Dubois, Stefan V.; Nievelstein, Rutger A J; Kwee, Thomas C.

    2015-01-01

    Purpose. To determine the additional value of bone marrow biopsy (BMB) in the standard staging work-up of patients with newly diagnosed diffuse large B-cell lymphoma (DLBCL), in terms of risk assessment and treatment planning. Material and methods. A total of 113 consecutive patients with newly

  4. Autologous Bone Marrow-Derived Stem Cells in Spinal Cord Injury.

    Science.gov (United States)

    Bansal, Himanshu; Verma, Poonam; Agrawal, Anupama; Leon, Jerry; Sundell, I Birgitta; Koka, Prasad S

    Spinal cord injury is a traumatic neurological condition which makes the patient disable. Its management still remains challenging but advancements in the regenerative medicine have changed the approach of treating this serious debilitating condition of the central nervous system. Cell based therapies can restore function in spinal cord injury by replacing the lost neural tissue. These therapies also rejuvenate the existing intact neurons by facilitating remyelination and by repairing and reducing progressive tissue damage and scarring. Autologous bone marrow stem cells were collected from the patients. 5 ml of the processed sample was injected back into the patients via lumbar puncture at L1/L2 level. The bone marrow harvesting and administration was repeated every 4 weeks 3 times (12 weeks). Significant improvements were noticed following the injections into the patients with the duration of injury less than 6 months. ASIA grade improvements were observed in 6 out of 10 patients. VTC and walking, at least with the support, was restored in eight patients. Bladder control and sexual functions improved in three and five patients respectively. Eight patients exhibited decreased spasticity. We believe that autologous bone marrow stem cells contributed towards the neuroplaticity and/or paracrine effect due to which we observed the considerable improvements in the conditions of the patients. This preliminary proof of patient improvement reinforces the potential of autologous bone marrow stem cell treatment in the patients suffering from Spinal Cord Injury. Although the results are encouraging further studies are needed to substantiate the claims.

  5. Frequency of polyploid cells in the bone marrow of rats fed irradiated wheat

    International Nuclear Information System (INIS)

    George, K.P.; Chaubey, R.C.; Sundaram, K.; Gopal-Ayengar, A.R.

    1976-01-01

    Diets containing different proportions of non-irradiated or irradiated wheat were fed to Wistar rats for 1 or 6 wk. Cytological analysis of the bone marrow showed no significant difference in the frequency of polyploid cells in the rats fed non-irradiated or irradiated wheat diets, even when the treated wheat was fed to the rats within 24 hr of irradiation. (author)

  6. Intrathecal application of autologous bone marrow cell preparations in parkinsonian syndromes

    DEFF Research Database (Denmark)

    Storch, Alexander; Csoti, Ilona; Eggert, Karla

    2012-01-01

    A growing number of patients is treated with intrathecal application of autologous bone marrow cells (aBMCs), but clinical data are completely lacking in movement disorders. We provide first clinical data on efficacy and safety of this highly experimental treatment approach in parkinsonian...

  7. Effects of peripheral stem cell or bone marrow reinfusion on peripheral serotonin metabolism

    NARCIS (Netherlands)

    Wymenga, ANM; van der Graaf, WTA; Kema, IP; Sibinga, CTS; de Vries, EGE; Mulder, NH

    1999-01-01

    Reinfusion of autologous hematopoietic peripheral blood stem cells (PBSC) or bone marrow is often accompanied by flushing, dyspnea, abdominal cramping, nausea and diarrhea. These symptoms and the observation that they can be prevented by ondansetron, a selective 5-HT3 receptor antagonist, led to the

  8. Immunomodulatory properties of oat and barley β-glucan populations on bone marrow derived dendritic cells

    NARCIS (Netherlands)

    Rosch, Christiane; Meijerink, Marjolein; Delahaije, Roy J.B.M.; Taverne, Nico; Gruppen, Harry; Wells, Jerry M.; Schols, Henk A.

    2016-01-01

    Specific structures of oat and barley β(1,3)(1,4)-glucans induced different in vitro immunomodulatory effects in bone marrow derived dendritic cells (BMDC) from TLR2/4 knock out mice. All barley β-glucan fractions induced larger amounts of cytokines in BMDCs than their oat equivalents. The

  9. Characterization and comparison of canine multipotent stromal cells derived from liver and bone marrow

    NARCIS (Netherlands)

    Malagola, Ermanno; Teunissen, Michelle; van der Laan, Luc J W; Verstegen, Monique; Schotanus, Baukje Akke; van Steenbeek, Frank G; Penning, Louis C; van Wolferen, Monique E; Tryfonidou, Marianna A; Spee, Bart

    2016-01-01

    Liver-derived multipotent stromal cells (L-MSCs) may prove preferable for treatment strategies of liver diseases, in comparison to the widely studied bone marrow-derived MSCs (BM-MSCs). Canines are a large animal model, in which the pathologies of liver diseases is similar to man. This study further

  10. Enhanced adipogenic differentiation of bovine bone marrow-derived mesenchymal stem cells

    Science.gov (United States)

    Until now, the isolation and characterization of bovine bone marrow-derived mesenchymal stem cells (bBM-MSCs) have not been established, which prompted us to optimize the differentiation protocol for bBM-MSCs. In this study, bBM-MSCs were freshly isolated from three 6-month-old cattle and used for p...

  11. Genotoxicity of copper oxide nanoparticles with different surface chemistry on rat bone marrow mesenchymal stem cells

    DEFF Research Database (Denmark)

    Zhang, Wenjing; Jiang, Pengfei; Chen, Wei

    2016-01-01

    The surface chemistry of nanoparticles (NPs) is one of the critical factors determining their cellular responses. In this study, the cytotoxicity and genotoxicity of copper oxide (CuO) NPs with a similar size but different surface chemistry to rat bone marrow mesenchymal stem cells (MSCs) were in...

  12. Isolation and characterization of mesenchymal stem cell population entrapped in bone marrow collection sets

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, J.; Hrubá, A.; Velebný, V.; Kubala, Lukáš

    2008-01-01

    Roč. 32, č. 9 (2008), s. 1116-1125 ISSN 1065-6995 R&D Projects: GA ČR(CZ) GA305/08/1704 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : bone marrow * cell isolation * differentiation Subject RIV: BO - Biophysics Impact factor: 1.619, year: 2008

  13. Endogenous GAS6 and Mer receptor signaling regulate prostate cancer stem cells in bone marrow.

    Science.gov (United States)

    Jung, Younghun; Decker, Ann M; Wang, Jingcheng; Lee, Eunsohl; Kana, Lulia A; Yumoto, Kenji; Cackowski, Frank C; Rhee, James; Carmeliet, Peter; Buttitta, Laura; Morgan, Todd M; Taichman, Russell S

    2016-05-03

    GAS6 and its receptors (Tryo 3, Axl, Mer or "TAM") are known to play a role in regulating tumor progression in a number of settings. Previously we have demonstrated that GAS6 signaling regulates invasion, proliferation, chemotherapy-induced apoptosis of prostate cancer (PCa) cells. We have also demonstrated that GAS6 secreted from osteoblasts in the bone marrow environment plays a critical role in establishing prostate tumor cell dormancy. Here we investigated the role that endogenous GAS6 and Mer receptor signaling plays in establishing prostate cancer stem cells in the bone marrow microenvironment.We first observed that high levels of endogenous GAS6 are expressed by disseminated tumor cells (DTCs) in the bone marrow, whereas relatively low levels of endogenous GAS6 are expressed in PCa tumors grown in a s.c. Interestingly, elevated levels of endogenous GAS6 were identified in putative cancer stem cells (CSCs, CD133+/CD44+) compared to non-CSCs (CD133-/CD44-) isolated from PCa/osteoblast cocultures in vitro and in DTCs isolated from the bone marrow 24 hours after intracardiac injection. Moreover, we found that endogenous GAS6 expression is associated with Mer receptor expression in growth arrested (G1) PCa cells, which correlates with the increase of the CSC populations. Importantly, we found that overexpression of GAS6 activates phosphorylation of Mer receptor signaling and subsequent induction of the CSC phenotype in vitro and in vivo.Together these data suggest that endogenous GAS6 and Mer receptor signaling contribute to the establishment of PCa CSCs in the bone marrow microenvironment, which may have important implications for targeting metastatic disease.

  14. Proliferation differentiation and therapeutic effect of short-term cultured murine bone marrow cells

    International Nuclear Information System (INIS)

    Zhao Zekun; Cong Jianbo

    1986-01-01

    Murine bone marrow cells were cultured in conditioned medium of muscle. After 24 hours of culture, both adherent and suspended cells appeared in the culture. The adherent cells mainly consisted of macrophages and the suspended cells were predominantly granulocytes. After 6 days, the total number of nucleated cells and CFU-C in the culture increased about 400% and 600% respectively, but CFU-S reduced to 21% approximately. Lymphocytes persisted only for 4 days. The stem cells (CFU-S) from 6-day culture were injected into the lethally irradiated syngenic mice. The 30 day survival rate of the treated mice was 89% whereas that of the controls was only 7%. The bone marrow cells in 2/8 of recipients sacrificed at 30 or 60 days were of donor type and 6/8 of the recipients were chimeras

  15. Breast Cancer Cell Colonization of the Human Bone Marrow Adipose Tissue Niche

    Directory of Open Access Journals (Sweden)

    Zach S. Templeton

    2015-12-01

    Full Text Available BACKGROUND/OBJECTIVES: Bone is a preferred site of breast cancer metastasis, suggesting the presence of tissue-specific features that attract and promote the outgrowth of breast cancer cells. We sought to identify parameters of human bone tissue associated with breast cancer cell osteotropism and colonization in the metastatic niche. METHODS: Migration and colonization patterns of MDA-MB-231-fLuc-EGFP (luciferase-enhanced green fluorescence protein and MCF-7-fLuc-EGFP breast cancer cells were studied in co-culture with cancellous bone tissue fragments isolated from 14 hip arthroplasties. Breast cancer cell migration into tissues and toward tissue-conditioned medium was measured in Transwell migration chambers using bioluminescence imaging and analyzed as a function of secreted factors measured by multiplex immunoassay. Patterns of breast cancer cell colonization were evaluated with fluorescence microscopy and immunohistochemistry. RESULTS: Enhanced MDA-MB-231-fLuc-EGFP breast cancer cell migration to bone-conditioned versus control medium was observed in 12/14 specimens (P = .0014 and correlated significantly with increasing levels of the adipokines/cytokines leptin (P = .006 and IL-1β (P = .001 in univariate and multivariate regression analyses. Fluorescence microscopy and immunohistochemistry of fragments underscored the extreme adiposity of adult human bone tissues and revealed extensive breast cancer cell colonization within the marrow adipose tissue compartment. CONCLUSIONS: Our results show that breast cancer cells migrate to human bone tissue-conditioned medium in association with increasing levels of leptin and IL-1β, and colonize the bone marrow adipose tissue compartment of cultured fragments. Bone marrow adipose tissue and its molecular signals may be important but understudied components of the breast cancer metastatic niche.

  16. Bone marrow cell migration to the heart in a chimeric mouse model of acute chagasic disease

    Directory of Open Access Journals (Sweden)

    Camila Iansen Irion

    Full Text Available BACKGROUND Chagas disease is a public health problem caused by infection with the protozoan Trypanosoma cruzi. There is currently no effective therapy for Chagas disease. Although there is some evidence for the beneficial effect of bone marrow-derived cells in chagasic disease, the mechanisms underlying their effects in the heart are unknown. Reports have suggested that bone marrow cells are recruited to the chagasic heart; however, studies using chimeric mouse models of chagasic cardiomyopathy are rare. OBJECTIVES The aim of this study was to investigate the migration of bone marrow cells to the heart after T. cruzi infection in a model of chagasic disease in chimeric mice. METHODS To obtain chimerical mice, wild-type (WT C57BL6 mice were exposed to full body irradiation (7 Gy, causing bone marrow ablation. Then, bone marrow cells from green fluorescent protein (GFP-transgenic mice were infused into the mice. Graft effectiveness was confirmed by flow cytometry. Experimental mice were divided into four groups: (i infected chimeric (iChim mice; (ii infected WT (iWT mice, both of which received 3 × 104 trypomastigotes of the Brazil strain; (iii non-infected chimeric (Chim mice; and (iv non-infected WT mice. FINDINGS At one-month post-infection, iChim and iWT mice showed first degree atrioventricular block with decreased heart rate and treadmill exercise parameters compared to those in the non-infected groups. MAIN CONCLUSIONS iChim mice showed an increase in parasitaemia, myocarditis, and the presence of amastigote nests in the heart tissue compared to iWT mice. Flow cytometry analysis did not detect haematopoietic progenitor cells in the hearts of infected mice. Furthermore, GFP+ cardiomyocytes were not detected in the tissues of chimeric mice.

  17. Bone marrow cell migration to the heart in a chimeric mouse model of acute chagasic disease

    Science.gov (United States)

    Irion, Camila Iansen; Paredes, Bruno Diaz; Brasil, Guilherme Visconde; da Cunha, Sandro Torrentes; Paula, Luis Felipe; Carvalho, Alysson Roncally; de Carvalho, Antonio Carlos Campos; Carvalho, Adriana Bastos; Goldenberg, Regina Coeli dos Santos

    2017-01-01

    BACKGROUND Chagas disease is a public health problem caused by infection with the protozoan Trypanosoma cruzi. There is currently no effective therapy for Chagas disease. Although there is some evidence for the beneficial effect of bone marrow-derived cells in chagasic disease, the mechanisms underlying their effects in the heart are unknown. Reports have suggested that bone marrow cells are recruited to the chagasic heart; however, studies using chimeric mouse models of chagasic cardiomyopathy are rare. OBJECTIVES The aim of this study was to investigate the migration of bone marrow cells to the heart after T. cruzi infection in a model of chagasic disease in chimeric mice. METHODS To obtain chimerical mice, wild-type (WT) C57BL6 mice were exposed to full body irradiation (7 Gy), causing bone marrow ablation. Then, bone marrow cells from green fluorescent protein (GFP)-transgenic mice were infused into the mice. Graft effectiveness was confirmed by flow cytometry. Experimental mice were divided into four groups: (i) infected chimeric (iChim) mice; (ii) infected WT (iWT) mice, both of which received 3 × 104 trypomastigotes of the Brazil strain; (iii) non-infected chimeric (Chim) mice; and (iv) non-infected WT mice. FINDINGS At one-month post-infection, iChim and iWT mice showed first degree atrioventricular block with decreased heart rate and treadmill exercise parameters compared to those in the non-infected groups. MAIN CONCLUSIONS iChim mice showed an increase in parasitaemia, myocarditis, and the presence of amastigote nests in the heart tissue compared to iWT mice. Flow cytometry analysis did not detect haematopoietic progenitor cells in the hearts of infected mice. Furthermore, GFP+ cardiomyocytes were not detected in the tissues of chimeric mice. PMID:28767980

  18. Mesenchymal Stem Cells in Perichondrium Express Activated Leukocyte Cell Adhesion Molecule and Participate in Bone Marrow Formation

    Science.gov (United States)

    Arai, Fumio; Ohneda, Osamu; Miyamoto, Takeshi; Zhang, Xiu Qin; Suda, Toshio

    2002-01-01

    Perichondrium in fetal limb is composed of undifferentiated mesenchymal cells. However, the multipotency of cells in this region and the role of perichondrium in bone marrow formation are not well understood. In this report, we purified and characterized perichondrial cells using a monoclonal antibody against activated leukocyte cell adhesion molecule (ALCAM) and investigated the role of perichondrial cells in hematopoietic bone marrow formation. ALCAM is expressed on hematopoietic cells, endothelial cells, bone marrow stromal cells, and mesenchymal stem cells and mediates homophilic (ALCAM–ALCAM)/heterophilic (ALCAM-CD6) cell adhesion. Here we show by immunohistochemical staining that ALCAM is expressed in perichondrium. ALCAM+ perichondrial cells isolated by FACS® exhibit the characteristics of mesenchymal stem cells. ALCAM+ cells can differentiate into osteoblasts, adipocytes, chondrocytes, and stromal cells, which can support osteoclastogenesis, hematopoiesis, and angiogenesis. Furthermore, the addition of ALCAM-Fc or CD6-Fc to the metatarsal culture, the invasion of the blood vessels to a cartilage was inhibited. Our findings indicate that ALCAM+ perichondrial cells participate in vascular invasion by recruiting osteoclasts and vessels. These findings suggest that perichondrium might serve as a stem cell reservoir and play an important role in the early development of a bone and bone marrow. PMID:12070283

  19. Bone marrow transplantation

    International Nuclear Information System (INIS)

    Storb, R.; Santos, G.W.

    1979-01-01

    Bone marrow transplantation has been increasingly used to treat patients with severe combined immunodeficiency diseases, severe aplastic anemia, and malignant hematologic diseases, especially leukemia. At the Workshop a number of problems were discussed, e.g., conditioning regimens aimed at overcoming the problem of marrow graft rejection and reducing the incidence of recurrent leukemia, prevention of graft-versus-host disease (GVHD), possible mechanisms involved in stable graft-host tolerance, graft-versus-leukemia effect in mice, and finally, the possible use of autologous marrow transplantation

  20. Bone Marrow-Derived Cells as a Therapeutic Approach to Optic Nerve Diseases

    Directory of Open Access Journals (Sweden)

    Louise A. Mesentier-Louro

    2016-01-01

    Full Text Available Following optic nerve injury associated with acute or progressive diseases, retinal ganglion cells (RGCs of adult mammals degenerate and undergo apoptosis. These diseases have limited therapeutic options, due to the low inherent capacity of RGCs to regenerate and due to the inhibitory milieu of the central nervous system. Among the numerous treatment approaches investigated to stimulate neuronal survival and axonal extension, cell transplantation emerges as a promising option. This review focuses on cell therapies with bone marrow mononuclear cells and bone marrow-derived mesenchymal stem cells, which have shown positive therapeutic effects in animal models of optic neuropathies. Different aspects of available preclinical studies are analyzed, including cell distribution, potential doses, routes of administration, and mechanisms of action. Finally, published and ongoing clinical trials are summarized.

  1. Aging of marrow stromal (skeletal) stem cells and their contribution to age-related bone loss

    DEFF Research Database (Denmark)

    Bellantuono, Ilaria; Aldahmash, Abdullah; Kassem, Moustapha

    2009-01-01

    Marrow stromal cells (MSC) are thought to be stem cells with osteogenic potential and therefore responsible for the repair and maintenance of the skeleton. Age related bone loss is one of the most prevalent diseases in the elder population. It is controversial whether MSC undergo a process of aging...... in vivo, leading to decreased ability to form and maintain bone homeostasis with age. In this review we summarize evidence of MSC involvement in age related bone loss and suggest new emerging targets for intervention....

  2. Stromal cell migration precedes hemopoietic repopulation of the bone marrow after irradiation

    International Nuclear Information System (INIS)

    Werts, E.D.; Gibson, D.P.; Knapp, S.A.; DeGowin, R.L.

    1980-01-01

    Circulation of hemopoietic stem cells into an irradiated site has been thoroughly documented, but migration of stromal cells to repair radiation damage has not. We determined the radiosensitivity of mouse bone marrow stroma and evaluated stromal and hemopoietic repopulation in x-irradiated marrow. The D 0 for growth of colonies of marrow stromal cells (MSC) was 215 to 230 rad. Total-body irradiation (TB) obliterated marrow stromal and hemopoietic cells within 3 days. In contrast, 1 day after 1000 rad leg irradiation (LI), MSC rose to 80% of normal, but fell to 34% by 3 days and recovered to 72% by 30 days. However, femoral nucleated cells diminished to 20% by 3 days and recovered to 74% of normal by 30 days. Likewise, differentiated marrow cells and hemopoietic stem cells were initially depleted. With 1000 rad LI followed 3 h later by 1000 rad to the body while shielding the leg, MSC and femoral nucleated cells recovered to values intermediate between 1000 rad TB and 1000 rad LI. We concluded that: (1) the D 0 for MSC was 215 to 230 rad, (2) stromal repopulation preceded hemopoietic recovery, and (3) immigration of stromal cells from an unirradiated sanctuary facilitated hemopoietic repopulation of a heavily irradiated site

  3. Bone marrow aspiration

    Science.gov (United States)

    Bain, B

    2001-01-01

    Bone marrow aspiration biopsies are carried out principally to permit cytological assessment but also for immunophenotypic, cytogenetic, molecular genetic, and other specialised investigations. Often, a trephine biopsy is carried out as part of the same procedure. Bone marrow aspirations should be carried out by trained individuals who are aware of the indications, contraindications, and hazards of the procedure. They should follow a standard operating procedure. The operator should have made an adequate assessment of clinical and haematological features to ensure both that appropriate indications exist and that all relevant tests are performed. For the patient's comfort and safety, the posterior iliac crest is generally the preferred site of aspiration. Films of aspirated marrow and, when appropriate, films of crushed particles should be made and labelled. Once thoroughly dry, films should be fixed and stained. As a minimum, a Romanowsky stain and a Perls' stain are required. A cover slip should be applied. The bone marrow films should be assessed and reported in a systematic manner so that nothing of importance is overlooked, using a low power, then intermediate, then high power objective. A differential count should be performed. An interpretation of the findings, in the light of the clinical and haematological features, should be given. The report should be signed or computer authorised, using a secure password, and issued in a timely manner. Key Words: bone marrow aspirate • haematological diagnosis PMID:11533068

  4. Adipose Stem Cells as Alternatives for Bone Marrow Mesenchymal Stem Cells in Oral Ulcer Healing

    Science.gov (United States)

    Aziz Aly, Lobna Abdel; Menoufy, Hala El-; Ragae, Alyaa; Rashed, Laila Ahmed; Sabry, Dina

    2012-01-01

    Background and Objectives Adipose tissue is now recognized as an accessible, abundant, and reliable site for the isolation of adult stem cells suitable for tissue engineering and regenerative medicine applications. Methods and Results Oral ulcers were induced by topical application of formocresol in the oral cavity of dogs. Transplantation of undifferentiated GFP-labeled Autologous Bone Marrow Stem Cell (BMSCs), Adipose Derived Stem Cell (ADSCs) or vehicle (saline) was injected around the ulcer in each group. The healing process of the ulcer was monitored clinically and histopathologically. Gene expression of vascular endothelial growth factor (VEGF) was detected in MSCs by Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Expression of VEGF and collagen genes was detected in biopsies from all ulcers. Results: MSCs expressed mRNA for VEGF MSCs transplantation significantly accelerated oral ulcer healing compared with controls. There was increased expression of both collagen and VEGF genes in MSCs-treated ulcers compared to controls. Conclusions MSCs transplantation may help to accelerate oral ulcer healing, possibly through the induction of angiogenesis by VEGF together with increased intracellular matrix formation as detected by increased collagen gene expression. This body of work has provided evidence supporting clinical applications of adipose-derived cells in safety and efficacy trials as an alternative for bone marrow mesenchymal stem cells in oral ulcer healing. PMID:24298363

  5. Use of Bone Marrow derived Stem Cells in patients with Cardiovascular Disorders

    OpenAIRE

    Abraham S; Naveen AT; Kirtivasan V; Prasad GN; Karthik Vaidyanathan; Rajesh V; Madhusankar N; Cherian KM

    2007-01-01

    Patients with end stage heart failure have very few treatment options. The long waiting times for transplant and the complications associated with immunosuppression has led to the search for alternatives. Subsequent to the isolation and characterization of stem cells, tremendous advances have been made and the safety and feasibility of autologous bone marrow derived stem cells has been proven in preclinical studies. Clinical studies have also shown mobilized cells repair the infracted heart, ...

  6. The effect of thymus cells on bone marrow transplants into sublethally irradiated mice

    International Nuclear Information System (INIS)

    Kruszewski, J.A.; Szcylik, C.; Wiktor-Jedrzejczak, W.

    1984-01-01

    Bone marrow cells formed similar numbers of 10-days spleen colonies in sublethally (6 Gy) irradiated C57B1/6 mice as in lethally (7.5 Gy) irradiated mice i.e. approximately 20 per 10 5 cells. Numbers of 10 day endogenous spleen colonies in sublethally irradiated mice (0.2 to 0.6 per spleen) did not differ significantly from the numbers in lethally irradiated mice. Yet, transplants of 10 7 coisogenic marrow cells into sublethally irradiated mice resulted in predominantly endogenous recovery of granulocyte system as evidenced by utilization of ''beige'' marker for transplanted cells. Nevertheless, transplanted cells engrafted into sublethally irradiated mice were present in their hemopoietic tissues throughout the observation period of 2 months never exceeding 5 to 10% of cells. Thymus cells stimulated endogenous and exogenous spleen colony formation as well as endogenous granulopoietic recovery. Additionally, they increased both the frequency and absolute numbers of graft-derived granulocytic cells in hemopoietic organs of transplanted mice. They failed, however, to essentially change the quantitative relationships between endogenous and exogenous hemopoietic recovery. These results may suggest that spleen colony studies are not suitable for prediction of events following bone marrow transplant into sublethally irradiated mice. Simultaneously, they have strengthened the necessity for appropriate conditioning of recipients of marrow transplants. (orig.) [de

  7. Culturing bone marrow cells with dexamethasone and ascorbic acid improves osteogenic cell sheet structure.

    Science.gov (United States)

    Akahane, M; Shimizu, T; Kira, T; Onishi, T; Uchihara, Y; Imamura, T; Tanaka, Y

    2016-11-01

    To assess the structure and extracellular matrix molecule expression of osteogenic cell sheets created via culture in medium with both dexamethasone (Dex) and ascorbic acid phosphate (AscP) compared either Dex or AscP alone. Osteogenic cell sheets were prepared by culturing rat bone marrow stromal cells in a minimal essential medium (MEM), MEM with AscP, MEM with Dex, and MEM with Dex and AscP (Dex/AscP). The cell number and messenger (m)RNA expression were assessed in vitro, and the appearance of the cell sheets was observed after mechanical retrieval using a scraper. β-tricalcium phosphate (β-TCP) was then wrapped with the cell sheets from the four different groups and subcutaneously implanted into rats. After mechanical retrieval, the osteogenic cell sheets from the MEM, MEM with AscP, and MEM with Dex groups appeared to be fragmented or incomplete structures. The cell sheets cultured with Dex/AscP remained intact after mechanical retrieval, without any identifiable tears. Culture with Dex/AscP increased the mRNA and protein expression of extracellular matrix proteins and cell number compared with those of the other three groups. More bridging bone formation was observed after transplantation of the β-TCP scaffold wrapped with cell sheets cultured with Dex/AscP, than in the other groups. These results suggest that culture with Dex/AscP improves the mechanical integrity of the osteogenic cell sheets, allowing retrieval of the confluent cells in a single cell sheet structure. This method may be beneficial when applied in cases of difficult tissue reconstruction, such as nonunion, bone defects, and osteonecrosis.Cite this article: M. Akahane, T. Shimizu, T. Kira, T. Onishi, Y. Uchihara, T. Imamura, Y. Tanaka. Culturing bone marrow cells with dexamethasone and ascorbic acid improves osteogenic cell sheet structure. Bone Joint Res 2016;5:569-576. DOI: 10.1302/2046-3758.511.BJR-2016-0013.R1. © 2016 Akahane et al.

  8. Possible mechanisms of retinal function recovery with the use of cell therapy with bone marrow-derived stem cells

    Directory of Open Access Journals (Sweden)

    Rubens Camargo Siqueira

    2010-10-01

    Full Text Available Bone marrow has been proposed as a potential source of stem cells for regenerative medicine. In the eye, degeneration of neural cells in the retina is a hallmark of such widespread ocular diseases as age-related macular degeneration (AMD and retinitis pigmentosa. Bone marrow is an ideal tissue for studying stem cells mainly because of its accessibility. Furthermore, there are a number of well-defined mouse models and cell surface markers that allow effective study of hematopoiesis in healthy and injured mice. Because of these characteristics and the experience of bone marrow transplantation in the treatment of hematological disease such as leukemia, bone marrow-derived stem cells have also become a major tool in regenerative medicine. Those cells may be able to restore the retina function through different mechanisms: A cellular differentiation, B paracrine effect, and C retinal pigment epithelium repair. In this review, we described these possible mechanisms of recovery of retinal function with the use of cell therapy with bone marrow-derived stem cells.

  9. Immunohistochemistry analysis of bone marrow biopsies in multiple sclerosis patients undergoing autologous haematopoietic stem cells transplantation.

    Science.gov (United States)

    Carrai, Valentina; Donnini, Irene; Mazzanti, Benedetta; Alterini, Renato; Amato, Maria Pia; Barilaro, Alessandro; Bosi, Alberto; Massacesi, Luca; Portaccio, Emilio; Repice, Anna Maria; Rotunno, Giada; Saccardi, Riccardo

    2013-07-01

    Recently autologous haematopoietic stem cell transplantation (AHSCT) has been introduced for the treatment of severe forms of multiple sclerosis (MS). As little data are available on bone marrow (BM) of MS patients undergoing AHSCT, we investigated the morphological and phenotypic characteristics of MS BM. BM biopsies of 14 MS patients screened for AHSCT and 10 control patients were evaluated to assess cellularity, morphology, immunological profile and bone marrow microenvironment. Immunohistochemistry analysis was performed to evaluate the expression of CD3, CD4, CD8, CD20, CD68, CD45, MMP-9. 8 out of 14 MS (57%) patients showed a reduction of age-related bone marrow cellularity, possibly due to previous immunosuppressive therapies. There were no differences in the T CD3+ lymphocyte expression rate amongst MS and the control patients, the CD4/CD8 ratio (2:1) was maintained as was the rate of B lymphocytes. We found an increased, although not significant, MMP-9 expression (9.2%) in the bone marrow of MS patients, when compared to the control patients (6.3%). The BM of MS patients showed a reduced cellularity and CD45+ cells content in comparison to the controls. A slightly increased expression of MMP-9 was also shown, possibly confirming an involvement of this compartment in the pathogenesis of the disease. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Bone Marrow Cells in Acute Lymphoblastic Leukemia Create a Proinflammatory Microenvironment Influencing Normal Hematopoietic Differentiation Fates

    Directory of Open Access Journals (Sweden)

    Armando Vilchis-Ordoñez

    2015-01-01

    Full Text Available B-cell acute lymphoblastic leukemia (B-ALL is a serious public health problem in the pediatric population worldwide, contributing to 85% of deaths from childhood cancers. Understanding the biology of the disease is crucial for its clinical management and the development of therapeutic strategies. In line with that observed in other malignancies, chronic inflammation may contribute to a tumor microenvironment resulting in the damage of normal processes, concomitant to development and maintenance of neoplastic cells. We report here that hematopoietic cells from bone marrow B-ALL have the ability to produce proinflammatory and growth factors, including TNFα, IL-1β, IL-12, and GM-CSF that stimulate proliferation and differentiation of normal stem and progenitor cells. Our findings suggest an apparently distinct CD13+CD33+ population of leukemic cells contributing to a proinflammatory microenvironment that may be detrimental to long-term normal hematopoiesis within B-ALL bone marrow.

  11. Bone Marrow Stromal Cells Contribute to Bone Formation Following Infusion into Femoral Cavities of a Mouse Model of Osteogenesis Imperfecta

    Science.gov (United States)

    Li, Feng; Wang, Xujun; Niyibizi, Christopher

    2010-01-01

    Currently, there are conflicting data in literature regarding contribution of bone marrow stromal cells (BMSCs) to bone formation when the cells are systemically delivered in recipient animals. To understand if BMSCs contribute to bone cell phenotype and bone formation in osteogenesis imperfecta bones (OI), MSCs marked with GFP were directly infused into the femurs of a mouse model of OI (oim). The contribution of the cells to the cell phenotype and bone formation was assessed by histology, immunohistochemistry and biomechanical loading of recipient bones. Two weeks following infusion of BMSCs, histological examination of the recipient femurs demonstrated presence of new bone when compared to femurs injected with saline which showed little or no bone formation. The new bone contained few donor cells as demonstrated by GFP fluorescence. At six weeks following cell injection, new bone was still detectable in the recipient femurs but was enhanced by injection of the cells suspended in pepsin solublized type I collagen. Immunofluorescence and immunohistochemical staining showed that donor GFP positive cells in the new bone were localized with osteocalcin expressing cells suggesting that the cells differentiated into osteoblasts in vivo. Biomechanical loading to failure in thee point bending, revealed that, femurs infused with BMSCs in PBS or in soluble type I collagen were biomechanically stronger than those injected with PBS or type I collagen alone. Taken together, the results indicate that transplanted cells differentiated into osteoblasts in vivo and contributed to bone formation in vivo; we also speculate that donor cells induced differentiation or recruitment of endogenous cells to initiate reparative process at early stages following transplantation. PMID:20570757

  12. Bone marrow evaluation in small cell carcinoma of the lung. [Radiographic and nuclear medical examinations also performed

    Energy Technology Data Exchange (ETDEWEB)

    Giaccone, G.; Ciuffreda, L.; Donadio, M.; Ferrati, P.; Risio, M.; Leria, G.; Bonardi, G.; Calciati, A.

    1987-01-01

    Bone marrow examination is commonly included in the staging of small cell lung carcinoma (SCLC). We reviewed marrow samples of 103 patients. Marrow examination was mainly performed by unilateral or bilateral biopsy of iliac crests, using a Jamshidi needle. Only 6 of 97 evaluable cases (6.2%) were positive for marrow metastases at staging, and in 3 cases (3%) bone marrow was the only metastatic site. No focal metastases were found in additional sections made from the blocks of negative samples. In our experience bone marrow biopsy was of little value in staging SCLC. Bilateral biopsy plus aspirate, with the addition of more sophisticated staining techniques might, however, provide a higher yield of positive marrow involvement.

  13. Single-cell analysis of the fate of c-kit-positive bone marrow cells

    Science.gov (United States)

    Czarna, Anna; Sanada, Fumihiro; Matsuda, Alex; Kim, Junghyun; Signore, Sergio; Pereira, João D.; Sorrentino, Andrea; Kannappan, Ramaswamy; Cannatà, Antonio; Hosoda, Toru; Rota, Marcello; Crea, Filippo; Anversa, Piero; Leri, Annarosa

    2017-10-01

    The plasticity of c-kit-positive bone marrow cells (c-kit-BMCs) in tissues different from their organ of origin remains unclear. We tested the hypothesis that c-kit-BMCs are functionally heterogeneous and only a subgroup of these cells possesses cardiomyogenic potential. Population-based assays fall short of identifying the properties of individual stem cells, imposing on us the introduction of single cell-based approaches to track the fate of c-kit-BMCs in the injured heart; they included viral gene-tagging, multicolor clonal-marking and transcriptional profiling. Based on these strategies, we report that single mouse c-kit-BMCs expand clonally within the infarcted myocardium and differentiate into specialized cardiac cells. Newly-formed cardiomyocytes, endothelial cells, fibroblasts and c-kit-BMCs showed in their genome common sites of viral integration, providing strong evidence in favor of the plasticity of a subset of BMCs expressing the c-kit receptor. Similarly, individual c-kit-BMCs, which were infected with multicolor reporters and injected in infarcted hearts, formed cardiomyocytes and vascular cells organized in clusters of similarly colored cells. The uniform distribution of fluorescent proteins in groups of specialized cells documented the polyclonal nature of myocardial regeneration. The transcriptional profile of myogenic c-kit-BMCs and whole c-kit-BMCs was defined by RNA sequencing. Genes relevant for engraftment, survival, migration, and differentiation were enriched in myogenic c-kit-BMCs, a cell subtype which could not be assigned to a specific hematopoietic lineage. Collectively, our findings demonstrate that the bone marrow comprises a category of cardiomyogenic, vasculogenic and/or fibrogenic c-kit-positive cells and a category of c-kit-positive cells that retains an undifferentiated state within the damaged heart.

  14. MR tomography of bone marrow changes after high-dose chemotherapy and autologous peripheral stem cell transplantation

    International Nuclear Information System (INIS)

    Pereira, P.L.; Schick, F.; Farnsworth, C.T.; Mattke, A.; Duda, S.H.; Claussen, C.D.; Einsele, H.; Kollmansberger, C.

    1999-01-01

    Purpose: Evaluation of MR standard imaging and short time inversion recovery (STIR) imaging to assess changes in red bone marrow cellularity after high-dose chemotherapy (HDC) and peripheral blood stem cells transplantation (PBSCT). Results: STIR sequences demonstrated marked changes in signal intensity not only until the aplasia occurred but also during bone marrow repopulation. An increased signal intensity was observed after HDC in 13/15 patients (87%), followed by a decrease in signal intensity immediately after aplasia in 14/15 patients (93%). Signal intensity further changed parallel to marrow engraftment in 11/15 patients (73%). T 2 -TSE only showed clear changes during repopulation in 8/15 patients (53%). The individual course of the signal in T 1 -TSE was markedly inhomogeneous. Conclusions: STIR sequences show bone marrow edema during aplasia and marrow cellularity during reconstitution and are suitable for characterisation of red bone marrow after HDC and autologous PBSCT. (orig.) [de

  15. Migration of acute lymphoblastic leukemia cells into human bone marrow stroma.

    Science.gov (United States)

    Makrynikola, V; Bianchi, A; Bradstock, K; Gottlieb, D; Hewson, J

    1994-10-01

    Most cases of acute lymphoblastic leukemia (ALL) arise from malignant transformation of B-cell precursors in the bone marrow. Recent studies have shown that normal and leukemic B-cell precursors bind to bone marrow stromal cells through the beta-1 integrins VLA-4 and VLA-5, thereby exposing early lymphoid cells to regulatory cytokines. It has been recently reported that the pre-B cell line NALM-6 is capable of migrating under layers of murine stromal cells in vitro (Miyake et al. J Cell Biol 1992;119:653-662). We have further analyzed leukemic cell motility using human bone marrow fibroblasts (BMF) as a stromal layer. The precursor-B ALL cell line NALM-6 rapidly adhered to BMF, and underwent migration or tunneling into BMF layers within 5 h, as demonstrated by light and electron microscopy, and confirmed by a chromium-labeling assay. Migration was also observed with the precursor-B ALL lines Reh and KM-3, with a T leukemia line RPMI-8402, the monocytic line U937, and the mature B line Daudi. In contrast, mature B (Raji), myeloid (K562, HL-60), and T lines (CCRF-CEM, MOLT-4) did not migrate. When cases of leukemia were analyzed, BMF migration was largely confined to precursor-B ALL, occurring in eight of 13 cases tested. Of other types of leukemia, migration was observed in one of four cases of T-ALL, but no evidence was seen in six acute myeloid leukemias and two patients with chronic lymphocytic leukemia. Only minimal migration into BMF was observed with purified sorted CD10+ CD19+ early B cells from normal adult marrow, while normal mature B lymphocytes from peripheral blood did not migrate. ALL migration was inhibited by monoclonal antibodies to the beta sub-unit of the VLA integrin family, and by a combination of antibodies to VLA-4 and VLA-5. Partial inhibition was also observed when leukemic cells were incubated with antibodies to VLA-4, VLA-5, or VLA-6 alone. In contrast, treatment of stromal cells with antibodies to vascular cell adhesion molecule or

  16. Potential of Osteoblastic Cells Derived from Bone Marrow and Adipose Tissue Associated with a Polymer/Ceramic Composite to Repair Bone Tissue.

    Science.gov (United States)

    Freitas, Gileade P; Lopes, Helena B; Almeida, Adriana L G; Abuna, Rodrigo P F; Gimenes, Rossano; Souza, Lucas E B; Covas, Dimas T; Beloti, Marcio M; Rosa, Adalberto L

    2017-09-01

    One of the tissue engineering strategies to promote bone regeneration is the association of cells and biomaterials. In this context, the aim of this study was to evaluate if cell source, either from bone marrow or adipose tissue, affects bone repair induced by osteoblastic cells associated with a membrane of poly(vinylidene-trifluoroethylene)/barium titanate (PVDF-TrFE/BT). Mesenchymal stem cells (MSC) were isolated from rat bone marrow and adipose tissue and characterized by detection of several surface markers. Also, both cell populations were cultured under osteogenic conditions and it was observed that MSC from bone marrow were more osteogenic than MSC from adipose tissue. The bone repair was evaluated in rat calvarial defects implanted with PVDF-TrFE/BT membrane and locally injected with (1) osteoblastic cells differentiated from MSC from bone marrow, (2) osteoblastic cells differentiated from MSC from adipose tissue or (3) phosphate-buffered saline. Luciferase-expressing osteoblastic cells derived from bone marrow and adipose tissue were detected in bone defects after cell injection during 25 days without difference in luciferin signal between cells from both sources. Corroborating the in vitro findings, osteoblastic cells from bone marrow combined with the PVDF-TrFE/BT membrane increased the bone formation, whereas osteoblastic cells from adipose tissue did not enhance the bone repair induced by the membrane itself. Based on these findings, it is possible to conclude that, by combining a membrane with cells in this rat model, cell source matters and that bone marrow could be a more suitable source of cells for therapies to engineer bone.

  17. Analysis of bone marrow stromal cell transferred bacterial {beta}-galactosidase gene by PIXE

    Energy Technology Data Exchange (ETDEWEB)

    Kumakawa, Toshiro [Tokyo Metropolitan Geriatric Hospital, Tokyo (Japan). Dept. of Blood Transfusion and Hematology; Hibino, Hitoshi; Tani, Kenzaburo; Asano, Shigetaka; Futatugawa, Shouji; Sera, Kouichiro

    1997-12-31

    PIXE, Particle Induced X-ray Emission, is a powerful, multi-elemental analysis method which has many distinguishing features and has been used in varies research fields. Recently the method of applying baby cyclotrons for nuclear medicine to PIXE has been developed. This enables us to study biomedical phenomena from the physical point of view. Mouse bone marrow stromal cells were transferred bacterial {beta}-galactosidase gene (LacZ gene) by murine retroviral vectors. Analysis of the bone marrow stromal cells with the LacZ gene by PIXE revealed remarkable changes of intracellular trace elements compared with the normal control cells. These results indicate that gene transfer by retroviral vectors may bring about a dynamic change of intracellular circumstances of the target cell. (author)

  18. Treatment with at Homeopathic Complex Medication Modulates Mononuclear Bone Marrow Cell Differentiation

    Directory of Open Access Journals (Sweden)

    Beatriz Cesar

    2011-01-01

    Full Text Available A homeopathic complex medication (HCM, with immunomodulatory properties, is recommended for patients with depressed immune systems. Previous studies demonstrated that the medication induces an increase in leukocyte number. The bone marrow microenvironment is composed of growth factors, stromal cells, an extracellular matrix and progenitor cells that differentiate into mature blood cells. Mice were our biological model used in this research. We now report in vivo immunophenotyping of total bone marrow cells and ex vivo effects of the medication on mononuclear cell differentiation at different times. Cells were examined by light microscopy and cytokine levels were measured in vitro. After in vivo treatment with HCM, a pool of cells from the new marrow microenvironment was analyzed by flow cytometry to detect any trend in cell alteration. The results showed decreases, mainly, in CD11b and TER-119 markers compared with controls. Mononuclear cells were used to analyze the effects of ex vivo HCM treatment and the number of cells showing ring nuclei, niche cells and activated macrophages increased in culture, even in the absence of macrophage colony-stimulating factor. Cytokines favoring stromal cell survival and differentiation in culture were induced in vitro. Thus, we observe that HCM is immunomodulatory, either alone or in association with other products.

  19. Legumain Regulates Differentiation Fate of Human Bone Marrow Stromal Cells and Is Altered in Postmenopausal Osteoporosis.

    Science.gov (United States)

    Jafari, Abbas; Qanie, Diyako; Andersen, Thomas L; Zhang, Yuxi; Chen, Li; Postert, Benno; Parsons, Stuart; Ditzel, Nicholas; Khosla, Sundeep; Johansen, Harald Thidemann; Kjærsgaard-Andersen, Per; Delaisse, Jean-Marie; Abdallah, Basem M; Hesselson, Daniel; Solberg, Rigmor; Kassem, Moustapha

    2017-02-14

    Secreted factors are a key component of stem cell niche and their dysregulation compromises stem cell function. Legumain is a secreted cysteine protease involved in diverse biological processes. Here, we demonstrate that legumain regulates lineage commitment of human bone marrow stromal cells and that its expression level and cellular localization are altered in postmenopausal osteoporotic patients. As shown by genetic and pharmacological manipulation, legumain inhibited osteoblast (OB) differentiation and in vivo bone formation through degradation of the bone matrix protein fibronectin. In addition, genetic ablation or pharmacological inhibition of legumain activity led to precocious OB differentiation and increased vertebral mineralization in zebrafish. Finally, we show that localized increased expression of legumain in bone marrow adipocytes was inversely correlated with adjacent trabecular bone mass in a cohort of patients with postmenopausal osteoporosis. Our data suggest that altered proteolytic activity of legumain in the bone microenvironment contributes to decreased bone mass in postmenopausal osteoporosis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Isolation and characterization of mesenchymal stem cell population entrapped in bone marrow collection sets.

    Science.gov (United States)

    Dvorakova, Jana; Hruba, Alena; Velebny, Vladimir; Kubala, Lukas

    2008-09-01

    Bone marrow is an important source of mesenchymal stem cells (MSCs), and a promising tool for cytotherapy. MSC utilization is limited by low cell yields obtained under standard isolation protocols. Herein, used bone marrow collection sets were evaluated as a valuable source of MSCs. Adherent cells washed from the collection sets were examined for widely accepted criteria defining MSCs. Significant numbers of cells (median 9million per set in passage 1) with colony-forming activity and high proliferative potential at low seeding densities were obtained. These cells were positive for essential MSC surface molecules (CD90, CD105, CD166, CD44, CD29) and negative for most haematopoietic and endothelial cell markers (CD45, CD34, CD11a, CD235a, HLA-DR, CD144). The cells were capable of differentiation along adipogenic, osteogenic and chondrogenic pathways. Washing out bone marrow collection sets may constitute a highly ethical source of MSCs for research purposes and may be utilized also in clinical applications.

  1. Use of Bone Marrow derived Stem Cells in patients with Cardiovascular Disorders

    Directory of Open Access Journals (Sweden)

    Abraham S

    2007-01-01

    Full Text Available Patients with end stage heart failure have very few treatment options. The long waiting times for transplant and the complications associated with immunosuppression has led to the search for alternatives. Subsequent to the isolation and characterization of stem cells, tremendous advances have been made and the safety and feasibility of autologous bone marrow derived stem cells has been proven in preclinical studies. Clinical studies have also shown mobilized cells repair the infracted heart, improving function and survival. We have started a clinical study to evaluate the efficacy of bone marrow derived stem cells. Bone-marrow was aspirated from the right iliac crest and the stem cells were isolated by density gradient method and suspended according to the mode of delivery.From Jan 2007 till date 10 patients (8 adults, 2 children, age with end stage cardiovascular disorder of varied etiology (Ischemic left ventricular dysfunction - 6 patients, Primary pulmonary hypertension - 2 patients, Dilated cardiomyopathy -1 patient, Biventricular non-compaction -1 patient underwent stem cell therapy. All patients were evaluated and cardiac function was measured by using echocardiography and thallium scintigraphy. There were no procedure related complications. These patients are being regularly followed-up and one patient who has completed 6-month follow-up has shown improvement in perfusion as well as increase in ejection fraction of 10%. Stem cell therapy in patients with end-stage cardiovascular disorder might be a promising tool by means of angiogenesis and other paracrine mechanisms.

  2. Exendin-4 Induces Bone Marrow Stromal Cells Migration Through Bone Marrow-Derived Macrophages Polarization via PKA-STAT3 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Ning Wang

    2017-12-01

    Full Text Available Background/Aims: The synthesis and degradation processes involved in bone remodeling are critically regulated by osteoblasts and osteoclasts. The GLP-1 receptor agonist Exendin-4 is beneficial for osteoblast differentiation and increases the number of osteoblasts. Methods: We constructed an ovariectomized model to evaluate the impact of Exendin-4 on bone formation in osteoporosis. A macrophage-depleted model was also created to investigate the effect of macrophages on bone formation. Thirty-two female WT C57BL/6 mice (aged 3 months were randomly assigned to a normal control group and four ovariectomized (OVX subgroups: OVX + vehicle group, OVX + Exendin-4 (4.2 µg/kg/day group, OVX + chloride phosphate liposome group and OVX + chloride phosphate liposome + Exendin-4 group. Results: In this study, we found that Exendin-4 not only increased the number of osteoblasts and decreased the number of osteoclasts, but also increased the number of bone marrow stromal cells (BMSCs at the bone surface. Moreover, we found that OVX mice treated with Exendin-4 increased TGF-β1 levels at the bone surface compared with that in OVX mice. Besides, Exendin-4 promoted the polarization of bone marrow-derived macrophages into M2 subtype and increased TGF-β1 secretion by the M2 subtype. Finally, we found that Exendin-4 induced macrophage polarization via the cAMP-PKA-STAT3 signaling pathway. Conclusion: Exendin-4 promotes bone marrow-derived macrophage polarization to the M2 subtype and induces BMSC migration to the bone surface via PKA-STAT3 signaling.

  3. The Fate of Intrapleurally Injected Bone Marrow-Derived Stem Cells in Mice with Pleural Mesothelioma

    Science.gov (United States)

    2012-12-01

    11-1-0574 TITLE: The Fate of Intrapleurally Injected Bone Marrow-Derived Stem Cells in Mice with Pleural Mesothelioma PRINCIPAL...Mice with Pleural Mesothelioma 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-11-1-0574 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Jonathan M...stem cells (BMSCs) as potential therapeutics against malignant mesothelioma (MM). Our over-arching goal was to determine whether fluorescently

  4. Canine Bone Marrow Stromal Cells Promote Functional Recovery in Mice with Spinal Cord Injury

    OpenAIRE

    ODA, Yasutaka; TANI, Kenji; ASARI, Yusuke; QUINTANILHA, Luiz Fernando; HARAGUCHI, Tomoya; MOMOTA, Yutaka; KATAYAMA, Masaaki; ITAMOTO, Kazuhito; NAKAZAWA, Hiroshi; TAURA, Yasuho

    2014-01-01

    ABSTRACT Regenerative therapy has begun to be clinically applied in humans and dogs to treat neurological disorders, such as spinal cord injury (SCI). Here, we show the therapeutic potential of transplantation of cultured canine bone marrow stromal cells (BMSCs) into mice with SCI. Canine BMSC transplantation therapy was performed, immediately after the spinal cord was injured. Canine BMSC therapy enhanced functional recovery of the hind limbs in mice with SCI. Nestin-positive cells were obse...

  5. Specific profiles of ion channels and ionotropic receptors define adipose- and bone marrow derived stromal cells.

    Czech Academy of Sciences Publication Activity Database

    Forostyak, Oksana; Butenko, Olena; Anděrová, Miroslava; Forostyak, Serhiy; Syková, Eva; Verkhratsky, A.; Dayanithi, Govindan

    2016-01-01

    Roč. 16, č. 3 (2016), s. 622-634 ISSN 1873-5061 R&D Projects: GA ČR(CZ) GA14-34077S; GA ČR(CZ) GAP304/11/2373; GA ČR(CZ) GBP304/12/G069 Institutional support: RVO:68378041 Keywords : adipose derived stromal cells * bone marrow stromal cell * Ca(2+) signaling * Ion channels Subject RIV: FH - Neurology Impact factor: 3.494, year: 2016

  6. Effect of daunorubicin drug with and without cimetidine on the nucleated cells of bone marrow of balb/c mouse

    Directory of Open Access Journals (Sweden)

    ali asghar Kiani

    2004-01-01

    Full Text Available Introduction: Hematopoiesis is an on going process mammalian marrow system. A few cells from the nucleated cells of bone marrow are hematopoietic cells which include primary stem cells, precursor cells and progenitor cells. Primary stem cells and progenitor cells are able to produce colonies in culture medium (CFU-C and irradiated mouse spleen (CFU-S. A hematopoietic cell is alive and active when it can produce colonies and proliferate otherwise it is practically a dead cell. These cells are subject to damage from chemical or physical agents such as chemothrapeutic drugs or ionizing radiation . Materials and Methods: In the present research 150 balb/c mice were bought from Razi institute, as well as daunorubicin, which is an important drug for treatment of acute myeloid leukemia, was used as a destructive agent for bone marrow and cimetidine was used as a protective agent for bone marrow against daunorubicin. In this research one of the methods of in vivo stem cell assay. Which is called spleen colony assay, is used. The basis of this method is injection of bone marrow hematopietic cells into irradiated mouse (Supralethal irradiation . 8 to 10 days after injecting bone marrow cells stem cells produce colonies in spleen of irradiated mouse each colony represents one primary hematopoietic cell. Findings: By the method of spleen colony assay it was shown that daunorubicin at doses of 5 to 20 mg/kg will decrease the number of colonies formed in spleen . On the other hand it was shown that cimetidine in concentration of 15 mg/kg will decrease the toxic effects of these drugs and will cause an increase in spleen colonies and relative survival of mouse bone marrow cells. Cimetidine will possibly cause its relieving effects by neutralizing histamine free radicals through decreasing the activity of cytochrome P450 and increasing glutathione and increasing glutathione activity. Conclusion: Cimetidine is able to reduce the cytolytic and cytotoxic effect of

  7. [Method for concentrating marrow stem cells using the IBM 2991 washer. Necessary preparation before in vitro treatment of bone marrow by pharmacologic or immunologic means].

    Science.gov (United States)

    Hervé, P; Coffe, C; Peters, A

    1983-04-01

    The technique using the IBM 2991 blood cell processor is an effective technique for the concentration of mononuclear cells from large volumes of bone marrow. The marrow cells are layered on to Ficoll Metrizoate using the IBM processing set. The mononuclear cells and CFU-GM recoveries are in close relationship with the hematocrit of the cell suspension processed. Twenty two bone marrows have been collected and purified according to this protocol. The mononuclear cell recovery is an average of 78,3% (range: 44-92%) and the CFU-GM recovery is in average of 67,5% (range: 40-89%). At the end of the procedure the cell viability is satisfying (97,1% +/- 1,7 are trypan blue negatives). When it is necessary to remove from the bone marrow collected either malignant cells prior autologous bone marrow graft or T lymphocytes in an attempt to prevent GVHD in allogeneic BMT, the purity of marrow cell suspension become a fundamental parameter.

  8. [Osteogenic potential of bone marrow mesenchymal stem cells from ovariectomied osteoporotic rat].

    Science.gov (United States)

    Li, Dong-ju; Ge, Dong-xia; Wu, Wen-chao; Wu, Jiang; Li, Liang

    2005-05-01

    To investigate the difference of osteogenic potential of bone marrow mesenchymal stem cells (MSCs) between healthy rats and osteoporotic rats. We established the animal model of osteoporosis by performing ovariectom on the 3-month-old female Sprague-Dawley rats. Bone marrow mesenchymal stem cells(MSCs) were isolated from the rats of control group and of ovariectomized (ovx) group by means of the density-gradient centrifugation method, and the 3rd-4th passage MSCs were used in all the experiments. The experiments comprised 4 groups: (1) Marrow mesenchymal stem cells control group (MSCs control group); (2) Marrow mesenchymal stem cells ovx group (MSCs ovx group); (3) Osteogenesis induction control group (OSI control group); (4) Osteogenesis induction ovx group (OSI ovx group). Cell cycle and proliferation index (PI) of MSCs were detected by flow cytometry. The expression of alkaline phosphatase (ALP) was detected by dynamics method with substrate of phosphoric acid para-Nitro benzene. The levels of osteocalcin were detected with the isotope labelling method. (1) PI of MSCs was lower in MSCs ovx group than in MSCs control group. (2) The expression of alkaline phosphatase (ALP) was much higher in OSI control group than in the MSCs control group; the expression of alkaline phosphatase (ALP) was much higher in the OSI control group than in OSI ovx group after 7-day and 14-day osteogenic induction. (3) The level of osteocalcin was much higher in the OSI control group than in the MSCs control group after 14-day, 21-day, 28-day osteogenic induction. The level of osteocalcin was much higher in the OSI control group than in the OSI ovx group. Both the proliferative potential and the osteogenic potential of bone marrow mesenchymal stem cells (MSCs) from the ovariectomized osteoporotic rat are decreased.

  9. Role of bone marrow macrophages in controlling homeostasis and repair in bone and bone marrow niches.

    Science.gov (United States)

    Kaur, Simranpreet; Raggatt, Liza Jane; Batoon, Lena; Hume, David Arthur; Levesque, Jean-Pierre; Pettit, Allison Robyn

    2017-01-01

    Macrophages, named for their phagocytic ability, participate in homeostasis, tissue regeneration and inflammatory responses. Bone and adjacent marrow contain multiple functionally unique resident tissue macrophage subsets which maintain and regulate anatomically distinct niche environments within these interconnected tissues. Three subsets of bone-bone marrow resident tissue macrophages have been characterised; erythroblastic island macrophages, haematopoietic stem cell niche macrophages and osteal macrophages. The role of these macrophages in controlling homeostasis and repair in bone and bone marrow niches is reviewed in detail. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Review of Preclinical and Clinical Studies of Bone Marrow-Derived Cell Therapies for Intracerebral Hemorrhage

    Directory of Open Access Journals (Sweden)

    Paulo Henrique Rosado-de-Castro

    2016-01-01

    Full Text Available Stroke is the second leading cause of mortality worldwide, causing millions of deaths annually, and is also a major cause of disability-adjusted life years. Hemorrhagic stroke accounts for approximately 10 to 27% of all cases and has a fatality rate of about 50% in the first 30 days, with limited treatment possibilities. In the past two decades, the therapeutic potential of bone marrow-derived cells (particularly mesenchymal stem cells and mononuclear cells has been intensively investigated in preclinical models of different neurological diseases, including models of intracerebral hemorrhage and subarachnoid hemorrhage. More recently, clinical studies, most of them small, unblinded, and nonrandomized, have suggested that the therapy with bone marrow-derived cells is safe and feasible in patients with ischemic or hemorrhagic stroke. This review discusses the available evidence on the use of bone marrow-derived cells to treat hemorrhagic strokes. Distinctive properties of animal studies are analyzed, including study design, cell dose, administration route, therapeutic time window, and possible mechanisms of action. Furthermore, clinical trials are also reviewed and discussed, with the objective of improving future studies in the field.

  11. Data on bone marrow stem cells delivery using porous polymer scaffold

    Directory of Open Access Journals (Sweden)

    Ramasatyaveni Geesala

    2016-03-01

    Full Text Available Low bioavailability and/or survival at the injury site of transplanted stem cells necessitate its delivery using a biocompatible, biodegradable cell delivery vehicle. In this dataset, we report the application of a porous biocompatible, biodegradable polymer network that successfully delivers bone marrow stem cells (BMSCs at the wound site of a murine excisional splint wound model. In this data article, we are providing the additional data of the reference article “Porous polymer scaffold for on-site delivery of stem cells – protects from oxidative stress and potentiates wound tissue repair” (Ramasatyaveni et al., 2016 [1]. This data consists of the characterization of bone marrow stem cells (BMSCs showing the pluripotency and stem cell-specific surface markers. Image analysis of the cellular penetration into PEG–PU polymer network and the mechanism via enzymatic activation of MMP-2 and MMP-13 are reported. In addition, we provide a comparison of various routes of transplantation-mediated BMSCs engraftment in the murine model using bone marrow transplantation chimeras. Furthermore, we included in this dataset the engraftment of BMSCs expressing Sca-1+Lin−CD133+CD90.2+ in post-surgery day 10.

  12. Bone marrow mesenchymal stem cells protect against retinal ganglion cell loss in aged rats with glaucoma

    Directory of Open Access Journals (Sweden)

    Hu Y

    2013-10-01

    Full Text Available Ying Hu,1,2 Hai Bo Tan,1 Xin Mei Wang,3 Hua Rong,1 Hong Ping Cui,1 Hao Cui2 Departments of Ophthalmology, 1Shanghai East Hospital of Tongji University, Shanghai, 2First Affiliated Hospital, 3Fourth Affiliated Hospital, Harbin Medical University, Harbin, People's Republic of China Abstract: Glaucoma is a common eye disease in the aged population and has severe consequences. The present study examined the therapeutic effects of bone marrow mesenchymal stem cell (BMSC transplantation in preventing loss of visual function in aged rats with glaucoma caused by laser-induced ocular hypertension. We found that BMSCs promoted survival of retinal ganglion cells in the transplanted eye as compared with the control eye. Further, in swimming tests guided by visual cues, the rats with a BMSC transplant performed significantly better. We believe that BMSC transplantation therapy is effective in treating aged rats with glaucoma. Keywords: glaucoma, stem cell, transplantation, cell therapy, aging

  13. Intractable diseases treated with intra-bone marrow-bone marrow transplantation

    OpenAIRE

    Li, Ming; Guo, Kuquan; Ikehara, Susumu

    2014-01-01

    Bone marrow transplantation (BMT) is used to treat hematological disorders, autoimmune diseases (ADs) and lymphoid cancers. Intra bone marrow-BMT (IBM-BMT) has been proven to be a powerful strategy for allogeneic BMT due to the rapid hematopoietic recovery and the complete restoration of T cell functions. IBM-BMT not only replaces hematopoietic stem cells (HSCs) but also mesenchymal stromal cells (MSCs). MSCs are multi-potent stem cells that can be isolated from bone marrow (BM), umbilical co...

  14. Potential Role of Bone Marrow Mesenchymal Stem Cells in Obstructive Sleep Apnea

    Science.gov (United States)

    Carreras, Alba; Almendros, Isaac; Farré, Ramon

    2011-01-01

    Obstructive sleep apnea syndrome (OSA) is a prevalent disease caused by increased collapsibility of the upper airway. OSA induces oxidative stress, inflammation and endothelial dysfunction, with important clinical consequences such as neurocognitive alterations and cardiovascular diseases. Although it has been shown that bone marrow-derived stem cells play a protective and reparative function in several diseases involving inflammatory processes and endothelial dysfunction, the data currently available on the potential role of adult stem cells in OSA are scarce. The present review presents recent data on the potential role of bone marrow-derived mesenchymal stem cells (MSC) in OSA. The results obtained in animal models that realistically mimic the events characterizing this sleep breathing disorder strongly support the notion that MSC are mobilized in circulating blood and then activated to play an anti-inflammatory role in OSA. PMID:24298333

  15. Promoting spinal fusions by biomineralized silk fibroin films seeded with bone marrow stromal cells: An in vivo animal study.

    Science.gov (United States)

    Gu, Yong; Chen, Liang; Niu, Hai-Yun; Shen, Xiao-Feng; Yang, Hui-Lin

    2016-03-01

    To prepare a biomineralized nano silk fibroin film seeded with bone marrow stromal cells (BMSCs), and to evaluate its performance in spinal fusion. The silk fibroin film was mineralized in a modified, simulated body fluid, seeded with BMSCs, and evaluated in a rat model of posterolateral lumbar fusion, compared with pure silk fibroin, silk fibroin/bone marrow stromal cells, mineralized silk fibroin, mineralized silk fibroin/bone marrow stromal cells, iliac crest bone, and no graft. After 12 weeks, all rats were sacrificed and underwent manual palpation, micro-CT scanning, biomechanical testing, and histology. The infrared spectrum, X-ray diffraction, and scanning electron microscopy demonstrated deposition of mineral layers on the silk fibroin film surface. The fusion rate, bone volume, relative strength and stiffness, and histological score of the mineralized silk fibroin/bone marrow stromal cells were slightly lower than the autograft, but without any significant difference (p > 0.05). In addition, the mineralized silk fibroin was significantly greater in most parameters than the silk fibroin/bone marrow stromal cells (p spinal fusion is enhanced when the mineralized silk fibroin is seeded with bone marrow stromal cells. © The Author(s) 2015.

  16. Histone deacetylase 3 depletion in osteo/chondroprogenitor cells decreases bone density and increases marrow fat.

    Directory of Open Access Journals (Sweden)

    David F Razidlo

    2010-07-01

    Full Text Available Histone deacetylase (Hdac3 is a nuclear enzyme that contributes to epigenetic programming and is required for embryonic development. To determine the role of Hdac3 in bone formation, we crossed mice harboring loxP sites around exon 7 of Hdac3 with mice expressing Cre recombinase under the control of the osterix promoter. The resulting Hdac3 conditional knockout (CKO mice were runted and had severe deficits in intramembranous and endochondral bone formation. Calvarial bones were significantly thinner and trabecular bone volume in the distal femur was decreased 75% in the Hdac3 CKO mice due to a substantial reduction in trabecular number. Hdac3-CKO mice had fewer osteoblasts and more bone marrow adipocytes as a proportion of tissue area than their wildtype or heterozygous littermates. Bone formation rates were depressed in both the cortical and trabecular regions of Hdac3 CKO femurs. Microarray analyses revealed that numerous developmental signaling pathways were affected by Hdac3-deficiency. Thus, Hdac3 depletion in osterix-expressing progenitor cells interferes with bone formation and promotes bone marrow adipocyte differentiation. These results demonstrate that Hdac3 inhibition is detrimental to skeletal health.

  17. Investigations of genotoxic potential of levamisole hydrochloride in bone marrow cells of Wistar rats

    Directory of Open Access Journals (Sweden)

    Kulić Milan

    2006-01-01

    Full Text Available An experiment was performed under in vivo conditions on bone marrow cells of Wistar rats. The following doses of levamisole hydrochloride were tested: a therapeutic dose of 2.2 mg/kg bm, a dose of 4.4 mg/kg bm, LD50 -25% mg/kg bm, and LD50 -75% mg/kg bm. We followed the effect of levamisole hydrochloride on kinetics of the cell cycle and the appearance of structural and numeric changes in chromosomes in bone marrow cells. The therapeutic dose of levamisole of 2.2 mg/kg bm exhibited a capability to increase mitotic activity in the observed cells, thus confirming knowledge of the immunostimulative effect of this dose of the medicine under in vivo conditions. The other tested doses of levamisole in this experiment, observed in comparison with the control group, had an opposite effect, namely, they caused a reduction in the mitotic activity of bone marrow cells. All the examined doses in vivo exhibited the ability to induce numeric (aneuploid and polyploid and structural (lesions, breaks and insertions chromosomal aberrations. It can be concluded on the grounds of these findings that the examined doses have a genotoxic effect.

  18. [Long-term results of intracoronary transplantation of autologous bone marrow cells in dilated cardiomyopathy].

    Science.gov (United States)

    Bartolucci, Jorge; Verdugo, Fernando J; Carrion, Flavio; Abarzúa, Ema; Goset, Carlos; Lamich, Rubén; Sanhueza, Patricio; Pedreros, Pablo; Nazzal, Carolina; Khoury, Maroun; Figueroa, Fernando E

    2015-04-01

    Intracoronary delivery of autologous bone marrow mononuclear cells is an interesting therapeutic promise for patients with heart failure of different etiologies. To evaluate the long-term safety and efficacy of this therapy in patients with dilated cardiomyopathy of different etiologies under optimal medical treatment. Prospective, open-label, controlled clinical trial. Of 23 consecutive patients, 12 were assigned to autologous bone marrow mononuclear cell intracoronary transplantation, receiving a mean dose of 8.19 ± 4.43 x 10(6) CD34+ cells. Mortality, cardiovascular readmissions and cancer incidence rate, changes in functional capacity, quality of life questionnaires and echocardiographic measures from baseline, were assessed at long-term follow-up (37.7 ± 9.7 months) in patients receiving or not the cells. No significant differences were observed in mortality, cardiovascular readmissions or cancer incidence rate amongst groups. An improvement in functional class and quality of life questionnaires in the transplanted group was observed (p transplantation of autologous bone marrow mononuclear cells is feasible and safe in patients with dilated cardiomyopathy of diverse etiologies. This therapy was associated to persistent improvements in functional class and quality of life. There was also a non-significant long-term improvement of left ventricular function.

  19. Intralesional Application of Autologous Bone Marrow Stem Cells with Scaffold in Canine for Spinal Cord Injury

    Directory of Open Access Journals (Sweden)

    Justin William B

    2009-01-01

    Full Text Available A three year old male non-descriptive companion dog was presented to the Small Animal Orthopedic Unit of Madras Veterinary College Teaching Hospital (MVC with paraplegia of fourth degree neurological deficit of hind limbs due to automobile trauma. Radiographic views were suggestive of dislocation at T8-T9 vertebral segment with fracture of L2 vertebra. Myelography confirmed the signs of abrupt stoppage of the contrast column cranial to dislocated area and was interpretive of transected spinal cord at L2 level. Construct was prepared with bone marrow mononuclear cells (BMMNC isolated from bone marrow aspirate of femur and the cells were seeded in Thermoreversible Gelatin Polymer (TGP at the cell processing facility of Nichi-In Centre for Regenerative Medicine (NCRM as per GMP protocols and was engrafted after hemilaminectomy and durotomy procedures in the MVC. Postoperatively the animal was clinically stable; however the animal died on the 7th day. Autopsy revealed co-morbid conditions like cystitis, nephritis and transmissible venereal tumor. Histopathology of the engrafted area revealed sustainability of aggregated stem cells that were transplanted revealing an ideal biocompatibility of the construct prepared with bone marrow mononuclear cells and polymer hydrogel for spinal cord regeneration in dogs. Further studies in similar cases will have to be undertaken to prove the long term efficacy.

  20. Intracoronary bone marrow cell application for terminal heart failure in children.

    Science.gov (United States)

    Rupp, Stefan; Jux, Christian; Bönig, Halvard; Bauer, Jürgen; Tonn, Torsten; Seifried, Erhard; Dimmeler, Stefanie; Zeiher, Andreas M; Schranz, Dietmar

    2012-10-01

    In spite of tremendous progress in the medical and surgical treatment of children with congenital heart disease and dilated cardiomyopathy achieved during the past few decades, for some children a heart transplant remains the only option. Clinically relevant benefits of intracoronary injection of autologous stem cells on cardiac function and remodelling have been demonstrated in adult patients with acute myocardial infarction. Experience with autologous stem cell therapy in children with severe congenital or acquired pump failure is limited to a small number of case reports. Between 2006 and 2010, nine severely ill children were treated with intracoronary infusion of autologous bone marrow-derived mononuclear cells as part of a compassionate therapy in our centre. No procedure-related unexpected adverse events occurred. There was one patient on extracorporeal membrane oxygenation who died of haemorrhage unrelated to the procedure; three patients proceeded to heart transplantation once a donor heart became available. The other five patients showed an improvement with respect to New York Heart Association classification (greater than or equal to 1), brain natriuretic peptide serum levels, and ejection fraction. Similar to adults, intracoronary injection of autologous bone marrow cell is technically feasible and safe for children. On the basis of our data, we propose to perform a pilot study for children with congestive heart failure, to formally assess the efficacy of intracoronary autologous bone marrow cell therapy.

  1. Micrometastatic cancer cells in lymph nodes, bone marrow, and blood: Clinical significance and biologic implications.

    Science.gov (United States)

    Leong, Stanley P L; Tseng, William W

    2014-01-01

    Cancer metastasis may be regarded as a progressive process from its inception in the primary tumor microenvironment to distant sites by way of the lymphovascular system. Although this type of tumor dissemination often occurs in an orderly fashion via the sentinel lymph node (SLN), acting as a possible gateway to the regional lymph nodes, bone marrow, and peripheral blood and ultimately to distant metastatic sites, this is not a general rule as tumor cells may enter the blood and spread to distant sites, bypassing the SLN. Methods of detecting micrometastatic cancer cells in the SLN, bone marrow, and peripheral blood of patients have been established. Patients with cancer cells in their SLN, bone marrow, or peripheral blood have worse clinical outcomes than patients with no evidence of spread to these compartments. The presence of these cells also has important biologic implications for disease progression and the clinician's understanding of the process of cancer metastasis. Further characterization of these micrometastatic cancer cells at each stage and site of metastasis is needed to design novel selective therapies for a more "personalized" treatment. © 2014 American Cancer Society, Inc.

  2. Bone marrow adipocytes promote the regeneration of stem cells and haematopoiesis by secreting SCF.

    Science.gov (United States)

    Zhou, Bo O; Yu, Hua; Yue, Rui; Zhao, Zhiyu; Rios, Jonathan J; Naveiras, Olaia; Morrison, Sean J

    2017-08-01

    Endothelial cells and leptin receptor + (LepR + ) stromal cells are critical sources of haematopoietic stem cell (HSC) niche factors, including stem cell factor (SCF), in bone marrow. After irradiation or chemotherapy, these cells are depleted while adipocytes become abundant. We discovered that bone marrow adipocytes synthesize SCF. They arise from Adipoq-Cre/ER + progenitors, which represent ∼5% of LepR + cells, and proliferate after irradiation. Scf deletion using Adipoq-Cre/ER inhibited haematopoietic regeneration after irradiation or 5-fluorouracil treatment, depleting HSCs and reducing mouse survival. Scf from LepR + cells, but not endothelial, haematopoietic or osteoblastic cells, also promoted regeneration. In non-irradiated mice, Scf deletion using Adipoq-Cre/ER did not affect HSC frequency in long bones, which have few adipocytes, but depleted HSCs in tail vertebrae, which have abundant adipocytes. A-ZIP/F1 'fatless' mice exhibited delayed haematopoietic regeneration in long bones but not in tail vertebrae, where adipocytes inhibited vascularization. Adipocytes are a niche component that promotes haematopoietic regeneration.

  3. Intra-arterial Autologous Bone Marrow Cell Transplantation in a Patient with Upper-extremity Critical Limb Ischemia

    Energy Technology Data Exchange (ETDEWEB)

    Madaric, Juraj, E-mail: jurmad@hotmail.com [National Institute of Cardiovascular Diseases (NUSCH) and Slovak Medical University, Department of Cardiology and Angiology (Slovakia); Klepanec, Andrej [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia); Mistrik, Martin [Clinic of Hematology and Transfusiology, Faculty Hospital (Slovakia); Altaner, Cestmir [Slovak Academy of Science, Institute of Experimental Oncology (Slovakia); Vulev, Ivan [National Institute of Cardiovascular Diseases, Department of Diagnostic and Interventional Radiology (Slovakia)

    2013-04-15

    Induction of therapeutic angiogenesis by autologous bone marrow mononuclear cell transplantation has been identified as a potential new option in patients with advanced lower-limb ischemia. There is little evidence of the benefit of intra-arterial cell application in upper-limb critical ischemia. We describe a patient with upper-extremity critical limb ischemia with digital gangrene resulting from hypothenar hammer syndrome successfully treated by intra-arterial autologous bone marrow mononuclear cell transplantation.

  4. Phenotypic characterization of the bone marrow stem cells used in regenerative cellular therapy

    International Nuclear Information System (INIS)

    Macias Abraham, Consuelo; Valle Perez, Lazaro O del; Baganet Cobas, Aymara

    2011-01-01

    Regenerative medicine is a novel therapeutic method with broad potential for the treatment of various illnesses, based on the use of bone marrow (BM) stem cells, whose phenotypic characterization is limited. The paper deals with the expression of different cell membrane markers in mononuclear BM cells from 14 patients who underwent autologous cell therapy, obtained by medullary puncture and mobilization to peripheral blood, with the purpose of characterizing the different types of cells present in that heterogeneous cellular population and identifying the adhesion molecules involved in their adhesion. A greater presence was observed of adherent stem cells from the marrow stroma in mononuclear cells obtained directly from the BM; a larger population of CD90 +c ells in mononuclear cells from CD34 -/ CD45 -p eripheral blood with a high expression of molecules CD44 and CD62L, which suggests a greater presence of mesenchymal stem cells (MSC) in mobilized cells from the marrow stroma. The higher levels of CD34 +c ells in peripheral blood stem cells with a low expression of molecules CD117 -a nd DR -s uggests the presence of hematopoietic stem cells, hemangioblasts and progenitor endothelial cells mobilized to peripheral circulation. It was found that mononuclear cells from both the BM and peripheral blood show a high presence of stem cells with expression of adhesion molecule CD44 (MMC marker), probably involved in their migration, settling and differentiation

  5. Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury.

    Science.gov (United States)

    Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

    2014-04-15

    We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group.

  6. Mesenchymal stromal cells from bone marrow treated with bovine tendon extract acquire the phenotype of mature tenocytes

    Directory of Open Access Journals (Sweden)

    Lívia Maria Mendonça Augusto

    2016-02-01

    Full Text Available ABSTRACT OBJECTIVE: This study evaluated in vitro differentiation of mesenchymal stromal cells isolated from bone marrow, in tenocytes after treatment with bovine tendon extract. METHODS: Bovine tendons were used for preparation of the extract and were stored at -80 °C. Mesenchymal stromal cells from the bone marrow of three donors were used for cytotoxicity tests by means of MTT and cell differentiation by means of qPCR. RESULTS: The data showed that mesenchymal stromal cells from bone marrow treated for up to 21 days in the presence of bovine tendon extract diluted at diminishing concentrations (1:10, 1:50 and 1:250 promoted activation of biglycan, collagen type I and fibromodulin expression. CONCLUSION: Our results show that bovine tendon extract is capable of promoting differentiation of bone marrow stromal cells in tenocytes.

  7. Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

    Science.gov (United States)

    Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

    2014-01-01

    We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

  8. Aging is associated with decreased maximal life span and accelerated senescence of bone marrow stromal cells

    DEFF Research Database (Denmark)

    Dokkedahl, Karin Stenderup; Justesen, Jeannette; Clausen, Christian

    2003-01-01

    Age-related decrease in bone formation is well described. However, the cellular causes are not known. Thus, we have established cultures of bone marrow stromal cells (MSC) from young (aged 18-29 years, n = 6) and old (aged 68-81 years, n = 5) donors. MSC were serially passaged until reaching...... donors were able to form similar amounts of mineralized matrix in vitro and of normal lamellar bone in vivo. In adipogenic medium similar numbers of adipocytes formed in cultures of young and old donors. In conclusion, aging is associated with decreased proliferative capacity of osteoprogenitor cells......, suggesting that decreased osteoblastic cell number, and not function, leads to age-related decrease in bone formation....

  9. Histological and Immunohistochemical Evaluation of Autologous Cultured Bone Marrow Mesenchymal Stem Cells and Bone Marrow Mononucleated Cells in Collagenase-Induced Tendinitis of Equine Superficial Digital Flexor Tendon

    Science.gov (United States)

    Crovace, Antonio; Lacitignola, Luca; Rossi, Giacomo; Francioso, Edda

    2010-01-01

    The aim of this study was to compare treatment with cultured bone marrow stromal cells (cBMSCs), bone marrow Mononucleated Cells (BMMNCs), and placebo to repair collagenase-induced tendinitis in horses. In six adult Standardbred horses, 4000 IU of collagenase were injected in the superficial digital flexor tendon (SDFT). Three weeks after collagenase treatment, an average of either 5.5 × 106 cBMSCs or 1.2 × 108 BMMNCs, fibrin glue, and saline solution was injected intralesionally in random order. In cBMSC- and BMMNCS-treated tendons, a high expression of cartilage oligomeric matrix protein (COMP) and type I collagen, but low levels of type III collagen were revealed by immunohistochemistry, with a normal longitudinally oriented fiber pattern. Placebo-treated tendons expressed very low quantities of COMP and type I collagen but large numbers of randomly oriented type III collagen fibers. Both cBMSC and BMMNCS grafts resulted in a qualitatively similar heling improvement of tendon extracellular matrix, in terms of the type I/III collagen ratio, fiber orientation, and COMP expression. PMID:20445779

  10. FoxO4 inhibits atherosclerosis through its function in bone marrow derived cells

    Science.gov (United States)

    Zhu, Min; Zhang, Qing-Jun; Wang, Lin; Li, Hao; Liu, Zhi-Ping

    2011-01-01

    Objectives FoxO proteins are transcription factors involved in varieties of cellular processes, including immune cell homeostasis, cytokine production, anti-oxidative stress, and cell proliferation and differentiation. Although these processes are implicated in the development of atherosclerosis, very little is known about the role of FoxO proteins in the context of atherosclerosis. Our objectives were to determine whether and how inactivation of Foxo4, a member of the FoxO family, in vivo promotes atherosclerosis. Methods and Results Apolipoprotein E-deficient (apoE−/−) mice were crossbred with animals lacking Foxo4 (Foxo4−/−). After 10 weeks on a high fat diet (HFD), Foxo4−/−apoE−/− mice showed elevated atherosclerosis and increased amount of macrophages and T cells in the plaque compared to apoE−/− mice. Bone marrow transplantations of chimeric C57B/6 mice reconstituted with either wild-type or Foxo4−/− bone marrows indicate that Foxo4-deficiency in bone marrow derived cells sufficiently promoted atherosclerosis. Foxo4-null macrophages produced elevated inflammatory cytokine IL-6 and levels of reactive oxygen species (ROS) in response to lipopolysaccharides in vitro. Serum levels of IL-6 were upregulated in HFD-fed Foxo4−/−apoE−/− mice compared to those of apoE−/− mice. Conclusions FoxO4 inhibits atherosclerosis through bone marrow derived cells, possibly by inhibition of ROS and inflammatory cytokines that promote monocyte recruitment and/or retention. PMID:22005198

  11. Origanum vulgare leaf extract protects mice bone marrow cells against ionizing radiation

    Directory of Open Access Journals (Sweden)

    Reza Ghasemnezhad Targhi

    2016-11-01

    Full Text Available Objective: Ionizing radiation produces free radicals which induce DNA damage and cell death. Origanum vulgare leaf extract (OVLE is a natural compound and its capability of scavenging free radicals and its antioxidant activity have been demonstrated by many researchers. In this study, using micronucleus assay, radioprotective effect of OVLE against clastogenic and cytotoxic effect of gamma irradiation has been investigated in mice bone marrow cells. Materials and Methods: OVLE was injected intraperitoneally to the BALB/c mice 1hr prior to gamma irradiation (3Gy at the doses of 100 and 200 mg/kg. Twenty four hours after irradiation or treatment, animals were killed and smears were prepared from the bone marrow cells. The slides were stained with May Grunwald–Giemsa method and analyzed microscopically. The frequency of micronucleated polychromatic erythrocytes (MnPCEs, micronucleated normochromatic erythrocyte (MnNCEs and cell proliferation ratio PCE/PCE+NCE (polychromatic erythrocyte/polychromatic erythrocyte + normochromatic erythrocyte were calculated. Results: The results showed that gamma irradiation (3Gy increased the frequency of MnPCEs, MnNCEs and  reduced the PCE/PCE+NCE ratio in mice bone marrow compared to the non-irradiated control group (p< 0.0001. Injection of OVLE significantly reduced the frequency of MnPCEs (p< 0.0001 and MnNCEs (p< 0.05 and increased the PCE/PCE+NCE ratio as compared to the irradiated control group (p< 0.05. Conclusion: It seems that OVLE with its antioxidant properties and its capability of scavenging free radicals and reactive oxygen species can reduce the cytotoxic effects of gamma irradiation in mice bone marrow cells.

  12. Effect of Green Tea Extract in Reducing Genotoxic Injuries of Cell Phone Microwaves on Bone Marrow

    Directory of Open Access Journals (Sweden)

    Zahra Zahedifar

    2013-11-01

    Full Text Available Background: Green tea (Camellia sinensis extract is rich source of natural antioxidants specially catechin that is quickly absorbed into the body and it has cancer protective, anti microbial and anti inflammation effects. In this study has been studied role of green tea extract against genotoxic damage induced by cell phone microwaves on bone marrow polychromatic erythrocytes of adult male Balb/C mouse.Materials and Methods: In this experimental study 40 mouse were divided into five groups, control animals were located under natural condition, sham -exposed animals were prepared by experimental condition without cell phone waves radiation. Experimental 1 group that irradiated at cell phones for 4 days (3 hours/day and experimental 2 groups were injected intraperitoneal 100 mg/kg green tea extract for 5 days and experimental 3 group that irradiated at active mobile phones for 4 days (3 hours/day and were injected intraperitoneal 100 mg/kg green tea extract for 5 days. After treatment period micronucleus test was evaluated in polychromatic erythrocytes on bone marrow. The quantitative data was analyzed by ANOVA and Tukey test with using of SPSS-13 software at the level of p<0.05.Results: Based on this study, treatment with extracts of green tea decreased micronucleus frequency in bone marrow polychromatic erythrocytes of Balb/C mouse that irradiated at cell phone microwave (0.92±0.129, (p<0.001.Conclusion: Cell phone microwaves (940 MHz increased micronucleus on bone marrow polychromatic erythrocytes of male Balb/C mouse, but green tea had inhibitory effect and it decreased the average number of micronucleus.

  13. Bone and bone marrow scintigraphy in a patient with sickle cell-thalassemia and recurrent pain attacks

    International Nuclear Information System (INIS)

    Mikosch, P.; Gallowitsch, H.-J.; Lind, P.; Jauk, B.; Kaulfersch, W.

    2003-01-01

    The case of an eight years old African boy who suffers from sickle cell-thalassemia is presented. In the course of the disease frequent pain attacks occurred within the abdomen and extremities, recently also within the trunk. Local pain, at some occasions in combination with local swelling and always positive laboratory parameters for inflammation, hindered a solely clinical differentiation between bone infarcts and osteomyelitis. Bone scintigraphy, eventually in combination with bone marrow scintigraphy, can assist the clinician in the differentiation of aseptic bone infarcts versus secondary osteomyelitis. Based on the presented case scintigraphic results for bone infarcts, osteomyelitis and special scintigraphic pattern seen in sickle cell disease are presented. Furthermore, problems regarding the interpretation of the scintigraphies in relation to the delayed time after the beginning of pain attacks are discussed. (author)

  14. Association of murine lupus and thymic full-length endogenous retroviral expression maps to a bone marrow stem cell

    International Nuclear Information System (INIS)

    Krieg, A.M.; Gourley, M.F.; Steinberg, A.D.

    1991-01-01

    Recent studies of thymic gene expression in murine lupus have demonstrated 8.4-kb (full-length size) modified polytropic (Mpmv) endogenous retroviral RNA. In contrast, normal control mouse strains do not produce detectable amounts of such RNA in their thymuses. Prior studies have attributed a defect in experimental tolerance in murine lupus to a bone marrow stem cell rather than to the thymic epithelium; in contrast, infectious retroviral expression has been associated with the thymic epithelium, rather than with the bone marrow stem cell. The present study was designed to determine whether the abnormal Mpmv expression associated with murine lupus mapped to thymic epithelium or to a marrow precursor. Lethally irradiated control and lupus-prone mice were reconstituted with T cell depleted bone marrow; one month later their thymuses were studied for endogenous retroviral RNA and protein expression. Recipients of bone marrow from nonautoimmune donors expressed neither 8.4-kb Mpmv RNA nor surface MCF gp70 in their thymuses. In contrast, recipients of bone marrow from autoimmune NZB or BXSB donors expressed thymic 8.4-kb Mpmv RNA and mink cell focus-forming gp70. These studies demonstrate that lupus-associated 8.4-kb Mpmv endogenous retroviral expression is determined by bone marrow stem cells

  15. Chondroitinase ABC plus bone marrow mesenchymal stem cells for repair of spinal cord injury.

    Science.gov (United States)

    Zhang, Chun; He, Xijing; Li, Haopeng; Wang, Guoyu

    2013-04-15

    As chondroitinase ABC can improve the hostile microenvironment and cell transplantation is proven to be effective after spinal cord injury, we hypothesized that their combination would be a more effective treatment option. At 5 days after T8 spinal cord crush injury, rats were injected with bone marrow mesenchymal stem cell suspension or chondroitinase ABC 1 mm from the edge of spinal cord damage zone. Chondroitinase ABC was first injected, and bone marrow mesenchymal stem cell suspension was injected on the next day in the combination group. At 14 days, the mean Basso, Beattie and Bresnahan score of the rats in the combination group was higher than other groups. Hematoxylin-eosin staining showed that the necrotic area was significantly reduced in the combination group compared with other groups. Glial fibrillary acidic protein-chondroitin sulfate proteoglycan double staining showed that the damage zone of astrocytic scars was significantly reduced without the cavity in the combination group. Glial fibrillary acidic protein/growth associated protein-43 double immunostaining revealed that positive fibers traversed the damage zone in the combination group. These results suggest that the combination of chondroitinase ABC and bone marrow mesenchymal stem cell transplantation contributes to the repair of spinal cord injury.

  16. Mint3 in bone marrow-derived cells promotes lung metastasis in breast cancer model mice.

    Science.gov (United States)

    Hara, Toshiro; Murakami, Yoshinori; Seiki, Motoharu; Sakamoto, Takeharu

    2017-08-26

    Breast cancer is one of the most common cancers in women in the world. Although breast cancer is well treatable at the early stage, patients with distant metastases show a poor prognosis. Data from recent studies using transplantation models indicate that Mint3/APBA3 might promote breast cancer malignancy. However, whether Mint3 indeed contributes to tumor development, progression, or metastasis in vivo remains unclear. To address this, here we examined whether Mint3 depletion affects tumor malignancy in MMTV-PyMT breast cancer model mice. In MMTV-PyMT mice, Mint3 depletion did not affect tumor onset and tumor growth, but attenuated lung metastases. Experimental lung metastasis of breast cancer Met-1 cells derived from MMTV-PyMT mice also decreased in Mint3-depleted mice, indicating that host Mint3 expression affected lung metastasis of MMTV-PyMT-derived breast cancer cells. Further bone marrow transplant experiments revealed that Mint3 in bone marrow-derived cells promoted lung metastasis in MMTV-PyMT mice. Thus, targeting Mint3 in bone marrow-derived cells might be a good strategy for preventing metastasis and improving the prognosis of breast cancer patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Chondroitinase ABC plus bone marrow mesenchymal stem cells for repair of spinal cord injury☆

    Science.gov (United States)

    Zhang, Chun; He, Xijing; Li, Haopeng; Wang, Guoyu

    2013-01-01

    As chondroitinase ABC can improve the hostile microenvironment and cell transplantation is proven to be effective after spinal cord injury, we hypothesized that their combination would be a more effective treatment option. At 5 days after T8 spinal cord crush injury, rats were injected with bone marrow mesenchymal stem cell suspension or chondroitinase ABC 1 mm from the edge of spinal cord damage zone. Chondroitinase ABC was first injected, and bone marrow mesenchymal stem cell suspension was injected on the next day in the combination group. At 14 days, the mean Basso, Beattie and Bresnahan score of the rats in the combination group was higher than other groups. Hematoxylin-eosin staining showed that the necrotic area was significantly reduced in the combination group compared with other groups. Glial fibrillary acidic protein-chondroitin sulfate proteoglycan double staining showed that the damage zone of astrocytic scars was significantly reduced without the cavity in the combination group. Glial fibrillary acidic protein/growth associated protein-43 double immunostaining revealed that positive fibers traversed the damage zone in the combination group. These results suggest that the combination of chondroitinase ABC and bone marrow mesenchymal stem cell transplantation contributes to the repair of spinal cord injury. PMID:25206389

  18. Bone marrow mesenchymal stem cells differentiation and proliferation on the surface of coral implant

    International Nuclear Information System (INIS)

    Al-Salihi, K.A.; Samsudin, A.R.

    2004-01-01

    This study was designed to evaluate the ability of natural coral implant to provide an environment for marrow cells to differentiate into osteoblasts and function suitable for mineralized tissue formation. DNA content, alkaline phosptatase (ALP) activity, calcium (Ca) content and mineralized nodules, were measured at day 3, day 7 and day 14, in rat bone marrow stromal cells cultured with coral discs glass discs, while cells alone and coral disc alone cultured as control. DNA content, ALP activity, Ca content measurements showed no difference between coral, glass and cells groups at 3 day which were higher than control (coral disc alone), but there were higher asurement at day 7 and 14 in the cell cultured on coral than on glass discs, control cells and control coral discs. Mineralized nodules formation (both in area and number) was more predominant on the coral surface than in control groups. These results showed that natural coral implant provided excellent and favorable situation for marrow cell to differentiate to osteoblasts, lead to large amount of mineralized tissue formation on coral surface. This in vitro result could explain the rapid bone bonding of coral in vivo. (Author)

  19. The primary role of murine bone marrow in the production of natural killer cells. A cytokinetic study.

    Science.gov (United States)

    Pollack, S B; Rosse, C

    1987-10-01

    The normal steady state production of natural killer (NK) cells in the bone marrow and spleen was characterized with cytokinetic technics. We developed a protocol to enrich for NK cells in bone marrow and demonstrate that target binding can be used as a criterion for marrow NK cells if nonspecifically "sticky" cells are eliminated. The selected population of B cell-depleted bone marrow lymphoid cells was comprised mainly of lymphocytes, of which 80% were NK-1.1+. B cell-depleted bone marrow lymphocytes that bound to YAC-1 could be characterized as two populations on the basis of morphology and proliferative status: large, proliferating target-binding cells (TBC), of which 25% were in S phase of the mitotic cycle, and small postmitotic TBC. Pulse and chase studies indicated that the small TBC in bone marrow were derived from an immediate proliferating precursor, presumably the large TBC, which were, in turn, derived from a precursor population that was more rapidly proliferating. In contrast, few if any splenic TBC were labeled after a 30-min pulse with [3H]TdR and significant numbers of labeled TBC did not appear in the spleen until 2 or more days after the pulse label. Surprisingly, some of the splenic TBC were relatively long lived and survived 2 mo or longer. These studies are the first to directly characterize the production of NK cells in situ in normal marrow. We demonstrate that the marrow is the primary site of production of NK cells and that little, if any, proliferation of NK cells occurs in the periphery of unstimulated mice. The data suggest the existence in the bone marrow of at least three compartments in the NK lineage: a rapidly proliferating NK precursor population, a less rapidly proliferating population of large TBC, and a population of small postmitotic TBC.

  20. Bone marrow stromal cell transplantation mitigates radiation-induced gastrointestinal syndrome in mice.

    Directory of Open Access Journals (Sweden)

    Subhrajit Saha

    Full Text Available Nuclear accidents and terrorism presents a serious threat for mass casualty. While bone-marrow transplantation might mitigate hematopoietic syndrome, currently there are no approved medical countermeasures to alleviate radiation-induced gastrointestinal syndrome (RIGS, resulting from direct cytocidal effects on intestinal stem cells (ISC and crypt stromal cells. We examined whether bone marrow-derived adherent stromal cell transplantation (BMSCT could restitute irradiated intestinal stem cells niche and mitigate radiation-induced gastrointestinal syndrome.Autologous bone marrow was cultured in mesenchymal basal medium and adherent cells were harvested for transplantation to C57Bl6 mice, 24 and 72 hours after lethal whole body irradiation (10.4 Gy or abdominal irradiation (16-20 Gy in a single fraction. Mesenchymal, endothelial and myeloid population were characterized by flow cytometry. Intestinal crypt regeneration and absorptive function was assessed by histopathology and xylose absorption assay, respectively. In contrast to 100% mortality in irradiated controls, BMSCT mitigated RIGS and rescued mice from radiation lethality after 18 Gy of abdominal irradiation or 10.4 Gy whole body irradiation with 100% survival (p<0.0007 and p<0.0009 respectively beyond 25 days. Transplantation of enriched myeloid and non-myeloid fractions failed to improve survival. BMASCT induced ISC regeneration, restitution of the ISC niche and xylose absorption. Serum levels of intestinal radioprotective factors, such as, R-Spondin1, KGF, PDGF and FGF2, and anti-inflammatory cytokines were elevated, while inflammatory cytokines were down regulated.Mitigation of lethal intestinal injury, following high doses of irradiation, can be achieved by intravenous transplantation of marrow-derived stromal cells, including mesenchymal, endothelial and macrophage cell population. BMASCT increases blood levels of intestinal growth factors and induces regeneration of the irradiated

  1. Chromosomal changes induced in mouse bone marrow cells following six weeks inhalation of cyclohexanol.

    Science.gov (United States)

    Siviková, Katarína; Dianovský, J; Piesová, Elena; Holecková, Beatá

    2007-12-01

    The effects of low doses of cyclohexanol exposure were studied in mouse bone marrow cells including chromosome aberrations (CA), micronucleus (MN) and sister chromatid exchanges (SCE) as biomarkers. Capillaries with a tested agent that was evaporated continuously were placed in an experimental chamber for six weeks. No clastogenic and/or aneugenic effect of CA and MN induction was observed. A significant elevation of induced damage was achieved in the SCE study (p cyclohexanol to mice.

  2. Multilineage differentiation of porcine bone marrow stromal cells associated with specific gene expression pattern

    DEFF Research Database (Denmark)

    Zou, Lijin; Zou, Xuenong; Chen, Li

    2008-01-01

    genes. However, it is not fully clear whether multilineage differentiation (osteogenesis, chondrogenesis, and adipogenesis) of BMSC is associated with a specific gene expression pattern. In the present study, we investigated the gene expression pattern of representative transcription factors and marker......There are increasing reports regarding differentiation of bone marrow stromal cells (BMSC) from human and various species of animals including pigs. The phenotype and function of BMSC along a mesenchymal lineage differentiation are well characterized by specific transcription factors and marker...

  3. Autologous transplantation of bone marrow adult stem cells for the treatment of idiopathic dilated cardiomyopathy.

    Science.gov (United States)

    Westphal, Ricardo João; Bueno, Ronaldo Rocha Loures; Galvão, Paulo Bezerra de Araújo; Zanis Neto, José; Souza, Juliano Mendes; Guérios, Ênio Eduardo; Senegaglia, Alexandra Cristina; Brofman, Paulo Roberto; Pasquini, Ricardo; Cunha, Claudio Leinig Pereira da

    2014-12-01

    Morbimortality in patients with dilated idiopathic cardiomyopathy is high, even under optimal medical treatment. Autologous infusion of bone marrow adult stem cells has shown promising preliminary results in these patients. Determine the effectiveness of autologous transplantation of bone marrow adult stem cells on systolic and diastolic left ventricular function, and on the degree of mitral regurgitation in patients with dilated idiopathic cardiomyopathy in functional classes NYHA II and III. We administered 4,54 x 10(8) ± 0,89 x 10(8) bone marrow adult stem cells into the coronary arteries of 24 patients with dilated idiopathic cardiomyopathy in functional classes NYHA II and III. Changes in functional class, systolic and diastolic left ventricular function and degree of mitral regurgitation were assessed after 3 months, 6 months and 1 year. During follow-up, six patients (25%) improved functional class and eight (33.3%) kept stable. Left ventricular ejection fraction improved 8.9%, 9.7% e 13.6%, after 3, 6 and 12 months (p = 0.024; 0.017 and 0.018), respectively. There were no significant changes neither in diastolic left ventricular function nor in mitral regurgitation degree. A combined cardiac resynchronization and implantable cardioversion defibrillation was implanted in two patients (8.3%). Four patients (16.6%) had sudden death and four patients died due to terminal cardiac failure. Average survival of these eight patients was 2.6 years. Intracoronary infusion of bone marrow adult stem cells was associated with an improvement or stabilization of functional class and an improvement in left ventricular ejection fraction, suggesting the efficacy of this intervention. There were no significant changes neither in left ventricular diastolic function nor in the degree of mitral regurgitation.

  4. Bone marrow-derived mesenchymal stromal cell treatment in patients with severe ischaemic heart failure

    DEFF Research Database (Denmark)

    Mathiasen, Anders Bruun; Qayyum, Abbas Ali; Jørgensen, Erik

    2015-01-01

    AIMS: Regenerative treatment with mesenchymal stromal cells (MSCs) has been promising in patients with ischaemic heart failure but needs confirmation in larger randomized trials. We aimed to study effects of intra-myocardial autologous bone marrow-derived MSC treatment in patients with severe...... identified. CONCLUSION: Intra-myocardial injections of autologous culture expanded MSCs were safe and improved myocardial function in patients with severe ischaemic heart failure. STUDY REGISTRATION NUMBER: NCT00644410 (ClinicalTrials.gov)....

  5. Evaluation of cell regeneration of bone marrow after fractionated irradiation of mouse in toto

    International Nuclear Information System (INIS)

    Maisin, H.; Evercoren, A. van; Anckaert, M.A.; Coster, B.M. de

    1979-01-01

    We have studied the recovery for mice bone marrow cells after fractionated irradiation of the whole body. The additional dose (Dr) to obtain a given biological effect if the irradiation is split in two equal subfractions (2 Di) separated by a short interval of time (i) is 40 rad per day when the interval of time between the two irradiations is lenghtened of one day [fr

  6. Autologous Transplantation of Bone Marrow Adult Stem Cells for the Treatment of Idiopathic Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Ricardo João Westphal

    2014-12-01

    Full Text Available Background: Morbimortality in patients with dilated idiopathic cardiomyopathy is high, even under optimal medical treatment. Autologous infusion of bone marrow adult stem cells has shown promising preliminary results in these patients. Objective: Determine the effectiveness of autologous transplantation of bone marrow adult stem cells on systolic and diastolic left ventricular function, and on the degree of mitral regurgitation in patients with dilated idiopathic cardiomyopathy in functional classes NYHA II and III. Methods: We administered 4,54 x 108 ± 0,89 x 108 bone marrow adult stem cells into the coronary arteries of 24 patients with dilated idiopathic cardiomyopathy in functional classes NYHA II and III. Changes in functional class, systolic and diastolic left ventricular function and degree of mitral regurgitation were assessed after 3 months, 6 months and 1 year. Results: During follow-up, six patients (25% improved functional class and eight (33.3% kept stable. Left ventricular ejection fraction improved 8.9%, 9.7% e 13.6%, after 3, 6 and 12 months (p = 0.024; 0.017 and 0.018, respectively. There were no significant changes neither in diastolic left ventricular function nor in mitral regurgitation degree. A combined cardiac resynchronization and implantable cardioversion defibrillation was implanted in two patients (8.3%. Four patients (16.6% had sudden death and four patients died due to terminal cardiac failure. Average survival of these eight patients was 2.6 years. Conclusion: Intracoronary infusion of bone marrow adult stem cells was associated with an improvement or stabilization of functional class and an improvement in left ventricular ejection fraction, suggesting the efficacy of this intervention. There were no significant changes neither in left ventricular diastolic function nor in the degree of mitral regurgitation.

  7. Antagonistic and synergistic effects of bone morphogenetic protein 2/7 and all-trans retinoic acid on the osteogenic differentiation of rat bone marrow stromal cells

    NARCIS (Netherlands)

    Bi, W.; Gu, Z.; Zheng, Y.; Wang, L.; Guo, J.; Wu, G.

    2013-01-01

    The osteogenesis of bone marrow stromal cells (BMSCs) is of paramount importance for the repair of large-size bone defects, which may be compromised by the dietary-accumulated all-trans retinoic acid (ATRA). We have shown that heterodimeric bone morphogenetic protein 2/7 (BMP2/7) could induce bone

  8. Autologous bone marrow mononuclear cell transplant and surgical decompression in a dog with chronic spinal cord injury.

    Science.gov (United States)

    Tamura, Katsutoshi; Harada, Yasuji; Kunimi, Maki; Takemitsu, Hiroshi; Hara, Yasushi; Nakamura, Tatsuo; Tagawa, Masahiro

    2015-02-01

    In dogs with deep analgesia caused by acute spinal cord injury from thoracolumbar disk herniation, autologous bone marrow mononuclear cell transplant may improve recovery. The purpose of the present study was to evaluate autologous bone marrow mononuclear cell transplant in a dog that had paraplegia and deep analgesia caused by chronic spinal cord injury. Autologous bone marrow mononuclear cell transplant was performed in a dog having paraplegia and analgesia for 3 years that was caused by a chronic spinal cord injury secondary to Hansen type I thoracolumbar disk herniation. Functional recovery was evaluated with electrophysiologic studies and the Texas Spinal Cord Injury Scale. Somatosensory evoked potentials were absent before transplant but were detected after transplant. Functional improvement was noted (Texas Spinal Cord Injury Scale: before transplant, 0; after transplant, 6). No adverse events were observed. Autologous bone marrow mononuclear cell transplant into the subarachnoid space may be a safe and beneficial treatment for chronic spinal cord injury in dogs.

  9. Transplantation of neurotrophin-3-transfected bone marrow mesenchymal stem cells for the repair of spinal cord injury.

    Science.gov (United States)

    Dong, Yuzhen; Yang, Libin; Yang, Lin; Zhao, Hongxing; Zhang, Chao; Wu, Dapeng

    2014-08-15

    Bone marrow mesenchymal stem cell transplantation has been shown to be therapeutic in the repair of spinal cord injury. However, the low survival rate of transplanted bone marrow mesenchymal stem cells in vivo remains a problem. Neurotrophin-3 promotes motor neuron survival and it is hypothesized that its transfection can enhance the therapeutic effect. We show that in vitro transfection of neurotrophin-3 gene increases the number of bone marrow mesenchymal stem cells in the region of spinal cord injury. These results indicate that neurotrophin-3 can promote the survival of bone marrow mesenchymal stem cells transplanted into the region of spinal cord injury and potentially enhance the therapeutic effect in the repair of spinal cord injury.

  10. Osteogenic potential of bone marrow stromal cells on smooth, roughened, and tricalcium phosphate-modified titanium alloy surfaces.

    LENUS (Irish Health Repository)

    Colombo, John S

    2012-09-01

    This study investigated the influence of smooth, roughened, and tricalcium phosphate (TCP)-coated roughened titanium-aluminum-vanadium (Ti-6Al-4V) surfaces on the osteogenic potential of rat bone marrow stromal cells (BMSCs).

  11. Transcriptional Profiling of Bone Marrow Stromal Cells in Response to Porphyromonas gingivalis Secreted Products

    Science.gov (United States)

    Reddi, Durga; Belibasakis, Georgios N.

    2012-01-01

    Periodontitis is an infectious inflammatory disease that destroys the tooth-supporting (periodontal) tissues. Porphyromonas gingivalis is an oral pathogen highly implicated in the pathogenesis of this disease. It can exert its effects to a number of cells, including osteogenic bone marrow stromal cells which are important for homeostastic capacity of the tissues. By employing gene microarray technology, this study aimed to describe the overall transcriptional events (>2-fold regulation) elicited by P. gingivalis secreted products in bone marrow stromal cells, and to dissect further the categories of genes involved in bone metabolism, inflammatory and immune responses. After 6 h of challenge with P. gingivalis, 271 genes were up-regulated whereas 209 genes were down-regulated, whereas after 24 h, these numbers were 259 and 109, respectively. The early (6 h) response was characterised by regulation of genes associated with inhibition of cell cycle, induction of apoptosis and loss of structural integrity, whereas the late (24 h) response was characterised by induction of chemokines, cytokines and their associated intracellular pathways (such as NF-κB), mediators of connective tissue and bone destruction, and suppression of regulators of osteogenic differentiation. The most strongly up-regulated genes were lipocalin 2 (LCN2) and serum amyloid A3 (SAA3), both encoding for proteins of the acute phase inflammatory response. Collectively, these transcriptional changes elicited by P. gingivalis denote that the fundamental cellular functions are hindered, and that the cells acquire a phenotype commensurate with propagated innate immune response and inflammatory-mediated tissue destruction. In conclusion, the global transcriptional profile of bone marrow stromal cells in response to P. gingivalis is marked by deregulated homeostatic functions, with implications in the pathogenesis of periodontitis. PMID:22937121

  12. Persistence of donor-derived protein in host myeloid cells after induced rejection of engrafted allogeneic bone marrow cells

    Science.gov (United States)

    Saito, Toshiki I.; Fujisaki, Joji; Carlson, Alicia L.; Lin, Charles P.; Sykes, Megan

    2014-01-01

    Objective In recipients of allogeneic hematopoietic stem cell transplantation to treat hematologic malignancies, we have unexpectedly observed anti-tumor effects in association with donor cell rejection in both mice and humans. Host-type CD8 T cells were shown to be required for these anti-tumor effects in the murine model. Since sustained host CD8 T cell activation was observed in the murine bone marrow following the disappearance of donor chimerism in the peripheral blood, we hypothesized that donor antigen presentation in the bone marrow might be prolonged. Materials and Methods To assess this hypothesis, we established mixed chimerism with green fluorescence protein (GFP)-positive allogeneic bone marrow cells, induced rejection of the donor cells by giving recipient leukocyte infusions (RLI), and utilized in vivo microscopy to follow GFP-positive cells. Results After peripheral donor leukocytes disappeared, GFP persisted within host myeloid cells surrounding the blood vessels in the bone marrow, suggesting that the host myeloid cells captured donor-derived GFP protein. Conclusions Since the host-versus-graft reaction promotes the induction of anti-tumor responses in this model, this retention of donor-derived protein may play a role in the efficacy of RLI as an anti-tumor therapy. PMID:20167247

  13. Effect of erythropoietin on the glucose transport of rat erythrocytes and bone marrow cells

    International Nuclear Information System (INIS)

    Ghosal, J.; Chakraborty, M.; Biswas, T.; Ganguly, C.K.; Datta, A.G.

    1987-01-01

    The effect of Ep on radioactive glucose and methyl-alpha-D-glucoside transport by rat erythrocytes and bone marrow cells were studied. There is initial linearity followed by saturation kinetics of [ 14 C]glucose transport by the erythrocytes of starved and starved plus Ep-treated rats at different concentrations of glucose. Starvation caused slight inhibition of glucose transport which increased markedly on Ep administration to starved rats. Normal animals failed to show any significant change in glucose transport after Ep treatment. Methyl-alpha-D-glucoside inhibited the Ep-stimulated glucose transport significantly. Ep also stimulated the transport of radioactive methyl-alpha-D-glucoside which was competitively inhibited in presence of D-glucose. Glucose transport in erythrocytes was found to be sensitive to metabolic inhibitors like azide and DNP. A sulfhydryl reagent and ouabain also inhibited the transport process. Ep stimulated glucose and methyl-alpha-D-glucoside transport in the bone marrow cells of starved rats. The sugar analog competitively inhibited the glucose transport in bone marrow cells and vice versa

  14. Case of metastatic basal cell carcinoma to bone marrow, resulting in myelophthisic anemia.

    Science.gov (United States)

    Pham, Catherine M; Syed, Almas A; Siddiqui, Huma A; Keller, Richard A; Kowalewski, Catherine

    2013-04-01

    While basal cell carcinoma (BCC) remains the most common skin cancer, the incidence of metastasis is rare. Most cases of metastatic BCC have been to regional lymph nodes. Metastasis to bone marrow with myelophthisic anemia is especially rare. To our knowledge, there have been only 5 reported cases in literature. We report a sixth case. A 46-year-old male patient presented with an 8 × 7-cm ulcerated plaque on his chest, found to be morpheaform basal cell on pathology. Laboratory findings were notable for normocytic anemia, thrombocytopenia, and elevated LDH. Further work up with bone marrow biopsy revealed tumor cells staining positive for CK AE1/AE3, BerEP4, CK7, CD56, and PIN-4. This confirmed the diagnosis of metastatic BCC (MBCC) to bone marrow. Although the rate of metastasis for BCC is rare, once it occurs, prognosis is poor. MBCC remains a challenge to treat. Therefore, it is critical to resolve the primary BCC and obtain vigilant follow-up, especially in patients with multiple risk factors for MBCC.

  15. Cadaveric bone marrow mesenchymal stem cells: first experience treating a patient with large severe burns.

    Science.gov (United States)

    Mansilla, Eduardo; Marín, Gustavo H; Berges, Mirta; Scafatti, Silvia; Rivas, Jaime; Núñez, Andrea; Menvielle, Martin; Lamonega, Roberto; Gardiner, Cecilia; Drago, Hugo; Sturla, Flavio; Portas, Mercedes; Bossi, Silvia; Castuma, Maria Victoria; Peña Luengas, Sandra; Roque, Gustavo; Martire, Karina; Tau, Jose Maria; Orlandi, Gabriel; Tarditti, Adrian

    2015-01-01

    In January 2005, Rasulov et al. originally published "First experience in the use of bone marrow mesenchymal stem cells (MSCs) for the treatment of a patient with deep skin burns". Here, we present the first ever treated patient with cadaveric bone marrow mesenchymal stem cells (CMSCs) in the history of Medicine. A young man, who severely burned 60 % of his total body surface with 30 % of full-thickness burns while working with a grass trimmer that exploded, was involved in the study. MSCs were obtained from the bone marrow of a cadaver donor in a routine procurement procedure of CUCAIBA, the Province of Buenos Aires, Argentina, Ministry of Health, Transplantation Agency, cultured, expanded, and applied on the burned surfaces using a fibrin spray after early escharotomy. So far, our preliminary experience and our early results have been very impressive showing an outstanding safety data as well as some impressive good results in the use of CMSCs. Based on all this, we think that improvements in the use of stem cells for burns might be possible in the near future and a lot of time as well as many lives could be saved by many other research teams all over the world. CMSCs will probably be a real scientific opportunity in Regenerative Medicine as well as in Transplantation.

  16. Comparison of fracture site callus with iliac crest bone marrow as the source of plastic-adherent cells

    Directory of Open Access Journals (Sweden)

    Achmad Zaki

    2013-05-01

    Full Text Available Background: Red marrow has been described as the main source of mesenchymal stem cells although its aspiration and isolation from bone marrow was reported to have significant donor site morbidity. Since secondary bone healing occurs through formation of callus as the result of proliferation and differentiation of mesenchymal stem cells, callus may become alternative source for mesenchymal stem cells. In this study, we compared the number of plastic-adherent cells from fracture site callus and bone marrow of iliac crest after two and four weeks of culture.Methods: Sixteen New Zealand rabbits were fracturized at the femoral shaft. Then, these rabbits were taken care. After two weeks of fracturization, 3 mL iliac crest bone marrow aspiration and callus extraction of eight rabbits were cultured (group I. The other eight rabbits were treated equally after four weeks of fracturization (group II. Simultaneously, the cultures were observed after one and two weeks. Four weeks later, they were harvested. Cells were counted using Neubauer hemocytometer. The average number of cells between the sources and groups were statistically analyzed using the unpaired t-test. Results: In group I, there were 2.6 ± 0.1 x 104 cells in the culture of iliac crest bone marrow aspirate and 2.5 ± 0.1 x 104 cells in culture of callus extract from fracture site (p = 0.34. In group II, there were 2.7 ± 0.1 x 104 cells and 2.1 ± 0.1 x 104 cells, respectively (p < 0.001.Conclusion: Fracture site callus at the second week post-fracturization may be potential as source of plastic-adherent cells compared with iliac crest bone marrow. (Med J Indones. 2013;22:70-5Keywords: Bone marrow, fracture site callus, iliac crest, long bone, mesenchymal stem cell, plastic-adherent cells

  17. Comparative analysis of curative effect of bone marrow mesenchymal stem cell and bone marrow mononuclear cell transplantation for spastic cerebral palsy.

    Science.gov (United States)

    Liu, Xuebin; Fu, Xiaojun; Dai, Guanghui; Wang, Xiaodong; Zhang, Zan; Cheng, Hongbin; Zheng, Pei; An, Yihua

    2017-02-24

    Bone marrow mesenchymal stem cells (BMMSCs) and bone marrow mononuclear cells (BMMNCs) are both used to treat spastic cerebral palsy. However, the differences in therapeutic effect remain unknown. A total of 105 patients with spastic cerebral palsy were enrolled and randomly assigned to three groups: the BMMSC group, the BMMNC group and the control group. Patients in both transplantation groups received four intrathecal cell injections. Patients in the control group received Bobath therapy. The gross motor function measure (GMFM) and the fine motor function measure (FMFM) were used to evaluate the therapeutic efficacy before transplantation and 3, 6, and 12 months after transplantation. Three months after cell transplantation, scores in the A dimension of GMFM and the A and C dimensions of FMFM scores in the BMMSC group are all higher than those of the BMMNC and the control groups (P < 0.05). Six months after cell transplantation, scores in the A, B dimensions of GMFM and the A, B, C, D, and E dimensions of FMFM scores in the BMMSC group are higher than those of the BMMNC and the control groups (P < 0.05). Twelve months after cell transplantation, scores in the A, B, and C dimensions of GMFM and the A, B, C, D, and E dimensions of FMFM scores in the BMMSC group are all higher than those of the BMMNC and the control groups (P < 0.05). No obvious adverse effects were investigated during follow-up. BMMSC transplantation for the treatment of cerebral palsy is safe and feasible, and can improve gross motor and fine motor function significantly. In addition, compared with BMMNC, the motor function of children improved significantly in terms of gross motor and fine motor functions.

  18. Gene expression profiling of bone marrow mesenchymal stem cells from Osteogenesis Imperfecta patients during osteoblast differentiation.

    Science.gov (United States)

    Kaneto, Carla Martins; Pereira Lima, Patrícia S; Prata, Karen Lima; Dos Santos, Jane Lima; de Pina Neto, João Monteiro; Panepucci, Rodrigo Alexandre; Noushmehr, Houtan; Covas, Dimas Tadeu; de Paula, Francisco José Alburquerque; Silva, Wilson Araújo

    2017-06-01

    Mesenchymal stem cells (MSCs) are precursors present in adult bone marrow that are able to differentiate into osteoblasts, adipocytes and chondroblasts that have gained great importance as a source for cell therapy. Recently, a number of studies involving the analysis of gene expression of undifferentiated MSCs and of MSCs in the differentiation into multiple lineage processes were observed but there is no information concerning the gene expression of MSCs from Osteogenesis Imperfecta (OI) patients. Osteogenesis Imperfecta is characterized as a genetic disorder in which a generalized osteopenia leads to excessive bone fragility and severe bone deformities. The aim of this study was to analyze gene expression profile during osteogenic differentiation from BMMSCs (Bone Marrow Mesenchymal Stem Cells) obtained from patients with Osteogenesis Imperfecta and from control subjects. Bone marrow samples were collected from three normal subjects and five patients with OI. Mononuclear cells were isolated for obtaining mesenchymal cells that had been expanded until osteogenic differentiation was induced. RNA was harvested at seven time points during the osteogenic differentiation period (D0, D+1, D+2, D+7, D+12, D+17 and D+21). Gene expression analysis was performed by the microarray technique and identified several differentially expressed genes. Some important genes for osteoblast differentiation had lower expression in OI patients, suggesting a smaller commitment of these patient's MSCs with the osteogenic lineage. Other genes also had their differential expression confirmed by RT-qPCR. An increase in the expression of genes related to adipocytes was observed, suggesting an increase of adipogenic differentiation at the expense osteogenic differentiation. Copyright © 2017. Published by Elsevier Masson SAS.

  19. The effect of Emdogain on the growth and differentiation of rat bone marrow cells.

    Science.gov (United States)

    van den Dolder, J; Vloon, A P G; Jansen, J A

    2006-10-01

    The major extracellular matrix (ECM) proteins in developing enamel can induce and maintain the formation and mineralization of other skeletal hard tissue, such as bone. Therefore, dental matrix proteins are ideal therapeutic agents when direct formation of functional bone is required for a successful clinical outcome. Emdogain (EMD) consists of enamel matrix proteins which are known to stimulate bone formation. However, only a few studies in the literature have reported the effect of EMD on osteoblast-like cells in vitro. In this study, rat bone marrow cells, obtained from the femora of Wistar rats, were precultured for 7 d in osteogenic medium. Then, the cells were harvested and seeded in 24-well plates at a concentration of 20,000 cells/well. The wells were either precoated with 100 microg/ml EMD, or left uncoated. The seeded cells were cultured in osteogenic medium for 32 d and analysed for cell attachment (by using the Live and Dead assay), cell growth (by determining DNA content) and cell differentiation (by measuring alkaline phosphatase activity and calcium content, and by using scanning electron microscopy and the reverse transcription-polymerase chain reaction). The results showed that at the 4-h time point of the experiment, more cells were attached to EMD-negative wells, but this effect was no longer apparent at 24 h. DNA analysis revealed that both groups showed a similar linear trend of cell growth. No differences in alkaline phosphatase activity or calcium content were observed, and no differences in gene expression (osteocalcin, alkaline phosphatase and collagen type I) were found between the groups. Based on our results, we conclude that EMD had no significant effect on the cell growth and differentiation of rat bone marrow cells.

  20. Recent progress in the differentiation of bone marrow derived ...

    African Journals Online (AJOL)

    ONOS

    2010-08-09

    Aug 9, 2010 ... Bone marrow mesenchymal stem cells (BMMSCs) are one of the cells found in bone marrow stromal. A large number of ..... Bone marrow stromal cell: Nature, Biology, and potential application. Stem cell,. 19(3): 180-192. Cao F, Sun DD, Li CX, Narsinh K, Zhao L, Li X Feng XY, Zhang J,. Duan YY, Wang J, ...

  1. Cigarette Smoking Is Associated with a Lower Concentration of CD105+ Bone Marrow Progenitor Cells

    Directory of Open Access Journals (Sweden)

    Shaul Beyth

    2015-01-01

    Full Text Available Cigarette smoking is associated with musculoskeletal degenerative disorders, delayed fracture healing, and nonunion. Bone marrow progenitor cells (BMPCs, known to express CD105, are important in local trophic and immunomodulatory activity and central to musculoskeletal healing/regeneration. We hypothesized that smoking is associated with lower levels of BMPC. Iliac bone marrow samples were collected from individuals aged 18–65 years during the first steps of pelvic surgery, under IRB approval with informed consent. Patients with active infectious or neoplastic disease, a history of cytotoxic or radiation therapy, primary or secondary metabolic bone disease, or bone marrow dysfunction were excluded. Separation process purity and the number of BMPCs recovered were assessed with FACS. BMPC populations in self-reported smokers and nonsmokers were compared using the two-tailed t-test. 13 smokers and 13 nonsmokers of comparable age and gender were included. The average concentration of BMPCs was 3.52 × 105/mL ± 2.45 × 105/mL for nonsmokers versus 1.31 × 105/mL ± 1.61 × 105/mL for smokers (t= 3.2, P=0.004. This suggests that cigarette smoking is linked to a significant decrease in the concentration of BMPCs, which may contribute to the reduced regenerative capacity of smokers, with implications for musculoskeletal maintenance and repair.

  2. Heterogeneity within the spleen colony-forming cell population in rat bone marrow

    International Nuclear Information System (INIS)

    Martens, A.C.; van Bekkum, D.W.; Hagenbeek, A.

    1986-01-01

    The pluripotent hemopoietic stem cell (HSC) of the rat can be enumerated in a spleen colony assay (SCA) in rats as well as mice. After injection of rat bone marrow into lethally irradiated mice, macroscopically visible spleen colonies (CFU-S) are found from day 6 through 14, but the number varies on consecutive days. In normal bone marrow a constant ratio of day-8 to day-12 colony numbers is observed. However, this ratio is changed after in vivo treatment of rats with cyclophosphamide, as well as after in vitro treatment of rat bone marrow with cyclophosphamide derivatives. This indicates that the CFU-S that form colonies on day 8 react differently to this treatment than the CFU-S that form colonies on day 12, and suggests heterogeneity among the CFU-S population. Posttreatment regrowth of day-8 and day-12 CFU-S is characterized by differences in population-doubling times (Td = 0.85 days vs 1.65 days). Another argument in support of the postulate of heterogeneity within the rat CFU-S population is derived from the fact that (in contrast to normal rat spleen) the spleen of leukemic rats contains high numbers of CFU-S that show a ratio of day-8 to day-12 CFU-S of 4.5, which is different than that observed for a CFU-S population in normal bone marrow (a ratio of 2.4). It is concluded that, in rat hemopoiesis, two populations of spleen colony-forming cells can be distinguished using the rat-to-mouse SCA. This indicates that mouse and rat hemopoiesis are comparable in this respect and that heterogeneity in the stem cell compartment is a general phenomenon

  3. [Immune regulatory effect of human bone marrow mesenchymal stem cells on T lymphocyte].

    Science.gov (United States)

    Lu, Xiao-Xi; Liu, Ting; Meng, Wen-Tong; Zhu, Huan-Ling; Xi, Ya-Ming; Liu, Yong-Mei

    2005-08-01

    To investigate the immune regulatory effects of human bone marrow mesenchymal stem cells on alloantigen T lymphocyte in vitro, human MSCs were isolated and expanded from bone marrow cells, and identified with cell morphology, and the phenotypes were assessed by immunohistochemistry and flow cytometry. As the stimulation factor of T lymphocytes proliferation, either PHA or dendritic cells isolated from cord blood were cocultured with CD2(+) T lymphocytes from peripheral blood mononuclear cells by magnetic beads with or without MSC in 96-well plats for seven days. T cell proliferation was assessed by [(3)H]-thymidine incorporation using a liquid scintillation counter. T cell subsets, Th1, Th2, Tc1 and Tc2 were analyzed by flow cytometry after co-culture of CD2(+) T cells with MSCs for 10 days. The results showed that a significant decrease of CD2(+) T cell proliferation was evident when MSC were added back to T cells stimulated by DC or PHA, and an increase of Th2 and Tc2 subsets were observed after co-culture of MSC with T lymphocytes. It is suggested that allogeneic MSC can suppress T cell proliferation in vitro and the cause of that was partly depend on interaction of cells and the alteration of T cell subsets.

  4. Injectable calcium phosphate with hydrogel fibers encapsulating induced pluripotent, dental pulp and bone marrow stem cells for bone repair.

    Science.gov (United States)

    Wang, Lin; Zhang, Chi; Li, Chunyan; Weir, Michael D; Wang, Ping; Reynolds, Mark A; Zhao, Liang; Xu, Hockin H K

    2016-12-01

    Human induced pluripotent stem cell-derived mesenchymal stem cells (hiPSC-MSCs), dental pulp stem cells (hDPSCs) and bone marrow MSCs (hBMSCs) are exciting cell sources in regenerative medicine. However, there has been no report comparing hDPSCs, hBMSCs and hiPSC-MSCs for bone engineering in an injectable calcium phosphate cement (CPC) scaffold. The objectives of this study were to: (1) develop a novel injectable CPC containing hydrogel fibers encapsulating stem cells for bone engineering, and (2) compare cell viability, proliferation and osteogenic differentiation of hDPSCs, hiPSC-MSCs from bone marrow (BM-hiPSC-MSCs) and from foreskin (FS-hiPSC-MSCs), and hBMSCs in CPC for the first time. The results showed that the injection did not harm cell viability. The porosity of injectable CPC was 62%. All four types of cells proliferated and differentiated down the osteogenic lineage inside hydrogel fibers in CPC. hDPSCs, BM-hiPSC-MSCs, and hBMSCs exhibited high alkaline phosphatase, runt-related transcription factor, collagen I, and osteocalcin gene expressions. Cell-synthesized minerals increased with time (p0.1). Mineralization by hDPSCs, BM-hiPSC-MSCs, and hBMSCs inside CPC at 14d was 14-fold that at 1d. FS-hiPSC-MSCs were inferior in osteogenic differentiation compared to the other cells. In conclusion, hDPSCs, BM-hiPSC-MSCs and hBMSCs are similarly and highly promising for bone tissue engineering; however, FS-hiPSC-MSCs were relatively inferior in osteogenesis. The novel injectable CPC with cell-encapsulating hydrogel fibers may enhance bone regeneration in dental, craniofacial and orthopedic applications. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. CD146/MCAM defines functionality of human bone marrow stromal stem cell populations

    DEFF Research Database (Denmark)

    Harkness, Linda; Zaher, Walid; Ditzel, Nicholas

    2016-01-01

    BACKGROUND: Identification of surface markers for prospective isolation of functionally homogenous populations of human skeletal (stromal, mesenchymal) stem cells (hMSCs) is highly relevant for cell therapy protocols. Thus, we examined the possible use of CD146 to subtype a heterogeneous h......MSC population. METHODS: Using flow cytometry and cell sorting, we isolated two distinct hMSC-CD146(+) and hMSC-CD146(-) cell populations from the telomerized human bone marrow-derived stromal cell line (hMSC-TERT). Cells were examined for differences in their size, shape and texture by using high......-content analysis and additionally for their ability to differentiate toward osteogenesis in vitro and form bone in vivo, and their migrational ability in vivo and in vitro was investigated. RESULTS: In vitro, the two cell populations exhibited similar growth rate and differentiation capacity to osteoblasts...

  6. Autologous bone marrow-derived progenitor cell transplantation for myocardial regeneration after acute infarction

    Directory of Open Access Journals (Sweden)

    Obradović Slobodan

    2004-01-01

    Full Text Available Background. Experimental and first clinical studies suggest that the transplantation of bone marrow derived, or circulating blood progenitor cells, may beneficially affect postinfarction remodelling processes after acute myocardial infarction. Aim. This pilot trial reports investigation of safety and feasibility of autologous bone marrow-derived progenitor cell therapy for faster regeneration of the myocardium after infarction. Methods and results. Four male patients (age range 47-68 years with the first extensive anterior, ST elevation, acute myocardial infarction (AMI, were treated by primary angioplasty. Bone marrow mononuclear cells were administered by intracoronary infusion 3-5 days after the infarction. Bone marrow was harvested by multiple aspirations from posterior cristae iliacae under general anesthesia, and under aseptic conditions. After that, cells were filtered through stainless steel mesh, centrifuged and resuspended in serum-free culture medium, and 3 hours later infused through the catheter into the infarct-related artery in 8 equal boluses of 20 ml. Myocardial viability in the infarcted area was confirmed by dobutamin stress echocardiography testing and single-photon emission computed tomography (SPECT 10-14 days after infarction. One patient had early stent thrombosis immediately before cell transplantation, and was treated successfully with second angioplasty. Single average ECG revealed one positive finding at discharge, and 24-hour Holter ECG showed only isolated ventricular ectopic beats during the follow-up period. Early findings in two patients showed significant improvement of left ventricular systolic function 3 months after the infarction. There were no major cardiac events after the transplantation during further follow-up period (30-120 days after infarction. Control SPECT for the detection of ischemia showed significant improvement in myocardial perfusion in two patients 4 months after the infarction

  7. Bone marrow stromal cell therapy for ischemic stroke: A meta-analysis of randomized control animal trials.

    Science.gov (United States)

    Wu, Qing; Wang, Yuexiang; Demaerschalk, Bart M; Ghimire, Saruna; Wellik, Kay E; Qu, Wenchun

    2017-04-01

    Background Results of animal studies assessing efficacy of bone marrow stromal cell therapy for ischemic stroke remain inconsistent. Aims The aims are to assess efficacy of bone marrow stromal cell therapy for ischemic stroke in animal studies. Methods Randomized controlled animal trials assessing efficacy of bone marrow stromal cell therapy were eligible. Stroke therapy academic industry round table was used to assess methodologic quality of included studies. Primary outcomes were total infarction volume and modified Neurological Severity Score. Multiple prespecified sensitivity analyses and subgroup analyses were conducted. Random effects models were used for meta-analysis. Results Thirty-three randomized animal trials were included with a total of 796 animals. The median quality score was 6 (interquartile range, 5-7). Bone marrow stromal cell therapy decreased total infarction volume (standardized mean difference, 0.897; 95% confidence interval, 0.553-1.241; P animals treated with bone marrow stromal cell and controls was 2.47 (95% confidence interval, 1.84-3.11; P animal studies. Conclusions Bone marrow stromal cell therapy significantly decreased total infarction volume and increased neural functional recovery in randomized controlled animal models of ischemic stroke.

  8. Autologous Bone Marrow-Derived Stem Cells for Treating Diabetic Neuropathy in Metabolic Syndrome

    Directory of Open Access Journals (Sweden)

    Wei Liu

    2017-01-01

    Full Text Available Diabetic neuropathy is one of the most common and serious complications of diabetes mellitus and metabolic syndrome. The current therapy strategies, including glucose control and pain management, are not effective for most patients. Growing evidence suggests that infiltration of inflammation factors and deficiency of local neurotrophic and angiogenic factors contribute significantly to the pathologies of diabetic neuropathy. Experimental and clinical studies have shown that bone marrow-derived stem cells (BMCs therapy represents a novel and promising strategy for tissue repair through paracrine secretion of multiple cytokines, which has a potential to inhibit inflammation and promote angiogenesis and neurotrophy in diabetic neuropathy. In this review, we discuss the clinical practice in diabetic neuropathy and the therapeutic effect of BMC. We subsequently illustrate the functional impairment of autologous BMCs due to the interrupted bone marrow niche in diabetic neuropathy. We anticipate that the functional restoration of BMCs could improve their therapeutic effect and enable their wide applications in diabetic neuropathy.

  9. Chondrogenic potential of mesenchymal stromal cells derived from equine bone marrow and umbilical cord blood

    DEFF Research Database (Denmark)

    Berg, Lise Charlotte; Koch, Thomas Gadegaard; Heerkens, T.

    2009-01-01

    including bone marrow and umbilical cord blood. The objective of this study was to provide an in vitro comparison of the chondrogenic potential in MSC derived from adult bone marrow (BM-MSC) and umbilical cord blood (CB-MSC). Results: MSC from both sources produced tissue with cartilage-like morphology...... CB- and BM-MSC pellets. Protein concentration of cartilage-derived retinoic acid sensitive protein was higher in culture medium from CB- than BM-MSC pellets. Conclusion: CB-MSC and BM-MSC were both capable of producting hyaline-like cartilage in vitro. Howeverm, in this study the MSC from umbilical...... cord blood appeared to have more chondrogenic potential than the BM-MSC based on the cells tested and parameters measured....

  10. Injectable calcium phosphate with hydrogel fibers encapsulating induced pluripotent, dental pulp and bone marrow stem cells for bone repair

    International Nuclear Information System (INIS)

    Wang, Lin; Zhang, Chi; Li, Chunyan; Weir, Michael D.; Wang, Ping; Reynolds, Mark A.; Zhao, Liang; Xu, Hockin H.K.

    2016-01-01

    Human induced pluripotent stem cell-derived mesenchymal stem cells (hiPSC-MSCs), dental pulp stem cells (hDPSCs) and bone marrow MSCs (hBMSCs) are exciting cell sources in regenerative medicine. However, there has been no report comparing hDPSCs, hBMSCs and hiPSC-MSCs for bone engineering in an injectable calcium phosphate cement (CPC) scaffold. The objectives of this study were to: (1) develop a novel injectable CPC containing hydrogel fibers encapsulating stem cells for bone engineering, and (2) compare cell viability, proliferation and osteogenic differentiation of hDPSCs, hiPSC-MSCs from bone marrow (BM-hiPSC-MSCs) and from foreskin (FS-hiPSC-MSCs), and hBMSCs in CPC for the first time. The results showed that the injection did not harm cell viability. The porosity of injectable CPC was 62%. All four types of cells proliferated and differentiated down the osteogenic lineage inside hydrogel fibers in CPC. hDPSCs, BM-hiPSC-MSCs, and hBMSCs exhibited high alkaline phosphatase, runt-related transcription factor, collagen I, and osteocalcin gene expressions. Cell-synthesized minerals increased with time (p < 0.05), with no significant difference among hDPSCs, BM-hiPSC-MSCs and hBMSCs (p > 0.1). Mineralization by hDPSCs, BM-hiPSC-MSCs, and hBMSCs inside CPC at 14 d was 14-fold that at 1 d. FS-hiPSC-MSCs were inferior in osteogenic differentiation compared to the other cells. In conclusion, hDPSCs, BM-hiPSC-MSCs and hBMSCs are similarly and highly promising for bone tissue engineering; however, FS-hiPSC-MSCs were relatively inferior in osteogenesis. The novel injectable CPC with cell-encapsulating hydrogel fibers may enhance bone regeneration in dental, craniofacial and orthopedic applications. - Highlights: • The osteogenic differentiation of hiPSC-MSCs from different origins, hDPSCs and hBMSCs were first investigated and compared in this study. • hDPSCs and hiPSC-MSCs from bone marrow represented viable alternatives to hBMSCs in bone tissue engineering. • hi

  11. Bone marrow toxicity in mice treated with Indium-114m-Labelled blood cells

    Energy Technology Data Exchange (ETDEWEB)

    Hoyes, K. P.; Wadeson, P. J.; Lord, B. I. [University of Manchester, Paterson Institute for Cancer Research, Cancer Research Campaign, Dept. of Experimental Haematology, Manchester (United Kingdom); Cowan, R. A. [University of Manchester, Christie Hospital, North Western Medical Physics Dept., Dept. of Clinical Oncology, Manchester (United Kingdom); Sharma, H. L. [University of Manchester, Dept. of Imaging Science and Biomedical Engineering, Manchester (United Kingdom)

    2001-12-01

    Clinical trials with autologous indium-114m-labelled lymphocytes have revealed significant anti-tumour effects in chronic lymphocytic leukaemia patients with highly resistant disease. Substitution of the lymphocyte vector with heat-damaged red blood cells (HDRBC) may make this treatment more universally applicable and reduce the dose-limiting myelosuppression encountered with labelled lymphocytes. Therefore, the bone marrow localization and toxicities of indium-labelled lymphocytes or HDRBC have been investigated in BDF1 mice. At 24 hours approximately 4% and 1.2% of {sup 114}In{sup m} administered as labelled lymphocytes or HDRBC respectively was localized within the bone marrow and remained constant for 57 days thereafter. Toxicity towards bone marrow stem cells, measured as CFU-S, was equivalent for both cellular vectors. However, at clinically relevant activities, {sup 114}In{sup m} HDRBC were less toxic than labelled lymphocytes towards committed progenitors, assayed as in vitro-CFC and CFU-Meg. These data suggest that substitution of HDRBC for lymphocytes as the {sup 114}In{sup m} vector may be beneficial in reducing the myelosuppression associated with this technique.

  12. Radioprotective effects of hawthorn fruit extract against gamma irradiation in mouse bone marrow cells

    International Nuclear Information System (INIS)

    Hosseinimehr, S.J.; Azadbakht, M.; Mousavi, S.M.; Mahmoudzadeh, A.; Akhlaghpoor, S.

    2007-01-01

    The radioprotective effect of hawthorn (Crataegus microphylla) fruit extract against genotoxicity induced by gamma irradiation has been investigated in mouse bone marrow cells. A single intraperitoneal (ip) administration of hawthorn extract at doses of 25, 50, 100 and 200 mg/kg 1 h prior to gamma irradiation (2 Gy) reduced the frequencies of micronucleated polychromatic erythrocytes (MnPCEs). All four doses of hawthorn extract significantly reduced the frequencies of MnPCEs and increased the PCE/PCE+NCE ratio (polychromatic erythrocyte/polychromatic erythrocyte+normochromatic erythrocyte) in mice bone marrow compared with the non drug-treated irradiated control (p<0.02-0.00001). The maximum reduction in MnPCEs was observed in mice treated with extract at a dose of 200 mg/kg. Administration of amifostine at dose 100 mg/kg and hawthorn at dose 200 mg/kg reduced the frequency of MnPCE almost 4.8 and 5.7 fold; respectively, after being exposed to 2 Gy of gamma rays, compare with the irradiated control group. Crataegus extract exhibited concentration-dependent activity on 1, 1-diphenyl 2-picrylhydrazyl free radical showing that Crataegus contained high amounts of phenolic compounds and the high performance liquid chromatography (HPLC) analysis determined that it contained chlorogenic acid, epicatechin and hyperoside. It appeared that hawthorn extract with antioxidant activity reduced the genotoxicity induced by gamma irradiation in bone marrow cells. (author)

  13. Activation of Cannabinoid Receptor 2 Enhances Osteogenic Differentiation of Bone Marrow Derived Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Yong-Xin Sun

    2015-01-01

    Full Text Available Bone marrow derived mesenchymal stem cells (BM-MSCs are considered as the most promising cells source for bone engineering. Cannabinoid (CB receptors play important roles in bone mass turnover. The aim of this study is to test if activation of CB2 receptor by chemical agonist could enhance the osteogenic differentiation and mineralization in bone BM-MSCs. Alkaline phosphatase (ALP activity staining and real time PCR were performed to test the osteogenic differentiation. Alizarin red staining was carried out to examine the mineralization. Small interference RNA (siRNA was used to study the role of CB2 receptor in osteogenic differentiation. Results showed activation of CB2 receptor increased ALP activity, promoted expression of osteogenic genes, and enhanced deposition of calcium in extracellular matrix. Knockdown of CB2 receptor by siRNA inhibited ALP activity and mineralization. Results of immunofluorescent staining showed that phosphorylation of p38 MAP kinase is reduced by knocking down of CB2 receptor. Finally, bone marrow samples demonstrated that expression of CB2 receptor is much lower in osteoporotic patients than in healthy donors. Taken together, data from this study suggested that activation of CB2 receptor plays important role in osteogenic differentiation of BM-MSCs. Lack of CB2 receptor may be related to osteoporosis.

  14. T Regulatory Cells Support Plasma Cell Populations in the Bone Marrow

    Directory of Open Access Journals (Sweden)

    Arielle Glatman Zaretsky

    2017-02-01

    Full Text Available Long-lived plasma cells (PCs in the bone marrow (BM are a critical source of antibodies after infection or vaccination, but questions remain about the factors that control PCs. We found that systemic infection alters the BM, greatly reducing PCs and regulatory T (Treg cells, a population that contributes to immune privilege in the BM. The use of intravital imaging revealed that BM Treg cells display a distinct behavior characterized by sustained co-localization with PCs and CD11c-YFP+ cells. Gene expression profiling indicated that BM Treg cells express high levels of Treg effector molecules, and CTLA-4 deletion in these cells resulted in elevated PCs. Furthermore, preservation of Treg cells during systemic infection prevents PC loss, while Treg cell depletion in uninfected mice reduced PC populations. These studies suggest a role for Treg cells in PC biology and provide a potential target for the modulation of PCs during vaccine-induced humoral responses or autoimmunity.

  15. Dendritic cells derived from HOXB4-immortalized hematopoietic bone marrow cells.

    Science.gov (United States)

    Baru, Abdul Mannan; Krishnaswamy, Jayendra Kumar; Rathinasamy, Anchana; Scherr, Michaela; Eder, Matthias; Behrens, Georg M N

    2011-11-01

    Dendritic cells (DCs) are essential for the generation and modulation of cell-mediated adaptive immunity against infections. DC-based vaccination involves transplantation of ex vivo-generated DCs loaded with antigen in vitro, but remains limited by the number of autologous or allogeneic cells. While in vitro expansion and differentiation of hematopoietic stem cells (HSCs) into DCs seems to be the most viable alternative to overcome this problem, the complexity of HSC expansion in vitro has posed significant limitations for clinical application. We immortalized lineage-depleted murine hematopoietic bone marrow (lin(-)BM) cells with HOXB4, and differentiated them into CD11c(+)MHCII(+) DCs. These cells showed the typical DC phenotype and upregulated surface expression of co-stimulatory molecules on stimulation with various toll-like receptor ligands. These DCs efficiently presented exogenous antigen to T-cells via major histocompatibility complex (MHC) I and II and viral antigen on infection. Finally, they showed migratory capacity and were able to generate antigen-specific primed T-cells in vivo. In summary, we provide evidence that HOXB4-transduced lin(-)BM cells can serve as a viable means of generating fully functional DCs for scientific and therapeutic applications.

  16. The Phenotypic Fate of Bone Marrow-Derived Stem Cells in Acute Kidney Injury

    Directory of Open Access Journals (Sweden)

    Guowei Feng

    2013-11-01

    Full Text Available Background: Despite increasing attention on the role of bone marrow derived stem cells in repair or rejuvenation of tissues and organs, cellular mechanisms of such cell-based therapy remain poorly understood. Methods: We reconstituted hematopoiesis in recipient C57BL/6J mice by transplanting syngeneic GFP+ bone marrow (BM cells. Subsequently, the recipients received subcutaneous injection of granulocyte-colony stimulating factor (G-CSF and were subjected to acute renal ischemic injury. Flow cytometry and immunostaining were performed at various time points to assess engraftment and phenotype of BM derived stem cells. Results: Administration of G-CSF increased the release of BM derived stem cells into circulation and enhanced the ensuing recruitment of BM derived stem cells into injured kidney. During the second month post injury, migrated BM derived stem cells lost hematopoietic phenotype (CD45 but maintained the expression of other markers (Sca-1, CD133 and CD44, suggesting their potential of transdifferentiation into renal stem cells. Moreover, G-CSF treatment enhanced the phenotypic conversion. Conclusion: Our work depicted a time-course dependent transition of phenotypic characteristics of BM derived stem cells, demonstrated the existence of BM derived stem cells in damaged kidney and revealed the effects of G-CSF on cell transdifferentiation.

  17. Association between in vivo bone formation and ex vivo migratory capacity of human bone marrow stromal cells

    DEFF Research Database (Denmark)

    Andersen, Rikke K; Zaher, Walid; Larsen, Kenneth H

    2015-01-01

    INTRODUCTION: There is a clinical need for developing systemic transplantation protocols for use of human skeletal stem cells (also known bone marrow stromal stem cells) (hBMSC) in tissue regeneration. In systemic transplantation studies, only a limited number of hBMSC home to injured tissues...... by bioluminescence imaging (BLI). In order to identify the molecular phenotype associated with enhanced migration, we carried out comparative DNA microarray analysis of gene expression of hBMSC-derived high bone forming (HBF) clones versus low bone forming (LBF) clones. RESULTS: HBF clones were exhibited higher ex...... vivo transwell migration and following intravenous injection, better in vivo homing ability to bone fracture when compared to LBF clones. Comparative microarray analysis of HBF versus LBF clones identified enrichment of gene categories of chemo-attraction, adhesion and migration associated genes. Among...

  18. Multiple intracellular signaling pathways orchestrate adipocytic differentiation of human bone marrow stromal stem cells

    DEFF Research Database (Denmark)

    Ayesh Hafez Ali, Dalia; Abuelreich, Sarah; Alkeraishan, Nora

    2018-01-01

    Bone marrow adipocyte formation plays a role in bone homeostasis and whole body energy metabolism. However, the transcriptional landscape and signaling pathways associated with adipocyte lineage commitment and maturation are not fully delineated. Thus, we performed global gene expression profilin...

  19. Origins and Properties of Dental, Thymic, and Bone Marrow Mesenchymal Cells and Their Stem Cells

    Science.gov (United States)

    Komada, Yukiya; Yamane, Toshiyuki; Kadota, Daiji; Isono, Kana; Takakura, Nobuyuki; Hayashi, Shin-Ichi; Yamazaki, Hidetoshi

    2012-01-01

    Mesenchymal cells arise from the neural crest (NC) or mesoderm. However, it is difficult to distinguish NC-derived cells from mesoderm-derived cells. Using double-transgenic mouse systems encoding P0-Cre, Wnt1-Cre, Mesp1-Cre, and Rosa26EYFP, which enabled us to trace NC-derived or mesoderm-derived cells as YFP-expressing cells, we demonstrated for the first time that both NC-derived (P0- or Wnt1-labeled) and mesoderm-derived (Mesp1-labeled) cells contribute to the development of dental, thymic, and bone marrow (BM) mesenchyme from the fetal stage to the adult stage. Irrespective of the tissues involved, NC-derived and mesoderm-derived cells contributed mainly to perivascular cells and endothelial cells, respectively. Dental and thymic mesenchyme were composed of either NC-derived or mesoderm-derived cells, whereas half of the BM mesenchyme was composed of cells that were not derived from the NC or mesoderm. However, a colony-forming unit-fibroblast (CFU-F) assay indicated that CFU-Fs in the dental pulp, thymus, and BM were composed of NC-derived and mesoderm-derived cells. Secondary CFU-F assays were used to estimate the self-renewal potential, which showed that CFU-Fs in the teeth, thymus, and BM were entirely NC-derived cells, entirely mesoderm-derived cells, and mostly NC-derived cells, respectively. Colony formation was inhibited drastically by the addition of anti-platelet–derived growth factor receptor-β antibody, regardless of the tissue and its origin. Furthermore, dental mesenchyme expressed genes encoding critical hematopoietic factors, such as interleukin-7, stem cell factor, and cysteine-X-cysteine (CXC) chemokine ligand 12, which supports the differentiation of B lymphocytes and osteoclasts. Therefore, the mesenchymal stem cells found in these tissues had different origins, but similar properties in each organ. PMID:23185234

  20. Constant post-irradiation repopulation rates and linear relationship between cellular blood response and number of transplanted bone marrow cells in inbread mice

    International Nuclear Information System (INIS)

    Petersen, B.H.

    1977-01-01

    Graded doses of syngeneic bone marrow cells were transplanted into lethally irradiated mice. Repopulation curves of peripheral blood granulocytes and platelets were apparently exponential and parallel after doses larger than 5 x 10 5 cells. The blood platelet sub(d) was reduced from 111 h to 53-57 h, and granulocyte Tsub(d) from 57 to 40 h in transplanted groups. The mean blood cell counts were reproducible to be used as a biological assay of the amount of bone marrow cells transplanted. Linear relationship between increment of blood cells up to day 16 and number of bone marrow cells transplanted on day 1 was demonstrated (1,200 granulocytes and 14,300 platelets/μl blood per 10 5 bone marrow cells). The linearity suggested a mean Tsub(d) < 22.5 h of proliferating bone marrow cells, and allowed a rough estimation of mouse bone marrow stem cell radiosensitivity (Dsub(o) 76 rad). (author)

  1. A simple and efficient method for deriving neurospheres from bone marrow stromal cells

    International Nuclear Information System (INIS)

    Yang Qin; Mu Jun; Li Qi; Li Ao; Zeng Zhilei; Yang Jun; Zhang Xiaodong; Tang Jin; Xie Peng

    2008-01-01

    Bone marrow stromal cells (MSCs) can be differentiated into neuronal and glial-like cell types under appropriate experimental conditions. However, previously reported methods are complicated and involve the use of toxic reagents. Here, we present a simplified and nontoxic method for efficient conversion of rat MSCs into neurospheres that express the neuroectodermal marker nestin. These neurospheres can proliferate and differentiate into neuron, astrocyte, and oligodendrocyte phenotypes. We thus propose that MSCs are an emerging model cell for the treatment of a variety of neurological diseases

  2. Radiosensitivity of hemopoietic stem cells on cloning in bone marrow and spleen

    International Nuclear Information System (INIS)

    Shvets, V.N.; Shafirkin, A.V.

    1979-01-01

    It was shown that population of stem cells from bone marrow of mice is heterogenous by radiosensitivity. A 55%-survival of CFU is exponential function of radiation dose (D 0 -9 rad). A dose-effect curve for radioresistant part of the population (D 0 =180 rad) is sygmoid (Dsub(q)=130 rad). Radiosensitive CFU are suggested to represent a primarily committed fraction of half-semi cells, and radioresistant CFU are referable to a pool of pluripotent stem cells. Heterogenous nature of CFU population is proved with different modifications of radiation effect and interactions of CFU with T-lymphocytes

  3. Bone Marrow-Derived Mesenchymal Stromal Cells from Patients with Sickle Cell Disease Display Intact Functionality.

    Science.gov (United States)

    Stenger, Elizabeth O; Chinnadurai, Raghavan; Yuan, Shala; Garcia, Marco; Arafat, Dalia; Gibson, Greg; Krishnamurti, Lakshmanan; Galipeau, Jacques

    2017-05-01

    Hematopoietic cell transplantation (HCT) is the only cure for sickle cell disease (SCD), but engraftment remains challenging in patients lacking matched donors. Infusion of mesenchymal stromal cells (MSCs) at the time of HCT may promote hematopoiesis and ameliorate graft-versus-host disease. Experimental murine models suggest MSC major histocompatibility complex compatibility with recipient impacts their in vivo function, suggesting autologous MSCs could be superior to third-party MSCs for promoting HCT engraftment. Here we tested whether bone marrow (BM)-derived MSCs from SCD subjects have comparable functionality compared with MSCs from healthy volunteers. SCD MSC doubling time and surface marker phenotype did not differ significantly from non-SCD. Third-party and autologous (SCD) T cell proliferation was suppressed in a dose-dependent manner by all MSCs. SCD MSCs comparably expressed indoleamine-2,3-dioxygenase, which based on transwell and blocking experiments appeared to be the dominant immunomodulatory pathway. The expression of key genes involved in hematopoietic stem cell (HSC)-MSC interactions was minimally altered between SCD and non-SCD MSCs. Expression was, however, altered by IFN-γ stimulation, particularly CXCL14, CXCL26, CX3CL1, CKITL, and JAG1, indicating the potential to augment MSC expression by cytokine stimulation. These data demonstrate the feasibility of expanding BM-derived MSCs from SCD patients that phenotypically and functionally do not differ per International Society of Cell Therapy essential criteria from non-SCD MSCs, supporting initial evaluation (primarily for safety) of autologous MSCs to enhance haploidentical HSC engraftment in SCD. Copyright © 2017 The American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.

  4. Differentiation of osteomyelitis and infarction in sickle-cell hemoglobinopathies using combined bone-marrow and gallium scanning

    International Nuclear Information System (INIS)

    Hatfield, M.K.; Kahn, C.E.; Ryan, J.W.; Martin, W.B.

    1986-01-01

    The clinical records and scintigrams of patients with sickle cell hemoglobinopathies in whom acute symptoms developed suggestive of possible osteomyelitis and who had undergone sequential Tc-99m bone marrow scans and gallium scintigraphy of the affected sites were reviewed. Osteomyelitis was correctly diagnosed in six of 18 cases when gallium was focally increased relative to a site of decreased or absent bone marrow activity. Of 12 episodes of infarction, both studies showed focally decreased activity in a concordant manner in 11. The remaining, false-positive study indicated slightly increased gallium in 11. The remaining, false-positive indicated slightly increased gallium concentration at a site of decreased bone marrow activity. Overall, a protocol of sequential Tc-99m bone marrow scans and gallium scintigraphy is an effective means of distinguishing osteomyelitis from infarction in patients with sickle cell hemoglobinopathies

  5. Enhancement of the repair of dog alveolar cleft by an autologous iliac bone, bone marrow-derived mesenchymal stem cell, and platelet-rich fibrin mixture.

    Science.gov (United States)

    Yuanzheng, Chen; Yan, Gao; Ting, Li; Yanjie, Fu; Peng, Wu; Nan, Bai

    2015-05-01

    Autologous bone graft has been regarded as the criterion standard for the repair of alveolar cleft. However, the most prominent issue in alveolar cleft treatment is the high absorption rate of the bone graft. The authors' objective was to investigate the effects of an autologous iliac bone, bone marrow-derived mesenchymal stem cell, and platelet-rich fibrin mixture on the repair of dog alveolar cleft. Twenty beagle dogs with unilateral alveolar clefts created by surgery were divided randomly into four groups: group A underwent repair with an autologous iliac bone, bone marrow-derived mesenchymal stem cell, and platelet-rich fibrin mixture; group B underwent repair with autologous iliac bone and bone marrow-derived mesenchymal stem cells; group C underwent repair with autologous iliac bone and platelet-rich fibrin; and group D underwent repair with autologous iliac bone as the control. One day and 6 months after transplantation, the transplant volumes and bone mineral density were assessed by quantitative computed tomography. All of the transplants were harvested for hematoxylin and eosin staining 6 months later. Bone marrow-derived mesenchymal stem cells and platelet-rich fibrin transplants formed the greatest amounts of new bone among the four groups. The new bone formed an extensive union with the underlying maxilla in groups A, B, and C. Transplants with the bone marrow-derived mesenchymal stem cells, platelet-rich fibrin, and their mixture retained the majority of their initial volume, whereas the transplants in the control group showed the highest absorption rate. Bone mineral density of transplants with the bone marrow-derived mesenchymal stem cells, platelet-rich fibrin, and their mixture 6 months later was significantly higher than in the control group (p bone marrow-derived mesenchymal stem cells and platelet-rich fibrin mixed transplants. Hematoxylin and eosin staining showed that the structure of new bones formed the best in group A. Both bone marrow

  6. Bone marrow-derived thymic antigen-presenting cells determine self-recognition of Ia-restricted T lymphocytes

    International Nuclear Information System (INIS)

    Longo, D.L.; Kruisbeek, A.M.; Davis, M.L.; Matis, L.A.

    1985-01-01

    The authors previously have demonstrated that in radiation-induced bone marrow chimeras, T-cell self-Ia restriction specificity appeared to correlate with the phenotype of the bone marrow-derived antigen-presenting (or dendritic) cell in the thymus during T-cell development. However, these correlations were necessarily indirect because of the difficulty in assaying thymic function directly by adult thymus transplant, which has in the past been uniformly unsuccessful. They now report success in obtaining functional T cells from nude mice grafted with adult thymuses reduced in size by treatment of the thymus donor with anti-thymocyte globulin and cortisone. When (B10 Scn X B10.D2)F1 nude mice (I-Ab,d) are given parental B10.D2 (I-Ad) thymus grafts subcutaneously, their T cells are restricted to antigen recognition in association with I-Ad gene products but not I-Ab gene products. Furthermore, thymuses from (B10 X B10.D2)F1 (I-Ab,d)----B10 (I-Ab) chimeras transplanted 6 months or longer after radiation (a time at which antigen-presenting cell function is of donor bone marrow phenotype) into (B10 X B10.D2)F1 nude mice generate T cells restricted to antigen recognition in association with both I-Ad and I-Ab gene products. Thymuses from totally allogeneic bone marrow chimeras appear to generate T cells of bone marrow donor and thymic host restriction specificity. Thus, when thymus donors are radiation-induced bone marrow chimeras, the T-cell I-region restriction of the nude mice recipients is determined at least in part by the phenotype of the bone marrow-derived thymic antigen presenting cells or dendritic cells in the chimeric thymus

  7. The effect of fresh bone marrow cells on reconstruction of mouse calvarial defect combined with calvarial osteoprogenitor cells and collagen-apatite scaffold.

    Science.gov (United States)

    Yu, Xiaohua; Wang, Liping; Peng, Fei; Jiang, Xi; Xia, Zengmin; Huang, Jianping; Rowe, David; Wei, Mei

    2013-12-01

    Fresh bone marrow cells have already exhibited its advantages as osteogenic donor cells, but the combination between fresh bone marrow cells and other donor cells utilized for bone healing has not been fully explored. To highlight the impact of fresh bone marrow cells on scaffold-based bone regeneration, single or a combination of calvarial osteoprogenitor cells (OPCs) and bone marrow cells (BMCs) were used as donor cells combined with collagen-apatite scaffold for calvarial defect healing. The host and donor contributions to bone formation were assessed using histological and GFP imaging analysis. Although the amount of new bone formed by different cell sources did not show significant differences, the origin of the bone formation in the defects mainly depended on the types of donor cells employed: when only calvarial OPCs were used as donor cells, a donor-derived bone healing instead of host-derived bone ingrowth was observed; when only fresh BMCs were loaded, the host bone could grow into the defect along the lamellar structure of the scaffolds, but the amount of new bone formed was significantly lower than the defect loaded with calvarial OPCs only. The combination of calvarial OPCs and fresh BMCs had similar amount of new bone formation as the group loaded with calvarial osteoprogenitors alone, but did not induce any host-derived bone formation. These results provide compelling evidence of the importance of fresh BMCs to induce host-implant integration in bone tissue engineering. Copyright © 2012 John Wiley & Sons, Ltd.

  8. Schwann cells promote neuronal differentiation of bone marrow ...

    African Journals Online (AJOL)

    Administrator

    2011-04-25

    Apr 25, 2011 ... Schwann cells lose myelin, are activated and proliferate within the distal nerve segment to produce a variety of neurotrophic factors, cytokines and cell adhesion molecules thereby providing the path- way for regenerating axons. This process is collectively called Wallerian degeneration (Fawcet et al., 1990; ...

  9. Schwann cells promote neuronal differentiation of bone marrow ...

    African Journals Online (AJOL)

    It has been suggested that the BMSCs have the capacity to differentiate into neurons under specific experimental conditions, using chemical factors. In this study, we showed that BMSCs can be induced to differentiate into neuron-like cells when they are co-cultured with Schwann cells by Brdu pulse label technology.

  10. The role of bone marrow derived mesenchymal stem cells in ...

    African Journals Online (AJOL)

    Stroke is the third most common cause of death, and a leading cause of physical disability in adults. Recovery after a major stroke is usually limited, but cell therapy, especially by application of mesenchymal stem cells (MSCs) is emerging with fixed neurologic deficits. The aim of the current study was directed to isolation ...

  11. Bone marrow mesenchymal stem cells stimulate proliferation and neuronal differentiation of retinal progenitor cells.

    Directory of Open Access Journals (Sweden)

    Jing Xia

    Full Text Available During retina development, retinal progenitor cell (RPC proliferation and differentiation are regulated by complex inter- and intracellular interactions. Bone marrow mesenchymal stem cells (BMSCs are reported to express a variety of cytokines and neurotrophic factors, which have powerful trophic and protective functions for neural tissue-derived cells. Here, we show that the expanded RPC cultures treated with BMSC-derived conditioned medium (CM which was substantially enriched for bFGF and CNTF, expressed clearly increased levels of nuclear receptor TLX, an essential regulator of neural stem cell (NSC self-renewal, as well as betacellulin (BTC, an EGF-like protein described as supporting NSC expansion. The BMSC CM- or bFGF-treated RPCs also displayed an obviously enhanced proliferation capability, while BMSC CM-derived bFGF knocked down by anti-bFGF, the effect of BMSC CM on enhancing RPC proliferation was partly reversed. Under differentiation conditions, treatment with BMSC CM or CNTF markedly favoured RPC differentiation towards retinal neurons, including Brn3a-positive retinal ganglion cells (RGCs and rhodopsin-positive photoreceptors, and clearly diminished retinal glial cell differentiation. These findings demonstrate that BMSCs supported RPC proliferation and neuronal differentiation which may be partly mediated by BMSC CM-derived bFGF and CNTF, reveal potential limitations of RPC culture systems, and suggest a means for optimizing RPC cell fate determination in vitro.

  12. CELL EXPANSION-DEPENDENT INFLAMMATORY AND METABOLIC PROFILE OF HUMAN BONE MARROW MESENCHYMAL STEM CELLS

    Directory of Open Access Journals (Sweden)

    PATRICIA PRIETO

    2016-11-01

    Full Text Available Stem cell therapy has emerged as a promising new area in regenerative medicine allowing the recovery of viable tissues. Among the many sources of adult stem cells, bone marrow-derived are easy to expand in culture via plastic adherence and their multipotentiality for differentiation make them ideal for clinical applications. Interestingly, several studies have indicated that MSCs expansion in vitro may be limited mainly due to cell aging related to the number of cell divisions in culture. We have determined that MSCs exhibit a progressive decline across successive passages in the expression of stem cell markers, in plasticity and in the inflammatory response, presenting low immunogenicity. We have exposed human MSCs after several passages to TLRs ligands and analyzed their inflammatory response. These cells responded to pro-inflammatory stimuli (i.e., NOS-2 expression and to anti-inflammatory cytokines (i.e., HO1 and Arg1 until two expansions, rapidly declining upon subculture. Moreover, in the first passages, MSCs were capable to release IL1β, IL6 and IL8, as well as to produce active MMPs allowing them to migrate. Interestingly enough, after two passages, anaerobic glycolysis was enhanced releasing high levels of lactate to the extracellular medium. All these results may have important implications for the safety and efficacy of MSCs-based cell therapies.

  13. Lymphoid Infiltrates in B Cell Non Hodgkin’s Lymphoma: Comparing Nuclear Characteristics between Lymph Node and Bone Marrow; and Evaluating Diagnostic Features of Bone Marrow Infiltrates in Paraffin Embedded Tissues

    Directory of Open Access Journals (Sweden)

    Mark H. Deverell

    1997-01-01

    Full Text Available Distinguishing non Hodgkin’s lymphoma from benign lymphoid aggregates in bone marrow is well recognised to be difficult. Our objective was to evaluate nuclear morphology, and to perform morphometry on benign and neoplastic lymphoid infiltrates, to establish if objective criteria were of value in the diagnosis of neoplasia. By comparing neoplastic infiltrates in bone marrow with infiltrates in lymph nodes, the validity of grading non Hodgkin’s lymphoma on the basis of bone marrow histology alone was assessed. 82 cases of B cell non Hodgkin’s lymphoma (44 low grade and 38 high grade, known to have both lymph node and bone marrow involvement at the time of presentation, were compared with bone marrow trephines containing reactive lymphoid infiltrates.

  14. Epithelial cells derived from swine bone marrow express stem cell markers and support influenza virus replication in vitro.

    Directory of Open Access Journals (Sweden)

    Mahesh Khatri

    Full Text Available The bone marrow contains heterogeneous population of cells that are involved in the regeneration and repair of diseased organs, including the lungs. In this study, we isolated and characterized progenitor epithelial cells from the bone marrow of 4- to 5-week old germ-free pigs. Microscopically, the cultured cells showed epithelial-like morphology. Phenotypically, these cells expressed the stem cell markers octamer-binding transcription factor (Oct4 and stage-specific embryonic antigen-1 (SSEA-1, the alveolar stem cell marker Clara cell secretory protein (Ccsp, and the epithelial cell markers pan-cytokeratin (Pan-K, cytokeratin-18 (K-18, and occludin. When cultured in epithelial cell growth medium, the progenitor epithelial cells expressed type I and type II pneumocyte markers. Next, we examined the susceptibility of these cells to influenza virus. Progenitor epithelial cells expressed sialic acid receptors utilized by avian and mammalian influenza viruses and were targets for influenza virus replication. Additionally, differentiated type II but not type I pneumocytes supported the replication of influenza virus. Our data indicate that we have identified a unique population of progenitor epithelial cells in the bone marrow that might have airway reconstitution potential and may be a useful model for cell-based therapies for infectious and non-infectious lung diseases.

  15. Pleiotrophin commits human bone marrow mesenchymal stromal cells towards hypertrophy during chondrogenesis.

    Science.gov (United States)

    Bouderlique, Thibault; Henault, Emilie; Lebouvier, Angelique; Frescaline, Guilhem; Bierling, Phillipe; Rouard, Helene; Courty, José; Albanese, Patricia; Chevallier, Nathalie

    2014-01-01

    Pleiotrophin (PTN) is a growth factor present in the extracellular matrix of the growth plate during bone development and in the callus during bone healing. Bone healing is a complicated process that recapitulates endochondral bone development and involves many cell types. Among those cells, mesenchymal stromal cells (MSC) are able to differentiate toward chondrogenic and osteoblastic lineages. We aimed to determine PTN effects on differentiation properties of human bone marrow stromal cells (hBMSC) under chondrogenic induction using histological analysis and quantitative reverse transcription polymerase chain reaction. PTN dramatically potentiated chondrogenic differentiation as indicated by a strong increase of collagen 2 protein, and cartilage-related gene expression. Moreover, PTN increased transcription of hypertrophic chondrocyte markers such as MMP13, collagen 10 and alkaline phosphatase and enhanced calcification and the content of collagen 10 protein. These effects are dependent on PTN receptors signaling and PI3 K pathway activation. These data suggest a new role of PTN in bone regeneration as an inducer of hypertrophy during chondrogenic differentiation of hBMSC.

  16. Pleiotrophin commits human bone marrow mesenchymal stromal cells towards hypertrophy during chondrogenesis.

    Directory of Open Access Journals (Sweden)

    Thibault Bouderlique

    Full Text Available Pleiotrophin (PTN is a growth factor present in the extracellular matrix of the growth plate during bone development and in the callus during bone healing. Bone healing is a complicated process that recapitulates endochondral bone development and involves many cell types. Among those cells, mesenchymal stromal cells (MSC are able to differentiate toward chondrogenic and osteoblastic lineages. We aimed to determine PTN effects on differentiation properties of human bone marrow stromal cells (hBMSC under chondrogenic induction using histological analysis and quantitative reverse transcription polymerase chain reaction. PTN dramatically potentiated chondrogenic differentiation as indicated by a strong increase of collagen 2 protein, and cartilage-related gene expression. Moreover, PTN increased transcription of hypertrophic chondrocyte markers such as MMP13, collagen 10 and alkaline phosphatase and enhanced calcification and the content of collagen 10 protein. These effects are dependent on PTN receptors signaling and PI3 K pathway activation. These data suggest a new role of PTN in bone regeneration as an inducer of hypertrophy during chondrogenic differentiation of hBMSC.

  17. Liposome-mediated functional expression of multiple drug resistance gene in human bone marrow CD34+ cells.

    Science.gov (United States)

    Cao, Wenjing; Zou, Ping

    2004-01-01

    The expression and functional activity of multiple drug resistance (MDR1) gene in human normal bone marrow CD34+ cells was observed. Human normal bone marrow CD34+ cells were enriched with magnetic cell sorting (MACS) system, and then liposome-mediated MDR1 gene was transferred into bone marrow CD34+ cells. Fluorescence-activated cell sorter was used to evaluate the expression and functional activity of P-glycoprotein (P-gp) encoded by MDR1 gene. It was found that the purity of bone marrow CD34+ cells was approximately (91 +/- 4.56)% and recovery rate was (72.3 +/- 2.36)% by MACS. The expression of P-gp in the transfected CD34+ cells was obviously higher than that in non-transfected CD34+ cells. The amount of P-gp in non-transfected CD34+ cells was (11.2 +/- 2.2)%, but increased to (23.6 +/- 2.34)% 48 h after gene transfection (PMRD1 transferring into human normal bone marrow CD34+ cells.

  18. Myelosuppressive conditioning using busulfan enables bone marrow cell accumulation in the spinal cord of a mouse model of amyotrophic lateral sclerosis.

    Science.gov (United States)

    Lewis, Coral-Ann B; Manning, John; Barr, Christine; Peake, Kyle; Humphries, R Keith; Rossi, Fabio; Krieger, Charles

    2013-01-01

    Myeloablative preconditioning using irradiation is the most commonly used technique to generate rodents having chimeric bone marrow, employed for the study of bone marrow-derived cell accumulation in the healthy and diseased central nervous system. However, irradiation has been shown to alter the blood-brain barrier, potentially creating confounding artefacts. To better study the potential of bone marrow-derived cells to function as treatment vehicles for neurodegenerative diseases alternative preconditioning regimens must be developed. We treated transgenic mice that over-express human mutant superoxide dismutase 1, a model of amyotrophic lateral sclerosis, with busulfan to determine whether this commonly used chemotherapeutic leads to stable chimerism and promotes the entry of bone marrow-derived cells into spinal cord. Intraperitoneal treatment with busulfan at 60 mg/kg or 80 mg/kg followed by intravenous injection of green fluorescent protein-expressing bone marrow resulted in sustained levels of chimerism (~80%). Bone marrow-derived cells accumulated in the lumbar spinal cord of diseased mice at advanced stages of pathology at both doses, with limited numbers of bone marrow derived cells observed in the spinal cords of similarly treated, age-matched controls; the majority of bone marrow-derived cells in spinal cord immunolabelled for macrophage antigens. Comparatively, significantly greater numbers of bone marrow-derived cells were observed in lumbar spinal cord following irradiative myeloablation. These results demonstrate bone marrow-derived cell accumulation in diseased spinal cord is possible without irradiative preconditioning.

  19. Myelosuppressive conditioning using busulfan enables bone marrow cell accumulation in the spinal cord of a mouse model of amyotrophic lateral sclerosis.

    Directory of Open Access Journals (Sweden)

    Coral-Ann B Lewis

    Full Text Available Myeloablative preconditioning using irradiation is the most commonly used technique to generate rodents having chimeric bone marrow, employed for the study of bone marrow-derived cell accumulation in the healthy and diseased central nervous system. However, irradiation has been shown to alter the blood-brain barrier, potentially creating confounding artefacts. To better study the potential of bone marrow-derived cells to function as treatment vehicles for neurodegenerative diseases alternative preconditioning regimens must be developed. We treated transgenic mice that over-express human mutant superoxide dismutase 1, a model of amyotrophic lateral sclerosis, with busulfan to determine whether this commonly used chemotherapeutic leads to stable chimerism and promotes the entry of bone marrow-derived cells into spinal cord. Intraperitoneal treatment with busulfan at 60 mg/kg or 80 mg/kg followed by intravenous injection of green fluorescent protein-expressing bone marrow resulted in sustained levels of chimerism (~80%. Bone marrow-derived cells accumulated in the lumbar spinal cord of diseased mice at advanced stages of pathology at both doses, with limited numbers of bone marrow derived cells observed in the spinal cords of similarly treated, age-matched controls; the majority of bone marrow-derived cells in spinal cord immunolabelled for macrophage antigens. Comparatively, significantly greater numbers of bone marrow-derived cells were observed in lumbar spinal cord following irradiative myeloablation. These results demonstrate bone marrow-derived cell accumulation in diseased spinal cord is possible without irradiative preconditioning.

  20. Bone marrow concentrated cell transplantation: rationale for its use in the treatment of human osteochondral lesions.

    Science.gov (United States)

    Cavallo, C; Desando, G; Cattini, L; Cavallo, M; Buda, R; Giannini, S; Facchini, A; Grigolo, B

    2013-01-01

    Bone marrow is one of the best characterized stem cell microenvironments that contains Mesenchymal Stem Cells (MSCs), a rare population of non-hematopoietic stromal cells. MSCs have been indicated as a new option for regenerative medicine because of their ability to differentiate into various lineages such as bone, cartilage and adipose tissue. However, isolation procedures are crucial for the functional activity of the transplanted cells. The use of concentrated bone marrow cells (BMCs) enables a cell population surrounded by its microenvironment (niche) to be implanted while avoiding all the complications related to the in vitro culture. The cells of the niche are able to regulate stem cell behavior through direct physical contact and secreting paracrine factors. The aim of this study was to characterize BMCs in vitro to evaluate their ability to differentiate toward mature cells and try to understand whether there are differences in the chondrogenic and osteogenic potential of cells from patients of different ages. Mononuclear Cells (MNCs) isolated by Ficoll were used as control. Both cell populations were grown in monolayers and differentiated with specific factors and analyzed by histological and molecular biology assays to evaluate the expression of some specific extracellular matrix molecules. The present investigations revealed the ability of BMCs to act as isolated cells. They are able to form colonies and differentiate toward chondrogenic and osteogenic lineages, the latter pathway appearing to be influenced by donor age. The results obtained by this study support the use of BMCs in clinical practice for the repair of osteochondral damage, which might be particularly useful for the one-step procedure allowing cells to be directly implanted in operating room.

  1. Bone marrow mononuclear stem cells: potential in the treatment of myocardial infarction

    Directory of Open Access Journals (Sweden)

    Anne-Laure Leblond

    2009-12-01

    Full Text Available Anne-Laure Leblond, John O’Sullivan, Noel Caplice1Centre for Research in Vascular Biology (CRVB, Biosciences Institute, University College Cork, Cork, IrelandAbstract: Despite advances in the management of myocardial infarction, congestive heart failure following myocardial infarction continues to be a major worldwide medical problem. Mononuclear cells from bone marrow are currently being studied as potential candidates for cellbased therapy to repair and regenerate damaged myocardium, with mixed results. The success of this strategy requires structural repair through both cardiomyogenesis and angiogenesis but also functional repair. However, pre-clinical and clinical studies with the intracoronary administration of cells indicate limited cardiomyogenesis and cell survival, controversial functional benefit and suggest paracrine effects mediated by the administered cells. Further investigations for optimizing therapeutic benefit focus on the requirement for stable cell engraftment and the involvement of cytokines in this process. This includes a large and varied range of strategies including cell or heart pre-treatment, tissue engineering and protein therapy. Although cellbased therapy holds promise in the future treatment of myocardial infarction, its current use is significantly hampered by biological and technological challenges.Keywords: bone marrow mononuclear cells, myocardial infarction, cardiac cell therapy

  2. Physical, biologic, and phenotypic properties of natural regulatory cells in murine bone marrow

    International Nuclear Information System (INIS)

    Dorshkind, K.; Rosse, C.

    1982-01-01

    A lymphocyte-enriched fraction of murine bone marrow (BML) contains natural regulatory cells (NRC) that can inhibit, on a dose-dependent basis, proliferative and cytotoxic responses to alloantigens in a mixed lymphocyte culture. The objective of this study was to investigate the characteristics of the cells responsible for this phenomenon in CBA mice. Maximal suppression was obtained with BML cells themselves rather than cell products. Light-scatter analysis of NRC on the fluorescence-activated cell sorter demonstrated them to be larger than small lymphocytes, and their sedimentation in discontinuous Percoll gradients showed the cells to be of heterogeneous density. This heterogeneity is further reflected by the fact that both plastic adherent and nonadherent BML are suppressive. NRC must be viable in order to mediate suppression; they are cortisone-resistant and are not affected by doses of gamma irradiation up to 1,000 R. NRC are not T or B lymphocytes or Ia-bearing macrophages. The involvement of mature granulocytes and macrophages in natural suppression is unlikely in that NRC do not bear Fc receptors. Elimination of cells from BML with the natural killer (NK) surface marker Asialo GM1 does not abrogate suppression. NRC are capable of mediating suppression across major and minor histocompatibility complex barriers. While lymphoid cells are prominent in BML, the contamination of this marrow fraction with immature granulocytes and monocytes makes a morphologic identification of NRC difficult. These characteristics are most consistent with NRC begin immature marrow cells of undetermined lineage. The relationship of NRC to naturally occurring marrow suppressor cells described in other systems is not yet clear and awaits experimental clarification

  3. Neural ganglioside GD2(+) cells define a subpopulation of mesenchymal stem cells in adult murine bone marrow.

    Science.gov (United States)

    Xu, Jie; Fan, WenJun; Tu, Xi Xiang; Zhang, Teng; Hou, Zhi Jie; Guo, Tao; Shu, Xin; Luo, Xi; Liu, Yang; Peng, Fei; Wang, Chang; Xu, LingZhi; Zhou, Han; Liu, Quentin

    2013-01-01

    Due to the lack of specific markers, the isolation of pure mesenchymal stem cells (MSCs) from murine bone marrow remains an unsolved problem. The present study explored whether the neural ganglioside GD2 could serve as a single surface marker to uniquely distinguish murine bone marrow MSCs (mBM-MSCs) from other marrow elements. Immunocytochemistry and flow cytometry, in combination with quantitative RT-PCR, were used to identify the expression of GD2 on culture-expanded mBM-MSCs. GD2(+) and GD2(-) fractions from mBM-MSCs cultures were sorted by immunosorting. Flow cytometry was performed to further analyze the biomarkers of GD2-sorted and unsorted cells. Employing CFU-F assay and CCK-8 assay, we examined the clonogenic and proliferative capabilities of GD2-sorted and unsorted cells. Using oil red O and von Kossa staining assay, we also assessed the multi-lineage potential of GD2-sortedand unsorted cells. We found that mBM-MSCs expressed a novel surface marker the neural ganglioside GD2. Importantly, mBM-MSCs were the only cells within bone marrow that expressed this marker. Further studies demonstrated that a homogenous population of MSCs could be obtained from bone marrow cultures in early passages by GD2 immunosorting. Compared to parental cells, GD2(+)-sorted cells not only possessed much higher clonogenic and proliferative capabilities but also had significantly stronger differentiation potential to adipocytes and osteoblasts. Furthermore, GD2(+)-sorted cells displayed enhanced expression of ES markers SSEA-1 and Nanog. Our observations provide the first demonstration that GD2 may serve as a maker for identification and purification of mBM-MSCs. Meanwhile, our study indicates that the cells selected by GD2 are a subpopulation of MSCs with features of primitive precursor cells. © 2013 S. Karger AG, Basel

  4. Neural Ganglioside GD2+ Cells Define a Subpopulation of Mesenchymal Stem Cells in Adult Murine Bone Marrow

    Directory of Open Access Journals (Sweden)

    Jie Xu

    2013-09-01

    Full Text Available Background/Aims: Due to the lack of specific markers, the isolation of pure mesenchymal stem cells (MSCs from murine bone marrow remains an unsolved problem. The present study explored whether the neural ganglioside GD2 could serve as a single surface marker to uniquely distinguish murine bone marrow MSCs (mBM-MSCs from other marrow elements. Methods: Immunocytochemistry and flow cytometry, in combination with quantitative RT-PCR, were used to identify the expression of GD2 on culture-expanded mBM-MSCs. GD2+ and GD2- fractions from mBM-MSCs cultures were sorted by immunosorting. Flow cytometry was performed to further analyze the biomarkers of GD2-sorted and unsorted cells. Employing CFU-F assay and CCK-8 assay, we examined the clonogenic and proliferative capabilities of GD2-sorted and unsorted cells. Using oil red O and von Kossa staining assay, we also assessed the multi-lineage potential of GD2-sortedand unsorted cells. Results: We found that mBM-MSCs expressed a novel surface marker the neural ganglioside GD2. Importantly, mBM-MSCs were the only cells within bone marrow that expressed this marker. Further studies demonstrated that a homogenous population of MSCs could be obtained from bone marrow cultures in early passages by GD2 immunosorting. Compared to parental cells, GD2+-sorted cells not only possessed much higher clonogenic and proliferative capabilities but also had significantly stronger differentiation potential to adipocytes and osteoblasts. Furthermore, GD2+-sorted cells displayed enhanced expression of ES markers SSEA-1 and Nanog. Conclusion: Our observations provide the first demonstration that GD2 may serve as a maker for identification and purification of mBM-MSCs. Meanwhile, our study indicates that the cells selected by GD2 are a subpopulation of MSCs with features of primitive precursor cells.

  5. Human bone marrow-derived mesenchymal stem cells | Nasef ...

    African Journals Online (AJOL)

    Mesenchymal stem cells (MSCs) have elicited a great clinical interest, particularly in the areas of regenerative medicine and induction of tolerance in allogeneic transplantation. Previous reports demonstrated the feasibility of transplanting MSCs, which generates new prospects in cellular therapy. Recently, injection of ...

  6. Bone marrow oedema associated with benign and malignant bone tumours

    Energy Technology Data Exchange (ETDEWEB)

    James, S.L.J. [Department of Radiology, Royal Orthopaedic Hospital, Birmingham, B31 2AP (United Kingdom)], E-mail: steven.james@roh.nhs.uk; Panicek, D.M. [Department of Radiology, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021 (United States); Davies, A.M. [Department of Radiology, Royal Orthopaedic Hospital, Birmingham, B31 2AP (United Kingdom)

    2008-07-15

    Bone marrow oedema is associated with a wide variety of pathological processes including both benign and malignant bone tumours. This imaging finding in relation to intraosseous tumours can aid in providing a more focused differential diagnosis. In this review, we will discuss the MR imaging of bone marrow oedema surrounding intraosseous neoplasms. The different pulse sequences used in differentiating underlying tumour from surrounding oedema are discussed along with the role of dynamic contrast enhanced MRI. Benign lesions commonly associated with bone marrow oedema include osteoid osteoma, osteoblastoma, chondroblastoma and Langerhan's cell histiocytosis. Metastases and malignant primary bone tumours such as osteosarcoma, Ewing's sarcoma and chondrosarcoma may also be surrounded by bone marrow oedema. The imaging findings of these conditions are reviewed and illustrated. Finally, the importance of bone marrow oedema in assessment of post chemotherapeutic response is addressed.

  7. Bone marrow oedema associated with benign and malignant bone tumours

    International Nuclear Information System (INIS)

    James, S.L.J.; Panicek, D.M.; Davies, A.M.

    2008-01-01

    Bone marrow oedema is associated with a wide variety of pathological processes including both benign and malignant bone tumours. This imaging finding in relation to intraosseous tumours can aid in providing a more focused differential diagnosis. In this review, we will discuss the MR imaging of bone marrow oedema surrounding intraosseous neoplasms. The different pulse sequences used in differentiating underlying tumour from surrounding oedema are discussed along with the role of dynamic contrast enhanced MRI. Benign lesions commonly associated with bone marrow oedema include osteoid osteoma, osteoblastoma, chondroblastoma and Langerhan's cell histiocytosis. Metastases and malignant primary bone tumours such as osteosarcoma, Ewing's sarcoma and chondrosarcoma may also be surrounded by bone marrow oedema. The imaging findings of these conditions are reviewed and illustrated. Finally, the importance of bone marrow oedema in assessment of post chemotherapeutic response is addressed

  8. Monosomy 7 in donor cell-derived leukemia after bone marrow transplantation for severe aplastic anemia: Report of a new case and review of the literature

    OpenAIRE

    Otero, Luize; de Souza, Daiane Correa; de Cássia Tavares, Rita; Gomes, Bernadete Evangelho; Padilha, Telma França; Bouzas, Luiz Fernando; de Souza Fernandez, Teresa; Abdelhay, Eliana

    2012-01-01

    Monosomy 7 arises as a recurrent chromosome aberration in donor cell leukemia after hematopoietic stem cell transplantation. We report a new case of donor cell leukemia with monosomy 7 following HLA-identical allogenic bone marrow transplantation for severe aplastic anemia (SAA). The male patient received a bone marrow graft from his sister, and monosomy 7 was detected only in the XX donor cells, 34 months after transplantation. The patient's bone marrow microenvironment may have played a rol...

  9. Treatment of Severe Adult Traumatic Brain Injury Using Bone Marrow Mononuclear Cells.

    Science.gov (United States)

    Cox, Charles S; Hetz, Robert A; Liao, George P; Aertker, Benjamin M; Ewing-Cobbs, Linda; Juranek, Jenifer; Savitz, Sean I; Jackson, Margaret L; Romanowska-Pawliczek, Anna M; Triolo, Fabio; Dash, Pramod K; Pedroza, Claudia; Lee, Dean A; Worth, Laura; Aisiku, Imoigele P; Choi, Huimahn A; Holcomb, John B; Kitagawa, Ryan S

    2017-04-01

    Preclinical studies using bone marrow derived cells to treat traumatic brain injury have demonstrated efficacy in terms of blood-brain barrier preservation, neurogenesis, and functional outcomes. Phase 1 clinical trials using bone marrow mononuclear cells infused intravenously in children with severe traumatic brain injury demonstrated safety and potentially a central nervous system structural preservation treatment effect. This study sought to confirm the safety, logistic feasibility, and potential treatment effect size of structural preservation/inflammatory biomarker mitigation in adults to guide Phase 2 clinical trial design. Adults with severe traumatic brain injury (Glasgow Coma Scale 5-8) and without signs of irreversible brain injury were evaluated for entry into the trial. A dose escalation format was performed in 25 patients: 5 controls, followed 5 patients in each dosing cohort (6, 9, 12 ×10 6 cells/kg body weight), then 5 more controls. Bone marrow harvest, cell processing to isolate the mononuclear fraction, and re-infusion occurred within 48 hours after injury. Patients were monitored for harvest-related hemodynamic changes, infusional toxicity, and adverse events. Outcome measures included magnetic resonance imaging-based measurements of supratentorial and corpus callosal volumes as well as diffusion tensor imaging-based measurements of fractional anisotropy and mean diffusivity of the corpus callosum and the corticospinal tract at the level of the brainstem at 1 month and 6 months postinjury. Functional and neurocognitive outcomes were measured and correlated with imaging data. Inflammatory cytokine arrays were measured in the plasma pretreatment, posttreatment, and at 1 and 6 month follow-up. There were no serious adverse events. There was a mild pulmonary toxicity of the highest dose that was not clinically significant. Despite the treatment group having greater injury severity, there was structural preservation of critical regions of interest

  10. Transplanted Bone Marrow Mesenchymal Stem Cells Improve Memory in Rat Models of Alzheimer's Disease

    OpenAIRE

    Babaei, Parvin; Soltani Tehrani, Bahram; Alizadeh, Arsalan

    2012-01-01

    The present study aims to evaluate the effect of bone marrow mesenchymal stem cells (MSCs) grafts on cognition deficit in chemically and age-induced Alzheimer's models of rats. In the first experiments aged animals (30 months) were tested in Morris water maze (MWM) and divided into two groups: impaired memory and unimpaired memory. Impaired groups were divided into two groups and cannulated bilaterally at the CA1 of the hippocampus for delivery of mesenchymal stem cells ( 5 0 0 × 1 0 3 / ...

  11. Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells

    Science.gov (United States)

    2015-10-01

    NM_004629 CTCATTGAGGTAGAATTACTA 964-984(ORF) Hs_FANCG_4 FANCG_R1 NM_004629 (GA)GTCTGGAGCTGCTAGTTGA 903-923(ORF) Rosetta design 1 FANCG_R2 NM_004629 ( CA ...Derived CD34+ and iPS Cells The goal of this project is to use genome-editing TALEN and CRISPR /Cas9 nucleases to correct the two most common disease

  12. Human bone marrow-derived mesenchymal stem cells

    Directory of Open Access Journals (Sweden)

    Lopez M

    2007-01-01

    Full Text Available Mesenchymal stem cells (MSCs have elicited a great clinical interest, particularly in the areas of regenerative medicine and induction of tolerance in allogeneic transplantation. Previous reports demonstrated the feasibility of transplanting MSCs, which generates new prospects in cellular therapy. Recently, injection of MSCs induced remission of steroid-resistant acute graft-versus-host disease (GVHD. This review summarizes the knowledge and possible future clinical uses of MSCs.

  13. Concise Review: Bone Marrow Mononuclear Cells for the Treatment of Ischemic Syndromes: Medicinal Product or Cell Transplantation?

    Science.gov (United States)

    Rico, Laura; Herrera, Concha

    2012-01-01

    In November of 2011, the Committee for Advanced Therapies (CAT) of the European Medicines Agency (EMA) published two scientific recommendations regarding the classification of autologous bone marrow-derived mononuclear cells (BM-MNCs) and autologous bone marrow-derived CD133+ cells as advanced therapy medicinal products (ATMPs), specifically tissue-engineered products, when intended for regeneration in ischemic heart tissue on the basis that they are not used for the same essential function (hematological restoration) that they fulfill in the donor. In vitro and in vivo evidence demonstrates that bone marrow cells are physiologically involved in adult neovascularization and tissue repair, making their therapeutic use for these purposes a simple exploitation of their own essential functions. Therefore, from a scientific/legal point of view, nonsubstantially manipulated BM-MNCs and CD133+ cells are not an ATMP, because they have a physiological role in the processes of postnatal neovascularization and, when used therapeutically for vascular restoration in ischemic tissues, they are carrying out one of their essential physiological functions (the legal definition recognizes that cells can have several essential functions). The consequences of classifying BM-MNCs and CD133+ cells as medicinal products instead of cellular transplantation, like bone marrow transplantation, in terms of costs and time for these products to be introduced into clinical practice, make this an issue of crucial importance. Therefore, the recommendations of EMA/CAT could be reviewed in collaboration with scientific societies, in light of organizational and economic consequences as well as scientific knowledge recently acquired about the mechanisms of postnatal neovascularization and the function of bone marrow in the regeneration of remote tissues. PMID:23197819

  14. Spinal cord injury in rats treated using bone marrow mesenchymal stem-cell transplantation.

    Science.gov (United States)

    Chen, Yu-Bing; Jia, Quan-Zhang; Li, Dong-Jun; Sun, Jing-Hai; Xi, Shuang; Liu, Li-Ping; Gao, De-Xuan; Jiang, Da-Wei

    2015-01-01

    The aim of this study was to observe the effects of bone marrow mesenchymal stem-cell transplantation (BMSCs) in repairing acute spinal cord damage in rats and to examine the potential beneficial effects. 192 Wistar rats were randomized into 8 groups. Spinal cord injury was created. Behavior and limb functions were scored. Repairing effects of BMSCs transplantation was evaluated and compared. In vitro 4',6-diamidino-2-phenylindole (DAPI)-tagged BMSCs were observed, and whether they migrated to the area of spinal cord injury after intravenous tail injection was investigated. The expression of neuron-specific protein (NSE) on BMSCs was examined. Fifteen days after transplantation, the BMSCs-treated groups scored significantly higher in limb function tests than the untreated group. Pathological sections of the bone marrow after operation showed significant recovery in treated groups in comparison to the control group. After transplantation, small amounts of fluorescent-tagged BMSCs can be found in the blood vessels in the area of spinal cord injury, and fluorescent-tagged BMSCs were diffused in extravascular tissues, whereas the DAPI-tagged BMSCs could not be detected,and BrdU/NSE double-labeled cells were found in the injured marrow. BMSCs improve behavioral responses and can repair spinal cord injuries by migrating to the injured area, where they can differentiate into neurons.

  15. Differentiation potential of menstrual blood- versus bone marrow-stem cells into glial-like cells.

    Science.gov (United States)

    Azedi, Fereshteh; Kazemnejad, Somaieh; Zarnani, Amir Hassan; Behzadi, Gila; Vasei, Mohammad; Khanmohammadi, Manijeh; Khanjani, Sayeh; Edalatkhah, Haleh; Lakpour, Niknam

    2014-05-01

    Menstrual blood is easily accessible, renewable, and inexpensive source of stem cells that have been interested for cell therapy of neurodegenerative diseases. In this study, we showed conversion of menstrual blood stem cells (MenSCs) into clonogenic neurosphere- like cells (NSCs), which can be differentiated into glial-like cells. Moreover, differentiation potential of MenSCs into glial lineage was compared with bone marrow stem cells (BMSCs). Differentiation potential of individual converted NSCs derived from MenSCs or BMSCs into glial-like cells was investigated using immunofluorescence staining and real-time polymerase chain reaction.The fibroblastic morphology of both MenSCs and BMSCs was turned into NSCs shape during first step of differentiation. NSCs derived from both BMSCs and MenSCs expressed higher levels of Olig-2 and Nestin markers compared to undifferentiated cells. The expression levels of myelin basic protein (MBP) mRNA up regulated only in BMSCs-NSCs no in MenSCs-NSCs. However, outgrowth of individual NSCs derived from both MenSCs and BMSCs into glial-like cells led to significant up regulation of glial fibrillary acidic protein,Olig-2 and MBP at mRNA and protein level accompanied with down regulation of Nestin protein.This is the first study demonstrating that MenSCs can be converted to NSCs with differentiation ability into glial-like cells. Accumulative data show different expression pattern of glial markers in differentiated MenSCs compared to BMSCs. The comparable differentiation potential, more accessibility and no invasive technique for sample collection of MenSCs in comparison with BMSCs introduce MenSCs as an apt, consistent and safe alternative to BMSCs for cell therapy of neurodegenerative diseases. © 2014 International Federation for Cell Biology.

  16. Protein malnutrition induces bone marrow mesenchymal stem cells commitment to adipogenic differentiation leading to hematopoietic failure.

    Science.gov (United States)

    Cunha, Mayara Caldas Ramos; Lima, Fabiana da Silva; Vinolo, Marco Aurélio Ramirez; Hastreiter, Araceli; Curi, Rui; Borelli, Primavera; Fock, Ricardo Ambrósio

    2013-01-01

    Protein malnutrition (PM) results in pathological changes that are associated with peripheral leukopenia, bone marrow (BM) hypoplasia and alterations in the BM microenvironment leading to hematopoietic failure; however, the mechanisms involved are poorly understood. In this context, the BM mesenchymal stem cells (MSCs) are cells intimately related to the formation of the BM microenvironment, and their differentiation into adipocytes is important because adipocytes are cells that have the capability to negatively modulate hematopoiesis. Two-month-old male Balb/c mice were subjected to protein-energy malnutrition with a low-protein diet containing 2% protein, whereas control animals were fed a diet containing 12% protein. The hematopoietic parameters and the expression of CD45 and CD117 positive cells in the BM were evaluated. MSCs were isolated from BM, and their capability to produce SCF, IL-3, G-CSF and GM-CSF were analyzed. The expression of PPAR-γ and C/EBP-α as well as the expression of PPAR-γ and SREBP mRNAs were evaluated in MSCs together with their capability to differentiate into adipocytes in vitro. The malnourished animals had anemia and leukopenia as well as spleen and bone marrow hypoplasia and a reduction in the expression of CD45 and CD117 positive cells from BM. The MSCs of the malnourished mice presented an increased capability to produce SCF and reduced production of G-CSF and GM-CSF. The MSCs from the malnourished animals showed increased expression of PPAR-γ protein and PPAR-γ mRNA associated with an increased capability to differentiate into adipocytes. The alterations found in the malnourished animals allowed us to conclude that malnutrition committed MSC differentiation leading to adipocyte decision and compromised their capacity for cytokine production, contributing to an impaired hematopoietic microenvironment and inducing the bone marrow failure commonly observed in protein malnutrition states.

  17. Is bone marrow biopsy always indicated in patients with primary cutaneous marginal zone B-cell lymphoma?

    Science.gov (United States)

    Muniesa, C; Hernández-Machín, B

    2013-10-01

    Bone marrow involvement at the time of diagnosis is uncommon in patients with primary cutaneous marginal zone B-cell lymphoma (PCMZL). Moreover, in these patients such involvement is rarely found in isolation on diagnosis. Typically the few patients with PCMZL who have early bone marrow involvement also present secondary nodal or visceral involvement, which is detected by other staging studies (usually computed tomography). In recent years, this has given rise to some debate about whether a bone marrow biopsy should be routinely performed in patients diagnosed with PCMZL in view of the good prognosis and low incidence of bone marrow infiltration and/or extracutaneous involvement in this type of lymphoma. Copyright © 2012 Elsevier España, S.L. and AEDV. All rights reserved.

  18. Bone marrow dendritic cell-based anticancer vaccines

    Czech Academy of Sciences Publication Activity Database

    Indrová, Marie; Mendoza, Luis; Reiniš, Milan; Vonka, V.; Šmahel, M.; Němečková, Š.; Jandlová, Táňa; Bubeník, Jan

    2001-01-01

    Roč. 495, - (2001), s. 355-358 ISSN 0065-2598 R&D Projects: GA MZd NC5526; GA ČR GA312/98/0826; GA ČR GA312/99/0542; GA ČR GA301/00/0114; GA ČR GA301/01/0985; GA AV ČR IAA7052002 Institutional research plan: CEZ:AV0Z5052915 Keywords : HPV16 * dendritic cells * tumour vaccines Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.513, year: 2000

  19. Nonspecific suppressor T cells cause decreased mixed lymphocyte culture reactivity in bone marrow transplant patients

    Energy Technology Data Exchange (ETDEWEB)

    Harada, M.; Ueda, M.; Nakao, S.; Kondo, K.; Odaka, K.; Shiobara, S.; Matsue, K.; Mori, T.; Matsuda, T.

    1986-07-15

    Decreased reactivity in mixed lymphocyte culture (MLC) was observed in patients within 1 yr after allogeneic and autologous bone marrow transplantation. Suppressor activity of peripheral blood mononuclear cells (PBMC) from transplant patients was studied by adding these cells as modulator cells to a bidirectional MLC with cells from normal individuals. PBMC from transplant patients markedly suppressed MLC reactivity in a dose-dependent manner. Suppressor activity was present in cells forming rosettes with sheep erythrocytes. Treatment of modulator cells with monoclonal antibodies against T cell differentiation antigens (OKT8, OKIa1) and complement completely abolished suppression of MLC. Suppressor activity was unaffected by 30 Gy irradiation. Suppressor activity declined gradually after transplantation and was inversely correlated with MLC reactivity of each patient at a significant level (p less than 0.01). These observations suggest that OKT8+ Ia+ radioresistant suppressor T cells play a role in the development of decreased MLC reactivity observed during the early post-transplant period.

  20. Bone tissue engineering with a collagen–hydroxyapatite scaffold and culture expanded bone marrow stromal cells

    Science.gov (United States)

    Villa, Max M.; Wang, Liping; Huang, Jianping; Rowe, David W.; Wei, Mei

    2015-01-01

    Osteoprogenitor cells combined with supportive biomaterials represent a promising approach to advance the standard of care for bone grafting procedures. However, this approach faces challenges, including inconsistent bone formation, cell survival in the implant, and appropriate biomaterial degradation. We have developed a collagen–hydroxyapatite (HA) scaffold that supports consistent osteogenesis by donor derived osteoprogenitors, and is more easily degraded than a pure ceramic scaffold. Herein, the material properties are characterized as well as cell attachment, viability, and progenitor distribution in vitro. Furthermore, we examined the biological performance in vivo in a critical-size mouse calvarial defect. To aid in the evaluation of the in-house collagen–HA scaffold, the in vivo performance was compared with a commercial collagen–HA scaffold (Healos®, Depuy). The in-house collagen–HA scaffold supported consistent bone formation by predominantly donor-derived osteoblasts, nearly completely filling a 3.5 mm calvarial defect with bone in all samples (n=5) after 3 weeks of implantation. In terms of bone formation and donor cell retention at 3 weeks postimplantation, no statistical difference was found between the in-house and commercial scaffold following quantitative histomorphometry. The collagen–HA scaffold presented here is an open and well-defined platform that supports robust bone formation and should facilitate the further development of collagen–hydroxyapatite biomaterials for bone tissue engineering. PMID:24909953

  1. Bone marrow mesenchymal stem cells overexpressing human basic fibroblast growth factor increase vasculogenesis in ischemic rats

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, J.C. [Department of Vascular Surgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Zheng, G.F. [Department of Vascular Surgery, The People' s Hospital of Ganzhou, Ganzhou (China); Wu, L.; Ou Yang, L.Y.; Li, W.X. [Department of Vascular Surgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China)

    2014-08-08

    Administration or expression of growth factors, as well as implantation of autologous bone marrow cells, promote in vivo angiogenesis. This study investigated the angiogenic potential of combining both approaches through the allogenic transplantation of bone marrow-derived mesenchymal stem cells (MSCs) expressing human basic fibroblast growth factor (hbFGF). After establishing a hind limb ischemia model in Sprague Dawley rats, the animals were randomly divided into four treatment groups: MSCs expressing green fluorescent protein (GFP-MSC), MSCs expressing hbFGF (hbFGF-MSC), MSC controls, and phosphate-buffered saline (PBS) controls. After 2 weeks, MSC survival and differentiation, hbFGF and vascular endothelial growth factor (VEGF) expression, and microvessel density of ischemic muscles were determined. Stable hbFGF expression was observed in the hbFGF-MSC group after 2 weeks. More hbFGF-MSCs than GFP-MSCs survived and differentiated into vascular endothelial cells (P<0.001); however, their differentiation rates were similar. Moreover, allogenic transplantation of hbFGF-MSCs increased VEGF expression (P=0.008) and microvessel density (P<0.001). Transplantation of hbFGF-expressing MSCs promoted angiogenesis in an in vivo hind limb ischemia model by increasing the survival of transplanted cells that subsequently differentiated into vascular endothelial cells. This study showed the therapeutic potential of combining cell-based therapy with gene therapy to treat ischemic disease.

  2. Isolation, expansion and differentiation of mesenchymal stromal cells from rabbits' bone marrow

    Directory of Open Access Journals (Sweden)

    Renato B. Eleotério

    2016-05-01

    Full Text Available Abstract: Tissue engineering has been a fundamental technique in the regenerative medicine field, once it permits to build tri-dimensional tissue constructs associating undifferentiated mesenchymal cells (or mesenchymal stromal cells - MSCs and scaffolds in vitro. Therefore, many studies have been carried out using these cells from different animal species, and rabbits are often used as animal model for in vivo tissue repair studies. However, most of the information available about MSCs harvesting and characterization is about human and murine cells, which brings some doubts to researchers who desire to work with a rabbit model in tissue repair studies based on MSCs. In this context, this study aimed to add and improve the information available in the scientific literature providing a complete technique for isolation, expansion and differentiation of MSCs from rabbits. Bone marrow mononuclear cells (BMMCs from humerus and femur of rabbits were obtained and to evaluate their proliferation rate, three different culture media were tested, here referred as DMEM-P, DMEM´S and α-MEM. The BMMCs were also cultured in osteogenic, chondrogenic and adipogenic induction media to prove their multipotentiality. It was concluded that the techniques suggested in this study can provide a guideline to harvest and isolate MSCs from bone marrow of rabbits in enough amount to allow their expansion and, based on the laboratory experience where the study was developed, it is also suggested a culture media formulation to provide a better cell proliferation rate with multipotentiality preservation.

  3. Bone marrow mesenchymal stem cells overexpressing human basic fibroblast growth factor increase vasculogenesis in ischemic rats

    Directory of Open Access Journals (Sweden)

    J.C. Zhang

    2014-10-01

    Full Text Available Administration or expression of growth factors, as well as implantation of autologous bone marrow cells, promote in vivo angiogenesis. This study investigated the angiogenic potential of combining both approaches through the allogenic transplantation of bone marrow-derived mesenchymal stem cells (MSCs expressing human basic fibroblast growth factor (hbFGF. After establishing a hind limb ischemia model in Sprague Dawley rats, the animals were randomly divided into four treatment groups: MSCs expressing green fluorescent protein (GFP-MSC, MSCs expressing hbFGF (hbFGF-MSC, MSC controls, and phosphate-buffered saline (PBS controls. After 2 weeks, MSC survival and differentiation, hbFGF and vascular endothelial growth factor (VEGF expression, and microvessel density of ischemic muscles were determined. Stable hbFGF expression was observed in the hbFGF-MSC group after 2 weeks. More hbFGF-MSCs than GFP-MSCs survived and differentiated into vascular endothelial cells (P<0.001; however, their differentiation rates were similar. Moreover, allogenic transplantation of hbFGF-MSCs increased VEGF expression (P=0.008 and microvessel density (P<0.001. Transplantation of hbFGF-expressing MSCs promoted angiogenesis in an in vivo hind limb ischemia model by increasing the survival of transplanted cells that subsequently differentiated into vascular endothelial cells. This study showed the therapeutic potential of combining cell-based therapy with gene therapy to treat ischemic disease.

  4. Gene expression profile in bone marrow and hematopoietic stem cells in mice exposed to inhaled benzene

    International Nuclear Information System (INIS)

    Faiola, Brenda; Fuller, Elizabeth S.; Wong, Victoria A.; Recio, Leslie

    2004-01-01

    Acute myeloid leukemia and chronic lymphocytic leukemia are associated with benzene exposure. In mice, benzene induces chromosomal breaks as a primary mode of genotoxicity in the bone marrow (BM). Benzene-induced DNA lesions can lead to changes in hematopoietic stem cells (HSC) that give rise to leukemic clones. To gain insight into the mechanism of benzene-induced leukemia, we investigated the DNA damage repair and response pathways in total bone marrow and bone marrow fractions enriched for HSC from male 129/SvJ mice exposed to benzene by inhalation. Mice exposed to 100 ppm benzene for 6 h per day, 5 days per week for 2 week showed significant hematotoxicity and genotoxicity compared to air-exposed control mice. Benzene exposure did not alter the level of apoptosis in BM or the percentage of HSC in BM. RNA isolated from total BM cells and the enriched HSC fractions from benzene-exposed and air-exposed mice was used for microarray analysis and quantitative real-time RT-PCR. Interestingly, mRNA levels of DNA repair genes representing distinct repair pathways were largely unaffected by benzene exposure, whereas altered mRNA expression of various apoptosis, cell cycle, and growth control genes was observed in samples from benzene-exposed mice. Differences in gene expression profiles were observed between total BM and HSC. Notably, p21 mRNA was highly induced in BM but was not altered in HSC following benzene exposure. The gene expression pattern suggests that HSC isolated immediately following a 2 weeks exposure to 100 ppm benzene were not actively proliferating. Understanding the toxicogenomic profile of the specific target cell population involved in the development of benzene-associated diseases may lead to a better understanding of the mechanism of benzene-induced leukemia and may identify important interindividual and tissue susceptibility factors

  5. Our Experience with Autologous Bone Marrow Stem Cell Application in Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Mukund K

    2009-01-01

    Full Text Available Background - Use of autologous bone marrow stem cell is a newly evolving treatment modality for end stage cardiac failure as reported in the literature. We report our experience with two patients with dilated cardiomyopathy who underwent this treatment after failure of maximal conventional therapy. Methods - A 29 year old Male patient with history of orthopnea and PND, with a diagnosis of dilated cardiomyopathy and echocardiographic evidence of severe LV dysfunction was referred for further treatment. His echo on admission showed EF of 17% and no other abnormal findings except elevated bilirubin levels. He was in NYHA functional class IV. He received intracoronary injection of autologous bone marrow stem cells in January 2009. 254X106 cells were injected with a CD34+ of 0.20%. His clinical condition stabilized and he was discharged home. He received a second injection of 22X106 in vitro expanded stem cells with a CD34+ of 0.72% in Aug 2009. He is now in NYHA class II-III with EF 24%. A 31year old Male patient with history of increasing shortness of breath, severe over the past 3-4 days was admitted for evaluation and treatment. His echo on admission showed EF of 20% and was in NYHA functional class IV. Coronary angiogram was normal and he was stabilized on maximal anti failure measures. He received intracoronary autologous bone marrow stem cell injection of 56X106 with a CD34+ of 0.53% in August 2009. His clinical condition stabilized over the next 10 days and he was discharged home. Conclusions - In our experience of two cases of dilated cardiomyopathy, safety of intracoronary injection of autologous bone marrow stem cells both isolated and in vitro expanded has been proven in both the cases with efficacy proven in one of the cases. Long term follow-up of these two cases and inclusion of more number of similar cases where all available conventional therapies have not resulted in significant improvement for such studies are planned.

  6. Butyrate and retinoic acid imprint mucosal-like dendritic cell development synergistically from bone marrow cells.

    Science.gov (United States)

    Qiang, Y; Xu, J; Yan, C; Jin, H; Xiao, T; Yan, N; Zhou, L; An, H; Zhou, X; Shao, Q; Xia, S

    2017-09-01

    Accumulating data show that the phenotypes and functions of distinctive mucosal dendritic cells (DCs) in the gut are regulated by retinoic acid (RA). Unfortunately, the exact role of butyrate in RA-mediated mucosal DC differentiation has not been elucidated thoroughly to date. Mucosal-like dendritic cell differentiation was completed in vitro by culturing bone marrow cells with growth factors [granulocyte-macrophage colony-stimulating factor (GM-CSF/interleukin (IL)-4], RA and/or butyrate. The phenotypes, cytokine secretion, immune functions and levels of retinal dehydrogenase of different DCs were detected using quantitative polymerase chain reaction (qPCR), enzyme-linked immunosorbent assay (ELISA) and flow cytometry, respectively. The results showed that RA-induced DCs (RA-DCs) showed mucosal DC properties, including expression of CD103 and gut homing receptor α 4 β 7 , low proinflammatory cytokine secretion and low priming capability to antigen-specific CD4 + T cells. Butyrate-treated RA-DCs (Bu-RA-DCs) decreased CD11c, but increased CD103 and α 4 β 7 expression. Moreover, the CD4 + T priming capability and the levels of retinal dehydrogenase of RA-DCs were suppressed significantly by butyrate. Thus, butyrate and retinoic acid have different but synergistic regulatory functions on mucosal DC differentiation, indicating that immune homeostasis in the gut depends largely upon RA and butyrate to imprint different mucosal DC subsets, both individually and collectively. © 2017 British Society for Immunology.

  7. Application of cell sheet technology to bone marrow stromal cell transplantation for rat brain infarct.

    Science.gov (United States)

    Ito, Masaki; Shichinohe, Hideo; Houkin, Kiyohiro; Kuroda, Satoshi

    2017-02-01

    Bone marrow stromal cells (BMSC) transplantation enhances functional recovery after cerebral infarct, but the optimal delivery route is undetermined. This study was aimed to assess whether a novel cell-sheet technology non-invasively serves therapeutic benefits to ischemic stroke. First, the monolayered cell sheet was engineered by culturing rat BMSCs on a temperature-responsive dish. The cell sheet was analysed histologically and then transplanted onto the ipsilateral neocortex of rats subjected to permanent middle cerebral artery occlusion at 7 days after the insult. Their behaviours and histology were compared with those in the animals treated with direct injection of BMSCs or vehicle over 4 weeks post-transplantation. The cell sheet was 27.9 ± 8.0 μm thick and was composed of 9.8 ± 2.4 × 10 5 cells. Cell sheet transplantation significantly improved motor function when compared with the vehicle-injected animals. Histological analysis revealed that the BMSCs were densely distributed to the neocortex adjacent to the cerebral infarct and expressed neuronal phenotype in the cell sheet-transplanted animals. These findings were almost equal to those for the animals treated with direct BMSC injection. The attachment of the BMSC sheet to the brain surface did not induce reactive astrocytes in the adjacent neocortex, although direct injection of BMSCs profoundly induced reactive astrocytes around the injection site. These findings suggest that the BMSCs in cell sheets preserve their biological capacity of migration and neural differentiation. Cell-sheet technology may enhance functional recovery after ischaemic stroke, using a less invasive method. Copyright © 2014 John Wiley & Sons, Ltd. Copyright © 2014 John Wiley & Sons, Ltd.

  8. Activation of GLP-1 Receptor Promotes Bone Marrow Stromal Cell Osteogenic Differentiation through β-Catenin

    Directory of Open Access Journals (Sweden)

    Jingru Meng

    2016-04-01

    Full Text Available Glucagon-like peptide 1 (GLP-1 plays an important role in regulating bone remodeling, and GLP-1 receptor agonist shows a positive relationship with osteoblast activity. However, GLP-1 receptor is not found in osteoblast, and the mechanism of GLP-1 receptor agonist on regulating bone remodeling is unclear. Here, we show that the GLP-1 receptor agonist exendin-4 (Ex-4 promoted bone formation and increased bone mass and quality in a rat unloading-induced bone loss model. These functions were accompanied by an increase in osteoblast number and serum bone formation markers, while the adipocyte number was decreased. Furthermore, GLP-1 receptor was detected in bone marrow stromal cells (BMSCs, but not in osteoblast. Activation of GLP-1 receptor by Ex-4 promoted the osteogenic differentiation and inhibited BMSC adipogenic differentiation through regulating PKA/β-catenin and PKA/PI3K/AKT/GSK3β signaling. These findings reveal that GLP-1 receptor regulates BMSC osteogenic differentiation and provide a molecular basis for therapeutic potential of GLP-1 against osteoporosis.

  9. Stem Cell Recipes of Bone Marrow and Fish: Just What the Stroke Doctors Ordered.

    Science.gov (United States)

    Napoli, Eleonora; Borlongan, Cesar V

    2017-04-01

    Stem cell therapy for stroke has advanced from the laboratory to the clinic, but remains as an experimental treatment. Two lines of transplant regimens have emerged, namely the "early bird" peripheral injections in subacute stroke patients and the "late night" direct intracerebral treatments in chronic stroke patients. Autologous bone marrow-derived stem cells, which only required minimal manipulations during graft cell preparation, gained fast-track entry into the clinic, while gene modified stem cells necessitated overcoming more stringent regulatory criteria before they were approved for clinical use. Safety of the stem cell therapy can be declared from these clinical trials, but efficacy warrants further investigations. Here, we offer insights into the translation of cell therapy from the laboratory to the clinic, in the hopes that highlighting the lessons we learned from this experience will guide the optimization of functional outcomes of future clinical trials of stem cell therapy for stroke.

  10. Aging of bone marrow mesenchymal stromal/stem cells: Implications on autologous regenerative medicine.

    Science.gov (United States)

    Charif, N; Li, Y Y; Targa, L; Zhang, L; Ye, J S; Li, Y P; Stoltz, J F; Han, H Z; de Isla, N

    2017-01-01

    With their proliferation, differentiation into specific cell types, and secretion properties, mesenchymal stromal/stem cells (MSC) are very interesting tools to be used in regenerative medicine. Bone marrow (BM) was the first MSC source characterized. In the frame of autologous MSC therapy, it is important to detect donor's parameters affecting MSC potency. Age of the donors appears as one parameter that could greatly affect MSC properties. Moreover, in vitro cell expansion is needed to obtain the number of cells necessary for clinical developments. It will lead to in vitro cell aging that could modify cell properties. This review recapitulates several studies evaluating the effect of in vitro and in vivo MSC aging on cell properties.

  11. Human gingiva-derived mesenchymal stem cells are superior to bone marrow-derived mesenchymal stem cells for cell therapy in regenerative medicine

    International Nuclear Information System (INIS)

    Tomar, Geetanjali B.; Srivastava, Rupesh K.; Gupta, Navita; Barhanpurkar, Amruta P.; Pote, Satish T.; Jhaveri, Hiral M.; Mishra, Gyan C.; Wani, Mohan R.

    2010-01-01

    Mesenchymal stem cells (MSCs) are capable of self-renewal and differentiation into multiple cell lineages. Presently, bone marrow is considered as a prime source of MSCs; however, there are some drawbacks and limitations in use of these MSCs for cell therapy. In this study, we demonstrate that human gingival tissue-derived MSCs have several advantages over bone marrow-derived MSCs. Gingival MSCs are easy to isolate, homogenous and proliferate faster than bone marrow MSCs without any growth factor. Importantly, gingival MSCs display stable morphology and do not loose MSC characteristic at higher passages. In addition, gingival MSCs maintain normal karyotype and telomerase activity in long-term cultures, and are not tumorigenic. Thus, we reveal that human gingiva is a better source of MSCs than bone marrow, and large number of functionally competent clinical grade MSCs can be generated in short duration for cell therapy in regenerative medicine and tissue engineering.

  12. Human gingiva-derived mesenchymal stem cells are superior to bone marrow-derived mesenchymal stem cells for cell therapy in regenerative medicine

    Energy Technology Data Exchange (ETDEWEB)

    Tomar, Geetanjali B.; Srivastava, Rupesh K.; Gupta, Navita; Barhanpurkar, Amruta P.; Pote, Satish T. [National Center for Cell Science, University of Pune Campus, Pune 411 007 (India); Jhaveri, Hiral M. [Department of Periodontics and Oral Implantology, Dr. D.Y. Patil Dental College and Hospital, Pune (India); Mishra, Gyan C. [National Center for Cell Science, University of Pune Campus, Pune 411 007 (India); Wani, Mohan R., E-mail: mohanwani@nccs.res.in [National Center for Cell Science, University of Pune Campus, Pune 411 007 (India)

    2010-03-12

    Mesenchymal stem cells (MSCs) are capable of self-renewal and differentiation into multiple cell lineages. Presently, bone marrow is considered as a prime source of MSCs; however, there are some drawbacks and limitations in use of these MSCs for cell therapy. In this study, we demonstrate that human gingival tissue-derived MSCs have several advantages over bone marrow-derived MSCs. Gingival MSCs are easy to isolate, homogenous and proliferate faster than bone marrow MSCs without any growth factor. Importantly, gingival MSCs display stable morphology and do not loose MSC characteristic at higher passages. In addition, gingival MSCs maintain normal karyotype and telomerase activity in long-term cultures, and are not tumorigenic. Thus, we reveal that human gingiva is a better source of MSCs than bone marrow, and large number of functionally competent clinical grade MSCs can be generated in short duration for cell therapy in regenerative medicine and tissue engineering.

  13. Low oxygen tension maintains multipotency, whereas normoxia increases differentiation of mouse bone marrow stromal cells.

    Science.gov (United States)

    Berniakovich, Ina; Giorgio, Marco

    2013-01-22

    Optimization of mesenchymal stem cells (MSC) culture conditions is of great importance for their more successful application in regenerative medicine. O(2) regulates various aspects of cellular biology and, in vivo, MSC are exposed to different O(2) concentrations spanning from very low tension in the bone marrow niche, to higher amounts in wounds. In our present work, we isolated mouse bone marrow stromal cells (BMSC) and showed that they contained a population meeting requirements for MSC definition. In order to establish the effect of low O(2) on cellular properties, we examined BSMC cultured under hypoxic (3% O(2)) conditions. Our results demonstrate that 3% O(2) augmented proliferation of BMSC, as well as the formation of colonies in the colony-forming unit assay (CFU-A), the percentage of quiescent cells, and the expression of stemness markers Rex-1 and Oct-4, thereby suggesting an increase in the stemness of culture when exposed to hypoxia. In contrast, intrinsic differentiation processes were inhibited by 3% O(2). Overall yield of differentiation was dependent on the adjustment of O(2) tension to the specific stage of BMSC culture. Thus, we established a strategy for efficient BMSC in vitro differentiation using an initial phase of cell propagation at 3% O(2), followed by differentiation stage at 21% O(2). We also demonstrated that 3% O(2) affected BMSC differentiation in p53 and reactive oxygen species (ROS) independent pathways. Our findings can significantly contribute to the obtaining of high-quality MSC for effective cell therapy.

  14. Feasibility and safety of intrathecal transplantation of autologous bone marrow mesenchymal stem cells in horses.

    Science.gov (United States)

    Maia, Leandro; da Cruz Landim-Alvarenga, Fernanda; Taffarel, Marilda Onghero; de Moraes, Carolina Nogueira; Machado, Gisele Fabrino; Melo, Guilherme Dias; Amorim, Rogério Martins

    2015-03-15

    Recent studies have demonstrated numerous biological properties of mesenchymal stem cells and their potential application in treating complex diseases or injuries to tissues that have difficulty regenerating, such as those affecting the central and peripheral nervous system. Thus, therapies that use mesenchymal stem cells are promising because of their high capacity for self-regeneration, their low immunogenicity, and their paracrine, anti-inflammatory, immunomodulatory, anti-apoptotic and neuroprotective effects. In this context, the purpose of this study was to evaluate the feasibility and safety of intrathecal transplantation of bone marrow-derived mesenchymal stem cells in horses, for future application in the treatment of neurological diseases. During the neurological evaluations, no clinical signs were observed that were related to brain and/or spinal cord injury of the animals from the control group or the treated group. The hematological and cerebrospinal fluid results from day 1 and day 6 showed no significant differences (P > 0.05) between the treated group and the control group. Additionally, analysis of the expression of matrix metalloproteinase (MMP) -2 and -9 in the cerebrospinal fluid revealed only the presence of pro-MMP-2 (latent), with no significant difference (P > 0.05) between the studied groups. The results of the present study support the hypothesis of the feasibility and safety of intrathecal transplantation of autologous bone marrow-derived mesenchymal stem cells, indicating that it is a promising pathway for cell delivery for the treatment of neurological disorders in horses.

  15. Intravitreal Implantation of Genetically Modified Autologous Bone Marrow-Derived Stem Cells for Treating Retinal Disorders.

    Science.gov (United States)

    Tracy, Christopher J; Sanders, Douglas N; Bryan, Jeffrey N; Jensen, Cheryl A; Castaner, Leilani J; Kirk, Mark D; Katz, Martin L

    2016-01-01

    A number of retinal degenerative diseases may be amenable to treatment with continuous intraocular delivery of therapeutic agents that cannot be delivered effectively to the retina via systemic or topical administration. Among these disorders are lysosomal storage diseases resulting from deficiencies in soluble lysosomal enzymes. Most cells, including those of the retina, are able to take up these enzymes and incorporate them in active form into their lysosomes. In theory, therefore, continuous intraocular administration of a normal form of a soluble lysosomal enzyme should be able to cure the molecular defect in the retinas of subjects lacking this enzyme. Experiments were conducted to determine whether genetically modified bone marrow-derived stem cells implanted into the vitreous could be used as -vehicles for continuous delivery of such enzymes to the retina. Bone marrow-derived mesenchymal stem cells (MSCs) from normal mice were implanted into the vitreous of mice undergoing retinal degeneration as a result of a mutation in the PPT1 gene. The implanted cells appeared to survive indefinitely in the vitreous without proliferating or invading the retina. This indicates that intravitreal implantation of MSCs is likely a safe means of long-term delivery of proteins synthesized by the implanted cells. Experiments have been initiated to test the efficacy of using genetically modified autologous MSCs to inhibit retinal degeneration in a canine model of neuronal ceroid lipofuscinosis.

  16. Transfer of accelerated presbycusis by transplantation of bone marrow cells from senescence-accelerated mice.

    Science.gov (United States)

    Baba, Susumu; Iwai, Hiroshi; Inaba, Muneo; Kawamoto, Kohei; Omae, Mariko; Yamashita, Toshio; Ikehara, Susumu

    2006-11-20

    Until now, there has been no effective therapy for chronic sensorineural hearing impairment. This study investigated the role of bone marrow cells (BMCs) in cochlear dysfunction. BALB/c mice (2 months of age), a non-presbycusis-prone mouse strain, were lethally irradiated and then transplanted with BMCs from SAMP1 mice (2 months of age), a presbycusis-prone mouse strain. Acceleration of age-related hearing loss, early degeneration of spiral ganglion cells (SGCs) and impairment of immune function were observed in the recipient mice as well as in the SAMP1 mice. However, no spiral ganglion cells of donor (SAMP1) origin were detected in the recipient mice. These results indicated that accelerated presbycusis, cochlear pathology, and immune dysfunction of SAMP1 mice can be transferred to BALB/c recipient mice using allogeneic bone marrow transplantation (BMT). However, although the BMCs themselves cannot differentiate into the spiral ganglion cells (SGCs), they indirectly cause the degeneration of the SGCs. Further studies into the relationship between the inner ear cells and BMCs are required.

  17. Autologous Bone Marrow Mononuclear Cells in Ischemic Cerebrovascular Accident Paves Way for Neurorestoration: A Case Report

    Directory of Open Access Journals (Sweden)

    Alok Sharma

    2014-01-01

    Full Text Available In response to acute ischemic stroke, large numbers of bone marrow stem cells mobilize spontaneously in peripheral blood that home onto the site of ischemia activating the penumbra. But with chronicity, the numbers of mobilized cells decrease, reducing the degree and rate of recovery. Cellular therapy has been explored as a new avenue to restore the repair process in the chronic stage. A 67-year-old Indian male with a chronic right middle cerebral artery ischemic stroke had residual left hemiparesis despite standard management. Recovery was slow and partial resulting in dependence to carry out activities of daily living. Our aim was to enhance the speed of recovery process by providing an increased number of stem cells to the site of injury. We administered autologous bone marrow mononuclear cells intrathecally alongwith rehabilitation and regular follow up. The striking fact was that the hand functions, which are the most challenging deficits, showed significant recovery. Functional Independence Measure scores and quality of life improved. This could be attributed to the neural tissue restoration. We hypothesize that cell therapy may be safe, novel and appealing treatment for chronic ischemic stroke. Further controlled trials are indicated to advance the concept of Neurorestoration.

  18. Clinical relevance of bone marrow fibrosis and CD34-positive cell clusters in primary myelodysplastic syndromes.

    Science.gov (United States)

    Della Porta, Matteo Giovanni; Malcovati, Luca; Boveri, Emanuela; Travaglino, Erica; Pietra, Daniela; Pascutto, Cristiana; Passamonti, Francesco; Invernizzi, Rosangela; Castello, Alessandro; Magrini, Umberto; Lazzarino, Mario; Cazzola, Mario

    2009-02-10

    We studied bone marrow (BM) histologic abnormalities in myelodysplastic syndromes (MDS) classified according to WHO criteria to determine their clinical correlates and prognostic value. Three hundred one consecutive patients were retrospectively evaluated for BM fibrosis and CD34 immunoreactivity. Marrow fibrosis was assessed following the European consensus guidelines. Moderate to severe BM fibrosis was detected in 17% of cases and was associated with multilineage dysplasia (P = .001), high transfusion requirement (P WHO categories with excess of blasts (P according to International Prognostic Scoring System and WHO classification-based Prognostic Scoring System categories, BM fibrosis involved a shift to a one-step more advanced risk group. BM fibrosis identifies a distinct subgroup of MDS with multilineage dysplasia, high transfusion requirement, and poor prognosis and represents an independent prognostic factor that may be useful in clinical decision making. Furthermore, the presence of CD34+ cell clusters is an independent risk factor for progression to acute leukemia.

  19. Prostacyclin Suppresses Twist Expression in the Presence of Indomethacin in Bone Marrow-Derived Mesenchymal Stromal Cells

    OpenAIRE

    Kemper, Oliver; Herten, Monika; Fischer, Johannes; Haversath, Marcel; Beck, Sascha; Classen, Tim; Warwas, Sebastian; Tassemeier, Tjark; Landgraeber, Stefan; Lensing-Höhn, Sabine; Krauspe, Rüdiger; Jäger, Marcus

    2014-01-01

    Background Iloprost, a stable prostacyclin I2 analogue, seems to have an osteoblast-protective potential, whereas indomethacin suppresses new bone formation. The aim of this study was to investigate human bone marrow stromal cell (BMSC) proliferation and differentiation towards the osteoblastic lineage by administration of indomethacin and/or iloprost. Material/Methods Human bone marrow cells were obtained from 3 different donors (A=26 yrs/m; B=25 yrs/f, C=35 yrs/m) via vacuum aspiration of t...

  20. Efficient generation of induced pluripotent stem cells from human bone marrow mesenchymal stem cells.

    Science.gov (United States)

    Yulin, X; Lizhen, L; Lifei, Z; Shan, F; Ru, L; Kaimin, H; Huang, H

    2012-01-01

    Ectopic expression of defined sets of genetic factors can reprogramme somatic cells to induced pluripotent stem cells (iPSCs) that closely resemble embryonic stem cells. However, the low reprogramming efficiency is a significant handicap for mechanistic studies and potential clinical application. In this study, we used human bone marrow-derived mesenchymal stem cells (hBMMSCs) as target cells for reprogramming and investigated efficient iPSC generation from hBMMSCs using the compounds of p53 siRNA, valproic acid (VPA) and vitamin C (Vc) with four transcription factors OCT4, SOX2, KLF4, and c-MYC (compound induction system). The synergetic mechanism of the compounds was studied. Our results showed that the compound induction system could efficiently reprogramme hBMMSCs to iPSCs. hBMMSC-derived iPSC populations expressed pluripotent markers and had multi-potential to differentiate into three germ layer-derived cells. p53 siRNA, VPA and Vc had a synergetic effect on cell reprogramming and the combinatorial use of these substances greatly improved the efficiency of iPSC generation by suppressing the expression of p53, decreasing cell apoptosis, up-regulating the expression of the pluripotent gene OCT4 and modifying the cell cycle. Therefore, our study highlights a straightforward method for improving the speed and efficiency of iPSC generation and provides versatile tools for investigating early developmental processes such as haemopoiesis and relevant diseases. In addition, this study provides a paradigm for the combinatorial use of genetic factors and molecules to improve the efficiency of iPSC generation.

  1. Evaluation of Posterolateral Lumbar Fusion in Sheep Using Mineral Scaffolds Seeded with Cultured Bone Marrow Cells

    Science.gov (United States)

    Cuenca-López, María D.; Andrades, José A.; Gómez, Santiago; Zamora-Navas, Plácido; Guerado, Enrique; Rubio, Nuria; Blanco, Jerónimo; Becerra, José

    2014-01-01

    The objective of this study is to investigate the efficacy of hybrid constructs in comparison to bone grafts (autograft and allograft) for posterolateral lumbar fusion (PLF) in sheep, instrumented with transpedicular screws and bars. Hybrid constructs using cultured bone marrow (BM) mesenchymal stem cells (MSCs) have shown promising results in several bone healing models. In particular, hybrid constructs made by calcium phosphate-enriched cells have had similar fusion rates to bone autografts in posterolateral lumbar fusion in sheep. In our study, four experimental spinal fusions in two animal groups were compared in sheep: autograft and allograft (reference group), hydroxyapatite scaffold, and hydroxyapatite scaffold seeded with cultured and osteoinduced bone marrow MSCs (hybrid construct). During the last three days of culture, dexamethasone (dex) and beta-glycerophosphate (β-GP) were added to potentiate osteoinduction. The two experimental situations of each group were tested in the same spinal segment (L4–L5). Spinal fusion and bone formation were studied by clinical observation, X-ray, computed tomography (CT), histology, and histomorphometry. Lumbar fusion rates assessed by CT scan and histology were higher for autograft and allograft (70%) than for mineral scaffold alone (22%) and hybrid constructs (35%). The quantity of new bone formation was also higher for the reference group, quite similar in both (autograft and allograft). Although the hybrid scaffold group had a better fusion rate than the non-hybrid scaffold group, the histological analysis revealed no significant differences between them in terms of quantity of bone formation. The histology results suggested that mineral scaffolds were partly resorbed in an early phase, and included in callus tissues. Far from the callus area the hydroxyapatite alone did not generate bone around it, but the hybrid scaffold did. In nude mice, labeled cells were induced to differentiate in vivo and monitored by

  2. Evaluation of Posterolateral Lumbar Fusion in Sheep Using Mineral Scaffolds Seeded with Cultured Bone Marrow Cells

    Directory of Open Access Journals (Sweden)

    María D. Cuenca-López

    2014-12-01

    Full Text Available The objective of this study is to investigate the efficacy of hybrid constructs in comparison to bone grafts (autograft and allograft for posterolateral lumbar fusion (PLF in sheep, instrumented with transpedicular screws and bars. Hybrid constructs using cultured bone marrow (BM mesenchymal stem cells (MSCs have shown promising results in several bone healing models. In particular, hybrid constructs made by calcium phosphate-enriched cells have had similar fusion rates to bone autografts in posterolateral lumbar fusion in sheep. In our study, four experimental spinal fusions in two animal groups were compared in sheep: autograft and allograft (reference group, hydroxyapatite scaffold, and hydroxyapatite scaffold seeded with cultured and osteoinduced bone marrow MSCs (hybrid construct. During the last three days of culture, dexamethasone (dex and beta-glycerophosphate (β-GP were added to potentiate osteoinduction. The two experimental situations of each group were tested in the same spinal segment (L4–L5. Spinal fusion and bone formation were studied by clinical observation, X-ray, computed tomography (CT, histology, and histomorphometry. Lumbar fusion rates assessed by CT scan and histology were higher for autograft and allograft (70% than for mineral scaffold alone (22% and hybrid constructs (35%. The quantity of new bone formation was also higher for the reference group, quite similar in both (autograft and allograft. Although the hybrid scaffold group had a better fusion rate than the non-hybrid scaffold group, the histological analysis revealed no significant differences between them in terms of quantity of bone formation. The histology results suggested that mineral scaffolds were partly resorbed in an early phase, and included in callus tissues. Far from the callus area the hydroxyapatite alone did not generate bone around it, but the hybrid scaffold did. In nude mice, labeled cells were induced to differentiate in vivo and monitored

  3. Transplantation of islet cells across major histocompatibility barriers after total lymphoid irradiation and infusion of allogeneic bone marrow cells

    International Nuclear Information System (INIS)

    Britt, L.D.; Scharp, D.W.; Lacy, P.E.; Slavin, S.

    1982-01-01

    Diabetic Lewis rats (AgB1/L) were evaluated as recipients of allogeneic Wistar-Furth (AgB2/2) isolated adult islets without the use of standard recipient immunosuppression. One group was treated with fractionated total lymphoid irradiation (TLI) and Wistar-Furth bone marrow cell reconstitution to proven chimerism prior to islet transplantation. This group returned to a prediabetic state following Wistar-Furth islet transplantation without any evidence of rejection for 100 days posttransplant. A second group of Lewis rats received only TLI without bone marrow treatment. They gave a varying result following islet transplantation with one recipient showing evidence of prolonged islet survival. A third chimeric control group did not receive isolated islets and did not alter their diabetic state. A fourth group was not given TLI nor donor bone marrow cells and uniformly rejected their allogeneic islets by 7 days. Thus, allogeneic adult islets will survive across major rat histocompatibility barriers using TLI and donor bone marrow chimerism as the only form of immunosuppression

  4. Bone regeneration with autologous plasma, bone marrow stromal cells, and porous beta-tricalcium phosphate in nonhuman primates.

    Science.gov (United States)

    Torigoe, Ichiro; Sotome, Shinichi; Tsuchiya, Akio; Yoshii, Toshitaka; Maehara, Hidetsugu; Sugata, Yumi; Ichinose, Shizuko; Shinomiya, Kenichi; Okawa, Atsushi

    2009-07-01

    To potentiate the bone formation capability of bone marrow stromal cell (BMSC)/beta-tricalcium phosphate (beta-TCP) constructs, we devised an autologous plasma-based construct. We tested its effectiveness and investigated the effects of its components on a monkey ectopic bone formation model. The autologous plasma (platelet-rich plasma, PRP, or platelet-poor plasma, PPP)/BMSC/beta-TCP construct (R group or P group) showed significantly more bone formation at 3 and 6 weeks after implantation than a conventional BMSC/beta-TCP construct using a culture medium (M group). There was no significant difference between the P and R groups. Moreover, the P group constructs with a 10-fold lower cell concentration yielded equivalent bone formation to the M group at 5 weeks after implantation. To elucidate the effect of fibrin and serum contained in the plasma, five constructs were prepared using the following cell vehicles: autologous serum + fibrinogen (0, 1, 4, or 16 mg/mL) or phosphate-buffered saline + fibrinogen (4 mg/mL). The serum + fibrinogen (4 mg/mL, physiological concentration of monkeys) construct showed the most abundant bone formation at 3 weeks after implantation, though at 5 weeks no statistical difference existed among the groups. Autologous plasma efficiently promoted osteogenesis of BMSCs/porous beta-TCP constructs, and both fibrin and serum proved to play significant roles in the mechanism.

  5. Bone marrow macrophages maintain hematopoietic stem cell (HSC) niches and their depletion mobilizes HSCs.

    Science.gov (United States)

    Winkler, Ingrid G; Sims, Natalie A; Pettit, Allison R; Barbier, Valérie; Nowlan, Bianca; Helwani, Falak; Poulton, Ingrid J; van Rooijen, Nico; Alexander, Kylie A; Raggatt, Liza J; Lévesque, Jean-Pierre

    2010-12-02

    In the bone marrow, hematopoietic stem cells (HSCs) reside in specific niches near osteoblast-lineage cells at the endosteum. To investigate the regulation of these endosteal niches, we studied the mobilization of HSCs into the bloodstream in response to granulocyte colony-stimulating factor (G-CSF). We report that G-CSF mobilization rapidly depletes endosteal osteoblasts, leading to suppressed endosteal bone formation and decreased expression of factors required for HSC retention and self-renewal. Importantly, G-CSF administration also depleted a population of trophic endosteal macrophages (osteomacs) that support osteoblast function. Osteomac loss, osteoblast suppression, and HSC mobilization occurred concomitantly, suggesting that osteomac loss could disrupt endosteal niches. Indeed, in vivo depletion of macrophages, in either macrophage Fas-induced apoptosis (Mafia) transgenic mice or by administration of clodronate-loaded liposomes to wild-type mice, recapitulated the: (1) loss of endosteal osteoblasts and (2) marked reduction of HSC-trophic cytokines at the endosteum, with (3) HSC mobilization into the blood, as observed during G-CSF administration. Together, these results establish that bone marrow macrophages are pivotal to maintain the endosteal HSC niche and that the loss of such macrophages leads to the egress of HSCs into the blood.

  6. [RelB silencing in mouse bone-marrow derived dendritic cells mediated by lentiviral vector].

    Science.gov (United States)

    Bao, Jie; Wang, Qian; Zheng, Lei; Qiu, Yu-rong; Zeng, Fang-yin; Yang, Chun-li; Huang, Xian-zhang

    2008-09-01

    To silence RelB gene in mouse bone-marrow derived dendritic cells (DC) utilizing lentiviral vector, a novel tolerogenic dendritic cell with a relatively low expression level RelB was constructed and a new way to treat and prevent autoimmune diseases was explored. Interferential targeting sequence R5 of RelB in mice was designed, synthesized and cloned into lentiviral vectors. Together with viral packaging materials were co-cultured in 293FT cell line to package lentiviral vector. Supernatant fluids were harvested, then virus titer detected. Mouse bone marrow derived DCs were infected by lentivirus particle. RelB gene expression level was detected by RT-PCR and immunofluorescence staining and analyzed by software of geo pro. There are three experiment control groups including immature DC, mature DC and DC infected by a negative independent control of T6. A similar RelB expression was detected by RT-PCR and immunofluorescence staining assay between DC infected virus R5 and immature DC, but was lower than that of mature DC. Significant difference in statistics P < 0.05. A similar RelB expression was detected by RT-PCR and immunofluorescence staining approaches between DC infected virus T6 and mature DC, but was higher than that of immature DC. Significant difference in statistics P < 0.05. RelB gene expressed by mouse bone marrow derived DC was silenced by Lentivirus vector effectively. The lentivirus vector with a low immunogenicity can be used to immunotherapy in vivo and overcome difficult transfection problem of primary DC. A new viral vector of DC immunotherapy can be obtained.

  7. Effects of adjuvant chemotherapy on bone marrow mesenchymal stem cells of colorectal cancer patients.

    Science.gov (United States)

    Cao, J; Tan, M H; Yang, P; Li, W L; Xia, J; Du, H; Tang, W B; Wang, H; Chen, X W; Xiao, H Q

    2008-05-18

    Chemotherapy damages the bone marrow and that is one of the most important problems in the treatment of malignancies, particularly colorectal cancer. The aim of the present study was to assess the effects of surgical adjuvant chemotherapy for CRC patients on human MSCs using an in vitro culture system. The bone marrows of 43 CRC patients were harvested for separation and culture of MSC at pre- and post-chemotherapy. The number of colonies forming unit-fibroblast (CFU-F) was counted. The adhesive function of MSC was assayed and the growth of colony-forming unit-mixed hematopoietic cell (CFU-Mix) on the MSC layer was observed. The concentration of IL-6, SCF and FLT-T3 proteins in the MSC culture supernatant were also detected by ELISA assay. In the CRC patients with chemotherapy, we have demonstrated that the CFU-F exhibit significantly decreased. We also showed that the adhesive rate of bone marrow mesenchymal stem cell (BMSC) was significantly decreased. The growth of CFU-Mix on the MSC layer was inhibited. Most importantly, decreased CFU-F and the adhesive rate of BMSC were correlated significantly with decreased interleukins and stem-cell factor (IL-6, SCF and FLT-3L) expressions in the CRC patients after chemotherapy. Our results suggest that MSCs of CRC patients can be damaged by chemotherapy. Our data also indicates that the decreased expression of haematogenesis factors may play an important role in the pathogenesis. In the future, the MSC refused may have a potential clinical application in chemotherapeutically treated patients.

  8. Bone marrow edema syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Korompilias, Anastasios V.; Lykissas, Marios G.; Beris, Alexandros E. [University of Ioannina, Department of Orthopaedic Surgery, School of Medicine, Ioannina (Greece); Karantanas, Apostolos H. [University of Crete School of Medicine, Department of Radiology, Heraklion (Greece)

    2009-05-15

    Bone marrow edema syndrome (BMES) refers to transient clinical conditions with unknown pathogenic mechanism, such as transient osteoporosis of the hip (TOH), regional migratory osteoporosis (RMO), and reflex sympathetic dystrophy (RSD). BMES is primarily characterized by bone marrow edema (BME) pattern. The disease mainly affects the hip, the knee, and the ankle of middle-aged males. Many hypotheses have been proposed to explain the pathogenesis of the disease. Unfortunately, the etiology of BMES remains obscure. The hallmark that separates BMES from other conditions presented with BME pattern is its self-limited nature. Laboratory tests usually do not contribute to the diagnosis. Histological examination of the lesion is unnecessary. Plain radiographs may reveal regional osseous demineralization. Magnetic resonance imaging is mainly used for the early diagnosis and monitoring the progression of the disease. Early differentiation from other aggressive conditions with long-term sequelae is essential in order to avoid unnecessary treatment. Clinical entities, such as TOH, RMO, and RSD are spontaneously resolving, and surgical treatment is not needed. On the other hand, early differential diagnosis and surgical treatment in case of osteonecrosis is of crucial importance. (orig.)

  9. Limiting-dilution analysis for the determination of leukemic cell frequencies after bone marrow decontamination with mafosfamide or merocyanine 540

    International Nuclear Information System (INIS)

    Porcellini, A.; Talevi, N.; Marchetti-Rossi, M.T.; Palazzi, M.; Manna, A.; Sparaventi, G.; Delfini, C.; Valentini, M.

    1987-01-01

    To stimulate a leukemia remission marrow, cell suspensions of normal human bone marrow were mixed with human acute lymphoblastic or myelogenous leukemic cells of the CCRF-SF, Nalm-6, and K-562 lines. The cell mixtures were incubated in vitro with mafosfamide (AZ) or with the photoreactive dye merocyanine 540 (MC-540). A quantity of 10(4) cells of the treated suspensions was dispensed into microculture plates, and graded cell numbers of the line used to contaminate the normal marrow were added. Limiting-dilution analysis was used to estimate the frequency of leukemia cells persisting after treatment with the decontaminating agents. Treatment with AZ or MC-540 produced a total elimination (ie, 6 logs or 5.3 logs respectively) of B cell acute leukemia cells (CCRF-SB), whereas nearly 1.7 logs and 2 logs of K-562 acute myelogenous blasts were still present in the cell mixtures after treatment with MC-540 and AZ, respectively. Treatment of the Nalm-6-contaminated cell mixtures with AZ resulted in 100% elimination of clonogenic cells, whereas nearly 80% decontamination was obtained with MC-540. Our results suggest that treatment with AZ could be an effective method of eliminating clonogenic tumor cells from human bone marrow. MC-540, shown by previous studies to spare sufficient pluripotential stem cells to ensure hemopoietic reconstitution in the murine model and in clinical application, has comparable effects and merits trials for possible clinical use in autologous bone marrow transplantation

  10. Limiting-dilution analysis for the determination of leukemic cell frequencies after bone marrow decontamination with mafosfamide or merocyanine 540

    Energy Technology Data Exchange (ETDEWEB)

    Porcellini, A.; Talevi, N.; Marchetti-Rossi, M.T.; Palazzi, M.; Manna, A.; Sparaventi, G.; Delfini, C.; Valentini, M.

    1987-11-01

    To stimulate a leukemia remission marrow, cell suspensions of normal human bone marrow were mixed with human acute lymphoblastic or myelogenous leukemic cells of the CCRF-SF, Nalm-6, and K-562 lines. The cell mixtures were incubated in vitro with mafosfamide (AZ) or with the photoreactive dye merocyanine 540 (MC-540). A quantity of 10(4) cells of the treated suspensions was dispensed into microculture plates, and graded cell numbers of the line used to contaminate the normal marrow were added. Limiting-dilution analysis was used to estimate the frequency of leukemia cells persisting after treatment with the decontaminating agents. Treatment with AZ or MC-540 produced a total elimination (ie, 6 logs or 5.3 logs respectively) of B cell acute leukemia cells (CCRF-SB), whereas nearly 1.7 logs and 2 logs of K-562 acute myelogenous blasts were still present in the cell mixtures after treatment with MC-540 and AZ, respectively. Treatment of the Nalm-6-contaminated cell mixtures with AZ resulted in 100% elimination of clonogenic cells, whereas nearly 80% decontamination was obtained with MC-540. Our results suggest that treatment with AZ could be an effective method of eliminating clonogenic tumor cells from human bone marrow. MC-540, shown by previous studies to spare sufficient pluripotential stem cells to ensure hemopoietic reconstitution in the murine model and in clinical application, has comparable effects and merits trials for possible clinical use in autologous bone marrow transplantation.

  11. Targeting eradication of malignant cells derived from human bone marrow mesenchymal stromal cells

    International Nuclear Information System (INIS)

    Yang, Yingbin; Cai, Shaoxi; Yang, Li; Yu, Shuhui; Jiang, Jiahuan; Yan, Xiaoqing; Zhang, Haoxing; Liu, Lan; Liu, Qun; Du, Jun; Cai, Shaohui; Sung, K.L. Paul

    2010-01-01

    Human bone marrow mesenchymal stromal cells (hBMSC) have been shown to participate in malignant transformation. However, hampered by the low frequency of malignant transformation of hBMSC, we do not yet know how to prevent malignant transformation of implanted hBMSC. In this study, in order to establish a model for the eradication of hBMSC-derived malignant cells, a gene fusion consisting of a human telomerase (hTERT) promoter modified with both c-Myc and myeloid zinc finger protein2 (MZF-2) binding elements and followed by the E. coli cytosine deaminase (CD) and luciferase genes was stably transferred into hBMSC via lentiviral transduction; n-phosphonacelyl-L-aspartic acid (PALA) selection was used to generate malignant cell colonies derived from transduced hBMSC after treatment with the carcinogenic reagent BPDE. Cells that were amplified after PALA selection were used for transplantation and 5-FC pro-drug cytotoxicity tests. The results showed that PALA-resistant malignant cells could be generated from hBMSC co-induced with lentiviral transduction and treatment with Benzo(a)pyrene Diol Epoxide (BPDE); the modification of c-Myc and MZF-2 binding elements could remarkably enhance the transcriptional activities of the hTERT promoter in malignant cells, whereas transcriptional activity was depressed in normal hBMSC; malignant cells stably expressing CD under the control of the modified hTERT promoter could be eliminated by 5-FC administration. This study has provided a method for targeted eradication of malignant cells derived from hBMSC.

  12. Targeting eradication of malignant cells derived from human bone marrow mesenchymal stromal cells

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Yingbin [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); School of Life Science, Southwest University, Chongqing 400715 (China); Cai, Shaoxi, E-mail: sxcai@cqu.edu.cn [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); Yang, Li [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); College of Pharmacy, Jinan University, Guangzhou 510632 (China); Yu, Shuhui [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); Library of Southwest University, Chongqing 400715 (China); Jiang, Jiahuan; Yan, Xiaoqing [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); Zhang, Haoxing [School of Life Science, Southwest University, Chongqing 400715 (China); Liu, Lan [Department of Laboratory of Medicine, Children' s Hospital of Chongqin Medical University, Chongqing 400014 (China); Liu, Qun [College of Life Science and Technology, Southwest University for Nationalities, Chengdu 610041 (China); Du, Jun [Center of Microbiology, Biochemistry, and Pharmacology, School of Pharmaceutical Science, Sun Yat-Sen University, Guangzhou 510080 (China); Cai, Shaohui [College of Pharmacy, Jinan University, Guangzhou 510632 (China); Sung, K.L. Paul [Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing 400044 (China); Departments of Orthopaedic Surgery and Bioengineering, University of California, SD 0412 (United States)

    2010-12-10

    Human bone marrow mesenchymal stromal cells (hBMSC) have been shown to participate in malignant transformation. However, hampered by the low frequency of malignant transformation of hBMSC, we do not yet know how to prevent malignant transformation of implanted hBMSC. In this study, in order to establish a model for the eradication of hBMSC-derived malignant cells, a gene fusion consisting of a human telomerase (hTERT) promoter modified with both c-Myc and myeloid zinc finger protein2 (MZF-2) binding elements and followed by the E. coli cytosine deaminase (CD) and luciferase genes was stably transferred into hBMSC via lentiviral transduction; n-phosphonacelyl-L-aspartic acid (PALA) selection was used to generate malignant cell colonies derived from transduced hBMSC after treatment with the carcinogenic reagent BPDE. Cells that were amplified after PALA selection were used for transplantation and 5-FC pro-drug cytotoxicity tests. The results showed that PALA-resistant malignant cells could be generated from hBMSC co-induced with lentiviral transduction and treatment with Benzo(a)pyrene Diol Epoxide (BPDE); the modification of c-Myc and MZF-2 binding elements could remarkably enhance the transcriptional activities of the hTERT promoter in malignant cells, whereas transcriptional activity was depressed in normal hBMSC; malignant cells stably expressing CD under the control of the modified hTERT promoter could be eliminated by 5-FC administration. This study has provided a method for targeted eradication of malignant cells derived from hBMSC.

  13. Trophic Actions of Bone Marrow-Derived Mesenchymal Stromal Cells for Muscle Repair/Regeneration

    Directory of Open Access Journals (Sweden)

    Lucia Formigli

    2012-10-01

    Full Text Available Bone marrow-derived mesenchymal stromal cells (BM-MSCs represent the leading candidate cell in tissue engineering and regenerative medicine. These cells can be easily isolated, expanded in vitro and are capable of providing significant functional benefits after implantation in the damaged muscle tissues. Despite their plasticity, the participation of BM-MSCs to new muscle fiber formation is controversial; in fact, emerging evidence indicates that their therapeutic effects occur without signs of long-term tissue engraftment and involve the paracrine secretion of cytokines and growth factors with multiple effects on the injured tissue, including modulation of inflammation and immune reaction, positive extracellular matrix (ECM remodeling, angiogenesis and protection from apoptosis. Recently, a new role for BM-MSCs in the stimulation of muscle progenitor cells proliferation has been demonstrated, suggesting the potential ability of these cells to influence the fate of local stem cells and augment the endogenous mechanisms of repair/regeneration in the damaged tissues.

  14. c-Myb is required for plasma cell migration to bone marrow after immunization or infection

    Science.gov (United States)

    O’Donnell, Kristy; Belz, Gabrielle T.; Nutt, Stephen L.

    2015-01-01

    Plasma cell migration is crucial to immunity, but little is known about the molecular regulators of their migratory programs. Here, we detail the critical role of the transcription factor c-Myb in determining plasma cell location. In the absence of c-Myb, no IgG+ antigen-specific plasma cells were detected in the bone marrow after immunization or virus infection. This was correlated with a dramatic reduction of plasma cells in peripheral blood, mislocalization in spleen, and an inability of c-Myb–deficient plasma cells to migrate along a CXCL12 gradient. Therefore, c-Myb plays an essential, novel role in establishing the long-lived plasma cell population in the BM via responsiveness to chemokine migration cues. PMID:26077717

  15. Micronuclei induced by municipal landfill leachate in mouse bone marrow cells in vivo

    International Nuclear Information System (INIS)

    Li Guangke; Sang Nan; Zhao Youcai

    2004-01-01

    The induction of micronuclei (MN) in polychromatic erythrocytes (PCE) of mouse bone marrow by municipal landfill leachate was studied in vivo. Results showed that mouse exposure via drinking water containing various concentrations of leachate caused a significant increase of MN frequencies in a concentration (Chemical oxygen demand measured with potassium dichromate oxidation, COD Cr )-dependent manner. MN induction in female and male mice was different at higher concentrations. This implies that leachate is a genotoxic agent in mammalian cells and that exposure to leachate in an aquatic environment may pose a potential genotoxic risk to human beings

  16. Study of clone forming cells (CFC) in blood and bone marrow of subjects with chronic myeloid leukemia (CML)

    International Nuclear Information System (INIS)

    Berthier, Rolande; Metral, Jacqueline; Hollard, Daniel.

    1975-01-01

    Density of blood and bone marrow CFC of patients with CML (Chronic Myeloid Leukemia) is lower than density of normal CFC. The rate of bone marrow and blood light CFC of normal subjects and of subjects with LMC were determined. Bone marrow and blood samples from the same subject were also studied. Comparative study of blood and bone marrow has shown that the rate of bone marrow light CFC is lower than the rate of blood CFC [fr

  17. Bone Marrow Stem Cell Chemotactic Activity Is Induced by Elevated CXCl12 in Endometriosis.

    Science.gov (United States)

    Moridi, Irene; Mamillapalli, Ramanaiah; Cosar, Emine; Ersoy, Gulcin Sahin; Taylor, Hugh S

    2017-04-01

    Endometriosis is an inflammatory gynecological disorder caused by the growth of endometrial tissue outside the uterus. Endometriosis produces chemokines, including CXCL12, that attract bone marrow cells to the lesions. In this study, we describe the expression, localization, and chemotactic activity of CXCL12 in endometriotic lesions. Biopsies were collected both from women with endometriosis undergoing laparoscopy and control endometrium from women without endometriosis. Expression of CXCl12 and CXCR4 messenger RNA was increased approximately 4- and 6-fold, respectively, in endometriosis compared to eutopic endometrium. Immunohistochemistry of lesions revealed that CXCR4 was expressed in the stroma and epithelium in both endometriosis and control eutopic endometrium. The level of CXCR4 protein expression was significantly higher in all cellular compartments of the endometriotic lesions compared to control endometrium. CXCL12 protein expression was also higher in endometriotic lesions and was greatest in the epithelial compartment. CXCL12 was increased more in the condition media of cultured endometriosis than in controls as measured by enzyme-linked immunosorbent assay. Transwell chamber migration was used to demonstrate 2-fold increased chemoattraction of mouse bone marrow stem cells toward CXCL12 in the endometriotic-conditioned medium compared with eutopic endometrium. Our results indicate that a preferential recruitment of stem cells to endometriosis can explain how endometriosis outcompetes eutopic endometrium in recruiting the limited supply of circulating stem cells. The CXCL12/CXCR4 signaling axis is a potential target for the treatment of endometriosis and its associated disorders.

  18. Effects of Na/K-ATPase and its ligands on bone marrow stromal cell differentiation

    Directory of Open Access Journals (Sweden)

    Moustafa Sayed

    2014-07-01

    Full Text Available Endogenous ligands of Na/K-ATPase have been demonstrated to increase in kidney dysfunction and heart failure. It is also reported that Na/K-ATPase signaling function effects stem cell differentiation. This study evaluated whether Na/K-ATPase activation through its ligands and associated signaling functions affect bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells differentiation capacity. BMSCs were isolated from male Sprague–Dawley rats and cultured in minimal essential medium alpha (MEM-α supplemented with 15% Fetal Bovine serum (FBS. The results showed that marinobufagenin (MBG, a specific Na/K-ATPase ligand, potentiated rosiglitazone-induced adipogenesis in these BMSCs. Meanwhile, it attenuated BMSC osteogenesis. Mechanistically, MBG increased CCAAT/enhancer binding protein alpha (C/EBPα protein expression through activation of an extracellular regulated kinase (ERK signaling pathway, which leads to enhanced rosiglitazone-induced adipogenesis. Inhibition of ERK activation by U0126 blocks the effect of MBG on C/EBPα expression and on rosiglitazone-induced adipogenesis. Reciprocally, MBG reduced runt-related transcription factor 2 (RunX2 expression, which resulted in the inhibition of osteogenesis induced by β-glycerophosphate/ascorbic acid. MBG also potentiated rosiglitazone-induced adipogenesis in 3T3-L1 cells and in mouse BMSCs. These results suggest that Na/K-ATPase and its signaling functions are involved in the regulation of BMSCs differentiation.

  19. The tropism of neurally differentiated bone marrow stromal cells towards C6 glioma.

    Science.gov (United States)

    Long, Qianfa; Liu, Weiping; Zhong, Jun; Yi, Xicai; Liu, Yang; Liu, Yuanyang; Yang, Yang; Han, Rui; Fei, Zhou

    2011-10-24

    Recent studies have indicated that bone marrow stromal cells (BMSCs) have significant tropism towards glioma which makes them play an important role in carrying genes/drugs to inhibit the growth of glioma as cell vehicles. But BMSCs may differentiate into neural cells under entocranial environment and few researches support the idea that neurally differentiated bone marrow stromal cells (N-D-BMSCs) still hold the capacity of migrating to the tumor sites. The aim of our study was to investigate the tropism of N-D-BMSCs towards C6 glioma. In vitro migration assay was employed by transwell co-culture system and Student's t-test analysis indicated that N-D-BMSCs had the significant tropism towards C6 glioma-conditioned medium (GCM) (Ptropism of N-D-BMSCs towards C6 glioma sites presented time variation (P-value=2.9E-20). Moreover, multiple comparisons for the time variables with the Student's t-test and the results suggested that the migration capacity of N-D-BMSCs towards C6 glioma sites reach the peak on the 7th day after transplantation. These results demonstrate that N-D-BMSCs as well as BMSCs have significant tropism towards C6 glioma. Published by Elsevier Ireland Ltd.

  20. Using Hydroxyapatite-Gelatin Scaffold Seeded with Bone Marrow Stromal Cells as a Bone Graft in Animal Model

    Directory of Open Access Journals (Sweden)

    Mahsoumeh Behruzi

    2016-11-01

    Full Text Available Background: Nowadays, composite scaffolds with some desired characteristics have a numerous applications in hard tissue engineering. In present study, the role of composite hydroxyapatite - gelatin was examined in both alone and coated by Bone Marrow Stromal Stem Cells (BMSCs conditions in the process of healing bone defects, reduction of time repair and the immune response of body by laboratory studies (in vitro and in vivo on the skull of adult rats as well. Materials and Methods: In present study, nano-hydroxyapatite powder and gelatin were used to provide nano-hydroxyapatite-gelatin scaffold, BMSCs were isolated by Flushing method. Fifteen adult male Wistar rats weighing 250-200 g were used. Studing groups included bone defect with hydroxyapatite-gelatin scaffold, bone defect with hydroxyapatite-gelatin with BMSCs and bone defects without scaffolding as a controlwhich were examined after a week and a month after surgery. MTT assay was used in order to evaluation of biocompatibility of scaffolds. To confirm the healing progress trend and the presence of inflammatory cells we used hematoxylin-eosin and we used Masson's trichrome staining in order to study of synthesis of collagen fibers. Results: The results of MTT showed that the scaffold has no toxic effects on stromal cells. The first signs of ossification in hydroxyapatite-gelatin with BMSCs cells group, appeared in the first week. However, in the fourth week, ossification was completed and the scaffold remaining was found as embedded islands in the spongy bone tissue. The greatest number of lymphocytes was observed in the experimental group after one week of planting scaffold. Conclusion: it seems that Hydroxyapatite-gelatin scaffold coated with BMSCs cells has a potential role in the healing process of bone and it can be suitable as a therapeutic strategy to repair extensive bone lesions.

  1. Nanocrystalline diamond: In vitro biocompatibility assessment by MG63 and human bone marrow cells cultures.

    Science.gov (United States)

    Amaral, M; Dias, A G; Gomes, P S; Lopes, M A; Silva, R F; Santos, J D; Fernandes, M H

    2008-10-01

    Nanocrystalline diamond (NCD) has a great potential for prosthetic implants coating. Nevertheless, its biocompatibility still has to be better understood. To do so, we employed several materials characterization techniques (SEM, AFM, micro-Raman spectroscopy) and cell culture assays using MG63 osteoblast-like and human bone marrow cells. Biochemical routines (MTT assays, Lowry's method, ALP activity) supported by SEM and confocal microscopy characterization were carried out. We used silicon nitride (Si3N4) substrates for NCD coatings based on a previous demonstration of the superior adhesion and tribological performance of these NCD coated ceramics. Results demonstrate an improved human osteoblast proliferation and the stimulation of differentiated markers, like ALP activity and matrix mineralization, compared with standard polystyrene tissue culture plates. The nanometric featuring of NCD, associated to its chemical affinity are key points for bone regeneration purposes.

  2. Immediate bromodeoxyuridine labelling of unseparated human bone marrow cells ex vivo is superior to labelling after routine laboratory processing

    DEFF Research Database (Denmark)

    Jensen, P O; Mortensen, B T; Christensen, I J

    1998-01-01

    It is important to evaluate the proliferation of bone marrow cells in several disease conditions and during treatment of patients with for example cytokines. Labelling with bromodeoxyuridine (BrdUrd), immunocytochemical staining with anti-BrdUrd antibody and analysis by flow cytometry provides...... a reliable and reproducible technique for estimation of the fraction of cells that incorporated BrdUrd into DNA during S-phase. We have compared immediate BrdUrd labelling of unseparated bone marrow cells with the previously used labelling in the laboratory after routine separation of the mononuclear cells...

  3. Omega 3 fatty acids reduce myeloid progenitor cell frequency in the bone marrow of mice and promote progenitor cell differentiation

    Directory of Open Access Journals (Sweden)

    Sollars Vincent E

    2009-03-01

    Full Text Available Abstract Background Omega 3 fatty acids have been found to inhibit proliferation, induce apoptosis, and promote differentiation in various cell types. The processes of cell survival, expansion, and differentiation are of key importance in the regulation of hematopoiesis. We investigated the role of omega 3 fatty acids in controlling the frequency of various myeloid progenitor cells in the bone marrow of mice. Increased progenitor cell frequency and blocked differentiation are characteristics of hematopoietic disorders of the myeloid lineage, such as myeloproliferative diseases and myeloid leukemias. Results We found that increasing the proportion of omega 3 fatty acids relative to the proportion of omega 6 fatty acids in the diet caused increased differentiation and reduced the frequency of myeloid progenitor cells in the bone marrow of mice. Furthermore, this had no adverse effect on peripheral white blood cell counts. Conclusion Our results indicate that omega 3 fatty acids impact hematopoietic differentiation by reducing myeloid progenitor cell frequency in the bone marrow and promoting progenitor cell differentiation. Further exploration of this discovery could lead to the use of omega 3 fatty acids as a therapeutic option for patients that have various disorders of hematopoiesis.

  4. Comparative study of internal contamination of different radiators in skeleton on induction of mutagenic effect in bone marrow cells

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Wang Liuyi; Yang Weidong

    1990-10-01

    The purpose of the present study was to ascertain comparative retention of 134 Cs or 147 Pm in skeleton on induction of chromosome aberrations and PCE's micronucleus formation in bone marrow cells. Results indicated that after iv signal nuclide 134 Cs, through 7 weeks observation, the retention data in skeleton could be well described by an exponential expression. Experiments indicated that the retention value and the absorption dose of 147 Pm in skeleton were significantly higher in comparison with 134 Cs. Both internal contamination of 134 Cs or 147 Pm could induce chromosome aberrations and PCE's micronucleus formation in bone marrow cells. Among the type of chromosome aberrations of bone marrow cells induced by 134 Cs or 147 Pm included gap, chromatid breakage, chromosome breakage and translocation. Moreover, the chromosome aberration rates were elevated when the intake of radioactivity of 134 Cs or 147 Pm were enlarged. At the same time, chromosome fragment of bone marrow cells also induced by 134 Cs or 147 Pm only through high radioactive contamination. Studies showed that chromosome translocation was appeared only through high radioactivity of 147 Pm contamination. By comparing with 1 '4 7 Pm, however, the induction of chromosome aberrations and PCE's micronucleus formation rates on bone marrow cells induced by 134 Cs was quite low

  5. T11TS repress gliomagenic apoptosis of bone marrow hematopoietic stem cells.

    Science.gov (United States)

    Mondal, Somnath; Hazra, Iman; Datta, Ankur; Sk Md, Omar Faruk; Moitra, Saibal; Tripathi, Santanu Kumar; Chaudhuri, Swapna

    2018-01-01

    Combating gliomagenic global immunosuppression is one of the emerging key for improving prognosis in malignant glioma. Apoptosis plays a pivotal role within the adult hematopoietic system particularly in regulating the cells of immune system. Gliomagenic regulation of apoptotic mediators within bone marrow milieu has not been elucidated. We previously demonstrated that administration of membrane glycopeptides T11 target structure (T11TS) not only rejuvenate bone marrow hematopoietic stem cells (BMHSCs) from glioma mediated hibernation by inhibiting gliomagenic overexpression of Ang-1/Tie-2 but also stimulate glioma mediated diminution of expression CD34, c-kit, and Sca-1 markers. In the present study, we investigated the impact of glioma on apoptotic signaling cascades of BMHSCs and consequences following T11TS therapy. Bone marrow smear and Annexin V staining confirm gliomagenic acceleration of apoptotic fate of BMHSCs whereas T11TS treatment in glioma-bearing rats disrupted apoptosis of BMHSCs. Flowcytometry, immunoblotting, and immunofluorescence imagining results revealed multi potent T11TS not only significantly downregulates gliomagenic overexpression of Fas, Fas L, Bid, and caspase-8, the pro-apoptotic extrinsic mediators but also strongly inhibits cytosolic release of cytochrome-c, Apf-1, and Bax to deactivate gliomagenic caspase-9, 3 the key intrinsic apoptotic mediators followed by up modulation of anti-apoptotic Bcl-2 in glioma associated HSCs. T11TS is also able to diminish the perforin-granzyme B mediated apoptotic verdict of BMHSCs during gliomagenesis. The anti-apoptotic action of T11TS on glioma associated BMHSCs provide a crucial insight into how T11TS exerts its immunomodulatory action against glioma mediated immune devastation. © 2017 Wiley Periodicals, Inc.

  6. Influence of rhBMP-2 on rat bone marrow stromal cells cultured on titanium fiber mesh.

    NARCIS (Netherlands)

    Vehof, J.W.M.; Ruijter, J.E. de; Spauwen, P.H.M.; Jansen, J.A.

    2001-01-01

    Titanium (Ti) fiber mesh is a candidate scaffold material for the creation of bone graft substitutes (BGS). Two densities (3.54 x 10(4) cells/cm(2) [LD or low density] and 3.54 x 10(5) cells/cm(2) [HD or high density]) of rat bone marrow stromal cells were seeded on Ti-fiber mesh discs. Cells were

  7. Transplantation of human bone marrow stromal cell-derived neuroregenrative cells promotes functional recovery after spinal cord injury in mice.

    Science.gov (United States)

    Mannoji, Chikato; Koda, Masao; Kamiya, Koshiro; Dezawa, Mari; Hashimoto, Masayuki; Furuya, Takeo; Okawa, Akihiko; Takahashi, Kazuhisa; Yamazaki, Masashi

    2014-01-01

    Transplantation of bone marrow stromal cells (BMSCs) for spinal cord injury (SCI) has been shown to improve functional outcome. BMSCs can be easily obtained from bone marrow aspirate and have fewer problems in the clinical application for human SCI from the ethical and legal points of view. Recently, we produced cells with neural stem and/or progenitor cell property and neural regeneration supporting capacity from human bone marrow stromal cells (human bone marrow stromal cell-derived neuroregenerative cells: hBMSC-NRs). The aim of the present study was to clarify the effectiveness of transplantation of hBMSC-NRs to injured spinal cord of severe combined immunodeficiency (NOD/SCID) mice. Neurite outgrowth assay of PC-12 cells was performed. One week after a T9-level contusion SCI, hBMSCs or hBMSC-NRs were transplanted into the spinal cord. After the transplantation, functional and histological examinations were performed. Conditioned media of hBMSC-NRs significantly promoted the neurite outgrowth of PC-12 cells in vitro. Transplanted hBMSC-NRs survived in the injured spinal cord 8 weeks after SCI. Immunohistochemistry revealed that the density of serotonin-positive fibers of the transplanted group was significantly higher than that of the control group at the epicenter and caudal segment to the injured site. The recovery of hind limb function of the hBMSC-NRs group was significantly better than that of the control group. In conclusion, hBMSC-NRs can be one of the realistic candidates for cell transplantation therapy for human SCI.

  8. MRI in bone marrow lesions

    International Nuclear Information System (INIS)

    Linden, A.; Theissen, P.; Schauerte, G.; Schicha, H.; Diehl, V.

    1989-01-01

    MRI has the potential to demonstrate bone marrow pathology due to its good soft tissue contrast. Inflammation and necrosis can be detected very early before there is evidence of radiological changes. In bone tumors intramedullary infiltration can be visualized in addition to soft tissue changes. Metastases of bone and bone marrow, especially in spinal and pelvic regions, are well depicted, often before bone scintigraphy yields pathological findings. In haematological disorders MRI permits follow-up studies due to its good reproducibility. Infiltration by malignant lymphoma and multiple myeloma and its extension in bone marrow can be visualized by MRI, too. However, the most common pathological MRI findings in bone marrow are not very specific, and final diagnosis requires further clinical or histological information. (orig.) [de

  9. Effects of radiations on bone marrow

    International Nuclear Information System (INIS)

    Tubiana, M.; Frindel, E.; Croizat, H.; Parmentier, C.

    1979-01-01

    After total body irradiation for kidney transplant, the initial decrease of circulating blood cells is more rapid, the nadir is reached sooner and the regeneration occurs earlier when the doses are higher than a few hundred rads. The LD 50 in man seems to be higher than 450 rads. The in vivo and in vitro assays of hemopoietic stem cells have greatly increasedd the understanding of acute and late effects. Multipotential stem cells are very radiosensitive, furthermore the differentiation of the surviving stem cells is accelerated after irradiation. This results in a severe depletion of the stem cell compartment. When this stem cell number falls below a critical value, the stem cell no longer differentiates till the completion of the regeneration of the stem cell compartment. Stem cell proliferation is regulated by inhibitors and stimulators. Release of stimulators by irradiated bone marrow has been demonstrated. Severe sequellae are observed after irradiation of animal and human bone marrow. They seem to be due either to the damage of the stromal cell or to the stem cell population. In patients, four compensating mechanisms are observed after a regional bone marrow irradiation: stimulation of non irradiated bone marrow, extension of hemopoietic areas, regeneration of irradiated bone marrow when the irradiated volume is large and increase in the amplification factor resulting in an increase in the output of mature cells for one stem cell input. Assay of progenitor cells provides useful information and a reduction in their number is still observed many years after a large regional irradiation

  10. Biopsy needle advancement during bone marrow aspiration increases mesenchymal stem cell concentration

    Directory of Open Access Journals (Sweden)

    Anne E Peters

    2016-03-01

    Full Text Available Point-of-care kits to concentrate bone marrow (BM derived mesenchymal stem cells (MSCs are used clinically in horses. A maximal number of MSCs per ml of marrow aspirated might be desired prior to use of a point-of-care system to concentrate MSCs. Our objective was to test a method to increase the number of MSCs per ml of marrow collected. We collected 2 BM aspirates using 2 different collection techniques from 12 horses. The first collection technique was to aspirate BM from a single site without advancement of the biopsy needle. The second collection technique was to aspirate marrow from multiple sites within the same sternal puncture by advancing the needle 5 mm 3 times for BM aspiration from 4 sites. Numbers of MSCs in collected BM were assessed by total nucleated cell count (TNCC of BM after aspiration, total Colony-Forming-Unit-fibroblast (CFU-F assay, and total MSC number at each culture passage. The BM aspiration technique of 4 needle advancements during BM aspiration resulted in higher initial nucleated cell counts, more CFU-Fs, and more MSCs at the first passage. There were no differences in the number of MSCs at later passages. Multiple advancements of the BM needle during BM aspiration resulted in increased MSC concentration at the time of BM collection. If a point-of-care kit is used to concentrate MSCs, multiple advancements may result in higher MSC numbers in the BM concentrate after preparation by the point-of-care kit. For culture expanded MSCs beyond the first cell passage, the difference is of questionable clinical relevance.

  11. Bone marrow-derived cells in the population of spinal microglia after peripheral nerve injury.

    Science.gov (United States)

    Tashima, Ryoichi; Mikuriya, Satsuki; Tomiyama, Daisuke; Shiratori-Hayashi, Miho; Yamashita, Tomohiro; Kohro, Yuta; Tozaki-Saitoh, Hidetoshi; Inoue, Kazuhide; Tsuda, Makoto

    2016-03-23

    Accumulating evidence indicates that peripheral nerve injury (PNI) activates spinal microglia that are necessary for neuropathic pain. Recent studies using bone marrow (BM) chimeric mice have reported that after PNI, circulating BM-derived cells infiltrate into the spinal cord and differentiate into microglia-like cells. This raises the possibility that the population of spinal microglia after PNI may be heterogeneous. However, the infiltration of BM cells in the spinal cord remains controversial because of experimental adverse effects of strong irradiation used for generating BM chimeric mice. In this study, we evaluated the PNI-induced spinal infiltration of BM-derived cells not only by irradiation-induced myeloablation with various conditioning regimens, but also by parabiosis and mice with genetically labelled microglia, models without irradiation and BM transplantation. Results obtained from these independent approaches provide compelling evidence indicating little contribution of circulating BM-derived cells to the population of spinal microglia after PNI.

  12. Bone marrow-derived cells in the population of spinal microglia after peripheral nerve injury

    Science.gov (United States)

    Tashima, Ryoichi; Mikuriya, Satsuki; Tomiyama, Daisuke; Shiratori-Hayashi, Miho; Yamashita, Tomohiro; Kohro, Yuta; Tozaki-Saitoh, Hidetoshi; Inoue, Kazuhide; Tsuda, Makoto

    2016-01-01

    Accumulating evidence indicates that peripheral nerve injury (PNI) activates spinal microglia that are necessary for neuropathic pain. Recent studies using bone marrow (BM) chimeric mice have reported that after PNI, circulating BM-derived cells infiltrate into the spinal cord and differentiate into microglia-like cells. This raises the possibility that the population of spinal microglia after PNI may be heterogeneous. However, the infiltration of BM cells in the spinal cord remains controversial because of experimental adverse effects of strong irradiation used for generating BM chimeric mice. In this study, we evaluated the PNI-induced spinal infiltration of BM-derived cells not only by irradiation-induced myeloablation with various conditioning regimens, but also by parabiosis and mice with genetically labelled microglia, models without irradiation and BM transplantation. Results obtained from these independent approaches provide compelling evidence indicating little contribution of circulating BM-derived cells to the population of spinal microglia after PNI. PMID:27005516

  13. Studies on hematopoietic cell apoptosis and the relative gene expression in irradiated mouse bone marrow

    International Nuclear Information System (INIS)

    Peng Ruiyun; Wang Dewen; Xiong Chengqi; Gao Yabing; Yang Hong; Cui Yufang; Wang Baozhen

    2001-01-01

    Objective: To study apoptosis and expressions bcl-2 and p53 in irradiated mouse bone marrow. Methods: LACA mice were irradiated with 60 Co γ-rays. By means of in situ terminal labelling, in situ hybridization and image analysis, the authors studied radiation-induced apoptosis of hematopoietic cells and the expressions of bcl-2 and p53. Results: The characteristics of apoptosis appeared in hematopoietic cells at 6 hrs after irradiation. The expression of bcl-2 was obviously decreased when apoptosis of hematopoietic cells occurred, whereas it increased in the early recovery phase; p53 protein increased during both apoptosis of hematopoietic cells and the recovery phase, and mutant type p53 DNA was positive only in the recovery phase. Conclusion: Radiation may induced apoptosis of hematopoietic cells in a dose-dependent manner; Both bcl-2 and p53 genes play an important role in apoptosis and recovery phase

  14. Haematopoietic ESL-1 enables stem cell proliferation in the bone marrow by limiting TGFβ availability.

    Science.gov (United States)

    Leiva, Magdalena; Quintana, Juan A; Ligos, José M; Hidalgo, Andrés

    2016-01-08

    The life-long maintenance of haematopoietic stem and progenitor cells (HSPCs) critically relies on environmental signals produced by cells that constitute the haematopoietic niche. Here we report a cell-intrinsic mechanism whereby haematopoietic cells limit proliferation within the bone marrow, and show that this pathway is repressed by E-selectin ligand 1 (ESL-1). Mice deficient in ESL-1 display aberrant HSPC quiescence, expansion of the immature pool and reduction in niche size. Remarkably, the traits were transplantable and dominant when mutant and wild-type precursors coexisted in the same environment, but were independent of E-selectin, the vascular receptor for ESL-1. Instead, quiescence is generated by unrestrained production of the cytokine TGFβ by mutant HSPC, and in vivo or in vitro blockade of the cytokine completely restores the homeostatic properties of the haematopoietic niche. These findings reveal that haematopoietic cells, including the more primitive compartment, can actively shape their own environment.

  15. Micro/Nano Structural Tantalum Coating for Enhanced Osteogenic Differentiation of Human Bone Marrow Stem Cells

    Directory of Open Access Journals (Sweden)

    Ding Ding

    2018-04-01

    Full Text Available Recently, tantalum has been attracting much attention for its anticorrosion resistance and biocompatibility, and it has been widely used in surface modification for implant applications. To improve its osteogenic differentiation of human bone marrow stem cells (hBMSCs, a micro/nano structure has been fabricated on the tantalum coating surface through the combination of anodic oxidation and plasma spraying method. The morphology, composition, and microstructure of the modified coating were comprehensively studied by employing scanning electron microscopy (SEM, X-ray diffraction (XRD as well as transmission electron microscopy (TEM. The effects of hierarchical structures as well as micro-porous structure of tantalum coating on the behavior for human bone marrow stem cells (hBMSCs were evaluated and compared at both cellular and molecular levels in vitro. The experimental results show that a hierarchical micro/nano structure with Ta2O5 nanotubes spread onto a micro-scale tantalum coating has been fabricated successfully, which is confirmed to promote cell adhesion and spreading. Besides, the hierarchical micro/nano tantalum coating can provide 1.5~2.1 times improvement in gene expression, compared with the micro-porous tantalum coating. It demonstrates that it can effectively enhance the proliferation and differentiation of hBMSCs in vitro.

  16. Micro/Nano Structural Tantalum Coating for Enhanced Osteogenic Differentiation of Human Bone Marrow Stem Cells.

    Science.gov (United States)

    Ding, Ding; Xie, Youtao; Li, Kai; Huang, Liping; Zheng, Xuebin

    2018-04-03

    Recently, tantalum has been attracting much attention for its anticorrosion resistance and biocompatibility, and it has been widely used in surface modification for implant applications. To improve its osteogenic differentiation of human bone marrow stem cells (hBMSCs), a micro/nano structure has been fabricated on the tantalum coating surface through the combination of anodic oxidation and plasma spraying method. The morphology, composition, and microstructure of the modified coating were comprehensively studied by employing scanning electron microscopy (SEM), X-ray diffraction (XRD) as well as transmission electron microscopy (TEM). The effects of hierarchical structures as well as micro-porous structure of tantalum coating on the behavior for human bone marrow stem cells (hBMSCs) were evaluated and compared at both cellular and molecular levels in vitro. The experimental results show that a hierarchical micro/nano structure with Ta₂O₅ nanotubes spread onto a micro-scale tantalum coating has been fabricated successfully, which is confirmed to promote cell adhesion and spreading. Besides, the hierarchical micro/nano tantalum coating can provide 1.5~2.1 times improvement in gene expression, compared with the micro-porous tantalum coating. It demonstrates that it can effectively enhance the proliferation and differentiation of hBMSCs in vitro.

  17. Transplanted Bone Marrow Mesenchymal Stem Cells Improve Memory in Rat Models of Alzheimer's Disease

    Directory of Open Access Journals (Sweden)

    Parvin Babaei

    2012-01-01

    Full Text Available The present study aims to evaluate the effect of bone marrow mesenchymal stem cells (MSCs grafts on cognition deficit in chemically and age-induced Alzheimer's models of rats. In the first experiments aged animals (30 months were tested in Morris water maze (MWM and divided into two groups: impaired memory and unimpaired memory. Impaired groups were divided into two groups and cannulated bilaterally at the CA1 of the hippocampus for delivery of mesenchymal stem cells (500×103/ and PBS (phosphate buffer saline. In the second experiment, Ibotenic acid (Ibo was injected bilaterally into the nucleus basalis magnocellularis (NBM of young rats (3 months and animals were tested in MWM. Then, animals with memory impairment received the following treatments: MSCs (500×103/ and PBS. Two months after the treatments, cognitive recovery was assessed by MWM in relearning paradigm in both experiments. Results showed that MSCs treatment significantly increased learning ability and memory in both age- and Ibo-induced memory impairment. Adult bone marrow mesenchymal stem cells show promise in treating cognitive decline associated with aging and NBM lesions.

  18. Bone marrow stromal cells as an inducer for cardiomyocyte differentiation from mouse embryonic stem cells.

    Science.gov (United States)

    Yue, Fengming; Johkura, Kohei; Tomotsune, Daihachiro; Shirasawa, Sakiko; Yokoyama, Tadayuki; Nagai, Mika; Sasaki, Katsunori

    2010-09-20

    Bone marrow stromal cells (BMSCs) secrete soluble factors and display varied cell-biological functions. To confirm the ability and efficiency of BMSCs to induce embryonic stem cells (ESCs) into cardiomyocytes, mouse embryoid bodies (EBs) were co-cultured with rat BMSCs. After about 10 days, areas of rhythmically contracting cells in more solid aggregates became evident with bundle-like structures formed along borders between EB outgrowth and BMSC layer. ESC-derived cardiomyocytes exhibited sarcomeric striations when stained with troponin I (Trop I), organized in separated bundles. Besides, the staining for connexin 43 was detected in cell-cell junctions, which demonstrated that ESC-derived cardiomyocytes were coupled by gap junction in culture. The related genes of cardiomyocytes were found in these beating and no-beating EBs co-cultured with BMSCs. In addition, an improved efficiency of cardiomyocyte differentiation from ESC-BMSC co-culture was found in the serum-free medium: 5-fold up-regulation in the number of beating area compared with the serum medium. Effective cardiac differentiation was also recognized in transfer filter assay and in condition medium obtained from BMSC culture. A clear increase in the expression of cardiac genes and TropI protein confirmed further cardiac differentiation by BMP4 and Retinoic Acid (RA) treatment. These results demonstrate that BMSCs can induce cardiomyocyte differentiation from ESCs through soluble factors and enhance it with BMP4 or RA treatment. Serum-free ESC-BMSC co-culture represents a defined in vitro model for identifying the cardiomyocyte-inducing activity from BMSCs and, in addition, a straightforward experimental system for assessing clinical applications. Copyright © 2010 Elsevier GmbH. All rights reserved.

  19. Advances of mesenchymal stem cells derived from bone marrow and dental tissue in craniofacial tissue engineering.

    Science.gov (United States)

    Yang, Maobin; Zhang, Hongming; Gangolli, Riddhi

    2014-05-01

    Bone and dental tissues in craniofacial region work as an important aesthetic and functional unit. Reconstruction of craniofacial tissue defects is highly expected to ensure patients to maintain good quality of life. Tissue engineering and regenerative medicine have been developed in the last two decades, and been advanced with the stem cell technology. Bone marrow derived mesenchymal stem cells are one of the most extensively studied post-natal stem cell population, and are widely utilized in cell-based therapy. Dental tissue derived mesenchymal stem cells are a relatively new stem cell population that isolated from various dental tissues. These cells can undergo multilineage differentiation including osteogenic and odontogenic differentiation, thus provide an alternative source of mesenchymal stem cells for tissue engineering. In this review, we discuss the important issues in mesenchymal stem cell biology including the origin and functions of mesenchymal stem cells, compare the properties of these two types of mesenchymal cells, update recent basic research and clinic applications in this field, and address important future challenges.

  20. IDENTIFICATION AND KINETICS OF 2 RECENTLY BONE-MARROW-DERIVED B-CELL POPULATIONS IN PERIPHERAL LYMPHOID-TISSUES

    NARCIS (Netherlands)

    KROESE, FGM; DEBOER, NK; DEBOER, T; NIEUWENHUIS, P; KANTOR, AB; DEENEN, GJ

    In rats, the glycoprotein Thy-1 is expressed on recently bone marrow (BM)-generated B cells but not on mature recirculating follicular (RF) B cells. Here we demonstrate that Thy-1(+) B cells consist of two phenotypically distinct, but developmentally related, populations: a population of newly

  1. Immediate bromodeoxyuridine labelling of unseparated human bone marrow cells ex vivo is superior to labelling after routine laboratory processing

    DEFF Research Database (Denmark)

    Jensen, P O; Mortensen, B T; Christensen, I J

    1998-01-01

    a reliable and reproducible technique for estimation of the fraction of cells that incorporated BrdUrd into DNA during S-phase. We have compared immediate BrdUrd labelling of unseparated bone marrow cells with the previously used labelling in the laboratory after routine separation of the mononuclear cells...

  2. Myelosuppressive Conditioning Using Busulfan Enables Bone Marrow Cell Accumulation in the Spinal Cord of a Mouse Model of Amyotrophic Lateral Sclerosis

    OpenAIRE

    Lewis, Coral-Ann B.; Manning, John; Barr, Christine; Peake, Kyle; Humphries, R. Keith; Rossi, Fabio; Krieger, Charles

    2013-01-01

    Myeloablative preconditioning using irradiation is the most commonly used technique to generate rodents having chimeric bone marrow, employed for the study of bone marrow-derived cell accumulation in the healthy and diseased central nervous system. However, irradiation has been shown to alter the blood-brain barrier, potentially creating confounding artefacts. To better study the potential of bone marrow-derived cells to function as treatment vehicles for neurodegenerative diseases alternativ...

  3. Transcription factor and bone marrow stromal cells in osseointegration of dental implants.

    Science.gov (United States)

    Yan, S G; Zhang, J; Tu, Q; Ye, J H; Luo, E; Schuler, M; Dard, M M; Yu, Y; Murray, D; Cochran, D L; Kim, S H; Yang, P; Chen, J

    2013-12-19

    Titanium implants are widely used in dental clinics and orthopaedic surgery. However, bone formation surrounding the implant is relatively slow after inserting the implant. The current study assessed the effects of bone marrow stromal cells (BMSCs) with forced expression of special AT-rich sequence-binding protein 2 (SATB2) on the osseointegration of titanium implants. To determine whether SATB2 overexpression in BMSCs can enhance the osseointegration of implants, BMSCs were infected with the retrovirus encoding Satb2 (pBABE-Satb2) and were locally applied to bone defects before implanting the titanium implants in the mouse femur. Seven and twenty-one days after implantation, the femora were isolated for immunohistochemical (IHC) staining, haematoxylin eosin (H&E) staining, real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR), and micro-computed tomography (μCT) analysis. IHC staining analysis revealed that SATB2-overexpressing BMSCs were intensely distributed in the bone tissue surrounding the implant. Histological analysis showed that SATB2-overexpressing BMSCs significantly enhanced new bone formation and bone-to-implant contact 3 weeks after implantation. Real-time qRT-PCR results showed that the local delivery of SATB2-overexpressing BMSCs enhanced expression levels of potent osteogenic transcription factors and bone matrix proteins in the implantation sites. μCT analysis demonstrated that SATB2-overexpressing BMSCs significantly increased the density of the newly formed bone surrounding the implant 3 weeks post-operatively. These results conclude that local delivery of SATB2-overexpressing BMSCs significantly accelerates osseointegration of titanium implants. These results provide support for future pharmacological and clinical applications of SATB2, which accelerates bone regeneration around titanium implants.

  4. Gene expression pattern of functional neuronal cells derived from human bone marrow mesenchymal stromal cells

    Directory of Open Access Journals (Sweden)

    Bron Dominique

    2008-04-01

    Full Text Available Abstract Background Neuronal tissue has limited potential to self-renew or repair after neurological diseases. Cellular therapies using stem cells are promising approaches for the treatment of neurological diseases. However, the clinical use of embryonic stem cells or foetal tissues is limited by ethical considerations and other scientific problems. Thus, bone marrow mesenchymal stomal cells (BM-MSC could represent an alternative source of stem cells for cell replacement therapies. Indeed, many studies have demonstrated that MSC can give rise to neuronal cells as well as many tissue-specific cell phenotypes. Methods BM-MSC were differentiated in neuron-like cells under specific induction (NPBM + cAMP + IBMX + NGF + Insulin. By day ten, differentiated cells presented an expression profile of real neurons. Functionality of these differentiated cells was evaluated by calcium influx through glutamate receptor AMPA3. Results Using microarray analysis, we compared gene expression profile of these different samples, before and after neurogenic differentiation. Among the 1943 genes differentially expressed, genes down-regulated are involved in osteogenesis, chondrogenesis, adipogenesis, myogenesis and extracellular matrix component (tuftelin, AGC1, FADS3, tropomyosin, fibronectin, ECM2, HAPLN1, vimentin. Interestingly, genes implicated in neurogenesis are increased. Most of them are involved in the synaptic transmission and long term potentialisation as cortactin, CASK, SYNCRIP, SYNTL4 and STX1. Other genes are involved in neurite outgrowth, early neuronal cell development, neuropeptide signaling/synthesis and neuronal receptor (FK506, ARHGAP6, CDKRAP2, PMCH, GFPT2, GRIA3, MCT6, BDNF, PENK, amphiregulin, neurofilament 3, Epha4, synaptotagmin. Using real time RT-PCR, we confirmed the expression of selected neuronal genes: NEGR1, GRIA3 (AMPA3, NEF3, PENK and Epha4. Functionality of these neuron-like cells was demonstrated by Ca2+ influx through glutamate

  5. Superparamagnetic iron oxide nanoparticles labeling of bone marrow stromal (mesenchymal cells does not affect their "stemness".

    Directory of Open Access Journals (Sweden)

    Arun Balakumaran

    2010-07-01

    Full Text Available Superparamagnetic iron oxide nanoparticles (SPION are increasingly used to label human bone marrow stromal cells (BMSCs, also called "mesenchymal stem cells" to monitor their fate by in vivo MRI, and by histology after Prussian blue (PB staining. SPION-labeling appears to be safe as assessed by in vitro differentiation of BMSCs, however, we chose to resolve the question of the effect of labeling on maintaining the "stemness" of cells within the BMSC population in vivo. Assays performed include colony forming efficiency, CD146 expression, gene expression profiling, and the "gold standard" of evaluating bone and myelosupportive stroma formation in vivo in immuncompromised recipients. SPION-labeling did not alter these assays. Comparable abundant bone with adjoining host hematopoietic cells were seen in cohorts of mice that were implanted with SPION-labeled or unlabeled BMSCs. PB+ adipocytes were noted, demonstrating their donor origin, as well as PB+ pericytes, indicative of self-renewal of the stem cell in the BMSC population. This study confirms that SPION labeling does not alter the differentiation potential of the subset of stem cells within BMSCs.

  6. The differentiation directions of the bone marrow stromal cells under modeling microgravity

    Science.gov (United States)

    Nesterenko, Olga; Rodionova, Natalia; Katkova, Olena

    metabolism disorder. In differentiated cells, disorganization and a cytoskeleton destruction was observed. Results showed that under microgravity conditions proliferative and differentiation (including osteogenic) potentialities of low-differentiated marrow stromal cells decreased, induction of their adipocytic differentiation was observes as well. Obtained results make a new contribution into gravitation sensitivity mechanisms understanding for stromal cells of the bone marrow which contain osteogenic cells- predecessors, features of the osteoporosis development.

  7. Radiobiological studies on target cell populations in murine bone marrow transplantation recipients.

    NARCIS (Netherlands)

    van Os, Ronald Peter

    1994-01-01

    The experiments presented in this thesis were designed to investigate the role of total body irradiation (TBI) in conditioning murine recipients of syngeneic and allogeneic bone marrow transplantation (BMT). ... Zie: Summary

  8. Bone- and bone marrow scintigraphy in Gaucher disease type 1

    Energy Technology Data Exchange (ETDEWEB)

    Mikosch, P. [Dept. of Nuclear Medicine and Endocrinology, State Hospital Klagenfurt (Austria); Dept. of Internal Medicine II, State Hospital Klagenfurt (Austria); Zitter, F. [Dept. of Internal Medicine II, State Hospital Klagenfurt (Austria); Gallowitsch, H.J.; Lind, P. [Dept. of Nuclear Medicine and Endocrinology, State Hospital Klagenfurt (Austria); Wuertz, F. [Dept. of Pathology, State Hospital Klagenfurt (Austria); Mehta, A.B.; Hughes, D.A. [Lysosomal Storage Disorder Unit, Dept. of Academic Haematology, Royal Free and Univ. Coll. Medical School, London (United Kingdom)

    2008-07-01

    Scintigraphy is a method for imaging metabolism and should be viewed as complimentary to morphological imaging. Bone and bone marrow scintigraphy can particularly contribute to the detection of focal disease in Gaucher disease. In bone crises it can discriminate within three days after pain onset between local infection and aseptic necrosis. A further advantage of bone- and bone marrow scintigraphy is the visualization of the whole skeleton within one setting. Whole body imaging for focal lesions might thus be an objective in GD, in particular in patients complaining of several painful sites. Direct imaging of bone marrow deposits in GD by MIBI scintigraphy might be of special interest in children in whom bone marrow undergoes a developmental conversion from red to yellow marrow in the ap-pendicular skeleton. MRI interpretation in young GD patients is thus difficult in order to estimate the exact amount and extent of bone marrow infiltration by Gaucher cells. 99mTc-MIBI scintigraphy with its direct visualization of lipid storage could thus add interesting additional information not shown with other methods including MRI. Although MRI is the most accepted imaging modality in assessing the skeletal status in GD, a selective use of scintigraphy for imaging bone and bone marrow may add information in the evaluation of patients with Gaucher disease.

  9. Bone- and bone marrow scintigraphy in Gaucher disease type 1

    International Nuclear Information System (INIS)

    Mikosch, P.; Zitter, F.; Gallowitsch, H.J.; Lind, P.; Wuertz, F.; Mehta, A.B.; Hughes, D.A.

    2008-01-01

    Scintigraphy is a method for imaging metabolism and should be viewed as complimentary to morphological imaging. Bone and bone marrow scintigraphy can particularly contribute to the detection of focal disease in Gaucher disease. In bone crises it can discriminate within three days after pain onset between local infection and aseptic necrosis. A further advantage of bone- and bone marrow scintigraphy is the visualization of the whole skeleton within one setting. Whole body imaging for focal lesions might thus be an objective in GD, in particular in patients complaining of several painful sites. Direct imaging of bone marrow deposits in GD by MIBI scintigraphy might be of special interest in children in whom bone marrow undergoes a developmental conversion from red to yellow marrow in the ap-pendicular skeleton. MRI interpretation in young GD patients is thus difficult in order to estimate the exact amount and extent of bone marrow infiltration by Gaucher cells. 99mTc-MIBI scintigraphy with its direct visualization of lipid storage could thus add interesting additional information not shown with other methods including MRI. Although MRI is the most accepted imaging modality in assessing the skeletal status in GD, a selective use of scintigraphy for imaging bone and bone marrow may add information in the evaluation of patients with Gaucher disease

  10. Non-Hematopoietic Essential Functions of Bone Marrow Cells: A Review of Scientific and Clinical Literature and Rationale for Treating Bone Defects.

    Science.gov (United States)

    Harrell, David B; Caradonna, Eugenio; Mazzucco, Laura; Gudenus, Rosmarie; Amann, Berthold; Prochazka, Vaclav; Giannoudis, Peter V; Hendrich, Christian; Jäger, Marcus; Krauspe, Rüdiger; Hernigou, Philippe

    2015-12-28

    Hematopoiesis as the only essential function of bone marrow cells has been challenged for several decades through basic science (in vitro and in vivo) and clinical data. Such work has shed light on two other essential functions of bone marrow cells: osteopoiesis and angio-genesis/vasculogenesis. Clinical utility of autologous concentrated bone marrow aspirate (CBMA) has demonstrated both safety and efficacy in treating bone defects. Moreover, CBMA has been shown to be comparable to the gold standard of iliac crest bone graft (ICBG), or autograft, with regard to being osteogenic and osteoinductive. ICBG is not considered an advanced therapy medicinal product (ATMP), but CBMA may become regulated as an ATMP. The European Medicines Agency Committee for Advanced Therapies (EMA:CAT) has issued a reflection paper (20 June 2014) in which reversal of the 2013 ruling that CBMA is a non-ATMP has been proposed. We review bone marrow cell involvement in osteopoiesis and angiogenesis/vasculogenesis to examine EMA:CAT 2013 decision to use CBMA for treatment of osteonecrosis (e.g, of the femoral head) should be considered a non-ATMP. This paper is intended to provide discussion on the 20 June 2014 reflection paper by reviewing two non-hematopoietic essential functions of bone marrow cells. Additionally, we provide clinical and scientific rationale for treating osteonecrosis with CBMA.

  11. Non-hematopoietic essential functions of bone marrow cells: a review of scientific and clinical literature and rationale for treating bone defects

    Directory of Open Access Journals (Sweden)

    David B. Harrell

    2015-12-01

    Full Text Available Hematopoiesis as the only essential function of bone marrow cells has been challenged for several decades through basic science (in vitro and in vivo and clinical data. Such work has shed light on two other essential functions of bone marrow cells: osteopoiesis and angiogenesis/vasculogenesis. Clinical utility of autologous concentrated bone marrow aspirate (CBMA has demonstrated both safety and efficacy in treating bone defects. Moreover, CBMA has been shown to be comparable to the gold standard of iliac crest bone graft (ICBG, or autograft, with regard to being osteogenic and osteoinductive. ICBG is not considered an advanced therapy medicinal product (ATMP, but CBMA may become regulated as an ATMP. The European Medicines Agency Committee for Advanced Therapies (EMA:CAT has issued a reflection paper (20 June 2014 in which reversal of the 2013 ruling that CBMA is a non-ATMP has been proposed. We review bone marrow cell involvement in osteopoiesis and angiogenesis/vasculogenesis to examine EMA:CAT 2013 decision to use CBMA for treatment of osteonecrosis (e.g, of the femoral head should be considered a non-ATMP. This paper is intended to provide discussion on the 20 June 2014 reflection paper by reviewing two non-hematopoietic essential functions of bone marrow cells. Additionally, we provide clinical and scientific rationale for treating osteonecrosis with CBMA.

  12. Bone Marrow-Derived Stem Cell Populations Are Differentially Regulated by Thyroid or/and Ovarian Hormone Loss

    Directory of Open Access Journals (Sweden)

    Bassam F. Mogharbel

    2017-10-01

    Full Text Available Bone marrow-derived stem cells (BMDSCs play an essential role in organ repair and regeneration. The molecular mechanisms by which hormones control BMDSCs proliferation and differentiation are unclear. Our aim in this study was to investigate how a lack of ovarian or/and thyroid hormones affects stem cell number in bone marrow lineage. To examine the effect of thyroid or/and ovarian hormones on the proliferative activity of BMDSCs, we removed the thyroid or/and the ovaries of adult female rats. An absence of ovarian and thyroid hormones was confirmed by Pap staining and Thyroid Stimulating Hormone (TSH measurement, respectively. To obtain the stem cells from the bone marrow, we punctured the iliac crest, and aspirated and isolated cells by using a density gradient. Specific markers were used by cytometry to identify the different BMDSCs types: endothelial progenitor cells (EPCs, precursor B cells/pro-B cells, and mesenchymal stem cells (MSCs. Interestingly, our results showed that hypothyroidism caused a significant increase in the percentage of EPCs, whereas a lack of ovarian hormones significantly increased the precursor B cells/pro-B cells. Moreover, the removal of both glands led to increased MSCs. In conclusion, both ovarian and thyroid hormones appear to have key and diverse roles in regulating the proliferation of cells populations of the bone marrow.

  13. Autotransplantation of bone marrow-derived stem cells as a therapy for neurodegenerative diseases.

    Science.gov (United States)

    Kan, I; Melamed, E; Offen, D

    2007-01-01

    Neurodegenerative diseases are characterized by a progressive degeneration of selective neural populations. This selective hallmark pathology and the lack of effective treatment modalities make these diseases appropriate candidates for cell therapy. Bone marrow-derived mesenchymal stem cells (MSCs) are self-renewing precursors that reside in the bone marrow and may further be exploited for autologous transplantation. Autologous transplantation of MSCs entirely circumvents the problem of immune rejection, does not cause the formation of teratomas, and raises very few ethical or political concerns. More than a few studies showed that transplantation of MSCs resulted in clinical improvement. However, the exact mechanisms responsible for the beneficial outcome have yet to be defined. Possible rationalizations include cell replacement, trophic factors delivery, and immunomodulation. Cell replacement theory is based on the idea that replacement of degenerated neural cells with alternative functioning cells induces long-lasting clinical improvement. It is reasoned that the transplanted cells survive, integrate into the endogenous neural network, and lead to functional improvement. Trophic factor delivery presents a more practical short-term approach. According to this approach, MSC effectiveness may be credited to the production of neurotrophic factors that support neuronal cell survival, induce endogenous cell proliferation, and promote nerve fiber regeneration at sites of injury. The third potential mechanism of action is supported by the recent reports claiming that neuroinflammatory mechanisms play an important role in the pathogenesis of neurodegenerative disorders. Thus, inhibiting chronic inflammatory stress might explain the beneficial effects induced by MSC transplantation. Here, we assemble evidence that supports each theory and review the latest studies that have placed MSC transplantation into the spotlight of biomedical research.

  14. The natural history of fetal cells in postpartum murine maternal lung and bone marrow

    Science.gov (United States)

    Pritchard, Stephanie; Peter, Inga; Johnson, Kirby L.; Bianchi, Diana W.

    2012-01-01

    During pregnancy, fetal cells cross into the maternal organs where they reside postpartum. Evidence from multiple laboratories suggests that these microchimeric fetal cells contribute to maternal tissue repair after injury. In mouse models, most injury experiments are performed during pregnancy; however, in a clinical setting most injuries or diseases occur postpartum. Therefore, experiments using animal models should be designed to address questions in the time period following delivery. In order to provide a baseline for such experiments, we analyzed the natural history of fetal cells in the postpartum maternal organs. Female C57BL/6J mice were mated to males homozygous for the enhanced green fluorescent protein gene. Fetal cells in the maternal lungs and bone marrow were identified by their green fluorescence using in a high-speed flow cytometer and their counts were compared between the lung and bone marrow. Spearman correlation analysis was used to identify relationships between the duration of time postpartum and the cell counts and ratio of live and dead cells. Our results show that fetal cells persist in these organs until at least three months postpartum in healthy female mice. We show a two-stage decline, with an initial two and a half-week rapid clearance followed by a trend of gradual decrease. Additionally, an increase in the ratio of live to dead cells within the lung over time suggests that these cells may replicate in vivo. The results presented here will inform the design of future experiments and may have implications for women’s health. PMID:23128065

  15. The effects and mechanisms of clinorotation on proliferation and differentiation in bone marrow mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Ming [Department of Orthopaedic Surgery, XiJing Hospital, The Fourth Military Medical University, Xi' an 710032 (China); Wang, Yongchun [Department of Aerospace Biodynamics, School of Aerospace Medicine, Fourth Military Medical University, Xi' an 710032 (China); Yang, Min; Liu, Yanwu [Department of Orthopaedic Surgery, XiJing Hospital, The Fourth Military Medical University, Xi' an 710032 (China); Qu, Bo [Chengdu Military General Hospital, Chengdu, 610083 (China); Ye, Zhengxu; Liang, Wei [Department of Orthopaedic Surgery, XiJing Hospital, The Fourth Military Medical University, Xi' an 710032 (China); Sun, Xiqing, E-mail: sunxiqing@fmmu.edu.cn [Department of Aerospace Biodynamics, School of Aerospace Medicine, Fourth Military Medical University, Xi' an 710032 (China); Luo, Zhuojing, E-mail: zjluo@fmmu.edu.cn [Department of Orthopaedic Surgery, XiJing Hospital, The Fourth Military Medical University, Xi' an 710032 (China)

    2015-05-01

    Data from human and rodent studies have demonstrated that microgravity induces observed bone loss in real spaceflight or simulated experiments. The decrease of bone formation and block of maturation may play important roles in bone loss induced by microgravity. The aim of this study was to investigate the changes of proliferation and differentiation in bone marrow mesenchymal stem cells (BMSCs) induced by simulated microgravity and the mechanisms underlying it. We report here that clinorotation, a simulated model of microgravity, decreased proliferation and differentiation in BMSCs after exposure to 48 h simulated microgravity. The inhibited proliferation are related with blocking the cell cycle in G2/M and enhancing the apoptosis. While alterations of the osteoblast differentiation due to the decreased SATB2 expression induced by simulated microgravity in BMSCs. - Highlights: • Simulated microgravity inhibited proliferation and differentiation in BMSCs. • The decreased proliferation due to blocked cell cycle and enhanced the apoptosis. • The inhibited differentiation accounts for alteration of SATB2, Hoxa2 and Cbfa1.

  16. Adipogenic Mesenchymal Stromal Cells from Bone Marrow and Their Hematopoietic Supportive Role: Towards Understanding the Permissive Marrow Microenvironment in Acute Myeloid Leukemia.

    Science.gov (United States)

    Le, Yevgeniya; Fraineau, Sylvain; Chandran, Priya; Sabloff, Mitchell; Brand, Marjorie; Lavoie, Jessie R; Gagne, Rémi; Rosu-Myles, Michael; Yauk, Carole L; Richardson, Richard B; Allan, David S

    2016-04-01

    The role of bone marrow-derived mesenchymal stem/stromal cells (MSCs) in creating a permissive microenvironment that supports the emergence and progression of acute myeloid leukemia (AML) is not well established. We investigated the extent to which adipogenic differentiation in normal MSCs alters hematopoietic supportive capacity and we undertook an in-depth comparative study of human bone marrow MSCs derived from newly diagnosed AML patients and healthy donors, including an assessment of adipogenic differentiation capacity. MSCs from healthy controls with partial induction of adipogenic differentiation, in comparison to MSCs undergoing partial osteogenic differentiation, expressed increased levels of hematopoietic factors and induced greater proliferation, decreased quiescence and reduced in vitro hematopoietic colony forming capacity of CD34(+) hematopoietic stem and progenitor cells (HSPCs). Moreover, we observed that AML-derived MSCs had markedly increased adipogenic potential and delayed osteogenic differentiation, while maintaining normal morphology and viability. AML-derived MSCs, however, possessed reduced proliferative capacity and decreased frequency of subendothelial quiescent MSCs compared to controls. Our results support the notion of a bone marrow microenvironment characterized by increased propensity toward adipogenesis in AML, which may negatively impact normal hematopoiesis. Larger confirmatory studies are needed to understand the impact of various clinical factors. Novel leukemia treatments aimed at normalizing bone marrow niches may enhance the competitive advantage of normal hematopoietic progenitors over leukemia cells.

  17. In vitro evaluation of cardiomyogenic differentiation of bone marrow derived mesenchymal stem cells (MSCs)

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Min Hwan; Lee, Yong Jin; Kang, Joo Hyun [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2010-10-15

    Bone marrow derived mesenchymal stem cells (MSCs) are excellent candidate as therapeutic agent for cell therapy. MSCs can be expanded in vitro rapidly (more than 3-5 fold in a weeks), and maintained their stem cell properties for a long culture period. Recently, many investigators have suggested that MSCs have ability to differentiate into cardiomyocytes by given appropriate condition in vitro or in vivo. Although, MSCs may be useful cell therapeutic agents in heart disease, there are still exist major barriers to track their capacity to differentiate into functional cardiomyocytes. In our previous study, the transgenic mouse model expressing sodium iodide symporter (NIS) driven by {alpha}-myosin heavy chain ({alpha}-MHC) promoter was developed to image cardiomyocyte with {gamma}-camera and microPET in vivo. In this study, we investigate the monitoring availability of {alpha}-MHC driven NIS gene of MSCs from the transgenic mouse during cardiomyogenic differentiation in vitro

  18. Bone Marrow Stem Cell Derived Paracrine Factors for Regenerative Medicine: Current Perspectives and Therapeutic Potential

    Directory of Open Access Journals (Sweden)

    Tom J. Burdon

    2011-01-01

    Full Text Available During the past several years, there has been intense research in the field of bone marrow-derived stem cell (BMSC therapy to facilitate its translation into clinical setting. Although a lot has been accomplished, plenty of challenges lie ahead. Furthermore, there is a growing body of evidence showing that administration of BMSC-derived conditioned media (BMSC-CM can recapitulate the beneficial effects observed after stem cell therapy. BMSCs produce a wide range of cytokines and chemokines that have, until now, shown extensive therapeutic potential. These paracrine mechanisms could be as diverse as stimulating receptor-mediated survival pathways, inducing stem cell homing and differentiation or regulating the anti-inflammatory effects in wounded areas. The current review reflects the rapid shift of interest from BMSC to BMSC-CM to alleviate many logistical and technical issues regarding cell therapy and evaluates its future potential as an effective regenerative therapy.

  19. Bone Marrow-Derived Mesenchymal Cell Differentiation toward Myogenic Lineages: Facts and Perspectives

    Directory of Open Access Journals (Sweden)

    Daniela Galli

    2014-01-01

    Full Text Available Bone marrow-derived mesenchymal stem cells (BM-MSCs are valuable platforms for new therapies based on regenerative medicine. BM-MSCs era is coming of age since the potential of these cells is increasingly demonstrated. In fact, these cells give origin to osteoblasts, chondroblasts, and adipocyte precursors in vitro, and they can also differentiate versus other mesodermal cell types like skeletal muscle precursors and cardiomyocytes. In our short review, we focus on the more recent manipulations of BM-MSCs toward skeletal and heart muscle differentiation, a growing field of obvious relevance considering the toll of muscle disease (i.e., muscular dystrophies, the heavier toll of heart disease in developed countries, and the still not completely understood mechanisms of muscle differentiation and repair.

  20. Polydatin Protects Bone Marrow Stem Cells against Oxidative Injury: Involvement of Nrf 2/ARE Pathways

    Directory of Open Access Journals (Sweden)

    Meihui Chen

    2016-01-01

    Full Text Available Polydatin, a glucoside of resveratrol, has been reported to possess potent antioxidative effects. In the present study, we aimed to investigate the effects of polydatin in bone marrow-derived mesenchymal stem cells (BMSCs death caused by hydrogen peroxide (H2O2, imitating the microenvironment surrounding transplanted cells in the injured spinal cord in vitro. In our study, MTT results showed that polydatin effectively prevented the decrease of cell viability caused by H2O2. Hochest 33258, Annexin V-PI, and Western blot assay showed H2O2-induced apoptosis in BMSCs, which was attenuated by polydatin. Further studies indicated that polydatin significantly protects BMSCs against apoptosis due to its antioxidative effects and the regulation of Nrf 2/ARE pathway. Taken together, our results indicate that polydatin could be used in combination with BMSCs for the treatment of spinal cord injury by improving the cell survival and oxidative stress microenvironments.

  1. DNA transfection of bone marrow mesenchymal stem cells using micro electroporation chips

    KAUST Repository

    Deng, Peigang

    2011-02-01

    Experimental study of electroporation of bone marrow mesenchymal stem cells (MSCs) at the single-cell level was carried out on a micro EP chip by using single electric rectangular pulse. The threshold values of the electrode potential and pulse width for gas bubble generation on the micro electrodes due to electrolysis of water were revealed as 4.5 volt and 100 μs, respectively. Quantitative EP study was performed with various electric field strengths for various pulse widths, ranging from 20μs to 15ms. Over 1,000 single-cell EP results were used to construct an EP "phase diagram", which delineates the boundaries for (1) effective EP of MSCs and (2) electric cell lysis of MSCs. Finally, the micro EP chip showed successful transfection of the pEGFP-C1 plasmid into the MSCs by properly choosing the electric parameters from the EP "phase diagram". © 2011 IEEE.

  2. Engineered bone from bone marrow stromal cells: a structural study by an advanced x-ray microdiffraction technique

    International Nuclear Information System (INIS)

    Cedola, A; Mastrogiacomo, M; Burghammer, M; Komlev, V; Giannoni, P; Favia, A; Cancedda, R; Rustichelli, F; Lagomarsino, S

    2006-01-01

    The mechanism of mineralized matrix deposition was studied in a tissue engineering approach in which bone tissue is formed when porous ceramic constructs are loaded with bone marrow stromal cells and implanted in vivo. We investigated the local interaction between the mineral crystals of the engineered bone and the biomaterial by means of microdiffraction, using a set-up based on an x-ray waveguide. We demonstrated that the newly formed bone is well organized inside the scaffold pore, following the growth model of natural bone. Combining wide angle (WAXS) and small angle (SAXS) x-ray scattering with high spatial resolution, we were able to determine the orientation of the crystallographic c-axis inside the bone crystals, and the orientation of the mineral crystals and collagen micro-fibrils with respect to the scaffold. In this work we analysed six samples and for each of them two pores were studied in detail. Similar results were obtained in all cases but we report here only the most significant sample. (note)

  3. Automated morphological analysis of bone marrow cells in microscopic images for diagnosis of leukemia: nucleus-plasma separation and cell classification using a hierarchical tree model of hematopoesis

    Science.gov (United States)

    Krappe, Sebastian; Wittenberg, Thomas; Haferlach, Torsten; Münzenmayer, Christian

    2016-03-01

    The morphological differentiation of bone marrow is fundamental for the diagnosis of leukemia. Currently, the counting and classification of the different types of bone marrow cells is done manually under the use of bright field microscopy. This is a time-consuming, subjective, tedious and error-prone process. Furthermore, repeated examinations of a slide may yield intra- and inter-observer variances. For that reason a computer assisted diagnosis system for bone marrow differentiation is pursued. In this work we focus (a) on a new method for the separation of nucleus and plasma parts and (b) on a knowledge-based hierarchical tree classifier for the differentiation of bone marrow cells in 16 different classes. Classification trees are easily interpretable and understandable and provide a classification together with an explanation. Using classification trees, expert knowledge (i.e. knowledge about similar classes and cell lines in the tree model of hematopoiesis) is integrated in the structure of the tree. The proposed segmentation method is evaluated with more than 10,000 manually segmented cells. For the evaluation of the proposed hierarchical classifier more than 140,000 automatically segmented bone marrow cells are used. Future automated solutions for the morphological analysis of bone marrow smears could potentially apply such an approach for the pre-classification of bone marrow cells and thereby shortening the examination time.

  4. Bone marrow mesenchymal stem cells combined with minocycline improve spinal cord injury in a rat model.

    Science.gov (United States)

    Chen, Dayong; Zeng, Wei; Fu, Yunfeng; Gao, Meng; Lv, Guohua

    2015-01-01

    The aims of this study were to assess that the effects of bone marrow mesenchymal stem cells (BMSCs) combination with minocycline improve spinal cord injury (SCI) in rat model. In the present study, the Wistar rats were randomly divided into five groups: control group, SCI group, BMSCs group, Minocycline group and BMSCs + minocycline group. Basso, Beattie and Bresnahan (BBB) test and MPO activity were used to assess the effect of combination therapy on locomotion and neutrophil infiltration. Inflammation factors, VEGF and BDNF expression, caspase-3 activation, phosphorylation-p38MAPK, proNGF, p75NTR and RhoA expressions were estimated using commercial kits or western blot, respectively. BBB scores were significantly increased and MPO activity was significantly undermined by combination therapy. In addition, combination therapy significantly decreased inflammation factors in SCI rats. Results from western blot showed that combination therapy significantly up-regulated the protein of VEGF and BDNF expression and down-regulated the protein of phosphorylation-p38MAPK, proNGF, p75NTR and RhoA expressions in SCI rats. Combination therapy stimulation also suppressed the caspase-3 activation in SCI rats. These results demonstrated that the effects of bone marrow mesenchymal stem cells combination with minocycline improve SCI in rat model.

  5. Cadmium chloride strongly enhances cyclophosphamide-induced chromosome aberrations in mouse bone marrow cells

    Energy Technology Data Exchange (ETDEWEB)

    Pandurangarao, V.L.; Blazina, S.; Bherje, R. [Western Michigan Univ., Kalamazoo, MI (United States)] [and others

    1997-10-01

    Earlier we reported that a single 5 mg cadmium chloride (CdCl{sub 2})/kg ip dose enhanced chromosome aberrations (ca) with 50 mg/kg cyclophosphamide (CP) in mouse bone marrow cells. In this report groups of 4 mice were injected ip with saline, 0.31, 0.62, 1.25, 2.5 or 5.0 mg/kg CdCl{sub 2}, followed by saline injections at 24 h. Other mice similarly uninjected at 0 h were injected with 50 mg/kg CP at 24 h. All the mice were injected ip with 4 mg colchicine/kg at 44 h. At 48 h the bone marrow cells were processed for chromosome spreads. After dissection, visual examination revealed obvious internal hemorrhaging of the testes at 1.25 CdCl{sub 2} mg/kg and higher doses. This effect was not further increased by CP treatment. The lowest ca enhancing dose of CdCl{sub 2} on CP was 0.625 mg/kg. Our hypothesis is that Cd replaces zinc presents in numerous DNA repair enzymes and proteins resulting in diminished repair. Subsequently, the excess of unrepaired DNA damage is seen as chromatid breaks, deletions, fragments and exchanges.

  6. Phase 1 Trial of Autologous Bone Marrow Stem Cell Transplantation in Patients with Spinal Cord Injury

    Directory of Open Access Journals (Sweden)

    Zurab Kakabadze

    2016-01-01

    Full Text Available Introduction. A total of 18 patients, with complete motor deficits and paraplegia caused by thoracic and lumbar spine trauma without muscle atrophy or psychiatric problems, were included into this study. Materials and Methods. The bone marrow was aspirated from the anterior iliac crest under local anesthesia and the mononuclear fraction was isolated by density gradient method. At least 750 million mononuclear-enriched cells, suspended in 2 mL of saline, were infused intrathecally. Results and Discussion. The study reports demonstrated improvement of motor and sensory functions of various degrees observed in 9 of the 18 (50% cases after bone marrow stem cell transplantation. Measured by the American Spinal Injury Association (ASIA scale, 7 (78% out of the 9 patients observed an improvement by one grade, while two cases (22% saw an improvement by two grades. However, there were no cases in which the condition was improved by three grades. Conclusions. Analysis of subsequent treatment results indicated that the transplantation of mononuclear-enriched autologous BMSCs is a feasible and safe technique. However, successful application of the BMSCs in the clinical practice is associated with the necessity of executing more detailed examinations to evaluate the effect of BMSCs on the patients with spinal cord injury.

  7. Contribution of bone marrow-derived endothelial progenitor cells to neovascularization and astrogliosis following spinal cord injury.

    Science.gov (United States)

    Kamei, Naosuke; Kwon, Sang-Mo; Kawamoto, Atsuhiko; Ii, Masaaki; Ishikawa, Masakazu; Ochi, Mitsuo; Asahara, Takayuki

    2012-12-01

    Spinal cord injury causes initial mechanical damage, followed by ischemia-induced, secondary degeneration, worsening the tissue damage. Although endothelial progenitor cells (EPCs) have been reported to play an important role for pathophysiological neovascularization in various ischemic tissues, the EPC kinetics following spinal cord injury have never been elucidated. In this study, we therefore assessed the in vivo kinetics of bone marrow-derived EPCs by EPC colony-forming assay and bone marrow transplantation from Tie2/lacZ transgenic mice into wild-type mice with spinal cord injury. The number of circulating mononuclear cells and EPC colonies formed by the mononuclear cells peaked at day 3 postspinal cord injury. Bone marrow transplantation study revealed that bone marrow-derived EPCs recruited into the injured spinal cord markedly increased at day 7, when neovascularization and astrogliosis drastically occurred in parallel with axon growth in the damaged tissue. To elucidate further the contribution of EPCs to recovery after spinal cord injury, exogenous EPCs were systemically infused immediately after the injury. The administered EPCs were incorporated into the injured spinal cord and accelerated neovascularization and astrogliosis. These findings suggest that bone marrow-derived EPCs may contribute to the tissue repair by augmenting neovascularization and astrogliosis following spinal cord injury. Copyright © 2012 Wiley Periodicals, Inc.

  8. Chromosomal damage at bone-marrow cells is induced by exposure of rats to waterpipe water filtrate.

    Science.gov (United States)

    Azab, Mohammad A; Khabour, Omar F; Alzoubi, Karem H; Alzubi, Mohammad A; Masadeh, Majed M; Shakhatreh, Muhamad Ali K

    2018-04-03

    Waterpipe smoking is continuing to spread globally. The aim of this study is to investigate the effect of waterpipe water filtrate on chromosomal integrity in the bone-marrow cells of rats. Chromosomal damage was examined using in vivo chromosomal aberrations (CAs) and SCEs assays. Young Wistar male rats were exposed to WWF via drinking water. Chromosomal damage was measured in bone marrow cells after 6 weeks of treatment using fluorescent-plus-Giemsa staining. Treatment of rats with waterpipe water filtrate for 6 weeks did not affect food/liquid consumption and gain in body weight. The results showed that waterpipe water filtrate increased the frequencies of chromosomal breaks and exchanges by more than 30% (p < 0.01). In addition, waterpipe water filtrate significantly increased SCEs in the bone-marrow cells of rats. In conclusion, waterpipe water filtrate contains genotoxic compounds providing additional evidence for genotoxicity of waterpipe smoke.

  9. Progenitor cells of erythroblasts: an in vitro investigation of erythropoietin-responsive cells of guinea pig bone marrow

    International Nuclear Information System (INIS)

    Rosse, C.; Beaufait, D.W.

    1978-01-01

    The experiments were designed to therst whether erythroblast progenitor cell function could be demonstrated in a morphological cell type designated as transitional cells. Two cell fractions were obtained from the bone marrow of normal and polycythemic guinea pigs. One fraction (F1) was enriched in transitional cells and contained few other cell types which could be considered as candidates for erythropoietin responsive cells (ERC). The other fraction (F2) contained undifferentiated blast cells as well as transitional cells. The effect of human urinary erythropoiesis stimulating factors (ESF) on heme synthesis was compared in these two fractions by measuring 59 Fe incorporation into heme. ESF was more effective in stimulating heme synthesis in guinea pig bone marrow cells than homologous sera obtained from anemic or hypoxic animals. The majority of ERC sedimented in F2, but the stimulation index was comparable in the two fractions. It was confirmed by radioautography that the ESF response in F1 was due to the generation of proerythroblasts and basophilic erythroblasts that incorporated 55 Fe. The generation of these cells in F1 was dependent on the addition of ESF to the cultures, whereas 55 Fe-labeled erythroblasts were recovered from cultures of F2 not supplemented with ESF. ESF induced a proportion of transitional cells to incorporate 55 Fe in both F1 and F2. Transitional cells were the only cell type in which heme synthesis was dependent on ESF. Radioautography with 55 Fe identified a proportion of these cells as ERC in both F1 and F2 fractions of bone marrow obtained from normal and polycythemic guinea pigs. The present studies show that some transitional cells function as progenitors of erythroblasts because they respond to ESF by initiation of heme synthesis and by transformation into the earliest recognizable erythroid cells

  10. Radiological protection effect on vanillin derivative VND3207 radiation-induced cytogenetic damage in mouse bone marrow cells

    International Nuclear Information System (INIS)

    Wang Chuangao; Wang Li; Zhou Pingkun; Wang Zhongwen; Hu Yongzhe; Jin Haiming; Zhang Xueqing; Chen Ying

    2010-01-01

    Objective: To study the protection of vanillin derivative VND3207 on the cytogenetic damage of mouse bone marrow cell induced by ionizing radiation. Methods: BALB/c mice were randomly divided into five groups: normal control group, 2 Gy dose irradiation group, and three groups of 2 Gy irradiation with VND3207 protection at doses of 10, 50 and 100 mg/kg, respectively. VND3207 was given by intragastric administration once a day for five days. Two hours after the last drug administration, the mice were irradiated with 2 Gy γ-rays. The changes of polychromatophilic erythroblasts micronuclei (MN), chromosome aberration (CA) and mitosis index (MI) of mouse bone marrow cells were observed at 24 and 48 h after irradiation. Results: Under the protection of VND3207 at the dosages 10, 50, 100 μmg/kg, the yields of poly-chromatophilic erythroblasts MN and CA of bone marrow cells were significantly decreased (t=2.36-4.26, P<0.05), and the marrow cells MI remained much higher level compared with the irradiated mice without drug protection (t=2.58, 2.01, P<0.05). The radiological protection effect was drug dose-dependent, and the administration of VND3207 at the dosage of 100 mg/kg resulted in reduction by 50 % and 65% in the yields of MN and CA, respectively. Conclusions: VND3207 had a good protection effect of on γ-ray induced cytogentic damage of mouse bone marrow cells. (authors)

  11. Osteogenic potential of effective bone engineering using dental pulp stem cells, bone marrow stem cells, and periosteal cells for osseointegration of dental implants.

    Science.gov (United States)

    Ito, Kenji; Yamada, Yoichi; Nakamura, Sayaka; Ueda, Minoru

    2011-01-01

    The aim of this comparative study was to investigate cell-based effective bone engineering and the correlation between the osseointegration of dental implants and tissue-engineered bone using dental pulp stem cells (DPSC), bone marrow stem cells (BMSC), and periosteal cells (PC). The first molar and all premolars were extracted from the mandibles of three dogs, and in each dog, six bone defects (three on each side) were prepared with a 10-mm-diameter trephine bur after 4 weeks. Different materials were implanted in the defects and the sites were allowed to heal. The experimental groups were as follows: (1) dog DPSC and platelet-rich plasma (PRP) (dDPSC/PRP), (2) dog BMSC and PRP (dBMSC/PRP), (3) dog PC and PRP (dPC/PRP), and (4) control (defect only). Eight weeks later, dental implants were placed in the defects. After another 8 weeks, the amount of bone regeneration was assessed by histologic and histomorphometric analyses (bone-implant contact). The mean bone-implant contact values were 66.7% ± 3.6% for group 1 (dDPSC/PRP), 62.5% ± 3.1% for group 2 (dBMSC/PRP), 39.4% ± 2.4% for group 3 (dPC/PRP), and 30.3% ± 2.6% for the control group. DPSC showed the highest osteogenic potential and may be a useful cell source for tissue-engineered bone around dental implants.

  12. Adenoviral Mediated Expression of BMP2 by Bone Marrow Stromal Cells Cultured in 3D Copolymer Scaffolds Enhances Bone Formation

    Science.gov (United States)

    Sharma, Sunita; Sapkota, Dipak; Xue, Ying; Sun, Yang; Finne-Wistrand, Anna; Bruland, Ove; Mustafa, Kamal

    2016-01-01

    Selection of appropriate osteoinductive growth factors, suitable delivery method and proper supportive scaffold are critical for a successful outcome in bone tissue engineering using bone marrow stromal cells (BMSC). This study examined the molecular and functional effect of a combination of adenoviral mediated expression of bone morphogenetic protein-2 (BMP2) in BMSC and recently developed and characterized, biodegradable Poly(L-lactide-co-є-caprolactone){poly(LLA-co-CL)}scaffolds in osteogenic molecular changes and ectopic bone formation by using in vitro and in vivo approaches. Pathway-focused custom PCR array, validation using TaqMan based quantitative RT-PCR (qRT-PCR) and ALP staining showed significant up-regulation of several osteogenic and angiogenic molecules, including ALPL and RUNX2 in ad-BMP2 BMSC group grown in poly(LLA-co-CL) scaffolds both at 3 and 14 days. Micro CT and histological analyses of the subcutaneously implanted scaffolds in NOD/SCID mice revealed significantly increased radiopaque areas, percentage bone volume and formation of vital bone in ad-BMP2 scaffolds as compared to the control groups both at 2 and 8 weeks. The increased bone formation in the ad-BMP2 group in vivo was paralleled at the molecular level with concomitant over-expression of a number of osteogenic and angiogenic genes including ALPL, RUNX2, SPP1, ANGPT1. The increased bone formation in ad-BMP2 explants was not found to be associated with enhanced endochondral activity as evidenced by qRT-PCR (SOX9 and FGF2) and Safranin O staining. Taken together, combination of adenoviral mediated BMP-2 expression in BMSC grown in the newly developed poly(LLA-co-CL) scaffolds induced expression of osteogenic markers and enhanced bone formation in vivo. PMID:26808122

  13. Bone marrow dendritic cells are reduced in patients with high-risk myelodysplastic syndromes.

    Science.gov (United States)

    Saft, Leonie; Björklund, Elisabet; Berg, Elisabeth; Hellström-Lindberg, Eva; Porwit, Anna

    2013-03-01

    Dendritic cells (DC) are antigen-presenting cells that play a pivotal role in coordinating functions of the immune system. Previous studies suggest that bone marrow (BM) failure in myelodysplastic syndromes (MDS) may be in part immune-mediated, and that the high propensity for relapse may reflect decreased immune surveillance. This study aimed to assess the frequency of DC in BM samples from well-annotated untreated MDS patients by using 4-colour flow cytometry. DC levels were markedly reduced in all subtypes of MDS. The clinical impact of this finding on therapy response and relapse after, e.g. allogeneic stem cell transplantation warrants further investigation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Canine Bone Marrow Stromal Cells Promote Functional Recovery in Mice with Spinal Cord Injury

    Science.gov (United States)

    ODA, Yasutaka; TANI, Kenji; ASARI, Yusuke; QUINTANILHA, Luiz Fernando; HARAGUCHI, Tomoya; MOMOTA, Yutaka; KATAYAMA, Masaaki; ITAMOTO, Kazuhito; NAKAZAWA, Hiroshi; TAURA, Yasuho

    2014-01-01

    ABSTRACT Regenerative therapy has begun to be clinically applied in humans and dogs to treat neurological disorders, such as spinal cord injury (SCI). Here, we show the therapeutic potential of transplantation of cultured canine bone marrow stromal cells (BMSCs) into mice with SCI. Canine BMSC transplantation therapy was performed, immediately after the spinal cord was injured. Canine BMSC therapy enhanced functional recovery of the hind limbs in mice with SCI. Nestin-positive cells were observed only in the lesion of mice with SCI that received BMSCs. These results suggest that canine BMSCs promote functional recovery in mice with SCI and that migration of nestin-positive cells may contribute to the efficacy of the BMSC treatment. PMID:24561315

  15. Development of the fetal bone marrow niche and regulation of HSC quiescence and homing ability by emerging osteolineage cells

    Science.gov (United States)

    Coşkun, Süleyman; Chao, Hsu; Vasavada, Hema; Heydari, Kartoosh; Gonzales, Naomi; Zhou, Xin; de Crombrugghe, Benoit; Hirschi, Karen K.

    2014-01-01

    SUMMARY Hematopoietic stem cells (HSC) reside within a specialized niche where interactions with vasculature, osteoblasts and stromal components regulate their self-renewal and differentiation. Little is known about bone marrow niche formation or the role of its cellular components in HSC development; therefore, we established the timing of murine fetal long bone vascularization and ossification relative to the onset of HSC activity. Adult-repopulating HSC emerged at E16.5, coincident with marrow vascularization, and were contained within the c-Kit+Sca-1+Lin− (KSL) population. We used Osterix-null (Osx−/−) mice that form vascularized marrow, but lack osteolineage cells to dissect the role(s) of these cellular components in HSC development. Osx−/− fetal bone marrow cells formed multi-lineage colonies in vitro, but were hyper-proliferative and failed to home to and/or engraft transplant recipients. Thus, in developing bone marrow, the vasculature can sustain multi-lineage progenitors, but interactions with osteolineage cells are needed to regulate LT-HSC proliferation and potential. PMID:25310984

  16. Development of the Fetal Bone Marrow Niche and Regulation of HSC Quiescence and Homing Ability by Emerging Osteolineage Cells

    Directory of Open Access Journals (Sweden)

    Süleyman Coşkun

    2014-10-01

    Full Text Available Hematopoietic stem cells (HSCs reside within a specialized niche where interactions with vasculature, osteoblasts, and stromal components regulate their self-renewal and differentiation. Little is known about bone marrow niche formation or the role of its cellular components in HSC development; therefore, we established the timing of murine fetal long bone vascularization and ossification relative to the onset of HSC activity. Adult-repopulating HSCs emerged at embryonic day 16.5 (E16.5, coincident with marrow vascularization, and were contained within the c-Kit+Sca-1+Lin− (KSL population. We used Osterix-null (Osx−/− mice that form vascularized marrow but lack osteolineage cells to dissect the role(s of these cellular components in HSC development. Osx−/− fetal bone marrow cells formed multilineage colonies in vitro but were hyperproliferative and failed to home to and/or engraft transplant recipients. Thus, in developing bone marrow, the vasculature can sustain multilineage progenitors, but interactions with osteolineage cells are needed to regulate long-term HSC proliferation and potential.

  17. Development of the fetal bone marrow niche and regulation of HSC quiescence and homing ability by emerging osteolineage cells.

    Science.gov (United States)

    Coşkun, Süleyman; Chao, Hsu; Vasavada, Hema; Heydari, Kartoosh; Gonzales, Naomi; Zhou, Xin; de Crombrugghe, Benoit; Hirschi, Karen K

    2014-10-23

    Hematopoietic stem cells (HSCs) reside within a specialized niche where interactions with vasculature, osteoblasts, and stromal components regulate their self-renewal and differentiation. Little is known about bone marrow niche formation or the role of its cellular components in HSC development; therefore, we established the timing of murine fetal long bone vascularization and ossification relative to the onset of HSC activity. Adult-repopulating HSCs emerged at embryonic day 16.5 (E16.5), coincident with marrow vascularization, and were contained within the c-Kit(+)Sca-1(+)Lin(-) (KSL) population. We used Osterix-null (Osx(-/-)) mice that form vascularized marrow but lack osteolineage cells to dissect the role(s) of these cellular components in HSC development. Osx(-/-) fetal bone marrow cells formed multilineage colonies in vitro but were hyperproliferative and failed to home to and/or engraft transplant recipients. Thus, in developing bone marrow, the vasculature can sustain multilineage progenitors, but interactions with osteolineage cells are needed to regulate long-term HSC proliferation and potential. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Inhibitory effect of benzene metabolites on nuclear DNA synthesis in bone marrow cells

    International Nuclear Information System (INIS)

    Lee, E.W.; Johnson, J.T.; Garner, C.D.

    1989-01-01

    Effects of endogenously produced and exogenously added benzene metabolites on the nuclear DNA synthetic activity were investigated using a culture system of mouse bone marrow cells. Effects of the metabolites were evaluated by a 30-min incorporation of [ 3 H]thymidine into DNA following a 30-min interaction with the cells in McCoy's 5a medium with 10% fetal calf serum. Phenol and muconic acid did not inhibit nuclear DNA synthesis. However, catechol, 1,2,4-benzenetriol, hydroquinone, and p-benzoquinone were able to inhibit 52, 64, 79, and 98% of the nuclear DNA synthetic activity, respectively, at 24 μM. In a cell-free DNA synthetic system, catechol and hydroquinone did not inhibit the incorporation of [ 3 H]thymidine triphosphate into DNA up to 24 μM but 1,2,4-benzenetriol and p-benzoquinone did. The effect of the latter two benzene metabolites was completely blocked in the presence of 1,4-dithiothreitol (1 mM) in the cell-free assay system. Furthermore, when DNA polymerase α, which requires a sulfhydryl (SH) group as an active site, was replaced by DNA polymerase 1, which does not require an SH group for its catalytic activity, p-benzoquinone and 1,2,4-benzenetriol were unable to inhibit DNA synthesis. Thus, the data imply the p-benzoquinone and 1,2,4-benzenetriol inhibited DNA polymerase α, consequently resulting in inhibition of DNA synthesis in both cellular and cell-free DNA synthetic systems. The present study identifies catechol, hydroquinone, p-benzoquinone, and 1,2,4-benzenetriol as toxic benzene metabolites in bone marrow cells and also suggests that their inhibitory action on DNA synthesis is mediated by mechanism(s) other than that involving DNA damage as a primary cause

  19. Artemisinin-derived sesquiterpene lactones as potential antitumour compounds : Cytotoxic action against bone marrow and tumour cells

    NARCIS (Netherlands)

    Beekman, AC; Wierenga, PK; Woerdenbag, HJ; Van Uden, W; Pras, N; Konings, AWT; El-Feraly, FS; Galal, AM; Wikstrom, HV

    1998-01-01

    We determined the in vitro cytotoxic activity of the sesquiterpene lactone endoperoxide artemisinin (1) and some chemically prepared derivatives, which have been found to display cytotoxicity to cloned murine Ehrlich ascites tumour (EAT) cells and human HeLa cells and against murine bone marrow

  20. The Role of Bone Marrow Mesenchymal Stem Cells in the Treatment of Acute Liver Failure

    Directory of Open Access Journals (Sweden)

    Shufang Yuan

    2013-01-01

    Full Text Available Objective. This study is to investigate the effects of bone marrow mesenchymal stem cell (BMSC transplantation on acute liver failure (ALF. Methods. BMSCs were separated from rat bone marrow, cultured, and identified by flow cytometry. Rat model with ALF was established by injecting D-galactosamine and lipopolysaccharide. Rats were randomly divided into the control group and BMSC transplantation group. The serum levels of alanine aminotransferase (ALT and aspartate aminotransferase (AST were measured at 24 h, 120 h, and 168 h after BMSC transplantation. Apoptosis was detected by TUNEL assay. The expression of VEGF and AFP proteins was detected by immunofluorescence. Caspase-1 and IL-18 proteins and mRNA were detected by immunohistochemistry and RT-PCR. Results. Compared with the control group, levels of ALT, AST, caspase-1 and IL-18 proteins, and mRNA in the transplantation group were significantly lower at 120 h and 168 h after BMSCs transplantation. Apoptosis was inhibited by BMSCs transplantation. The VEGF protein levels were increased with the improvement of liver function, and the AFP protein levels were increased with the deterioration of the liver function after BMSCs transplantation. Conclusions. BMSCs transplantation can improve liver function and inhibit hepatocyte apoptosis as well as promote hepatocyte proliferation in rat model with ALF.

  1. Bone marrow mesenchymal stem cells ameliorate colitis-associated tumorigenesis in mice.

    Science.gov (United States)

    Chen, Zexian; He, Xiaowen; He, Xiaosheng; Chen, Xiuting; Lin, Xutao; Zou, Yifeng; Wu, Xiaojian; Lan, Ping

    2014-08-08

    Bone marrow-derived mesenchymal stem cell (MSC) is widely studied in inflammatory bowel disease (IBD) in basic and clinical research. However, patients with IBD have higher risk of developing colorectal cancer and MSC has dual effect on tumorigenesis. This study aims to evaluate the role of MSC on tumorigenesis of IBD. MSCs were isolated from the bone marrow of allogenic mice and identified by flow cytometry. Mice in the model of colitis-associated tumorigenesis induced by azoxymethane and dextran sulfate sodium were injected with MSCs. Colon length, spleen size and tumors formation were assessed macroscopically. Pro-inflammatory cytokines and STAT3 phosphorylation in colon tissues were analyzed. MSCs ameliorated the severity of colitis associated tumorigenesis compared with PBS control, with attenuated weight loss, longer colons and smaller spleens. Tumor number and tumor load were significantly less in the MSC group while tumor size remained comparable. Histological assessment indicated MSCs could reduce histological damage of the colon tissue. Decreased expression of pro-inflammatory cytokines (TNF-α, IL-1β and IL-6), and down-regulation of STAT3 phosphorylation in colon tissue were found after MSC treatment. MSCs might ameliorate the tumorigenesis of inflammatory bowel disease by suppression of expression of pro-inflammatory cytokines and STAT3 activation. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Bone marrow involvement in diffuse large B-cell lymphoma: correlation between FDG-PET uptake and type of cellular infiltrate

    Energy Technology Data Exchange (ETDEWEB)

    Paone, Gaetano; Itti, Emmanuel; Lin, Chieh; Meignan, Michel [Universite Paris 12, Department of Nuclear Medicine, Hopital Henri Mondor, Assistance Publique-Hopitaux de Paris (AP-HP), Creteil (France); Haioun, Corinne; Dupuis, Jehan [Universite Paris 12, Department of Clinical Haematology, Hopital Henri Mondor, Assistance Publique-Hopitaux de Paris (AP-HP), Creteil (France); Gaulard, Philippe [Universite Paris 12, Department of Pathology, Hopital Henri Mondor, Assistance Publique-Hopitaux de Paris (AP-HP), Creteil (France); Universite Paris 12, INSERM U841, Hopital Henri Mondor, Assistance Publique-Hopitaux de Paris (AP-HP), Creteil (France)

    2009-05-15

    To assess, in patients with diffuse large B-cell lymphoma (DLBCL), whether the low sensitivity of {sup 18}F-fluorodeoxyglucose positron emission tomography (FDG-PET) for bone marrow assessment may be explained by histological characteristics of the cellular infiltrate. From a prospective cohort of 110 patients with newly diagnosed aggressive lymphoma, 21 patients with DLBCL had bone marrow involvement. Pretherapeutic FDG-PET images were interpreted visually and semiquantitatively, then correlated with the type of cellular infiltrate and known prognostic factors. Of these 21 patients, 7 (33%) had lymphoid infiltrates with a prominent component of large transformed lymphoid cells (concordant bone marrow involvement, CBMI) and 14 (67%) had lymphoid infiltrates composed of small cells (discordant bone marrow involvement, DBMI). Only 10 patients (48%) had abnormal bone marrow FDG uptake, 6 of the 7 with CBMI and 4 of the 14 with DBMI. Therefore, FDG-PET positivity in the bone marrow was significantly associated with CBMI, while FDG-PET negativity was associated with DBMI (Fisher's exact test, p=0.024). There were no significant differences in gender, age and overall survival between patients with CBMI and DBMI, while the international prognostic index was significantly higher in patients with CBMI. Our study suggests that in patients with DLBCL with bone marrow involvement bone marrow FDG uptake depends on two types of infiltrate, comprising small (DBMI) or large (CBMI) cells. This may explain the apparent low sensitivity of FDG-PET previously reported for detecting bone marrow involvement. (orig.)

  3. Bone marrow involvement in diffuse large B-cell lymphoma: correlation between FDG-PET uptake and type of cellular infiltrate

    International Nuclear Information System (INIS)

    Paone, Gaetano; Itti, Emmanuel; Lin, Chieh; Meignan, Michel; Haioun, Corinne; Dupuis, Jehan; Gaulard, Philippe

    2009-01-01

    To assess, in patients with diffuse large B-cell lymphoma (DLBCL), whether the low sensitivity of 18 F-fluorodeoxyglucose positron emission tomography (FDG-PET) for bone marrow assessment may be explained by histological characteristics of the cellular infiltrate. From a prospective cohort of 110 patients with newly diagnosed aggressive lymphoma, 21 patients with DLBCL had bone marrow involvement. Pretherapeutic FDG-PET images were interpreted visually and semiquantitatively, then correlated with the type of cellular infiltrate and known prognostic factors. Of these 21 patients, 7 (33%) had lymphoid infiltrates with a prominent component of large transformed lymphoid cells (concordant bone marrow involvement, CBMI) and 14 (67%) had lymphoid infiltrates composed of small cells (discordant bone marrow involvement, DBMI). Only 10 patients (48%) had abnormal bone marrow FDG uptake, 6 of the 7 with CBMI and 4 of the 14 with DBMI. Therefore, FDG-PET positivity in the bone marrow was significantly associated with CBMI, while FDG-PET negativity was associated with DBMI (Fisher's exact test, p=0.024). There were no significant differences in gender, age and overall survival between patients with CBMI and DBMI, while the international prognostic index was significantly higher in patients with CBMI. Our study suggests that in patients with DLBCL with bone marrow involvement bone marrow FDG uptake depends on two types of infiltrate, comprising small (DBMI) or large (CBMI) cells. This may explain the apparent low sensitivity of FDG-PET previously reported for detecting bone marrow involvement. (orig.)

  4. Expansion of Bone Marrow Mesenchymal Stromal Cells in Perfused 3D Ceramic Scaffolds Enhances In Vivo Bone Formation.

    Science.gov (United States)

    Hoch, Allison I; Duhr, Ralph; Di Maggio, Nunzia; Mehrkens, Arne; Jakob, Marcel; Wendt, David

    2017-12-01

    Bone marrow-derived mesenchymal stromal cells (BMSC), when expanded directly within 3D ceramic scaffolds in perfusion bioreactors, more reproducibly form bone when implanted in vivo as compared to conventional expansion on 2D polystyrene dishes/flasks. Since the bioreactor-based expansion on 3D ceramic scaffolds encompasses multiple aspects that are inherently different from expansion on 2D polystyrene, we aimed to decouple the effects of specific parameters among these two model systems. We assessed the effects of the: 1) 3D scaffold vs. 2D surface; 2) ceramic vs. polystyrene materials; and 3) BMSC niche established within the ceramic pores during in vitro culture, on subsequent in vivo bone formation. While BMSC expanded on 3D polystyrene scaffolds in the bioreactor could maintain their in vivo osteogenic potential, results were similar as BMSC expanded in monolayer on 2D polystyrene, suggesting little influence of the scaffold 3D environment. Bone formation was most reproducible when BMSC are expanded on 3D ceramic, highlighting the influence of the ceramic substrate. The presence of a pre-formed niche within the scaffold pores had negligible effects on the in vivo bone formation. The results of this study allow a greater understanding of the parameters required for perfusion bioreactor-based manufacturing of osteogenic grafts for clinical applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Differentiation of Adipose-derived Stem Cells into Schwann Cell Phenotype in Comparison with Bone Marrow Stem Cells

    Directory of Open Access Journals (Sweden)

    Zolikha Golipoor

    2010-06-01

    Full Text Available Objective(sBone marrow is the traditional source of human multipotent mesenchymal stem cells (MSCs, but adipose tissue appears to be an alternative and more readily available source. In this study, rat adipose-derived stem cells (ADSCs were induced to differentiate into Schwann-like cells and compared with rat bone marrow stem cells (BMSCs for their Schwann-like cells differentiation potential. Materials and MethodsBMSCs and ADSCs were characterized for expression of MSCs-specific markers, osteogenic and adipogenic differentiation. They were induced to differentiate into Schwann-like cells and analyzed for expression of the Schwann specific markers. The immunocytochemical differentiation markers were S-100 and real time quantitative Real-time polymerase chain reaction (RT-PCR markers were S100, P75 and glial fibrillary acidic protein (GFAP. 3-(4, 5-Dimethylthiazol- 2-yl-2, 5-diphenyltetrazolium bromide (MTT assay and Annexin V-Fluorescein isothiocyanate (FITC/ Propidium iodide (PI double labeling method were employed to detect early stage cell apoptosis.ResultsBMSCs and ADSCs showed similarities in expression of the MSC-specific markers, osteogenic and adipogenic differentiation. Both quantitative RT-PCR and immunocytochemical analysis demonstrated that BMSCs and ADSCs had equal expression of the Schwann-specific markers following Schwann-like cells differentiation. However, gene expression of P75 was higher in BMSCs compared with ADSCs. MTT assay and flow cytometry found that of the total BMSCs and ADSCs in the culture medium, 20% to 30% of the cells died, but the remaining cell population remained strongly attached to the substrate and differentiated.ConclusionComparative analysis showed that Schwann-like cell differentiation potential of ADSCs was slightly decreased in comparison with BMSCs. Therefore, BMSCs are more favorable choice than ADSCs for tissue engineering.

  6. Modulation of Selectin-Mediated Adhesion of Flowing Lymphoma and Bone Marrow Cells by Immobilized SDF-1

    Directory of Open Access Journals (Sweden)

    Elizabeth A. Hedges

    2014-08-01

    Full Text Available The α-chemokine, stromal-derived factor-1 (SDF-1, has been linked to the homing of circulating tumor cells to bone. SDF-1 is expressed by bone microvascular cells and osteoblasts and normally functions to attract blood-borne hematopoietic stem and progenitor cells to marrow. It has been shown that treatment of cancer cells with soluble SDF-1 results in a more aggressive phenotype; however, the relevance of the administration of the soluble protein is unclear. As such, a flow device was functionalized with P-selectin and SDF-1 to mimic the bone marrow microvasculature and the initial steps of cell adhesion. The introduction of SDF-1 onto the adhesive surface was found to significantly enhance the adhesion of lymphoma cells, as well as low-density bone marrow cells (LDBMC, both in terms of the number of adherent cells and the strength of cell adhesion. Thus, SDF-1 has a synergistic effect with P-selectin on cancer cell adhesion and may be sufficient to promote preferential metastasis to bone.

  7. Cerium oxide nanoparticles protect primary mouse bone marrow stromal cells from apoptosis induced by oxidative stress

    Science.gov (United States)

    Zhang, Qun; Ge, Kun; Duan, Jianlei; Chen, Shizhu; Zhang, Ran; Zhang, Cuimiao; Wang, Shuxiang; Zhang, Jinchao

    2014-11-01

    Cerium oxide nanoparticles (nanoceria) have been widely used in industries and biomedical fields due to its unique properties. Previous biodistribution studies of nanoceria in vivo have shown that they are accumulated in the bone of mice after intravenous administration, about 20 % of the total intake, however, the potential effect and the mechanism of nanoceria on bone metabolism are not well-understood. Our results showed that both 25 and 50 nm nanceria decreased the damage of cell viability induced by H2O2 in a dose-dependent manner. The apoptosis ratio of pre-incubated group with nanoceria was lower than the H2O2 group. The cellular uptake studies indicated that there was a dose-dependent accumulation of both two size nanoparticles in bone marrow stromal cells. Nanoceria could be uptaken by cells due to the synergistic effect of multiple endocytosis mechanisms, and then evenly distributed in the cytoplasm without entering the nucleus. Our results suggest that nanoceria could reduce intracellular ROS level induced by H2O2 in a dose-dependent manner, moreover, maintain the normal function of mitochondria, suggesting nanoceria may have potent applications for preventing or treating osteoporosis.

  8. Leptin Overexpression in Bone Marrow Stromal Cells Promotes Periodontal Regeneration in a Rat Model of Osteoporosis.

    Science.gov (United States)

    Zheng, Baoyu; Jiang, Jun; Chen, Yuling; Lin, Minkui; Du, Zhibin; Xiao, Yin; Luo, Kai; Yan, Fuhua

    2017-08-01

    Osteoporosis is associated with widespread periodontitis and impaired periodontal healing. However, there is a lack of information about the outcomes of regenerative approaches under the influence of osteoporosis. This study investigates the effect of leptin (LEP) overexpression on the regenerative potential of bone marrow stromal cells (BMSCs) in an osteoporotic rat periodontal fenestration defect model. Rat BMSCs were transfected with adenoviruses harboring the human (h)LEP gene. Cell proliferation and osteogenic differentiation were evaluated. A β-tricalcium phosphate scaffold seeded with transfected cells was implanted into nude mice to investigate ectopic osteogenesis and into an osteoporotic rat defect to study periodontal regeneration. Regenerated periodontal and bone-like tissues were analyzed by histologic methods. hLEP overexpression induced osteogenic differentiation of BMSCs as evidenced by the upregulation of osteogenesis-related genes such as Runt-related transcription factor 2, alkaline phosphatase (ALP), and collagen Type I, as well as increased ALP activity and enhanced mineralization. Mice implanted with hLEP-BMSC-containing scaffolds showed more extensive formation of bone-like tissue than those in other groups. Periodontal defects were also filled to a greater degree when treated with hLEP-BMSCs and contained cementum and a well-organized periodontal ligament after 10 and 28 days. hLEP overexpression in BMSCs can stimulate periodontal regeneration in osteoporotic conditions and might be a promising strategy for periodontal regeneration in patients with osteoporosis.

  9. Low Oxygen Tension Maintains Multipotency, Whereas Normoxia Increases Differentiation of Mouse Bone Marrow Stromal Cells

    Directory of Open Access Journals (Sweden)

    Marco Giorgio

    2013-01-01

    Full Text Available Optimization of mesenchymal stem cells (MSC culture conditions is of great importance for their more successful application in regenerative medicine. O2 regulates various aspects of cellular biology and, in vivo, MSC are exposed to different O2 concentrations spanning from very low tension in the bone marrow niche, to higher amounts in wounds. In our present work, we isolated mouse bone marrow stromal cells (BMSC and showed that they contained a population meeting requirements for MSC definition. In order to establish the effect of low O2 on cellular properties, we examined BSMC cultured under hypoxic (3% O2 conditions. Our results demonstrate that 3% O2 augmented proliferation of BMSC, as well as the formation of colonies in the colony-forming unit assay (CFU-A, the percentage of quiescent cells, and the expression of stemness markers Rex-1 and Oct-4, thereby suggesting an increase in the stemness of culture when exposed to hypoxia. In contrast, intrinsic differentiation processes were inhibited by 3% O2. Overall yield of differentiation was dependent on the adjustment of O2 tension to the specific stage of BMSC culture. Thus, we established a strategy for efficient BMSC in vitro differentiation using an initial phase of cell propagation at 3% O2, followed by differentiation stage at 21% O2. We also demonstrated that 3% O2 affected BMSC differentiation in p53 and reactive oxygen species (ROS independent pathways. Our findings can significantly contribute to the obtaining of high-quality MSC for effective cell therapy.

  10. Cigarette smoke challenges bone marrow mesenchymal stem cell capacities in guinea pig.

    Science.gov (United States)

    Tura-Ceide, Olga; Lobo, Borja; Paul, Tanja; Puig-Pey, Raquel; Coll-Bonfill, Núria; García-Lucio, Jéssica; Smolders, Valérie; Blanco, Isabel; Barberà, Joan A; Peinado, Víctor I

    2017-03-23

    Cigarette smoke (CS) is associated with lower numbers of circulating stem cells and might severely affect their mobilization, trafficking and homing. Our study was designed to demonstrate in an animal model of CS exposure whether CS affects the homing and functional capabilities of bone marrow-derived mesenchymal stem cells (BM-MSCs). Guinea pigs (GP), exposed or sham-exposed to CS, were administered via tracheal instillation or by vascular administration with 2.5 × 10 6 BM-MSCs obtained from CS-exposed or sham-exposed animal donors. Twenty-four hours after cell administration, animals were sacrificed and cells were visualised into lung structures by optical microscopy. BM-MSCs from 8 healthy GP and from 8 GP exposed to CS for 1 month were isolated from the femur, cultured in vitro and assessed for their proliferation, migration, senescence, differentiation potential and chemokine gene expression profile. CS-exposed animals showed greater BM-MSCs lung infiltration than sham-exposed animals regardless of route of administration. The majority of BM-MSCs localized in the alveolar septa. BM-MSCs obtained from CS-exposed animals showed lower ability to engraft and lower proliferation and migration. In vitro, BM-MSCs exposed to CS extract showed a significant reduction of proliferative, cellular differentiation and migratory potential and an increase in cellular senescence in a dose dependent manner. Short-term CS exposure induces BM-MSCs dysfunction. Such dysfunction was observed in vivo, affecting the cell homing and proliferation capabilities of BM-MSCs in lungs exposed to CS and in vitro altering the rate of proliferation, senescence, differentiation and migration capacity. Additionally, CS induced a reduction in CXCL9 gene expression in the BM from CS-exposed animals underpinning a potential mechanistic action of bone marrow dysfunction.

  11. Neurotrophins regulate bone marrow stromal cell IL-6 expression through the MAPK pathway.

    Directory of Open Access Journals (Sweden)

    Fariba Rezaee

    2010-03-01

    Full Text Available The host's response to infection is characterized by altered levels of neurotrophins and an influx of inflammatory cells to sites of injured tissue. Progenitor cells that give rise to the differentiated cellular mediators of inflammation are derived from bone marrow progenitor cells where their development is regulated, in part, by cues from bone marrow stromal cells (BMSC. As such, alteration of BMSC function in response to elevated systemic mediators has the potential to alter their function in biologically relevant ways, including downstream alteration of cytokine production that influences hematopoietic development.In the current study we investigated BMSC neurotrophin receptor expression by flow cytometric analysis to determine differences in expression as well as potential to respond to NGF or BDNF. Intracellular signaling subsequent to neurotrophin stimulation of BMSC was analyzed by western blot, microarray analysis, confocal microscopy and real-time PCR. Analysis of BMSC Interleukin-6 (IL-6 expression was completed using ELISA and real-time PCR.BMSC established from different individuals had distinct expression profiles of the neurotrophin receptors, TrkA, TrkB, TrkC, and p75(NTR. These receptors were functional, demonstrated by an increase in Akt-phosphorylation following BMSC exposure to recombinant NGF or BDNF. Neurotrophin stimulation of BMSC resulted in increased IL-6 gene and protein expression which required activation of ERK and p38 MAPK signaling, but was not mediated by the NFkappaB pathway. BMSC response to neurotrophins, including the up-regulation of IL-6, may alter their support of hematopoiesis and regulate the availability of inflammatory cells for migration to sites of injury or infection. As such, these studies are relevant to the growing appreciation of the interplay between neurotropic mediators and the regulation of hematopoiesis.

  12. Bone Marrow Cell Therapy on 1,2-Dimethylhydrazine (DMH)-Induced Colon Cancer in Rats.

    Science.gov (United States)

    El-Khadragy, Manal F; Nabil, Heba M; Hassan, Basmaa N; Tohamy, Amany A; Waaer, Hanaa F; Yehia, Hany M; Alharbi, Afra M; Moneim, Ahmed Esmat Abdel

    2018-01-01

    Stem cell based therapies are being under focus due to their possible role in treatment of various tumors. Bone marrow stem cells believed to have anticancer potential and are preferred for their activities by stimulating the immune system, migration to the site of tumor and ability for inducting apoptosis in cancer cells. The current study was aimed to investigate the tumor suppressive effects of bone marrow cells (BMCs) in 1,2-dimethylhydrazine (DMH)-induced colon cancer in rats. The rats were randomly allocated into four groups: control, BMCs alone, DMH alone and BMCs with DMH. BMCs were injected intrarectally while DMH was injected subcutaneously at 20 mg/kg body weight once a week for 15 weeks. Histopathological examination and gene expression of survivin, β-catenin and multidrug resistance-1 (MDR-1) by real-time reverse transcription-polymerase chain reaction (RT-PCR) in rat colon tissues. This is in addition to oxidative stress markers in colon were performed across all groups. The presence of aberrant crypt foci was reordered once histopathological examination of colon tissue from rats which received DMH alone. Administration of BMCs into rats starting from zero-day of DMH injection improved the histopathological picture which showed a clear improvement in mucosal layer, few inflammatory cells infiltration periglandular and in the lamina propria. Gene expression in rat colon tissue demonstrated that BMCs down-regulated survivin, β-catenin, MDR-1 and cytokeratin 20 genes expression in colon tissues after colon cancer induction. Amelioration of the colon status after administration of MSCs has been evidenced by a major reduction of lipid peroxidation, nitric oxide, and increasing of glutathione content and superoxide dismutase along with catalase activities. Our findings demonstrated that BMCs have tumor suppressive effects in DMH-induced colon cancer as evidenced by down-regulation of survivin, β-catenin, and MDR-1 genes and enhancing the antioxidant

  13. Hard tissue formation in a porous HA/TCP ceramic scaffold loaded with stromal cells derived from dental pulp and bone marrow.

    NARCIS (Netherlands)

    Zhang, W.; Walboomers, X.F.; Osch, G.J.V.M. van; Dolder, J. van den; Jansen, J.A.

    2008-01-01

    The aim of this study was to compare the ability of hard tissue regeneration of four types of stem cells or precursors under both in vitro and in vivo situations. Primary cultures of rat bone marrow, rat dental pulp, human bone marrow, and human dental pulp cells were seeded onto a porous ceramic

  14. Oxidative Stress, Bone Marrow Failure, and Genome Instability in Hematopoietic Stem Cells

    Directory of Open Access Journals (Sweden)

    Christine Richardson

    2015-01-01

    Full Text Available Reactive oxygen species (ROS can be generated by defective endogenous reduction of oxygen by cellular enzymes or in the mitochondrial respiratory pathway, as well as by exogenous exposure to UV or environmental damaging agents. Regulation of intracellular ROS levels is critical since increases above normal concentrations lead to oxidative stress and DNA damage. A growing body of evidence indicates that the inability to regulate high levels of ROS leading to alteration of cellular homeostasis or defective repair of ROS-induced damage lies at the root of diseases characterized by both neurodegeneration and bone marrow failure as well as cancer. That these diseases may be reflective of the dynamic ability of cells to respond to ROS through developmental stages and aging lies in the similarities between phenotypes at the cellular level. This review summarizes work linking the ability to regulate intracellular ROS to the hematopoietic stem cell phenotype, aging, and disease.

  15. Clonal proliferation and karyotypic features of cells in bone marrow after irradiation

    International Nuclear Information System (INIS)

    Kohno, S.; Ishihara, T.

    1979-01-01

    Single stem cells in which chromosome abnormalities are induced by radiation may multiply to form the chromosomally abnormal clones of cells that may replace most of the cells in regenerating hematopoietic tissues after irradiation. It is only a limited number of karyotypes out of a variety of the cells with radiation-induced chromosome abnormalities that can persist as proliferative clones. Such clones in the bone marrows of irradiated rats were found to have aneusomic chromosome constitutions with trisomy or monosomy. This finding is contradictory to the general beliefs that the chromosomally abnormal clones surviving after irradiation would have the chromosome constitutions comparable to a normal diploid set making such clone cells selectively neutral, and that autosomally monosomic cells would not be able to compete against the cells in normal somatic tissues. The proliferation of aneusomic cells in hematopoietic tissues is a phenomenon observable in various blood disorders such as leukemia. The fact that almost all of the aneuploid clones observed possessed various chromosomal rearrangements in addition to their numerical changes appears to indicate that the chromosomal imbalance in original clones may predispose their chromosomes to non-disjunction. The process of the leukemic development of cells may require two steps: the leukemic transformation of cells and the proliferation of such transformed cells up to the manifestation of the disease. (Yamashita, S.)

  16. Regulatory Systems in Bone Marrow for Hematopoietic Stem/Progenitor Cells Mobilization and Homing

    Directory of Open Access Journals (Sweden)

    P. Alvarez

    2013-01-01

    Full Text Available Regulation of hematopoietic stem cell release, migration, and homing from the bone marrow (BM and of the mobilization pathway involves a complex interaction among adhesion molecules, cytokines, proteolytic enzymes, stromal cells, and hematopoietic cells. The identification of new mechanisms that regulate the trafficking of hematopoietic stem/progenitor cells (HSPCs cells has important implications, not only for hematopoietic transplantation but also for cell therapies in regenerative medicine for patients with acute myocardial infarction, spinal cord injury, and stroke, among others. This paper reviews the regulation mechanisms underlying the homing and mobilization of BM hematopoietic stem/progenitor cells, investigating the following issues: (a the role of different factors, such as stromal cell derived factor-1 (SDF-1, granulocyte colony-stimulating factor (G-CSF, and vascular cell adhesion molecule-1 (VCAM-1, among other ligands; (b the stem cell count in peripheral blood and BM and influential factors; (c the therapeutic utilization of this phenomenon in lesions in different tissues, examining the agents involved in HSPCs mobilization, such as the different forms of G-CSF, plerixafor, and natalizumab; and (d the effects of this mobilization on BM-derived stem/progenitor cells in clinical trials of patients with different diseases.

  17. Lack of galectin-3 modifies differentially Notch ligands in bone marrow and spleen stromal cells interfering with B cell differentiation.

    Science.gov (United States)

    de Oliveira, Felipe Leite; Dos Santos, Sofia Nascimento; Ricon, Lauremilia; da Costa, Thayse Pinheiro; Pereira, Jonathas Xavier; Brand, Camila; Fermino, Marise Lopes; Chammas, Roger; Bernardes, Emerson Soares; El-Cheikh, Márcia Cury

    2018-02-22

    Galectin-3 (Gal-3) is a β-galactoside binding protein that controls cell-cell and cell-extracellular matrix interactions. In lymphoid organs, gal-3 inhibits B cell differentiation by mechanisms poorly understood. The B cell development is dependent on tissue organization and stromal cell signaling, including IL-7 and Notch pathways. Here, we investigate possible mechanisms that gal-3 interferes during B lymphocyte differentiation in the bone marrow (BM) and spleen. The BM of gal-3-deficient mice (Lgals3 -/- mice) was evidenced by elevated numbers of B220 + CD19 + c-Kit + IL-7R + progenitor B cells. In parallel, CD45 - bone marrow stromal cells expressed high levels of mRNA IL-7, Notch ligands (Jagged-1 and Delta-like 4), and transcription factors (Hes-1, Hey-1, Hey-2 and Hey-L). The spleen of Lgals3 -/- mice was hallmarked by marginal zone disorganization, high number of IgM + IgD + B cells and CD138 + plasma cells, overexpression of Notch ligands (Jagged-1, Delta-like 1 and Delta-like 4) by stromal cells and Hey-1. Morever, IgM + IgD + B cells and B220 + CD138 + CXCR4 + plasmablasts were significantly increased in the BM and blood of Lgals3 -/- mice. For the first time, we demonstrated that gal-3 inhibits Notch signaling activation in lymphoid organs regulating earlier and terminal events of B cell differentiation.

  18. White blood cell differential count of maturation stages in bone marrow smear using dual-stage convolutional neural networks.

    Directory of Open Access Journals (Sweden)

    Jin Woo Choi

    Full Text Available The white blood cell differential count of the bone marrow provides information concerning the distribution of immature and mature cells within maturation stages. The results of such examinations are important for the diagnosis of various diseases and for follow-up care after chemotherapy. However, manual, labor-intensive methods to determine the differential count lead to inter- and intra-variations among the results obtained by hematologists. Therefore, an automated system to conduct the white blood cell differential count is highly desirable, but several difficulties hinder progress. There are variations in the white blood cells of each maturation stage, small inter-class differences within each stage, and variations in images because of the different acquisition and staining processes. Moreover, a large number of classes need to be classified for bone marrow smear analysis, and the high density of touching cells in bone marrow smears renders difficult the segmentation of single cells, which is crucial to traditional image processing and machine learning. Few studies have attempted to discriminate bone marrow cells, and even these have either discriminated only a few classes or yielded insufficient performance. In this study, we propose an automated white blood cell differential counting system from bone marrow smear images using a dual-stage convolutional neural network (CNN. A total of 2,174 patch images were collected for training and testing. The dual-stage CNN classified images into 10 classes of the myeloid and erythroid maturation series, and achieved an accuracy of 97.06%, a precision of 97.13%, a recall of 97.06%, and an F-1 score of 97.1%. The proposed method not only showed high classification performance, but also successfully classified raw images without single cell segmentation and manual feature extraction by implementing CNN. Moreover, it demonstrated rotation and location invariance. These results highlight the promise of

  19. White blood cell differential count of maturation stages in bone marrow smear using dual-stage convolutional neural networks.

    Science.gov (United States)

    Choi, Jin Woo; Ku, Yunseo; Yoo, Byeong Wook; Kim, Jung-Ah; Lee, Dong Soon; Chai, Young Jun; Kong, Hyoun-Joong; Kim, Hee Chan

    2017-01-01

    The white blood cell differential count of the bone marrow provides information concerning the distribution of immature and mature cells within maturation stages. The results of such examinations are important for the diagnosis of various diseases and for follow-up care after chemotherapy. However, manual, labor-intensive methods to determine the differential count lead to inter- and intra-variations among the results obtained by hematologists. Therefore, an automated system to conduct the white blood cell differential count is highly desirable, but several difficulties hinder progress. There are variations in the white blood cells of each maturation stage, small inter-class differences within each stage, and variations in images because of the different acquisition and staining processes. Moreover, a large number of classes need to be classified for bone marrow smear analysis, and the high density of touching cells in