BMI-1 targeting interferes with patient-derived tumor-initiating cell survival and tumor growth in prostate cancer

Science.gov (United States)

Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.

2016-01-01

Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599

Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion

Directory of Open Access Journals (Sweden)

Lowell Evan Michael

2008-12-01

Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.

Nuclear export of cutaneous HPV8 E7 oncoprotein is mediated by a leucine-rich nuclear export signal via a CRM1 pathway.

Science.gov (United States)

Onder, Zeynep; Chang, Vivian; Moroianu, Junona

2015-01-01

We recently determined that the nuclear import of cutaneous beta genus HPV8 E7 oncoprotein it is mediated by its zinc-binding domain via direct hydrophobic interactions with the FG nucleoporins Nup62 and Nup153 (Onder and Moroianu, 2014). Here we investigated the nuclear export of HPV8 E7 oncoprotein using confocal microscopy after transfections of HeLa cells with EGFP-8cE7 and mutant plasmids and treatment with Ratjadone A nuclear export inhibitor. We determined that HPV8 E7 contains a leucine-rich nuclear export signal (NES), 76IRTFQELLF84, within its zinc-binding domain that mediates its nuclear export via a CRM1 pathway. We found that HPV8 E7 interacts with CRM1 and that the hydrophobic amino acid residues I76, F79 and L82 of the NES are essential for this interaction and for nuclear export of HPV8 E7 oncoprotein. Copyright © 2014 Elsevier Inc. All rights reserved.

Bmi-1 Regulates Extensive Erythroid Self-Renewal

Directory of Open Access Journals (Sweden)

Ah Ram Kim

2015-06-01

Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

Viral oncoprotein antibodies as a marker for recurrence of Merkel cell carcinoma: A prospective validation study.

Science.gov (United States)

Paulson, Kelly G; Lewis, Christopher W; Redman, Mary W; Simonson, William T; Lisberg, Aaron; Ritter, Deborah; Morishima, Chihiro; Hutchinson, Kathleen; Mudgistratova, Lola; Blom, Astrid; Iyer, Jayasri; Moshiri, Ata S; Tarabadkar, Erica S; Carter, Joseph J; Bhatia, Shailender; Kawasumi, Masaoki; Galloway, Denise A; Wener, Mark H; Nghiem, Paul

2017-04-15

Merkel cell carcinoma (MCC) is an aggressive skin cancer with a recurrence rate of >40%. Of the 2000 MCC cases per year in the United States, most are caused by the Merkel cell polyomavirus (MCPyV). Antibodies to MCPyV oncoprotein (T-antigens) have been correlated with MCC tumor burden. The present study assesses the clinical utility of MCPyV-oncoprotein antibody titers for MCC prognostication and surveillance. MCPyV-oncoprotein antibody detection was optimized in a clinical laboratory. A cohort of 219 patients with newly diagnosed MCC were followed prospectively (median follow-up, 1.9 years). Among the seropositive patients, antibody titer and disease status were serially tracked. Antibodies to MCPyV oncoproteins were rare among healthy individuals (1%) but were present in most patients with MCC (114 of 219 patients [52%]; P < .01). Seropositivity at diagnosis independently predicted decreased recurrence risk (hazard ratio, 0.58; P = .04) in multivariate analyses adjusted for age, sex, stage, and immunosuppression. After initial treatment, seropositive patients whose disease did not recur had rapidly falling titers that became negative by a median of 8.4 months. Among seropositive patients who underwent serial evaluation (71 patients; 282 time points), an increasing oncoprotein titer had a positive predictive value of 66% for clinically evident recurrence, whereas a decreasing titer had a negative predictive value of 97%. Determination of oncoprotein antibody titer assists in the clinical management of patients with newly diagnosed MCC by stratifying them into a higher risk seronegative cohort, in which radiologic imaging may play a more prominent role, and into a lower risk seropositive cohort, in which disease status can be tracked in part by oncoprotein antibody titer. Cancer 2017;123:1464-1474. © 2016 American Cancer Society. © 2016 American Cancer Society.

Expression of Bmi-1 is a prognostic marker in bladder cancer

International Nuclear Information System (INIS)

Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing

2009-01-01

The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer

Bmi-1: At the crossroads of physiological and pathological biology

Science.gov (United States)

Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar

2015-01-01

Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339

Regulation of the Wnt/β-Catenin Signaling Pathway by Human Papillomavirus E6 and E7 Oncoproteins

Directory of Open Access Journals (Sweden)

Jesus Omar Muñoz Bello

2015-08-01

Full Text Available Cell signaling pathways are the mechanisms by which cells transduce external stimuli, which control the transcription of genes, to regulate diverse biological effects. In cancer, distinct signaling pathways, such as the Wnt/β-catenin pathway, have been implicated in the deregulation of critical molecular processes that affect cell proliferation and differentiation. For example, changes in β-catenin localization have been identified in Human Papillomavirus (HPV-related cancers as the lesion progresses. Specifically, β-catenin relocates from the membrane/cytoplasm to the nucleus, suggesting that this transcription regulator participates in cervical carcinogenesis. The E6 and E7 oncoproteins are responsible for the transforming activity of HPV, and some studies have implicated these viral oncoproteins in the regulation of the Wnt/β-catenin pathway. Nevertheless, new interactions of HPV oncoproteins with cellular proteins are emerging, and the study of the biological effects of such interactions will help to understand HPV-related carcinogenesis. Viruses 2015, 7 4735 This review addresses the accumulated evidence of the involvement of the HPV E6 and E7 oncoproteins in the activation of the Wnt/β-catenin pathway.

Bmi-1 expression modulates non-small cell lung cancer progression

Science.gov (United States)

Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua

2015-01-01

Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371

Expression of Bmi-1 is a prognostic marker in bladder cancer

Directory of Open Access Journals (Sweden)

Xu Li-Hua

2009-02-01

Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.

The Role of BMI1 in CRPC

Science.gov (United States)

2016-10-01

we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of

miR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1

Energy Technology Data Exchange (ETDEWEB)

Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)

2015-01-02

Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.

Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion

NARCIS (Netherlands)

Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.

2008-01-01

Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in

The human papillomavirus type 16 E6 oncoprotein activates mTORC1 signaling and increases protein synthesis.

Science.gov (United States)

Spangle, Jennifer M; Münger, Karl

2010-09-01

The mammalian target of rapamycin (mTOR) kinase acts as a cellular rheostat that integrates signals from a variety of cellular signal transduction pathways that sense growth factor and nutrient availability as well as intracellular energy status. It was previously reported that the human papillomavirus type 16 (HPV16) E6 oncoprotein may activate the S6 protein kinase (S6K) through binding and E6AP-mediated degradation of the mTOR inhibitor tuberous sclerosis complex 2 (TSC2) (Z. Lu, X. Hu, Y. Li, L. Zheng, Y. Zhou, H. Jiang, T. Ning, Z. Basang, C. Zhang, and Y. Ke, J. Biol. Chem. 279:35664-35670, 2004; L. Zheng, H. Ding, Z. Lu, Y. Li, Y. Pan, T. Ning, and Y. Ke, Genes Cells 13:285-294, 2008). Our results confirmed that HPV16 E6 expression causes an increase in mTORC1 activity through enhanced phosphorylation of mTOR and activation of downstream signaling pathways S6K and eukaryotic initiation factor binding protein 1 (4E-BP1). However, we did not detect a decrease in TSC2 levels in HPV16 E6-expressing cells. We discovered, however, that HPV16 E6 expression causes AKT activation through the upstream kinases PDK1 and mTORC2 under conditions of nutrient deprivation. We show that HPV16 E6 expression causes an increase in protein synthesis by enhancing translation initiation complex assembly at the 5' mRNA cap and an increase in cap-dependent translation. The increase in cap-dependent translation likely results from HPV16 E6-induced AKT/mTORC1 activation, as the assembly of the translation initiation complex and cap-dependent translation are rapamycin sensitive. Lastly, coexpression of the HPV16 E6 and E7 oncoproteins does not affect HPV16 E6-induced activation of mTORC1 and cap-dependent translation. HPV16 E6-mediated activation of mTORC1 signaling and cap-dependent translation may be a mechanism to promote viral replication under conditions of limited nutrient supply in differentiated, HPV oncoprotein-expressing proliferating cells.

Nuclear export of cutaneous HPV8 E7 oncoprotein is mediated by a leucine-rich nuclear export signal via a CRM1 pathway

Energy Technology Data Exchange (ETDEWEB)

Onder, Zeynep; Chang, Vivian; Moroianu, Junona, E-mail: moroianu@bc.edu

2015-01-01

We recently determined that the nuclear import of cutaneous beta genus HPV8 E7 oncoprotein it is mediated by its zinc-binding domain via direct hydrophobic interactions with the FG nucleoporins Nup62 and Nup153 (Onder and Moroianu, 2014). Here we investigated the nuclear export of HPV8 E7 oncoprotein using confocal microscopy after transfections of HeLa cells with EGFP–8cE7 and mutant plasmids and treatment with Ratjadone A nuclear export inhibitor. We determined that HPV8 E7 contains a leucine-rich nuclear export signal (NES), {sub 76}IRTFQELLF{sub 84}, within its zinc-binding domain that mediates its nuclear export via a CRM1 pathway. We found that HPV8 E7 interacts with CRM1 and that the hydrophobic amino acid residues I76, F79 and L82 of the NES are essential for this interaction and for nuclear export of HPV8 E7 oncoprotein. - Highlights: • HPV8 E7 has a leucine-rich NES within its zinc-binding domain that mediates its nuclear export. • CRM1 nuclear export receptor interacts with HPV8 E7 and mediates its export. • Identification of the critical hydrophobic amino acids of the NES of HPV8 E7.

Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

Science.gov (United States)

Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

2016-01-01

Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

Ethnicity influences BMI as evaluated from reported serum lipid values in Inuit and non-Inuit: raised upper limit of BMI in Inuit?

Science.gov (United States)

Noahsen, Paneeraq; Andersen, Stig

2013-01-01

To identify thresholds of BMI at which similar levels of serum lipids occur in Inuit and in non-Inuit as the impact of obesity on metabolic risk factors differ in Inuit compared to other ethnic groups. Published comparative data among Inuit and non-Inuit whites on BMI and HDL-cholesterol and triglyceride were identified for analysis. A literature search was done for BMI, lipids, Inuit and Greenland or Canada. Studies with data on triglycerides and HDL-cholesterol in Inuit and non-Inuit Caucasians were selected and data were retrieved. Regression equations were computed for BMI and HDL-cholesterol and BMI and triglycerides. BMI for similar levels of lipids in Inuit and non-Inuit and ratios of Inuit/non-Inuit BMI's were calculated. At BMI 25 kg/m2 HDL-cholesterol was 1.7/1.6 mM in Greenland Inuit/non-Inuit women and 1.7/1.5 mM in men in a major comparative study. HDL cholesterol decreased by 0.09 for each 1 kg/m2 increase in BMI. Serum triglycerides were 1.0/1.1 mM for Greenland Inuit/non-Inuit women and 0.9/ 1.4 mM for men at BMI 25 kg/m2. Slopes were around 0.1. A comparative study in Canadian Inuit/non-Inuit gave similar results. The BMI levels required for similar HDL-cholesterol or triglycerides were around 27.5 kg/m2, and Inuit/non-Inuit BMI-ratios were around 1.1. The same degree of dyslipidaemia was seen when Inuit had a 10% higher BMI compared to non-Inuit. This may support the establishment of Inuit-specific BMI cut-offs for the purposes of health screening and population health surveillance.

Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency

Directory of Open Access Journals (Sweden)

Anthony Flamier

2018-05-01

Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.

Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway

Science.gov (United States)

Liu, Jiaguo; Luo, Bin; Zhao, Meng

2017-01-01

Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587

Bmi1 confers resistance to oxidative stress on hematopoietic stem cells.

Directory of Open Access Journals (Sweden)

Shunsuke Nakamura

Full Text Available The polycomb-group (PcG proteins function as general regulators of stem cells. We previously reported that retrovirus-mediated overexpression of Bmi1, a gene encoding a core component of polycomb repressive complex (PRC 1, maintained self-renewing hematopoietic stem cells (HSCs during long-term culture. However, the effects of overexpression of Bmi1 on HSCs in vivo remained to be precisely addressed.In this study, we generated a mouse line where Bmi1 can be conditionally overexpressed under the control of the endogenous Rosa26 promoter in a hematopoietic cell-specific fashion (Tie2-Cre;R26Stop(FLBmi1. Although overexpression of Bmi1 did not significantly affect steady state hematopoiesis, it promoted expansion of functional HSCs during ex vivo culture and efficiently protected HSCs against loss of self-renewal capacity during serial transplantation. Overexpression of Bmi1 had no effect on DNA damage response triggered by ionizing radiation. In contrast, Tie2-Cre;R26Stop(FLBmi1 HSCs under oxidative stress maintained a multipotent state and generally tolerated oxidative stress better than the control. Unexpectedly, overexpression of Bmi1 had no impact on the level of intracellular reactive oxygen species (ROS.Our findings demonstrate that overexpression of Bmi1 confers resistance to stresses, particularly oxidative stress, onto HSCs. This thereby enhances their regenerative capacity and suggests that Bmi1 is located downstream of ROS signaling and negatively regulated by it.

BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.

Science.gov (United States)

Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian

2010-02-21

The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.

BMI and BMI SDS in childhood: annual increments and conditional change

OpenAIRE

Brannsether-Ellingsen, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Juliusson, Petur Benedikt

2016-01-01

Background: Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim: To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods: The distributions of 1-year increments of BMI (kg/m2) and BMI SDS are summarised by...

The associations of Bmi-1 with progression of glomerular chronic kidney disease
.

Science.gov (United States)

Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren

2018-02-01

Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings.
.

The Msi Family of RNA-Binding Proteins Function Redundantly as Intestinal Oncoproteins

Directory of Open Access Journals (Sweden)

Ning Li

2015-12-01

Full Text Available Members of the Msi family of RNA-binding proteins have recently emerged as potent oncoproteins in a range of malignancies. MSI2 is highly expressed in hematopoietic cancers, where it is required for disease maintenance. In contrast to the hematopoietic system, colorectal cancers can express both Msi family members, MSI1 and MSI2. Here, we demonstrate that, in the intestinal epithelium, Msi1 and Msi2 have analogous oncogenic effects. Further, comparison of Msi1/2-induced gene expression programs and transcriptome-wide analyses of Msi1/2-RNA-binding targets reveal significant functional overlap, including induction of the PDK-Akt-mTORC1 axis. Ultimately, we demonstrate that concomitant loss of function of both MSI family members is sufficient to abrogate the growth of human colorectal cancer cells, and Msi gene deletion inhibits tumorigenesis in several mouse models of intestinal cancer. Our findings demonstrate that MSI1 and MSI2 act as functionally redundant oncoproteins required for the ontogeny of intestinal cancers.

Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients

Directory of Open Access Journals (Sweden)

Xiaodong Li

2016-11-01

Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.

BMI and BMI SDS in childhood: annual increments and conditional change.

Science.gov (United States)

Brannsether, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Júlíusson, Pétur Benedikt

2017-02-01

Background Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods The distributions of 1-year increments of BMI (kg/m 2 ) and BMI SDS are summarised by percentiles. Differences according to sex, age, height, weight, initial BMI and weight status on the BMI and BMI SDS increments were assessed with multiple linear regression. Conditional change in BMI SDS was based on the correlation between annual BMI measurements converted to SDS. Results BMI increments depended significantly on sex, height, weight and initial BMI. Changes in BMI SDS depended significantly only on the initial BMI SDS. The distribution of conditional change in BMI SDS using a two-correlation model was close to normal (mean = 0.11, SD = 1.02, n = 1167), with 3.2% (2.3-4.4%) of the observations below -2 SD and 2.8% (2.0-4.0%) above +2 SD. Conclusion Conditional change in BMI SDS can be used to detect unexpected large changes in BMI SDS. Although this method requires the use of a computer, it may be clinically useful to detect aberrant weight development.

Peptide-DNA conjugates as tailored bivalent binders of the oncoprotein c-Jun.

Science.gov (United States)

Pazos, Elena; Portela, Cecilia; Penas, Cristina; Vázquez, M Eugenio; Mascareñas, José L

2015-05-21

We describe a ds-oligonucleotide-peptide conjugate that is able to efficiently dismount preformed DNA complexes of the bZIP regions of oncoproteins c-Fos and c-Jun (AP-1), and therefore might be useful as disrupters of AP-1-mediated gene expression pathways.

Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells

Energy Technology Data Exchange (ETDEWEB)

Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)

2012-08-24

Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.

Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma

International Nuclear Information System (INIS)

Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua

2010-01-01

Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis

The Sumo-targeted ubiquitin ligase RNF4 regulates the localization and function of the HTLV-1 oncoprotein Tax

Science.gov (United States)

Fryrear, Kimberly A.; Guo, Xin

2012-01-01

The Really Interesting New Gene (RING) Finger Protein 4 (RNF4) represents a class of ubiquitin ligases that target Small Ubiquitin-like Modifier (SUMO)–modified proteins for ubiquitin modification. To date, the regulatory function of RNF4 appears to be ubiquitin-mediated degradation of sumoylated cellular proteins. In the present study, we show that the Human T-cell Leukemia Virus Type 1 (HTLV-1) oncoprotein Tax is a substrate for RNF4 both in vivo and in vitro. We mapped the RNF4-binding site to a region adjacent to the Tax ubiquitin/SUMO modification sites K280/K284. Interestingly, RNF4 modification of Tax protein results in relocalization of the oncoprotein from the nucleus to the cytoplasm. Overexpression of RNF4, but not the RNF4 RING mutant, resulted in cytoplasmic enrichment of Tax. The RNF4-induced nucleus-to-cytoplasm relocalization was associated with increased NF-κB–mediated and decreased cAMP Response Element-Binding (CREB)–mediated Tax activity. Finally, depletion of RNF4 by RNAi prevented the DNA damage–induced nuclear/cytoplasmic translocation of Tax. These results provide important new insight into STUbL-mediated pathways that regulate the subcellular localization and functional dynamics of viral oncogenes. PMID:22106342

GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.

Directory of Open Access Journals (Sweden)

Bart A Westerman

Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.

Weighted gene co-expression network analysis of expression data of monozygotic twins identifies specific modules and hub genes related to BMI.

Science.gov (United States)

Wang, Weijing; Jiang, Wenjie; Hou, Lin; Duan, Haiping; Wu, Yili; Xu, Chunsheng; Tan, Qihua; Li, Shuxia; Zhang, Dongfeng

2017-11-13

The therapeutic management of obesity is challenging, hence further elucidating the underlying mechanisms of obesity development and identifying new diagnostic biomarkers and therapeutic targets are urgent and necessary. Here, we performed differential gene expression analysis and weighted gene co-expression network analysis (WGCNA) to identify significant genes and specific modules related to BMI based on gene expression profile data of 7 discordant monozygotic twins. In the differential gene expression analysis, it appeared that 32 differentially expressed genes (DEGs) were with a trend of up-regulation in twins with higher BMI when compared to their siblings. Categories of positive regulation of nitric-oxide synthase biosynthetic process, positive regulation of NF-kappa B import into nucleus, and peroxidase activity were significantly enriched within GO database and NF-kappa B signaling pathway within KEGG database. DEGs of NAMPT, TLR9, PTGS2, HBD, and PCSK1N might be associated with obesity. In the WGCNA, among the total 20 distinct co-expression modules identified, coral1 module (68 genes) had the strongest positive correlation with BMI (r = 0.56, P = 0.04) and disease status (r = 0.56, P = 0.04). Categories of positive regulation of phospholipase activity, high-density lipoprotein particle clearance, chylomicron remnant clearance, reverse cholesterol transport, intermediate-density lipoprotein particle, chylomicron, low-density lipoprotein particle, very-low-density lipoprotein particle, voltage-gated potassium channel complex, cholesterol transporter activity, and neuropeptide hormone activity were significantly enriched within GO database for this module. And alcoholism and cell adhesion molecules pathways were significantly enriched within KEGG database. Several hub genes, such as GAL, ASB9, NPPB, TBX2, IL17C, APOE, ABCG4, and APOC2 were also identified. The module eigengene of saddlebrown module (212 genes) was also significantly

File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...

File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...

File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...

File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...

BMI and Lifetime Changes in BMI and Cancer Mortality Risk

Science.gov (United States)

Taghizadeh, Niloofar; Boezen, H. Marike; Schouten, Jan P.; Schröder, Carolien P.; de Vries, E. G. Elisabeth; Vonk, Judith M.

2015-01-01

Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and lifetime changes in BMI (calculated over different time periods (i.e. short time period: annual change in BMI between successive surveys, long time period: annual change in BMI over the entire study period) with mortality from any cancer, and lung, colorectal, prostate and breast cancer in a large cohort study (n=8,645. Vlagtwedde-Vlaardingen, 1965-1990) with a follow-up on mortality status on December 31st 2008. We used multivariate Cox regression models with adjustments for age, smoking, sex, and place of residence. Being overweight at baseline was associated with a higher risk of prostate cancer mortality (hazard ratio (HR) =2.22; 95% CI 1.19-4.17). Obesity at baseline was associated with a higher risk of any cancer mortality [all subjects (1.23 (1.01-1.50)), and females (1.40 (1.07-1.84))]. Chronically obese females (females who were obese during the entire study-period) had a higher risk of mortality from any cancer (2.16 (1.47-3.18), lung (3.22 (1.06-9.76)), colorectal (4.32 (1.53-12.20)), and breast cancer (2.52 (1.15-5.54)). We found no significant association between long-term annual change in BMI and cancer mortality risk. Both short-term annual increase and decrease in BMI were associated with a lower mortality risk from any cancer [all subjects: (0.67 (0.47-0.94)) and (0.73 (0.55-0.97)), respectively]. In conclusion, a higher BMI is associated with a higher cancer mortality risk. This study is the first to show that short-term annual changes in BMI were associated with lower mortality from any type of cancer. PMID:25881129

Excess BMI in Childhood: A Modifiable Risk Factor for Type 1 Diabetes Development?

Science.gov (United States)

Ferrara, Christine Therese; Geyer, Susan Michelle; Liu, Yuk-Fun; Evans-Molina, Carmella; Libman, Ingrid M; Besser, Rachel; Becker, Dorothy J; Rodriguez, Henry; Moran, Antoinette; Gitelman, Stephen E; Redondo, Maria J

2017-05-01

We aimed to determine the effect of elevated BMI over time on the progression to type 1 diabetes in youth. We studied 1,117 children in the TrialNet Pathway to Prevention cohort (autoantibody-positive relatives of patients with type 1 diabetes). Longitudinally accumulated BMI above the 85th age- and sex-adjusted percentile generated a cumulative excess BMI (ceBMI) index. Recursive partitioning and multivariate analyses yielded sex- and age-specific ceBMI thresholds for greatest type 1 diabetes risk. Higher ceBMI conferred significantly greater risk of progressing to type 1 diabetes. The increased diabetes risk occurred at lower ceBMI values in children <12 years of age compared with older subjects and in females versus males. Elevated BMI is associated with increased risk of diabetes progression in pediatric autoantibody-positive relatives, but the effect varies by sex and age. © 2017 by the American Diabetes Association.

File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...

File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...

File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...

File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...

File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...

File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...

File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...

MUC1-C Oncoprotein Integrates a Program of EMT, Epigenetic Reprogramming and Immune Evasion in Human Carcinomas.

Science.gov (United States)

Rajabi, Hasan; Kufe, Donald

2017-08-01

The MUC1 gene evolved in mammalian species to provide protection of epithelia. The transmembrane MUC1 C-terminal subunit (MUC1-C) signals stress to the interior of the epithelial cell and, when overexpressed as in most carcinomas, functions as an oncoprotein. MUC1-C induces the epithelial-mesenchymal transition (EMT) by activating the inflammatory NF-κB p65 pathway and, in turn, the EMT-transcriptional repressor ZEB1. Emerging evidence has indicated that MUC1-C drives a program integrating the induction of EMT with activation of stem cell traits, epigenetic reprogramming and immune evasion. This mini-review focuses on the potential importance of this MUC1-C program in cancer progression. Copyright © 2017 Elsevier B.V. All rights reserved.

Phosphorylation of Nanog is Essential to Regulate Bmi1 and Promote Tumorigenesis

Science.gov (United States)

Xie, Xiujie; Piao, Longzhu; Cavey, Greg S.; Old, Matthew; Teknos, Theodoros N.; Mapp, Anna K; Pan, Quintin

2014-01-01

Emerging evidence indicates that Nanog is intimately involved in tumorigenesis in part through regulation of the cancer initiating cell population. However, the regulation and role of Nanog in tumorigenesis are still poorly understood. In this study, human Nanog was identified to be phosphorylated by human PKCε at multiple residues including T200 and T280. Our work indicated that phosphorylation at T200 and T280 modulates Nanog function through several regulatory mechanisms. Results with phosphorylation-insensitive and phosphorylation-mimetic mutant Nanog revealed that phosphorylation at T200 and T280 enhance Nanog protein stability. Moreover, phosphorylation-insensitive T200A and T280A mutant Nanog had a dominant-negative function to inhibit endogenous Nanog transcriptional activity. Inactivation of Nanog was due to impaired homodimerization, DNA binding, promoter occupancy, and p300, a transcriptional co-activator, recruitment resulting in a defect in target gene promoter activation. Ectopic expression of phosphorylation-insensitive T200A or T280A mutant Nanog reduced cell proliferation, colony formation, invasion, migration, and the cancer initiating cell population in head and neck squamous cell carcinoma (HNSCC) cells. The in vivo cancer initiating ability was severely compromised in HNSCC cells expressing phosphorylation-insensitive T200A or T280A mutant Nanog; 87.5% (14/16), 12.5% (1/8), and 0% (0/8) for control, T200A, and T280A, respectively. Nanog occupied the Bmi1 promoter to directly transactivate and regulate Bmi1. Genetic ablation and rescue experiments demonstrated that Bmi1 is a critical downstream signaling node for the pleiotropic, pro-oncogenic effects of Nanog. Taken together, our study revealed, for the first time, that post-translational phosphorylation of Nanog is essential to regulate Bmi1 and promote tumorigenesis. PMID:23708658

BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.

Science.gov (United States)

Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili

2017-12-01

Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.

p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells

Science.gov (United States)

Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah

2015-01-01

Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797

Calmodulin promotes matrix metalloproteinase 9 production and cell migration by inhibiting the ubiquitination and degradation of TBC1D3 oncoprotein in human breast cancer cells.

Science.gov (United States)

Zhao, Huzi; Zhang, Lina; Zhang, Yongchen; Zhao, Lei; Wan, Qing; Wang, Bei; Bu, Xiaodong; Wan, Meiling; Shen, Chuanlu

2017-05-30

The hominoid oncoprotein TBC1D3 enhances growth factor (GF) signaling and GF signaling, conversely, induces the ubiquitination and subsequent degradation of TBC1D3. However, little is known regarding the regulation of this degradation, and the role of TBC1D3 in the progression of tumors has also not been defined. In the present study, we demonstrated that calmodulin (CaM), a ubiquitous cellular calcium sensor, specifically interacted with TBC1D3 in a Ca2+-dependent manner and inhibited GF signaling-induced ubiquitination and degradation of the oncoprotein in both cytoplasm and nucleus of human breast cancer cells. The CaM-interacting site of TBC1D3 was mapped to amino acids 157~171, which comprises two 1-14 hydrophobic motifs and one lysine residue (K166). Deletion of these motifs was shown to abolish interaction between TBC1D3 and CaM. Surprisingly, this deletion mutation caused inability of GF signaling to induce the ubiquitination and subsequent degradation of TBC1D3. In agreement with this, we identified lysine residue 166 within the CaM-interacting motifs of TBC1D3 as the actual site for the GF signaling-induced ubiquitination using mutational analysis. Point mutation of this lysine residue exhibited the same effect on TBC1D3 as the deletion mutant, suggesting that CaM inhibits GF signaling-induced degradation of TBC1D3 by occluding its ubiquitination at K166. Notably, we found that TBC1D3 promoted the expression and activation of MMP-9 and the migration of MCF-7 cells. Furthermore, interaction with CaM considerably enhanced such effect of TBC1D3. Taken together, our work reveals a novel model by which CaM promotes cell migration through inhibiting the ubiquitination and degradation of TBC1D3.

Association Between BMI and Recurrence of Primary Spontaneous Pneumothorax.

Science.gov (United States)

Tan, Juntao; Yang, Yang; Zhong, Jianhong; Zuo, Chuantian; Tang, Huamin; Zhao, Huimin; Zeng, Guang; Zhang, Jianfeng; Guo, Jianji; Yang, Nuo

2017-05-01

Whether body mass index (BMI) is a significant risk factor for recurrence of primary spontaneous pneumothorax (PSP) remains controversial. The purpose of this study was to examine whether BMI and other factors are linked to risk of PSP recurrence. A consecutive cohort of 273 patients was retrospectively evaluated. Patients were divided into those who experienced recurrence (n = 81) and those who did not (n = 192), as well as into those who had low BMI (n = 75) and those who had normal or elevated BMI (n = 198). The two pairs of groups were compared in terms of baseline data, and Cox proportional hazards modeling was used to identify predictors of PSP recurrence. Rates of recurrence among all 273 patients were 20.9% at 1 year, 23.8% at 2 years, and 28.7% at 5 years. Univariate analysis identified the following significant predictors of PSP recurrence: height, weight, BMI, size of pneumothorax, and treatment modality. Multivariate analyses identified several risk factors for PSP recurrence: low BMI, pneumothorax size ≥50%, and non-surgical treatment. Kaplan-Meier survival analysis indicated that patients with low BMI showed significantly lower recurrence-free survival than patients with normal or elevated BMI (P pneumothorax size ≥50%, and non-surgical treatment were risk factors for PSP recurrence in our cohort. Low BMI may be a clinically useful predictor of PSP recurrence.

Bmi1 regulates murine intestinal stem cell proliferation and self-renewal downstream of Notch.

Science.gov (United States)

López-Arribillaga, Erika; Rodilla, Verónica; Pellegrinet, Luca; Guiu, Jordi; Iglesias, Mar; Roman, Angel Carlos; Gutarra, Susana; González, Susana; Muñoz-Cánoves, Pura; Fernández-Salguero, Pedro; Radtke, Freddy; Bigas, Anna; Espinosa, Lluís

2015-01-01

Genetic data indicate that abrogation of Notch-Rbpj or Wnt-β-catenin pathways results in the loss of the intestinal stem cells (ISCs). However, whether the effect of Notch is direct or due to the aberrant differentiation of the transit-amplifying cells into post-mitotic goblet cells is unknown. To address this issue, we have generated composite tamoxifen-inducible intestine-specific genetic mouse models and analyzed the expression of intestinal differentiation markers. Importantly, we found that activation of β-catenin partially rescues the differentiation phenotype of Rbpj deletion mutants, but not the loss of the ISC compartment. Moreover, we identified Bmi1, which is expressed in the ISC and progenitor compartments, as a gene that is co-regulated by Notch and β-catenin. Loss of Bmi1 resulted in reduced proliferation in the ISC compartment accompanied by p16(INK4a) and p19(ARF) (splice variants of Cdkn2a) accumulation, and increased differentiation to the post-mitotic goblet cell lineage that partially mimics Notch loss-of-function defects. Finally, we provide evidence that Bmi1 contributes to ISC self-renewal. © 2015. Published by The Company of Biologists Ltd.

Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.

Science.gov (United States)

Lu, You-Wei; Li, Jin; Guo, Wei-Jian

2010-11-08

The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Science.gov (United States)

Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

2015-01-01

BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

The HPV16 E7 oncoprotein increases the expression of Oct3/4 and stemness-related genes and augments cell self-renewal

Energy Technology Data Exchange (ETDEWEB)

Organista-Nava, Jorge; Gómez-Gómez, Yazmín [Programa de Doctorado en Ciencias Biomédicas, Instituto de Fisiología Celular (IFC), Universidad Nacional Autónoma de México (UNAM), Ciudad de México 04510, México (Mexico); Departamento de Genética y Biología Molecular, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN), Ciudad de México 07360, México (Mexico); Ocadiz-Delgado, Rodolfo; García-Villa, Enrique [Departamento de Genética y Biología Molecular, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN), Ciudad de México 07360, México (Mexico); Bonilla-Delgado, José [Unidad de Investigación, Hospital Juárez de México, Ciudad de México 07760, México (Mexico); Lagunas-Martínez, Alfredo [División de Biología Molecular de Patógenos, CISEI, Instituto Nacional de Salud Pública, Cuernavaca, Morelos, México (Mexico); and others

2016-12-15

Oct3/4 is a transcription factor involved in maintenance of the pluripotency and self-renewal of stem cells. The E7 oncoprotein and 17β-estradiol (E{sub 2}) are key factors in cervical carcinogenesis. In the present study, we aimed to investigate the effect of the HPV16 E7 oncoprotein and E{sub 2} on the expression pattern of Oct3/4, Sox2, Nanog and Fgf4. We also determined whether the E7 oncoprotein is associated with cell self-renewal. The results showed that Oct3/4, Sox2, Nanog and Fgf4 were upregulated by the E7 oncoprotein in vivo and in vitro and implicate E{sub 2} in the upregulation of these factors in vivo. We also demonstrated that E7 is involved in cell self-renewal, suggesting that the HPV16 E7 oncoprotein upregulates Oct3/4, Sox2, Nanog and Fgf4 expression to maintain the self-renewal capacity of cancer stem cells. -- Graphical abstract: The HPV16 E7 oncoprotein and 17β-estradiol are involved in the upregulation of Oct3/4, Sox2, Nanog and Fgf4 expression to maintain the self-renewal ability of cancer stem cells in cervical cancer. - Highlights: •The HPV16 E7 oncoprotein enhances cellular proliferation and dedifferentiation. •The E7 oncoprotein induces stemness-related genes expression in vivo and in vitro. •The 17β-estradiol induces stemness-related genes expression in vivo. •The HPV16 E7 oncoprotein is involved in the cell self-renewal of cancer cells.

The HPV16 E7 oncoprotein increases the expression of Oct3/4 and stemness-related genes and augments cell self-renewal

International Nuclear Information System (INIS)

Organista-Nava, Jorge; Gómez-Gómez, Yazmín; Ocadiz-Delgado, Rodolfo; García-Villa, Enrique; Bonilla-Delgado, José; Lagunas-Martínez, Alfredo

2016-01-01

Oct3/4 is a transcription factor involved in maintenance of the pluripotency and self-renewal of stem cells. The E7 oncoprotein and 17β-estradiol (E 2 ) are key factors in cervical carcinogenesis. In the present study, we aimed to investigate the effect of the HPV16 E7 oncoprotein and E 2 on the expression pattern of Oct3/4, Sox2, Nanog and Fgf4. We also determined whether the E7 oncoprotein is associated with cell self-renewal. The results showed that Oct3/4, Sox2, Nanog and Fgf4 were upregulated by the E7 oncoprotein in vivo and in vitro and implicate E 2 in the upregulation of these factors in vivo. We also demonstrated that E7 is involved in cell self-renewal, suggesting that the HPV16 E7 oncoprotein upregulates Oct3/4, Sox2, Nanog and Fgf4 expression to maintain the self-renewal capacity of cancer stem cells. -- Graphical abstract: The HPV16 E7 oncoprotein and 17β-estradiol are involved in the upregulation of Oct3/4, Sox2, Nanog and Fgf4 expression to maintain the self-renewal ability of cancer stem cells in cervical cancer. - Highlights: •The HPV16 E7 oncoprotein enhances cellular proliferation and dedifferentiation. •The E7 oncoprotein induces stemness-related genes expression in vivo and in vitro. •The 17β-estradiol induces stemness-related genes expression in vivo. •The HPV16 E7 oncoprotein is involved in the cell self-renewal of cancer cells.

BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

Directory of Open Access Journals (Sweden)

Mehdi Hayat Shahi

Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

Attenuation of doxorubicin-induced cardiotoxicity by esculetin through modulation of Bmi-1 expression.

Science.gov (United States)

Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan

2017-09-01

The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.

The transcription elongation factor ELL2 is specifically upregulated in HTLV-1-infected T-cells and is dependent on the viral oncoprotein Tax.

Science.gov (United States)

Mann, Melanie C; Strobel, Sarah; Fleckenstein, Bernhard; Kress, Andrea K

2014-09-01

The oncoprotein Tax of human T-cell leukemia virus type 1 (HTLV-1) is a potent transactivator of viral and cellular transcription. Here, we identified ELL2 as the sole transcription elongation factor to be specifically upregulated in HTLV-1-/Tax-transformed T-cells. Tax contributes to regulation of ELL2, since transient transfection of Tax increases ELL2 mRNA, Tax transactivates the ELL2 promoter, and repression of Tax results in decrease of ELL2 in transformed T-lymphocytes. However, we also measured upregulation of ELL2 in HTLV-1-transformed cells exhibiting undetectable amounts of Tax, suggesting that ELL2 can still be maintained independent of continuous Tax expression. We further show that Tax and ELL2 synergistically activate the HTLV-1 promoter, indicating that ELL2 cooperates with Tax in viral transactivation. This is supported by our findings that Tax and ELL2 accumulate in nuclear fractions and that they co-precipitate upon co-expression in transiently-transfected cells. Thus, upregulation of ELL2 could contribute to HTLV-1 gene regulation. Copyright © 2014 Elsevier Inc. All rights reserved.

Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.

Science.gov (United States)

Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori

2017-04-01

We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Predictors of BMI Vary along the BMI Range of German Adults – Results of the German National Nutrition Survey II

Science.gov (United States)

Moon, Kilson; Krems, Carolin; Heuer, Thorsten; Roth, Alexander; Hoffmann, Ingrid

2017-01-01

Objective The objective of the study was to identify predictors of BMI in German adults by considering the BMI distribution and to determine whether the association between BMI and its predictors varies along the BMI distribution. Methods The sample included 9,214 adults aged 18–80 years from the German National Nutrition Survey II (NVS II). Quantile regression analyses were conducted to examine the association between BMI and the following predictors: age, sports activities, socio-economic status (SES), healthy eating index-NVS II (HEI-NVS II), dietary knowledge, sleeping duration and energy intake as well as status of smoking, partner relationship and self-reported health. Results Age, SES, self-reported health status, sports activities and energy intake were the strongest predictors of BMI. The important outcome of this study is that the association between BMI and its predictors varies along the BMI distribution. Especially, energy intake, health status and SES were marginally associated with BMI in normal-weight subjects; this relationships became stronger in the range of overweight, and were strongest in the range of obesity. Conclusions Predictors of BMI and the strength of these associations vary across the BMI distribution in German adults. Consequently, to identify predictors of BMI, the entire BMI distribution should be considered. PMID:28219069

About BMI for Adults

Science.gov (United States)

... between the BMI and body fatness is fairly strong 1,2,3,7 , but even if 2 people have the same BMI, their level of body fatness may differ 12 . In general, At the same BMI, women tend to have more body fat than men. At the same BMI, Blacks have less body ...

miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes

Energy Technology Data Exchange (ETDEWEB)

McKenna, Declan J., E-mail: dj.mckenna@ulster.ac.uk [Biomedical Sciences Research Institute, University of Ulster, Coleraine, Co. Derry BT52 1SA (United Kingdom); Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); Patel, Daksha, E-mail: d.patel@qub.ac.uk [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); McCance, Dennis J., E-mail: d.mccance@qub.ac.uk [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom)

2014-01-05

A screen of microRNA (miRNA) expression following differentiation in human foreskin keratinocytes (HFKs) identified changes in several miRNAs, including miR-24 and miR-205. We investigated how expression of Human Papilloma Virus Type-16 (HPV16) onco-proteins E6 and E7 affected expression of miR-24 and miR-205 during proliferation and differentiation of HFKs. We show that the induction of both miR-24 and miR-205 observed during differentiation of HFKs is lost in HFKs expressing E6 and E7. We demonstrate that the effect on miR-205 is due to E7 activity, as miR-205 expression is dependent on pRb expression. Finally, we provide evidence that miR-24 effects in the cell may be due to targeting of cyclin dependent kinase inhibitor p27. In summary, these results indicate that expression of both miR-24 and miR-205 are impacted by E6 and/or E7 expression, which may be one mechanism by which HPV onco-proteins can disrupt the balance between proliferation and differentiation in keratinocytes. - Highlights: • miR-24 and miR-205 are induced during keratinocyte differentiation. • This induction is lost in keratinocytes expressing HPV onco-proteins E6 and E7. • miR-205 is dependent upon pRb expression. • miR-24 targets p27 in cycling keratinocytes.

miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes

International Nuclear Information System (INIS)

McKenna, Declan J.; Patel, Daksha; McCance, Dennis J.

2014-01-01

A screen of microRNA (miRNA) expression following differentiation in human foreskin keratinocytes (HFKs) identified changes in several miRNAs, including miR-24 and miR-205. We investigated how expression of Human Papilloma Virus Type-16 (HPV16) onco-proteins E6 and E7 affected expression of miR-24 and miR-205 during proliferation and differentiation of HFKs. We show that the induction of both miR-24 and miR-205 observed during differentiation of HFKs is lost in HFKs expressing E6 and E7. We demonstrate that the effect on miR-205 is due to E7 activity, as miR-205 expression is dependent on pRb expression. Finally, we provide evidence that miR-24 effects in the cell may be due to targeting of cyclin dependent kinase inhibitor p27. In summary, these results indicate that expression of both miR-24 and miR-205 are impacted by E6 and/or E7 expression, which may be one mechanism by which HPV onco-proteins can disrupt the balance between proliferation and differentiation in keratinocytes. - Highlights: • miR-24 and miR-205 are induced during keratinocyte differentiation. • This induction is lost in keratinocytes expressing HPV onco-proteins E6 and E7. • miR-205 is dependent upon pRb expression. • miR-24 targets p27 in cycling keratinocytes

Human Papillomavirus Type 16 E6 and E7 Oncoproteins Act Synergistically to Cause Head and Neck Cancer in Mice

Science.gov (United States)

Jabbar, Sean; Strati, Katerina; Shin, Myeong Kyun; Pitot, Henry C.; Lambert, Paul F.

2010-01-01

High-risk human papillomaviruses (HPVs) contribute to cervical and other anogenital cancers, and they are also linked etiologically to a subset of head and neck squamous cell carcinomas (HNSCC). We previously established a model for HPV-associated HNSCC in which we treated transgenic mice expressing the papillomaviral oncoproteins with the chemical carcinogen 4-nitroquinoline-1-oxide (4-NQO). We found that the HPV-16 E7 oncoprotein was highly potent in causing HNSCC, and its dominance masked any potential oncogenic contribution of E6, a second papillomaviral oncoprotein commonly expressed in human cancers. In the current study, we shortened the duration of treatment with 4-NQO to reduce the incidence of cancers and discovered a striking synergy between E6 and E7 in causing HNSCC. Comparing the oncogenic properties of wild-type versus mutant E6 genes in this model for HNSCC uncovered a role for some but not other cellular targets of E6 previously shown to contribute to cervical cancer. PMID:20797753

The oncoprotein HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote the proliferation of breast cancer cells

International Nuclear Information System (INIS)

Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli; Zhang, Xiaodong; Ye, Lihong

2013-01-01

Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells

The oncoprotein HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote the proliferation of breast cancer cells

Energy Technology Data Exchange (ETDEWEB)

Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China); Zhang, Xiaodong, E-mail: zhangxd@nankai.edu.cn [Department of Cancer Research, Institute for Molecular Biology, College of Life Sciences, Nankai University, Tianjin 300071 (China); Ye, Lihong, E-mail: yelihong@nankai.edu.cn [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China)

2013-05-03

Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells.

Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance

Science.gov (United States)

Jin, Jianliang; Lv, Xianhui; Chen, Lulu; Zhang, Wei; Li, Jinbo; Wang, Qian; Wang, Rong; Lu, Xiang; Miao, Dengshun

2014-01-01

To determine whether Bmi-1 deficiency could lead to renal tubulointerstitial injury by mitochondrial dysfunction and increased oxidative stress in the kidney, 3-week-old Bmi-1-/- mice were treated with the antioxidant N-acetylcysteine (NAC, 1 mg mL−1) in their drinking water, or pyrro-quinoline quinone (PQQ, 4 mg kg−1 diet) in their diet for 2 weeks, and their renal phenotypes were compared with vehicle-treated Bmi1-/- and wild-type mice. Bmi-1 was knocked down in human renal proximal tubular epithelial (HK2) cells which were treated with 1 mm NAC for 72 or 96 h, and their phenotypes were compared with control cells. Five-week-old vehicle-treated Bmi-1-/- mice displayed renal interstitial fibrosis, tubular atrophy, and severe renal function impairment with decreased renal cell proliferation, increased renal cell apoptosis and senescence, and inflammatory cell infiltration. Impaired mitochondrial structure, decreased mitochondrial numbers, and increased oxidative stress occurred in Bmi-1-/- mice; subsequently, this caused DNA damage, the activation of TGF-β1/Smad signaling, and the imbalance between extracellular matrix synthesis and degradation. Oxidative stress-induced epithelial-to-mesenchymal transition of renal tubular epithelial cells was enhanced in Bmi-1 knocked down HK2 cells. All phenotypic alterations caused by Bmi-1 deficiency were ameliorated by antioxidant treatment. These findings indicate that Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance and will be a novel therapeutic target for preventing renal tubulointerstitial injury. PMID:24915841

Modulation of DNA methylation by human papillomavirus E6 and E7 oncoproteins in cervical cancer

Science.gov (United States)

Sen, Prakriti; Ganguly, Pooja; Ganguly, Niladri

2018-01-01

Human papillomaviruses (HPVs) are double stranded circular DNA viruses that infect cutaneous and mucosal epithelial cells. Almost 99% of cervical cancer has a HPV infection. The early oncoproteins E6 and E7 are important in this cellular transformation process. Epigenetic mechanisms have long been known to result in decisive alterations in DNA, leading to alterations in DNA-protein interactions, alterations in chromatin structure and compaction and significant alterations in gene expression. The enzymes responsible for these epigenetic modifications are DNA methyl transferases (DNMTs), histone acetylases and deacetylases. Epigenetics has an important role in cancer development by modifying the cellular micro environment. In this review, the authors discuss the role of HPV oncoproteins E6 and E7 in modulating the epigenetic mechanisms inside the host cell. The oncoproteins induce the expression of DNMTs which lead to aberrant DNA methylations and disruption of the normal epigenetic processes. The E7 oncoprotein may additionally directly bind and induce methyl transferase activity of the enzyme. These modulations lead to altered gene expression levels, particularly the genes involved in apoptosis, cell cycle and cell adhesion. In addition, the present review discusses how epigenetic mechanisms may be targeted for possible therapeutic interventions for HPV mediated cervical cancer. PMID:29285184

MicroRNA-128 suppresses paclitaxel-resistant lung cancer by inhibiting MUC1-C and BMI-1 in cancer stem cells.

Science.gov (United States)

Koh, Hyebin; Park, Hyeri; Chandimali, Nisansala; Huynh, Do Luong; Zhang, Jiao Jiao; Ghosh, Mrinmoy; Gera, Meeta; Kim, Nameun; Bak, Yesol; Yoon, Do-Young; Park, Yang Ho; Kwon, Taeho; Jeong, Dong Kee

2017-12-15

The existence of cancer stem cells (CSCs) is the main reason for failure of cancer treatment caused by drug resistance. Therefore, eradicating cancers by targeting CSCs remains a significant challenge. In the present study, because of the important role of BMI-1 proto-oncogene, polycomb ring finger (BMI-1) and C-terminal Mucin1 (MUC1-C) in tumor growth and maintenance of CSCs, we aimed to confirm that microRNA miR-128, as an inhibitor of BMI-1 and MUC1-C, could effectively suppress paclitaxel (PTX)-resistant lung cancer stem cells. We showed that CSCs have significantly higher expression levels of BMI-1, MUC1-C, stemness proteins, signaling factors, and higher malignancy compared with normal tumor cells. After transfection with miR-128, the BMI-1 and MUC1-C levels in CSCs were suppressed. When miR-128 was stably expressed in PTX-resistant lung cancer stem cells, the cells showed decreased proliferation, metastasis, self-renewal, migration, invasive ability, clonogenicity, and tumorigenicity in vitro and in vivo and increased apoptosis compared with miR-NC (negative control) CSCs. Furthermore, miR-128 effectively decreased the levels of β-catenin and intracellular signaling pathway-related factors in CSCs. MiR-128 also decreased the luciferase activity of MUC1 reporter constructs and reduced the levels of transmembrane MUC1-C and BMI-1. These results suggested miR-128 as an attractive therapeutic strategy for PTX-resistant lung cancer via inhibition of BMI-1 and MUC1-C.

BMI-1 suppression increases the radiosensitivity of oesophageal carcinoma via the PI3K/Akt signaling pathway.

Science.gov (United States)

Yang, Xing-Xiao; Ma, Ming; Sang, Mei-Xiang; Zhang, Xue-Yuan; Liu, Zhi-Kun; Song, Heng; Zhu, Shu-Chai

2018-02-01

B-cell‑specific Moloney murine leukaemia virus integration site-1 (BMI-1) contributes to the growth of tumour cells post-irradiation (IR). The aim of the present study was to characterize the effects of BMI-1 on cell viability, radiosensitivity and its mechanisms of action in oesophageal squamous cell cancer (ESCC). Western blotting and immunohistochemistry were employed to evaluate the protein expression of BMI-1 in ESCC cells and specimens, respectively. Additionally, the protein expression levels of BMI-1, H2AK119ub and γH2AX in ESCC cells were detected following different doses of IR and at different times after IR. The protein expression levels of MDC1 and 53BP1 were also measured. Flow cytometry and MTT assays were used to determine cell cycle progression, apoptosis and cell viability. The phosphatidylinositol 3-kinase inhibitor LY294002 and the agonist IGF-1 were employed to suppress or induce the phosphorylation of Akt to determine whether BMI-1 induces radioresistance in ESCC cells via activation of the PI3K/Akt pathway. The expression of BMI-1 was higher in ESCC tissues and cells compared with that in normal oesophageal tissues and cells. In addition, BMI-1 was positively related to tumour size and lymph node metastases and negatively to the overall survival of ESCC patients. IR induced the expression of BMI-1, H2AK119ub and γH2AX in a dose- and time-dependent manner. BMI-1 knockdown lowered the expression of γH2AX, MDC1 and 53BP1, suppressed cell viability and increased radiosensitivity. G2/M phase arrest was eliminated; this was followed by an increased proportion of cells entering the G0/G1 phase after IR and BMI-1 knockdown via the upregulation of P16 and downregulation of cyclin D2 and cyclin-dependent kinase-4. Moreover, BMI-1 knockdown increased cell apoptosis, downregulated MCL-1 and p-Akt and upregulated Bax. Additionally, the inhibitory effect of the downregulation of p-Akt by LY294002 on tumour cell viability was identical to that of

The HPV16 E7 oncoprotein increases the expression of Oct3/4 and stemness-related genes and augments cell self-renewal.

Science.gov (United States)

Organista-Nava, Jorge; Gómez-Gómez, Yazmín; Ocadiz-Delgado, Rodolfo; García-Villa, Enrique; Bonilla-Delgado, José; Lagunas-Martínez, Alfredo; Tapia, Jesús Santa-Olalla; Lambert, Paul F; García-Carrancá, Alejandro; Gariglio, Patricio

2016-12-01

Oct3/4 is a transcription factor involved in maintenance of the pluripotency and self-renewal of stem cells. The E7 oncoprotein and 17β-estradiol (E 2 ) are key factors in cervical carcinogenesis. In the present study, we aimed to investigate the effect of the HPV16 E7 oncoprotein and E 2 on the expression pattern of Oct3/4, Sox2, Nanog and Fgf4. We also determined whether the E7 oncoprotein is associated with cell self-renewal. The results showed that Oct3/4, Sox2, Nanog and Fgf4 were upregulated by the E7 oncoprotein in vivo and in vitro and implicate E 2 in the upregulation of these factors in vivo. We also demonstrated that E7 is involved in cell self-renewal, suggesting that the HPV16 E7 oncoprotein upregulates Oct3/4, Sox2, Nanog and Fgf4 expression to maintain the self-renewal capacity of cancer stem cells. Copyright © 2016 Elsevier Inc. All rights reserved.

Polycomb complex protein BMI-1 promotes invasion and metastasis of pancreatic cancer stem cells by activating PI3K/AKT signaling, an ex vivo, in vitro, and in vivo study

Science.gov (United States)

Wang, Min-Cong; Jiao, Min; Wu, Tao; Jing, Li; Cui, Jie; Guo, Hui; Tian, Tao; Ruan, Zhi-ping; Wei, Yong-Chang; Jiang, Li-Li; Sun, Hai-Feng; Huang, Lan-Xuan; Nan, Ke-Jun; Li, Chun-Li

2016-01-01

Cancer stem cell theory indicates cancer stem cells are the key to promote tumor invasion and metastasis. Studies showed that BMI-1 could promote self-renew, differentiation and tumor formation of CSCs and invasion/metastasis of human cancer. However, whether BMI-1 could regulate invasion and metastasis ability of CSCs is still unclear. In our study, we found that up-regulated expression of BMI-1 was associated with tumor invasion, metastasis and poor survival of pancreatic cancer patients. CD133+ cells were obtained by using magnetic cell sorting and identified of CSCs properties such as self-renew, multi-differentiation and tumor formation ability. Then, we found that BMI-1 expression was up-regulated in pancreatic cancer stem cells. Knockdown of BMI-1 expression attenuated invasion ability of pancreatic cancer stem cells in Transwell system and liver metastasis capacity in nude mice which were injected CSCs through the caudal vein. We are the first to reveal that BMI-1 could promote invasion and metastasis ability of pancreatic cancer stem cells. Finally, we identified that BMI-1 expression activating PI3K/AKT singing pathway by negative regulating PTEN was the main mechanism of promoting invasion and metastasis ability of pancreatic CSCs. In summary, our findings indicate that BMI-1 could be used as the therapeutic target to inhibiting CSCs-mediated pancreatic cancer metastasis. PMID:26840020

Gene-diet interaction effects on BMI levels in the Singapore Chinese population.

Science.gov (United States)

Chang, Xuling; Dorajoo, Rajkumar; Sun, Ye; Han, Yi; Wang, Ling; Khor, Chiea-Chuen; Sim, Xueling; Tai, E-Shyong; Liu, Jianjun; Yuan, Jian-Min; Koh, Woon-Puay; van Dam, Rob M; Friedlander, Yechiel; Heng, Chew-Kiat

2018-02-24

Recent genome-wide association studies (GWAS) have identified 97 body-mass index (BMI) associated loci. We aimed to evaluate if dietary intake modifies BMI associations at these loci in the Singapore Chinese population. We utilized GWAS information from six data subsets from two adult Chinese population (N = 7817). Seventy-eight genotyped or imputed index BMI single nucleotide polymorphisms (SNPs) that passed quality control procedures were available in all datasets. Alternative Healthy Eating Index (AHEI)-2010 score and ten nutrient variables were evaluated. Linear regression analyses between z score transformed BMI (Z-BMI) and dietary factors were performed. Interaction analyses were performed by introducing the interaction term (diet x SNP) in the same regression model. Analysis was carried out in each cohort individually and subsequently meta-analyzed using the inverse-variance weighted method. Analyses were also evaluated with a weighted gene-risk score (wGRS) contructed by BMI index SNPs from recent large-scale GWAS studies. Nominal associations between Z-BMI and AHEI-2010 and some dietary factors were identified (P = 0.047-0.010). The BMI wGRS was robustly associated with Z-BMI (P = 1.55 × 10 - 15 ) but not with any dietary variables. Dietary variables did not significantly interact with the wGRS to modify BMI associations. When interaction analyses were repeated using individual SNPs, a significant association between cholesterol intake and rs4740619 (CCDC171) was identified (β = 0.077, adjP interaction  = 0.043). The CCDC171 gene locus may interact with cholesterol intake to increase BMI in the Singaporean Chinese population, however most known obesity risk loci were not associated with dietary intake and did not interact with diet to modify BMI levels.

BMI trajectory groups in veterans of the Iraq and Afghanistan wars.

Science.gov (United States)

Rosenberger, Patricia H; Ning, Yuming; Brandt, Cynthia; Allore, Heather; Haskell, Sally

2011-09-01

The study sought to determine BMI trajectories in Iraq/Afghanistan veterans over 6 years and to examine sociodemographic factors associated with BMI trajectory membership. Our study sample included 16,656 veterans post-deployment and entering the Veteran Healthcare Administration (VHA) healthcare system. We used national VHA administrative sociodemographic data, tracked veteran BMI for 6 years, and used trajectory modeling to identify BMI trajectories and sociodemographic characteristics associated with trajectory membership. Five trajectory groups determined in the full sample were primarily differentiated by their post-deployment initial BMI: "healthy" (14.1%), "overweight" (36.3%), "borderline obese" (27.9%), "obese" (15.7%), and "severely obese" (6.0). Being female, younger, and white were associated with lower initial BMI trajectory group membership (p'seducation and white female Veterans were associated with the lowest initial BMI group (p'sEducation level and racial status are differentially related to BMI trajectory by gender. Published by Elsevier Inc.

Overexpression of microRNA-132 enhances the radiosensitivity of cervical cancer cells by down-regulating Bmi-1.

Science.gov (United States)

Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan

2017-10-06

We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.

The relationship between BMI and striatal dopamine transporter with 99Tcm-TRODAT-1 brain SPECT

International Nuclear Information System (INIS)

Lu Rongbin; Liu Xingdang; Liu Congjin; Wang Yuankai; Zhang Guangming; Tang Jie; Chen Zhengqing; Luo Shineng

2011-01-01

Objective: To assess the relationship between the BMI and the brain DAT, and the influence of BMI on the brain SPECT imaging with 99 Tc m -TRODAT-1. Methods: MRI and 99 Tc m -TRODAT-1SPECT imaging were performed in 31 healthy volunteers (16 males and 15 females), and then the three-dimensional reconstruction of SPECT images were completed. Based on the MRI images, right striatum (RST) and the left striatum (LST) were drawn as ROI on the 4 most clearly consecutive transverse slices.The cerebellum (CB) was taken as the background reference area and the corresponding uptake ratios of ST/CB, LST/CB and RST/CB were calculated. The Pearson correlation tests for radio-uptake ratios (ST/CB, LST/CB, RST/CB), BMI and age were performed, Then multiple linear regression analysis using ST/CB as dependent variable and BMI and age as independent variables was performed. SPSS 15.0 was used in data analysis. Results: The ST imaging was symmetrical. The radioactivity was higher in the ST front area than that of the back area. The average uptake ratios of ST/CB, LST/CB, RST/CB were 1.71±0.16,1.70±0.16 and 1.72±0.17 respectively, in which the three ratios of the female were 1.74±0.18, 1.71±0.19 and 1.76±0.19 respectively and those of the male were 1.68±0.14, 1.68±0.13 and 1.69±0.15 respectively. ST/CB, LST/CB and RST/CB were negatively correlated with patients' BMI (r = -0.53, -0.57, -0.47, all P<0.05). The ST/CB was negatively correlated with patients' age (r=-0.39, P=0.03). The multiple linear regression analysis showed that the BMI was significant independent variable (β=-0.53, t= -3.36, P=0.002). Conclusions: The ST DAT level may decrease as patients' BMI and age increase. Females' DAT level is slightly higher than males'. For ST DAT imaging, age, gender and BMI should be all taken into consideration. (authors)

Smoking and Socio-demographic correlates of BMI

Directory of Open Access Journals (Sweden)

Peizhi Wang

2016-06-01

Full Text Available Abstract Background The aim of the current study was to examine the associations between Body Mass Index (BMI and socio-demographic factors and to examine the relationship between BMI, smoking status and ethnicity. Methods The Singapore Mental Health Study (SMHS surveyed Singapore Residents (Singapore Citizens and Permanent Residents aged 18 years old and above. BMI was calculated using height and weight which were self-reported by respondents. Socio-demographic characteristics and smoking status were recorded in a standardized data collection form. Results Six thousand and six hundred sixteen respondents completed the study (response rate of 75.9 % which constituted a representative sample of the adult resident population in Singapore. Ethnicity, gender and education status were associated with obesity. There was an interaction effect between ethnicity smoking status, and BMI. Indian and Malay smokers were less likely to be obese compared to Chinese smokers. The relationship between ethnicity and BMI was thus reversed when smoking was taken into account. Conclusions The study identified certain subgroups and risk factors that are associated with obesity. There is a need for further research to explore and identify genetic, metabolic and ethnic differences that underlie the interaction between ethnicity and smoking status which affects BMI.

Bmi-1 promotes invasion and metastasis, and its elevated expression is correlated with an advanced stage of breast cancer

Science.gov (United States)

2011-01-01

Background B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) acts as an oncogene in various tumors, and its overexpression correlates with a poor outcome in several human cancers. Ectopic expression of Bmi-1 can induce epithelial-mesenchymal transition (EMT) and enhance the motility and invasiveness of human nasopharyngeal epithelial cells (NPECs), whereas silencing endogenous Bmi-1 expression can reverse EMT and reduce the metastatic potential of nasopharyngeal cancer cells (NPCs). Mouse xenograft studies indicate that coexpression of Bmi-1 and H-Ras in breast cancer cells can induce an aggressive and metastatic phenotype with an unusual occurrence of brain metastasis; although, Bmi-1 overexpression did not result in oncogenic transformation of MCF-10A cells. However, the underlying molecular mechanism of Bmi-1-mediated progression and the metastasis of breast cancer are not fully elucidated at this time. Results Bmi-1 expression is more pronouncedly increased in primary cancer tissues compared to matched adjacent non-cancerous tissues. High Bmi-1 expression is correlated with advanced clinicopathologic classifications (T, N, and M) and clinical stages. Furthermore, a high level of Bmi-1 indicates an unfavorable overall survival and serves as a high risk marker for breast cancer. In addition, inverse transcriptional expression levels of Bmi-1 and E-cadherin are detected between the primary cancer tissues and the matched adjacent non-cancerous tissues. Higher Bmi-1 levels are found in the cancer tissue, whereas the paired adjacent non-cancer tissue shows higher E-cadherin levels. Overexpression of Bmi-1 increases the motility and invasive properties of immortalized human mammary epithelial cells, which is concurrent with the increased expression of mesenchymal markers, the decreased expression of epithelial markers, the stabilization of Snail and the dysregulation of the Akt/GSK3β pathway. Consistent with these observations, the repression of Bmi

Induction of neural stem cell-like cells (NSCLCs) from mouse astrocytes by Bmi1

International Nuclear Information System (INIS)

Moon, Jai-Hee; Yoon, Byung Sun; Kim, Bona; Park, Gyuman; Jung, Hye-Youn; Maeng, Isaac; Jun, Eun Kyoung; Yoo, Seung Jun; Kim, Aeree; Oh, Sejong; Whang, Kwang Youn; Kim, Hyunggee; Kim, Dong-Wook; Kim, Ki Dong; You, Seungkwon

2008-01-01

Recently, Bmi1 was shown to control the proliferation and self-renewal of neural stem cells (NSCs). In this study, we demonstrated the induction of NSC-like cells (NSCLCs) from mouse astrocytes by Bmi1 under NSC culture conditions. These NSCLCs exhibited the morphology and growth properties of NSCs, and expressed NSC marker genes, including nestin, CD133, and Sox2. In vitro differentiation of NSCLCs resulted in differentiated cell populations containing astrocytes, neurons, and oligodendrocytes. Following treatment with histone deacetylase inhibitors (trichostatin A and valproic acid), the potential of NSCLCs for proliferation, dedifferentiation, and self-renewal was significantly inhibited. Our data indicate that multipotent NSCLCs can be generated directly from astrocytes by the addition of Bmi1

Co-Expression of Bmi-1 and Podoplanin Predicts Overall Survival in Patients With Squamous Cell Carcinoma of the Head and Neck Treated With Radio(chemo)therapy

International Nuclear Information System (INIS)

Vormittag, Laurenz; Thurnher, Dietmar; Geleff, Silvana; Pammer, Johannes; Heiduschka, Gregor; Brunner, Markus; Grasl, Matthaeus Ch.; Erovic, Boban M.

2009-01-01

Purpose: This study was conducted to determine the expression of Bmi-1 and podoplanin in healthy oral mucosa and in untreated tumor tissues samples of patients with squamous cell carcinomas of the head and neck. All patients were treated by primary radio(chemo)therapy. Methods and Materials: The expression of Bmi-1 and podoplanin was immunohistochemically evaluated in 12 normal oral mucosa and 63 tumor specimens and correlated with patients' clinical data. Results: In healthy mucosa expression of Bmi-1 and podoplanin was restricted to the basal cell layer. Expression of both proteins was found in 79% and 86% of our tumor samples, respectively. In 17 and 8 samples, Bmi-1 and podoplanin were co-expressed at the invasive border or diffuse in the bulk of the tumor, respectively. Univariate analysis showed that the co-expression of Bmi-1 and podoplanin correlated to decreased overall survival (p = 0.044). Moreover, multivariate testing identified high expression of podoplanin (p = 0.044), co-expression of Bmi-1 and podoplanin (p = 0.007) and lack of response to therapy (p < 0.0001) as predictors of shortened overall survival in patients treated with primary radio(chemo)therapy. Conclusions: Bmi-1 and podoplanin are expressed at the invasive front of squamous cell carcinomas of the head and neck. Co-expression of Bmi-1 and podoplanin predicts significantly overall survival of patients treated with primary radio(chemo)therapy

Reciprocal expression of Bmi1 and Mel-18 is associated with functioning of primitive hematopoietic cells.

Science.gov (United States)

Kajiume, Teruyuki; Ohno, Norioki; Sera, Yasuhiko; Kawahara, Yumi; Yuge, Louis; Kobayashi, Masao

2009-07-01

The Polycomb-group (PcG) genes regulate global gene expression in many biological processes, including hematopoiesis, by manipulating specific target genes. It is known that various PcG genes regulate self-renewal of hematopoietic stem cells (HSCs). Here we have shown that the reciprocal expression of PcG proteins regulates self-renewal and differentiation of HSCs. We used murine and human bone marrow cells and evaluated the reciprocal expression of PcG proteins on the basis of their respective intranuclear distributions. PcG-gene expression in HSCs was knocked down by small interfering RNAs. The function of each gene in HSCs was analyzed in vitro and in vivo. Cells were either Bmi1-positive or Mel-18-positive. The Bmi1-positive cells contained very little amounts of Mel-18 and vice versa. The bmi1-knockdown marrow cells did not show HSC function, while the mel-18-knockdown marrow cells showed increased stem cell function. Results of the analysis on human cells were similar to those observed in case of murine cells. In a clinical investigation, transplantation using sources with a low Bmi1 to Mel-18 ratio was associated with early hematopoietic recovery. Reciprocal expression of Bmi1 and Mel-18 regulated HSC function. Here, we observed that expression of the PcG genes-bmi1 and mel-18-is correlated with self-renewal and differentiation of HSCs. Thus, it was suggested that the balance between Bmi1 and Mel-18 regulates self-renewal of HSCs.

Direct binding of the N-terminus of HTLV-1 tax oncoprotein to cyclin-dependent kinase 4 is a dominant path to stimulate the kinase activity.

Science.gov (United States)

Li, Junan; Li, Hongyuan; Tsai, Ming-Daw

2003-06-10

The involvement of Tax oncoprotein in the INK4-CDK4/6-Rb pathway has been regarded as a key factor for immortalization and transformation of human T-cell leukemia virus 1 (HTLV-1) infected cells. In both p16 -/- and +/+ cells, expression of Tax has been correlated with an increase in CDK4 activity, which subsequently increases the phosphorylation of Rb and drives the infected cells into cell cycle progression. In relation to these effects, Tax has been shown to interact with two components of the INK4-CDK4/6-Rb pathway, p16 and cyclin D(s). While Tax competes with CDK4 for p16 binding, thus suppressing p16 inhibition of CDK4, Tax also binds to cyclin D(s) with concomitant increases in both CDK4 activity and the phosphorylation of cyclin D(s). Here we show that both Tax and residues 1-40 of the N-terminus of Tax, Tax40N, bind to and activate CDK4 in vitro. In the presence of INK4 proteins, binding of Tax and Tax40N to CDK4 counteracts against the inhibition of p16 and p18 and acts as the major path to regulate Tax-mediated activation of CDK4. We also report that Tax40N retains the transactivation ability. These results of in vitro studies demonstrate a potentially novel, p16-independent route to regulate CDK4 activity by the Tax oncoprotein in HTLV-1 infected cells.

Maternal Metabolic Health Parameters During Pregnancy in Relation to Early Childhood BMI Trajectories.

Science.gov (United States)

Montazeri, Parisa; Vrijheid, Martine; Martinez, David; Basterrechea, Mikel; Fernandez-Somoano, Ana; Guxens, Monica; Iñiguez, Carmen; Lertxundi, Aitana; Murcia, Mario; Tardon, Adonina; Sunyer, Jordi; Valvi, Damaskini

2018-03-01

The objective of this study was to evaluate the associations between maternal metabolic parameters and early childhood BMI trajectories. Two thousand two hundred fifty-one children born in Spain between 2004 and 2008 were analyzed. Five BMI z score trajectories from birth to age 4 years were identified by using latent class growth analysis. Multinomial regression assessed the associations between maternal metabolic parameters and offspring's BMI trajectories. Children in the reference BMI trajectory had average size at birth followed by a slower BMI gain. Maternal prepregnancy obesity was associated with trajectories of accelerated BMI gain departing from either higher (relative risk ratio [RRR] = 1.77; 95% CI: 1.07-2.91) or lower size at birth (RRR = 1.91; 95% CI: 1.17-3.12). Gestational weight gain (GWG) above clinical guidelines was associated with a trajectory of higher birth size followed by accelerated BMI gain (RRR = 2.14; 95% CI: 1.53-2.97). Maternal serum triglycerides were negatively associated with BMI trajectories departing from lower birth sizes. Gestational diabetes, maternal serum cholesterol, and C-reactive protein were unrelated to children's BMI trajectories. Maternal prepregnancy obesity, GWG, and serum triglycerides are associated with longitudinal BMI trajectories in early childhood that may increase disease risk in later life. Health initiatives should promote healthy weight status before and during pregnancy to improve maternal and child health. © 2018 The Obesity Society.

Eating tasty food to cope. Longitudinal association with BMI.

Science.gov (United States)

Boggiano, M M; Wenger, L E; Turan, B; Tatum, M M; Morgan, P R; Sylvester, M D

2015-04-01

The goals of this study were to determine if a change in certain motives to eat highly palatable food, as measured by the Palatable Eating Motives Scale (PEMS), could predict a change in body mass index (BMI) over time, to assess the temporal stability of these motive scores, and to test the reliability of previously reported associations between eating tasty foods to cope and BMI. BMI, demographics, and scores on the PEMS and the Binge Eating Scale were obtained from 192 college students. Test-retest analysis was performed on the PEMS motives in groups varying in three gap times between tests. Regression analyses determined what PEMS motives predicted a change in BMI over two years. The results replicated previous findings that eating palatable food for Coping motives (e.g., to forget about problems, reduce negative feelings) is associated with BMI. Test-retest correlations revealed that motive scores, while somewhat stable, can change over time. Importantly, among overweight participants, a change in Coping scores predicted a change in BMI over 2 years, such that a 1-point change in Coping predicted a 1.76 change in BMI (equivalent to a 10.5 lb. change in body weight) independent of age, sex, ethnicity, and initial binge-eating status (Cohen's f(2) effect size = 1.44). The large range in change of Coping scores suggests it is possible to decrease frequency of eating to cope by more than 1 scale point to achieve weight losses greater than 10 lbs. in young overweight adults, a group already at risk for rapid weight gain. Hence, treatments aimed specifically at reducing palatable food intake for coping reasons vs. for social, reward, or conformity reasons, should help achieve a healthier body weight and prevent obesity if this motive-type is identified prior to significant weight gain. Copyright © 2015 Elsevier Ltd. All rights reserved.

The transcription elongation factor ELL2 is specifically upregulated in HTLV-1-infected T-cells and is dependent on the viral oncoprotein Tax

Energy Technology Data Exchange (ETDEWEB)

Mann, Melanie C., E-mail: melanie.mann@viro.med.uni-erlangen.de; Strobel, Sarah, E-mail: sarah.strobel@viro.med.uni-erlangen.de; Fleckenstein, Bernhard, E-mail: bernhard.fleckenstein@viro.med.uni-erlangen.de; Kress, Andrea K., E-mail: andrea.kress@viro.med.uni-erlangen.de

2014-09-15

The oncoprotein Tax of human T-cell leukemia virus type 1 (HTLV-1) is a potent transactivator of viral and cellular transcription. Here, we identified ELL2 as the sole transcription elongation factor to be specifically upregulated in HTLV-1-/Tax-transformed T-cells. Tax contributes to regulation of ELL2, since transient transfection of Tax increases ELL2 mRNA, Tax transactivates the ELL2 promoter, and repression of Tax results in decrease of ELL2 in transformed T-lymphocytes. However, we also measured upregulation of ELL2 in HTLV-1-transformed cells exhibiting undetectable amounts of Tax, suggesting that ELL2 can still be maintained independent of continuous Tax expression. We further show that Tax and ELL2 synergistically activate the HTLV-1 promoter, indicating that ELL2 cooperates with Tax in viral transactivation. This is supported by our findings that Tax and ELL2 accumulate in nuclear fractions and that they co-precipitate upon co-expression in transiently-transfected cells. Thus, upregulation of ELL2 could contribute to HTLV-1 gene regulation. - Highlights: • ELL2, a transcription elongation factor, is upregulated in HTLV-1-positive T-cells. • Tax transactivates the ELL2 promoter. • Tax and ELL2 synergistically activate the HTLV-1 promoter. • Tax and ELL2 interact in vivo.

The transcription elongation factor ELL2 is specifically upregulated in HTLV-1-infected T-cells and is dependent on the viral oncoprotein Tax

International Nuclear Information System (INIS)

Mann, Melanie C.; Strobel, Sarah; Fleckenstein, Bernhard; Kress, Andrea K.

2014-01-01

The oncoprotein Tax of human T-cell leukemia virus type 1 (HTLV-1) is a potent transactivator of viral and cellular transcription. Here, we identified ELL2 as the sole transcription elongation factor to be specifically upregulated in HTLV-1-/Tax-transformed T-cells. Tax contributes to regulation of ELL2, since transient transfection of Tax increases ELL2 mRNA, Tax transactivates the ELL2 promoter, and repression of Tax results in decrease of ELL2 in transformed T-lymphocytes. However, we also measured upregulation of ELL2 in HTLV-1-transformed cells exhibiting undetectable amounts of Tax, suggesting that ELL2 can still be maintained independent of continuous Tax expression. We further show that Tax and ELL2 synergistically activate the HTLV-1 promoter, indicating that ELL2 cooperates with Tax in viral transactivation. This is supported by our findings that Tax and ELL2 accumulate in nuclear fractions and that they co-precipitate upon co-expression in transiently-transfected cells. Thus, upregulation of ELL2 could contribute to HTLV-1 gene regulation. - Highlights: • ELL2, a transcription elongation factor, is upregulated in HTLV-1-positive T-cells. • Tax transactivates the ELL2 promoter. • Tax and ELL2 synergistically activate the HTLV-1 promoter. • Tax and ELL2 interact in vivo

The relationship between BMI and insulin resistance and progression from single to multiple autoantibody positivity and type 1 diabetes among TrialNet Pathway to Prevention participants.

Science.gov (United States)

Meah, Farah A; DiMeglio, Linda A; Greenbaum, Carla J; Blum, Janice S; Sosenko, Jay M; Pugliese, Alberto; Geyer, Susan; Xu, Ping; Evans-Molina, Carmella

2016-06-01

The incidence of type 1 diabetes is increasing at a rate of 3-5% per year. Genetics cannot fully account for this trend, suggesting an influence of environmental factors. The accelerator hypothesis proposes an effect of metabolic factors on type 1 diabetes risk. To test this in the TrialNet Pathway to Prevention (PTP) cohort, we analysed the influence of BMI, weight status and insulin resistance on progression from single to multiple islet autoantibodies (Aab) and progression from normoglycaemia to diabetes. HOMA1-IR was used to estimate insulin resistance in Aab-positive PTP participants. Cox proportional hazards models were used to evaluate the effects of BMI, BMI percentile (BMI%), weight status and HOMA1-IR on the progression of autoimmunity or the development of diabetes. Data from 1,310 single and 1,897 multiple Aab-positive PTP participants were included. We found no significant relationships between BMI, BMI%, weight status or HOMA1-IR and the progression from one to multiple Aabs. Similarly, among all Aab-positive participants, no significant relationships were found between BMI, weight status or HOMA1-IR and progression to diabetes. Diabetes risk was modestly increased with increasing BMI% among the entire cohort, in obese participants 13-20 years of age and with increasing HOMA1-IR in adult Aab-positive participants. Analysis of the accelerator hypothesis in the TrialNet PTP cohort does not suggest a broad influence of metabolic variables on diabetes risk. Efforts to identify other potentially modifiable environmental factors should continue.

Desirable factors for maintaining normal BMI of urban affluent women of Delhi.

Science.gov (United States)

Gupta, Anu Taneja; Siddhu, Anupa

2015-01-01

The study aimed to identify desirable social, familial, reproductive, dietary, and lifestyle factors for maintaining normal body mass index (BMI) of urban affluent women (25-45 years) in Delhi, India. A total of 387 urban affluent women with at least one living child participated in this cross-sectional study conducted from March 2008 to April 2010. Women were classified into four BMI categories on the basis of World Health Organization (WHO; 2004) classification for Asians. Significant factors for maintaining normal BMI were: Younger age, less parity, nuclear family, normal weight status of parents, postpartum weight gain between 2 and 3 kg, regularity in taking meals, fixed meal size, self-perceived normal weight, and shorter sitting time and television viewing time. Multivariate regression analysis identified five determining factors for maintaining BMI, which are normal weight of father, self-perceived normal weight, fixed meal size, sitting time less than 6 h/day, and television viewing time less than 1 h/day. By small lifestyle modifications, normal BMI can be maintained.

[Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

Science.gov (United States)

Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

2014-06-01

To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

Earlier BMI rebound and lower pre-rebound BMI as risk of obesity among Japanese preschool children.

Science.gov (United States)

Kato, N; Isojima, T; Yokoya, S; Tanaka, T; Ono, A; Yokomichi, H; Yamagata, Z; Tanaka, S; Matsubara, H; Ishikuro, M; Kikuya, M; Chida, S; Hosoya, M; Kuriyama, S; Kure, S

2018-01-01

Longitudinal growth data of children were analyzed to clarify the relationship between the timing of body mass index (BMI) rebound and obesity risk in later ages. Of 54 558 children born between April 2004 and March 2005 and longitudinally measured in April and October every year in the preschool period, 15 255 children were analyzed wherein no longitudinal measurement is missing after 1 year of age. BMI rebound age was determined as the age with smallest BMI value across longitudinal individual data after 1 year of age. Rebound age was compared between overweight and non-overweight groups. The subjects were divided into groups based on the timing of rebound. The sex- and age-adjusted mean of the BMI, height and weight s.d. scores for age group, along with 6 months weight and height gain, were compared among groups using analysis of covariance. Among those who were overweight at 66-71 months of age, BMI rebound age obtained at approximately 3 years of age was compared with the non-overweight group, whose BMI rebound age was utmost 66 months or later (PBMI age group showed that earlier BMI rebound results in larger BMI (PBMI rebound earlier than 30 months of age, low BMI was observed (PBMI rebound among groups with rebound age earlier than 60 months of age (PBMI rebound timing with pre-rebound low BMI leads to greater childhood obesity risk; hence, early detection and prevention is necessary for such cases.

BMI-1 Mediates Estrogen-Deficiency-Induced Bone Loss by Inhibiting Reactive Oxygen Species Accumulation and T Cell Activation.

Science.gov (United States)

Li, Jinbo; Wang, Qian; Yang, Renlei; Zhang, Jiaqi; Li, Xing; Zhou, Xichao; Miao, Dengshun

2017-05-01

Previous studies have shown that estrogen regulates bone homeostasis through regulatory effects on oxidative stress. However, it is unclear how estrogen deficiency triggers reactive oxygen species (ROS) accumulation. Recent studies provide evidence that the B lymphoma Mo-MLV insertion region 1 (BMI-1) plays a critical role in protection against oxidative stress and that this gene is directly regulated by estrogen via estrogen receptor (ER) at the transcriptional level. In this study, ovariectomized mice were given drinking water with/without antioxidant N-acetyl-cysteine (NAC, 1 mg/mL) supplementation, and compared with each other and with sham mice. Results showed that ovariectomy resulted in bone loss with increased osteoclast surface, increased ROS levels, T cell activation, and increased TNF and RANKL levels in serum and in CD4 T cells; NAC supplementation largely prevented these alterations. BMI-1 expression levels were dramatically downregulated in CD4 T cells from ovariectomized mice. We supplemented drinking water to BMI-1-deficient mice with/without NAC and compared them with each other and with wild-type (WT) mice. We found that BMI-1 deficiency mimicked alterations observed in ovariectomy whereas NAC supplementation reversed all alterations induced by BMI-1 deficiency. Because T cells are critical in mediating ovariectomy-induced bone loss, we further assessed whether BMI-1 overexpression in lymphocytes can protect against estrogen deficiency-induced osteoclastogenesis and bone loss by inhibiting oxidative stress, T cell activation, and RANKL production. When WT and Eμ-BMI-1 transgenic mice with BMI-1 specifically overexpressed in lymphocytes were ovariectomized and compared with each other and with WT sham mice, we found that BMI-1 overexpression in lymphocytes clearly reversed all alterations induced by ovariectomy. Results from this study indicate that estrogen deficiency downregulates BMI-1 and subsequently increases ROS, T cell activation, and

Fuel shipment experience, fuel movements from the BMI-1 transport cask

International Nuclear Information System (INIS)

Bauer, Thomas L.; Krause, Michael G.

1986-01-01

The University of Texas at Austin received two shipments of irradiated fuel elements from Northrup Aircraft Corporation on April 11 and 16, 1985. A total of 59 elements consisting of standard and instrumented TRIGA fuel were unloaded from the BMI-1 shipping cask. At the time of shipment, the Northrup core burnup was approximately 50 megawatt days with fuel element radiation levels, after a cooling time of three months, of approximately 1.75 rem/hr at 3 feet. In order to facilitate future planning of fuel shipment at the UT facility and other facilities, a summary of the recent transfer process including several factors which contributed to its success are presented. Numerous color slides were made of the process for future reference by UT and others involved in fuel transfer and handling of the BMI-1 cask

Oncoprotein metastasis and its suppression revisited

Directory of Open Access Journals (Sweden)

Radulescu Razvan T

2010-04-01

Full Text Available Abstract The past two decades have witnessed an increasing appreciation of the role of the tumor microenvironment, of genetic and epigenetic alterations in normal cells adjacent to tumors and of the migration of normal cells with aberrant intrinsic properties in cancer pathophysiology. Aside from these insights, a novel concept termed "oncoprotein metastasis" (OPM has recently been advanced and proposed to reflect protein-based neoplastic phenomena that might occur even before any modifications relating to the morphology, location or (epigenetic outfit of cells during the malignant process. Here, evidence is presented that supports the OPM perception and thus should contribute not only to further rethink the definition of a normal cell, but also the treatment of cancer disease in the years to come.

Anti-aging Effect of Transplanted Amniotic Membrane Mesenchymal Stem Cells in a Premature Aging Model of Bmi-1 Deficiency

Science.gov (United States)

Xie, Chunfeng; Jin, Jianliang; Lv, Xianhui; Tao, Jianguo; Wang, Rong; Miao, Dengshun

2015-01-01

To determine whether transplanted amniotic membrane mesenchymal stem cells (AMSCs) ameliorated the premature senescent phenotype of Bmi-1-deficient mice, postnatal 2-day-old Bmi-1−/− mice were injected intraperitoneally with the second-passage AMSCs from amniotic membranes of β-galactosidase (β-gal) transgenic mice or wild-type (WT) mice labeled with DiI. Three reinjections were given, once every seven days. Phenotypes of 5-week-old β-gal+ AMSC-transplanted or 6-week-old DiI+ AMSC-transplanted Bmi-1−/− mice were compared with vehicle-transplanted Bmi-1−/− and WT mice. Vehicle-transplanted Bmi-1−/− mice displayed growth retardation and premature aging with decreased cell proliferation and increased cell apoptosis; a decreased ratio and dysmaturity of lymphocytic series; premature osteoporosis with reduced osteogenesis and increased adipogenesis; redox imbalance and DNA damage in multiple organs. Transplanted AMSCs carried Bmi-1 migrated into multiple organs, proliferated and differentiated into multiple tissue cells, promoted growth and delayed senescence in Bmi-1−/− transplant recipients. The dysmaturity of lymphocytic series were ameliorated, premature osteoporosis were rescued by promoting osteogenesis and inhibiting adipogenesis, the oxidative stress and DNA damage in multiple organs were inhibited by the AMSC transplantation in Bmi-1−/− mice. These findings indicate that AMSC transplantation ameliorated the premature senescent phenotype of Bmi-1-deficient mice and could be a novel therapy to delay aging and prevent aging-associated degenerative diseases. PMID:26370922

Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells

International Nuclear Information System (INIS)

Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

2017-01-01

The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 −/− ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN.

Meta-analysis of genome-wide linkage studies in BMI and obesity.

Science.gov (United States)

Saunders, Catherine L; Chiodini, Benedetta D; Sham, Pak; Lewis, Cathryn M; Abkevich, Victor; Adeyemo, Adebowale A; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S; Blangero, John; Boehnke, Michael; Borecki, Ingrid B; Chagnon, Yvon C; Chen, Wei; Comuzzie, Anthony G; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F; Froguel, Philippe; Hanson, Robert L; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H; Li, Weidong; Luke, Amy; Martin, Lisa J; Nash, Matthew; Ohman, Miina; Palmer, Lyle J; Peltonen, Leena; Perola, Markus; Price, R Arlen; Redline, Susan; Srinivasan, Sathanur R; Stern, Michael P; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A

2007-09-01

The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. We identified 37 published studies containing data on over 31,000 individuals from more than >10,000 families and obtained genome-wide logarithm of the odds (LOD) scores, non-parametric linkage (NPL) scores, or maximum likelihood scores (MLS). BMI was analyzed in a pooled set of all studies, as a subgroup of 10 studies that used BMI-defined obesity, and for subgroups ascertained through type 2 diabetes, hypertension, or subjects of European ancestry. Bins at chromosome 13q13.2- q33.1, 12q23-q24.3 achieved suggestive evidence of linkage to BMI in the pooled analysis and samples ascertained for hypertension. Nominal evidence of linkage to these regions and suggestive evidence for 11q13.3-22.3 were also observed for BMI-defined obesity. The FTO obesity gene locus at 16q12.2 also showed nominal evidence for linkage. However, overall distribution of summed rank p values <0.05 is not different from that expected by chance. The strongest evidence was obtained in the families ascertained for hypertension at 9q31.1-qter and 12p11.21-q23 (p < 0.01). Despite having substantial statistical power, we did not unequivocally implicate specific loci for BMI or obesity. This may be because genes influencing adiposity are of very small effect, with substantial genetic heterogeneity and variable dependence on environmental factors. However, the observation that the FTO gene maps to one of the highest ranking bins for obesity is interesting and, while not a validation of this approach, indicates that other potential loci identified in this study should be investigated further.

BMI and Lifetime Changes in BMI and Cancer Mortality Risk

NARCIS (Netherlands)

Taghizadeh, Niloofar; Boezen, H Marike; Schouten, Jan P; Schröder, Carolien P; de Vries, Elisabeth G. E.; Vonk, Judith M

2015-01-01

Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and

The oncoprotein BCL11A binds to orphan nuclear receptor TLX and potentiates its transrepressive function.

Directory of Open Access Journals (Sweden)

Sara B Estruch

Full Text Available Nuclear orphan receptor TLX (NR2E1 functions primarily as a transcriptional repressor and its pivotal role in brain development, glioblastoma, mental retardation and retinopathologies make it an attractive drug target. TLX is expressed in the neural stem cells (NSCs of the subventricular zone and the hippocampus subgranular zone, regions with persistent neurogenesis in the adult brain, and functions as an essential regulator of NSCs maintenance and self-renewal. Little is known about the TLX social network of interactors and only few TLX coregulators are described. To identify and characterize novel TLX-binders and possible coregulators, we performed yeast-two-hybrid (Y2H screens of a human adult brain cDNA library using different TLX constructs as baits. Our screens identified multiple clones of Atrophin-1 (ATN1, a previously described TLX interactor. In addition, we identified an interaction with the oncoprotein and zinc finger transcription factor BCL11A (CTIP1/Evi9, a key player in the hematopoietic system and in major blood-related malignancies. This interaction was validated by expression and coimmunoprecipitation in human cells. BCL11A potentiated the transrepressive function of TLX in an in vitro reporter gene assay. Our work suggests that BCL11A is a novel TLX coregulator that might be involved in TLX-dependent gene regulation in the brain.

The oncoprotein BCL11A binds to orphan nuclear receptor TLX and potentiates its transrepressive function.

Science.gov (United States)

Estruch, Sara B; Buzón, Víctor; Carbó, Laia R; Schorova, Lenka; Lüders, Jens; Estébanez-Perpiñá, Eva

2012-01-01

Nuclear orphan receptor TLX (NR2E1) functions primarily as a transcriptional repressor and its pivotal role in brain development, glioblastoma, mental retardation and retinopathologies make it an attractive drug target. TLX is expressed in the neural stem cells (NSCs) of the subventricular zone and the hippocampus subgranular zone, regions with persistent neurogenesis in the adult brain, and functions as an essential regulator of NSCs maintenance and self-renewal. Little is known about the TLX social network of interactors and only few TLX coregulators are described. To identify and characterize novel TLX-binders and possible coregulators, we performed yeast-two-hybrid (Y2H) screens of a human adult brain cDNA library using different TLX constructs as baits. Our screens identified multiple clones of Atrophin-1 (ATN1), a previously described TLX interactor. In addition, we identified an interaction with the oncoprotein and zinc finger transcription factor BCL11A (CTIP1/Evi9), a key player in the hematopoietic system and in major blood-related malignancies. This interaction was validated by expression and coimmunoprecipitation in human cells. BCL11A potentiated the transrepressive function of TLX in an in vitro reporter gene assay. Our work suggests that BCL11A is a novel TLX coregulator that might be involved in TLX-dependent gene regulation in the brain.

The Effect of GWAS Identified BMI Loci on Changes in Body Weight among Middle-Aged Danes during a Five-Year Period

DEFF Research Database (Denmark)

Sandholt, C. H.; Allin, K. H.; Toft, U.

2014-01-01

Objective: Genome-wide association studies have identified genetic variants associating with BMI, however, it is un-clarified whether the same variants also influence body weight fluctuations. Methods: Among 3,982 adult individuals that attended both a baseline and a five-year follow-up examinati...

Nucleosome acidic patch promotes RNF168- and RING1B/BMI1-dependent H2AX and H2A ubiquitination and DNA damage signaling.

Directory of Open Access Journals (Sweden)

Justin W Leung

2014-03-01

Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.

Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells.

Science.gov (United States)

Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

2017-01-22

The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 -/- ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN. Copyright © 2016 Elsevier Inc. All rights reserved.

Postoperative Complications of Total Joint Arthroplasty in Obese Patients Stratified by BMI.

Science.gov (United States)

Zusmanovich, Mikhail; Kester, Benjamin S; Schwarzkopf, Ran

2018-03-01

High body mass index (BMI) is associated with significant complications in patients undergoing total joint arthroplasty. Many studies have evaluated this trend, but few have looked at the rates of complications based on BMI as a continuous variable. The purpose of this study was to stratify obese patients into 3 BMI categories and evaluate their rates of complications and gauge whether transitioning from higher to lower BMI category lowers complication. Patients undergoing primary total joint arthroplasty were selected from the National Surgical Quality Improvement Program database from 2008-2015 and arranged into 3 groups based on BMI: O1 (BMI 30-34.9 kg/m 2 ), O2 (BMI 35-39.9 kg/m 2 ), and O3 (BMI >40 kg/m 2 ). Thirty-day complications were recorded and evaluated utilizing univariate and multivariate analyses stratified by BMI. A total of 268,663 patients were identified. Patients with a BMI >30 kg/m 2 had more infectious and medical complications compared with nonobese patients. Furthermore, there were increased complications as the BMI categories increased. Patients with a BMI >40 kg/m 2 (O3) had longer operating times, length of stay, higher rates of readmissions, reoperations, deep venous thrombosis, renal insufficiency, superficial infections, deep infections, and wound dehiscence. These trends were present when comparing the O2 with O1 category as well. We have demonstrated increased rates of medical and surgical complications in obese patients. Furthermore, we demonstrated a stepwise increase in complication rates when transitioning to higher BMI groups. Based on our data, we believe that preoperative counseling and interventions to decrease BMI should be explored before offering elective surgery to obese patients. Copyright © 2017 Elsevier Inc. All rights reserved.

Differential gene expression between skin and cervix induced by the E7 oncoprotein in a transgenic mouse model

Science.gov (United States)

Ibarra Sierra, E; Díaz Chávez, J; Cortés-Malagón, EM; Uribe-Figueroa, L; Hidalgo-Miranda, A; Lambert, PF; Gariglio, P

2013-01-01

HPV16 E7 oncoprotein expression in K14E7 transgenic mice induces cervical cancer after 6 months of treatment with the co-carcinogen 17β-estradiol. In untreated mice, E7 also induces skin tumors late in life albeit at low penetrance. These findings indicate that E7 alters cellular functions in cervix and skin so as to predispose these organs to tumorigenesis. Using microarrays, we determined the global genes expression profile in cervical and skin tissue of young adult K14E7 transgenic mice without estrogen treatment. In these tissues, the E7 oncoprotein altered the transcriptional pattern of genes involved in several biological processes including signal transduction, transport, metabolic process, cell adhesion, apoptosis, cell differentiation, immune response and inflammatory response. Among the E7-dysregulated genes were ones not previously known to be involved in cervical neoplasia including DMBT1, GLI1 and 17βHSD2 in cervix, as well as MMP2, 12, 14, 19 and 27 in skin. PMID:22980503

Bmi1 is down-regulated in the aging brain and displays antioxidant and protective activities in neurons.

Directory of Open Access Journals (Sweden)

Mohamed Abdouh

Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.

Is BMI a valid measure of obesity in postmenopausal women?

Science.gov (United States)

Banack, Hailey R; Wactawski-Wende, Jean; Hovey, Kathleen M; Stokes, Andrew

2018-03-01

Body mass index (BMI) is a widely used indicator of obesity status in clinical settings and population health research. However, there are concerns about the validity of BMI as a measure of obesity in postmenopausal women. Unlike BMI, which is an indirect measure of obesity and does not distinguish lean from fat mass, dual-energy x-ray absorptiometry (DXA) provides a direct measure of body fat and is considered a gold standard of adiposity measurement. The goal of this study is to examine the validity of using BMI to identify obesity in postmenopausal women relative to total body fat percent measured by DXA scan. Data from 1,329 postmenopausal women participating in the Buffalo OsteoPerio Study were used in this analysis. At baseline, women ranged in age from 53 to 85 years. Obesity was defined as BMI ≥ 30 kg/m and body fat percent (BF%) greater than 35%, 38%, or 40%. We calculated sensitivity, specificity, positive predictive value, and negative predictive value to evaluate the validity of BMI-defined obesity relative BF%. We further explored the validity of BMI relative to BF% using graphical tools, such as scatterplots and receiver-operating characteristic curves. Youden's J index was used to determine the empirical optimal BMI cut-point for each level of BF% defined obesity. The sensitivity of BMI-defined obesity was 32.4% for 35% body fat, 44.6% for 38% body fat, and 55.2% for 40% body fat. Corresponding specificity values were 99.3%, 97.1%, and 94.6%, respectively. The empirical optimal BMI cut-point to define obesity is 24.9 kg/m for 35% BF, 26.49 kg/m for 38% BF, and 27.05 kg/m for 40% BF according to the Youden's index. Results demonstrate that a BMI cut-point of 30 kg/m does not appear to be an appropriate indicator of true obesity status in postmenopausal women. Empirical estimates of the validity of BMI from this study may be used by other investigators to account for BMI-related misclassification in older women.

MPEG-CS/Bmi-1RNAi Nanoparticles Synthesis and Its Targeted Inhibition Effect on CD133+ Laryngeal Stem Cells.

Science.gov (United States)

Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei

2018-03-01

Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.

The Human Papillomavirus Type 16 E6 Oncoprotein Activates mTORC1 Signaling and Increases Protein Synthesis ▿ †

OpenAIRE

Spangle, Jennifer M.; Münger, Karl

2010-01-01

The mammalian target of rapamycin (mTOR) kinase acts as a cellular rheostat that integrates signals from a variety of cellular signal transduction pathways that sense growth factor and nutrient availability as well as intracellular energy status. It was previously reported that the human papillomavirus type 16 (HPV16) E6 oncoprotein may activate the S6 protein kinase (S6K) through binding and E6AP-mediated degradation of the mTOR inhibitor tuberous sclerosis complex 2 (TSC2) (Z. Lu, X. Hu, Y....

The effect of prenatal maternal cigarette smoking on children's BMI z-score with SGA as a mediator.

Science.gov (United States)

Salahuddin, Meliha; Pérez, Adriana; Ranjit, Nalini; Hoelscher, Deanna M; Kelder, Steven H

2018-02-21

The goal of this study was to assess the effect of prenatal maternal cigarette smoking on children's BMI z-score trajectories, and to evaluate whether small-for-gestational-age (SGA) acts as a potential mediator between prenatal maternal cigarette smoking and child's BMI z-score at 4 years of age. Group-based trajectory modeling (GBTM) methods were employed to describe and classify developmental BMI z-score trajectories (the outcome of interest) in children from 9 months to 4 years of age (n = 5221) in the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B) study (2001-2005). Further analysis examined whether the identified BMI z-score trajectories varied with the exposure, prenatal maternal cigarette smoking. Mediation analyses were utilized to examine whether being SGA (binary measure) acted as a potential mediator in the relationship between prenatal maternal cigarette smoking and BMI z-score among 4-year-old children. Using GBTM, two BMI z-score trajectory groups were identified: normal BMI z-score (57.8%); and high BMI z-score (42.2%). Children of mothers who smoked cigarettes during pregnancy were 2.1 times (RR 95% CI: 1.1-4.0, P value = 0.023) more at risk of being in the high BMI z-score trajectory group. Prenatal cigarette smoking was positively related to SGA at birth, but SGA was inversely related to BMI z-score at 4 years. The direct effect (0.19, 95% CI: 0.18, 0.19; P value BMI z-score among 4-year-old children was stronger and in the opposite direction of the indirect effect (-0.04, 95% CI: -0.04, -0.04; P value BMI z-score group, as well with SGA. The effects of prenatal smoking on BMI z-score at 4 years appears to act through pathways other than SGA.

Genome-wide association study for the interaction between BMR and BMI in obese Korean women including overweight.

Science.gov (United States)

Lee, Myoungsook; Kwon, Dae Young; Kim, Myung-Sunny; Choi, Chong Ran; Park, Mi-Young; Kim, Ae-Jung

2016-02-01

This is the first study to identify common genetic factors associated with the basal metabolic rate (BMR) and body mass index (BMI) in obese Korean women including overweight. This will be a basic study for future research of obese gene-BMR interaction. The experimental design was 2 by 2 with variables of BMR and BMI. A genome-wide association study (GWAS) of single nucleotide polymorphisms (SNPs) was conducted in the overweight and obesity (BMI > 23 kg/m(2)) compared to the normality, and in women with low BMR (BMR. A total of 140 SNPs reached formal genome-wide statistical significance in this study (P BMR (rs10786764; P = 8.0 × 10(-7), rs1040675; 2.3 × 10(-6)) and BMI (rs10786764; P = 2.5 × 10(-5), rs10786764; 6.57 × 10(-5)). The other genes related to BMI (HSD52, TMA16, MARCH1, NRG1, NRXN3, and STK4) yielded P BMR and BMI, including NRG3, OR8U8, BCL2L2-PABPN1, PABPN1, and SLC22A17 were identified in obese Korean women (P BMR- and BMI-related genes using GWAS. Although most of these newly established loci were not previously associated with obesity, they may provide new insights into body weight regulation. Our findings of five common genes associated with BMR and BMI in Koreans will serve as a reference for replication and validation of future studies on the metabolic rate.

Evaluation of potential prognostic value of Bmi-1 gene product and selected markers of proliferation (Ki-67 and apoptosis (p53 in the neuroblastoma group of tumors

Directory of Open Access Journals (Sweden)

Katarzyna Taran

2016-02-01

Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.

Problem-Solving Test: The Mechanism of Action of a Human Papilloma Virus Oncoprotein

Science.gov (United States)

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: human papilloma virus; cervical cancer; oncoproteins; malignant transformation; retinoblastoma protein; cell cycle; quiescent and cycling cells; cyclin/cyclin-dependent kinase (Cdk) complexes; E2F; S-phase genes; enhancer element; proto-oncogenes; tumor suppressor genes; radioactive…

MiR-218-targeting-Bmi-1 mediates the suppressive effect of 1,6,7-trihydroxyxanthone on liver cancer cells.

Science.gov (United States)

Fu, Wei-Ming; Tang, Li-Peng; Zhu, Xiao; Lu, Ying-Fei; Zhang, Yan-Ling; Lee, Wayne Yuk-Wai; Wang, Hua; Yu, Yang; Liang, Wei-Cheng; Ko, Chun-Hay; Xu, Hong-Xi; Kung, Hsiang-Fu; Zhang, Jin-Fang

2015-01-01

Traditional Chinese medicine is recently emerged as anti-cancer therapy or adjuvant with reduced side-effects and improved quality of life. In the present study, an active ingredient, 1,6,7-trihydroxyxanthone (THA), derived from Goodyera oblongifolia was found to strongly suppress cell growth and induce apoptosis in liver cancer cells. MicroRNAs are a group of small non-coding RNAs that regulate gene expression at post-transcriptional levels. Our results demonstrated that miR-218 was up-regulated and oncogene Bmi-1 was down-regulated by THA treatment. Further investigation showed that THA-induced-miR-218 up-regulation could lead to activation of tumor suppressor P16(Ink4a) and P14(ARF), the main down-stream targets of Bmi-1. In conclusion, THA might be a potential anti-cancer drug candidate, at least in part, through the activation of miR-218 and suppression of Bmi-1 expression.

Ubiquitination and degradation of the hominoid-specific oncoprotein TBC1D3 is regulated by protein palmitoylation

Energy Technology Data Exchange (ETDEWEB)

Kong, Chen; Lange, Jeffrey J.; Samovski, Dmitri [Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO 63110 (United States); Su, Xiong [Department of Internal Medicine, Center for Human Nutrition Washington University School of Medicine, St. Louis, MO 63110 (United States); Liu, Jialiu [Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO 63110 (United States); Sundaresan, Sinju [Department of Internal Medicine, Center for Human Nutrition Washington University School of Medicine, St. Louis, MO 63110 (United States); Stahl, Philip D., E-mail: pstahl@wustl.edu [Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO 63110 (United States)

2013-05-03

Highlights: •Hominoid-specific oncogene TBC1D3 is targeted to plasma membrane by palmitoylation. •TBC1D3 is palmitoylated on two cysteine residues: 318 and 325. •TBC1D3 palmitoylation governs growth factors-induced TBC1D3 degradation. •Post-translational modifications may regulate oncogenic properties of TBC1D3. -- Abstract: Expression of the hominoid-specific oncoprotein TBC1D3 promotes enhanced cell growth and proliferation by increased activation of signal transduction through several growth factors. Recently we documented the role of CUL7 E3 ligase in growth factors-induced ubiquitination and degradation of TBC1D3. Here we expanded our study to discover additional molecular mechanisms that control TBC1D3 protein turnover. We report that TBC1D3 is palmitoylated on two cysteine residues: 318 and 325. The expression of double palmitoylation mutant TBC1D3:C318/325S resulted in protein mislocalization and enhanced growth factors-induced TBC1D3 degradation. Moreover, ubiquitination of TBC1D3 via CUL7 E3 ligase complex was increased by mutating the palmitoylation sites, suggesting that depalmitoylation of TBC1D3 makes the protein more available for ubiquitination and degradation. The results reported here provide novel insights into the molecular mechanisms that govern TBC1D3 protein degradation. Dysregulation of these mechanisms in vivo could potentially result in aberrant TBC1D3 expression and promote oncogenesis.

ERG oncoprotein expression in prostate carcinoma patients of different ethnicities

OpenAIRE

KELLY, GREGORY M.; KONG, YINK HEAY; DOBI, ALBERT; SRIVASTAVA, SHIV; SESTERHENN, ISABELL A.; PATHMANATHAN, RAJADURAI; TAN, HUI MENG; TAN, SHYH-HAN; CHEONG, SOK CHING

2014-01-01

Overexpression of the erythroblast transformation-specific-related gene (ERG) oncoprotein due to transmembrane protease, serine 2 (TMPRSS2)-ERG fusion, the most prevalent genomic alteration in prostate cancer (CaP), is more frequently observed among Caucasian patients compared to patients of African or Asian descent. To the best of our knowledge, this is the first study to investigate the prevalence of ERG alterations in a multiethnic cohort of CaP patients. A total of 191 formalin-fixed para...

BMI Trajectories Associated With Resolution of Elevated Youth BMI and Incident Adult Obesity.

Science.gov (United States)

Buscot, Marie-Jeanne; Thomson, Russell J; Juonala, Markus; Sabin, Matthew A; Burgner, David P; Lehtimäki, Terho; Hutri-Kähönen, Nina; Viikari, Jorma S A; Jokinen, Eero; Tossavainen, Paivi; Laitinen, Tomi; Raitakari, Olli T; Magnussen, Costan G

2018-01-01

Youth with high BMI who become nonobese adults have the same cardiovascular risk factor burden as those who were never obese. However, the early-life BMI trajectories for overweight or obese youth who avoid becoming obese adults have not been described. We aimed to determine and compare the young-childhood BMI trajectories of participants according to their BMI status in youth and adulthood. Bayesian hierarchical piecewise regression modeling was used to analyze the BMI trajectories of 2717 young adults who had up to 8 measures of BMI from childhood (ages 3-18 years) to adulthood (ages 34-49 years). Compared with those with persistently high BMI, those who resolved their high youth BMI by adulthood had lower average BMI at age 6 years and slower rates of BMI change from young childhood. In addition, their BMI levels started to plateau at 16 years old for females and 21 years old for males, whereas the BMI of those whose high BMI persisted did not stabilize until 25 years old for male subjects and 27 years for female subjects. Compared with those youth who were not overweight or obese and who remained nonobese in adulthood, those who developed obesity had a higher BMI rate of change from 6 years old, and their BMI continued to increase linearly until age 30 years. Efforts to alter BMI trajectories for adult obesity should ideally commence before age 6 years. The natural resolution of high BMI starts in adolescence for males and early adulthood for females, suggesting a critical window for secondary prevention. Copyright © 2018 by the American Academy of Pediatrics.

Expression of Bmi-1, P16, and CD44v6 in Uterine Cervical Carcinoma and Its Clinical Significance

International Nuclear Information System (INIS)

Weng, Mei-ying; Li, Lin; Feng, Shu-ying; Hong, Shun-jia

2012-01-01

Bmi-1, a putative proto-oncogene, is a core member of the polycomb gene family, which is expressed in many human tumors. The p16 protein negatively regulated cell proliferation, whereas CD44v6 is associated with proliferation as an important protein. Additionally, CD44v6 is an important nuclear antigen closely correlated to tumor metastasis. The present study aims to investigate the expression and significance of Bmi-1, p16, and CD44v6 in uterine cervical carcinoma (UCC). A total of 62 UCC, 30 cervical neoplasic, and 20 normal cervical mucosal tissues were used in the current study. The expression of Bmi-1, p16, and CD44v6 in these tissues was determined using immunohistochemical assay. The relationships among the expression of these indices, the clinicopathologic features of UCC, and the survival rate of UCC patients were also discussed. The correlation between Bmi-1 protein expression and p16 or CD44v6 protein in UCC was analyzed. The expression of Bmi-1, p16, and CD44v6 was significantly high in cervical carcinoma compared with that in the cervical neoplasia and normal colorectal mucosa (P<0.05). The over-expression of Bmi-1 protein in UCC was apparently related to the distant metastasis (P<0.01) and the tumor, nodes and metastasis-classification, i.e. the TNM staging, World Health Organization (P<0.05). Nevertheless, the positive expression of p16 protein in UCC was not significantly associated with the clinicopathologic features (P>0.05). The Kaplan–Meier survival analysis showed that the over-expression of Bmi-1 significantly decreased the survival rate of UCC patients (P<0.05). A strong correlation indicated that there was statistical significance between the expression of Bmi-1 and CD44V6 proteins in UCC (r=0.419, P=0.001). The over-expression of Bmi-1 and CD44v6 protein closely correlate to the tumorigenesis, metastasis, and prognosis of UCC. Bmi-1 and CD44v6 may be used to predict the prognosis of cervical carcinoma. Bmi-1 may indirectly regulate the

Acute myeloid leukemia stem cell markers in prognosis and targeted therapy: potential impact of BMI-1, TIM-3 and CLL-1.

Science.gov (United States)

Darwish, Noureldien H E; Sudha, Thangirala; Godugu, Kavitha; Elbaz, Osama; Abdelghaffar, Hasan A; Hassan, Emad E A; Mousa, Shaker A

2016-09-06

Acute myeloid leukemia (AML) patients show high relapse rates and some develop conventional chemotherapy resistance. Leukemia Stem Cells (LSCs) are the main player for AML relapses and drug resistance. LSCs might rely on the B-cell-specific Moloney murine leukemia virus integration site-1 (BMI-1) in promoting cellular proliferation and survival. Growth of LSCs in microenvironments that are deprived of nutrients leads to up-regulation of the signaling pathways during the progression of the disease, which may illustrate the sensitivity of LSCs to inhibitors of those signaling pathways as compared to normal cells. We analyzed the expression of LSC markers (CD34, CLL-1, TIM-3 and BMI-1) using quantitative RT-PCR in bone marrow samples of 40 AML patients of different FAB types (M1, M2, M3, M4, M5, and M7). We also studied the expression of these markers in 2 AML cell lines (Kasumi-1 and KG-1a) using flow cytometry and quantitative RT-PCR. The overexpression of TIM-3, CLL-1, and BMI-1 was markedly correlated with poor prognosis in these patients. Our in vitro findings demonstrate that targeting BMI-1, which markedly increased in the leukemic cells, was associated with marked decrease in leukemic burden. This study also presents results for blocking LSCs' surface markers CD44, CLL-1, and TIM-3. These markers may play an important role in elimination of AML. Our study indicates a correlation between the expression of markers TIM-3, CLL-1, and especially of BMI-1 and the aggressiveness of AML and thus the potential impact of prognosis and therapies that target LSCs on improving the cure rates.

Hijacking of the O-GlcNAcZYME complex by the HTLV-1 Tax oncoprotein facilitates viral transcription.

Science.gov (United States)

Groussaud, Damien; Khair, Mostafa; Tollenaere, Armelle I; Waast, Laetitia; Kuo, Mei-Shiue; Mangeney, Marianne; Martella, Christophe; Fardini, Yann; Coste, Solène; Souidi, Mouloud; Benit, Laurence; Pique, Claudine; Issad, Tarik

2017-07-01

The viral Tax oncoprotein plays a key role in both Human T-cell lymphotropic virus type 1 (HTLV-1)-replication and HTLV-1-associated pathologies, notably adult T-cell leukemia. Tax governs the transcription from the viral 5'LTR, enhancing thereby its own expression, via the recruitment of dimers of phosphorylated CREB to cAMP-response elements located within the U3 region (vCRE). In addition to phosphorylation, CREB is also the target of O-GlcNAcylation, another reversible post-translational modification involved in a wide range of diseases, including cancers. O-GlcNAcylation consists in the addition of O-linked-N-acetylglucosamine (O-GlcNAc) on Serine or Threonine residues, a process controlled by two enzymes: O-GlcNAc transferase (OGT), which transfers O-GlcNAc on proteins, and O-GlcNAcase (OGA), which removes it. In this study, we investigated the status of O-GlcNAcylation enzymes in HTLV-1-transformed T cells. We found that OGA mRNA and protein expression levels are increased in HTLV-1-transformed T cells as compared to control T cell lines while OGT expression is unchanged. However, higher OGA production coincides with a reduction in OGA specific activity, showing that HTLV-1-transformed T cells produce high level of a less active form of OGA. Introducing Tax into HEK-293T cells or Tax-negative HTLV-1-transformed TL-om1 T cells is sufficient to inhibit OGA activity and increase total O-GlcNAcylation, without any change in OGT activity. Furthermore, Tax interacts with the OGT/OGA complex and inhibits the activity of OGT-bound OGA. Pharmacological inhibition of OGA increases CREB O-GlcNAcylation as well as HTLV-1-LTR transactivation by Tax and CREB recruitment to the LTR. Moreover, overexpression of wild-type CREB but not a CREB protein mutated on a previously described O-GlcNAcylation site enhances Tax-mediated LTR transactivation. Finally, both OGT and OGA are recruited to the LTR. These findings reveal the interplay between Tax and the O-GlcNAcylation pathway

Body size estimation of self and others in females varying in BMI.

Directory of Open Access Journals (Sweden)

Anne Thaler

Full Text Available Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI, on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1, but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a. The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

Body size estimation of self and others in females varying in BMI.

Science.gov (United States)

Thaler, Anne; Geuss, Michael N; Mölbert, Simone C; Giel, Katrin E; Streuber, Stephan; Romero, Javier; Black, Michael J; Mohler, Betty J

2018-01-01

Previous literature suggests that a disturbed ability to accurately identify own body size may contribute to overweight. Here, we investigated the influence of personal body size, indexed by body mass index (BMI), on body size estimation in a non-clinical population of females varying in BMI. We attempted to disentangle general biases in body size estimates and attitudinal influences by manipulating whether participants believed the body stimuli (personalized avatars with realistic weight variations) represented their own body or that of another person. Our results show that the accuracy of own body size estimation is predicted by personal BMI, such that participants with lower BMI underestimated their body size and participants with higher BMI overestimated their body size. Further, participants with higher BMI were less likely to notice the same percentage of weight gain than participants with lower BMI. Importantly, these results were only apparent when participants were judging a virtual body that was their own identity (Experiment 1), but not when they estimated the size of a body with another identity and the same underlying body shape (Experiment 2a). The different influences of BMI on accuracy of body size estimation and sensitivity to weight change for self and other identity suggests that effects of BMI on visual body size estimation are self-specific and not generalizable to other bodies.

Bmi1 overexpression in the cerebellar granule cell lineage of mice affects cell proliferation and survival without initiating medulloblastoma formation

Directory of Open Access Journals (Sweden)

Hourinaz Behesti

2013-01-01

BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.

Human papillomavirus E6 and E7 oncoproteins alter cell cycle progression but not radiosensitivity of carcinoma cells treated with low-dose-rate radiation

International Nuclear Information System (INIS)

DeWeese, Theodore L.; Walsh, Jonathan C.; Dillehay, Larry E.; Kessis, Theodore D.; Hedrick, Lora; Cho, Kathleen R.; Nelson, William G.

1997-01-01

Purpose: Low-dose-rate radiation therapy has been widely used in the treatment of urogenital malignancies. When continuously exposed to low-dose-rate ionizing radiation, target cancer cells typically exhibit abnormalities in replicative cell-cycle progression. Cancer cells that arrest in the G2 phase of the cell cycle when irradiated may become exquisitely sensitive to killing by further low-dose-rate radiation treatment. Oncogenic human papillomaviruses (HPVs), which play a major role in the pathogenesis of uterine cervix cancers and other urogenital cancers, encode E6 and E7 transforming proteins known to abrogate a p53-dependent G1 cell-cycle checkpoint activated by conventional acute-dose radiation exposure. This study examined whether expression of HPV E6 and E7 oncoproteins by cancer cells alters the cell-cycle redistribution patterns accompanying low-dose-rate radiation treatment, and whether such alterations in cell-cycle redistribution affect cancer cell killing. Methods and Materials: RKO carcinoma cells, which contain wild-type P53 alleles, and RKO cell sublines genetically engineered to express HPV E6 and E7 oncoproteins, were treated with low-dose-rate (0.25-Gy/h) radiation and then assessed for p53 and p21WAF1/CIP1 polypeptide induction by immunoblot analysis, for cell-cycle redistribution by flow cytometry, and for cytotoxicity by clonogenic survival assay. Results: Low-dose-rate radiation of RKO carcinoma cells triggered p53 polypeptide elevations, p21WAF1/CIP1 induction, and arrest in the G1 and G2 phases of the cell cycle. In contrast, RKO cells expressing E6 and E7 transforming proteins from high-risk oncogenic HPVs (HPV 16) arrested in G2, but failed to arrest in G1, when treated with low-dose-rate ionizing radiation. Abrogation of the G1 cell-cycle checkpoint activated by low-dose-rate radiation exposure appeared to be a characteristic feature of transforming proteins from high-risk oncogenic HPVs: RKO cells expressing E6 from a low

The human papillomavirus (HPV) E6 oncoproteins promotes nuclear localization of active caspase 8

Energy Technology Data Exchange (ETDEWEB)

Manzo-Merino, Joaquin [Unidad de Investigación Biomédica en Cáncer, Instituto Nacional de Cancerología, México/Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México. Av. San Fernando No. 22, Col. Sección XVI, Tlalpan 14080 (Mexico); Massimi, Paola [International Centre for Genetic Engineering and Biotechnology, Padriciano 99, I-34149 Trieste (Italy); Lizano, Marcela, E-mail: lizanosoberon@gmail.com [Unidad de Investigación Biomédica en Cáncer, Instituto Nacional de Cancerología, México/Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México. Av. San Fernando No. 22, Col. Sección XVI, Tlalpan 14080 (Mexico); Banks, Lawrence, E-mail: banks@icgeb.org [International Centre for Genetic Engineering and Biotechnology, Padriciano 99, I-34149 Trieste (Italy)

2014-02-15

The HPV-16 E6 and E6{sup ⁎} proteins have been shown previously to be capable of regulating caspase 8 activity. We now show that the capacity of E6 to interact with caspase 8 is common to diverse HPV types, being also seen with HPV-11 E6, HPV-18 E6 and HPV-18 E6{sup ⁎}. Unlike most E6-interacting partners, caspase 8 does not appear to be a major proteasomal target of E6, but instead E6 appears able to stimulate caspase 8 activation, without affecting the overall apoptotic activity. This would appear to be mediated in part by the ability of the HPV E6 oncoproteins to recruit active caspase 8 to the nucleus. - Highlights: • Multiple HPV E6 oncoproteins interact with the caspase 8 DED domain. • HPV E6 stimulates activation of caspase 8. • HPV E6 promotes nuclear accumulation of caspase 8.

The human papillomavirus (HPV) E6 oncoproteins promotes nuclear localization of active caspase 8

International Nuclear Information System (INIS)

Manzo-Merino, Joaquin; Massimi, Paola; Lizano, Marcela; Banks, Lawrence

2014-01-01

The HPV-16 E6 and E6 ⁎ proteins have been shown previously to be capable of regulating caspase 8 activity. We now show that the capacity of E6 to interact with caspase 8 is common to diverse HPV types, being also seen with HPV-11 E6, HPV-18 E6 and HPV-18 E6 ⁎ . Unlike most E6-interacting partners, caspase 8 does not appear to be a major proteasomal target of E6, but instead E6 appears able to stimulate caspase 8 activation, without affecting the overall apoptotic activity. This would appear to be mediated in part by the ability of the HPV E6 oncoproteins to recruit active caspase 8 to the nucleus. - Highlights: • Multiple HPV E6 oncoproteins interact with the caspase 8 DED domain. • HPV E6 stimulates activation of caspase 8. • HPV E6 promotes nuclear accumulation of caspase 8

Recombinant TAT-BMI-1 fusion protein induces ex vivo expansion of human umbilical cord blood-derived hematopoietic stem cells.

Science.gov (United States)

Codispoti, Bruna; Rinaldo, Nicola; Chiarella, Emanuela; Lupia, Michela; Spoleti, Cristina Barbara; Marafioti, Maria Grazia; Aloisio, Annamaria; Scicchitano, Stefania; Giordano, Marco; Nappo, Giovanna; Lucchino, Valeria; Moore, Malcolm A S; Zhou, Pengbo; Mesuraca, Maria; Bond, Heather Mandy; Morrone, Giovanni

2017-07-04

Transplantation of hematopoietic stem cells (HSCs) is a well-established therapeutic approach for numerous disorders. HSCs are typically derived from bone marrow or peripheral blood after cytokine-induced mobilization. Umbilical cord blood (CB) represents an appealing alternative HSC source, but the small amounts of the individual CB units have limited its applications. The availability of strategies for safe ex vivo expansion of CB-derived HSCs (CB-HSCs) may allow to extend the use of these cells in adult patients and to avoid the risk of insufficient engraftment or delayed hematopoietic recovery.Here we describe a system for the ex vivo expansion of CB-HSCs based on their transient exposure to a recombinant TAT-BMI-1 chimeric protein. BMI-1 belongs to the Polycomb family of epigenetic modifiers and is recognized as a central regulator of HSC self-renewal. Recombinant TAT-BMI-1 produced in bacteria was able to enter the target cells via the HIV TAT-derived protein transduction peptide covalently attached to BMI-1, and conserved its biological activity. Treatment of CB-CD34+ cells for 3 days with repeated addition of 10 nM purified TAT-BMI-1 significantly enhanced total cell expansion as well as that of primitive hematopoietic progenitors in culture. Importantly, TAT-BMI-1-treated CB-CD34+ cells displayed a consistently higher rate of multi-lineage long-term repopulating activity in primary and secondary xenotransplants in immunocompromised mice. Thus, recombinant TAT-BMI-1 may represent a novel, effective reagent for ex vivo expansion of CB-HSC for therapeutic purposes.

Restoration of type 1 iodothyronine deiodinase expression in renal cancer cells downregulates oncoproteins and affects key metabolic pathways as well as anti-oxidative system.

Science.gov (United States)

Popławski, Piotr; Wiśniewski, Jacek R; Rijntjes, Eddy; Richards, Keith; Rybicka, Beata; Köhrle, Josef; Piekiełko-Witkowska, Agnieszka

2017-01-01

Type 1 iodothyronine deiodinase (DIO1) contributes to deiodination of 3,5,3',5'-tetraiodo-L-thyronine (thyroxine, T4) yielding of 3,5,3'-triiodothyronine (T3), a powerful regulator of cell differentiation, proliferation, and metabolism. Our previous work showed that loss of DIO1 enhances proliferation and migration of renal cancer cells. However, the global effects of DIO1 expression in various tissues affected by cancer remain unknown. Here, the effects of stable DIO1 re-expression were analyzed on the proteome of renal cancer cells, followed by quantitative real-time PCR validation in two renal cancer-derived cell lines. DIO1-induced changes in intracellular concentrations of thyroid hormones were quantified by L-MS/MS and correlations between expression of DIO1 and potential target genes were determined in tissue samples from renal cancer patients. Stable re-expression of DIO1, resulted in 26 downregulated proteins while 59 proteins were overexpressed in renal cancer cells. The 'downregulated' group consisted mainly of oncoproteins (e.g. STAT3, ANPEP, TGFBI, TGM2) that promote proliferation, migration and invasion. Furthermore, DIO1 re-expression enhanced concentrations of two subunits of thyroid hormone transporter (SLC7A5, SLC3A2), enzymes of key pathways of cellular energy metabolism (e.g. TKT, NAMPT, IDH2), sex steroid metabolism and anti-oxidative response (AKR1C2, AKR1B10). DIO1 expression resulted in elevated intracellular concentration of T4. Expression of DIO1-affected genes strongly correlated with DIO1 transcript levels in tissue samples from renal cancer patients as well as with their poor survival. This first study addressing effects of deiodinase re-expression on proteome of cancer cells demonstrates that induced DIO1 re-expression in renal cancer robustly downregulates oncoproteins, affects key metabolic pathways, and triggers proteins involved in anti-oxidative protection. This data supports the notion that suppressed DIO1 expression and changes

Restoration of type 1 iodothyronine deiodinase expression in renal cancer cells downregulates oncoproteins and affects key metabolic pathways as well as anti-oxidative system.

Directory of Open Access Journals (Sweden)

Piotr Popławski

Full Text Available Type 1 iodothyronine deiodinase (DIO1 contributes to deiodination of 3,5,3',5'-tetraiodo-L-thyronine (thyroxine, T4 yielding of 3,5,3'-triiodothyronine (T3, a powerful regulator of cell differentiation, proliferation, and metabolism. Our previous work showed that loss of DIO1 enhances proliferation and migration of renal cancer cells. However, the global effects of DIO1 expression in various tissues affected by cancer remain unknown. Here, the effects of stable DIO1 re-expression were analyzed on the proteome of renal cancer cells, followed by quantitative real-time PCR validation in two renal cancer-derived cell lines. DIO1-induced changes in intracellular concentrations of thyroid hormones were quantified by L-MS/MS and correlations between expression of DIO1 and potential target genes were determined in tissue samples from renal cancer patients. Stable re-expression of DIO1, resulted in 26 downregulated proteins while 59 proteins were overexpressed in renal cancer cells. The 'downregulated' group consisted mainly of oncoproteins (e.g. STAT3, ANPEP, TGFBI, TGM2 that promote proliferation, migration and invasion. Furthermore, DIO1 re-expression enhanced concentrations of two subunits of thyroid hormone transporter (SLC7A5, SLC3A2, enzymes of key pathways of cellular energy metabolism (e.g. TKT, NAMPT, IDH2, sex steroid metabolism and anti-oxidative response (AKR1C2, AKR1B10. DIO1 expression resulted in elevated intracellular concentration of T4. Expression of DIO1-affected genes strongly correlated with DIO1 transcript levels in tissue samples from renal cancer patients as well as with their poor survival. This first study addressing effects of deiodinase re-expression on proteome of cancer cells demonstrates that induced DIO1 re-expression in renal cancer robustly downregulates oncoproteins, affects key metabolic pathways, and triggers proteins involved in anti-oxidative protection. This data supports the notion that suppressed DIO1 expression

[PRODUCT OF THE BMI1--A KEY COMPONENT OF POLYCOMB--POSITIVELY REGULATES ADIPOCYTE DIFFERENTIATION OF MOUSE MESENCHYMAL STEM CELLS].

Science.gov (United States)

Petrov, N S; Vereschagina, N A; Sushilova, E N; Kropotov, A V; Miheeva, N F; Popov, B V

2016-01-01

Bmil is a key component of Polycomb (PcG), which in mammals controls the basic functions of mammalian somatic stem cells (SSC) such as self-renewal and differentiation. Bmi1 supports SSC via transcriptional suppression of genes associated with cell cycle and differentiation. The most studied target genes of Bmi1 are the genes of Ink4 locus, CdkI p16(Ink4a) and p1(Arf), suppression of which due to activating mutations of the BMI1 results in formation of cancer stem cells (CSC) and carcinomas in various tissues. In contrast, inactivation of BMI1 results in cell cycle arrest and cell senescence. Although clinical phenomena of hypo- and hyperactivation of BMI1 are well known, its targets and mechanisms of regulation of tissue specific SSC are still obscure. The goal of this study was to evaluate the regulatory role of BMI1 in adipocyte differentiation (AD) of mouse mesenchymal stem cells (MSC). Induction of AD in mouse MSC of the C3H10T1/2 cell line was associated with an increase in the expression levels of BMI1, the genes of pRb family (RB, p130) and demethylase UTX, but not methyltransferase EZH2, whose products regulate the methylation levels of H3K27. It was observed earlier that H3K27me3 may play the role of the epigenetic switch by promoting AD of human MSC via activating expression of the PPARγ2, the master gene of AD (Hemming et al., 2014). Here we show that inactivation of BMI1 using specific siRNA slows and decreases the levels of AD, but does not abolish it. This is associated with a complete inhibition of the expression of adipogenic marker genes--PPARγ2, ADIPOQ and a decrease in the expression of RB, p130, but not UTX. The results obtained give evidence that the epigenetic mechanism regulating AD differentiation in mouse and human MSC is different.

Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma

International Nuclear Information System (INIS)

Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S

2014-01-01

Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC

Prospective associations between sedentary lifestyle and BMI in midlife.

Science.gov (United States)

Mortensen, Laust H; Siegler, Ilene C; Barefoot, John C; Grønbaek, Morten; Sørensen, Thorkild I A

2006-08-01

A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle. Using data from four follow-ups of the University of North Carolina Alumni Heart Study, we examined the prospective associations between BMI and sedentary lifestyle in a cohort of 4595 middle-aged men and women who had responded to questionnaires at the ages of 41 (standard deviation 2.3), 44 (2.3), 46 (2.0), and 54 (2.0). BMI was consistently related to increased risk of becoming sedentary in both men and women. The odds ratios of becoming sedentary as predicted by BMI were 1.04 (95% confidence limits, 1.00, 1.07) per 1 kg/m(2) from ages 41 to 44, 1.10 (1.07, 1.14) from ages 44 to 46, and 1.12 (1.08, 1.17) from ages 46 to 54. Controlling for concurrent changes in BMI marginally attenuated the effects. Sedentary lifestyle did not predict changes in BMI, except when concurrent changes in physical activity were taken into account (p sedentary lifestyle but did not provide unambiguous evidence for an effect of sedentary lifestyle on weight gain.

Dysregulation of the Bmi-1/p16Ink4a pathway provokes an aging-associated decline of submandibular gland function

Science.gov (United States)

Yamakoshi, Kimi; Katano, Satoshi; Iida, Mayu; Kimura, Hiromi; Okuma, Atsushi; Ikemoto-Uezumi, Madoka; Ohtani, Naoko; Hara, Eiji; Maruyama, Mitsuo

2015-01-01

Bmi-1 prevents stem cell aging, at least partly, by blocking expression of the cyclin-dependent kinase inhibitor p16Ink4a. Therefore, dysregulation of the Bmi-1/p16Ink4a pathway is considered key to the loss of tissue homeostasis and development of associated degenerative diseases during aging. However, because Bmi-1 knockout (KO) mice die within 20 weeks after birth, it is difficult to determine exactly where and when dysregulation of the Bmi-1/p16Ink4a pathway occurs during aging in vivo. Using real-time in vivo imaging of p16Ink4a expression in Bmi-1-KO mice, we uncovered a novel function of the Bmi-1/p16Ink4a pathway in controlling homeostasis of the submandibular glands (SMGs), which secrete saliva into the oral cavity. This pathway is dysregulated during aging in vivo, leading to induction of p16Ink4a expression and subsequent declined SMG function. These findings will advance our understanding of the molecular mechanisms underlying the aging-related decline of SMG function and associated salivary gland hypofunction, which is particularly problematic among the elderly. PMID:25832744

[In vitro study of joint intervention of E-cad and Bmi-1 mediated by transcription activator-like effector nuclease in nasopharyngeal carcinoma].

Science.gov (United States)

Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong

2018-03-28

To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells.
 Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay.
 Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all Pcad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.

Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

International Nuclear Information System (INIS)

Tátrai, Péter; Szepesi, Áron; Matula, Zsolt; Szigeti, Anna; Buchan, Gyöngyi; Mádi, András; Uher, Ferenc

2012-01-01

Highlights: ► We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. ► hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. ► SV40T introduced along with hTERT abrogates proliferation control and multipotency. ► hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC hTERT , ASC Bmi-1 , ASC Bmi-1+hTERT and ASC SV40T+hTERT were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC Bmi-1 had limited replicative potential, while the rapidly proliferating ASC SV40T+hTERT acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC hTERT and ASC hTERT+Bmi-1 , on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC hTERT also acquired aberrant karyotype and showed signs of transformation after long-term culture. In conclusion, hTERT alone was sufficient to extend the life span of human ASC, but ASC hTERT are prone to transformation during extensive

Neurodevelopmental problems and extremes in BMI

Directory of Open Access Journals (Sweden)

Nóra Kerekes

2015-07-01

Full Text Available Background. Over the last few decades, an increasing number of studies have suggested a connection between neurodevelopmental problems (NDPs and body mass index (BMI. Attention deficit/hyperactivity disorder (ADHD and autism spectrum disorders (ASD both seem to carry an increased risk for developing extreme BMI. However, the results are inconsistent, and there have been only a few studies of the general population of children.Aims. We had three aims with the present study: (1 to define the prevalence of extreme (low or high BMI in the group of children with ADHD and/or ASDs compared to the group of children without these NDPs; (2 to analyze whether extreme BMI is associated with the subdomains within the diagnostic categories of ADHD or ASD; and (3 to investigate the contribution of genetic and environmental factors to BMI in boys and girls at ages 9 and 12.Method. Parents of 9- or 12-year-old twins (n = 12,496 were interviewed using the Autism—Tics, ADHD and other Comorbidities (A-TAC inventory as part of the Child and Adolescent Twin Study in Sweden (CATSS. Univariate and multivariate generalized estimated equation models were used to analyze associations between extremes in BMI and NDPs.Results. ADHD screen-positive cases followed BMI distributions similar to those of children without ADHD or ASD. Significant association was found between ADHD and BMI only among 12-year-old girls, where the inattention subdomain of ADHD was significantly associated with the high extreme BMI. ASD scores were associated with both the low and the high extremes of BMI. Compared to children without ADHD or ASD, the prevalence of ASD screen-positive cases was three times greater in the high extreme BMI group and double as much in the low extreme BMI group. Stereotyped and repetitive behaviors were significantly associated with high extreme BMIs.Conclusion. Children with ASD, with or without coexisting ADHD, are more prone to have low or high extreme BMIs than

Childhood BMI growth trajectories and endometrial cancer risk

DEFF Research Database (Denmark)

Aarestrup, Julie; Gamborg, Michael; Tilling, Kate

2017-01-01

Previously, we found that excess weight already in childhood has positive associations with endometrial cancer, however, associations with changes in body mass index (BMI) during childhood are not well understood. Therefore, we examined whether growth in childhood BMI is associated with endometrial...... cancer and its sub-types. A cohort of 155,505 girls from the Copenhagen School Health Records Register with measured weights and heights at the ages of 6 to 14 years and born 1930-89 formed the analytical population. BMI was transformed to age-specific z-scores. Using linear spline multilevel models......, each girl's BMI growth trajectory was estimated as the deviance from the average trajectory for three different growth periods (6.25-7.99, 8.0-10.99, 11.0-14.0 years). Via a link to health registers, 1020 endometrial cancer cases were identified, and Cox regressions were performed. A greater gain...

Mutagenic Potential ofBos taurus Papillomavirus Type 1 E6 Recombinant Protein: First Description

Directory of Open Access Journals (Sweden)

Rodrigo Pinheiro Araldi

2015-01-01

Full Text Available Bovine papillomavirus (BPV is considered a useful model to study HPV oncogenic process. BPV interacts with the host chromatin, resulting in DNA damage, which is attributed to E5, E6, and E7 viral oncoproteins activity. However, the oncogenic mechanisms of BPV E6 oncoprotein per se remain unknown. This study aimed to evaluate the mutagenic potential of Bos taurus papillomavirus type 1 (BPV-1 E6 recombinant oncoprotein by the cytokinesis-block micronucleus assay (CBMNA and comet assay (CA. Peripheral blood samples of five calves were collected. Samples were subjected to molecular diagnosis, which did not reveal presence of BPV sequences. Samples were treated with 1 μg/mL of BPV-1 E6 oncoprotein and 50 μg/mL of cyclophosphamide (positive control. Negative controls were not submitted to any treatment. The samples were submitted to the CBMNA and CA. The results showed that BPV E6 oncoprotein induces clastogenesis per se, which is indicative of genomic instability. These results allowed better understanding the mechanism of cancer promotion associated with the BPV E6 oncoprotein and revealed that this oncoprotein can induce carcinogenesis per se. E6 recombinant oncoprotein has been suggested as a possible vaccine candidate. Results pointed out that BPV E6 recombinant oncoprotein modifications are required to use it as vaccine.

Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

Energy Technology Data Exchange (ETDEWEB)

Tatrai, Peter, E-mail: peter.tatrai@biomembrane.hu [Institute of Enzymology, Research Center for Natural Sciences, Hungarian Academy of Sciences, Karolina ut 29, H-1113 Budapest (Hungary); Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Szepesi, Aron, E-mail: aron.szepesi@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Matula, Zsolt, E-mail: matula.zsolt@gmail.com [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Szigeti, Anna, E-mail: anna.szigeti@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Buchan, Gyoengyi, E-mail: buchan@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Madi, Andras, E-mail: madi@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Stem Cell, Apoptosis and Genomics Research Group of the Hungarian Academy of Sciences, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Uher, Ferenc, E-mail: uher@biomembrane.hu [Stem Cell Laboratory, Hungarian National Blood Transfusion Service, Dioszegi ut 64, H-1113 Budapest (Hungary); and others

2012-05-25

Highlights: Black-Right-Pointing-Pointer We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. Black-Right-Pointing-Pointer hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. Black-Right-Pointing-Pointer SV40T introduced along with hTERT abrogates proliferation control and multipotency. Black-Right-Pointing-Pointer hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC{sup hTERT}, ASC{sup Bmi-1}, ASC{sup Bmi-1+hTERT} and ASC{sup SV40T+hTERT} were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC{sup Bmi-1} had limited replicative potential, while the rapidly proliferating ASC{sup SV40T+hTERT} acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC{sup hTERT} and ASC{sup hTERT+Bmi-1}, on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC{sup hTERT} also acquired aberrant karyotype and showed signs of transformation after long-term culture

MicroRNA-330-3p Expression Indicates Good Prognosis and Suppresses Cell Proliferation by Targeting Bmi-1 in Osteosarcoma

Directory of Open Access Journals (Sweden)

Zhenxin Zheng

2018-03-01

Full Text Available Background/Aims: Growing evidence has shown that miR-330-3p is closely related to the biological behavior of cancer, including proliferation, metastasis, and prognosis. However, there have been no reports on miR-330-3p expression and function in osteosarcoma. Methods: Expression of miR-330-3p in osteosarcoma tissues and cell lines was examined by quantitative PCR. Effects of miR-330-3p on osteosarcoma cell proliferation were investigated in vitro with the Cell Counting Kit-8 colorimetric assay. Targets of miR-330-3p were identified by dual-luciferase reporter assay. Results: The results showed that expression of miR-330 decreased in osteosarcoma tissues and cell lines. Prognosis of patients with high miR-330-3p expression was much better than that of those with low expression (P=0.001, and multivariate analysis suggested that miR-330-3p is an independent prognostic factor for osteosarcoma. In addition, miR-330-3p overexpression significantly inhibited the growth of MG-63 and U2OS osteosarcoma cells. Dual-luciferase reporter assay demonstrated that Bmi-1 was a direct target gene of miR-330-3p, and in a recovery experiment, miR-330-3p suppressed osteosarcoma cell proliferation by directly targeting Bmi-1. Conclusion: Our results suggest that miR-330-3p acts as a tumor suppressor by regulating Bmi-1 expression in osteosarcoma. Thus, miR-330-3p may represent a novel therapeutic target for the treatment of osteosarcoma.

Physical Activity, Sleep, and BMI Percentile in Rural and Urban Ugandan Youth.

Science.gov (United States)

Christoph, Mary J; Grigsby-Toussaint, Diana S; Baingana, Rhona; Ntambi, James M

Uganda is experiencing a dual burden of over- and undernutrition, with overweight prevalence increasing while underweight remains common. Potential weight-related factors, particularly physical activity, sleep, and rural/urban status, are not currently well understood or commonly assessed in Ugandan youth. The purpose of this study was to pilot test a survey measuring weight-related factors in rural and urban Ugandan schoolchildren. A cross-sectional survey measured sociodemographics, physical activity, sleep patterns, and dietary factors in 148 rural and urban schoolchildren aged 11-16 in central Uganda. Height and weight were objectively measured. Rural and urban youth were compared on these factors using χ 2 and t tests. Regression was used to identify correlates of higher body mass index (BMI) percentile in the full sample and nonstunted youth. Youth were on average 12.1 ± 1.1 years old; underweight (10%) was more common than overweight (1.4%). Self-reported sleep duration and subjective sleep quality did not differ by rural/urban residence. Rural children overall had higher BMI percentile and marginally higher stunting prevalence. In adjusted analyses in both the full and nonstunted samples, higher BMI percentile was related to living in a rural area, higher frequency of physical activity, and higher subjective sleep quality; it was negatively related to being active on weekends. In the full sample, higher BMI percentile was also related to female gender, whereas in nonstunted youth, higher BMI was related to age. BMI percentile was unrelated to sedentary time, performance of active chores and sports, and dietary factors. This study is one of the first to pilot test a survey assessing weight-related factors, particularly physical activity and sleep, in Ugandan schoolchildren. BMI percentile was related to several sociodemographic, sleep, and physical activity factors among primarily normal-weight school children in Uganda, providing a basis for

Optimum BMI cut points to screen asian americans for type 2 diabetes.

Science.gov (United States)

Araneta, Maria Rosario G; Kanaya, Alka M; Hsu, William C; Chang, Healani K; Grandinetti, Andrew; Boyko, Edward J; Hayashi, Tomoshige; Kahn, Steven E; Leonetti, Donna L; McNeely, Marguerite J; Onishi, Yukiko; Sato, Kyoko K; Fujimoto, Wilfred Y

2015-05-01

Asian Americans manifest type 2 diabetes at low BMI levels but may not undergo diagnostic testing for diabetes if the currently recommended BMI screening cut point of ≥25 kg/m(2) is followed. We aimed to ascertain an appropriate lower BMI cut point among Asian-American adults without a prior diabetes diagnosis. We consolidated data from 1,663 participants, ages ≥45 years, without a prior diabetes diagnosis, from population- and community-based studies, including the Mediators of Atherosclerosis in South Asians Living in America study, the North Kohala Study, the Seattle Japanese American Community Diabetes Study, and the University of California San Diego Filipino Health Study. Clinical measures included a 2-h 75-g oral glucose tolerance test, BMI, and glycosylated hemoglobin (HbA1c). Mean age was 59.7 years, mean BMI was 25.4 kg/m(2), 58% were women, and type 2 diabetes prevalence (American Diabetes Association 2010 criteria) was 16.9%. At BMI ≥25 kg/m(2), sensitivity (63.7%), specificity (52.8%), and Youden index (0.16) values were low; limiting screening to BMI ≥25 kg/m(2) would miss 36% of Asian Americans with type 2 diabetes. For screening purposes, higher sensitivity is desirable to minimize missing cases, especially if the diagnostic test is relatively simple and inexpensive. At BMI ≥23 kg/m(2), sensitivity (84.7%) was high in the total sample and by sex and Asian-American subgroup and would miss only ∼15% of Asian Americans with diabetes. The BMI cut point for identifying Asian Americans who should be screened for undiagnosed type 2 diabetes should be <25 kg/m(2), and ≥23 kg/m(2) may be the most practical. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

p38 MAPK-Mediated Bmi-1 Down-Regulation and Defective Proliferation in ATM-Deficient Neural Stem Cells Can Be Restored by Akt Activation

Science.gov (United States)

Kim, Jeesun; Hwangbo, Jeon; Wong, Paul K. Y.

2011-01-01

A-T (ataxia telangiectasia) is a genetic disease caused by a mutation in the Atm (A-T mutated) gene that leads to neurodegeneration. Despite an increase in the numbers of studies in this area in recent years, the mechanisms underlying neurodegeneration in human A-T are still poorly understood. Previous studies demonstrated that neural stem cells (NSCs) isolated from the subventricular zone (SVZ) of Atm -/- mouse brains show defective self-renewal and proliferation, which is accompanied by activation of chronic p38 mitogen-activated protein kinase (MAPK) and a lower level of the polycomb protein Bmi-1. However, the mechanism underlying Bmi-1 down-regulation and its relevance to defective proliferation in Atm-/- NSCs remained unclear. Here, we show that over-expression of Bmi-1 increases self-renewal and proliferation of Atm-/- NSCs to normal, indicating that defective proliferation in Atm-/- NSCs is a consequence of down-regulation of Bmi-1. We also demonstrate that epidermal growth factor (EGF)-induced Akt phosphorylation renders Bmi-1 resistant to the proteasomal degradation, leading to its stabilization and accumulation in the nucleus. However, inhibition of the Akt-dependent Bmi-1 stabilizing process by p38 MAPK signaling reduces the levels of Bmi-1. Treatment of the Atm-/- NSCs with a specific p38 MAPK inhibitor SB203580 extended Bmi-1 posttranscriptional turnover and H2A ubiquitination in Atm-/- NSCs. Our observations demonstrate the molecular basis underlying the impairment of self-renewal and proliferation in Atm-/- NSCs through the p38 MAPK-Akt-Bmi-1-p21 signaling pathway. PMID:21305053

CD133 and BMI1 expressions and its prognostic role in primary ...

Indian Academy of Sciences (India)

This study aimed to analyse the expression of CD133 mRNA and its correlations ... CD133 mRNA and BMI1 protein expression could independently predict the glioblastoma .... treatment at the National Institute of Mental Health and Neu- .... Low. 16 (76.2). High. 53 mutations of which 38 were exonic and 15 were intronic.

Bcr-Abl oncoproteins bind directly to activators of the Ras signalling pathway.

OpenAIRE

Puil, L; Liu, J; Gish, G; Mbamalu, G; Bowtell, D; Pelicci, P G; Arlinghaus, R; Pawson, T

1994-01-01

The cytosolic 185 and 210 kDa Bcr-Abl protein tyrosine kinases play important roles in the development of Philadelphia chromosome positive (Ph+) chronic myelogenous leukemia (CML) and acute lymphoblastic leukemia (Ph+ ALL). p185 and p210 Bcr-Abl contain identical abl-encoded sequences juxtaposed to a variable number of bcr-derived amino acids. As the mitogenic and transforming activities of tyrosine kinases involve stimulation of the Ras pathway, we analyzed Bcr-Abl oncoproteins for interacti...

BMI change during puberty and the risk of heart failure.

Science.gov (United States)

Kindblom, J M; Bygdell, M; Sondén, A; Célind, J; Rosengren, A; Ohlsson, C

2018-03-12

Hospitalization for heart failure amongst younger men has increased. The reason for this is unknown but it coincides with the obesity epidemic. The aim of this study was to evaluate the association between childhood BMI (Body Mass Index) and BMI change during puberty for risk of adult heart failure in men. Using the BMI Epidemiology Study (BEST), a population-based study in Gothenburg, Sweden, we collected information on childhood BMI at age 8 years and BMI change during puberty (BMI at age 20 - BMI at 8) for men born 1945-1961, followed until December 2013 (n = 37 670). BMI was collected from paediatric growth charts and mandatory military conscription tests. Information on heart failure was retrieved from high-quality national registers (342 first hospitalizations for heart failure). BMI change during puberty was independently of childhood BMI associated with risk of heart failure in a nonlinear J-shaped manner. Subjects in the upper quartile of BMI change during puberty (Q4) had more than twofold increased risk of heart failure compared with subjects in Q1 [HR (Hazard Ratio) = 2.29, 95% CI (Confidence Interval) 1.68-3.12]. Childhood BMI was not independently associated with risk of heart failure. Boys developing overweight during puberty (HR 3.14; 95% CI 2.25-4.38) but not boys with childhood overweight that normalized during puberty (HR 1.12, 95% CI 0.63-2.00) had increased risk of heart failure compared with boys without childhood or young adult overweight. BMI change during puberty is a novel risk factor for adult heart failure in men. © 2018 The Association for the Publication of the Journal of Internal Medicine.

Meta-analysis of genome-wide linkage studies in BMI and obesity

NARCIS (Netherlands)

Saunders, Catherine L.; Chiodini, Benedetta D.; Sham, Pak; Lewis, Cathryn M.; Abkevich, Victor; Adeyemo, Adebowale A.; de Andrade, Mariza; Arya, Rector; Berenson, Gerald S.; Blangero, John; Boehnke, Michael; Borecki, Ingrid B.; Chagnon, Yvon C.; Chen, Wei; Comuzzie, Anthony G.; Deng, Hong-Wen; Duggirala, Ravindranath; Feitosa, Mary F.; Froguel, Philippe; Hanson, Robert L.; Hebebrand, Johannes; Huezo-Dias, Patricia; Kissebah, Ahmed H.; Li, Weidong; Luke, Amy; Martin, Lisa J.; Nash, Matthew; Ohman, Muena; Palmer, Lyle J.; Peltonen, Leena; Perola, Markus; Price, R. Arlen; Redline, Susan; Srinivasan, Sathanur R.; Stern, Michael P.; Stone, Steven; Stringham, Heather; Turner, Stephen; Wijmenga, Cisca; Collier, David A.

Objective: The objective was to provide an overall assessment of genetic linkage data of BMI and BMI-defined obesity using a nonparametric genome scan meta-analysis. Research Methods and Procedures: We identified 37 published studies containing data on over 31,000 individuals from more than >10,000

Associations of maternal macronutrient intake during pregnancy with infant BMI peak characteristics and childhood BMI.

Science.gov (United States)

Chen, Ling-Wei; Aris, Izzuddin M; Bernard, Jonathan Y; Tint, Mya-Thway; Colega, Marjorelee; Gluckman, Peter D; Tan, Kok Hian; Shek, Lynette Pei-Chi; Chong, Yap-Seng; Yap, Fabian; Godfrey, Keith M; van Dam, Rob M; Chong, Mary Foong-Fong; Lee, Yung Seng

2017-03-01

Background: Infant body mass index (BMI) peak characteristics and early childhood BMI are emerging markers of future obesity and cardiometabolic disease risk, but little is known about their maternal nutritional determinants. Objective: We investigated the associations of maternal macronutrient intake with infant BMI peak characteristics and childhood BMI in the Growing Up in Singapore Towards healthy Outcomes study. Design: With the use of infant BMI data from birth to age 18 mo, infant BMI peak characteristics [age (in months) and magnitude (BMI peak ; in kg/m 2 ) at peak and prepeak velocities] were derived from subject-specific BMI curves that were fitted with the use of mixed-effects model with a natural cubic spline function. Associations of maternal macronutrient intake (assessed by using a 24-h recall during late gestation) with infant BMI peak characteristics ( n = 910) and BMI z scores at ages 2, 3, and 4 y were examined with the use of multivariable linear regression. Results: Mean absolute maternal macronutrient intakes (percentages of energy) were 72 g protein (15.6%), 69 g fat (32.6%), and 238 g carbohydrate (51.8%). A 25-g (∼100-kcal) increase in maternal carbohydrate intake was associated with a 0.01/mo (95% CI: 0.0003, 0.01/mo) higher prepeak velocity and a 0.04 (95% CI: 0.01, 0.08) higher BMI peak These associations were mainly driven by sugar intake, whereby a 25-g increment of maternal sugar intake was associated with a 0.02/mo (95% CI: 0.01, 0.03/mo) higher infant prepeak velocity and a 0.07 (95% CI: 0.01, 0.13) higher BMI peak Higher maternal carbohydrate and sugar intakes were associated with a higher offspring BMI z score at ages 2-4 y. Maternal protein and fat intakes were not consistently associated with the studied outcomes. Conclusion: Higher maternal carbohydrate and sugar intakes are associated with unfavorable infancy BMI peak characteristics and higher early childhood BMI. This trial was registered at clinicaltrials.gov as NCT

c-Myb and its target Bmi1 are required for p190BCR/ABL leukemogenesis in mouse and human cells.

Science.gov (United States)

Waldron, T; De Dominici, M; Soliera, A R; Audia, A; Iacobucci, I; Lonetti, A; Martinelli, G; Zhang, Y; Martinez, R; Hyslop, T; Bender, T P; Calabretta, B

2012-04-01

Expression of c-Myb is required for normal hematopoiesis and for proliferation of myeloid leukemia blasts and a subset of T-cell leukemia, but its role in B-cell leukemogenesis is unknown. We tested the role of c-Myb in p190(BCR/ABL)-dependent B-cell leukemia in mice transplanted with p190(BCR/ABL)-transduced marrow cells with a c-Myb allele (Myb(f/d)) and in double transgenic p190(BCR/ABL)/Myb(w/d) mice. In both models, loss of a c-Myb allele caused a less aggressive B-cell leukemia. In p190(BCR/ABL)-expressing human B-cell leukemia lines, knockdown of c-Myb expression suppressed proliferation and colony formation. Compared with c-Myb(w/f) cells, expression of Bmi1, a regulator of stem cell proliferation and maintenance, was decreased in pre-B cells from Myb(w/d) p190(BCR/ABL) transgenic mice. Ectopic expression of a mutant c-Myb or Bmi1 enhanced the proliferation and colony formation of Myb(w/d) p190(BCR/ABL) B-cells; by contrast, Bmi1 downregulation inhibited colony formation of p190(BCR/ABL)-expressing murine B cells and human B-cell leukemia lines. Moreover, c-Myb interacted with a segment of the human Bmi1 promoter and enhanced its activity. In blasts from 19 Ph(1) adult acute lymphoblastic leukemia patients, levels of c-Myb and Bmi1 showed a positive correlation. Together, these findings support the existence of a c-Myb-Bmi1 transcription-regulatory pathway required for p190(BCR/ABL) leukemogenesis.

BMI at birth and overweight at age four.

Science.gov (United States)

Winter, Jonathan D; Taylor, Yhenneko; Mowrer, Lauren; Winter, Katherine M; Dulin, Michael F

Extensive investigation has established that an elevated weight at birth is associated with subsequent obesity and obesity related negative health outcomes. The significance of overweight at birth, however, remains ill-defined. Historically, it has been difficult to approximate adiposity in infancy in a way that is both simple and meaningful. Body-mass-index (BMI) growth charts for children younger than two years of age only became available in 2006 when published by the WHO. This retrospective cohort analysis utilised anthropometric data extracted from the electronic medical record of a large integrated healthcare system in North Carolina. BMI and weight-for-age (WFA) >85% of WHO growth charts measured newborn overweight and macrosomia respectively. Logistic regression models assessed the associations between newborn macrosomia and overweight and overweight at 4 years of age, as well as associations with maternal BMI. Models included demographic data, gestational age, and maternal diabetes status as covariates. Both BMI and WFA >85% at birth were significantly associated with overweight at age 4 years. However, the greater odds of overweight was associated with newborn BMI >85%, with an adjusted odds ratio (AOR) of 2.08 (95% confidence interval [CI]: 1.4-3.08) versus 1.57 (95% CI: 1.08-2.27). Maternal obesity was also more robustly correlated with newborn BMI >85%, AOR of 4.14 (95% CI: 1.6-10.7), than with newborn WFA >85%, AOR of 3.09 (95% CI: 1.41-6.77). BMI >85% at birth is independently associated with overweight at 4 years. Newborn overweight is perhaps superior to newborn macrosomia in predicting overweight at age 4. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

The Role of BMI in Hip Fracture Surgery.

Science.gov (United States)

Akinleye, Sheriff D; Garofolo, Garret; Culbertson, Maya Deza; Homel, Peter; Erez, Orry

2018-01-01

Obesity is an oft-cited cause of surgical morbidity and many institutions require extensive supplementary screening for obese patients prior to surgical intervention. However, in the elderly patients, obesity has been described as a protective factor. This article set out to examine the effect of body mass index (BMI) on outcomes and morbidity after hip fracture surgery. The National Surgical Quality Improvement Program database was queried for all patients undergoing 1 of 4 surgical procedures to manage hip fracture between 2008 and 2012. Patient demographics, BMI, and known factors that lead to poor surgical outcomes were included as putative predictors for complications that included infectious, cardiac, pulmonary, renal, and neurovascular events. Using χ 2 tests, 30-day postoperative complication rates were compared between 4 patient groups stratified by BMI as low weight (BMI BMI = 20-30), obese (BMI = 30-40), and morbidly obese (BMI > 40). A total of 15 108 patients underwent surgery for hip fracture over the examined 5-year period. Of these, 18% were low weight (BMI BMI = 20-30), 13% were obese (BMI = 30-40), and 2% were morbidly obese (BMI > 40). The low-weight and morbidly obese patients had both the highest mortality rates and the lowest superficial infection rates. There was a significant increase in blood transfusion rates that decreased linearly with increasing BMI. Deep surgical site infection and renal failure increased linearly with increasing BMI, however, these outcomes were confounded by comorbidities. This study demonstrates that patients at either extreme of the BMI spectrum, rather than solely the obese, are at greatest risk of major adverse events following hip fracture surgery. This runs contrary to the notion that obese hip fracture patients automatically require additional preoperative screening and perioperative services, as currently implemented in many institutions.

Expression of a single, viral oncoprotein in skin epithelium is sufficient to recruit lymphocytes.

Directory of Open Access Journals (Sweden)

Allison Choyce

Full Text Available Established cancers are frequently associated with a lymphocytic infiltrate that fails to clear the tumour mass. In contrast, the importance of recruited lymphocytes during premalignancy is less well understood. In a mouse model of premalignant skin epithelium, transgenic mice that express the human papillomavirus type 16 (HPV16 E7 oncoprotein under a keratin 14 promoter (K14E7 mice display epidermal hyperplasia and have a predominant infiltrate of lymphocytes consisting of both CD4 and CD8 T cells. Activated, but not naïve T cells, were shown to preferentially traffic to hyperplastic skin with an increased frequency of proliferative CD8+ T cells and CD4+ T cells expressing CCR6 within the tissue. Disruption of the interaction between E7 protein and retinoblastoma tumour suppressor protein (pRb led to reduced epithelial hyperplasia and T cell infiltrate. Finally, while K14E7 donor skin grafts are readily accepted onto syngeneic, non-transgenic recipients, these same skin grafts lacking skin-resident lymphocytes were rejected. Our data suggests that expression of a single oncoprotein in the epidermis is sufficient for lymphocyte trafficking (including immunosuppressive lymphocytes to premalignant skin.

Expression of Human papillomavirus 16 E7ggg oncoprotein on N- and C-terminus of Potato virus X coat protein in bacterial and plant cells

Czech Academy of Sciences Publication Activity Database

Plchová, Helena; Moravec, Tomáš; Hoffmeisterová, Hana; Folwarczna, Jitka; Čeřovská, Noemi

2011-01-01

Roč. 77, č. 2 (2011), s. 146-152 ISSN 1046-5928 R&D Projects: GA ČR GA521/09/1525 Institutional research plan: CEZ:AV0Z50380511 Keywords : Bacterial expression * Human papillomavirus * Oncoprotein E7 Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.587, year: 2011

Trajectories of BMI from early childhood through early adolescence: SES and psychosocial predictors.

Science.gov (United States)

Lane, Sean P; Bluestone, Cheryl; Burke, Christopher T

2013-02-01

This study examined the ways in which body mass index (BMI) percentile - an identified risk factor for overweight and cardiovascular disease in adulthood - develops from birth through early adolescence. In addition, we examined whether psychosocial factors, such as parenting style and maternal depression, mediated the link between socio-economic status (SES) and BMI growth. Design. Data were obtained from phases 1-3 of the National Institute of Child Health and Human Development (NICHD) Study of Early Child Care and Youth Development (SECCYD) - a longitudinal study that followed children from 10 communities in the United States from birth to age 11. We applied growth mixture models to identify distinct subtypes of BMI development. Within these models, we performed between- and within-class mediation analyses to examine whether SES predicted class membership or differences in development within each class via maternal depression and parenting styles. Results identified three prototypic trajectories of BMI percentile growth, elevated, steady increase, and stable. We found evidence for both between- and within-class mediation, suggesting multiple pathways by which SES can affect BMI development. These findings add to the research that suggests that being in a family with a low SES is associated with falling into patterns of development characterized by early and lasting increases in BMI relative to one's peers, and that this association is partly accounted for by maternal depression and parenting styles. What is already known? Past research has found evidence that patterns of childhood overweight are impacted by socioeconomic status through psychosocial factors like parenting and depression. This evidence is often limited to individual points in time where neglectful, permissive, and authoritarian parenting and higher levels of maternal depression are associated with higher levels of overweight status among children from infancy to adolescence. However, little

Production of Human Papilloma Virus Type 16 E6 Oncoprotein as a Recombinant Protein in Eukaryotic Cells

Science.gov (United States)

Mirshahabi, H; Soleimanjahi, H; Pourpak, Z; Meshkat, Z; Hassan, ZM

2012-01-01

Background Cervical cancer is one of the most important and widespread cancer which affects women. There are several causes of cervical cancer; among them HPV types 16 and 18 are the most prominent ones which are recurrent and persistent infections. These genotypes are currently about 70% of cervical cancer causes in developing countries. Due to the importance of these viruses in cervical cancer, we pioneered the production of Human Papilloma Virus type16 E6 oncoprotein as a recombinant protein in order to develop a vaccine. Two HPV oncoproteins, E6 and E7, are consistently expressed in HPV-associated cancer cells and are responsible for malignant transformation. These oncogenic proteins represent ideal target antigens for developing vaccine and immunotherapeutic strategies against HPV-associated neoplasm. Methods In the present study, the cloned E6-oncoprotein of HPV16 in pTZ57R/T-E6 vector was used to produce professional expression vector. The target gene was subcloned in a eukaryotic expression vector. The pcDNA3-E6 vector was propagated in E.coli strain DH5α and transfected into CHO cells 72 hours post-transfection. Results The transfected cells were harvested; mRNA detection and the interest protein production were confirmed by western blot analysis using specific anti E6 monoclonal antibody. Conclusion HPV16-E6 target protein recognized by specific antibody could be an appropriate form of protein, which can be used for further studies. Due to potential effect of this protein, its DNA construction can be used for DNA vaccine in future studies. PMID:25780534

Body Mass Index (BMI) Trajectories in Infancy Differ by Population Ancestry and May Presage Disparities in Early Childhood Obesity

Science.gov (United States)

Roy, Sani M.; Chesi, Alessandra; Mentch, Frank; Xiao, Rui; Chiavacci, Rosetta; Mitchell, Jonathan A.; Kelly, Andrea; Hakonarson, Hakon; Grant, Struan F.A.; Zemel, Babette S.

2015-01-01

Context: No consensus definition exists for excess adiposity during infancy. After age 2 years, high body mass index (BMI) is related to adverse cardiometabolic outcomes. Before age 2 years, the utility of BMI as a metric of excess adiposity is unknown. Objectives: The objective of the study was to characterize infant BMI trajectories in a diverse, longitudinal cohort and investigate the relationship between the infancy BMI trajectory and childhood obesity. Subjects: Healthy, nonpreterm infants (n = 2114) in the Genetic Causes for Complex Pediatric Disorders study (The Children's Hospital of Philadelphia) with six or more BMI measurements in the first 13.5 months participated in the study. Design: For each infant, the BMI trajectory was modeled using polynomial regression. Independent effects of clinical factors on magnitude and timing of peak BMI were assessed. The relationship between infancy BMI and early childhood BMI (age 4 y) was examined (n = 1075). Results: The cohort was 53% male and 61% African-American. Peak BMI was 18.6 ± 1.7 kg/m2 and occurred at 8.6 ± 1.4 months. In multivariate analysis, boys had a higher (0.50 kg/m2, P BMI than girls. The peak was higher (0.53 kg/m2, P ≤ .001) and occurred earlier (by 12 d, P BMI. Conclusions: We demonstrate sex- and ancestry-specific differences in infancy BMI and an association of infancy peak BMI with childhood BMI. These findings support the potential utility of infancy BMI to identify children younger than age 2 years with increased risk for later obesity. PMID:25636051

Weighted gene co-expression network analysis of expression data of monozygotic twins identifies specific modules and hub genes related to BMI

DEFF Research Database (Denmark)

Wang, Weijing; Jiang, Wenjie; Hou, Lin

2017-01-01

BACKGROUND: The therapeutic management of obesity is challenging, hence further elucidating the underlying mechanisms of obesity development and identifying new diagnostic biomarkers and therapeutic targets are urgent and necessary. Here, we performed differential gene expression analysis......) were with a trend of up-regulation in twins with higher BMI when compared to their siblings. Categories of positive regulation of nitric-oxide synthase biosynthetic process, positive regulation of NF-kappa B import into nucleus, and peroxidase activity were significantly enriched within GO database...

Prediction of BMI by impulsivity, eating behavior and activity level

Directory of Open Access Journals (Sweden)

Jiang Xiaxia

2016-01-01

Full Text Available Objective: Discuss the relationship between the impulsivity, eating behavior and activity level and the body mass index (BMI. Method: Test 147 female college students with the impulsivity questionnaire (BIS-11 and BIS/BAS, Dutch Eating Behavior Questionnaire (DBEQ, Sitting Time Scale (STS and Exercising Time Scale (ETS. Results: (1 The correlation analysis indicates that BMI and impulsivity (r = 0.43 and 0.52 have a significant positive correlation with the sitting time (r = 0.61 and a significant negative correlation with the activity level (r= −0.49. (2 The path analysis indicates that the reward sensitivity directly affects BMI and indirectly affects BMI through the activity level as well; the eating behavior has an insignificantly direct impact on BMI, because its impact is generated by the intermediary role of induced diet. Conclusion: (1 The impulsivity, eating behavior and activity level are closely related to BMI; (2 the activity level, sitting time and induced diet play an intermediary role between the impulsivity and BMI.

Efficient expression of Human papillomavirus 16 E7 oncoprotein fused to C-terminus of Tobacco mosaic virus (TMV) coat protein using molecular chaperones in Escherichia coli

Czech Academy of Sciences Publication Activity Database

Folwarczna, Jitka; Moravec, Tomáš; Plchová, Helena; Hoffmeisterová, Hana; Čeřovská, Noemi

2012-01-01

Roč. 85, č. 1 (2012), s. 152-157 ISSN 1046-5928 R&D Projects: GA ČR GA521/09/1525; GA ČR GAP501/12/1761 Institutional research plan: CEZ:AV0Z50380511 Keywords : Bacterial expression * Human papillomavirus * E7 oncoprotein Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.429, year: 2012

Down-regulation of lipid raft-associated onco-proteins via cholesterol-dependent lipid raft internalization in docosahexaenoic acid-induced apoptosis.

Science.gov (United States)

Lee, Eun Jeong; Yun, Un-Jung; Koo, Kyung Hee; Sung, Jee Young; Shim, Jaegal; Ye, Sang-Kyu; Hong, Kyeong-Man; Kim, Yong-Nyun

2014-01-01

Lipid rafts, plasma membrane microdomains, are important for cell survival signaling and cholesterol is a critical lipid component for lipid raft integrity and function. DHA is known to have poor affinity for cholesterol and it influences lipid rafts. Here, we investigated a mechanism underlying the anti-cancer effects of DHA using a human breast cancer cell line, MDA-MB-231. We found that DHA decreased cell surface levels of lipid rafts via their internalization, which was partially reversed by cholesterol addition. With DHA treatment, caveolin-1, a marker for rafts, and EGFR were colocalized with LAMP-1, a lysosomal marker, in a cholesterol-dependent manner, indicating that DHA induces raft fusion with lysosomes. DHA not only displaced several raft-associated onco-proteins, including EGFR, Hsp90, Akt, and Src, from the rafts but also decreased total levels of those proteins via multiple pathways, including the proteasomal and lysosomal pathways, thereby decreasing their activities. Hsp90 overexpression maintained its client proteins, EGFR and Akt, and attenuated DHA-induced cell death. In addition, overexpression of Akt or constitutively active Akt attenuated DHA-induced apoptosis. All these data indicate that the anti-proliferative effect of DHA is mediated by targeting of lipid rafts via decreasing cell surface lipid rafts by their internalization, thereby decreasing raft-associated onco-proteins via proteasomal and lysosomal pathways and decreasing Hsp90 chaperone function. © 2013.

BMI in relation to sperm count

DEFF Research Database (Denmark)

Sermondade, N; Faure, C; Fezeu, L

2013-01-01

BACKGROUND The global obesity epidemic has paralleled a decrease in semen quality. Yet, the association between obesity and sperm parameters remains controversial. The purpose of this report was to update the evidence on the association between BMI and sperm count through a systematic review...... with meta-analysis. METHODS A systematic review of available literature (with no language restriction) was performed to investigate the impact of BMI on sperm count. Relevant studies published until June 2012 were identified from a Pubmed and EMBASE search. We also included unpublished data (n = 717 men...... studies were included in the meta-analysis, resulting in a sample of 13 077 men from the general population and attending fertility clinics. Data were stratified according to the total sperm count as normozoospermia, oligozoospermia and azoospermia. Standardized weighted mean differences in sperm...

Warm Parenting Associated with Decreasing or Stable Child BMI during Treatment.

Science.gov (United States)

Rhee, Kyung E; Jelalian, Elissa; Boutelle, Kerri; Dickstein, Susan; Seifer, Ronald; Wing, Rena

2016-04-01

While authoritative parenting, which includes high levels of warmth and behavioral control, has been associated with lower risk of obesity, little is known about how general parenting impacts child weight loss during treatment. Our goal was to examine the relationship between several general parenting dimensions and 'decreasing /stable' child BMI during a 16-week family-based behavioral weight control program. Forty-four overweight parent-child dyads (child age 8 to 12 years) enrolled in the program. Families were videotaped at baseline eating dinner in their home. Using the General Parenting Observational Scale (GPOS), meals were coded for several general parenting dimensions. Primary outcome was percent of children whose BMI 'decreased or stayed the same.' Multivariable logistic regression was used to determine the relationship between general parenting and decreasing/stable child BMI. Forty families (91%) completed the program. Children had a mean BMI change of -0.40 (SD 1.57), which corresponds to a -0.15 (SD 0.20) change in BMI z-score (BMI-Z); 75% of children had decreasing/stable BMI. In the unadjusted models, lower parent BMI, higher parent education, and higher levels of parental warmth were significantly associated with decreasing/stable child BMI. In the multivariable model, only higher level of warmth was associated with increased odds of decreasing/stable child BMI (OR = 1.28; 95% CI, 1.01, 1.62). Baseline parental warmth may influence a child's ability to lower/maintain BMI during a standard family-based behavioral weight control program. Efforts to increase parent displays of warmth and emotional support towards their overweight child may help to increase the likelihood of treatment success.

A molecular model for the differential activation of STAT3 and STAT6 by the herpesviral oncoprotein tip.

Directory of Open Access Journals (Sweden)

Eman Dey Mazumder

Full Text Available Constitutive STAT signaling provides growth promoting signals in many forms of malignancy. We performed molecular modeling and molecular dynamics studies of the interaction between the regulatory Src homology 2 (SH2 domains of STAT3 and 6 with phosphorylated peptides of the herpesviral oncoprotein Tip, which facilitates Src kinase mediated STAT-activation and T cell proliferation. The studies give insight into the ligand binding specificity of the STAT SH2 domains and provide the first model for the differential activation of STAT3 or STAT6 by two distinct regions of the viral Tip protein. The biological relevance of the modeled interactions was then confirmed by activation studies using corresponding recombinant oncoproteins, and finally by respective recombinant viruses. The functional data give experimental validation of the molecular dynamics study, and provide evidence for the involvement of STAT6 in the herpesvirus induced T cell proliferation.

Are BMI and Sedentariness Correlated? A Multilevel Study in Children

Directory of Open Access Journals (Sweden)

Thayse Natacha Gomes

2015-07-01

Full Text Available The purpose of this research was to investigate the relationship between body mass index (BMI and sedentariness (Sed in children and to examine the influence of child and school correlates on their variation. The sample comprises 580 children (337 girls, 9–11 years. Sedentariness was assessed with an accelerometer, and BMI was computed. Child- and school-level covariates were analyzed using multilevel models. No significant correlation between Sed and BMI was found. School context explains 5% and 1.5% of the total variance in Sed and BMI, respectively. At the child level, only moderate-to-vigorous physical activity was associated with both Sed (β = −0.02 ± 0.002 and BMI (β = −0.005 ± 0.002. Sleep time is related to Sed (β = −0.42 ± 0.04, while sex (β = 1.97 ± 0.13, biological maturity (β = 1.25 ± 0.07, media in the bedroom (β = 0.26 ± 0.08 and healthy (β = −0.09 ± 0.03 and unhealthy (β = −0.07 ± 0.04 diet scores were associated with BMI. None of the school-level covariates were related to BMI, but access to cafeteria (β = −0.97 ± 0.25, playground equipment (β = −0.67 ± 0.20 and restaurants (β = 0.16 ± 0.08 were related to Sed. In conclusion, Sed and BMI were not correlated. Further, they have different correlates, while children’s traits seem to play more relevant roles in their differences in Sed and BMI than the school milieu. This information should be taken into account when strategies to reduce Sed and BMI are implemented.

The HPV-16 E7 oncoprotein induces centriole multiplication through deregulation of Polo-like kinase 4 expression

Directory of Open Access Journals (Sweden)

Duensing Stefan

2011-05-01

Full Text Available Abstract Background Infection with high-risk human papillomaviruses (HPVs such as HPV-16 is intimately associated with squamous cell carcinomas (SCCs of the anogenital tract and a subset of oropharyngeal carcinomas. Such lesions, including pre-invasive precursors, frequently show multipolar mitoses and aneuploidy. The high-risk HPV-16-encoded E7 oncoprotein has been shown to rapidly induce centrosome abnormalities thereby causing the formation of supernumerary mitotic spindle poles and increasing the risk for chromosome missegregation. HPV-16 E7 has been found to rapidly induce centriole overduplication, in part, through the simultaneous formation of more than one daughter centriole at single maternal centrioles (centriole multiplication. The precise molecular mechanism that underlies HPV-16 E7-induced centriole multiplication, however, remains poorly understood. Findings Here, we show that human keratinocytes engineered to stably express the HPV-16 E7 oncoprotein exhibit aberrant Polo-like kinase 4 (PLK4 protein expression at maternal centrioles. Real-time quantitative reverse transcriptase (qRT-PCR analysis of these cells revealed an increase of PLK4 mRNA levels compared to control cells. Importantly, the ability of the HPV-16 E7 oncoprotein to induce centriole multiplication was found to correlate with its ability to activate the PLK4 promoter and to up-regulate PLK4 mRNA. Conclusions These results highlight the critical role of PLK4 transcriptional deregulation in centriole multiplication in HPV-16 E7-expressing cells. Our findings encourage further experiments to test transcriptional inhibitors or small molecules targeting PLK4 to prevent centriole abnormalities, mitotic infidelity and malignant progression in HPV-associated neoplasms and other tumors in which PLK4 regulation is disrupted.

Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmi1-deficient mice

NARCIS (Netherlands)

Bruggeman, SWM; Valk-Lingbeek, ME; van der Stoop, PPM; Jacobs, JJL; Kieboom, K; Tanger, E; Hulsman, D; Leung, C; Arsenijevic, Y; Marino, S; van Lohuizen, M

2005-01-01

The Polycomb group (PcG) gene Bmi1 promotes cell proliferation and stem cell self-renewal by repressing the Ink4a/Arf locus. We used a genetic approach to investigate whether Ink4a or Arf is more critical for relaying Bmi1 function in lymphoid cells, neural progenitors, and neural stem cells. We

Aspirin therapy reduces the ability of platelets to promote colon and pancreatic cancer cell proliferation: Implications for the oncoprotein c-MYC

Science.gov (United States)

Sylman, Joanna L.; Ngo, Anh T. P.; Pang, Jiaqing; Sears, Rosalie C.; Williams, Craig D.; McCarty, Owen J. T.

2017-01-01

Aspirin, an anti-inflammatory and antithrombotic drug, has become the focus of intense research as a potential anticancer agent owing to its ability to reduce tumor proliferation in vitro and to prevent tumorigenesis in patients. Studies have found an anticancer effect of aspirin when used in low, antiplatelet doses. However, the mechanisms through which low-dose aspirin works are poorly understood. In this study, we aimed to determine the effect of aspirin on the cross talk between platelets and cancer cells. For our study, we used two colon cancer cell lines isolated from the same donor but characterized by different metastatic potential, SW480 (nonmetastatic) and SW620 (metastatic) cancer cells, and a pancreatic cancer cell line, PANC-1 (nonmetastatic). We found that SW480 and PANC-1 cancer cell proliferation was potentiated by human platelets in a manner dependent on the upregulation and activation of the oncoprotein c-MYC. The ability of platelets to upregulate c-MYC and cancer cell proliferation was reversed by an antiplatelet concentration of aspirin. In conclusion, we show for the first time that inhibition of platelets by aspirin can affect their ability to induce cancer cell proliferation through the modulation of the c-MYC oncoprotein. PMID:27903583

ERD-based online brain-machine interfaces (BMI) in the context of neurorehabilitation: optimizing BMI learning and performance.

Science.gov (United States)

Soekadar, Surjo R; Witkowski, Matthias; Mellinger, Jürgen; Ramos, Ander; Birbaumer, Niels; Cohen, Leonardo G

2011-10-01

Event-related desynchronization (ERD) of sensori-motor rhythms (SMR) can be used for online brain-machine interface (BMI) control, but yields challenges related to the stability of ERD and feedback strategy to optimize BMI learning.Here, we compared two approaches to this challenge in 20 right-handed healthy subjects (HS, five sessions each, S1-S5) and four stroke patients (SP, 15 sessions each, S1-S15). ERD was recorded from a 275-sensor MEG system. During daily training,motor imagery-induced ERD led to visual and proprioceptive feedback delivered through an orthotic device attached to the subjects' hand and fingers. Group A trained with a heterogeneous reference value (RV) for ERD detection with binary feedback and Group B with a homogenous RV and graded feedback (10 HS and 2 SP in each group). HS in Group B showed better BMI performance than Group A (p learning was significantly better (p learning relative to use of a heterogeneous RV and binary feedback.

Toll like receptors TLR1/2, TLR6 and MUC5B as binding interaction partners with cytostatic proline rich polypeptide 1 in human chondrosarcoma.

Science.gov (United States)

Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen

2018-01-01

Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function.

Long-term BMI and growth profiles in offspring of women with gestational diabetes.

Science.gov (United States)

Hammoud, Nurah M; Visser, Gerard H A; van Rossem, Lenie; Biesma, Douwe H; Wit, Jan M; de Valk, Harold W

2018-05-01

Gestational diabetes mellitus (GDM) is reported to be associated with childhood obesity, however the magnitude of this association and relation to intrauterine growth is uncertain. We, therefore, aimed to assess whether the growth trajectories of large for gestational age (LGA) and non-LGA offspring of mothers with GDM (OGDM) are different until early adolescence. We also aimed to explore whether growth trajectories of OGDM differ from those of offspring of mothers with type 1 or 2 diabetes (ODM1, ODM2). We studied height and BMI standard deviation score (SDS) of the OGDM group, up to the age of 14 years, with subgroup analysis comparing LGA with non-LGA at birth as a reflection of the intrauterine environment. All mothers with GDM who delivered at the University Medical Center Utrecht between 1990 and 2006 were contacted to participate; informed consent was received for 104 OGDM of 93 mothers. Offspring data were collected through Dutch infant welfare centres. Recorded height and weight were converted to BMI and age- and sex-specific SDS values for Dutch children. Additionally, we compared the OGDM group with ODM1 and ODM2 groups in order to identify those offspring with the highest risk of becoming overweight. Growth trajectories were compared between non-LGA and LGA OGDM and between OGDM, ODM1 and ODM2, using a random-effects model. In the longitudinal follow-up a mean of 7.4 ± 2 measurements per infant were available. Mothers had a prepregnancy BMI of 25.8 kg/m 2 and 24% of their infants were LGA at birth. Heights of OGDM were no different from those of the Dutch Growth Study. Non-LGA OGDM showed a BMI SDS comparable with that of the reference population, with a slight increase in early adolescence. LGA OGDM had a higher BMI SDS trajectory than non-LGA OGDM and the reference population, which plateaued at around 10 years of age. Comparison of growth trajectories of OGDM, ODM1 and ODM2 showed ODM2 to have the highest trajectory followed by ODM1 and OGDM

Sex differences in heritability of BMI

DEFF Research Database (Denmark)

Schousboe, Karoline; Willemsen, Gonneke; Kyvik, Kirsten O

2003-01-01

pairs (including opposite sex pairs) aged 20-29 and 30-39 from eight different twin registries participating in the GenomEUtwin project. Quantitative genetic analyses were conducted and sex differences were explored. Variation in BMI was greater for women than for men, and in both sexes was primarily...... explained by additive genetic variance in all countries. Sex differences in the variance components were consistently significant. Results from analyses of opposite sex pairs also showed evidence of sex-specific genetic effects suggesting there may be some differences between men and women in the genetic...... factors that influence variation in BMI. These results encourage the continued search for genes of importance to the body composition and the development of obesity. Furthermore, they suggest that strategies to identify predisposing genes may benefit from taking into account potential sex specific effects....

Associations between BMI Change and Cardiometabolic Risk in Retired Football Players.

Science.gov (United States)

Trexler, Eric T; Smith-Ryan, Abbie E; Defreese, J D; Marshall, Stephen W; Guskiewicz, Kevin M; Kerr, Zachary Y

2018-04-01

Elevated rates of cardiometabolic diseases have been observed in former American football players. The current study sought to determine whether change in body mass index (ΔBMI) after retirement influences the prevalence of CHD, diabetes, or high blood pressure (HBP) in former professional football players. Retired professional football players (n = 3729) were sent a survey with questions regarding health status, playing history, and demographic information. Self-reported BMI at the time of retirement was subtracted from current self-reported BMI to calculate ΔBMI. Prevalence of CHD, diabetes, and HBP were determined by asking participants if they had ever been diagnosed by a health care professional. Binomial regression with a Poisson residual and robust variance estimation was used to compute crude prevalence ratios (PR) and 95% confidence intervals (CI) for each outcome. Adjusted PR values were calculated by adjusting for BMI at the time of retirement, age, years of football experience, race, exercise habits, alcohol use, steroid history, smoking history, and playing position. Complete data were available for 2062 respondents. Prevalence of CHD increased 25%-31% for each five-point increase in ΔBMI after retirement (crude PR = 1.25, 95% CI = 1.03-1.52, P = 0.026; adjusted PR = 1.31, 95% CI = 1.11-1.55, P = 0.001). Diabetes prevalence increased 69%-88% for each five-point ΔBMI increase (crude = 1.88, 95% CI = 1.45-2.44, P football players.

Loss of BMI-1 dampens migration and EMT of colorectal cancer in inflammatory microenvironment through TLR4/MD-2/MyD88-mediated NF-κB signaling.

Science.gov (United States)

Ye, Kai; Chen, Qi-Wei; Sun, Ya-Feng; Lin, Jian-An; Xu, Jian-Hua

2018-02-01

Increasing evidence from various clinical and experimental studies has demonstrated that the inflammatory microenvironment created by immune cells facilitates tumor migration. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in an inflammatory microenvironment. B-lymphoma Moloney murine leukemia virus insertion region 1 (BMI-1) acts as an oncogene in various tumors. Ectopic expression of Bmi-1 have an effect on EMT and invasiveness. The purpose of this study was to investigate the efficacy of BMI-1 on inflammation-induced tumor migration and EMT and the underlying mechanism. We observed that the expression of BMI-1, TNF-α, and IL-1β was significantly increased in HT29 and HCT116 cells after THP-1 Conditioned-Medium (THP-1-CM) stimulation. Additionally, inhibition of BMI-1 impeded cell invasion induced by THP-1-CM-stimulation in both HT29 and HCT116 cells. BMI-1 knockdown remarkably repressed THP-1-CM-induced EMT by regulating the expression of EMT biomarkers with an increase in E-cadherin accompanied by decrease in N-cadherin and vimentin. Furthermore, downregulation of BMI-1 dramatically impeded THP-1-CM-triggered Toll-like receptor 4(TLR4)/myeloid differentiation protein 2(MD-2)/myeloid differentiation factor 88(MyD88) activity by repressing the expression of the TLR4/MD-2 complex and MyD88. Further data demonstrated that knockout of BMI-1 also dampened NF-κB THP-1-CM-triggered activity. Taken all data together, our findings established that BMI-1 modulated TLR4/MD-2/MyD88 complex-mediated NF-κB signaling involved in inflammation-induced cancer cells invasion and EMT, and therefore, could be a potential chemopreventive agent against inflammation-associated colorectal cancer. Establishment of an inflammatory microenvironment. Suppression of BMI-1 reverses THP-1-CM-induced inflammatory cytokine production in CRC. Loss of BMI-1 suppressed TLR4/MD-2/MyD88 complex-mediated NF-κB signaling. © 2017 Wiley

Impact of baseline BMI and weight change in CCTG adjuvant breast cancer trials.

Science.gov (United States)

Yerushalmi, R; Dong, B; Chapman, J W; Goss, P E; Pollak, M N; Burnell, M J; Levine, M N; Bramwell, V H C; Pritchard, K I; Whelan, T J; Ingle, J N; Shepherd, L E; Parulekar, W R; Han, L; Ding, K; Gelmon, K A

2017-07-01

We hypothesized that increased baseline BMI and BMI change would negatively impact clinical outcomes with adjuvant breast cancer systemic therapy. Data from chemotherapy trials MA.5 and MA.21; endocrine therapy MA.12, MA.14 and MA.27; and trastuzumab HERA/MA.24 were analyzed. The primary objective was to examine the effect of BMI change on breast cancer-free interval (BCFI) landmarked at 5 years; secondary objectives included BMI changes at 1 and 3 years; BMI changes on disease-specific survival (DSS) and overall survival (OS); and effects of baseline BMI. Stratified analyses included trial therapy and composite trial stratification factors. In pre-/peri-/early post-menopausal chemotherapy trials (N = 2793), baseline BMI did not impact any endpoint and increased BMI from baseline did not significantly affect BCFI (P = 0.85) after 5 years although it was associated with worse BCFI (P = 0.03) and DSS (P = 0.07) after 1 year. BMI increase by 3 and 5 years was associated with better DSS (P = 0.01; 0.01) and OS (P = 0.003; 0.05). In pre-menopausal endocrine therapy trial MA.12 (N = 672), patients with higher baseline BMI had worse BCFI (P = 0.02) after 1 year, worse DSS (P = 0.05; 0.004) after 1 and 5 years and worse OS (P = 0.01) after 5 years. Increased BMI did not impact BCFI (P = 0.90) after 5 years, although it was associated with worse BCFI (P = 0.01) after 1 year. In post-menopausal endocrine therapy trials MA.14 and MA.27 (N = 8236), baseline BMI did not significantly impact outcome for any endpoint. BMI change did not impact BCFI or DSS after 1 or 3 years, although a mean increased BMI of 0.3 was associated with better OS (P = 0.02) after 1 year. With the administration of trastuzumab (N = 1395) baseline BMI and BMI change did not significantly impact outcomes. Higher baseline BMI and BMI increases negatively affected outcomes only in pre-/peri-/early post-menopausal trial patients. Otherwise, BMI

Behavioural patterns only predict concurrent BMI status and not BMI trajectories in a sample of youth in Ontario, Canada.

Science.gov (United States)

Laxer, Rachel E; Cooke, Martin; Dubin, Joel A; Brownson, Ross C; Chaurasia, Ashok; Leatherdale, Scott T

2018-01-01

Youth are engaging in multiple risky behaviours, increasing their risk of overweight, obesity, and related chronic diseases. The objective of this study was to examine the effect of engaging in unique clusters of unhealthy behaviours on youths' body mass index (BMI) trajectories. This study used a linked-longitudinal sample of Grades 9 and 10 students (13 to 17 years of age) participating in the COMPASS host study. Students reported obesity-related and other risky behaviours at baseline and height and weight (to derive BMI) at baseline (2012/2013) and annually for 2 years post-baseline (2013/14 and 2014/15). Students were grouped into behavioural clusters based on response probabilities. Linear mixed effects models, using BMI as a continuous outcome measure, were used to examine the effect of engaging in clusters of risky behaviours on BMI trajectories. There were significant differences in BMI of the four behavioural clusters at baseline that remained consistent over time. Higher BMI values were found among youth classified at baseline to be Typical High School Athletes (β = 0.232 kg/m2, [confidence interval (CI): 0.03-0.50]), Inactive High Screen-User (β = 0.348 kg/m2, CI: 0.11-0.59) and Moderately Active Substance Users (β = 0.759 kg/m2, CI: 0.36-1.15) compared to students classified as Health Conscious. Despite these baseline differences, BMI appeared to increase across all behavioural clusters annually by the same amount (β = 0.6097 kg/m2, (CI) = 0.57-0.64). Although annual increases in BMI did not differ by behavioural clusters, membership in a particular behavioural cluster was associated with baseline BMI, and these differences remained consistent over time. Results indicate that intervening and modifying unhealthy behaviours earlier might have a greater impact than during adolescence. Health promotion strategies targeting the highest risk youth as they enter secondary school might be promising means to prevent or delay the onset of obesity.

A comparison of chewing rate between overweight and normal BMI individuals.

Science.gov (United States)

White, Amy Kristin; Venn, Bernard; Lu, Louise Weiwei; Rush, Elaine; Gallo, Luigi Maria; Yong, Janet Lee Ching; Farella, Mauro

2015-06-01

Previous attempts to identify an 'obese eating style' have led to conflicting findings. This observational study compared the chewing features of overweight or obese young adults with those of normal range BMI. We hypothesised that chewing features are individual-specific and differ between participants of a normal BMI and high BMI. Fourteen overweight to obese participants (BMI≥25.0) were pairwise matched with 14 normal range BMI participants (18.5chewing episodes, including rate, duration, and power. Masticatory performance was assessed by a sieve test and was expressed as the percentage of particles ≤2mm after a standardised chewing test. Regardless of the meal, chewing rate was remarkably consistent among participants (ICC=0.89; 95% CI=0.79-0.94). Chewing rate did not differ between high and normal BMI participants (p>0.05), whereas chewing power was significantly higher in high BMI participants (pchewing characteristics were found between BMI groups. Participants chewed at similar rate in the natural environment (pizza) and in the laboratory (rice) setting (p>0.05). Masticatory performance did not differ significantly (p>0.05) between the high (55.9%) and normal (52.4%) BMI groups. Within the limitations of the present study, chewing characteristics appear to be individual-specific with wide variability. Overweight participants chew at a similar rate to control participants, albeit slightly stronger. Our preliminary findings need to be replicated in larger samples. Copyright © 2015. Published by Elsevier Inc.

The Predictive Factors for Diabetic Remission in Chinese Patients with BMI > 30 kg/m2 and BMI < 30 kg/m2 Are Different.

Science.gov (United States)

Liang, Hui; Cao, Qing; Liu, Huan; Guan, Wei; Wong, Claudia; Tong, Daniel

2018-01-15

Roux-en-Y gastric bypass has been proven to be beneficial for patients with obesity and type 2 diabetes mellitus (T2DM). In less-obese patient (BMI 30-35 kg/m 2 ), surgical treatment is indicated when medication fails to control the T2DM. Asian develops diabetes at a lower BMI. For lower-BMI patients, the rate of diabetes amelioration varies significantly with patients of higher BMI after surgical treatment. The factors that contribute to the post-operative diabetes response rate in lower-BMI patients have not been elucidated. Between 2010 and 2014, a total of 144 patients who underwent gastric bypass for the treatment of T2DM were included for study. Patients were divided into two groups for subgroup analysis, namely BMI > 30 kg/m 2 and BMI BMI group (BMI > 30 kg/m 2 ) was 80% (n = 90) whereas for the lower BMI (BMI BMI group, low HbA1c and high fasting C-peptide are predictive factors whereas for lower-BMI group, along with elevated C-peptide level, disease duration is the positive predictive factor for DM remission. Patients with BMI > 30 kg/m 2 and those with BMI BMI patients while duration of diabetes is for high-low-BMI patients. C-peptide is a predictor of remission in both groups. Further large-scale studies are required to define the predictors of diabetes remission after gastric bypass in low- and high-BMI patients.

The role of diabetes mellitus and BMI in the surgical treatment of ankle fractures.

Science.gov (United States)

Lanzetti, Riccardo Maria; Lupariello, Domenico; Venditto, Teresa; Guzzini, Matteo; Ponzo, Antonio; De Carli, Angelo; Ferretti, Andrea

2018-02-01

Open reduction and internal fixation is the standard treatment for displaced ankle fractures. However, the presence of comorbidities such as diabetes mellitus and body mass index (BMI) are associated with poor bone quality, and these factors may predict the development of postoperative complications. The study aim was to assess the role of diabetes mellitus and BMI in wound healing in patients younger than 65 years who were surgically treated for malleoli fractures. Ninety patients, aged from 18 to 65 years old, with surgically treated ankle fracture, were retrospectively enrolled. Patients were classified in two groups: patient with diabetes and patients without diabetes (insulin-dependent and noninsulin dependent). All patients were assessed for wound complications, Visual Analogue Scale and Foot and Ankle Disability Index (FADI) were assessed for all patients. Logistic regression was used to identify the risk of wound complications after surgery using the following factors as explanatory variables: age, gender, duration of surgery, BMI, hypercholesterolemia, smoking history, diabetes mellitus, and high blood pressure. In total, 38.9% of patients showed wound complications. Of them, 17.1% were nondiabetics and 82.9% were diabetics. We observed a significant association between DM and wound complications after surgery (P = .005). Logistic regression analysis revealed that DM (P BMI (P = .03) were associated with wound complications. The odds of having a postoperative wound complication were increased 0.16 times in the presence of diabetes and 1.14 times for increasing BMI. This study showed that diabetes mellitus and higher BMI delay the wound healing and increase the complication rate in young adult patients with surgically treated bimalleolar fractures. Copyright © 2017 John Wiley & Sons, Ltd.

Bidirectional associations between mothers' and fathers' parenting consistency and child BMI.

Science.gov (United States)

Jansen, Pauline W; Giallo, Rebecca; Westrupp, Elizabeth M; Wake, Melissa; Nicholson, Jan M

2013-12-01

Research suggests that general parenting dimensions and styles are associated with children's BMI, but directionality in this relationship remains unknown. Moreover, there has been little attention to the influences of both mothers' and fathers' parenting. We aimed to examine reciprocal relationships between maternal and paternal parenting consistency and child BMI. Participants were 4002 children and their parents in the population-based Longitudinal Study of Australian Children. Mothers and fathers self-reported parenting consistency, and children's BMI was measured at 4 biennial waves starting at age 4 to 5 years in 2004. Bidirectionality between parenting and child BMI was examined by using regression analyses in cross-lagged models. The best-fitting models indicated a modest influence from parenting to child BMI, whereas no support was found for bidirectional influences. For mothers, higher levels of parenting consistency predicted lower BMI in children from Waves 1 to 2 and 3 to 4; for example, for every SD increase in mothers' parenting consistency at Wave 1, child BMIz fell by 0.025 in Wave 2 (95% confidence interval: -0.05 to -0.003). For fathers, higher levels of parenting consistency were associated with lower child BMI from Waves 1 to 2 and 2 to 3. Parenting inconsistency of mothers and fathers prospectively predicted small increases in offspring BMI over 2-year periods across middle childhood. However, child BMI did not appear to influence parenting behavior. These findings support recent calls for expanding childhood overweight interventions to address the broad parenting context while involving both mothers and fathers.

MUC1-C activates polycomb repressive complexes and downregulates tumor suppressor genes in human cancer cells.

Science.gov (United States)

Rajabi, Hasan; Hiraki, Masayuki; Kufe, Donald

2018-04-01

The PRC2 and PRC1 complexes are aberrantly expressed in human cancers and have been linked to decreases in patient survival. MUC1-C is an oncoprotein that is also overexpressed in diverse human cancers and is associated with a poor prognosis. Recent studies have supported a previously unreported function for MUC1-C in activating PRC2 and PRC1 in cancer cells. In the regulation of PRC2, MUC1-C (i) drives transcription of the EZH2 gene, (ii) binds directly to EZH2, and (iii) enhances occupancy of EZH2 on target gene promoters with an increase in H3K27 trimethylation. Regarding PRC1, which is recruited to PRC2 sites in the hierarchical model, MUC1-C induces BMI1 transcription, forms a complex with BMI1, and promotes H2A ubiquitylation. MUC1-C thereby contributes to the integration of PRC2 and PRC1-mediated repression of tumor suppressor genes, such as CDH1, CDKN2A, PTEN and BRCA1. Like PRC2 and PRC1, MUC1-C is associated with the epithelial-mesenchymal transition (EMT) program, cancer stem cell (CSC) state, and acquisition of anticancer drug resistance. In concert with these observations, targeting MUC1-C downregulates EZH2 and BMI1, inhibits EMT and the CSC state, and reverses drug resistance. These findings emphasize the significance of MUC1-C as a therapeutic target for inhibiting aberrant PRC function and reprogramming the epigenome in human cancers.

Group-based developmental BMI trajectories, polycystic ovary syndrome, and gestational diabetes: a community-based longitudinal study.

Science.gov (United States)

Kakoly, Nadira Sultana; Earnest, Arul; Moran, Lisa J; Teede, Helena J; Joham, Anju E

2017-11-06

Obesity is common in young women, increasing insulin resistance (IR) and worsening pregnancy complications, including gestational diabetes (GDM). Women with polycystic ovary syndrome (PCOS) are commonly obese, which aggravates the severity of PCOS clinical expression. Relationships between these common insulin-resistant conditions, however, remain unclear. We conducted a secondary analysis of the Australian Longitudinal Study on Women's Health (ALSWH) database, including data from 8009 women aged 18-36 years across six surveys. We used latent-curve growth modelling to identify distinct body mass index (BMI) trajectories and multinomial logistic regression to explore sociodemographic and health variables characterizing BMI group membership. Logistic regression was used to assess independent risk of GDM. A total of 662 women (8.29%, 95% CI 7.68-8.89) reported PCOS. Three distinct BMI trajectories emerged, namely low stable (LSG) (63.8%), defined as an average trajectory remaining at ~25 kg/m 2 ; moderately rising (MRG) (28.8%), a curvilinear trajectory commencing in a healthy BMI and terminating in the overweight range; and high-rising (HRG) (7.4%), a curvilinear trajectory starting and terminating in the obese range. A high BMI in early reproductive life predicted membership in higher trajectories. The HRG BMI trajectory was independently associated with GDM (OR 2.50, 95% CI 1.80-3.48) and was a stronger correlate than PCOS (OR 1.89, 95% CI 1.41-2.54), maternal age, socioeconomic status, or parity. Our results suggest heterogeneity in BMI change among Australian women of reproductive age, with and without PCOS. Reducing early adult life weight represents an ideal opportunity to intervene at an early stage of reproductive life and decreases the risk of long-term metabolic complications such as GDM.

Acetylation of the c-MYC oncoprotein is required for cooperation with the HTLV-1 p30{sup II} accessory protein and the induction of oncogenic cellular transformation by p30{sup II}/c-MYC

Energy Technology Data Exchange (ETDEWEB)

Romeo, Megan M.; Ko, Bookyung; Kim, Janice; Brady, Rebecca; Heatley, Hayley C.; He, Jeffrey; Harrod, Carolyn K.; Barnett, Braden [Laboratory of Molecular Virology, Department of Biological Sciences, and The Dedman College Center for Drug Discovery, Design, and Delivery, Southern Methodist University, Dallas, TX 75275-0376 (United States); Ratner, Lee [Departments of Medicine and Molecular Microbiology, Washington University School of Medicine, St. Louis, MO 63110 (United States); Lairmore, Michael D. [University of California-Davis, School of Veterinary Medicine, One Shields Avenue, Davis, CA 95618 (United States); Martinez, Ernest [Department of Biochemistry, University of California, Riverside, CA 92521 (United States); Lüscher, Bernhard [Institute of Biochemistry, Klinikum, RWTH Aachen University, Pauwelsstrasse 30, 52057 Aachen (Germany); Robson, Craig N. [Northern Institute for Cancer Research, Newcastle University, The Medical School, Newcastle upon Tyne, NE2 4HH (United Kingdom); Henriksson, Marie [Department of Microbiology, Cell and Tumor Biology, Karolinska Institutet, Stockholm (Sweden); Harrod, Robert, E-mail: rharrod@smu.edu [Laboratory of Molecular Virology, Department of Biological Sciences, and The Dedman College Center for Drug Discovery, Design, and Delivery, Southern Methodist University, Dallas, TX 75275-0376 (United States)

2015-02-15

The human T-cell leukemia retrovirus type-1 (HTLV-1) p30{sup II} protein is a multifunctional latency-maintenance factor that negatively regulates viral gene expression and deregulates host signaling pathways involved in aberrant T-cell growth and proliferation. We have previously demonstrated that p30{sup II} interacts with the c-MYC oncoprotein and enhances c-MYC-dependent transcriptional and oncogenic functions. However, the molecular and biochemical events that mediate the cooperation between p30{sup II} and c-MYC remain to be completely understood. Herein we demonstrate that p30{sup II} induces lysine-acetylation of the c-MYC oncoprotein. Acetylation-defective c-MYC Lys→Arg substitution mutants are impaired for oncogenic transformation with p30{sup II} in c-myc{sup −/−} HO15.19 fibroblasts. Using dual-chromatin-immunoprecipitations (dual-ChIPs), we further demonstrate that p30{sup II} is present in c-MYC-containing nucleoprotein complexes in HTLV-1-transformed HuT-102 T-lymphocytes. Moreover, p30{sup II} inhibits apoptosis in proliferating cells expressing c-MYC under conditions of genotoxic stress. These findings suggest that c-MYC-acetylation is required for the cooperation between p30{sup II}/c-MYC which could promote proviral replication and contribute to HTLV-1-induced carcinogenesis. - Highlights: • Acetylation of c-MYC is required for oncogenic transformation by HTLV-1 p30{sup II}/c-MYC. • Acetylation-defective c-MYC mutants are impaired for foci-formation by p30{sup II}/c-MYC. • The HTLV-1 p30{sup II} protein induces lysine-acetylation of c-MYC. • p30{sup II} is present in c-MYC nucleoprotein complexes in HTLV-1-transformed T-cells. • HTLV-1 p30{sup II} inhibits apoptosis in c-MYC-expressing proliferating cells.

Childhood maltreatment and BMI trajectories to mid-adult life: follow-up to age 50 y in a British birth cohort.

Directory of Open Access Journals (Sweden)

Chris Power

Full Text Available Childhood maltreatment including abuse and neglect has been associated with adult obesity, but evidence on life-course development of obesity or BMI gain is unclear. We aim to establish whether childhood maltreatments are related to obesity or BMI at different life-stages 7 y-50 y and to identify possible explanations for associations.Childhood physical, psychological and sexual abuse, neglect and BMI at seven ages were recorded in the 1958 birth cohort (n~15,000. Associations of child maltreatments with BMI at separate ages were tested using linear regression or logistic regression for obesity, and with rate of child-to-adult BMI gain using multilevel models. We adjusted for potential covariates.Abuse was reported in ~12% of the population. Abuse was not associated with elevated childhood BMI, but adult associations were observed: i.e. the abused had faster child-adult BMI gain than the non-abused; associations were independent of adult covariates. For physical abuse in both genders there was a positive linear association of ~0.006/y zBMI gain with age after adjustment for all covariates. Similarly, there was a linear association of physical abuse with obesity risk: e.g. among females from a low OR(adjusted of 0.34 (0.16,0.71 at 7 y to 1.67 (1.25,2.24 at 50 y. In females faster zBMI gains with age of ~0.0034/y were observed for sexual abuse and increases in obesity risk were faster: from a low OR(adjusted of 0.23 (0.06,0.84 at 7 y to 1.34 (0.86,2.10 at 50 y. Psychological abuse and neglect associations were less consistent.Childhood maltreatment associations with BMI or obesity varied across life: physical and, in females, sexual abuse were associated with faster lifetime BMI gains, which may have detrimental long-term health consequences.

DNA binding-independent transcriptional activation of the vascular endothelial growth factor gene (VEGF) by the Myb oncoprotein

International Nuclear Information System (INIS)

Lutwyche, Jodi K.; Keough, Rebecca A.; Hunter, Julie; Coles, Leeanne S.; Gonda, Thomas J.

2006-01-01

Myb is a key transcription factor that can regulate proliferation, differentiation, and apoptosis, predominantly in the haemopoietic system. Abnormal expression of Myb is associated with a number of cancers, both haemopoietic and non-haemopoietic. In order to better understand the role of Myb in normal and tumorigenic processes, we undertook a cDNA array screen to identify genes that are regulated by this factor. In this way, we identified the gene encoding vascular endothelial growth factor (VEGF) as being potentially regulated by the Myb oncoprotein in myeloid cells. To determine whether this was a direct effect on VEGF gene transcription, we examined the activity of the murine VEGF promoter in the presence of either wild-type (WT) or mutant forms of Myb. It was found that WT Myb was able to activate the VEGF promoter and that a minimal promoter region of 120 bp was sufficient to confer Myb responsiveness. Surprisingly, activation of the VEGF promoter was independent of DNA binding by Myb. This was shown by the use of DNA binding-defective Myb mutants and by mutagenesis of a potential Myb-binding site in the minimal promoter. Mutation of Sp1 sites within this region abolished Myb-mediated regulation of a reporter construct, suggesting that Myb DNA binding-independent activation of VEGF expression occurs via these Sp1 binding elements. Regulation of VEGF production by Myb has implications for the potential role of Myb in myeloid leukaemias and in solid tumours where VEGF may be functioning as an autocrine growth factor

EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer

NARCIS (Netherlands)

Pietersen, Alexandra M.; Horlings, Hugo M.; Hauptmann, Michael; Langerod, Anita; Ajouaou, Abderrahim; Cornelissen-Steijger, Paulien; Wessels, Lodewijk F.; Jonkers, Jos; van de Vijver, Marc J.; van Lohuizen, Maarten

2008-01-01

Introduction PolycombGroup (PcG) proteins maintain gene repression through histone modifications and have been implicated in stem cell regulation and cancer. EZH2 is part of Polycomb Repressive Complex 2 (PRC2) and trimethylates H3K27. This histone mark recruits the BMI1-containing PRC1 that

Expression of BMI-1 and Mel-18 in breast tissue--a diagnostic marker in patients with breast cancer.

Science.gov (United States)

Riis, Margit L H; Lüders, Torben; Nesbakken, Anne-Jorunn; Vollan, Hilde S; Kristensen, Vessela; Bukholm, Ida R K

2010-12-16

Polycomb Group (PcG) proteins are epigenetic silencers involved in maintaining cellular identity, and their deregulation can result in cancer. Expression of Mel-18 and Bmi-1 has been studied in tumor tissue, but not in adjacent non-cancerous breast epithelium. Our study compares the expression of the two genes in normal breast epithelium of cancer patients and relates it to the level of expression in the corresponding tumors as well as in breast epithelium of healthy women. A total of 79 tumors, of which 71 malignant tumors of the breast, 6 fibroadenomas, and 2 DCIS were studied and compared to the reduction mammoplastic specimens of 11 healthy women. In addition there was available adjacent cancer free tissue for 23 of the malignant tumors. The tissue samples were stored in RNAlater, RNA was isolated to create expression microarray profile. These two genes were then studied more closely first on mRNA transcription level by microarrays (Agilent 44 K) and quantitative RT-PCR (TaqMan) and then on protein expression level using immunohistochemistry. Bmi-1 mRNA is significantly up-regulated in adjacent normal breast tissue in breast cancer patients compared to normal breast tissue from noncancerous patients. Conversely, mRNA transcription level of Mel-18 is lower in normal breast from patients operated for breast cancer compared to breast tissue from mammoplasty. When protein expression of these two genes was evaluated, we observed that most of the epithelial cells were positive for Bmi-1 in both groups of tissue samples, although the expression intensity was stronger in normal tissue from cancer patients compared to mammoplasty tissue samples. Protein expression of Mel-18 showed inversely stronger intensity in tissue samples from mammoplasty compared to normal breast tissue from patients operated for breast cancer. Bmi-1 mRNA level is consistently increased and Mel-18 mRNA level is consistently decreased in adjacent normal breast tissue of cancer patients as compared

Variations in BMI and prevalence of health risks in diverse racial and ethnic populations.

Science.gov (United States)

Stommel, Manfred; Schoenborn, Charlotte A

2010-09-01

When examining health risks associated with the BMI, investigators often rely on the customary BMI thresholds of the 1995 World Health Organization report. However, within-interval variations in morbidity and mortality can be substantial, and the thresholds do not necessarily correspond to identifiable risk increases. Comparing the prevalence of hypertension, diabetes, coronary heart disease (CHD), asthma, and arthritis among non-Hispanic whites, blacks, East Asians and Hispanics, we examine differences in the BMI-health-risk relationships for small BMI increments. The analysis is based on 11 years of data of the National Health Interview Survey (NHIS), with a sample size of 337,375 for the combined 1997-2007 Sample Adult. The analysis uses multivariate logistic regression models, employing a nonparametric approach to modeling the BMI-health-risk relationship, while relying on narrowly defined BMI categories. Rising BMI levels are associated with higher levels of chronic disease burdens in four major racial and ethnic groups, even after adjusting for many socio-demographic characteristics and three important health-related behaviors (smoking, physical activity, alcohol consumption). For all population groups, except East Asians, a modestly higher disease risk was noted for persons with a BMI ethnic groups regardless of BMI levels, the evidence presented here does not support the notion that the BMI-health-risk profile of East Asians and others warrants race-specific BMI cutoff points.

Stratifying type 2 diabetes cases by BMI identifies genetic risk variants in LAMA1 and enrichment for risk variants in lean compared to obese cases

NARCIS (Netherlands)

J.R.B. Perry (John); B.F. Voight (Benjamin); L. Yengo (Loic); N. Amin (Najaf); J. Dupuis (Josée); M. Ganser (Martha); H. Grallert (Harald); P. Navarro (Pau); M. Li (Man); L. Qi (Lu); V. Steinthorsdottir (Valgerdur); R.A. Scott (Robert); P. Almgren (Peter); D.E. Arking (Dan); Y.S. Aulchenko (Yurii); B. Balkau (Beverley); R. Benediktsson (Rafn); R.N. Bergman (Richard); E.A. Boerwinkle (Eric); L.L. Bonnycastle (Lori); N.P. Burtt (Noël); H. Campbell (Harry); G. Charpentier (Guillaume); F.S. Collins (Francis); C. Gieger (Christian); T. Green (Todd); S. Hadjadj (Samy); A.T. Hattersley (Andrew); C. Herder (Christian); A. Hofman (Albert); A.D. Johnson (Andrew); A. Köttgen (Anna); P. Kraft (Peter); Y. Labrune (Yann); C. Langenberg (Claudia); A.K. Manning (Alisa); K.L. Mohlke (Karen); A.P. Morris (Andrew); B.A. Oostra (Ben); J.S. Pankow (James); A.K. Petersen; P.P. Pramstaller (Peter Paul); I. Prokopenko (Inga); W. Rathmann (Wolfgang); N.W. Rayner (Nigel William); M. Roden (Michael); I. Rudan (Igor); D. Rybin (Denis); L.J. Scott (Laura); G. Sigurdsson (Gunnar); R. Sladek (Rob); G. Thorleifsson (Gudmar); U. Thorsteinsdottir (Unnur); J. Tuomilehto (Jaakko); A.G. Uitterlinden (André); S. Vivequin (Sidonie); M.N. Weedon (Michael); A.F. Wright (Alan); F.B. Hu (Frank); T. Illig (Thomas); W.H.L. Kao (Wen); J.B. Meigs (James); J.F. Wilson (James); J-A. Zwart (John-Anker); C.M. van Duijn (Cornelia); D. Altshuler (David); A.D. Morris (Andrew); M. Boehnke (Michael); M.I. McCarthy (Mark); P. Froguel (Philippe); C.N.A. Palmer (Colin); N.J. Wareham (Nick); L. Groop (Leif); T.M. Frayling (Timothy); S. Cauchi (Stephane)

2012-01-01

textabstractCommon diseases such as type 2 diabetes are phenotypically heterogeneous. Obesity is a major risk factor for type 2 diabetes, but patients vary appreciably in body mass index. We hypothesized that the genetic predisposition to the disease may be different in lean (BMI<25 Kg/m2) compared

Community-Specific BMI Cutoff Points for South Indian Females

Directory of Open Access Journals (Sweden)

K. B. Kishore Mohan

2011-01-01

Full Text Available Objective. To analyze multiparameters related to total body composition, with specific emphasis on obesity in South Indian females, in order to derive community-specific BMI cutoff points. Patients and Methods. A total number of 87 females (of age 37.33±13.12 years from South Indian Chennai urban population participated in this clinical study. Body composition analysis and anthropometric measurements were acquired after conducting careful clinical examination. Results. BMI demonstrated high significance when normal group (21.02±1.47 kg/m2 was compared with obese group (29.31±3.95 kg/m2, <0.0001. BFM displayed high significance when normal group (14.92±4.28 kg was compared with obese group (29.94 ± 8.1 kg, <0.0001. Conclusion. Community-specific BMI cutoffs are necessary to assess obesity in different ethnic groups, and relying on WHO-based universal BMI cutoff points would be a wrong strategy.

Early childhood BMI trajectories in monogenic obesity due to leptin, leptin receptor, and melanocortin 4 receptor deficiency.

Science.gov (United States)

Kohlsdorf, Katja; Nunziata, Adriana; Funcke, Jan-Bernd; Brandt, Stephanie; von Schnurbein, Julia; Vollbach, Heike; Lennerz, Belinda; Fritsch, Maria; Greber-Platzer, Susanne; Fröhlich-Reiterer, Elke; Luedeke, Manuel; Borck, Guntram; Debatin, Klaus-Michael; Fischer-Posovszky, Pamela; Wabitsch, Martin

2018-02-27

To evaluate whether early childhood body mass index (BMI) is an appropriate indicator for monogenic obesity. A cohort of n = 21 children living in Germany or Austria with monogenic obesity due to congenital leptin deficiency (group LEP, n = 6), leptin receptor deficiency (group LEPR, n = 6) and primarily heterozygous MC4 receptor deficiency (group MC4R, n = 9) was analyzed. A control group (CTRL) was defined that consisted of n = 22 obese adolescents with no mutation in the above mentioned genes. Early childhood (0-5 years) BMI trajectories were compared between the groups at selected time points. The LEP and LEPR group showed a tremendous increase in BMI during the first 2 years of life with all patients displaying a BMI >27 kg/m 2 (27.2-38.4 kg/m 2 ) and %BMI P95 (percentage of the 95th percentile BMI for age and sex) >140% (144.8-198.6%) at the age of 2 years and a BMI > 33 kg/m 2 (33.3-45.9 kg/m 2 ) and %BMI P95  > 184% (184.1-212.6%) at the age of 5 years. The MC4R and CTRL groups had a later onset of obesity with significantly lower BMI values at both time points (p BMI trajectories in this pediatric cohort with monogenic obesity we suggest that BMI values >27.0 kg/m 2 or %BMI P95  > 140% at the age of 2 years and BMI values >33.0 kg/m 2 or %BMI P95  > 184% at the age of 5 years may be useful cut points to identify children who should undergo genetic screening for monogenic obesity due to functionally relevant mutations in the leptin gene or leptin receptor gene.

The Role of BMI Change on Smoking Abstinence in a Sample of HIV-Infected Smokers

Science.gov (United States)

Gritz, Ellen R.; Kypriotakis, George; Arduino, Roberto C.; Vidrine, Damon J.

2016-01-01

The prevalence of cigarette smoking among persons living with HIV/AIDS (PLWHA) is approximately 40%, significantly higher than that of the general population. Identifying predictors of successful smoking cessation for PLWHA is necessary to alleviate the morbidity and mortality associated with smoking in this population. Weight gain has been associated with smoking relapse in the general population, but has not been studied among PLWHA. Data from 474 PLWHA enrolled in a smoking cessation randomized clinical trial were analyzed to examine the effect of BMI change, from baseline to 3-month follow-up, on smoking outcomes using multiple logistic regression. The odds of 7-day smoking abstinence at 3-month follow-up were 4.22 (95% CI=1.65, 10.82) times higher for participants classified as BMI decrease and 4.22 (95% CI=1.62, 11.01) times higher for participants classified as BMI increase as compared to participants with a minimal increase or decrease in BMI. In this sample, both weight gain and loss following smoking cessation were significantly associated with abstinence at 3-month follow-up among HIV-infected smokers. Further research and a better understanding of predictors of abstinence will encourage more tailored interventions, with the potential to reduce morbidity and mortality. PMID:26666313

Concordance between self-reported pre-pregnancy body mass index (BMI) and BMI measured at the first prenatal study contact.

Science.gov (United States)

Natamba, Barnabas K; Sanchez, Sixto E; Gelaye, Bizu; Williams, Michelle A

2016-07-26

The 2009 Institute of Medicine (IOM) gestational weight recommendations are tailored to women's pre-pregnancy body mass index (BMI). Limited evidence exists on methods for estimating women's pre-pregnancy BMI, particularly for women living in low and middle income countries. Using data from collected among Peruvian pregnant women, we compared the concordance between self-reported pre-pregnancy BMI with BMI measured at the earliest prenatal study visit. Data were from the Pregnancy Outcomes Maternal and Infant Study (PrOMIS), a cohort of pregnant women at the Instituto Nacional Materno Perinatal (INMP) in Lima, Peru. 2605 women aged 18 to 49 years (mean ± SD gestational age = 10.9 ± 3.3 weeks) were included in the study. Self-reported pre-pregnancy weight and height and measured weight and height were collected at the first prenatal study contact. We assessed the concordance between measured and self-reported BMI; and, the agreement among indicators of nutritional status obtained using measured and self-reported BMI. On average, weight measured at the first prenatal study visit was 0.27 kg higher than self-reported pre-pregnancy weight (p overweight or obese BMI categories tended to be lower when using self-reported BMI (38.2 %) than when using measured BMI (47.7 %). Self-reported pre-pregnancy BMI was strongly correlated with BMI measured at the first prenatal study contact. The findings potentially suggest that, in this context, there is minimal change between pre-pregnancy BMI and BMI measured at the first prenatal study contact; or, that women in this study just recalled their most recent measured anthropometrics (including values obtained during the index pregnancy but before enrollment in the PrOMIS study).

PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein augments the transforming activity in a rat fibroblast cell line

International Nuclear Information System (INIS)

Hirata, Akira; Higuchi, Masaya; Niinuma, Akiko; Ohashi, Minako; Fukushi, Masaya; Oie, Masayasu; Akiyama, Tetsu; Tanaka, Yuetsu; Gejyo, Fumitake; Fujii, Masahiro

2004-01-01

While human T-cell leukemia virus type 1 (HTLV-1) is associated with the development of adult T-cell leukemia (ATL), HTLV-2 has not been reported to be associated with such malignant leukemias. HTLV-1 Tax1 oncoprotein transforms a rat fibroblast cell line (Rat-1) to form multiple large colonies in soft agar, and this activity is much greater than that of HTLV-2 Tax2. We have demonstrated here that the increased number of transformed colonies induced by Tax1 relative to Tax2 was mediated by a PDZ domain-binding motif (PBM) in Tax1, which is absent in Tax2. Tax1 PBM mediated the interaction of Tax1 with the discs large (Dlg) tumor suppressor containing PDZ domains, and the interaction correlated well with the transforming activities of Tax1 and the mutants. Through this interaction, Tax1 altered the subcellular localization of Dlg from the detergent-soluble to the detergent-insoluble fraction in a fibroblast cell line as well as in HTLV-1-infected T-cell lines. These results suggest that the interaction of Tax1 with PDZ domain protein(s) is critically involved in the transforming activity of Tax1, the activity of which may be a crucial factor in malignant transformation of HTLV-1-infected cells in vivo

Bovine papillomavirus type 2 (BPV-2) E5 oncoprotein binds to the subunit D of the V₁-ATPase proton pump in naturally occurring urothelial tumors of the urinary bladder of cattle.

Science.gov (United States)

Roperto, Sante; Russo, Valeria; Borzacchiello, Giuseppe; Urraro, Chiara; Lucà, Roberta; Esposito, Iolanda; Riccardi, Marita Georgia; Raso, Cinzia; Gaspari, Marco; Ceccarelli, Dora Maria; Galasso, Rocco; Roperto, Franco

2014-01-01

Active infection by bovine papillomavirus type 2 (BPV-2) was documented for fifteen urinary bladder tumors in cattle. Two were diagnosed as papillary urothelial neoplasm of low malignant potential (PUNLMP), nine as papillary and four as invasive urothelial cancers. In all cancer samples, PCR analysis revealed a BPV-2-specific 503 bp DNA fragment. E5 protein, the major oncoprotein of the virus, was shown both by immunoprecipitation and immunohistochemical analysis. E5 was found to bind to the activated (phosphorylated) form of the platelet derived growth factor β receptor. PDGFβR immunoprecipitation from bladder tumor samples and from normal bladder tissue used as control revealed a protein band which was present in the pull-down from bladder cancer samples only. The protein was identified with mass spectrometry as "V₁-ATPase subunit D", a component of the central stalk of the V₁-ATPase vacuolar pump. The subunit D was confirmed in this complex by coimmunoprecipitation investigations and it was found to colocalize with the receptor. The subunit D was also shown to be overexpressed by Western blot, RT-PCR and immunofluorescence analyses. Immunoprecipitation and immunofluorescence also revealed that E5 oncoprotein was bound to the subunit D. For the first time, a tri-component complex composed of E5/PDGFβR/subunit D has been documented in vivo. Previous in vitro studies have shown that the BPV-2 E5 oncoprotein binds to the proteolipid c ring of the V₀-ATPase sector. We suggest that the E5/PDGFβR/subunit D complex may perturb proteostasis, organelle and cytosol homeostasis, which can result in altered protein degradation and in autophagic responses.

The oncoprotein gankyrin interacts with RelA and suppresses NF-κB activity

International Nuclear Information System (INIS)

Higashitsuji, Hiroaki; Higashitsuji, Hisako; Liu, Yu; Masuda, Tomoko; Fujita, Takanori; Abdel-Aziz, H. Ismail; Kongkham, Supranee; Dawson, Simon; John Mayer, R.; Itoh, Yoshito; Sakurai, Toshiharu; Itoh, Katsuhiko; Fujita, Jun

2007-01-01

Gankyrin is an oncoprotein commonly overexpressed in hepatocellular carcinomas. It interacts with multiple proteins and accelerates degradation of tumor suppressors Rb and p53. Since gankyrin consists of 7 ankyrin repeats and is structurally similar to IκBs, we investigated its interaction with NF-κB. We found that gankyrin directly binds to RelA. In HeLa and 293 cells, overexpression of gankyrin suppressed the basal as well as TNFα-induced transcriptional activity of NF-κB, whereas down-regulation of gankyrin increased it. Gankyrin did not affect the NF-κB DNA-binding activity or nuclear translocation of RelA induced by TNFα in these cells. Leptomycin B that inhibits nuclear export of RelA suppressed the NF-κB activity, which was further suppressed by gankyrin. The inhibitory effect of gankyrin was abrogated by nicotinamide as well as down-regulation of SIRT1, a class III histone deacetylase. Thus, gankyrin binds to NF-κB and suppresses its activity at the transcription level by modulating acetylation via SIRT1

BMI in relation to sperm count: an updated systematic review and collaborative meta-analysis.

Science.gov (United States)

Sermondade, N; Faure, C; Fezeu, L; Shayeb, A G; Bonde, J P; Jensen, T K; Van Wely, M; Cao, J; Martini, A C; Eskandar, M; Chavarro, J E; Koloszar, S; Twigt, J M; Ramlau-Hansen, C H; Borges, E; Lotti, F; Steegers-Theunissen, R P M; Zorn, B; Polotsky, A J; La Vignera, S; Eskenazi, B; Tremellen, K; Magnusdottir, E V; Fejes, I; Hercberg, S; Lévy, R; Czernichow, S

2013-01-01

BACKGROUND The global obesity epidemic has paralleled a decrease in semen quality. Yet, the association between obesity and sperm parameters remains controversial. The purpose of this report was to update the evidence on the association between BMI and sperm count through a systematic review with meta-analysis. METHODS A systematic review of available literature (with no language restriction) was performed to investigate the impact of BMI on sperm count. Relevant studies published until June 2012 were identified from a Pubmed and EMBASE search. We also included unpublished data (n = 717 men) obtained from the Infertility Center of Bondy, France. Abstracts of relevant articles were examined and studies that could be included in this review were retrieved. Authors of relevant studies for the meta-analysis were contacted by email and asked to provide standardized data. RESULTS A total of 21 studies were included in the meta-analysis, resulting in a sample of 13 077 men from the general population and attending fertility clinics. Data were stratified according to the total sperm count as normozoospermia, oligozoospermia and azoospermia. Standardized weighted mean differences in sperm concentration did not differ significantly across BMI categories. There was a J-shaped relationship between BMI categories and risk of oligozoospermia or azoospermia. Compared with men of normal weight, the odds ratio (95% confidence interval) for oligozoospermia or azoospermia was 1.15 (0.93-1.43) for underweight, 1.11 (1.01-1.21) for overweight, 1.28 (1.06-1.55) for obese and 2.04 (1.59-2.62) for morbidly obese men. CONCLUSIONS Overweight and obesity were associated with an increased prevalence of azoospermia or oligozoospermia. The main limitation of this report is that studied populations varied, with men recruited from both the general population and infertile couples. Whether weight normalization could improve sperm parameters should be evaluated further.

Is BMI a relevant marker of fat mass in 4 year old children? Results from the MINISTOP trial.

Science.gov (United States)

Delisle Nyström, Christine; Henriksson, Pontus; Ek, Anna; Henriksson, Hanna; Ortega, Francisco B; Ruiz, Jonatan R; Löf, Marie

2018-03-20

Due to the increase in childhood obesity, identifying children with excess body fat as early as possible is essential. Body mass index (BMI) is commonly used as a marker of body fat in children, adolescents, and adults, yet whether BMI is a valid marker of body fat in pre-school aged children remains to be confirmed. Therefore, we analyzed the associations of BMI with fat and fat-free mass in healthy 4-year-old Swedish children. The study comprised of 303 children (135 girls) participating in the MINISTOP obesity prevention trial. Fat and fat-free mass were measured using air displacement plethysmography and we computed fat mass index (FMI) and fat free mass index (FFMI) as fat and fat free mass (kg)/height 2 (m). BMI was positively yet weakly associated with percent fat mass (boys: r 2  = 0.120, P Children classified as normal weight had a wide range of percent fat mass (12.3 to 35.3%) and FMI (1.75 to 5.78 kg/m 2 ). BMI was strongly associated to both FMI and FFMI. Therefore, caution is needed when interpreting body fat status based on BMI values in pre-school children.

Does more education cause lower BMI, or do lower-BMI individuals become more educated? Evidence from the National Longitudinal Survey of Youth 1979.

Science.gov (United States)

Benson, Rebecca; von Hippel, Paul T; Lynch, Jamie L

2017-03-21

More educated adults have lower average body mass index (BMI). This may be due to selection, if adolescents with lower BMI attain higher levels of education, or it may be due to causation, if higher educational attainment reduces BMI gain in adulthood. We test for selection and causation in the National Longitudinal Survey of Youth 1979, which has followed a representative US cohort from age 14-22 in 1979 through age 47-55 in 2012. Using ordinal logistic regression, we test the selection hypothesis that overweight and obese adolescents were less likely to earn high school diplomas and bachelor's degrees. Then, controlling for selection with individual fixed effects, we estimate the causal effect of degree completion on BMI and obesity status. Among 18-year-old women, but not among men, being overweight or obese predicts lower odds of attaining higher levels of education. At age 47-48, higher education is associated with lower BMI, but 70-90% of the association is due to selection. Net of selection, a bachelor's degree predicts less than a 1 kg reduction in body weight, and a high school credential does not reduce BMI. Copyright © 2017 Elsevier Ltd. All rights reserved.

Change in BMI accurately predicted by social exposure to acquaintances.

Science.gov (United States)

Oloritun, Rahman O; Ouarda, Taha B M J; Moturu, Sai; Madan, Anmol; Pentland, Alex Sandy; Khayal, Inas

2013-01-01

Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO) method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC) and R(2). This study found a model that explains 68% (pchange in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as close friends.

HTLV-1 Tax Oncoprotein Subverts the Cellular DNA Damage Response via Binding to DNA-dependent Protein Kinase*S⃞

Science.gov (United States)

Durkin, Sarah S.; Guo, Xin; Fryrear, Kimberly A.; Mihaylova, Valia T.; Gupta, Saurabh K.; Belgnaoui, S. Mehdi; Haoudi, Abdelali; Kupfer, Gary M.; Semmes, O. John

2008-01-01

Human T-cell leukemia virus type-1 is the causative agent for adult T-cell leukemia. Previous research has established that the viral oncoprotein Tax mediates the transformation process by impairing cell cycle control and cellular response to DNA damage. We showed previously that Tax sequesters huChk2 within chromatin and impairs the response to ionizing radiation. Here we demonstrate that DNA-dependent protein kinase (DNA-PK) is a member of the Tax·Chk2 nuclear complex. The catalytic subunit, DNA-PKcs, and the regulatory subunit, Ku70, were present. Tax-containing nuclear extracts showed increased DNA-PK activity, and specific inhibition of DNA-PK prevented Tax-induced activation of Chk2 kinase activity. Expression of Tax induced foci formation and phosphorylation of H2AX. However, Tax-induced constitutive signaling of the DNA-PK pathway impaired cellular response to new damage, as reflected in suppression of ionizing radiation-induced DNA-PK phosphorylation and γH2AX stabilization. Tax co-localized with phospho-DNA-PK into nuclear speckles and a nuclear excluded Tax mutant sequestered endogenous phospho-DNA-PK into the cytoplasm, suggesting that Tax interaction with DNA-PK is an initiating event. We also describe a novel interaction between DNA-PK and Chk2 that requires Tax. We propose that Tax binds to and stabilizes a protein complex with DNA-PK and Chk2, resulting in a saturation of DNA-PK-mediated damage repair response. PMID:18957425

Longitudinal Analysis of Genetic Susceptibility and BMI Throughout Adult Life.

Science.gov (United States)

Song, Mingyang; Zheng, Yan; Qi, Lu; Hu, Frank B; Chan, Andrew T; Giovannucci, Edward L

2018-02-01

Little is known about the genetic influence on BMI trajectory throughout adulthood. We created a genetic risk score (GRS) comprising 97 adult BMI-associated variants among 9,971 women and 6,405 men of European ancestry. Serial measures of BMI were assessed from 18 (women) or 21 (men) years to 85 years of age. We also examined BMI change in early (from 18 or 21 to 45 years of age), middle (from 45 to 65 years of age), and late adulthood (from 65 to 80 years of age). GRS was positively associated with BMI across all ages, with stronger associations in women than in men. The associations increased from early to middle adulthood, peaked at 45 years of age in men and at 60 years of age in women (0.91 and 1.35 kg/m 2 per 10-allele increment, respectively) and subsequently declined in late adulthood. For women, each 10-allele increment in the GRS was associated with an average BMI gain of 0.54 kg/m 2 in early adulthood, whereas no statistically significant association was found for BMI change in middle or late adulthood or for BMI change in any life period in men. Our findings indicate that genetic predisposition exerts a persistent effect on adiposity throughout adult life and increases early adulthood weight gain in women. © 2017 by the American Diabetes Association.

Difficulty buying food, BMI, and eating habits in young children.

Science.gov (United States)

Fuller, Anne; Maguire, Jonathon L; Carsley, Sarah; Chen, Yang; Lebovic, Gerald; Omand, Jessica; Parkin, Patricia; Birken, Catherine S

2018-01-22

To determine whether parent report of difficulty buying food was associated with child body mass index (BMI) z-score or with eating habits in young children. This was a cross-sectional study in primary care offices in Toronto, Ontario. Subjects were children aged 1-5 years and their caregivers, recruited through the TARGet Kids! Research Network from July 2008 to August 2011. Regression models were developed to test the association between parent report of difficulty buying food because of cost and the following outcomes: child BMI z-score, parent's report of child's intake of fruit and vegetables, fruit juice and sweetened beverages, and fast food. Confounders included child's age, sex, birth weight, maternal BMI, education, ethnicity, immigration status, and neighbourhood income. The study sample consisted of 3333 children. Data on difficulty buying food were available for 3099 children, and 431 of these (13.9%) were from households reporting difficulty buying food. There was no association with child BMI z-score (p = 0.86). Children from households reporting difficulty buying food (compared with never having difficulty buying food) had increased odds of consuming three or fewer servings of fruits and vegetables per day (odds ratio [OR]: 1.31, 95% confidence interval [CI]: 1.03-1.69), more than one serving of fruit juice/sweetened beverage per day (OR: 1.60, 95% CI: 1.28-2.00), and, among children 1-2 years old, one or more servings of fast food per week (OR: 2.91, 95% CI: 1.67-5.08). Parental report of difficulty buying food is associated with less optimal eating habits in children but not with BMI z-score.

Socioeconomic differences in childhood BMI trajectories in Belarus.

Science.gov (United States)

Patel, Rita; Tilling, Kate; Lawlor, Debbie A; Howe, Laura D; Hughes, Rachael A; Bogdanovich, Natalia; Matush, Lidia; Nicoli, Emily; Oken, Emily; Kramer, Michael S; Martin, Richard M

2018-02-28

To examine associations of parental socioeconomic position with early-life offspring body mass index (BMI) trajectories in a middle-income country. Overall, 12,385 Belarusian children born 1996-97 and enrolled in a randomised breastfeeding promotion trial at birth, with 3-14 measurements of BMI from birth to 7 years. Cohort analysis in which exposures were parental education (common secondary or less; advanced secondary or partial university; completed university) and occupation (manual; non-manual) at birth, and the outcome was BMI z-score trajectories estimated using multilevel linear spline models, controlling for trial arm, location, parental BMI, maternal smoking status and number of older siblings. Infants born to university-educated mothers were heavier at birth than those born to secondary school-educated mothers [by 0.13 BMI z-score units (95% confidence interval, CI: 0.07, 0.19) for girls and 0.11 (95% CI: 0.05, 0.17) for boys; equivalent for an infant of average birth length to 43 and 38 g, respectively]. Between the ages of 3-7 years children of the most educated mothers had larger BMI increases than children of the least educated mothers. At age 7 years, after controlling for trial arm and location,  children of university-educated mothers had higher BMIs than those born to secondary school-educated mothers by 0.11 z-score (95% CI: 0.03, 0.19) among girls and 0.18 (95% CI: 0.1, 0.27) among boys, equivalent to differences in BMI for a child of average height of 0.19 and 0.26 kg/m 2 , respectively. After further controlling for parental BMI, these differences attenuated to 0.08 z-score (95% CI: 0, 0.16) and 0.16 z-score (95% CI: 0.07, 0.24), respectively, but changed very little after additional adjustment for number of older siblings and mother's smoking status. Associations were similar when based on paternal educational attainment and highest household occupation. In Belarus, consistent with some middle-income countries, higher socioeconomic

Desirable factors for maintaining normal BMI of urban affluent women of Delhi

OpenAIRE

Anu Taneja Gupta; Anupa Siddhu

2015-01-01

The study aimed to identify desirable social, familial, reproductive, dietary, and lifestyle factors for maintaining normal body mass index (BMI) of urban affluent women (25-45 years) in Delhi, India. A total of 387 urban affluent women with at least one living child participated in this cross-sectional study conducted from March 2008 to April 2010. Women were classified into four BMI categories on the basis of World Health Organization (WHO; 2004) classification for Asians. Significant facto...

Cisplatin Induces Bmi-1 and Enhances the Stem Cell Fraction in Head and Neck Cancer

Directory of Open Access Journals (Sweden)

Carolina Nör

2014-02-01

Full Text Available Recent evidence has unveiled a subpopulation of highly tumorigenic, multipotent cells capable of self-renewal in head and neck squamous cell carcinomas (HNSCCs. These unique cells, named here cancer stem cells (CSCs, proliferate slowly and might be involved in resistance to conventional chemotherapy. We have shown that CSCs are found in perivascular niches and rely on endothelial cell-secreted factors [particularly interleukin-6 (IL-6] for their survival and self-renewal in HNSCC. Here, we hypothesized that cisplatin enhances the stem cell fraction in HNSCC. To address this hypothesis, we generated xenograft HNSCC tumors with University of Michigan-squamous cell carcinoma 22B (UM-SCC-22B cells and observed that cisplatin treatment increased (P = .0013 the fraction of CSCs [i.e., aldehyde dehydrogenase activity high and cluster of differentiation 44 high (ALDHhighCD44high]. Cisplatin promoted self-renewal and survival of CSCs in vitro, as seen by an increase in the number of orospheres in ultralow attachment plates and induction in B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1 and octamer-binding transcription factor 4 expression. Cisplatin-resistant cells expressed more Bmi-1 than cisplatinsensitive cells. IL-6 potentiated cisplatin-induced orosphere formation generated when primary human HNSCC cells were sorted for ALDHhighCD44high immediately after surgery and plated onto ultralow attachment plates. IL-6-induced signal transducer and activator of transcription 3 (STAT3 phosphorylation (indicative of stemness was unaffected by treatment with cisplatin in UM-SCC-22B cells, whereas IL-6-induced extracellular signal-regulated kinase (ERK phosphorylation (indicative of differentiation processes was partially inhibited by cisplatin. Notably, cisplatin-induced Bmi-1 was inhibited by interleukin-6 receptor blockade in parental and cisplatin-resistant cells. Taken together, these results demonstrate that cisplatin enhances the fraction of CSCs

The effect of standardized food intake on the association between BMI and 1H-NMR metabolites

NARCIS (Netherlands)

Schutte, A.M.; Akker, van den Erik B.; Deelen, Joris; Rest, van de O.; Heemst, van D.; Feskens, E.J.M.; Beekman, M.; Slagboom, P.E.

2016-01-01

Multiple studies have shown that levels of 1H-NMR metabolites are associated with disease and risk factors of disease such as BMI. While most previous investigations have been performed in fasting samples, meta-analysis often includes both cohorts with fasting and non-fasting blood samples. In the

Maternal BMI at the start of pregnancy and offspring epigenome-wide DNA methylation: findings from the pregnancy and childhood epigenetics (PACE) consortium

Science.gov (United States)

Sharp, Gemma C.; Salas, Lucas A.; Monnereau, Claire; Allard, Catherine; Yousefi, Paul; Everson, Todd M.; Bohlin, Jon; Xu, Zongli; Huang, Rae-Chi; Reese, Sarah E.; Xu, Cheng-Jian; Baïz, Nour; Hoyo, Cathrine; Agha, Golareh; Roy, Ritu; Holloway, John W.; Ghantous, Akram; Merid, Simon K.; Bakulski, Kelly M.; Küpers, Leanne K.; Zhang, Hongmei; Richmond, Rebecca C.; Page, Christian M.; Duijts, Liesbeth; Lie, Rolv T.; Melton, Phillip E.; Vonk, Judith M.; Nohr, Ellen A.; Williams-DeVane, ClarLynda; Huen, Karen; Rifas-Shiman, Sheryl L.; Ruiz-Arenas, Carlos; Gonseth, Semira; Rezwan, Faisal I.; Herceg, Zdenko; Ekström, Sandra; Croen, Lisa; Falahi, Fahimeh; Perron, Patrice; Karagas, Margaret R.; Quraishi, Bilal M.; Suderman, Matthew; Magnus, Maria C.; Jaddoe, Vincent W.V.; Taylor, Jack A.; Anderson, Denise; Zhao, Shanshan; Smit, Henriette A.; Josey, Michele J.; Bradman, Asa; Baccarelli, Andrea A.; Bustamante, Mariona; Håberg, Siri E.; Pershagen, Göran; Hertz-Picciotto, Irva; Newschaffer, Craig; Corpeleijn, Eva; Bouchard, Luigi; Lawlor, Debbie A.; Maguire, Rachel L.; Barcellos, Lisa F.; Smith, George Davey; Eskenazi, Brenda; Karmaus, Wilfried; Marsit, Carmen J.; Hivert, Marie-France; Snieder, Harold; Fallin, M. Daniele; Melén, Erik; Munthe-Kaas, Monica C.; Arshad, Hasan; Wiemels, Joseph L.; Annesi-Maesano, Isabella; Vrijheid, Martine; Oken, Emily; Holland, Nina; Murphy, Susan K.; Sørensen, Thorkild I.A.; Koppelman, Gerard H.; Newnham, John P.; Wilcox, Allen J.; Nystad, Wenche; London, Stephanie J.; Felix, Janine F.; Relton, Caroline L.

2017-01-01

Pre-pregnancy maternal obesity is associated with adverse offspring outcomes at birth and later in life. Individual studies have shown that epigenetic modifications such as DNA methylation could contribute. Within the Pregnancy and Childhood Epigenetics (PACE) Consortium, we meta-analysed the association between pre-pregnancy maternal BMI and methylation at over 450,000 sites in newborn blood DNA, across 19 cohorts (9,340 mother-newborn pairs). We attempted to infer causality by comparing the effects of maternal versus paternal BMI and incorporating genetic variation. In four additional cohorts (1,817 mother-child pairs), we meta-analysed the association between maternal BMI at the start of pregnancy and blood methylation in adolescents. In newborns, maternal BMI was associated with small (BMI unit (1 kg/m2), P BMI on newborn methylation at just 8/86 sites. In conclusion, this well-powered analysis identified robust associations between maternal adiposity and variations in newborn blood DNA methylation, but these small effects may be better explained by genetic or lifestyle factors than a causal intrauterine mechanism. This highlights the need for large-scale collaborative approaches and the application of causal inference techniques in epigenetic epidemiology. PMID:29016858

Relationship between body fat and BMI in a U.S. Hispanic population-based cohort study: Results from HCHS/SOL

Science.gov (United States)

To evaluate the percentage of body fat (%BF)-BMI relationship, identify %BF levels corresponding to adult BMI cut points, and examine %BF-BMI agreement in a diverse Hispanic/Latino population. %BF by bioelectrical impedance analysis was corrected against %BF by 18O dilution in 434 participants of th...

The Report Card on BMI Report Cards.

Science.gov (United States)

Thompson, Hannah R; Madsen, Kristine A

2017-06-01

Half of states in the USA have legislation requiring that schools conduct body mass index (BMI) screening among students; just under half of these states report results to parents. The effectiveness of school-based BMI screening and reporting in reducing childhood obesity is not established and the practice has raised concerns about the potential for increased weight-based stigmatization. Recent experimental studies of BMI screening and reporting have not demonstrated a positive impact on students' weight status. However, the language and formatting of BMI reports used in studies to date have been suboptimal and have likely limited the potential effectiveness of the practice. This article reviews the recent literature on school-based BMI screening and reporting and highlights important areas for future inquiry. The present review suggests that evidence to date is not sufficient to support definitive conclusions about the value of school-based BMI screening and reporting as a childhood obesity prevention tool.

Change in BMI accurately predicted by social exposure to acquaintances.

Directory of Open Access Journals (Sweden)

Rahman O Oloritun

Full Text Available Research has mostly focused on obesity and not on processes of BMI change more generally, although these may be key factors that lead to obesity. Studies have suggested that obesity is affected by social ties. However these studies used survey based data collection techniques that may be biased toward select only close friends and relatives. In this study, mobile phone sensing techniques were used to routinely capture social interaction data in an undergraduate dorm. By automating the capture of social interaction data, the limitations of self-reported social exposure data are avoided. This study attempts to understand and develop a model that best describes the change in BMI using social interaction data. We evaluated a cohort of 42 college students in a co-located university dorm, automatically captured via mobile phones and survey based health-related information. We determined the most predictive variables for change in BMI using the least absolute shrinkage and selection operator (LASSO method. The selected variables, with gender, healthy diet category, and ability to manage stress, were used to build multiple linear regression models that estimate the effect of exposure and individual factors on change in BMI. We identified the best model using Akaike Information Criterion (AIC and R(2. This study found a model that explains 68% (p<0.0001 of the variation in change in BMI. The model combined social interaction data, especially from acquaintances, and personal health-related information to explain change in BMI. This is the first study taking into account both interactions with different levels of social interaction and personal health-related information. Social interactions with acquaintances accounted for more than half the variation in change in BMI. This suggests the importance of not only individual health information but also the significance of social interactions with people we are exposed to, even people we may not consider as

BMI Trajectories from Birth to Young Adulthood.

Science.gov (United States)

McGinty, Shannon M; Osganian, Stavroula K; Feldman, Henry A; Milliren, Carly E; Field, Alison E; Richmond, Tracy K

2018-04-19

This study aimed to compare BMI trajectories from childhood to early adulthood in those with overweight and/or obesity versus severe obesity. Longitudinal BMI values (2,542 measurements) were calculated from measured heights and weights for 103 children, adolescents, or young adults with overweight, obesity, or severe obesity. Segmented regression with splines was used to model BMI trajectories. Sixty-nine participants were classified as ever having severe obesity versus 34 who never had severe obesity. Trajectories and slopes did not differ by sex or race/ethnicity. Compared with those who never had severe obesity, BMI was higher in the group with severe obesity at all ages, and BMI slope was higher for those with severe obesity at age 14 (P = 0.002), with peak slope occurring later (18 years vs. 16 years) and higher (4.5 ± 0.5 kg/m 2 /y vs. 2.9 ± 0.5 kg/m 2 /y; P BMI fell below zero by the mid-20s (-0.3 ± 0.6 kg/m 2 /y); in those with severe obesity, BMI slope never reached zero (0.9 ± 0.5 kg/m 2 /y). Youth with severe obesity, compared with their peers without, started with higher BMIs, had more rapid rates of BMI increase beginning at age 14, as well as a higher peak and longer period of increase, and never achieved weight stabilization. © 2018 The Obesity Society.

High BMI levels associate with reduced mRNA expression of IL10 and increased mRNA expression of iNOS (NOS2) in human frontal cortex

DEFF Research Database (Denmark)

Lauridsen, J K; Olesen, R H; Vendelbo, J

2017-01-01

analysis was performed with BMI as variable on data on IL10, IL1β, IL6, PTGS2 (COX2) and NOS2 (iNOS). Increasing BMI is associated with a decrease in the mRNA expression of IL10 (P=0.014) and an increase in the expression of NOS2 (iNOS; P=0.040). Expressions of IL10 and NOS2 (iNOS) were negatively...... correlated (PIL10 was mostly affected by individuals with BMI ⩾40. Multiple linear regression analyses with BMI, age, sex and race as variables were performed in order to identify potential confounders. In conclusion, increasing BMI could affect the IL10-mediated anti...

Role of adapter function in oncoprotein-mediated activation of NF-kappaB. Human T-cell leukemia virus type I Tax interacts directly with IkappaB kinase gamma.

Science.gov (United States)

Jin, D Y; Giordano, V; Kibler, K V; Nakano, H; Jeang, K T

1999-06-18

Mechanisms by which the human T-cell leukemia virus type I Tax oncoprotein activates NF-kappaB remain incompletely understood. Although others have described an interaction between Tax and a holo-IkappaB kinase (IKK) complex, the exact details of protein-protein contact are not fully defined. Here we show that Tax binds to neither IKK-alpha nor IKK-beta but instead complexes directly with IKK-gamma, a newly characterized component of the IKK complex. This direct interaction with IKK-gamma correlates with Tax-induced IkappaB-alpha phosphorylation and NF-kappaB activation. Thus, our findings establish IKK-gamma as a key molecule for adapting an oncoprotein-specific signaling to IKK-alpha and IKK-beta.

Effect of weight, height and BMI on injury outcome in side impact crashes without airbag deployment.

Science.gov (United States)

Pal, Chinmoy; Tomosaburo, Okabe; Vimalathithan, K; Jeyabharath, M; Muthukumar, M; Satheesh, N; Narahari, S

2014-11-01

A comprehensive analysis is performed to evaluate the effect of weight, height and body mass index (BMI) of occupants on side impact injuries at different body regions. The accident dataset for this study is based on the National Automotive Sampling System-Crashworthiness Data System (NASS-CDS) for accident year 2000-08. The mean BMI values for driver and front passenger are estimated from all types of crashes using NASS database, which clearly indicates that mean BMI has been increasing over the years in the USA. To study the effect of BMI in side impact injuries, BMI was split into three groups namely (1) thin (BMI30). For more clear identification of the effect of BMI in side impact injuries, a minimum gap of three BMI is set in between each adjacent BMI groups. Car model years from MY1995-1999 to MY2000-2008 are chosen in order to identify the degree of influence of older and newer generation of cars in side impact injuries. Impact locations particularly side-front (F), side-center (P) and side-distributed (Y) are chosen for this analysis. Direction of force (DOF) considered for both near side and far side occupants are 8 o'clock, 9 o'clock, 10 o'clock and 2 o'clock, 3 o'clock and 4 o'clock respectively. Age <60 years is also one of the constraints imposed on data selection to minimize the effect of bone strength on the occurrence of occupant injuries. AIS2+ and AIS3+ injury risk in all body regions have been plotted for the selected three BMI groups of occupant, delta-V 0-60kmph, two sets (old and new) of car model years. The analysis is carried with three approaches: (a) injury risk percentage based on simple graphical method with respect to a single variable, (b) injury distribution method where the injuries are marked on the respective anatomical locations and (c) logistic regression, a statistical method, considers all the related variables together. Lower extremity injury risk appears to be high for thin BMI group. It is found that BMI does not have much

Know Your Body Mass Index (BMI)

Science.gov (United States)

... Past Issues Special Section Know Your Body Mass Index (BMI) Past Issues / Winter 2007 Table of Contents ... aging, it pays to understand your body mass index (BMI), a measure of body fat based on ...

Effects of BMI, Fat Mass, and Lean Mass on Asthma in Childhood: A Mendelian Randomization Study

Science.gov (United States)

Granell, Raquel; Henderson, A. John; Evans, David M.; Smith, George Davey; Ness, Andrew R.; Lewis, Sarah; Palmer, Tom M.; Sterne, Jonathan A. C.

2014-01-01

Background Observational studies have reported associations between body mass index (BMI) and asthma, but confounding and reverse causality remain plausible explanations. We aim to investigate evidence for a causal effect of BMI on asthma using a Mendelian randomization approach. Methods and Findings We used Mendelian randomization to investigate causal effects of BMI, fat mass, and lean mass on current asthma at age 7½ y in the Avon Longitudinal Study of Parents and Children (ALSPAC). A weighted allele score based on 32 independent BMI-related single nucleotide polymorphisms (SNPs) was derived from external data, and associations with BMI, fat mass, lean mass, and asthma were estimated. We derived instrumental variable (IV) estimates of causal risk ratios (RRs). 4,835 children had available data on BMI-associated SNPs, asthma, and BMI. The weighted allele score was strongly associated with BMI, fat mass, and lean mass (all p-valuesBMI on asthma was 1.55 (95% CI 1.16–2.07) per kg/m2, p = 0.003. This effect appeared stronger for non-atopic (1.90, 95% CI 1.19–3.03) than for atopic asthma (1.37, 95% CI 0.89–2.11) though there was little evidence of heterogeneity (p = 0.31). The estimated causal RRs for the effects of fat mass and lean mass on asthma were 1.41 (95% CI 1.11–1.79) per 0.5 kg and 2.25 (95% CI 1.23–4.11) per kg, respectively. The possibility of genetic pleiotropy could not be discounted completely; however, additional IV analyses using FTO variant rs1558902 and the other BMI-related SNPs separately provided similar causal effects with wider confidence intervals. Loss of follow-up was unlikely to bias the estimated effects. Conclusions Higher BMI increases the risk of asthma in mid-childhood. Higher BMI may have contributed to the increase in asthma risk toward the end of the 20th century. Please see later in the article for the Editors' Summary PMID:24983943

Changes in Adult BMI and Waist Circumference Are Associated with Increased Risk of Advanced Colorectal Neoplasia.

Science.gov (United States)

Gathirua-Mwangi, Wambui G; Monahan, Patrick; Song, Yiqing; Zollinger, Terrell W; Champion, Victoria L; Stump, Timothy E; Imperiale, Thomas F

2017-11-01

Waist circumference (WC) is a stronger predictor of colon cancer (CRC) risk than body mass index (BMI). However, how well change in either WC or BMI predicts risk of advanced colorectal neoplasia (AN) is unclear. To determine the relationship between change in BMI and WC from early adulthood to later age and the risk of AN and which change measure is a stronger predictor. In 4500 adults, ages 50-80, with no previous neoplasia and undergoing screening colonoscopy, BMI and WC at age 21 and at time of screening were reported. Changes in BMI and WC were defined using universal risk cutoffs. Known CRC risk factors were controlled in the logistic models. Overall, model statistics showed WC change (omnibus test χ 2  = 10.15, 2 DF, p value = 0.006) was a statistically stronger predictor of AN than BMI change (omnibus test χ 2  = 5.66, 5 DF, p value = 0.34). Independent of BMI change, participants who increased WC (OR 1.44; 95% CI 1.05-1.96) or maintained a high-risk WC (OR 2.50; 95% CI 1.38-4.53) at age 21 and at screening had an increased risk of AN compared to those with a low-risk WC. Study participants who were obese at age 21 and at screening had an increased risk of AN (OR 1.87; 95% CI 1.08-3.23) compared to those who maintained a healthy BMI. Maintaining an overweight BMI or increasing BMI was not associated with AN. Maintaining an unhealthy BMI and WC throughout adult life may increase risk of AN. WC change may be a better predictor of AN than BMI change.

Influence of age, BMI, gender and lumbar level on T1ρ magnetic resonance imaging of lumbar discs in healthy asymptomatic adults

Energy Technology Data Exchange (ETDEWEB)

Guebitz, Raphael [Asklepios Hospital Altona, Hamburg (Germany). Dept. of Radiology and Neuroradiology; Lange, Tobias; Gosheger, Georg [University Hospital Muenster (Germany). Dept. of Orthopaedics and Tumor Orthopaedics; Heindel, Walter; Allkemper, Thomas [University Hospital Muenster (Germany). Dept. of Clinical Radiology; Stehling, Christoph [Sankt-Barbara Hospital Ham-Heessen, Hamm (Germany). Clinic for Radiology and Neuroradiology; Gerss, Joachim [Muenster Univ. (Germany). Inst. of Biostatistics and Clinical Research; Kanthak, Christian [Fraunhofer MEVIS, Bremen (Germany). Inst. for Medical Image Computing; Schulte, Tobias L. [Bochum Univ. St. Josef Hospital (Germany). Dept. of Orthopaedics and Trauma Surgery

2018-02-15

To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.

Influence of age, BMI, gender and lumbar level on T1ρ magnetic resonance imaging of lumbar discs in healthy asymptomatic adults

International Nuclear Information System (INIS)

Guebitz, Raphael; Lange, Tobias; Gosheger, Georg; Heindel, Walter; Allkemper, Thomas; Stehling, Christoph; Gerss, Joachim; Kanthak, Christian; Schulte, Tobias L.

2018-01-01

To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.

hrHPV E5 oncoprotein: immune evasion and related immunotherapies.

Science.gov (United States)

de Freitas, Antonio Carlos; de Oliveira, Talita Helena Araújo; Barros, Marconi Rego; Venuti, Aldo

2017-05-25

The immune response is a key factor in the fight against HPV infection and related cancers, and thus, HPV is able to promote immune evasion through the expression of oncogenes. In particular, the E5 oncogene is responsible for modulation of several immune mechanisms, including antigen presentation and inflammatory pathways. Moreover, E5 was suggested as a promising therapeutic target, since there is still no effective medical therapy for the treatment of HPV-related pre-neoplasia and cancer. Indeed, several studies have shown good prospective for E5 immunotherapy, suggesting that it could be applied for the treatment of pre-cancerous lesions. Thus, insofar as the majority of cervical, oropharyngeal and anal cancers are caused by high-risk HPV (hrHPV), mainly by HPV16, the aim of this review is to discuss the immune pathways interfered by E5 oncoprotein of hrHPV highlighting the various aspects of the potential immunotherapeutic approaches.

Human T-cell leukemia virus type 1 Tax oncoprotein represses the expression of the BCL11B tumor suppressor in T-cells

Science.gov (United States)

Takachi, Takayuki; Takahashi, Masahiko; Takahashi-Yoshita, Manami; Higuchi, Masaya; Obata, Miki; Mishima, Yukio; Okuda, Shujiro; Tanaka, Yuetsu; Matsuoka, Masao; Saitoh, Akihiko; Green, Patrick L; Fujii, Masahiro

2015-01-01

Human T-cell leukemia virus type 1 (HTLV-1) is the etiological agent of adult T cell leukemia (ATL), which is an aggressive form of T-cell malignancy. HTLV-1 oncoproteins, Tax and HBZ, play crucial roles in the immortalization of T-cells and/or leukemogenesis by dysregulating the cellular functions in the host. Recent studies show that HTLV-1-infected T-cells have reduced expression of the BCL11B tumor suppressor protein. In the present study, we explored whether Tax and/or HBZ play a role in downregulating BCL11B in HTLV-1-infected T-cells. Lentiviral transduction of Tax in a human T-cell line repressed the expression of BCL11B at both the protein and mRNA levels, whereas the transduction of HBZ had little effect on the expression. Tax mutants with a decreased activity for the NF-κB, CREB or PDZ protein pathways still showed a reduced expression of the BCL11B protein, thereby implicating a different function of Tax in BCL11B downregulation. In addition, the HTLV-2 Tax2 protein reduced the BCL11B protein expression in T-cells. Seven HTLV-1-infected T-cell lines, including three ATL-derived cell lines, showed reduced BCL11B mRNA and protein expression relative to an uninfected T-cell line, and the greatest reductions were in the cells expressing Tax. Collectively, these results indicate that Tax is responsible for suppressing BCL11B protein expression in HTLV-1-infected T-cells; Tax-mediated repression of BCL11B is another mechanism that Tax uses to promote oncogenesis of HTLV-1-infected T-cells. PMID:25613934

The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

Science.gov (United States)

2014-03-01

8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

A Comparison between BMI, Waist Circumference, and Waist-To-Height Ratio for Identifying Cardio-Metabolic Risk in Children and Adolescents

DEFF Research Database (Denmark)

Sardinha, Luís B; Santos, Diana A; Silva, Analiza M

2016-01-01

R) with clustered cardiometabolic risk factors and to determine whether these anthropometric variables can be used to discriminate individuals with increased cardiometabolic risk (increased clustered triglycerides, HDL-cholesterol, systolic and diastolic blood pressure, and HOMA-IR). METHODS: The study sample...... pressure (mean arterial pressure), and HOMA-IR] and children with ≥1.0 SD in this score were defined as being at risk for clustering cardiometabolic risk factors.. Exposure variables were BMI, WC, WHtR. Statistics included mixed-effect regression and ROC analysis. RESULTS: All anthropometric variables were...

Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

Science.gov (United States)

Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

2017-12-01

This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with

Dinner rituals that correlate with child and adult BMI.

Science.gov (United States)

Wansink, Brian; van Kleef, Ellen

2014-05-01

What predicts whether a child will be at risk for obesity? Whereas past research has focused on foods, eating habits, feeding styles, and family meal patterns, this study departs from a food-centric approach to examine how various dinner rituals might influence the BMIs of children and adults. In this study of 190 parents (BMI = 29.1 ± 7.2) and 148 children (BMI = 20.3 ± 4.4), the relationship between their BMIs and everyday family dinner rituals was examined using both correlation and regression analysis (controlled for educational level of parents). Families who frequently ate dinner in the kitchen or dining room had significantly lower BMIs for both adults (r = -0.31) and children (r = -0.24) compared to families who ate elsewhere. Additionally, helping cook dinner was associated with higher BMI for girls (r = 0.26), and remaining at the table until everyone is finished with eating was associated with lower BMI for boys (r = -0.31). Dinner tables may be one place where social support and family involvement meet-both of which relate to the BMI of children as well as parents. Family meals and their rituals might be an underappreciated battleground to fight obesity. Copyright © 2013 The Obesity Society.

The Impact of Waiting List BMI Changes on the Short-term Outcomes of Lung Transplantation.

Science.gov (United States)

Jomphe, Valérie; Mailhot, Geneviève; Damphousse, Véronic; Tahir, Muhammad-Ramzan; Receveur, Olivier; Poirier, Charles; Ferraro, Pasquale

2018-02-01

Obesity and underweight are associated with a higher postlung transplantation (LTx) mortality. This study aims to assess the impact of the changes in body mass index (BMI) during the waiting period for LTx on early postoperative outcomes. Medical records of 502 consecutive cases of LTx performed at our institution between 1999 and 2015 were reviewed. Patients were stratified per change in BMI category between pre-LTx assessment (candidate BMI) and transplant BMI as follows: A-candidate BMI, less than 18.5 or 18.5 to 29.9 and transplant BMI, less than 18.5; B-candidate BMI, less than 18.5 and transplant BMI, 18.5 to 29.9; C-candidate BMI, 18.5 to 29.9 and transplant BMI, 18.5 to 29.9; D-candidate BMI, 30 or greater and transplant BMI, 18.5 to 29.9; and E-candidate BMI, 30 or greater or 18.5 to 29.9 and transplant BMI, 30 or greater. Our primary outcome was in-hospital mortality and secondary outcomes were length of mechanical ventilation, intensive care unit length of stay (LOS), hospital LOS and postoperative complications. BMI variation during the waiting time was common, as 1/3 of patients experienced a change in BMI category. Length of mechanical ventilation (21 days vs 9 days; P = 0.018), intensive care unit LOS (26 days vs 15 days; P = 0.035), and rates of surgical complications (76% vs 44%; P = 0.018) were significantly worse in patients of group E versus group D. Obese candidates who failed to decrease BMI less than 30 by transplant exhibited an increased risk of postoperative mortality (odds ratio, 2.62; 95% confidence interval, 1.01-6.48) compared with patients in group C. Pre-LTx BMI evolution had no impact on postoperative morbidity and mortality in underweight patients. Our results suggest that obese candidates with an unfavorable pretransplant BMI evolution are at greater risk of worse post-LTx outcomes.

Obesogenic family types identified through latent profile analysis.

Science.gov (United States)

Martinson, Brian C; VazquezBenitez, Gabriela; Patnode, Carrie D; Hearst, Mary O; Sherwood, Nancy E; Parker, Emily D; Sirard, John; Pasch, Keryn E; Lytle, Leslie

2011-10-01

Obesity may cluster in families due to shared physical and social environments. This study aims to identify family typologies of obesity risk based on family environments. Using 2007-2008 data from 706 parent/youth dyads in Minnesota, we applied latent profile analysis and general linear models to evaluate associations between family typologies and body mass index (BMI) of youth and parents. Three typologies described most families with 18.8% "Unenriched/Obesogenic," 16.9% "Risky Consumer," and 64.3% "Healthy Consumer/Salutogenic." After adjustment for demographic and socioeconomic factors, parent BMI and youth BMI Z-scores were higher in unenriched/obesogenic families (BMI difference = 2.7, p typology. In contrast, parent BMI and youth BMI Z-scores were similar in the risky consumer families relative to those in healthy consumer/salutogenic type. We can identify family types differing in obesity risks with implications for public health interventions.

The association of plasma cysteine and gamma-glutamyltransferase with BMI and obesity.

LENUS (Irish Health Repository)

Elshorbagy, Amany K

2009-07-01

We recently reported a strong positive association of plasma total cysteine (tCys) with fat mass in over 5,000 subjects. As gamma-glutamyltransferase (GGT) enzyme increases cysteine availability by catalyzing glutathione breakdown and is positively associated with BMI and adiposity, we hypothesized that GGT might explain the association of tCys with adiposity. To study whether the associations of tCys and serum GGT with BMI and obesity were interrelated we conducted a cross-sectional study using data from 1,550 subjects recruited from nine European countries in the COMAC project. Multiple linear and logistic regression models and concentration-response curves were used. In age and sex-adjusted analyses, tCys showed strong positive associations with BMI (partial r = 0.19, P < 0.001), and obesity (odds ratio (OR) for 4th vs. 1st tCys quartile: 2.8; 95% confidence interval: 1.6-5.0, P < 0.001), both of which remained robust after adjustment for GGT and other metabolic and lifestyle confounders. Serum GGT was also a positive predictor of BMI (partial r = 0.17, P < 0.001) and obesity (OR for 4th vs. 1st GGT quartile: 4.8; 95% confidence interval: 2.5-9.2, P < 0.001), independent of tCys. However, the associations of GGT with BMI and obesity were weakened by adjustment for obesity-related factors such as serum lipids and blood pressure. These results indicate that tCys is a strong positive predictor of BMI and obesity, independent of GGT and other obesity-related factors. We also suggest that the association of serum GGT with BMI and obesity is unrelated to the role of GGT in cysteine turnover. The potential link between cysteine and fat metabolism should be further evaluated.

School environment factors were associated with BMI among adolescents in Xi'an City, China

Directory of Open Access Journals (Sweden)

Dibley Michael J

2011-10-01

Full Text Available Abstract Background School environment influences students' behaviours. The purpose of this research was to identify school environment factors associated with BMI. Methods A cross-sectional study was conducted among 1792 school-aged adolescents from 30 schools in six districts in Xi'an City in 2004. Height and weight were taken from students by trained field staff. School environment characteristics such as physical factors (school facilities, school shops and fast food outlets in school area, school curricula and policies were collected from school doctors using school environment questionnaire. School environment factors were identified in linear mixed effect models with BMI as outcome and adjusted for socio-demographic factors. Results After adjusted for socio-demographic factors, BMI was associated with the availability of soft drinks at school shops, the availability and the number of western food outlet in the school vicinity. School curricula such as sports-meeting and health education session were also associated with BMI. Conclusions Urgent actions are needed to address the obesogenic elements of school environments. Community and school policy makers should make efforts for students to avoid exposure to fast food outlet in school area and soft drinks at school shops, and to improve school curricula to promote healthy behaviours.

Impact of HSD11B1 polymorphisms on BMI and components of the metabolic syndrome in patients receiving psychotropic treatments

KAUST Repository

Quteineh, Lina; Vandenberghe, Frederik; Saigi Morgui, Nuria; Delacré taz, Auré lie; Choong, Eva; Gholam-Rezaee, Mehdi; Magistretti, Pierre J.; Bondolfi, Guido; Von Gunten, Armin; Preisig, Martin A.; Castelao, Enrique; Vollenweider, Peter; Waeber, Gé rard; Bochud, Murielle; Kutalik, Zoltá n; Conus, Philippe O.; Eap, Chin Bin

2015-01-01

Background Metabolic syndrome (MetS) associated with psychiatric disorders and psychotropic treatments represents a major health issue. 11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1) is an enzyme that catalyzes tissue regeneration of active cortisol from cortisone. Elevated enzymatic activity of 11β-HSD1 may lead to the development of MetS. Methods We investigated the association between seven HSD11B1 gene (encoding 11β-HSD1) polymorphisms and BMI and MetS components in a psychiatric sample treated with potential weight gain-inducing psychotropic drugs (n=478). The polymorphisms that survived Bonferroni correction were analyzed in two independent psychiatric samples (n R1 =168, n R2 =188) and in several large population-based samples (n 1 =5338; n 2 =123 865; n 3 >100 000). Results HSD11B1 rs846910-A, rs375319-A, and rs4844488-G allele carriers were found to be associated with lower BMI, waist circumference, and diastolic blood pressure compared with the reference genotype (P corrected <0.05). These associations were exclusively detected in women (n=257) with more than 3.1 kg/m 2, 7.5 cm, and 4.2 mmHg lower BMI, waist circumference, and diastolic blood pressure, respectively, in rs846910-A, rs375319-A, and rs4844488-G allele carriers compared with noncarriers (P corrected <0.05). Conversely, carriers of the rs846906-T allele had significantly higher waist circumference and triglycerides and lower high-density lipoprotein-cholesterol exclusively in men (P corrected =0.028). The rs846906-T allele was also associated with a higher risk of MetS at 3 months of follow-up (odds ratio: 3.31, 95% confidence interval: 1.53-7.17, P corrected =0.014). No association was observed between HSD11B1 polymorphisms and BMI and MetS components in the population-based samples. Conclusions Our results indicate that HSD11B1 polymorphisms may contribute toward the development of MetS in psychiatric patients treated with potential weight gain-inducing psychotropic drugs, but do not

BMI, diet and female reproductive factors as risks for thyroid cancer: a systematic review.

Directory of Open Access Journals (Sweden)

Emily Peterson

Full Text Available BACKGROUND: Thyroid cancer incidence rates have been increasing worldwide but the reason behind this is unclear. Both the increasing use of diagnostic technologies allowing the detection of thyroid cancer and a true increase in thyroid cancer incidence have been proposed. This review assesses the role of body mass index (BMI, diet, and reproductive factors on the thyroid cancer trend. METHODS: Epidemiologic studies of the selected risk factors up to June 2010 were reviewed and critically assessed. RESULTS: Among the thirty-seven studies reviewed and despite variation in the risk estimates, most papers supported a small but positive association for BMI (risk estimate range: 1.1-2.3 in males and 1.0-7.4 in females.. Among specific dietary components, there was no consistent association of thyroid cancer risk with iodine intake through fortification (risk estimate range: 0.49-1.6 or fish consumption (risk estimate range 0.6-2.2, nor with diets high in cruciferous vegetables (risk estimate range 0.6-1.9. A small number of studies showed a consistent protective effect of diets high in non-cruciferous vegetable (risk estimate range: 0.71-0.92. Among reproductive factors (pregnancy, parity, number of live births, use of prescription hormones, menstrual cycle regularity, and menopausal status, none were consistently associated with higher thyroid cancer risk. CONCLUSIONS: BMI had the strongest link to thyroid cancer risk among those examined. Detailed examinations of population-level risk factors can help identify and support prevention efforts to reduce the burden of thyroid cancer.

Prediction of BMI at age 11 in a longitudinal sample of the Ulm Birth Cohort Study.

Directory of Open Access Journals (Sweden)

Hanna Christiansen

Full Text Available Obesity is one of the greatest public health challenges in the world with childhood prevalence rates between 20-26% and numerous associated health risks. The aim of the current study was to analyze the 11-year follow-up data of the Ulm Birth Cohort Study (UBCS, to identify whether abnormal eating behavior patterns, especially restrained eating, predict body mass index (BMI at 11 years of age and to explore other factors known to be longitudinally associated with it. Of the original UBCS, n = 422 children (~ 40% of the original sample and their parents participated in the 11-year follow-up. BMI at age 8 and 11 as well as information on restrained eating, psychological problems, depressive symptoms, lifestyle, and IQ at age 8 were assessed. Partial Least Squares Structural Equation Modeling (PLS-SEM was used to predict children's BMI scores at age 11. PLS-SEM explained 68% of the variance of BMI at age 11, with BMI at age 8 being the most important predictor. Restrained eating, via BMI at age 8 as well as parental BMI, had further weak associations with BMI at age 11; no other predictor was statistically significant. Since established overweight at age 8 already predicts BMI scores at age 11 longitudinally, obesity interventions should be implemented in early childhood.

BMI calculation in older people: The effect of using direct and surrogate measures of height in a community-based setting.

Science.gov (United States)

Butler, Rose; McClinchy, Jane; Morreale-Parker, Claudia; Marsh, Wendy; Rennie, Kirsten L

2017-12-01

There is currently no consensus on which measure of height should be used in older people's body mass index (BMI) calculation. Most estimates of nutritional status include a measurement of body weight and height which should be reliable and accurate, however at present several different methods are used interchangeably. BMI, a key marker in malnutrition assessment, does not reflect age-related changes in height or changes in body composition such as loss of muscle mass or presence of oedema. The aim of this pilot study was to assess how the use of direct and surrogate measures of height impacts on BMI calculation in people aged ≥75 years. A cross-sectional study of 64 free-living older people (75-96 yrs) quantified height by two direct measurements, current height (H C ), and self-report (H R ) and surrogate equations using knee height (H K ) and ulna length (H U ). BMI calculated from current height measurement (BMI C ) was compared with BMI calculated using self-reported height (BMI R ) and height estimated from surrogate equations for knee height (BMI K ) and ulna length (BMI U ). Median difference of BMI C -BMI R was 2.31 kg/m 2 . BMI K gave the closest correlation to BMI C . The percentage of study participants identified at increased risk of under-nutrition (BMI BMI; from 5% (BMI C ), 7.8% (BMI K ), 12.5% (BMI U ), to 14% (BMI R ) respectively. The results of this pilot study in a relatively healthy sample of older people suggest that interchangeable use of current and reported height in people ≥75 years can introduce substantial significant systematic error. This discrepancy could impact nutritional assessment of older people in poor health and lead to misclassification during nutritional screening if other visual and clinical clues are not taken into account. This could result in long-term clinical and cost implications if individuals who need nutrition support are not correctly identified. A consensus is required on which method should be used to

Multistage modeling of protein dynamics with monomeric Myc oncoprotein as an example.

Science.gov (United States)

Liu, Jiaojiao; Dai, Jin; He, Jianfeng; Niemi, Antti J; Ilieva, Nevena

2017-03-01

We propose to combine a mean-field approach with all-atom molecular dynamics (MD) into a multistage algorithm that can model protein folding and dynamics over very long time periods yet with atomic-level precision. As an example, we investigate an isolated monomeric Myc oncoprotein that has been implicated in carcinomas including those in colon, breast, and lungs. Under physiological conditions a monomeric Myc is presumed to be an example of intrinsically disordered proteins that pose a serious challenge to existing modeling techniques. We argue that a room-temperature monomeric Myc is in a dynamical state, it oscillates between different conformations that we identify. For this we adopt the Cα backbone of Myc in a crystallographic heteromer as an initial ansatz for the monomeric structure. We construct a multisoliton of the pertinent Landau free energy to describe the Cα profile with ultrahigh precision. We use Glauber dynamics to resolve how the multisoliton responds to repeated increases and decreases in ambient temperature. We confirm that the initial structure is unstable in isolation. We reveal a highly degenerate ground-state landscape, an attractive set towards which Glauber dynamics converges in the limit of vanishing ambient temperature. We analyze the thermal stability of this Glauber attractor using room-temperature molecular dynamics. We identify and scrutinize a particularly stable subset in which the two helical segments of the original multisoliton align in parallel next to each other. During the MD time evolution of a representative structure from this subset, we observe intermittent quasiparticle oscillations along the C-terminal α helix, some of which resemble a translating Davydov's Amide-I soliton. We propose that the presence of oscillatory motion is in line with the expected intrinsically disordered character of Myc.

Body mass index cut-points to identify cardiometabolic risk in black South Africans.

Science.gov (United States)

Kruger, H Salome; Schutte, Aletta E; Walsh, Corinna M; Kruger, Annamarie; Rennie, Kirsten L

2017-02-01

To determine optimal body mass index (BMI) cut-points for the identification of cardiometabolic risk in black South African adults. We performed a cross-sectional study of a weighted sample of healthy black South Africans aged 25-65 years (721 men, 1386 women) from the North West and Free State Provinces. Demographic, lifestyle and anthropometric measures were taken, and blood pressure, fasting serum triglycerides, high-density lipoprotein (HDL) cholesterol and blood glucose were measured. We defined elevated cardiometabolic risk as having three or more risk factors according to international metabolic syndrome criteria. Receiver operating characteristic curves were applied to identify an optimal BMI cut-point for men and women. BMI had good diagnostic performance to identify clustering of three or more risk factors, as well as individual risk factors: low HDL-cholesterol, elevated fasting glucose and triglycerides, with areas under the curve >.6, but not for high blood pressure. Optimal BMI cut-points averaged 22 kg/m 2 for men and 28 kg/m 2 for women, respectively, with better sensitivity in men (44.0-71.9 %), and in women (60.6-69.8 %), compared to a BMI of 30 kg/m 2 (17-19.1, 53-61.4 %, respectively). Men and women with a BMI >22 and >28 kg/m 2 , respectively, had significantly increased probability of elevated cardiometabolic risk after adjustment for age, alcohol use and smoking. In black South African men, a BMI cut-point of 22 kg/m 2 identifies those at cardiometabolic risk, whereas a BMI of 30 kg/m 2 underestimates risk. In women, a cut-point of 28 kg/m 2 , approaching the WHO obesity cut-point, identifies those at risk.

Admixture mapping of 15,280 African Americans identifies obesity susceptibility loci on chromosomes 5 and X.

Directory of Open Access Journals (Sweden)

Ching-Yu Cheng

2009-05-01

Full Text Available The prevalence of obesity (body mass index (BMI > or =30 kg/m(2 is higher in African Americans than in European Americans, even after adjustment for socioeconomic factors, suggesting that genetic factors may explain some of the difference. To identify genetic loci influencing BMI, we carried out a pooled analysis of genome-wide admixture mapping scans in 15,280 African Americans from 14 epidemiologic studies. Samples were genotyped at a median of 1,411 ancestry-informative markers. After adjusting for age, sex, and study, BMI was analyzed both as a dichotomized (top 20% versus bottom 20% and a continuous trait. We found that a higher percentage of European ancestry was significantly correlated with lower BMI (rho = -0.042, P = 1.6x10(-7. In the dichotomized analysis, we detected two loci on chromosome X as associated with increased African ancestry: the first at Xq25 (locus-specific LOD = 5.94; genome-wide score = 3.22; case-control Z = -3.94; and the second at Xq13.1 (locus-specific LOD = 2.22; case-control Z = -4.62. Quantitative analysis identified a third locus at 5q13.3 where higher BMI was highly significantly associated with greater European ancestry (locus-specific LOD = 6.27; genome-wide score = 3.46. Further mapping studies with dense sets of markers will be necessary to identify the alleles in these regions of chromosomes X and 5 that may be associated with variation in BMI.

Human milk insulin is related to maternal plasma insulin and BMI: but other components of human milk do not differ by BMI.

Science.gov (United States)

Young, B E; Patinkin, Z; Palmer, C; de la Houssaye, B; Barbour, L A; Hernandez, T; Friedman, J E; Krebs, N F

2017-09-01

The impact of maternal BMI and insulin sensitivity on bioactive components of human milk (HM) is not well understood. As the prevalence of obesity and diabetes rises, it is increasingly critical that we understand how maternal BMI and hormones associated with metabolic disease relate to concentrations of bioactive components in HM. This longitudinal cohort design followed 48 breastfeeding mothers through the first four months of lactation, collecting fasting morning HM samples at 2-weeks and 1, 2, 3 and 4-months, and fasting maternal blood at 2-weeks and 4-months. Insulin, glucose, adipokines leptin and adiponectin, appetite regulating hormone ghrelin, marker of oxidative stress 8OHdG and inflammatory cytokines (IL-6, IL-8, and TNF-a) were measured in HM and maternal plasma. A total of 26 normal weight (NW) (BMI=21.4±2.0 kg/m 2 ) and 22 overweight/obese (OW/Ob) (BMI=30.4±4.2 kg/m 2 ) were followed. Of all HM analytes measured, only insulin and leptin were different between groups - consistently higher in the OW/Ob group (leptin: P<0.001; insulin: P<0.03). HM insulin was 98% higher than maternal plasma insulin at 2-weeks and 32% higher at 4-months (P<0.001). Maternal fasting plasma insulin and HOMA-IR were positively related to HM insulin at 2-weeks (P<0.001, R 2 ⩾0.38, n=31), and 4-months (P⩽0.005, R 2 ⩾0.20, n=38). The concentrations of insulin in HM are higher than in maternal plasma and are related to maternal BMI and insulin sensitivity. With the exception of leptin, there were minimal other differences observed in HM composition across a wide range in maternal BMI.

Associations between parity and maternal BMI in a population-based cohort study.

Science.gov (United States)

Iversen, Ditte S; Kesmodel, Ulrik S; Ovesen, Per G

2018-02-07

We aimed to investigate the change in prevalence of overweight and obesity in pregnant Danish women from 2004 to 2012, and investigate whether increasing parity was associated with a change in body mass index (BMI) prevalence. We obtained a population-based cohort from the Danish Medical Birth Registry consisting of all Danish women giving birth in 2004-2012 (n = 572 321). This registry contains information on 99.8% of all births in Denmark. We calculated the overall change in prepregnancy BMI status among pregnant women in Denmark, and a multiple linear regression model with adjustment for several potential confounders was used to examine the change in prepregnancy BMI with increasing parity. In 2004, the prevalence of prepregnancy overweight and obesity (BMI ≥ 25) and obesity alone (BMI ≥ 30) was 31.9 and 11%, respectively. In 2012, the prevalence had reached 34.2 and 12.8%. The mean BMI increased for every additional parity from 23.80 (95% CI 23.77-23.82) in parity group 1 to 26.70 (26.52-26.90) in parity group 5+. A multiple linear regression adjusted for potential confounders showed that women on average gained 0.62 (0.58-0.65) BMI units after every additional birth. This study showed a 7.2% increase in overweight and obesity (BMI ≥ 25) and a 16.4% increase in obesity alone (BMI ≥ 30) for pregnant women in Denmark from 2004 to 2012. In addition, an increase in interpregnancy BMI was seen at every additional delivery, suggesting that obesity is an increasing challenge in obstetrics. © 2018 Nordic Federation of Societies of Obstetrics and Gynecology.

Adaptation to Elastic Loads and BMI Robot Controls During Rat Locomotion examined with Point-Process GLMs.

Directory of Open Access Journals (Sweden)

Weiguo eSong

2015-04-01

Full Text Available Currently little is known about how a mechanically coupled BMI system’s actions are integrated into ongoing body dynamics. We tested a locomotor task augmented with a BMI system driving a robot mechanically interacting with a rat under three conditions: control locomotion (BL, ‘simple elastic load’ (E and ‘BMI with elastic load’ (BMI/E. The effect of the BMI was to allow compensation of the elastic load as a function of the neural drive. Neurons recorded here were close to one another in cortex, all within a 200 micron diameter horizontal distance of one another. The interactions of these close assemblies of neurons may differ from those among neurons at longer distances in BMI tasks and thus are important to explore. A point process generalized linear model (GLM, was used to examine connectivity at two different binning timescales (1ms vs. 10ms. We used GLM models to fit non-Poisson neural dynamics solely using other neurons’ prior neural activity as covariates. Models at different timescales were compared based on Kolmogorov-Smirnov (KS goodness-of-fit and parsimony. About 15% of cells with non-Poisson firing were well fitted with the neuron-to-neuron models alone. More such cells were fitted at the 1ms binning than 10ms. Positive connection parameters (‘excitation’ ~70% exceeded negative parameters (‘inhibition’ ~30%. Significant connectivity changes in the GLM determined networks of well-fitted neurons occurred between the conditions. However, a common core of connections comprising at least ~15% of connections persisted between any two of the three conditions. Significantly almost twice as many connections were in common between the two load conditions (~27%, compared to between either load condition and the baseline. This local point process GLM identified neural correlation structure and the changes seen across task conditions in the rats in this neural subset may be intrinsic to cortex or due to feedback and input

HOMA, BMI, and Serum Leptin Levels Variations during Antiviral Treatment Suggest Virus-Related Insulin Resistance in Noncirrhotic, Nonobese, and Nondiabetic Chronic Hepatitis C Genotype 1 Patients.

Science.gov (United States)

Grasso, Alessandro; Malfatti, Federica; Andraghetti, Gabriella; Marenco, Simona; Mazzucchelli, Chiara; Labanca, Sara; Cordera, Renzo; Testa, Roberto; Picciotto, Antonino

2015-01-01

Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P = 0.033 and 0.048, resp.) in patients who achieved an early viral load decay (EVR), a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.

HOMA, BMI, and Serum Leptin Levels Variations during Antiviral Treatment Suggest Virus-Related Insulin Resistance in Noncirrhotic, Nonobese, and Nondiabetic Chronic Hepatitis C Genotype 1 Patients

Directory of Open Access Journals (Sweden)

Alessandro Grasso

2015-01-01

Full Text Available Objective. To investigate the relationship between insulin resistance and viral load decay in nondiabetic and noncirrhotic genotype 1 chronic HCV patients during peginterferon and ribavirin treatment and the possible influence of BMI and leptin as metabolic confounders. Methods. 75 consecutive noncirrhotic, nonobese, and nondiabetic patients with genotype 1 chronic hepatitis C treated with peginterferon alpha 2a plus ribavirin were evaluated. HOMA-IR, serum leptin, and BMI were measured in all patients at baseline and at weeks 12 and 48, whereas viral load was measured at the same time points and then 24 weeks after the end of treatment. Results. HOMA-IR was significantly associated with both BMI and leptin at baseline. During peginterferon plus ribavirin treatment, there was a significant reduction of HOMA-IR at weeks 12 and 48 from baseline (P=0.033 and 0.048, resp. in patients who achieved an early viral load decay (EVR, a trend not observed in patients who not achieved EVR. No variations during treatment were observed regarding BMI and leptin irrespective of EVR. Conclusion. The early reduction of HOMA-IR but not of BMI and leptin during antiviral treatment in noncirrhotic, chronic hepatitis C genotype 1 patients who achieved EVR suggests a viral genesis of insulin resistance in patients with nonmetabolic phenotype.

Increased Coagulation and Decreased Fibrinolysis as Measured with Overall Hemostatic Potential Are Dependent on BMI and Not Associated with PCOS.

Science.gov (United States)

Rakusa, Matej; Jensterle, Mojca; Božič-Mijovski, Mojca; Janez, Andrej

2017-05-01

Overall hemostatic potential (OHP) captures all factors that affect coagulation and fibrinolysis cascade. It has not yet been assessed in polycystic ovary syndrome (PCOS). The aim of the study was to identify the relationship of OHP with a syndrome per se and body mass index (BMI). In 90 women with PCOS aged 30.9 ± 8.1 years (50 obese, 13 overweight, and 27 lean) and 21 healthy age-matched controls (11 obese and 10 lean), OHP with overall coagulation potential (OCP) and overall fibrinolytic potential (OFP) was determined spectrophotometrically. OFP was calculated. OHP increased with BMI in PCOS (9.6 ± 2.3 in lean, 12.5 ± 5.1 in overweight, and 15.5 ± 3.8 Abs-sum in obese) and in controls (9.1 ± 1.0 in lean and 17.3 ± 4.6 Abs-sum in obese). There was significant difference between lean and obese PCOS (P PCOS (P PCOS (P PCOS did not differ significantly, while OHP for healthy obese was increased in comparison to overweight and lean PCOS (P PCOS was not associated with increased OHP compared with BMI and age-matched controls. However, increase in OHP was positively associated with BMI in PCOS and healthy women.

Eating frequency in relation to BMI in very young children: a longitudinal analysis.

Science.gov (United States)

Taylor, Rachael W; Iosua, Ella; Heath, Anne-Louise M; Gray, Andrew R; Taylor, Barry J; Lawrence, Julie A; Hanna, Maha; Cameron, Sonya L; Sayers, Rachel; Galland, Barbara

2017-06-01

Eating less frequently is associated with increased obesity risk in older children but data are potentially confounded by reverse causation, where bigger children eat less often in an effort to control their weight. Longitudinal data, particularly in younger children, are scarce. We aimed to determine whether eating frequency (meals and snacks) at 2 years of age is associated with past, current or subsequent BMI. Cohort analysis of a randomised controlled trial. Eating frequency at 2 years of age was estimated using 48 h diaries that recorded when each child ate meals and snacks (parent-defined) in five-minute blocks. Body length/height and weight were measured at 1, 2 and 3·5 years of age. Linear regression assessed associations between the number of eating occasions and BMI Z-score, before and after adjustment for potential confounding variables. Prevention of Overweight in Infancy (POI) study, Dunedin, New Zealand. Children (n 371) aged 1-3·5 years. On average, children ate 5·5 (sd 1·2) times/d at 2 years of age, with most children (88-89 %) eating 4-7 times/d. Eating frequency at 2 years was not associated with current (difference in BMI Z-score per additional eating occasion; 95 % CI: -0·02; -0·10, 0·05) or subsequent change (0·02; -0·03, 0·06) in BMI. Similarly, BMI at age 1 year did not predict eating frequency at 2 years of age (difference in eating frequency per additional BMI Z-score unit; 95 % CI: -0·03; -0·19, 0·13). Number of eating occasions per day was not associated with BMI in young children in the present study.

The S100A4 Oncoprotein Promotes Prostate Tumorigenesis in a Transgenic Mouse Model

DEFF Research Database (Denmark)

Siddique, Hifzur R; Adhami, Vaqar M; Parray, Aijaz

2013-01-01

earlier showed that S100A4 expression progressively increases in prostatic tissues with the advancement of prostate cancer (CaP) in TRAMP, an autochthonous mouse model. To study the functional significance of S100A4 in CaP, we generated a heterozygously deleted S100A4 (TRAMP/S100A4(+/-)) genotype...... (intracellular and extracellular) forms. We observed that 1) the growth-promoting effect of S100A4 is due to its activation of NFκB, 2) S100A4-deficient tumors exhibit reduced NFκB activity, 3) S100A4 regulates NFκB through the RAGE receptor, and 4) S100A4 and RAGE co-localize in prostatic tissues of mice......S100A4, a calcium-binding protein, is known for its role in the metastatic spread of tumor cells, a late event of cancer disease. This is the first report showing that S100A4 is not merely a metastatic protein but also an oncoprotein that plays a critical role in the development of tumors. We...

Predictors of increasing BMI during the course of diabetes in children and adolescents with type 1 diabetes: data from the German/Austrian DPV multicentre survey.

Science.gov (United States)

Fröhlich-Reiterer, Elke E; Rosenbauer, Joachim; Bechtold-Dalla Pozza, Susanne; Hofer, Sabine E; Schober, Edith; Holl, Reinhard W

2014-08-01

Increased weight gain has been reported prior to disease onset (accelerator hypothesis) and as a side effect of intensified insulin therapy in type 1 diabetes (T1D). Paediatric studies are complicated by the age-dependency and gender-dependency of BMI, and also by a trend towards obesity in the general population. The aim of this study was to evaluate factors related to the increase in BMI during the course of diabetes in children and adolescents with T1D in a large multicentre survey. Within the DPV database (Diabetespatienten Verlaufsdokumentation) a standardised, prospective, computer-based documentation programme, data of 53,108 patients with T1D, aged 12,774 patients (53% male, mean age 13.4±3.9, mean diabetes duration 4.7±3.0 years and mean age at diabetes onset 8.7±4.0 years) were included in this analysis. Population-based German reference data were used to calculate BMI-SDS and define overweight and obesity. 12.5% of T1D patients were overweight and 2.8% were obese. Multiple longitudinal regression analysis revealed that female gender, low BMI at diabetes onset, intensified insulin therapy and higher insulin dose, as well as pubertal diabetes onset, long diabetes duration and onset in earlier calendar years among girls, were related to higher BMI-SDS increase during the course of diabetes (p1; all). Intensified insulin regimen is associated with weight gain during T1D treatment, in addition to demographic variables. Optimisation of diabetes management, especially in females, might limit weight gain in order to reduce overweight and obesity together with comorbidities among paediatric T1D patients. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

High BMI levels associate with reduced mRNA expression of IL10 and increased mRNA expression of iNOS (NOS2) in human frontal cortex

DEFF Research Database (Denmark)

Lauridsen, J K; Olesen, R H; Vendelbo, J

2017-01-01

unknown. Therefore we aim to examine the relationship between BMI and gene expression of central inflammatory markers in the human frontal cortex. Microarray data of 141 neurologically and psychiatrically healthy individuals were obtained through the BrainCloud database. A simple linear regression...... correlated (Plinear regression analyses with BMI, age, sex and race as variables were performed in order to identify potential confounders. In conclusion, increasing BMI could affect the IL10-mediated anti...... analysis was performed with BMI as variable on data on IL10, IL1β, IL6, PTGS2 (COX2) and NOS2 (iNOS). Increasing BMI is associated with a decrease in the mRNA expression of IL10 (P=0.014) and an increase in the expression of NOS2 (iNOS; P=0.040). Expressions of IL10 and NOS2 (iNOS) were negatively...

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

Science.gov (United States)

Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria; Mollerup, Pernille Maria; Lausten-Thomsen, Ulrik; Pedersen, Oluf; Hansen, Torben; Holm, Jens-Christian

2018-01-01

The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment. 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6-21.7), and median BMI SDS 2.8 (range 1.3-5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4). Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC), low-density lipoprotein (LDL), high-density lipoprotein (HDL), non-HDL, and triglycerides (TG)) were available in 469 individuals (264 girls). Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations. At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4) and positively with TG (p = 9.7*10-6). Reductions in BMI SDS were associated with reductions in total body fat percentage (pobesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition and lipid concentrations may improve.

Adult BMI and Access to Built Environment Resources in a High-Poverty, Urban Geography.

Science.gov (United States)

Tung, Elizabeth L; Peek, Monica E; Makelarski, Jennifer A; Escamilla, Veronica; Lindau, Stacy T

2016-11-01

The purpose of this study is to examine the relationship between BMI and access to built environment resources in a high-poverty, urban geography. Participants (aged ≥35 years) were surveyed between November 2012 and July 2013 to examine access to common health-enabling resources (grocers, outpatient providers, pharmacies, places of worship, and physical activity resources). Survey data were linked to a contemporaneous census of built resources. Associations between BMI and access to resources (potential and realized) were examined using independent t-tests and multiple linear regression. Data analysis was conducted in 2014-2015. Median age was 53.8 years (N=267, 62% cooperation rate). Obesity (BMI ≥30) prevalence was 54.9%. BMI was not associated with potential access to resources located nearest to home. Nearly all participants (98.1%) bypassed at least one nearby resource type; half bypassed nearby grocers (realized access >1 mile from home). Bypassing grocers was associated with a higher BMI (p=0.03). Each additional mile traveled from home to a grocer was associated with a 0.9-higher BMI (95% CI=0.4, 1.3). Quality and affordability were common reasons for bypassing resources. Despite potential access to grocers in a high-poverty, urban region, half of participants bypassed nearby grocers to access food. Bypassing grocers was associated with a higher BMI. Copyright © 2016 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

Effects of pioglitazone therapy on blood parameters, weight and BMI: a meta-analysis

Directory of Open Access Journals (Sweden)

Elena Filipova

2017-11-01

Full Text Available Abstract Background Type 2 diabetes mellitus (T2DM is one of the most common diseases worldwide and insulin insufficiency and insulin resistance are two main metabolic issues connected with it. The dyslipidemia associated with insulin resistance and T2DM is characterized by higher triglycerides (TGs, higher very-low-density lipoprotein cholesterol and lower apo A1. Pioglitazone, a member of the thiazolidinedione class, with a proven antihyperglycemic effect, is known to positively influence insulin sensitivity and β-cell function and to have the potential to alter the lipid profile. Methods The aim of our meta-analysis is to summarize and determine the influence of pioglitazone on the glycemic profile and lipoprotein metabolism as well as on weight and BMI in order to highlight the benefit of pioglitazone therapy in patients with T2DM. A comprehensive literature search was conducted through the electronic databases PubMed, MEDLINE, Scopus, PsyInfo, eLIBRARY.ru (from 2000 until February 2016 to identify studies that investigate the effect of pioglitazone on the glycemic and lipid profile and on the weight and BMI. We chose the random-effects method as the primary analysis. Forest plots depict estimated results from the studies included in the analysis and funnel plots are used to evaluate publication bias. Sensitivity analyses were performed in order to evaluate the degree of influence of the consequent elimination of each individual study on the final result. Results Of the 1536 identified sources only 15 randomised trials were included in the meta-analysis. Pioglitazone treatment was associated with improvement in the glycemic profile. It reduced FPG levels by a mean of 1.1–2 mmol/l and HbA1c by a mean of 0.9–1.3%. Our results reaffirmed the hypothesis that pioglitazone has a positive influence on the lipid profile of T2DM patients with increase in TC and HDL, no significant changes in LDL and notable decrease in TGs. Results also showed

Animal-specific C-terminal domain links myeloblastosis oncoprotein (Myb) to an ancient repressor complex

Science.gov (United States)

Andrejka, Laura; Wen, Hong; Ashton, Jonathan; Grant, Megan; Iori, Kevin; Wang, Amy; Manak, J. Robert; Lipsick, Joseph S.

2011-01-01

Members of the Myb oncoprotein and E2F-Rb tumor suppressor protein families are present within the same highly conserved multiprotein transcriptional repressor complex, named either as Myb and synthetic multivuval class B (Myb-MuvB) or as Drosophila Rb E2F and Myb-interacting proteins (dREAM). We now report that the animal-specific C terminus of Drosophila Myb but not the more highly conserved N-terminal DNA-binding domain is necessary and sufficient for (i) adult viability, (ii) proper localization to chromosomes in vivo, (iii) regulation of gene expression in vivo, and (iv) interaction with the highly conserved core of the MuvB/dREAM transcriptional repressor complex. In addition, we have identified a conserved peptide motif that is required for this interaction. Our results imply that an ancient function of Myb in regulating G2/M genes in both plants and animals appears to have been transferred from the DNA-binding domain to the animal-specific C-terminal domain. Increased expression of B-MYB/MYBL2, the human ortholog of Drosophila Myb, correlates with poor prognosis in human patients with breast cancer. Therefore, our results imply that the specific interaction of the C terminus of Myb with the MuvB/dREAM core complex may provide an attractive target for the development of cancer therapeutics. PMID:21969598

Eating behaviour patterns and BMI in Portuguese higher education students.

Science.gov (United States)

Poínhos, Rui; Oliveira, Bruno M P M; Correia, Flora

2013-12-01

Our aim was to determine prototypical patterns of eating behaviour among Portuguese higher education students, and to relate these patterns with BMI. Data from 280 higher education students (63.2% females) aged between 18 and 27 years were analysed. Several eating behaviour dimensions (emotional and external eating, flexible and rigid restraint, binge eating, and eating self-efficacy) were assessed, and eating styles were derived through cluster analysis. BMI for current, desired and maximum self-reported weights and the differences between desired and current BMI and between maximum and current BMI were calculated. Women scored higher in emotional eating and restraint, whereas men showed higher eating self-efficacy. Men had higher current, desired and maximum BMI. Cluster analysis showed three eating styles in both male and female subsamples: "Overeating", "High self-efficacy" and "High restraint". High self-efficacy women showed lower BMI values than the others, and restrictive women had higher lost BMI. High self-efficacy men showed lower desired BMI than overeaters, and lower maximum and lost BMI than highly restrictive ones. Restrictive women and men differ on important eating behaviour features, which may be the cause of differences in the associations with BMI. Eating self-efficacy seems to be a central variable influencing the relationships between other eating behaviour dimensions and BMI. Copyright © 2013 Elsevier Ltd. All rights reserved.

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations

DEFF Research Database (Denmark)

Nielsen, Tenna Ruest Haarmark; Fonvig, Cilius Esmann; Dahl, Maria

2018-01-01

Objective The body mass index (BMI) standard deviation score (SDS) may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during......, and 80% improved their lipid concentrations. Conclusion Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma lipid concentrations. Even in individuals increasing their BMI SDS, body composition...... childhood obesity treatment. Methods 876 children and adolescents (498 girls) with overweight/obesity, median age 11.2 years (range 1.6±21.7), and median BMI SDS 2.8 (range 1.3±5.7) were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0...

Higher BMI Is Associated with Reduced Cognitive Performance in Division I Athletes

Directory of Open Access Journals (Sweden)

Andrew Fedor

2013-04-01

Full Text Available Objective: Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT in Division I collegiate athletes. Methods: Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Results: Regression analyses revealed that BMI incrementally predicted performance on visual memory (R2 change = 0.015, p = 0.026 beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17, visual memory (r = -0.16, and visual motor speed (r = -0.12. Conclusions: These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations.

Higher BMI is associated with reduced cognitive performance in division I athletes.

Science.gov (United States)

Fedor, Andrew; Gunstad, John

2013-01-01

Poor cardiovascular fitness has been implicated as a possible mechanism for obesity-related cognitive decline, though no study has examined whether BMI is associated with poorer cognitive function in persons with excellent fitness levels. The current study examined the relationship between BMI and cognitive function by the Immediate Post Concussion and Cognitive Test (ImPACT) in Division I collegiate athletes. Participants had an average age of 20.14 ± 1.78 years, were 31.3% female, and 53.9% football players. BMI ranged from 19.04 to 41.14 and averaged 26.72 ± 4.62. Regression analyses revealed that BMI incrementally predicted performance on visual memory (R(2) change = 0.015, p = 0.026) beyond control variables. Follow-up partial correlation analyses revealed small but significant negative correlations between BMI and verbal memory (r = -0.17), visual memory (r = -0.16), and visual motor speed (r = -0.12). These results suggest that higher BMI is associated with reduced cognitive function, even in a sample expected to have excellent levels of cardiovascular fitness. Further work is needed to better understand mechanisms for these associations. Copyright © 2013 S. Karger GmbH, Freiburg.

Mechanism by which BMI influences leisure-time physical activity behavior.

Science.gov (United States)

Godin, Gaston; Bélanger-Gravel, Ariane; Nolin, Bertrand

2008-06-01

The objective of this prospective study was to clarify the mechanism by which BMI influences leisure-time physical activity. This was achieved in accordance with the assumptions underlying the Theory of Planned Behavior (TPB), considered as one of the most useful theories to predict behavior adoption. At baseline, a sample of 1,530 respondents completed a short questionnaire to measure intention and perceived behavioral control (PBC), the two proximal determinants of behavior of TPB. Past behavior, sociodemographic variables, and weight and height were also assessed. The dependent variable, leisure-time physical activity was assessed 3 months later. Hierarchical multiple regression analyses revealed that BMI is a direct predictor of future leisure-time physical activity, not mediated by the variables of TPB. Additional hierarchical analyses indicated that BMI was not a moderator of the intention-behavior and PBC-behavior relationships. The results of this study suggest that high BMI is a significant negative determinant of leisure-time physical activity. This observation reinforces the importance of preventing weight gain as a health promotion strategy for avoiding a sedentary lifestyle.

Modeling the dynamics of BMI changes during adolescence. The Oporto Growth, Health and Performance Study.

Science.gov (United States)

de Souza, M C; Eisenmann, J C; e Santos, D V; de Chaves, R N; de Moraes Forjaz, C L; Maia, J A R

2015-07-01

The aims of this study were twofold: (i) to model changes in body mass index (BMI) of 10-18-year-old adolescents, and (ii) to investigate the effects of total physical activity (TPA), physical fitness (PF), sleep duration and fruit/vegetable consumption in BMI trajectories across time. Data were obtained from the Oporto Growth, Health and Performance Study and comprised 6894 adolescents (3418 girls) divided into four age cohorts (10, 12, 14 and 16 years) measured annually for 3 years. BMI was computed using the standard formula (kg m(-2)); TPA was estimated with the Baecke questionnaire; PF measures included 1-mile run/walk, 50 yard dash (50YD), standing long jump (SLJ), handgrip strength (HGr) and agility shuttle run. Longitudinal changes in BMI were analyzed using the multilevel modeling approach. The average BMI at age of peak of height velocity was 20.7±0.07 kg m(-2) for girls (P<0.001) and 20.58±0.06 kg m(-2) for boys (P<0.001). The annual increment in BMI was 1.36±0.04 kg m(-2), P<0.001 and 1.23±0.03 kg m(-2), P<0.001 for girls and boys, respectively. PF were related to BMI trajectories in both sexes (Girls: β1mile=0.12±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.28±0.05, P<0.001; βHGr=-8.91±0.54, P<0.001; Boys: β1mile=0.18±0.02, P<0.001; βSLJ=-0.01±0.00, P<0.001; β50YD=0.26±0.04, P<0.001; and βHGr=-8.15±0.45, P<0.001). TPA only showed significant, but positive, association with girls' BMI trajectories (β=0.10±0.03, P=0.001). After adjusting for the covariates, sleep duration and fruit/vegetable intake did not show any significant association with BMI trajectories either sex. BMI increased linearly with age in both gender. PF levels are negatively associated with BMI across time in both boys and girls. Therefore, promotion of PF in the adolescent years seems to be effective in the early prevention of obesity.

Prospective associations between sedentary lifestyle and BMI in midlife

DEFF Research Database (Denmark)

Mortensen, Laust Hvas; Siegler, Ilene C; Barefoot, John C

2006-01-01

A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle.......A strong positive cross-sectional relationship between BMI and a sedentary lifestyle has been consistently observed in numerous studies. However, it has been questioned whether high BMI is a determinant or a consequence of a sedentary lifestyle....

Association between mammographic density and pregnancies relative to age and BMI: a breast cancer case-only analysis.

Science.gov (United States)

Hack, Carolin C; Emons, Julius; Jud, Sebastian M; Heusinger, Katharina; Adler, Werner; Gass, Paul; Haeberle, Lothar; Heindl, Felix; Hein, Alexander; Schulz-Wendtland, Rüdiger; Uder, Michael; Hartmann, Arndt; Beckmann, Matthias W; Fasching, Peter A; Pöhls, Uwe G

2017-12-01

Percentage mammographic density (PMD) is a major risk factor for breast cancer (BC). It is strongly associated with body mass index (BMI) and age, which are themselves risk factors for breast cancer. This analysis investigated the association between the number of full-term pregnancies and PMD in different subgroups relative to age and BMI. Patients were identified in the breast cancer database of the University Breast Center for Franconia. A total of 2410 patients were identified, for whom information on parity, age, and BMI, and a mammogram from the time of first diagnosis were available for assessing PMD. Linear regression analyses were conducted to investigate the influence on PMD of the number of full-term pregnancies (FTPs), age, BMI, and interaction terms between them. As in previous studies, age, number of FTPs, and BMI were found to be associated with PMD in the expected direction. However, including the respective interaction terms improved the prediction of PMD even further. Specifically, the association between PMD and the number of FTPs differed in young patients under the age of 45 (mean decrease of 0.37 PMD units per pregnancy) from the association in older age groups (mean decrease between 2.29 and 2.39 PMD units). BMI did not alter the association between PMD and the number of FTPs. The effect of pregnancies on mammographic density does not appear to become apparent before the age of menopause. The mechanism that drives the effect of pregnancies on mammographic density appears to be counter-regulated by other influences on mammographic density in younger patients.

Childhood obesity treatment; Effects on BMI SDS, body composition, and fasting plasma lipid concentrations.

Directory of Open Access Journals (Sweden)

Tenna Ruest Haarmark Nielsen

Full Text Available The body mass index (BMI standard deviation score (SDS may not adequately reflect changes in fat mass during childhood obesity treatment. This study aimed to investigate associations between BMI SDS, body composition, and fasting plasma lipid concentrations at baseline and during childhood obesity treatment.876 children and adolescents (498 girls with overweight/obesity, median age 11.2 years (range 1.6-21.7, and median BMI SDS 2.8 (range 1.3-5.7 were enrolled in a multidisciplinary outpatient treatment program and followed for a median of 1.8 years (range 0.4-7.4. Height and weight, body composition measured by dual-energy X-ray absorptiometry, and fasting plasma lipid concentrations were assessed at baseline and at follow-up. Lipid concentrations (total cholesterol (TC, low-density lipoprotein (LDL, high-density lipoprotein (HDL, non-HDL, and triglycerides (TG were available in 469 individuals (264 girls. Linear regressions were performed to investigate the associations between BMI SDS, body composition indices, and lipid concentrations.At baseline, BMI SDS was negatively associated with concentrations of HDL (p = 6.7*10-4 and positively with TG (p = 9.7*10-6. Reductions in BMI SDS were associated with reductions in total body fat percentage (p<2*10-16 and percent truncal body fat (p<2*10-16. Furthermore, reductions in BMI SDS were associated with improvements in concentrations of TC, LDL, HDL, non-HDL, LDL/HDL-ratio, and TG (all p <0.0001. Changes in body fat percentage seemed to mediate the changes in plasma concentrations of TC, LDL, and non-HDL, but could not alone explain the changes in HDL, LDL/HDL-ratio or TG. Among 81 individuals with available lipid concentrations, who increased their BMI SDS, 61% improved their body composition, and 80% improved their lipid concentrations.Reductions in the degree of obesity during multidisciplinary childhood obesity treatment are accompanied by improvements in body composition and fasting plasma

Maternal BMI and diabetes in pregnancy: Investigating variations between ethnic groups using routine maternity data from London, UK.

Science.gov (United States)

Nishikawa, Erin; Oakley, Laura; Seed, Paul T; Doyle, Pat; Oteng-Ntim, Eugene

2017-01-01

To investigate the ethnicity-specific association between body mass index (BMI) and diabetes in pregnancy, with a focus on the appropriateness of using BMI cut-offs to identify pregnant women at risk of diabetes. Analysis of routinely-collected data from a maternity unit in London, UK. Data were available on 53 264 women delivering between 2004 and 2012. Logistic regression was used to explore the association between diabetes in pregnancy and BMI among women of different ethnicities, and adjusted probability estimates were used to derive risk equivalent cut-offs. ROC curve analysis was used to assess the performance of BMI as a predictor of diabetes in pregnancy. The prevalence of diabetes in pregnancy was 2.3% overall; highest in South and East Asian women (4.6% and 3.7%). In adjusted analysis, BMI category was strongly associated with diabetes in all ethnic groups. Modelled as a continuous variable with a quadratic term, BMI was an acceptable predictor of diabetes according to ROC curve analysis. Applying a BMI cut-off of 30 kg/m2 would identify just over half of Black women with diabetes in pregnancy, a third of White (32%) and South Asian (35%) women, but only 13% of East Asian women. The 'risk equivalent' (comparable to 30 kg/m2 in White women) threshold for South Asian and East Asian women was approximately 21 kg/m2, and 27.5 kg/m2 for Black women. This study suggests that current BMI thresholds are likely to be ineffective for diabetes screening in South and East Asian women, as many cases of diabetes will occur at low BMI levels. Our results suggest that East Asian women appear to face a similarly high risk of diabetes to South Asian women. Current UK guidelines recommend diabetes screening should be offered to all pregnant South Asian women; extending this recommendation to include women of East Asian ethnicity may be appropriate.

Genetic Influences on Growth Traits of BMI

DEFF Research Database (Denmark)

Hjelmborg, Jacob V B; Fagnani, Corrado; Silventoinen, Karri

2008-01-01

Objective:To investigate the interplay between genetic factors influencing baseline level and changes in BMI in adulthood.Methods and Procedures:A longitudinal twin study of the cohort of Finnish twins (N = 10,556 twin individuals) aged 20-46 years at baseline was conducted and followed up 15 years....... Data on weight and height were obtained from mailed surveys in 1975, 1981, and 1990.Results:Latent growth models revealed a substantial genetic influence on BMI level at baseline in males and females (heritability (h(2)) 80% (95% confidence interval 0.79-0.80) for males and h(2) = 82% (0.81, 0.......84) for females) and a moderate-to-high influence on rate of change in BMI (h(2) = 58% (0.50, 0.69) for males and h(2) = 64% (0.58, 0.69) for females). Only very weak evidence for genetic pleiotropy was observed; the genetic correlation between baseline and rate of change in BMI was very modest (-0.070 (-0.13, -0...

Representativeness and optimal use of body mass index (BMI) in the UK Clinical Practice Research Datalink (CPRD)

Science.gov (United States)

Bhaskaran, Krishnan; Forbes, Harriet J; Douglas, Ian; Leon, David A; Smeeth, Liam

2013-01-01

Objectives To assess the completeness and representativeness of body mass index (BMI) data in the Clinical Practice Research Datalink (CPRD), and determine an optimal strategy for their use. Design Descriptive study. Setting Electronic healthcare records from primary care. Participants A million patient random sample from the UK CPRD primary care database, aged ≥16 years. Primary and secondary outcome measures BMI completeness in CPRD was evaluated by age, sex and calendar period. CPRD-based summary BMI statistics for each calendar year (2003–2010) were age-standardised and sex-standardised and compared with equivalent statistics from the Health Survey for England (HSE). Results BMI completeness increased over calendar time from 37% in 1990–1994 to 77% in 2005–2011, was higher among females and increased with age. When BMI at specific time points was assigned based on the most recent record, calendar–year-specific mean BMI statistics underestimated equivalent HSE statistics by 0.75–1.1 kg/m2. Restriction to those with a recent (≤3 years) BMI resulted in mean BMI estimates closer to HSE (≤0.28 kg/m2 underestimation), but excluded up to 47% of patients. An alternative strategy of imputing up-to-date BMI based on modelled changes in BMI over time since the last available record also led to mean BMI estimates that were close to HSE (≤0.37 kg/m2 underestimation). Conclusions Completeness of BMI in CPRD increased over time and varied by age and sex. At a given point in time, a large proportion of the most recent BMIs are unlikely to reflect current BMI; consequent BMI misclassification might be reduced by employing model-based imputation of current BMI. PMID:24038008

Viewing as little as 1 hour of TV daily is associated with higher change in BMI between kindergarten and first grade.

Science.gov (United States)

Peck, Travis; Scharf, Rebecca J; Conaway, Mark R; DeBoer, Mark D

2015-08-01

Evaluate associations between TV viewing and weight status in children from kindergarten to first grade. Linear and logistic regression was used to evaluate associations of TV-viewing time on BMI-z-score cross-sectionally at kindergarten and first grade and longitudinally in between, among a nationally representative sample of 14,645 children from the Early Childhood Longitudinal Study-Kindergarten Cohort 2011. All analyses were adjusted for sex, race/ethnicity, parental education, and household income. Weekday TV-viewing time was correlated with BMI-z-score (P TV daily, children watching ≥1 h in kindergarten and first grade had a greater odds of overweight (1.50-1.60) and obesity (1.58-1.73). Children watching 1-TV had a greater odds of becoming overweight (1.39) and obese (1.86) between evaluations. Children watching as little as 1-TV daily were more likely to become overweight and obese over time. Physicians should encourage families to restrict TV-viewing time to reduce weight gain. © 2015 The Obesity Society.

Discovery of multiple interacting partners of gankyrin, a proteasomal chaperone and an oncoprotein--evidence for a common hot spot site at the interface and its functional relevance.

Science.gov (United States)

Nanaware, Padma P; Ramteke, Manoj P; Somavarapu, Arun K; Venkatraman, Prasanna

2014-07-01

Gankyrin, a non-ATPase component of the proteasome and a chaperone of proteasome assembly, is also an oncoprotein. Gankyrin regulates a variety of oncogenic signaling pathways in cancer cells and accelerates degradation of tumor suppressor proteins p53 and Rb. Therefore gankyrin may be a unique hub integrating signaling networks with the degradation pathway. To identify new interactions that may be crucial in consolidating its role as an oncogenic hub, crystal structure of gankyrin-proteasome ATPase complex was used to predict novel interacting partners. EEVD, a four amino acid linear sequence seems a hot spot site at this interface. By searching for EEVD in exposed regions of human proteins in PDB database, we predicted 34 novel interactions. Eight proteins were tested and seven of them were found to interact with gankyrin. Affinity of four interactions is high enough for endogenous detection. Others require gankyrin overexpression in HEK 293 cells or occur endogenously in breast cancer cell line- MDA-MB-435, reflecting lower affinity or presence of a deregulated network. Mutagenesis and peptide inhibition confirm that EEVD is the common hot spot site at these interfaces and therefore a potential polypharmacological drug target. In MDA-MB-231 cells in which the endogenous CLIC1 is silenced, trans-expression of Wt protein (CLIC1_EEVD) and not the hot spot site mutant (CLIC1_AAVA) resulted in significant rescue of the migratory potential. Our approach can be extended to identify novel functionally relevant protein-protein interactions, in expansion of oncogenic networks and in identifying potential therapeutic targets. © 2013 Wiley Periodicals, Inc.

Maternal BMI at the start of pregnancy and offspring epigenome-wide DNA methylation: findings from the pregnancy and childhood epigenetics (PACE) consortium.

Science.gov (United States)

Sharp, Gemma C; Salas, Lucas A; Monnereau, Claire; Allard, Catherine; Yousefi, Paul; Everson, Todd M; Bohlin, Jon; Xu, Zongli; Huang, Rae-Chi; Reese, Sarah E; Xu, Cheng-Jian; Baïz, Nour; Hoyo, Cathrine; Agha, Golareh; Roy, Ritu; Holloway, John W; Ghantous, Akram; Merid, Simon K; Bakulski, Kelly M; Küpers, Leanne K; Zhang, Hongmei; Richmond, Rebecca C; Page, Christian M; Duijts, Liesbeth; Lie, Rolv T; Melton, Phillip E; Vonk, Judith M; Nohr, Ellen A; Williams-DeVane, ClarLynda; Huen, Karen; Rifas-Shiman, Sheryl L; Ruiz-Arenas, Carlos; Gonseth, Semira; Rezwan, Faisal I; Herceg, Zdenko; Ekström, Sandra; Croen, Lisa; Falahi, Fahimeh; Perron, Patrice; Karagas, Margaret R; Quraishi, Bilal M; Suderman, Matthew; Magnus, Maria C; Jaddoe, Vincent W V; Taylor, Jack A; Anderson, Denise; Zhao, Shanshan; Smit, Henriette A; Josey, Michele J; Bradman, Asa; Baccarelli, Andrea A; Bustamante, Mariona; Håberg, Siri E; Pershagen, Göran; Hertz-Picciotto, Irva; Newschaffer, Craig; Corpeleijn, Eva; Bouchard, Luigi; Lawlor, Debbie A; Maguire, Rachel L; Barcellos, Lisa F; Davey Smith, George; Eskenazi, Brenda; Karmaus, Wilfried; Marsit, Carmen J; Hivert, Marie-France; Snieder, Harold; Fallin, M Daniele; Melén, Erik; Munthe-Kaas, Monica C; Arshad, Hasan; Wiemels, Joseph L; Annesi-Maesano, Isabella; Vrijheid, Martine; Oken, Emily; Holland, Nina; Murphy, Susan K; Sørensen, Thorkild I A; Koppelman, Gerard H; Newnham, John P; Wilcox, Allen J; Nystad, Wenche; London, Stephanie J; Felix, Janine F; Relton, Caroline L

2017-10-15

Pre-pregnancy maternal obesity is associated with adverse offspring outcomes at birth and later in life. Individual studies have shown that epigenetic modifications such as DNA methylation could contribute. Within the Pregnancy and Childhood Epigenetics (PACE) Consortium, we meta-analysed the association between pre-pregnancy maternal BMI and methylation at over 450,000 sites in newborn blood DNA, across 19 cohorts (9,340 mother-newborn pairs). We attempted to infer causality by comparing the effects of maternal versus paternal BMI and incorporating genetic variation. In four additional cohorts (1,817 mother-child pairs), we meta-analysed the association between maternal BMI at the start of pregnancy and blood methylation in adolescents. In newborns, maternal BMI was associated with small (effect of maternal BMI on newborn methylation at just 8/86 sites. In conclusion, this well-powered analysis identified robust associations between maternal adiposity and variations in newborn blood DNA methylation, but these small effects may be better explained by genetic or lifestyle factors than a causal intrauterine mechanism. This highlights the need for large-scale collaborative approaches and the application of causal inference techniques in epigenetic epidemiology. © The Author 2017. Published by Oxford University Press.

Cost of fertility treatment and live birth outcome in women of different ages and BMI.

Science.gov (United States)

Pandey, Shilpi; McLernon, David J; Scotland, Graham; Mollison, Jill; Wordsworth, Sarah; Bhattacharya, Siladitya

2014-10-10

What is the impact of different age and BMI groups on total investigation and treatment costs in women attending a secondary/tertiary care fertility clinic? Women in their early to mid-30s and women with normal BMI had higher cumulative investigation and treatment costs, but also higher probability of live birth. Female age and BMI have been used as criteria for rationing publically funded fertility treatments. Population-based data on the costs of investigating and treating infertility are lacking. A retrospective cohort study of 2463 women was conducted in a single secondary/tertiary care fertility clinic in Aberdeen, Scotland from 1998 to 2008. Participants included all women living in a defined geographical area referred from primary care to a specialized fertility clinic over an 11-year period. Women were followed up for 5 years or until live birth if this occurred sooner. Mean discounted cumulative National Health Service costs (expressed in 2010/2011 GBP) of fertility investigations, treatments (including all types of assisted reproduction), and pregnancy (including delivery episode) and neonatal admissions were calculated and summarized by age (≤ 30, 31-35, 36-40, >40 years) and BMI groupings (years, with 694 (55.1%) of these being natural conceptions. The live birth rate was highest among women in the youngest age group (64.3%), and lowest in those aged >40 years (13.4%). Overall live birth rates were generally lower in women with BMI >30 kg/m(2). The total costs of investigations were generally highest among women younger than 30 years (£491 in those with normal BMI), whilst treatment costs tended to be higher in 31-35 year olds (£1,840 in those with normal BMI). Multivariate modelling predicted a cost increase associated with treatment which was highest among women in the lowest BMI group (across all ages), and also highest among women aged 31-35 years. The increase in the predicted probability of live birth with exposure to treatment was consistent

Body mass index (BMI) in the Saudi population of Gassim.

Science.gov (United States)

Soyannwo, M A; Kurashi, N Y; Gadallah, M; Hams, J; el-Essawi, O; Khan, N A; Singh, R G; Alamri, A; Beyari, T H

1998-01-01

In a total cross-sectional population survey of the Faizia East Primary Health District of Buraidah, Gassim region of Saudi Arabia, 6,044 (2727 male and 3317 females) subjects out of a de facto population of 7695 got their BMI computed because infants and restless or bedridden subjects could not be examined. Mean (+/- SD) and percentiles (25th & 75th) were calculated in the conventional 5-year age cohorts as well as in functional age groups, namely, 0-5, 6-12, 13-49, 50-69 and 70+ years. 5th, 10th, 25th, 50th, 75th, 90th and 95th percentiles were computed only for the functional age groups. In general, the trend was for BMI to increase with age in both genders but the curve pattern showed some plateauing from about the age of 50 with slight decline in later life. Females had significantly higher indices than males, this becoming quite prominent from the 10-14 year age cohort. This difference persisted irrespective of the types of age grouping or residential location. Overall means (+/- SD) were 20.14 +/- 5.98 vs 22.22 +/- 7.21 for males and females respectively; df: 5771; p = 0.0000; 95% CI: -2.43, -1.735. Subjects in the urban living environment had significant higher indices than their rural counterpart: (21.666.92 vs 20.446.33: df: 5771; P = 0.0000; 95% CI: 1.595, -0.840). From the age of 15 about one quarter of females are overweight (BMI at the 75th percentile > 25) and from 30 years the same proportion are frankly obese (BMI > 30). Both systolic and diastolic blood pressure were significantly positively correlated with BMI in both genders: male SBP: r = 0.22, P r = 0.21, P r = 0.18, P < 0.00001.

Infant BMI peak as a predictor of overweight and obesity at age 2 years in a Chinese community-based cohort

Science.gov (United States)

Sun, Jie; Nwaru, Bright I; Hua, Jing; Li, Xiaohong; Wu, Zhuochun

2017-01-01

Objectives Infant body mass index (BMI) peak has proven to be a useful indicator for predicting childhood obesity risk in American and European populations. However, it has not been assessed in China. We characterised infant BMI trajectories in a Chinese longitudinal cohort and evaluated whether BMI peak can predict overweight and obesity at age 2 years. Methods Serial measurements (n=6–12) of weight and length were taken from healthy term infants (n=2073) in a birth cohort established in urban Shanghai. Measurements were used to estimate BMI growth curves from birth to 13.5 months using a polynomial regression model. BMI peak characteristics, including age (in months) and magnitude (BMI, in kg/m2) at peak and prepeak velocities (in kg/m2/month), were estimated. The relationship between infant BMI peak and childhood BMI at age 2 years was examined using binary logistic analysis. Results Mean age at peak BMI was 7.61 months, with a magnitude of 18.33 kg/m2. Boys (n=1022) had a higher average peak BMI (18.60 vs 18.07 kg/m2, pBMI and 1 month increase in peak time, the risk of overweight at age 2 years increased by 2.11 times (OR 3.11; 95% CI 2.64 to 3.66) and 35% (OR 1.35; 95% CI 1.21 to 1.50), respectively. Similarly, higher BMI magnitude (OR 2.69; 95% CI 2.00 to 3.61) and later timing of infant BMI peak (OR 1.35; 95% CI 1.08 to 1.68) were associated with an increased risk of childhood obesity at age 2 years. Conclusions We have shown that infant BMI peak is valuable for predicting early childhood overweight and obesity in urban Shanghai. Because this is the first Chinese community-based cohort study of this nature, future research is required to examine infant populations in other areas of China. PMID:28988164

Investigation of the effect of body mass index (BMI) on semen parameters and male reproductive system hormones.

Science.gov (United States)

Keskin, Mehmet Zeynel; Budak, Salih; Aksoy, Evrim Emre; Yücel, Cem; Karamazak, Serkan; Ilbey, Yusuf Ozlem; Kozacıoğlu, Zafer

2017-10-03

To evaluate the effects of body mass index (BMI) ratio on semen parameters and serum reproductive hormones. The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC), normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165), Group 2 (n = 222) and Group 3 (n = 56). There was no statistically significant difference in terms of all variables between the groups. We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.

Maternal BMI at the start of pregnancy and offspring epigenome-wide DNA methylation

DEFF Research Database (Denmark)

Sharp, Gemma C; Salas, Lucas A; Monnereau, Claire

2017-01-01

-analysed the association between pre-pregnancy maternal BMI and methylation at over 450,000 sites in newborn blood DNA, across 19 cohorts (9,340 mother-newborn pairs). We attempted to infer causality by comparing the effects of maternal versus paternal BMI and incorporating genetic variation. In four additional cohorts (1......,817 mother-child pairs), we meta-analysed the association between maternal BMI at the start of pregnancy and blood methylation in adolescents. In newborns, maternal BMI was associated with small (.... Adjustment for estimated cell proportions greatly attenuated the number of significant CpGs to 104, including 86 sites common to the unadjusted model. At 72/86 sites, the direction of the association was the same in newborns and adolescents, suggesting persistence of signals. However, we found evidence...

Gender expression associated with BMI in a prospective cohort study of US adolescents.

Science.gov (United States)

Bryn Austin, S; Ziyadeh, Najat J; Calzo, Jerel P; Sonneville, Kendrin R; Kennedy, Grace A; Roberts, Andrea L; Haines, Jess; Scherer, Emily A

2016-02-01

To examine the relationship between gender expression (GE) and BMI in adolescence. Repeated measures of weight-related behaviors and BMI were collected from 1996 to 2011 via annual/biennial self-report surveys from youth aged 10 to 23 years (6,693 females, 2,978 males) in the longitudinal Growing Up Today Study. GE (very conforming [referent], mostly conforming, nonconforming) was assessed in 2010/11. Sex-stratified, multivariable linear models estimated GE group differences in BMI and the contribution of sexual orientation and weight-related exposures to group differences. Models for males included interaction terms for GE with age. In females, mostly conforming youth had 0.53 kg m(-2) and nonconforming had 1.23 kg m(-2) higher BMI; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 8% and remained statistically significant. In males, mostly conforming youth had -0.67 kg m(-2) and nonconforming had -1.99 kg m(-2) lower BMI (age [in years]) interactions were between -0.09 and -0.14 kg m(-2) ; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 11% and remained statistically significant. GE is a strong independent predictor of BMI in adolescence. Obesity prevention and treatment interventions with youth must address ways that gender norms may reinforce or undermine healthful behaviors. © 2016 The Obesity Society.

Prevalence of human papilloma virus with risk of cervical cancer among south Indian women: A genotypic study with meta-analysis and molecular dynamics of HPV E6 oncoprotein.

Science.gov (United States)

Akram Husain, R S; Rajakeerthana, R; Sreevalsan, Anoop; Prema Jayaprasad, P; Ahmed, Shiek S S J; Ramakrishnan, V

2018-04-23

Cervical cancer (CC) is a major fatal health problem in women with high mortality worldwide. Human Papilloma Virus (HPV) is considered as one of the causative factors for CC. The HPV prevalence and their genotype distribution among women population are essential to evaluate the deteriorating impact of HPV. A cross-sectional study was performed involving 212 participants to identify the prevalence of high-risk HPV genotypes in south India using PCR and DNA Sequencing. The results obtained from cross-sectional study were used to conduct a meta-analysis of the previous published studies on HPV prevalence and genotype distribution across six geographical regions (North, Northeast, East, Central, West, and South) of India. Additionally, molecular simulation was performed using GROMACS software to determine the structural differences of E6 oncoprotein in HPV-16 and 18 genotypes, characterized from Indian subjects. Among the study participants, the HPV prevalence was found to be 81.70% in CC, 71.42% in HSIL and 61.30% in LSIL. The meta-analysis showed a high prevalence of HPV-16 in CC across the entire six regions. Of which, South and North India were found to have high HPV prevalence among Indian regions. Further, simulation of E6 oncoprotein revealed structural differences between HPV-16 and 18 which may be associated with their oncogenic nature. The HPV-16 and 18 were noticed to be highly prevalent in Indian women. Health awareness and vaccination programs are regularly needed to protect Indian women community. Copyright © 2018 Elsevier B.V. All rights reserved.

Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

International Nuclear Information System (INIS)

Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan

2016-01-01

Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

Energy Technology Data Exchange (ETDEWEB)

Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan, E-mail: drqzliu@hotmail.com

2016-08-01

Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

Human papillomavirus type 16 E7 oncoprotein engages but does not abrogate the mitotic spindle assembly checkpoint

Energy Technology Data Exchange (ETDEWEB)

Yu, Yueyang [Division of Infectious Diseases, Brigham and Women' s Hospital and Biological and Biomedical Sciences Program, Harvard Medical School, Boston, MA 02115 (United States); Munger, Karl, E-mail: kmunger@rics.bwh.harvard.edu [Division of Infectious Diseases, Brigham and Women' s Hospital and Biological and Biomedical Sciences Program, Harvard Medical School, Boston, MA 02115 (United States)

2012-10-10

The mitotic spindle assembly checkpoint (SAC) ensures faithful chromosome segregation during mitosis by censoring kinetochore-microtubule interactions. It is frequently rendered dysfunctional during carcinogenesis causing chromosome missegregation and genomic instability. There are conflicting reports whether the HPV16 E7 oncoprotein drives chromosomal instability by abolishing the SAC. Here we report that degradation of mitotic cyclins is impaired in cells with HPV16 E7 expression. RNAi-mediated depletion of Mad2 or BubR1 indicated the involvement of the SAC, suggesting that HPV16 E7 expression causes sustained SAC engagement. Mutational analyses revealed that HPV16 E7 sequences that are necessary for retinoblastoma tumor suppressor protein binding as well as sequences previously implicated in binding the nuclear and mitotic apparatus (NuMA) protein and in delocalizing dynein from the mitotic spindle contribute to SAC engagement. Importantly, however, HPV16 E7 does not markedly compromise the SAC response to microtubule poisons.

Trends in BMI of urban Australian adults, 1980-2000

DEFF Research Database (Denmark)

Walls, Helen L; Wolfe, Rory; Haby, Michelle M

2010-01-01

of 7.4 kg/m2 at the higher end for women aged 55-64 years. While the prevalence of obesity (BMI >or= 30 kg/m2) doubled, the prevalence of obesity class III (BMI >or= 40 kg/m2) increased fourfold. CONCLUSIONS: BMI in urban Australian adults has increased and its distribution has become increasingly...... right-skewed. This has resulted in a large increase in the prevalence of obesity, particularly the more severe levels of obesity. It will be important to monitor changes in the different classes of obesity and the extent to which obesity interventions both shift the BMI distribution leftwards...

Endothelial function in young women with polycystic ovary syndrome (PCOS): Implications of body mass index (BMI) and insulin resistance.

Science.gov (United States)

El-Kannishy, Ghada; Kamal, Shaheer; Mousa, Amany; Saleh, Omayma; Badrawy, Adel El; Farahaty, Reham El; Shokeir, Tarek

2010-01-01

Evidence regarding endothelial function in both obese and nonobese women with PCOS is contradictory. It is unknown whether obese women with PCOS carry an increased risk related to body mass index (BMI). To identify endothelial function and investigate its relationship to body mass index and insulin resistance in young women with PCOS. Twenty-two obese women with PCOS (BMI 35.2 ± 3.2) as well as fourteen lean women (BMI 22.8 ± 2.1)with PCOS were included in the study. Fasting serum insulin, blood glucose were estimated and HOMA and Quicki index were calculated. All patients were subjected to ultrasound recording of brachial artery diameter at rest and after reactive hyperemia (FMD) for assessment of endothelial function. Ten age matched healthy females with normal BMI were chosen as a control group. There were higher basal insulin levels with lower Quicki index and higher HOMA index in women with PCOS than normal group, but the differences were significant only between obese PCOS subgroup and control. On the other hand, FMD was significantly and equally decreased in both groups of women with PCOS, compared with control subjects (3.7 ± 3.2% in the nonobese subgroup and 3.5 ± 2.8% in the obese one vs. 10.6 ± 4.1% in control subjects, P, 0.001). FMD was not correlated with BMI nor insulin resistance indices. Endothelial dysfunction is already present in young women with PCOS. In this patient group, it cannot be attributed to insulin resistance or obesity. © 2010 Asian Oceanian Association for the Study of Obesity . Published by Elsevier Ltd. All rights reserved.

ERP, a new member of the ets transcription factor/oncoprotein family: cloning, characterization, and differential expression during B-lymphocyte development.

Science.gov (United States)

Lopez, M; Oettgen, P; Akbarali, Y; Dendorfer, U; Libermann, T A

1994-05-01

The ets gene family encodes a group of proteins which function as transcription factors under physiological conditions and, if aberrantly expressed, can cause cellular transformation. We have recently identified two regulatory elements in the murine immunoglobulin heavy-chain (IgH) enhancer, pi and microB, which exhibit striking similarity to binding sites for ets-related proteins. To identify ets-related transcriptional regulators expressed in pre-B lymphocytes that may interact with either the pi or the microB site, we have used a PCR approach with degenerate oligonucleotides encoding conserved sequences in all members of the ets family. We have cloned the gene for a new ets-related transcription factor, ERP (ets-related protein), from the murine pre-B cell line BASC 6C2 and from mouse lung tissue. The ERP protein contains a region of high homology with the ETS DNA-binding domain common to all members of the ets transcription factor/oncoprotein family. Three additional smaller regions show homology to the ELK-1 and SAP-1 genes, a subgroup of the ets gene family that interacts with the serum response factor. Full-length ERP expresses only negligible DNA-binding activity by itself. Removal of the carboxy terminus enables ERP to interact with a variety of ets-binding sites including the E74 site, the IgH enhancer pi site, and the lck promoter ets site, suggesting a carboxy-terminal negative regulatory domain. At least three ERP-related transcripts are expressed in a variety of tissues. However, within the B-cell lineage, ERP is highly expressed primarily at early stages of B-lymphocyte development, and expression declines drastically upon B-cell maturation, correlating with the enhancer activity of the IgH pi site. These data suggest that ERP might play a role in B-cell development and in IgH gene regulation.

A Study on Mediation by Offspring BMI in the Association between Maternal Obesity and Child Respiratory Outcomes in the Amsterdam Born and Their Development Study Cohort.

Science.gov (United States)

Harskamp-van Ginkel, Margreet W; London, Stephanie J; Magnus, Maria C; Gademan, Maaike G; Vrijkotte, Tanja G

2015-01-01

A causal relationship between maternal obesity and offspring asthma is hypothesized to begin during early development, but no underlying mechanism for the found association is identified. We quantitatively examined mediation by offspring body mass index (BMI) in the association of maternal pre-pregnancy BMI on risk of asthma and wheezing during the first 7-8 years of life in a large Amsterdam born birth cohort. For 3185 mother-child pairs, mothers reported maternal pre-pregnancy BMI and offspring outcomes "ever being diagnosed with asthma" and "wheezing in the past 12 months" on questionnaires. We measured offspring height and weight at age 5-6 years. We performed a multivariate log linear regression comparing outcomes in offspring of mothers with different BMI categories. For each category we quantified and tested mediation by offspring BMI and also investigated interaction by parental asthma. At the age of 7-8 years, 8% of the offspring ever had asthma and 7% had current wheezing. Maternal pre-pregnancy obesity was associated with higher risks of asthma (adjusted RR 2.32 (95% CI: 1.49-3.61) and wheezing (adjusted RR 2.16 (95% CI: 1.28-3.64). Offspring BMI was a mediator in the association between maternal BMI and offspring wheezing, but not for asthma. There was no interaction by parental asthma. Maternal pre-pregnancy obesity was associated with higher risks of offspring asthma and wheezing. The association between maternal obesity and offspring wheezing was both direct and indirect (mediated) through the child's own BMI.

ENERGY CONSUMPTION, THE DISTRIBUTION OF MACRONUTRIENTS AND BMI IN MOTHERS AND THEIR MEXICAN SCHOOLCHILDREN.

Science.gov (United States)

Miranda-Ríos, L Lizette; Vásquez-Garibay, Edgar M; Romero-Velarde, Enrique; Nuño-Cosío, M Eugenia; Campos-Barrera, Liliana R

2015-12-01

to identify the association between the percentage of adequacy of energy and protein and the distribution of macronutrients and sugar in the diets of mothers and schoolchildren with their respective BMI. in a cross-sectional study, 174 5-12-year-old schoolchildren and their mothers were randomly selected. BMI was measured, and 24-hour dietary surveys were administered on weekdays and weekends. The associations between the dietetic indicators in the mothers and their children and the BMI of the mothers and their children were assessed. The chi-square test, linear regression and odds ratio were used for analysis. excessive energy consumption in the mothers increased the risk of excessive energy consumption in their daughters by 11-fold (p=0.04). Maternal lipid intake was associated with the consumption of lipids in their sons and daughters (p. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

Elucidation of Ligand-Dependent Modulation of Disorder-Order Transitions in the Oncoprotein MDM2.

Directory of Open Access Journals (Sweden)

Juan A Bueren-Calabuig

2015-06-01

Full Text Available Numerous biomolecular interactions involve unstructured protein regions, but how to exploit such interactions to enhance the affinity of a lead molecule in the context of rational drug design remains uncertain. Here clarification was sought for cases where interactions of different ligands with the same disordered protein region yield qualitatively different results. Specifically, conformational ensembles for the disordered lid region of the N-terminal domain of the oncoprotein MDM2 in the presence of different ligands were computed by means of a novel combination of accelerated molecular dynamics, umbrella sampling, and variational free energy profile methodologies. The resulting conformational ensembles for MDM2, free and bound to p53 TAD (17-29 peptide identify lid states compatible with previous NMR measurements. Remarkably, the MDM2 lid region is shown to adopt distinct conformational states in the presence of different small-molecule ligands. Detailed analyses of small-molecule bound ensembles reveal that the ca. 25-fold affinity improvement of the piperidinone family of inhibitors for MDM2 constructs that include the full lid correlates with interactions between ligand hydrophobic groups and the C-terminal lid region that is already partially ordered in apo MDM2. By contrast, Nutlin or benzodiazepinedione inhibitors, that bind with similar affinity to full lid and lid-truncated MDM2 constructs, interact additionally through their solubilizing groups with N-terminal lid residues that are more disordered in apo MDM2.

The decline in BMI among Japanese women after World War II.

Science.gov (United States)

Maruyama, Shiko; Nakamura, Sayaka

2015-07-01

The body mass index (BMI) of the Japanese is significantly lower than is found in other high-income countries. Moreover, the average BMI of Japanese women is lower than that of Japanese men, and the age-specific BMI of Japanese women has decreased over time. The average BMI of Japanese women at age 25 decreased from 21.8 in 1948 to 20.4 in 2010 whereas that of men increased from 21.4 to 22.3 over the same period. We examine the long-term BMI trend in Japan by combining several historical data sources spanning eleven decades, from 1901 to 2012, to determine not only when but also how the BMI decline among women began: whether its inception was period-specific or cohort-specific. Our nonparametric regression analysis generated five findings. First, the BMI of Japanese women peaked with the 1930s birth cohort. This means that the trend is cohort-specific. Second, the BMI of men outpaced that of women in the next cohort. Third, the BMI of Japanese children, boys and girls alike, increased steadily throughout the 20th century. Fourth, the gender difference in the BMI trend is due to a gender difference in the weight trend, not the height trend. Fifth, these BMI trends are observed in urban and rural populations alike. We conclude that the BMI decline among Japanese women began with those who were in their late teens shortly after World War II. Copyright © 2015 Elsevier B.V. All rights reserved.

MicroRNA 128a increases intracellular ROS level by targeting Bmi-1 and inhibits medulloblastoma cancer cell growth by promoting senescence.

Directory of Open Access Journals (Sweden)

Sujatha Venkataraman

Full Text Available BACKGROUND: MicroRNAs (miRNAs are a class of short non-coding RNAs that regulate cell homeostasis by inhibiting translation or degrading mRNA of target genes, and thereby can act as tumor suppressor genes or oncogenes. The role of microRNAs in medulloblastoma has only recently been addressed. We hypothesized that microRNAs differentially expressed during normal CNS development might be abnormally regulated in medulloblastoma and are functionally important for medulloblastoma cell growth. METHODOLOGY AND PRINCIPAL FINDINGS: We examined the expression of microRNAs in medulloblastoma and then investigated the functional role of one specific one, miR-128a, in regulating medulloblastoma cell growth. We found that many microRNAs associated with normal neuronal differentiation are significantly down regulated in medulloblastoma. One of these, miR-128a, inhibits growth of medulloblastoma cells by targeting the Bmi-1 oncogene. In addition, miR-128a alters the intracellular redox state of the tumor cells and promotes cellular senescence. CONCLUSIONS AND SIGNIFICANCE: Here we report the novel regulation of reactive oxygen species (ROS by microRNA 128a via the specific inhibition of the Bmi-1 oncogene. We demonstrate that miR-128a has growth suppressive activity in medulloblastoma and that this activity is partially mediated by targeting Bmi-1. This data has implications for the modulation of redox states in cancer stem cells, which are thought to be resistant to therapy due to their low ROS states.

Investigation of the effect of body mass index (BMI on semen parameters and male reproductive system hormones

Directory of Open Access Journals (Sweden)

Mehmet Zeynel Keskin

2017-10-01

Full Text Available Aim: To evaluate the effects of body mass index (BMI ratio on semen parameters and serum reproductive hormones. Materials and methods: The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. Results: The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC, normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165, Group 2 (n = 222 and Group 3 (n = 56. There was no statistically significant difference in terms of all variables between the groups. Conclusions: We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.

Assessing the genetic overlap between BMI and cognitive function

Science.gov (United States)

Marioni, R E; Yang, J; Dykiert, D; Mõttus, R; Campbell, A; Ibrahim-Verbaas, Carla A; Bressler, Jan; Debette, Stephanie; Schuur, Maaike; Smith, Albert V; Davies, Gail; Bennett, David A; Deary, Ian J; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosely Jr, Thomas H; Davies, G; Hayward, C; Porteous, D J; Visscher, P M; Deary, I J

2016-01-01

Obesity and low cognitive function are associated with multiple adverse health outcomes across the life course. They have a small phenotypic correlation (r=−0.11; high body mass index (BMI)−low cognitive function), but whether they have a shared genetic aetiology is unknown. We investigated the phenotypic and genetic correlations between the traits using data from 6815 unrelated, genotyped members of Generation Scotland, an ethnically homogeneous cohort from five sites across Scotland. Genetic correlations were estimated using the following: same-sample bivariate genome-wide complex trait analysis (GCTA)–GREML; independent samples bivariate GCTA–GREML using Generation Scotland for cognitive data and four other samples (n=20 806) for BMI; and bivariate LDSC analysis using the largest genome-wide association study (GWAS) summary data on cognitive function (n=48 462) and BMI (n=339 224) to date. The GWAS summary data were also used to create polygenic scores for the two traits, with within- and cross-trait prediction taking place in the independent Generation Scotland cohort. A large genetic correlation of −0.51 (s.e. 0.15) was observed using the same-sample GCTA–GREML approach compared with −0.10 (s.e. 0.08) from the independent-samples GCTA–GREML approach and −0.22 (s.e. 0.03) from the bivariate LDSC analysis. A genetic profile score using cognition-specific genetic variants accounts for 0.08% (P=0.020) of the variance in BMI and a genetic profile score using BMI-specific variants accounts for 0.42% (P=1.9 × 10−7) of the variance in cognitive function. Seven common genetic variants are significantly associated with both traits at Pcognitive function. PMID:26857597

Education modifies genetic and environmental influences on BMI

DEFF Research Database (Denmark)

Johnson, Wendy; Kyvik, Kirsten Ohm; Skytthe, Axel

2011-01-01

environmental correlations between education and BMI differed by level of education, analyzing women and men separately. Correlations between education and BMI were -.13 in women, -.15 in men. High BMI's were less frequent among well-educated participants, generating less variance. In women, this was due...... to restriction of all forms of variance, overall by a factor of about 2. In men, genetic variance did not vary with education, but results for shared and nonshared environmental variance were similar to those for women. The contributions of the shared environment to the correlations between education and BMI......Obesity is more common among the less educated, suggesting education-related environmental triggers. Such triggers may act differently dependent on genetic and environmental predisposition to obesity. In a Danish Twin Registry survey, 21,522 twins of same-sex pairs provided zygosity, height, weight...

Maternal BMI and migration status as predictors of childhood obesity in Mexico.

Science.gov (United States)

Jiménez-Cruz, A; Wojcicki, J M; Bacardí-Gascón, M; Castellón-Zaragoza, A; García-Gallardo, J L; Schwartz, N; Heyman, M B

2011-01-01

To assess the association of maternal migration to Baja California, body mass index (BMI) status, children's perceived food insecurity, and childhood lifestyle behaviors with overweight (BMI > 85% ile), obesity (BMI > 95% ile) and abdominal obesity (Waist Circumference > 90% ile). Convenience sampling methods were used to recruit a cross-sectional sample of 4th, 5th and 6th grade children and their parents at Tijuana and Tecate Public Schools. Children's and parents' weights and heights were measured. Children were considered to have migrant parents if parents were not born in Baja California. One hundred and twenty-two children and their parents were recruited. The mean age of the children was 10.1 ± 1.0 years. Forty nine per cent of children were overweight or obese. Children with obese parents (BMI > 30) had greater odds of being obese, Odds Ratio (OR) 4.9 (95% Confidence Interval (CI), 1.2-19, p = 0.03). Children with migrant parents had greater odds of being obese, OR= 3.7 (95% CI, 1.6-8.3), p = 0.01) and of having abdominal obesity, OR = 3.2 (95% CI, 1.4-7.1, p = 0.01). Children from migrant parents have greater risk of higher consumption of potato chips, OR = 8.0 (95% CI, 2.1-29.1, p = 0.01). Children from non-migrant parents had greater odds of being at risk of hunger. Parental obesity and migration are associated with increased risk of obesity among Mexican children. Children whose parents were born in Baja California have greater odds of being at risk of hunger. Further studies should evaluate the role of migration on risk for childhood obesity.

Dasatinib inhibits the growth and survival of neoplastic human eosinophils (EOL-1) through targeting of FIP1L1-PDGFRalpha.

Science.gov (United States)

Baumgartner, Christian; Gleixner, Karoline V; Peter, Barbara; Ferenc, Veronika; Gruze, Alexander; Remsing Rix, Lily L; Bennett, Keiryn L; Samorapoompichit, Puchit; Lee, Francis Y; Pickl, Winfried F; Esterbauer, Harald; Sillaber, Christian; Superti-Furga, Giulio; Valent, Peter

2008-10-01

Chronic eosinophilic leukemia (CEL) is a myeloproliferative disorder characterized by molecular and/or cytogenetic evidence of clonality of eosinophils, marked eosinophilia, and organ damage. In many patients, the transforming mutation FIP1L1-PDGFRalpha and the related CHIC2 deletion are found. The respective oncoprotein, FIP1L1-PDGFRalpha, is considered to play a major role in malignant cell growth in CEL. The tyrosine kinase (TK) inhibitor imatinib (STI571) has been described to counteract the TK activity of FIP1L1-PDGFRalpha in most patients. However, not all patients with CEL show a response to imatinib. Therefore, several attempts have been made to identify other TK inhibitors that counteract growth of neoplastic eosinophils. We provide evidence that dasatinib, a multi-targeted kinase inhibitor, blocks the growth and survival of EOL-1, an eosinophil leukemia cell line carrying FIP1L1-PDGFRalpha. The effects of dasatinib on proliferation of EOL-1 cells were dose-dependent, with an IC50 of 0.5 to 1 nM, which was found to be in the same range when compared to IC50 values produced with imatinib. Dasatinib was also found to induce apoptosis in EOL-1 cells in a dose-dependent manner (IC50: 1-10 nM). The apoptosis-inducing effects of dasatinib on EOL-1 cells were demonstrable by light microscopy, flow cytometry, and in a TUNEL assay. In Western blot experiments, dasatinib completely blocked the phosphorylation of FIP1L1-PDGFRalpha in EOL-1 cells. Dasatinib inhibits the growth of leukemic eosinophils through targeting of the disease-related oncoprotein FIP1L1-PDGFRalpha. Based on this observation, dasatinib may be considered as a new interesting treatment option for patients with CEL.

Associations Between Sedentary Behaviors, Sleep Patterns, and BMI in Young Dancers Attending a Summer Intensive Dance Training Program.

Science.gov (United States)

Stracciolini, Andrea; Stein, Cynthia J; Kinney, Susan; McCrystal, Tara; Pepin, Michael J; Meehan Iii, William P

2017-09-15

The purpose of this study was to investigate associations between sedentary behaviors, sleep hours, and body mass index (BMI) in 12- to 17-year-old dancers. This was a cross sectional survey in which bivariate correlation and simple linear regression were used to determine associations between self-reported components. One hundred fifteen dancers were queried, 91.3% of whom were female. The mean BMI was 19.6 ± 2.3 kg/m2. Two-thirds of dancers fell below the 50th percentile for age-adjusted BMI, and 30.4% fell below the 25th percentile. Better than 12% of dancers reported a history of anxiety, and 2.6% reported depression. Mean hours of sleep per night was 7.8 ± 0.9, with 58% of the dancers getting less than 8 hours of sleep per night. The mean total screen time for dancers was 3.4 ± 2.1 hours/day, which consisted of tablet and computer usage: 1.6 ± 1.1 hours/day; texting: 0.5 ± 1.1 hours/day; watching television: 1.2 ± 1.1 hours/day; and playing video games 1.2 ± 1.1 hours/ day. Total screen time was independently associated positively with BMI, explaining nearly 10% of the variability in BMI. Age, hours dancing per day, and hours of sleep per night were not independently associated with BMI. To summarize: screen time was associated with increased BMI in this young dancer cohort; the majority of dancers slept less than 8 hours per night; anticipatory guidance addressing media use and sleep hygiene in the adolescent dancer population is needed.

Overweight or obese BMI is associated with earlier, but not later survival after common acute illnesses.

Science.gov (United States)

Prescott, Hallie C; Chang, Virginia W

2018-02-06

Obesity has been associated with improved short-term mortality following common acute illness, but its relationship with longer-term mortality is unknown. Observational study of U.S. Health and Retirement Study (HRS) participants with federal health insurance (fee-for-service Medicare) coverage, hospitalized with congestive heart failure (N = 4287), pneumonia (N = 4182), or acute myocardial infarction (N = 2001), 1996-2012. Using cox proportional hazards models, we examined the association between overweight or obese BMI (BMI ≥ 25.0 kg/m 2 ) and mortality to 5 years after hospital admission, adjusted for potential confounders measured at the same time as BMI, including age, race, sex, education, partnership status, income, wealth, and smoking status. Body mass index (BMI) was calculated from self-reported height and weight collected at the HRS survey prior to hospitalization (a median 1.1 year prior to hospitalization). The referent group was patients with a normal BMI (18.5 to BMI was associated with lower mortality at 1 year after hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction-with adjusted hazard ratios of 0.68 (95% CI 0.59-0.79), 0.74 (95% CI: 0.64-0.84), and 0.65 (95%CI: 0.53-0.80), respectively. Among participants who lived to one year, however, subsequent survival was similar between patients with normal versus overweight/obese BMI. In older Americans, overweight or obese BMI was associated with improved survival following hospitalization for congestive heart failure, pneumonia, and acute myocardial infarction. This association, however, is limited to the shorter-term. Conditional on surviving to one year, we did not observe a survival advantage associated with excess weight.

Diagnostic performance of Body Mass Index, Waist Circumference and the Waist-to-Height Ratio for identifying cardiometabolic risk in Scottish pre-adolescents.

Science.gov (United States)

Buchan, Duncan S; McLellan, Gillian; Donnelly, Samantha; Arthur, Rosie

2017-06-01

Limited studies have examined the diagnostic performance of body mass index (BMI), waist circumference (WC) or waist-to-height ratio (WHtR) for identifying cardiometabolic risk (increased clustered glucose, triglycerides, mean arterial pressure and inv-HDL-cholesterol) in pre-adolescent youth. To compare the utility of BMI, WC and WHtR as predictors of cardiometabolic risk (CMR) in Scottish pre-adolescent children. A cross-sectional analysis of 223 Scottish children (55.2% boys, mean age =8.4 years) was undertaken. BMI, WC and WHtR were used as exposure variables within multivariate logistic regression analysis and ROC analysis to examine the utility of these anthropometrical indices in identifying those at cardiometabolic risk. Individuals with an elevated WHtR, WC and BMI were 3.51 (95% CI = 1.71-7.23; p < .001); 2.34 (95% CI = 1.35-4.06; p = .002) and 2.59 (95% CI = 1.42-4.73; p = .002) times more likely to be at cardiometabolic risk, respectively. The areas under the curves [AUC] to identify children with cardiometabolic risk were significant and similar among anthropometric indices (AUC's = 0.60-0.65). When stratified by BMI, both WC and WHtR demonstrated a fair-to-good ability for identifying those at cardiometabolic risk (AUC = 0.75-0.81). Findings suggest that the combination of BMI with either WC or WHtR may provide an added benefit in the assessment of cardiometabolic risk amongst pre-adolescents.

Microaggressions, Discrimination, and Phenotype among African Americans: A Latent Class Analysis of the Impact of Skin Tone and BMI.

Science.gov (United States)

Keith, Verna M; Nguyen, Ann W; Taylor, Robert Joseph; Mouzon, Dawne M; Chatters, Linda M

2017-05-01

Data from the 2001-2003National Survey of American Life are used to investigate the effects of phenotype on everyday experiences with discrimination among African Americans (N=3343). Latent class analysis is used to identify four classes of discriminatory treatment: 1) low levels of discrimination, 2) disrespect and condescension, 3) character-based discrimination, and 4) high levels of discrimination. We then employ latent class multinomial logistic regression to evaluate the association between skin tone and body weight and these four classes of discrimination. Designating the low level discrimination class as the reference group, findings revealed that respondents with darker skin were more likely to be classified into the disrespect/condescension and the high level microaggression types. BMI was unrelated to the discrimination type, although there was a significant interaction effect between gender and BMI. BMI was strongly and positively associated with membership in the disrespect and condescension type among men but not among women. These findings indicate that skin tone and body weight are two phenotypic characteristics that influence the type and frequency of discrimination experienced by African Americans.

BMI-for-age graphs with severe obesity percentile curves: tools for plotting cross-sectional and longitudinal youth BMI data.

Science.gov (United States)

Racette, Susan B; Yu, Liyang; DuPont, Nicholas C; Clark, B Ruth

2017-05-24

Severe obesity is an important and distinct weight status classification that is associated with disease risk and is increasing in prevalence among youth. The ability to graphically present population weight status data, ranging from underweight through severe obesity class 3, is novel and applicable to epidemiologic research, intervention studies, case reports, and clinical care. The aim was to create body mass index (BMI) graphing tools to generate sex-specific BMI-for-age graphs that include severe obesity percentile curves. We used the Centers for Disease Control and Prevention youth reference data sets and weight status criteria to generate the percentile curves. The statistical software environments SAS and R were used to create two different graphing options. This article provides graphing tools for creating sex-specific BMI-for-age graphs for males and females ages 2 to obesity classes 2 and 3, the ability to plot individual data for thousands of children and adolescents on a single graph, and the ability to generate cross-sectional and longitudinal graphs. These new BMI graphing tools will enable investigators, public health professionals, and clinicians to view and present youth weight status data in novel and meaningful ways.

Maternal BMI during Pregnancy: Effect on trace elements Status and ...

African Journals Online (AJOL)

Maternal BMI was significantly positively related to age, parity and socioeconomic status. While a negative relationship was found between plasma copper and maternal BMI, significantly (p < 0.05) lower zinc levels were found in underweight and obese women when compared to women with normal BMI. Maternal anaemia ...

Percutaneous Nephrolithotomy in Patients With BMI >50: Single Surgeon Outcomes and Feasibility.

Science.gov (United States)

Streeper, Necole M; Radtke, Andrew C; Penniston, Kristina L; McDermott, John C; Nakada, Stephen Y

2016-01-01

To evaluate the use of percutaneous nephrolithotomy (PNL) and technical approach in the super obese population (body mass index [BMI] ≥ 50). We performed a retrospective review of 31 consecutive PNL cases with a BMI > 50 from a single surgeon (SYN) from 1995 to 2013. Procedures were performed in the prone position, and upper pole access was used. Operative time, length of hospital stay, stone burden, complication rates, and stone-free rates were measured. Of the 31 patients who underwent PNL (age 51.2 ± 12; 71% female), the mean BMI was 59.1 ± 6 kg/m(2) (range 50.4-71.7 kg/m(2)). Mean stone burden was 3.8 cm ± 2. The majority of patients (90.3%) had an upper pole puncture site for access with an operative time of 122.1 ± 75 minutes. The technique was similar to non-obese patients; however, there was a need for extra-long instrumentation. The overall stone-free rate was 71%, with utilization of a second-look PNL in 11 cases. The complication rate, Clavien grade 3 or higher, was 9.7% (3 of 31). PNL is technically feasible, safe, and effective in patients with a BMI ≥ 50. The complication rate, length of hospital stay, and stone-free rate with use of second-look PNL in super obese patients are comparable to severely obese patients. Intervention should not be automatically ruled out or delayed based on the patient's BMI alone. Copyright © 2015 Elsevier Inc. All rights reserved.

Parental nonstandard work schedules during infancy and children's BMI trajectories

Directory of Open Access Journals (Sweden)

Afshin Zilanawala

2017-09-01

Full Text Available Background: Empirical evidence has demonstrated adverse associations between parental nonstandard work schedules (i.e., evenings, nights, or weekends and child developmental outcomes. However, there are mixed findings concerning the relationship between parental nonstandard employment and children's body mass index (BMI, and few studies have incorporated information on paternal work schedules. Objective: This paper investigated BMI trajectories from early to middle childhood (ages 3-11 by parental work schedules at 9 months of age, using nationally representative cohort data from the United Kingdom. This study is the first to examine the link between nonstandard work schedules and children's BMI in the United Kingdom. Methods: We used data from the Millennium Cohort Study (2001‒2013, n = 13,021 to estimate trajectories in BMI, using data from ages 3, 5, 7, and 11 years. Joint parental work schedules and a range of biological, socioeconomic, and psychosocial covariates were assessed in the initial interviews at 9 months. Results: Compared to children in two-parent families where parents worked standard shifts, we found steeper BMI growth trajectories for children in two-parent families where both parents worked nonstandard shifts and children in single-parent families whose mothers worked a standard shift. Fathers' shift work, compared to standard shifts, was independently associated with significant increases in BMI. Conclusions: Future public health initiatives focused on reducing the risk of rapid BMI gain in childhood can potentially consider the disruptions to family processes resulting from working nonstandard hours. Contribution: Children in families in which both parents work nonstandard schedules had steeper BMI growth trajectories across the first decade of life. Fathers' nonstandard shifts were independently associated with increases in BMI.

Penetrating Osseous Spicules Causing High-Flow Ventral CSF Leaks in the Setting of Relatively Low BMI : A Preliminary Study.

Science.gov (United States)

Rosebrock, Richard E; Diehn, Felix E; Luetmer, Patrick H; Wald, John T; Lane, John I; Morris, Jonathan M; Lehman, Vance T; Carr, Carrie M; Mokri, Bahram; Thielen, Kent R

2017-05-16

We have anecdotally observed patients with high-flow ventral cerebrospinal fluid (CSF) leaks resulting from penetrating osseous spicules or calcified discs to be relatively thin. The purpose of this study was to explore the validity of this observation and determine if a potential association exists between low body mass index (BMI) and high-flow spinal ventral CSF leaks resulting from such dura-penetrating lesions. Sixteen consecutive patients with precisely localized high-flow ventral spinal CSF leaks on dynamic myelography were identified. The cause of the CSF leak was determined. The BMI on the date nearest to and within 2 weeks of myelography was recorded. Utilizing exact sign test, the body mass index was compared to the average BMI from the National Health and Nutrition Examination Survey (Centers for Disease Control), matched to sex and age-range. The cohort consisted of 10 males (63%) and 6 females with a mean age of 54 years (range 37-72 years). In all patients, a spiculated osteophyte/calcified disc was identified at the site of the leak. Fourteen patients (88%) had a BMI below the matched national average, while only two patients (13%) had values above the national average (p = 0.004). Patients with high-flow ventral CSF leaks resulting from spiculated osteophyte or calcified disc as identified by dynamic myelography are more likely to have a BMI below the U.S. national average, matched for gender and age-range. This exploratory analysis requires confirmation as well as further characterization of potential pathophysiologic mechanisms and impact on radiographic and clinical assessments.

Oncoprotein MDM2 Overexpression is Associated with Poor Prognosis in Distinct Non-Hodgkin's Lymphoma Entities

DEFF Research Database (Denmark)

Møller, Michael Boe; Nielsen, O; Pedersen, Niels Tinggaard

1999-01-01

MDM2 is an oncoprotein involved in the regulation of p53. MDM2 exerts its tumorigenic potential through p53-dependent and -independent mechanisms. It is frequently overexpressed in various malignancies. Little is known about the prognostic value of MDM2 expression in non-Hodgkin's lymphomas (NHL...... overexpression was present in 42 (22%) of 188 cases. The frequency was highest in aggressive/very aggressive NHL (P lymphomas, MDM2 overexpression was associated with higher-grade disease (P = .008). MDM2 overexpression was not related to a phenotype indicating...... altered p53. In univariate analysis MDM2 overexpression associated with short survival in follicle center lymphomas (P = .0256), extranodal marginal zone lymphomas (P lymphomas (P = .0047). The relation to poor prognosis was maintained in a Cox regression analysis including known...

Physical activity modifies the FTO effect on BMI change in Japanese adolescents.

Science.gov (United States)

Shinozaki, Keiko; Okuda, Masayuki; Okayama, Naoko; Kunitsugu, Ichiro

2018-04-14

Evidence of the effects of fat mass and obesity-associated (FTO) gene variation and long-term effects of physical activity (PA) on adiposity in adolescents is largely scarce. This study aimed to investigate whether physical activity modulates the effects of the FTO gene on body mass index (BMI) changes in Japanese adolescents between the ages of 13 and 18 years. Data of 343 subjects (156 boys; 187 girls) who were enrolled in 2006 and 2007 from schools on Shunan City, Japan, were collected. Genotyping (rs1558902) was conducted, and anthropometric measurements and blood test results were recorded for subjects in the eighth grade. A second survey involving self-reporting of anthropometric measurements was conducted when the subjects were in the twelfth grade. PA was estimated using the International Physical Activity Questionnaire in this survey. BMI and the standard deviation score for BMI (BMI-SDS) were calculated. BMI changes and BMI-SDS changes were compared among FTO genotypes using a multivariate model. The effect of the interaction between PA and the FTO genotype on BMI changes was significant among boys but not girls. Among boys, PA had a significant negative influence on BMI-SDS changes in those with the AA genotype and a significant positive influence on BMI and BMI-SDS changes in those with the TT genotype. These data suggest that the influence of PA on BMI changes and BMI-SDS changes varied on the basis of genotype. PA modified the effect of the FTO gene on BMI changes in Japanese boys. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

CORRELATION BETWEEN SERUM HER-2 ONCOPROTEIN AND PATIENTS WITH BREAST CANCER

Institute of Scientific and Technical Information of China (English)

Peng Yuan; Bing-he Xu; Da-tong Chu

2004-01-01

Objective To detect serum HER-2 oncoprotein levels in patients with operable and metastatic breast cancers, and to study the correlations between serum HER-2 level and lymph node status as well as other clinical parameters.Methods A total of 120 women were studied consisting of 10 healthy volunteers, 31 benign breast disease, 53 operable breast cancer, and 26 metastatic breast cancer patients. The levels of serum HER-2 were measured using an enzyme-liked immunosorbent assay (ELISA).Results The mean serum HER-2 levels were 9.6 + 1.5 ng/mL in healthy volunteers, 11.9 + 1.6 ng/mL in benign breast disease, 13.2 + 4.2 ng/mL in operable breast cancer, and 30.5 + 30.8 ng/mL in metastatic breast cancer patients. The former is much lower than the latter three (P=0.02, 0.001, 0.03, respectively). If using 15 ng/mL as a normal baseline, elevated serum HER-2 levels were observed in none of the healthy volunteers as well as patients with benign disease, but in 18.9% (10/53)operable breast cancer patients and 61.5% (16/26) metastatic patients. In patients with operable breast cancer, there was a positive correlation between serum concentrations of HER-2 and the size of primary rumor (P ＜ 0.05), whereas there was no correlation between serum concentration and axillary lymph node or estrogen receptor status. In patients with metastatic disease, there was no correlation with site of metastases (P ＞ 0.05).Conclusion Serum HER-2 level was strongly correlated with rumor loads and clinical stages, thus acting as a promising predictor of cancer recurrence in breast cancer patients.

Characteristics of screen media use associated with higher BMI in young adolescents.

Science.gov (United States)

Bickham, David S; Blood, Emily A; Walls, Courtney E; Shrier, Lydia A; Rich, Michael

2013-05-01

This study investigates how characteristics of young adolescents' screen media use are associated with their BMI. By examining relationships between BMI and both time spent using each of 3 screen media and level of attention allocated to use, we sought to contribute to the understanding of mechanisms linking media use and obesity. We measured heights and weights of 91 13- to 15-year-olds and calculated their BMIs. Over 1 week, participants completed a weekday and a Saturday 24-hour time-use diary in which they reported the amount of time they spent using TV, computers, and video games. Participants carried handheld computers and responded to 4 to 7 random signals per day by completing onscreen questionnaires reporting activities to which they were paying primary, secondary, and tertiary attention. Higher proportions of primary attention to TV were positively associated with higher BMI. The difference between 25th and 75th percentiles of attention to TV corresponded to an estimated +2.4 BMI points. Time spent watching television was unrelated to BMI. Neither duration of use nor extent of attention paid to video games or computers was associated with BMI. These findings support the notion that attention to TV is a key element of the increased obesity risk associated with TV viewing. Mechanisms may include the influence of TV commercials on preferences for energy-dense, nutritionally questionable foods and/or eating while distracted by TV. Interventions that interrupt these processes may be effective in decreasing obesity among screen media users.

Predictors of Success in Bariatric Surgery: the Role of BMI and Pre-operative Comorbidities.

Science.gov (United States)

da Cruz, Magda Rosa Ramos; Branco-Filho, Alcides José; Zaparolli, Marília Rizzon; Wagner, Nathalia Farinha; de Paula Pinto, José Simão; Campos, Antônio Carlos Ligocki; Taconeli, Cesar Augusto

2017-11-10

This is a retrospective review of 204 patients who underwent bariatric surgery. The impact of weight regain (WR), pre-operative comorbidities and BMI values on the recurrence of comorbidities was evaluated, and an equation was elaborated to estimate BMI at 5 years of bariatric surgery. Pre-operative data, after 1 year and after 5 years, was collected from the medical records. Descriptive analyses and bivariate hypothesis tests were performed first, and then, a generalised linear regression model with Tweedie distribution was adjusted. The hit rate and the Kendall coefficient of concordance (Kendall's W) of the equation were calculated. At the end, the Mann-Whitney test was performed between the BMI, WR and the presence of comorbidities, after a post-operative period of 5 years. The adjustment of the model resulted in an equation that estimates the mean value of BMI 5 years after surgery. The hit rate was 82.35% and the value of Kendall's W was 0.85 for the equation. It was found that patients with comorbidities presented a higher median WR (10.13%) and a higher mean BMI (30.09 kg/m 2 ) 5 years after the surgery. It is concluded that the equation is useful for estimating the mean BMI at 5 years of surgery and that patients with low pre-operative HDL and folic acid levels, with depression and/or anxiety and a higher BMI, have a higher BMI at 5 years of surgery and higher incidence of comorbid return and dissatisfaction with post-operative results.

Waist circumference is a better predictor of risk for frailty than BMI in the community-dwelling elderly in Beijing.

Science.gov (United States)

Liao, Qiuju; Zheng, Zheng; Xiu, Shuangling; Chan, Piu

2018-03-27

Obesity is found to be associated with frailty. Body mass index (BMI) and waist circumference (WC) are the commonly used measures for obesity, the former is more closely related to general obesity and body weight; the latter can more accurately reflect abdominal obesity and is more closely associated with metabolic disorders. In this study, we intend to study the relationship between frailty, BMI and WC among older people. Data were derived from the Beijing Longitudinal Study on Aging II Cohort, which included 6320 people 65 years or older from three urban districts in Beijing. A Frailty Index derived from 33 items was developed according to Rockwood's cumulative deficits method. A Frailty Index ≥ 0.25 was used as the cut-off criteria. BMI was classified as underweight, normal, overweight, or obese (BMI (≥ 28.0 kg/m 2 , 22.6%) or a larger WC (18.5%) were more likely to be frail. People with normal BMI and overweight people do not suffer from higher prevalence for frailty. In comparison with individuals with normal BMI (18.5-BMI and large WC (odds ratio 1.68; 95% CI 1.33-2.12), have overweight and large WC (odds ratio 1.58; 95% CI 1.23-1.96), or have obesity and large WC (odds ratio 2.28; 95% CI 1.79-2.89). In people with normal WC, only those who are underweight have a higher risk for frailty (odds ratio 1.65, 95% CI 1.08-2.52). In comparison with BMI, the relation of WC with the risk for frailty was much closer. Abdominal obesity is more closely associated with incidence of frailty than general obesity in the elderly. Older adults with large waist circumference are more likely to be frail. Frailty in the elderly might be more closely related to metabolic disorders. WC might be a better measurement to detect frailty than BMI, given its relationship with metabolic disorders.

Correction of self-reported BMI based on objective measurements: a Belgian experience.

Science.gov (United States)

Drieskens, S; Demarest, S; Bel, S; De Ridder, K; Tafforeau, J

2018-01-01

Based on successive Health Interview Surveys (HIS), it has been demonstrated that also in Belgium obesity, measured by means of a self-reported body mass index (BMI in kg/m 2 ), is a growing public health problem that needs to be monitored as accurately as possible. Studies have shown that a self-reported BMI can be biased. Consequently, if the aim is to rely on a self-reported BMI, adjustment is recommended. Data on measured and self-reported BMI, derived from the Belgian Food Consumption Survey (FCS) 2014 offers the opportunity to do so. The HIS and FCS are cross-sectional surveys based on representative population samples. This study focused on adults aged 18-64 years (sample HIS = 6545 and FCS = 1213). Measured and self-reported BMI collected in FCS were used to assess possible misreporting. Using FCS data, correction factors (measured BMI/self-reported BMI) were calculated in function of a combination of background variables (region, gender, educational level and age group). Individual self-reported BMI of the HIS 2013 were then multiplied with the corresponding correction factors to produce a corrected BMI-classification. When compared with the measured BMI, the self-reported BMI in the FCS was underestimated (mean 0.97 kg/m 2 ). 28% of the obese people underestimated their BMI. After applying the correction factors, the prevalence of obesity based on HIS data significantly increased (from 13% based on the original HIS data to 17% based on the corrected HIS data) and approximated the measured one derived from the FCS data. Since self-reported calculations of BMI are underestimated, it is recommended to adjust them to obtain accurate estimates which are important for decision making.

Duration of the action of rocuronium in patients with BMI of less than 25: An observational study.

Science.gov (United States)

Takahata, Osamu; Takahoko, Ken-Ichi; Sasakawa, Tomoki; Inagaki, Yasuyoshi; Takahoko, Hiroyuki; Kunisawa, Takayuki

2018-05-02

The duration of rocuronium in patients with BMI more than 30 kg m is prolonged. Whether the reverse is true when BMI is less than 18.5 kg m is unclear. The objective of this study was to investigate whether a BMI less than 25 kg m affects the duration of rocuronium in doses adjusted for actual body weight. A prospective, observational, single-centre study. The operating room of a teaching hospital from 1 June 2008 to 30 June 2015. Thirty patients with American Society of Anesthesiologists physical status I or II who were scheduled to undergo elective surgery (BMI rocuronium (D1) was defined as the time from injection of rocuronium 0.6 mg kg to return of first twitch height to 25% of the control. Duration of additional doses (D2) was the time from a supplement of 0.15 mg kg rocuronium to return of first twitch height to 25% of the control. The relationship between D1 or D2 and BMI was examined using linear regression analysis. Linear regression analysis revealed a significant correlation between duration of initial dose and BMI (R = 0.246; P = 0.00531). A significant correlation between the duration of the additional dose and BMI was also found (R = 0.316; P = 0.00122). The lower the BMI, the shorter the duration of rocuronium at initial and additional doses determined by the actual body weight in adult patients with a BMI less than 25 kg m. www.umin.ac.jp/ctr/index/htm with registry number UMIN 00009337 and UMIN 000015407.

Raised BMI cut-off for overweight in Greenland Inuit--a review.

Science.gov (United States)

Andersen, Stig; Fleischer Rex, Karsten; Noahsen, Paneeraq; Sørensen, Hans Christian Florian; Mulvad, Gert; Laurberg, Peter

2013-01-01

Obesity is associated with increased morbidity and premature death. Obesity rates have increased worldwide and the WHO recommends monitoring. A steep rise in body mass index (BMI), a measure of adiposity, was detected in Greenland from 1963 to 1998. Interestingly, the BMI starting point was in the overweight range. This is not conceivable in a disease-free, physically active, pre-western hunter population. This led us to reconsider the cut-off point for overweight among Inuit in Greenland. We found 3 different approaches to defining the cut-off point of high BMI in Inuit. First, the contribution to the height by the torso compared to the legs is relatively high. This causes relatively more kilograms per centimetre of height that increases the BMI by approximately 10% compared to Caucasian whites. Second, defining the cut-off by the upper 90-percentile of BMI from height and weight in healthy young Inuit surveyed in 1963 estimated the cut-off point to be around 10% higher compared to Caucasians. Third, if similar LDL-cholesterol and triglycerides are assumed for a certain BMI in Caucasians, the corresponding BMI in Inuit in both Greenland and Canada is around 10% higher. However, genetic admixture of Greenland Inuit and Caucasian Danes will influence this difference and hamper a clear distinction with time. Defining overweight according to the WHO cut-off of a BMI above 25 kg/m(2) in Greenland Inuit may overestimate the number of individuals with elevated BMI.

Mouse model of Epstein-Barr virus LMP1- and LMP2A-driven germinal center B-cell lymphoproliferative disease.

Science.gov (United States)

Minamitani, Takeharu; Ma, Yijie; Zhou, Hufeng; Kida, Hiroshi; Tsai, Chao-Yuan; Obana, Masanori; Okuzaki, Daisuke; Fujio, Yasushi; Kumanogoh, Atsushi; Zhao, Bo; Kikutani, Hitoshi; Kieff, Elliott; Gewurz, Benjamin E; Yasui, Teruhito

2017-05-02

Epstein-Barr virus (EBV) is a major cause of immunosuppression-related B-cell lymphomas and Hodgkin lymphoma (HL). In these malignancies, EBV latent membrane protein 1 (LMP1) and LMP2A provide infected B cells with surrogate CD40 and B-cell receptor growth and survival signals. To gain insights into their synergistic in vivo roles in germinal center (GC) B cells, from which most EBV-driven lymphomas arise, we generated a mouse model with conditional GC B-cell LMP1 and LMP2A coexpression. LMP1 and LMP2A had limited effects in immunocompetent mice. However, upon T- and NK-cell depletion, LMP1/2A caused massive plasmablast outgrowth, organ damage, and death. RNA-sequencing analyses identified EBV oncoprotein effects on GC B-cell target genes, including up-regulation of multiple proinflammatory chemokines and master regulators of plasma cell differentiation. LMP1/2A coexpression also up-regulated key HL markers, including CD30 and mixed hematopoietic lineage markers. Collectively, our results highlight synergistic EBV membrane oncoprotein effects on GC B cells and provide a model for studies of their roles in immunosuppression-related lymphoproliferative diseases.

Childhood BMI and Adult Type 2 Diabetes, Coronary Artery Diseases, Chronic Kidney Disease, and Cardiometabolic Traits: A Mendelian Randomization Analysis.

Science.gov (United States)

Geng, Tingting; Smith, Caren E; Li, Changwei; Huang, Tao

2018-05-01

To test the causal effect of childhood BMI on adult cardiometabolic diseases using a Mendelian randomization analysis. We used 15 single nucleotide polymorphisms as instrumental variables for childhood BMI to test the causal effect of childhood BMI on cardiometabolic diseases using summary-level data from consortia. We found that a 1-SD increase in childhood BMI (kg/m 2 ) was associated with an 83% increase in risk of type 2 diabetes (odds ratio [OR] 1.83 [95% CI 1.46, 2.30]; P = 2.5 × 10 -7 ) and a 28% increase in risk of coronary artery disease (CAD) (OR 1.28 [95% CI 1.17, 1.39]; P = 2.1 × 10 -8 ) at the Bonferroni-adjusted level of significance ( P BMI was associated with a 0.587-SD increase in adulthood BMI (kg/m 2 ), a 0.062-SD increase in hip circumference (cm), a 0.602-SD increase in waist circumference (cm), a 0.111 pmol/L increase in log fasting insulin, a 0.068 increase in log-transformed HOMA of ß-cell function (%), a 0.126 increase in log-transformed HOMA of insulin resistance (%), and a 0.109-SD increase in triglyceride (mg/dL) but a 0.138-SD decrease in HDL (mg/dL) in adults at the Bonferroni-adjusted level of significance ( P BMI was associated with increased risk of type 2 diabetes and CAD in adult life. These results provide evidence supportive of a causal association between childhood BMI and these outcomes. © 2018 by the American Diabetes Association.

Gender and socioeconomic disparities in BMI trajectories in the Seychelles: a cohort analysis based on serial population-based surveys.

Science.gov (United States)

Rossi, Isabelle A; Rousson, Valentin; Viswanathan, Bharathi; Bovet, Pascal

2011-12-09

The relationship between body mass index (BMI) and socioeconomic status (SES) tends to change over time and across populations. In this study, we examined, separately in men and women, whether the association between BMI and SES changed over successive birth cohorts in the Seychelles (Indian Ocean, African region). We used data from all participants in three surveys conducted in 1989, 1994 and 2004 in independent random samples of the population aged 25-64 years in the Seychelles (N = 3'403). We used linear regression to model mean BMI according to age, cohort, SES and smoking status, allowing for a quadratic term for age to account for a curvilinear relation between BMI and age and interactions between SES and age and between SES and cohorts to test whether the relation between SES and BMI changed across subsequent cohorts. All analyses were performed separately in men and women. BMI increased with age in all birth cohorts. BMI was lower in men of low SES than high SES but was higher in women of low SES than high SES. In all SES categories, BMI increased over successive cohorts (1.24 kg/m2 in men and 1.51 kg/m2 for a 10-year increase in birth cohorts, p < 0.001). The difference in BMI between men or women of high vs. low SES did not change significantly across successive cohorts (the interaction between SES and year of birth of cohort was statistically not significant). Smoking was associated with lower BMI in men and women (respectively -1.55 kg/m2 and 2.46 kg/m2, p < 0.001). Although large differences exist between men and women, social patterning of BMI did not change significantly over successive cohorts in this population of a middle-income country in the African region.

Accuracy and usefulness of BMI measures based on self-reported weight and height: findings from the NHANES & NHIS 2001-2006

Directory of Open Access Journals (Sweden)

Schoenborn Charlotte A

2009-11-01

Full Text Available Abstract Background The Body Mass Index (BMI based on self-reported height and weight ("self-reported BMI" in epidemiologic studies is subject to measurement error. However, because of the ease and efficiency in gathering height and weight information through interviews, it remains important to assess the extent of error present in self-reported BMI measures and to explore possible adjustment factors as well as valid uses of such self-reported measures. Methods Using the combined 2001-2006 data from the continuous National Health and Nutrition Examination Survey, discrepancies between BMI measures based on self-reported and physical height and weight measures are estimated and socio-demographic predictors of such discrepancies are identified. Employing adjustments derived from the socio-demographic predictors, the self-reported measures of height and weight in the 2001-2006 National Health Interview Survey are used for population estimates of overweight & obesity as well as the prediction of health risks associated with large BMI values. The analysis relies on two-way frequency tables as well as linear and logistic regression models. All point and variance estimates take into account the complex survey design of the studies involved. Results Self-reported BMI values tend to overestimate measured BMI values at the low end of the BMI scale ( 28. The discrepancies also vary systematically with age (younger and older respondents underestimate their BMI more than respondents aged 42-55, gender and the ethnic/racial background of the respondents. BMI scores, adjusted for socio-demographic characteristics of the respondents, tend to narrow, but do not eliminate misclassification of obese people as merely overweight, but health risk estimates associated with variations in BMI values are virtually the same, whether based on self-report or measured BMI values. Conclusion BMI values based on self-reported height and weight, if corrected for biases

Accuracy and usefulness of BMI measures based on self-reported weight and height: findings from the NHANES & NHIS 2001-2006.

Science.gov (United States)

Stommel, Manfred; Schoenborn, Charlotte A

2009-11-19

The Body Mass Index (BMI) based on self-reported height and weight ("self-reported BMI") in epidemiologic studies is subject to measurement error. However, because of the ease and efficiency in gathering height and weight information through interviews, it remains important to assess the extent of error present in self-reported BMI measures and to explore possible adjustment factors as well as valid uses of such self-reported measures. Using the combined 2001-2006 data from the continuous National Health and Nutrition Examination Survey, discrepancies between BMI measures based on self-reported and physical height and weight measures are estimated and socio-demographic predictors of such discrepancies are identified. Employing adjustments derived from the socio-demographic predictors, the self-reported measures of height and weight in the 2001-2006 National Health Interview Survey are used for population estimates of overweight & obesity as well as the prediction of health risks associated with large BMI values. The analysis relies on two-way frequency tables as well as linear and logistic regression models. All point and variance estimates take into account the complex survey design of the studies involved. Self-reported BMI values tend to overestimate measured BMI values at the low end of the BMI scale ( 28. The discrepancies also vary systematically with age (younger and older respondents underestimate their BMI more than respondents aged 42-55), gender and the ethnic/racial background of the respondents. BMI scores, adjusted for socio-demographic characteristics of the respondents, tend to narrow, but do not eliminate misclassification of obese people as merely overweight, but health risk estimates associated with variations in BMI values are virtually the same, whether based on self-report or measured BMI values. BMI values based on self-reported height and weight, if corrected for biases associated with socio-demographic characteristics of the survey

Fedmerelatererede sundhedsomkostninger vurderet ud fra måling af enten BMI eller taljeomkreds--sekundaerpublikation

DEFF Research Database (Denmark)

Højgaard, Betina; Olsen, Kim Rose; Søgaard, Jes

2009-01-01

circumference (WC) and body mass index (BMI). The analyses show that the combination of BMI and WC does not improve the identification of high-risk individuals compared with the use of WC alone. The health service costs increase by 1.24% in women and 2.08% in men pr. cm increase in WC above the normal range....

Fedmerelatererede sundhedsomkostninger vurderet ud fra måling af enten BMI eller taljeomkreds--sekundaerpublikation

DEFF Research Database (Denmark)

Højgaard, Betina; Olsen, Kim Rose; Søgaard, Jes

2009-01-01

circumference (WC) and body mass index (BMI). The analyses show that the combination of BMI and WC does not improve the identification of high-risk individuals compared with the use of WC alone. The health service costs increase by 1.24% in women and 2.08% in men pr. cm increase in WC above the normal range...

Reduced cortical thickness associated with visceral fat and BMI

Directory of Open Access Journals (Sweden)

Ralf Veit

2014-01-01

Full Text Available Structural brain imaging studies have shown that obesity is associated with widespread reductions in gray matter (GM volume. Although the body mass index (BMI is an easily accessible anthropometric measure, substantial health problems are more related to specific body fat compartments, like visceral adipose tissue (VAT. We investigated cortical thickness measures in a group of 72 healthy subjects (BMI range 20–35 kg/m2, age range 19–50 years. Multiple regression analyses were performed using VAT and BMI as predictors and age, gender, total surface area and education as confounds. BMI and VAT were independently associated with reductions in cortical thickness in clusters comprising the left lateral occipital area, the left inferior temporal cortex, and the left precentral and inferior parietal area, while the right insula, the left fusiform gyrus and the right inferior temporal area showed a negative correlation with VAT only. In addition, we could show significant reductions in cortical thickness with increasing VAT adjusted for BMI in the left temporal cortex. We were able to detect widespread cortical thinning in a young to middle-aged population related to BMI and VAT; these findings show close resemblance to studies focusing on GM volume differences in diabetic patients. This may point to the influence of VAT related adverse effects, like low-grade inflammation, as a potentially harmful factor on brain integrity already in individuals at risk of developing diabetes, metabolic syndromes and arteriosclerosis.

Relationship between 8/9-yr-old school children BMI, parents' BMI and educational level: a cross sectional survey

Directory of Open Access Journals (Sweden)

Pilato Valentina

2011-07-01

Full Text Available Abstract Background Parents are responsible not only for the genetic structure of their children, but also for passing onto them their behaviours and attitudes toward life. The aim of this study was to analyse the connection between school-age children's obesity and that of their parents as well as between child obesity and parents' educational level, as a proxy indicator of the socio-economic status (SES of families in Tuscany. Methods The children sample was selected from "OKkio alla Salute 2010" (a cross sectional survey carried out by the Italian Institute of Health and consisted of 1,751 (922 males and 855 females 8-9 year-old school children. Weight and height were measured by ad hoc trained personnel, and Body Mass Index (BMI categories were calculated using Cole et al.'s cut-off. Parents' weight, height and educational level were collected by a self-administered questionnaire. The educational levels were classified as high, medium and low. Results The prevalence of obese children increased along the parents' BMI category: from 1.4% for underweight mothers to 30.3% for obese mothers and from 4% for under-normal-weight fathers to 23.9% for obese fathers (p Conclusion Parents' obesity and the cultural resources of the family, particularly the father's, seem to influence the prevalence of overweight and obesity in Tuscan children.

Women with a BMI ≥ 30kg/m² and their experience of maternity care: A meta ethnographic synthesis.

Science.gov (United States)

Jones, Catriona; Jomeen, Julie

2017-10-01

this paper is a report of a systematic review and meta-ethnography of the experiences of women with body mass index (BMI) ≥ 30kg/m² and their experience of maternity care. systematic review methods identified 12 qualitative studies about women's experiences of maternity care when their BMI ≥ 30kg/m². Findings from the identified studies were synthesised into themes, using metaethnography. SYNTHESIS AND FINDINGS: the meta-ethnography produced four key concepts; Initial encounters, Negotiating risk, Missing out and The positive intervention, which represent the experiences of maternity care for women with BMI ≥ 30kg/m² KEY CONCLUSION: many women with BMI ≥ 30kg/m² appear to be dissatisfied with the approaches taken to discuss weight status during maternity encounters. When weight is not addressed during these encounters women appear to be equally dissatisfied. The absence of open and honest discussions about weight, the feeling of being denied of a normal experience, and an over emphasis on the risks imposed upon pregnancy and childbirth by obesity, leave women feeling dissatisfied and disenfranchised. Sensitive care and practical advice about diet and exercise can help women move towards feeling more in control of their weight management. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

Relationship between BMI and blood pressure in girls and boys.

Science.gov (United States)

Gundogdu, Zuhal

2008-10-01

To investigate the relationship between BMI and blood pressure as this is of crucial interest in evaluating both public health and the clinical impact of the so-called obesity epidemic. Data were gathered from 1899 children aged between 6 and 14 years, analysing and evaluating a possible relationship between BMI and systolic and diastolic blood pressure values for both girls and boys. Each child was classified on the basis of age- and sex-specific BMI percentile as normal weight (<85th percentile), overweight (95th percentile). In comparisons among age BMI percentile groups, systolic and diastolic blood pressure values were higher in obese and overweight groups than in normal weight groups for both sexes. Although BMI among girls was higher than among boys in all three percentile groups, there were no significant differences between sexes with respect to blood pressure values. The present findings emphasize the importance of the prevention of obesity in order to prevent future related problems such as hypertension in children and adolescents.

Identification of GPC2 as an Oncoprotein and Candidate Immunotherapeutic Target in High-Risk Neuroblastoma.

Science.gov (United States)

Bosse, Kristopher R; Raman, Pichai; Zhu, Zhongyu; Lane, Maria; Martinez, Daniel; Heitzeneder, Sabine; Rathi, Komal S; Kendsersky, Nathan M; Randall, Michael; Donovan, Laura; Morrissy, Sorana; Sussman, Robyn T; Zhelev, Doncho V; Feng, Yang; Wang, Yanping; Hwang, Jennifer; Lopez, Gonzalo; Harenza, Jo Lynne; Wei, Jun S; Pawel, Bruce; Bhatti, Tricia; Santi, Mariarita; Ganguly, Arupa; Khan, Javed; Marra, Marco A; Taylor, Michael D; Dimitrov, Dimiter S; Mackall, Crystal L; Maris, John M

2017-09-11

We developed an RNA-sequencing-based pipeline to discover differentially expressed cell-surface molecules in neuroblastoma that meet criteria for optimal immunotherapeutic target safety and efficacy. Here, we show that GPC2 is a strong candidate immunotherapeutic target in this childhood cancer. We demonstrate high GPC2 expression in neuroblastoma due to MYCN transcriptional activation and/or somatic gain of the GPC2 locus. We confirm GPC2 to be highly expressed on most neuroblastomas, but not detectable at appreciable levels in normal childhood tissues. In addition, we demonstrate that GPC2 is required for neuroblastoma proliferation. Finally, we develop a GPC2-directed antibody-drug conjugate that is potently cytotoxic to GPC2-expressing neuroblastoma cells. Collectively, these findings validate GPC2 as a non-mutated neuroblastoma oncoprotein and candidate immunotherapeutic target. Copyright © 2017 Elsevier Inc. All rights reserved.

Self-control mediates the relationship between time perspective and BMI.

Science.gov (United States)

Price, Menna; Higgs, Suzanne; Lee, Michelle

2017-01-01

Trait future time perspective measures the extent to which behaviour is dominated by a striving for future goals and rewards. Trait present time perspective measures orientation towards immediate pleasure. Previous research has explored the relationship between future and present time perspective and BMI with mixed findings. In addition, the psychological mechanism underlying this relationship is unclear. Self-control is a likely candidate, as it has been related to both BMI and time perspective, but the relationship between all of these concepts has not been examined in a single study. Therefore, the aim of this study was to examine if trait self-control mediates the relationship between time perspective (future and present) and BMI. Self-report time perspective (ZTPI), self-control (SCS) and height/weight data were collected using an online survey from a mixed student and community sample (N = 218) with wide ranging age (mean 29, SD 11, range 18-73 years) and BMI (mean 24, SD 4, range 15-43). The results of a structural equation model including both facets of time perspective suggested that the traits are related yet distinct measures that independently predict BMI through changes in self-control. Bootstrap mediation analysis showed that self-control mediated the relationship between both future time perspective (95% CI, -0.10 to -0.02) and present time perspective (95% CI, 0.03 to 0.17), and BMI in opposite directions. Participants with higher future time perspective scores (higher present time perspective scores) had higher (lower) self-control, which predicted lower (higher) BMI. These results are consistent with previous research suggesting an important role for time perspective in health outcomes. Self-control likely mediates the relationship between temporal perspectives and BMI, suggesting that time perspective may be a target for individualised interventions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Is a reduction in distance to nearest supermarket associated with BMI change among type 2 diabetes patients?

Science.gov (United States)

Zhang, Y Tara; Laraia, Barbara A; Mujahid, Mahasin S; Blanchard, Samuel D; Warton, E Margaret; Moffet, Howard H; Karter, Andrew J

2016-07-01

We examined whether residing within 2 miles of a new supermarket opening was longitudinally associated with a change in body mass index (BMI). We identified 12 new supermarkets that opened between 2009 and 2010 in 8 neighborhoods. Using the Kaiser Permanente Northern California Diabetes Registry, we identified members with type 2 diabetes residing continuously in any of these neighborhoods 12 months prior to the first supermarket opening until 10 months following the opening of the last supermarket. Exposure was defined as a reduction (yes/no) in travel distance to the nearest supermarket as a result of a new supermarket opening. First difference regression models were used to estimate the impact of reduced supermarket distance on BMI, adjusting for longitudinal changes in patient and neighborhood characteristics. Among patients in the exposed group, new supermarket openings reduced travel distance to the nearest supermarket by 0.7 miles on average. However, reduced distance to nearest supermarket was not associated with BMI changes. Overall, we found no evidence that reduced supermarket distance was associated with reduced levels of obesity for residents with type 2 diabetes. Published by Elsevier Ltd.