WorldWideScience

Sample records for bmi1 oncoprotein identifies

  1. The oncoprotein and stem cell renewal factor BMI1 associates with poor clinical outcome in oesophageal cancer patients undergoing preoperative chemoradiotherapy

    Directory of Open Access Journals (Sweden)

    Yoshikawa Reigetsu

    2012-10-01

    Full Text Available Abstract Background The polycomb group (PcG family BMI1, acting downstream of the hedgehog (Hh pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated that Hh signalling activation can predict very earlier relapse of oesophageal cancers. As data were not available on the clinical role of BMI1 expression in oesophageal cancers after chemoradiotherapy (CRT, we analysed whether it could be also used to predict disease progression and prognosis in oesophageal cancer patients undergoing trimodality therapy of preoperative CRT and oesophagectomy. Methods Expressions of BMI1 and p16INK4A, a downstream target of PcG, were analysed in 78 patients with histologically confirmed oesophageal squamous cell carcinoma (ESCC after preoperative CRT by immunohistochemical staining. The association of BMI1 and p16INK4A expression with clinicopathologic characteristics was analysed by χ2-test. Survival analysis was carried out by the log-rank test using Kaplan-Meier method. Results Among 78 ESCC patients, 24 patients (30.8% showed BMI1 positivity, mainly localised in the nuclei of tumour cells. Patients harbouring BMI1-positive tumour cells showed significantly poorer prognoses than those without such cells or residual tumours (mean disease-free survival (DFS time 16.8 vs 71.2 months; 3-yr DFS 13.3% vs 49.9%, P=0.002; mean OS time 21.8 vs 76.6 months; 3-yr OS 16.2% vs 54.9%, P=0.0005. There was no significant correlation between p16INK4A expression and BMI1 expression. Conclusions Our study shows that BMI1 expression is a predictor of early relapse and poor prognosis in ESCC after CRT. These findings suggest that BMI1 signal activation might be involved in promoting cancer regrowth and progression after CRT, and might be indicative of emergence of ‘more aggressive’ cancer progenitor cells.

  2. BMI-1, a promising therapeutic target for human cancer

    Science.gov (United States)

    WANG, MIN-CONG; LI, CHUN-LI; CUI, JIE; JIAO, MIN; WU, TAO; JING, LI; NAN, KE-JUN

    2015-01-01

    BMI-1 oncogene is a member of the polycomb-group gene family and a transcriptional repressor. Overexpression of BMI-1 has been identified in various human cancer tissues and is known to be involved in cancer cell proliferation, cell invasion, distant metastasis, chemosensitivity and patient survival. Accumulating evidence has revealed that BMI-1 is also involved in the regulation of self-renewal, differentiation and tumor initiation of cancer stem cells (CSCs). However, the molecular mechanisms underlying these biological processes remain unclear. The present review summarized the function of BMI-1 in different human cancer types and CSCs, and discussed the signaling pathways in which BMI-1 is potentially involved. In conclusion, BMI-1 may represent a promising target for the prevention and therapy of various cancer types. PMID:26622537

  3. MK3 modulation affects BMI1-dependent and independent cell cycle check-points.

    Directory of Open Access Journals (Sweden)

    Peggy Prickaerts

    Full Text Available Although the MK3 gene was originally found deleted in some cancers, it is highly expressed in others. The relevance of MK3 for oncogenesis is currently not clear. We recently reported that MK3 controls ERK activity via a negative feedback mechanism. This prompted us to investigate a potential role for MK3 in cell proliferation. We here show that overexpression of MK3 induces a proliferative arrest in normal diploid human fibroblasts, characterized by enhanced expression of replication stress- and senescence-associated markers. Surprisingly, MK3 depletion evokes similar senescence characteristics in the fibroblast model. We previously identified MK3 as a binding partner of Polycomb Repressive Complex 1 (PRC1 proteins. In the current study we show that MK3 overexpression results in reduced cellular EZH2 levels and concomitant loss of epigenetic H3K27me3-marking and PRC1/chromatin-occupation at the CDKN2A/INK4A locus. In agreement with this, the PRC1 oncoprotein BMI1, but not the PCR2 protein EZH2, bypasses MK3-induced senescence in fibroblasts and suppresses P16INK4A expression. In contrast, BMI1 does not rescue the MK3 loss-of-function phenotype, suggesting the involvement of multiple different checkpoints in gain and loss of MK3 function. Notably, MK3 ablation enhances proliferation in two different cancer cells. Finally, the fibroblast model was used to evaluate the effect of potential tumorigenic MK3 driver-mutations on cell proliferation and M/SAPK signaling imbalance. Taken together, our findings support a role for MK3 in control of proliferation and replicative life-span, in part through concerted action with BMI1, and suggest that the effect of MK3 modulation or mutation on M/SAPK signaling and, ultimately, proliferation, is cell context-dependent.

  4. The Role of BMI1 in CRPC

    Science.gov (United States)

    2017-10-01

    that inhibiting BMI1 decreased prostate cancer tumor growth in VCaP murine xenograft. 15. SUBJECT TERMS: Polycomb, BMI1, Androgen Receptor ...Repressive Complex, Androgen Receptor , Castration- Resistant Prostate Cancer , small molecule inhibitor 4 ACCOMPLISHMENTS A. What were the major...Qi Cao. A Novel Role of BMI1 in Androgen Receptor Pathway. 23rd Prostate Cancer Foundation Annual Scientific Retreat, Oct 26-29, 2016, Carlsbad, CA

  5. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    International Nuclear Information System (INIS)

    Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng

    2012-01-01

    The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic

  6. The Role of BMI1 in CRPC

    Science.gov (United States)

    2016-10-01

    we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of

  7. The Bmi-1 helix–turn and ring finger domains are required for Bmi-1 antagonism of (–) epigallocatechin-3-gallate suppression of skin cancer cell survival

    Science.gov (United States)

    Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.

    2016-01-01

    The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776

  8. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    Directory of Open Access Journals (Sweden)

    Jiang Lili

    2012-09-01

    Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF

  9. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  10. Convergence of BMI1 and CHD7 on ERK Signaling in Medulloblastoma

    Directory of Open Access Journals (Sweden)

    Sara Badodi

    2017-12-01

    Full Text Available Summary: We describe molecular convergence between BMI1 and CHD7 in the initiation of medulloblastoma. Identified in a functional genomic screen in mouse models, a BMI1High;CHD7Low expression signature within medulloblastoma characterizes patients with poor overall survival. We show that BMI1-mediated repression of the ERK1/2 pathway leads to increased proliferation and tumor burden in primary human MB cells and in a xenograft model, respectively. We provide evidence that repression of the ERK inhibitor DUSP4 by BMI1 is dependent on a more accessible chromatin configuration in G4 MB cells with low CHD7 expression. These findings extend current knowledge of the role of BMI1 and CHD7 in medulloblastoma pathogenesis, and they raise the possibility that pharmacological targeting of BMI1 or ERK may be particularly indicated in a subgroup of MB with low expression levels of CHD7. : Badodi et al. find convergence of the chromatin modifiers BMI1 and CHD7 in medulloblastoma pathogenesis, and they show that this pathway regulates tumor proliferation and growth via ERK signaling. Keywords: BMI1, CHD7, DUSP4, ERK, medulloblastoma, PcG genes, mouse models, epigenetics, chromatin

  11. Analysis list: BMI1 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie

  12. Cardiac Bmi1(+) cells contribute to myocardial renewal in the murine adult heart.

    Science.gov (United States)

    Valiente-Alandi, Iñigo; Albo-Castellanos, Carmen; Herrero, Diego; Arza, Elvira; Garcia-Gomez, Maria; Segovia, José C; Capecchi, Mario; Bernad, Antonio

    2015-10-26

    The mammalian adult heart maintains a continuous, low cardiomyocyte turnover rate throughout life. Although many cardiac stem cell populations have been studied, the natural source for homeostatic repair has not yet been defined. The Polycomb protein BMI1 is the most representative marker of mouse adult stem cell systems. We have evaluated the relevance and role of cardiac Bmi1 (+) cells in cardiac physiological homeostasis. Bmi1 (CreER/+);Rosa26 (YFP/+) (Bmi1-YFP) mice were used for lineage tracing strategy. After tamoxifen (TM) induction, yellow fluorescent protein (YFP) is expressed under the control of Rosa26 regulatory sequences in Bmi1 (+) cells. These cells and their progeny were tracked by FACS, immunofluorescence and RT-qPCR techniques from 5 days to 1 year. FACS analysis of non-cardiomyocyte compartment from TM-induced Bmi1-YFP mice showed a Bmi1 (+)-expressing cardiac progenitor cell (Bmi1-CPC: B-CPC) population, SCA-1 antigen-positive (95.9 ± 0.4 %) that expresses some stemness-associated genes. B-CPC were also able to differentiate in vitro to the three main cardiac lineages. Pulse-chase analysis showed that B-CPC remained quite stable for extended periods (up to 1 year), which suggests that this Bmi1 (+) population contains cardiac progenitors with substantial self-maintenance potential. Specific immunostaining of Bmi1-YFP hearts serial sections 5 days post-TM induction indicated broad distribution of B-CPC, which were detected in variably sized clusters, although no YFP(+) cardiomyocytes (CM) were detected at this time. Between 2 to 12 months after TM induction, YFP(+) CM were clearly identified (3 ± 0.6 % to 6.7 ± 1.3 %) by immunohistochemistry of serial sections and by flow cytometry of total freshly isolated CM. B-CPC also contributed to endothelial and smooth muscle (SM) lineages in vivo. High Bmi1 expression identifies a non-cardiomyocyte resident cardiac population (B-CPC) that contributes to the main lineages of the heart in

  13. Bmi-1: At the crossroads of physiological and pathological biology

    Science.gov (United States)

    Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar

    2015-01-01

    Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339

  14. BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.

    Science.gov (United States)

    Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan

    2006-01-01

    Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.

  15. miR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)

    2015-01-02

    Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.

  16. BMI-1 targeting interferes with patient-derived tumor-initiating cell survival and tumor growth in prostate cancer

    Science.gov (United States)

    Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.

    2016-01-01

    Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599

  17. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  18. Phosphorylation of Nanog is Essential to Regulate Bmi1 and Promote Tumorigenesis

    Science.gov (United States)

    Xie, Xiujie; Piao, Longzhu; Cavey, Greg S.; Old, Matthew; Teknos, Theodoros N.; Mapp, Anna K; Pan, Quintin

    2014-01-01

    Emerging evidence indicates that Nanog is intimately involved in tumorigenesis in part through regulation of the cancer initiating cell population. However, the regulation and role of Nanog in tumorigenesis are still poorly understood. In this study, human Nanog was identified to be phosphorylated by human PKCε at multiple residues including T200 and T280. Our work indicated that phosphorylation at T200 and T280 modulates Nanog function through several regulatory mechanisms. Results with phosphorylation-insensitive and phosphorylation-mimetic mutant Nanog revealed that phosphorylation at T200 and T280 enhance Nanog protein stability. Moreover, phosphorylation-insensitive T200A and T280A mutant Nanog had a dominant-negative function to inhibit endogenous Nanog transcriptional activity. Inactivation of Nanog was due to impaired homodimerization, DNA binding, promoter occupancy, and p300, a transcriptional co-activator, recruitment resulting in a defect in target gene promoter activation. Ectopic expression of phosphorylation-insensitive T200A or T280A mutant Nanog reduced cell proliferation, colony formation, invasion, migration, and the cancer initiating cell population in head and neck squamous cell carcinoma (HNSCC) cells. The in vivo cancer initiating ability was severely compromised in HNSCC cells expressing phosphorylation-insensitive T200A or T280A mutant Nanog; 87.5% (14/16), 12.5% (1/8), and 0% (0/8) for control, T200A, and T280A, respectively. Nanog occupied the Bmi1 promoter to directly transactivate and regulate Bmi1. Genetic ablation and rescue experiments demonstrated that Bmi1 is a critical downstream signaling node for the pleiotropic, pro-oncogenic effects of Nanog. Taken together, our study revealed, for the first time, that post-translational phosphorylation of Nanog is essential to regulate Bmi1 and promote tumorigenesis. PMID:23708658

  19. Bmi1 regulates murine intestinal stem cell proliferation and self-renewal downstream of Notch.

    Science.gov (United States)

    López-Arribillaga, Erika; Rodilla, Verónica; Pellegrinet, Luca; Guiu, Jordi; Iglesias, Mar; Roman, Angel Carlos; Gutarra, Susana; González, Susana; Muñoz-Cánoves, Pura; Fernández-Salguero, Pedro; Radtke, Freddy; Bigas, Anna; Espinosa, Lluís

    2015-01-01

    Genetic data indicate that abrogation of Notch-Rbpj or Wnt-β-catenin pathways results in the loss of the intestinal stem cells (ISCs). However, whether the effect of Notch is direct or due to the aberrant differentiation of the transit-amplifying cells into post-mitotic goblet cells is unknown. To address this issue, we have generated composite tamoxifen-inducible intestine-specific genetic mouse models and analyzed the expression of intestinal differentiation markers. Importantly, we found that activation of β-catenin partially rescues the differentiation phenotype of Rbpj deletion mutants, but not the loss of the ISC compartment. Moreover, we identified Bmi1, which is expressed in the ISC and progenitor compartments, as a gene that is co-regulated by Notch and β-catenin. Loss of Bmi1 resulted in reduced proliferation in the ISC compartment accompanied by p16(INK4a) and p19(ARF) (splice variants of Cdkn2a) accumulation, and increased differentiation to the post-mitotic goblet cell lineage that partially mimics Notch loss-of-function defects. Finally, we provide evidence that Bmi1 contributes to ISC self-renewal. © 2015. Published by The Company of Biologists Ltd.

  20. Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway

    Science.gov (United States)

    Liu, Jiaguo; Luo, Bin; Zhao, Meng

    2017-01-01

    Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587

  1. BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.

    Science.gov (United States)

    Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian

    2010-02-21

    The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.

  2. File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...

  3. File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...

  4. File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...

  5. File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...

  6. File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...

  7. File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...

  8. File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...

  9. File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...

  10. File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...

  11. File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...

  12. File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...

  13. Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion

    NARCIS (Netherlands)

    Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.

    2008-01-01

    Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in

  14. Co-Expression of Bmi-1 and Podoplanin Predicts Overall Survival in Patients With Squamous Cell Carcinoma of the Head and Neck Treated With Radio(chemo)therapy

    International Nuclear Information System (INIS)

    Vormittag, Laurenz; Thurnher, Dietmar; Geleff, Silvana; Pammer, Johannes; Heiduschka, Gregor; Brunner, Markus; Grasl, Matthaeus Ch.; Erovic, Boban M.

    2009-01-01

    Purpose: This study was conducted to determine the expression of Bmi-1 and podoplanin in healthy oral mucosa and in untreated tumor tissues samples of patients with squamous cell carcinomas of the head and neck. All patients were treated by primary radio(chemo)therapy. Methods and Materials: The expression of Bmi-1 and podoplanin was immunohistochemically evaluated in 12 normal oral mucosa and 63 tumor specimens and correlated with patients' clinical data. Results: In healthy mucosa expression of Bmi-1 and podoplanin was restricted to the basal cell layer. Expression of both proteins was found in 79% and 86% of our tumor samples, respectively. In 17 and 8 samples, Bmi-1 and podoplanin were co-expressed at the invasive border or diffuse in the bulk of the tumor, respectively. Univariate analysis showed that the co-expression of Bmi-1 and podoplanin correlated to decreased overall survival (p = 0.044). Moreover, multivariate testing identified high expression of podoplanin (p = 0.044), co-expression of Bmi-1 and podoplanin (p = 0.007) and lack of response to therapy (p < 0.0001) as predictors of shortened overall survival in patients treated with primary radio(chemo)therapy. Conclusions: Bmi-1 and podoplanin are expressed at the invasive front of squamous cell carcinomas of the head and neck. Co-expression of Bmi-1 and podoplanin predicts significantly overall survival of patients treated with primary radio(chemo)therapy

  15. Expression of Bmi-1 is a prognostic marker in bladder cancer

    Directory of Open Access Journals (Sweden)

    Xu Li-Hua

    2009-02-01

    Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.

  16. Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients

    Directory of Open Access Journals (Sweden)

    Xiaodong Li

    2016-11-01

    Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.

  17. Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma

    International Nuclear Information System (INIS)

    Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua

    2010-01-01

    Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis

  18. Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion

    Directory of Open Access Journals (Sweden)

    Lowell Evan Michael

    2008-12-01

    Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.

  19. Expression of Bmi-1 is a prognostic marker in bladder cancer

    International Nuclear Information System (INIS)

    Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing

    2009-01-01

    The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer

  20. Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.

    Science.gov (United States)

    Lu, You-Wei; Li, Jin; Guo, Wei-Jian

    2010-11-08

    The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.

  1. BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.

    Science.gov (United States)

    Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili

    2017-12-01

    Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.

  2. GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.

    Directory of Open Access Journals (Sweden)

    Bart A Westerman

    Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.

  3. Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.

  4. Bmi-1 expression modulates non-small cell lung cancer progression

    Science.gov (United States)

    Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua

    2015-01-01

    Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371

  5. BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

    Directory of Open Access Journals (Sweden)

    Mehdi Hayat Shahi

    Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

  6. BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.

    Science.gov (United States)

    Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B

    2015-01-01

    BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.

  7. Bmi1 confers resistance to oxidative stress on hematopoietic stem cells.

    Directory of Open Access Journals (Sweden)

    Shunsuke Nakamura

    Full Text Available The polycomb-group (PcG proteins function as general regulators of stem cells. We previously reported that retrovirus-mediated overexpression of Bmi1, a gene encoding a core component of polycomb repressive complex (PRC 1, maintained self-renewing hematopoietic stem cells (HSCs during long-term culture. However, the effects of overexpression of Bmi1 on HSCs in vivo remained to be precisely addressed.In this study, we generated a mouse line where Bmi1 can be conditionally overexpressed under the control of the endogenous Rosa26 promoter in a hematopoietic cell-specific fashion (Tie2-Cre;R26Stop(FLBmi1. Although overexpression of Bmi1 did not significantly affect steady state hematopoiesis, it promoted expansion of functional HSCs during ex vivo culture and efficiently protected HSCs against loss of self-renewal capacity during serial transplantation. Overexpression of Bmi1 had no effect on DNA damage response triggered by ionizing radiation. In contrast, Tie2-Cre;R26Stop(FLBmi1 HSCs under oxidative stress maintained a multipotent state and generally tolerated oxidative stress better than the control. Unexpectedly, overexpression of Bmi1 had no impact on the level of intracellular reactive oxygen species (ROS.Our findings demonstrate that overexpression of Bmi1 confers resistance to stresses, particularly oxidative stress, onto HSCs. This thereby enhances their regenerative capacity and suggests that Bmi1 is located downstream of ROS signaling and negatively regulated by it.

  8. The associations of Bmi-1 with progression of glomerular chronic kidney disease
.

    Science.gov (United States)

    Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren

    2018-02-01

    Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings.
.

  9. Evaluation of potential prognostic value of Bmi-1 gene product and selected markers of proliferation (Ki-67 and apoptosis (p53 in the neuroblastoma group of tumors

    Directory of Open Access Journals (Sweden)

    Katarzyna Taran

    2016-02-01

    Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.

  10. p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells

    Science.gov (United States)

    Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah

    2015-01-01

    Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797

  11. Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency

    Directory of Open Access Journals (Sweden)

    Anthony Flamier

    2018-05-01

    Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.

  12. Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.

    Science.gov (United States)

    Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori

    2017-04-01

    We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  13. Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance

    Science.gov (United States)

    Jin, Jianliang; Lv, Xianhui; Chen, Lulu; Zhang, Wei; Li, Jinbo; Wang, Qian; Wang, Rong; Lu, Xiang; Miao, Dengshun

    2014-01-01

    To determine whether Bmi-1 deficiency could lead to renal tubulointerstitial injury by mitochondrial dysfunction and increased oxidative stress in the kidney, 3-week-old Bmi-1-/- mice were treated with the antioxidant N-acetylcysteine (NAC, 1 mg mL−1) in their drinking water, or pyrro-quinoline quinone (PQQ, 4 mg kg−1 diet) in their diet for 2 weeks, and their renal phenotypes were compared with vehicle-treated Bmi1-/- and wild-type mice. Bmi-1 was knocked down in human renal proximal tubular epithelial (HK2) cells which were treated with 1 mm NAC for 72 or 96 h, and their phenotypes were compared with control cells. Five-week-old vehicle-treated Bmi-1-/- mice displayed renal interstitial fibrosis, tubular atrophy, and severe renal function impairment with decreased renal cell proliferation, increased renal cell apoptosis and senescence, and inflammatory cell infiltration. Impaired mitochondrial structure, decreased mitochondrial numbers, and increased oxidative stress occurred in Bmi-1-/- mice; subsequently, this caused DNA damage, the activation of TGF-β1/Smad signaling, and the imbalance between extracellular matrix synthesis and degradation. Oxidative stress-induced epithelial-to-mesenchymal transition of renal tubular epithelial cells was enhanced in Bmi-1 knocked down HK2 cells. All phenotypic alterations caused by Bmi-1 deficiency were ameliorated by antioxidant treatment. These findings indicate that Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance and will be a novel therapeutic target for preventing renal tubulointerstitial injury. PMID:24915841

  14. Attenuation of doxorubicin-induced cardiotoxicity by esculetin through modulation of Bmi-1 expression.

    Science.gov (United States)

    Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan

    2017-09-01

    The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.

  15. Reciprocal expression of Bmi1 and Mel-18 is associated with functioning of primitive hematopoietic cells.

    Science.gov (United States)

    Kajiume, Teruyuki; Ohno, Norioki; Sera, Yasuhiko; Kawahara, Yumi; Yuge, Louis; Kobayashi, Masao

    2009-07-01

    The Polycomb-group (PcG) genes regulate global gene expression in many biological processes, including hematopoiesis, by manipulating specific target genes. It is known that various PcG genes regulate self-renewal of hematopoietic stem cells (HSCs). Here we have shown that the reciprocal expression of PcG proteins regulates self-renewal and differentiation of HSCs. We used murine and human bone marrow cells and evaluated the reciprocal expression of PcG proteins on the basis of their respective intranuclear distributions. PcG-gene expression in HSCs was knocked down by small interfering RNAs. The function of each gene in HSCs was analyzed in vitro and in vivo. Cells were either Bmi1-positive or Mel-18-positive. The Bmi1-positive cells contained very little amounts of Mel-18 and vice versa. The bmi1-knockdown marrow cells did not show HSC function, while the mel-18-knockdown marrow cells showed increased stem cell function. Results of the analysis on human cells were similar to those observed in case of murine cells. In a clinical investigation, transplantation using sources with a low Bmi1 to Mel-18 ratio was associated with early hematopoietic recovery. Reciprocal expression of Bmi1 and Mel-18 regulated HSC function. Here, we observed that expression of the PcG genes-bmi1 and mel-18-is correlated with self-renewal and differentiation of HSCs. Thus, it was suggested that the balance between Bmi1 and Mel-18 regulates self-renewal of HSCs.

  16. Polycomb complex protein BMI-1 promotes invasion and metastasis of pancreatic cancer stem cells by activating PI3K/AKT signaling, an ex vivo, in vitro, and in vivo study

    Science.gov (United States)

    Wang, Min-Cong; Jiao, Min; Wu, Tao; Jing, Li; Cui, Jie; Guo, Hui; Tian, Tao; Ruan, Zhi-ping; Wei, Yong-Chang; Jiang, Li-Li; Sun, Hai-Feng; Huang, Lan-Xuan; Nan, Ke-Jun; Li, Chun-Li

    2016-01-01

    Cancer stem cell theory indicates cancer stem cells are the key to promote tumor invasion and metastasis. Studies showed that BMI-1 could promote self-renew, differentiation and tumor formation of CSCs and invasion/metastasis of human cancer. However, whether BMI-1 could regulate invasion and metastasis ability of CSCs is still unclear. In our study, we found that up-regulated expression of BMI-1 was associated with tumor invasion, metastasis and poor survival of pancreatic cancer patients. CD133+ cells were obtained by using magnetic cell sorting and identified of CSCs properties such as self-renew, multi-differentiation and tumor formation ability. Then, we found that BMI-1 expression was up-regulated in pancreatic cancer stem cells. Knockdown of BMI-1 expression attenuated invasion ability of pancreatic cancer stem cells in Transwell system and liver metastasis capacity in nude mice which were injected CSCs through the caudal vein. We are the first to reveal that BMI-1 could promote invasion and metastasis ability of pancreatic cancer stem cells. Finally, we identified that BMI-1 expression activating PI3K/AKT singing pathway by negative regulating PTEN was the main mechanism of promoting invasion and metastasis ability of pancreatic CSCs. In summary, our findings indicate that BMI-1 could be used as the therapeutic target to inhibiting CSCs-mediated pancreatic cancer metastasis. PMID:26840020

  17. Induction of neural stem cell-like cells (NSCLCs) from mouse astrocytes by Bmi1

    International Nuclear Information System (INIS)

    Moon, Jai-Hee; Yoon, Byung Sun; Kim, Bona; Park, Gyuman; Jung, Hye-Youn; Maeng, Isaac; Jun, Eun Kyoung; Yoo, Seung Jun; Kim, Aeree; Oh, Sejong; Whang, Kwang Youn; Kim, Hyunggee; Kim, Dong-Wook; Kim, Ki Dong; You, Seungkwon

    2008-01-01

    Recently, Bmi1 was shown to control the proliferation and self-renewal of neural stem cells (NSCs). In this study, we demonstrated the induction of NSC-like cells (NSCLCs) from mouse astrocytes by Bmi1 under NSC culture conditions. These NSCLCs exhibited the morphology and growth properties of NSCs, and expressed NSC marker genes, including nestin, CD133, and Sox2. In vitro differentiation of NSCLCs resulted in differentiated cell populations containing astrocytes, neurons, and oligodendrocytes. Following treatment with histone deacetylase inhibitors (trichostatin A and valproic acid), the potential of NSCLCs for proliferation, dedifferentiation, and self-renewal was significantly inhibited. Our data indicate that multipotent NSCLCs can be generated directly from astrocytes by the addition of Bmi1

  18. CD133 and BMI1 expressions and its prognostic role in primary ...

    Indian Academy of Sciences (India)

    This study aimed to analyse the expression of CD133 mRNA and its correlations ... CD133 mRNA and BMI1 protein expression could independently predict the glioblastoma .... treatment at the National Institute of Mental Health and Neu- .... Low. 16 (76.2). High. 53 mutations of which 38 were exonic and 15 were intronic.

  19. EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer

    NARCIS (Netherlands)

    Pietersen, Alexandra M.; Horlings, Hugo M.; Hauptmann, Michael; Langerod, Anita; Ajouaou, Abderrahim; Cornelissen-Steijger, Paulien; Wessels, Lodewijk F.; Jonkers, Jos; van de Vijver, Marc J.; van Lohuizen, Maarten

    2008-01-01

    Introduction PolycombGroup (PcG) proteins maintain gene repression through histone modifications and have been implicated in stem cell regulation and cancer. EZH2 is part of Polycomb Repressive Complex 2 (PRC2) and trimethylates H3K27. This histone mark recruits the BMI1-containing PRC1 that

  20. Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

    Science.gov (United States)

    Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

    2016-01-01

    Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

  1. Fuel shipment experience, fuel movements from the BMI-1 transport cask

    International Nuclear Information System (INIS)

    Bauer, Thomas L.; Krause, Michael G.

    1986-01-01

    The University of Texas at Austin received two shipments of irradiated fuel elements from Northrup Aircraft Corporation on April 11 and 16, 1985. A total of 59 elements consisting of standard and instrumented TRIGA fuel were unloaded from the BMI-1 shipping cask. At the time of shipment, the Northrup core burnup was approximately 50 megawatt days with fuel element radiation levels, after a cooling time of three months, of approximately 1.75 rem/hr at 3 feet. In order to facilitate future planning of fuel shipment at the UT facility and other facilities, a summary of the recent transfer process including several factors which contributed to its success are presented. Numerous color slides were made of the process for future reference by UT and others involved in fuel transfer and handling of the BMI-1 cask

  2. Bmi-1 promotes invasion and metastasis, and its elevated expression is correlated with an advanced stage of breast cancer

    Science.gov (United States)

    2011-01-01

    Background B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) acts as an oncogene in various tumors, and its overexpression correlates with a poor outcome in several human cancers. Ectopic expression of Bmi-1 can induce epithelial-mesenchymal transition (EMT) and enhance the motility and invasiveness of human nasopharyngeal epithelial cells (NPECs), whereas silencing endogenous Bmi-1 expression can reverse EMT and reduce the metastatic potential of nasopharyngeal cancer cells (NPCs). Mouse xenograft studies indicate that coexpression of Bmi-1 and H-Ras in breast cancer cells can induce an aggressive and metastatic phenotype with an unusual occurrence of brain metastasis; although, Bmi-1 overexpression did not result in oncogenic transformation of MCF-10A cells. However, the underlying molecular mechanism of Bmi-1-mediated progression and the metastasis of breast cancer are not fully elucidated at this time. Results Bmi-1 expression is more pronouncedly increased in primary cancer tissues compared to matched adjacent non-cancerous tissues. High Bmi-1 expression is correlated with advanced clinicopathologic classifications (T, N, and M) and clinical stages. Furthermore, a high level of Bmi-1 indicates an unfavorable overall survival and serves as a high risk marker for breast cancer. In addition, inverse transcriptional expression levels of Bmi-1 and E-cadherin are detected between the primary cancer tissues and the matched adjacent non-cancerous tissues. Higher Bmi-1 levels are found in the cancer tissue, whereas the paired adjacent non-cancer tissue shows higher E-cadherin levels. Overexpression of Bmi-1 increases the motility and invasive properties of immortalized human mammary epithelial cells, which is concurrent with the increased expression of mesenchymal markers, the decreased expression of epithelial markers, the stabilization of Snail and the dysregulation of the Akt/GSK3β pathway. Consistent with these observations, the repression of Bmi

  3. Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells.

    Science.gov (United States)

    Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

    2017-01-22

    The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 -/- ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Bmi1 overexpression in the cerebellar granule cell lineage of mice affects cell proliferation and survival without initiating medulloblastoma formation

    Directory of Open Access Journals (Sweden)

    Hourinaz Behesti

    2013-01-01

    BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.

  5. Bmi-1 plays a critical role in the protection from acute tubular necrosis by mobilizing renal stem/progenitor cells

    International Nuclear Information System (INIS)

    Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang

    2017-01-01

    The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 −/− ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN.

  6. BMI-1 suppression increases the radiosensitivity of oesophageal carcinoma via the PI3K/Akt signaling pathway.

    Science.gov (United States)

    Yang, Xing-Xiao; Ma, Ming; Sang, Mei-Xiang; Zhang, Xue-Yuan; Liu, Zhi-Kun; Song, Heng; Zhu, Shu-Chai

    2018-02-01

    B-cell‑specific Moloney murine leukaemia virus integration site-1 (BMI-1) contributes to the growth of tumour cells post-irradiation (IR). The aim of the present study was to characterize the effects of BMI-1 on cell viability, radiosensitivity and its mechanisms of action in oesophageal squamous cell cancer (ESCC). Western blotting and immunohistochemistry were employed to evaluate the protein expression of BMI-1 in ESCC cells and specimens, respectively. Additionally, the protein expression levels of BMI-1, H2AK119ub and γH2AX in ESCC cells were detected following different doses of IR and at different times after IR. The protein expression levels of MDC1 and 53BP1 were also measured. Flow cytometry and MTT assays were used to determine cell cycle progression, apoptosis and cell viability. The phosphatidylinositol 3-kinase inhibitor LY294002 and the agonist IGF-1 were employed to suppress or induce the phosphorylation of Akt to determine whether BMI-1 induces radioresistance in ESCC cells via activation of the PI3K/Akt pathway. The expression of BMI-1 was higher in ESCC tissues and cells compared with that in normal oesophageal tissues and cells. In addition, BMI-1 was positively related to tumour size and lymph node metastases and negatively to the overall survival of ESCC patients. IR induced the expression of BMI-1, H2AK119ub and γH2AX in a dose- and time-dependent manner. BMI-1 knockdown lowered the expression of γH2AX, MDC1 and 53BP1, suppressed cell viability and increased radiosensitivity. G2/M phase arrest was eliminated; this was followed by an increased proportion of cells entering the G0/G1 phase after IR and BMI-1 knockdown via the upregulation of P16 and downregulation of cyclin D2 and cyclin-dependent kinase-4. Moreover, BMI-1 knockdown increased cell apoptosis, downregulated MCL-1 and p-Akt and upregulated Bax. Additionally, the inhibitory effect of the downregulation of p-Akt by LY294002 on tumour cell viability was identical to that of

  7. Cisplatin Induces Bmi-1 and Enhances the Stem Cell Fraction in Head and Neck Cancer

    Directory of Open Access Journals (Sweden)

    Carolina Nör

    2014-02-01

    Full Text Available Recent evidence has unveiled a subpopulation of highly tumorigenic, multipotent cells capable of self-renewal in head and neck squamous cell carcinomas (HNSCCs. These unique cells, named here cancer stem cells (CSCs, proliferate slowly and might be involved in resistance to conventional chemotherapy. We have shown that CSCs are found in perivascular niches and rely on endothelial cell-secreted factors [particularly interleukin-6 (IL-6] for their survival and self-renewal in HNSCC. Here, we hypothesized that cisplatin enhances the stem cell fraction in HNSCC. To address this hypothesis, we generated xenograft HNSCC tumors with University of Michigan-squamous cell carcinoma 22B (UM-SCC-22B cells and observed that cisplatin treatment increased (P = .0013 the fraction of CSCs [i.e., aldehyde dehydrogenase activity high and cluster of differentiation 44 high (ALDHhighCD44high]. Cisplatin promoted self-renewal and survival of CSCs in vitro, as seen by an increase in the number of orospheres in ultralow attachment plates and induction in B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1 and octamer-binding transcription factor 4 expression. Cisplatin-resistant cells expressed more Bmi-1 than cisplatinsensitive cells. IL-6 potentiated cisplatin-induced orosphere formation generated when primary human HNSCC cells were sorted for ALDHhighCD44high immediately after surgery and plated onto ultralow attachment plates. IL-6-induced signal transducer and activator of transcription 3 (STAT3 phosphorylation (indicative of stemness was unaffected by treatment with cisplatin in UM-SCC-22B cells, whereas IL-6-induced extracellular signal-regulated kinase (ERK phosphorylation (indicative of differentiation processes was partially inhibited by cisplatin. Notably, cisplatin-induced Bmi-1 was inhibited by interleukin-6 receptor blockade in parental and cisplatin-resistant cells. Taken together, these results demonstrate that cisplatin enhances the fraction of CSCs

  8. Overexpression of microRNA-132 enhances the radiosensitivity of cervical cancer cells by down-regulating Bmi-1.

    Science.gov (United States)

    Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan

    2017-10-06

    We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.

  9. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  10. Anti-aging Effect of Transplanted Amniotic Membrane Mesenchymal Stem Cells in a Premature Aging Model of Bmi-1 Deficiency

    Science.gov (United States)

    Xie, Chunfeng; Jin, Jianliang; Lv, Xianhui; Tao, Jianguo; Wang, Rong; Miao, Dengshun

    2015-01-01

    To determine whether transplanted amniotic membrane mesenchymal stem cells (AMSCs) ameliorated the premature senescent phenotype of Bmi-1-deficient mice, postnatal 2-day-old Bmi-1−/− mice were injected intraperitoneally with the second-passage AMSCs from amniotic membranes of β-galactosidase (β-gal) transgenic mice or wild-type (WT) mice labeled with DiI. Three reinjections were given, once every seven days. Phenotypes of 5-week-old β-gal+ AMSC-transplanted or 6-week-old DiI+ AMSC-transplanted Bmi-1−/− mice were compared with vehicle-transplanted Bmi-1−/− and WT mice. Vehicle-transplanted Bmi-1−/− mice displayed growth retardation and premature aging with decreased cell proliferation and increased cell apoptosis; a decreased ratio and dysmaturity of lymphocytic series; premature osteoporosis with reduced osteogenesis and increased adipogenesis; redox imbalance and DNA damage in multiple organs. Transplanted AMSCs carried Bmi-1 migrated into multiple organs, proliferated and differentiated into multiple tissue cells, promoted growth and delayed senescence in Bmi-1−/− transplant recipients. The dysmaturity of lymphocytic series were ameliorated, premature osteoporosis were rescued by promoting osteogenesis and inhibiting adipogenesis, the oxidative stress and DNA damage in multiple organs were inhibited by the AMSC transplantation in Bmi-1−/− mice. These findings indicate that AMSC transplantation ameliorated the premature senescent phenotype of Bmi-1-deficient mice and could be a novel therapy to delay aging and prevent aging-associated degenerative diseases. PMID:26370922

  11. Nucleosome acidic patch promotes RNF168- and RING1B/BMI1-dependent H2AX and H2A ubiquitination and DNA damage signaling.

    Directory of Open Access Journals (Sweden)

    Justin W Leung

    2014-03-01

    Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.

  12. Expression of Bmi-1, P16, and CD44v6 in Uterine Cervical Carcinoma and Its Clinical Significance

    International Nuclear Information System (INIS)

    Weng, Mei-ying; Li, Lin; Feng, Shu-ying; Hong, Shun-jia

    2012-01-01

    Bmi-1, a putative proto-oncogene, is a core member of the polycomb gene family, which is expressed in many human tumors. The p16 protein negatively regulated cell proliferation, whereas CD44v6 is associated with proliferation as an important protein. Additionally, CD44v6 is an important nuclear antigen closely correlated to tumor metastasis. The present study aims to investigate the expression and significance of Bmi-1, p16, and CD44v6 in uterine cervical carcinoma (UCC). A total of 62 UCC, 30 cervical neoplasic, and 20 normal cervical mucosal tissues were used in the current study. The expression of Bmi-1, p16, and CD44v6 in these tissues was determined using immunohistochemical assay. The relationships among the expression of these indices, the clinicopathologic features of UCC, and the survival rate of UCC patients were also discussed. The correlation between Bmi-1 protein expression and p16 or CD44v6 protein in UCC was analyzed. The expression of Bmi-1, p16, and CD44v6 was significantly high in cervical carcinoma compared with that in the cervical neoplasia and normal colorectal mucosa (P<0.05). The over-expression of Bmi-1 protein in UCC was apparently related to the distant metastasis (P<0.01) and the tumor, nodes and metastasis-classification, i.e. the TNM staging, World Health Organization (P<0.05). Nevertheless, the positive expression of p16 protein in UCC was not significantly associated with the clinicopathologic features (P>0.05). The Kaplan–Meier survival analysis showed that the over-expression of Bmi-1 significantly decreased the survival rate of UCC patients (P<0.05). A strong correlation indicated that there was statistical significance between the expression of Bmi-1 and CD44V6 proteins in UCC (r=0.419, P=0.001). The over-expression of Bmi-1 and CD44v6 protein closely correlate to the tumorigenesis, metastasis, and prognosis of UCC. Bmi-1 and CD44v6 may be used to predict the prognosis of cervical carcinoma. Bmi-1 may indirectly regulate the

  13. MPEG-CS/Bmi-1RNAi Nanoparticles Synthesis and Its Targeted Inhibition Effect on CD133+ Laryngeal Stem Cells.

    Science.gov (United States)

    Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei

    2018-03-01

    Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.

  14. Bmi1 is down-regulated in the aging brain and displays antioxidant and protective activities in neurons.

    Directory of Open Access Journals (Sweden)

    Mohamed Abdouh

    Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.

  15. BMI-1 Mediates Estrogen-Deficiency-Induced Bone Loss by Inhibiting Reactive Oxygen Species Accumulation and T Cell Activation.

    Science.gov (United States)

    Li, Jinbo; Wang, Qian; Yang, Renlei; Zhang, Jiaqi; Li, Xing; Zhou, Xichao; Miao, Dengshun

    2017-05-01

    Previous studies have shown that estrogen regulates bone homeostasis through regulatory effects on oxidative stress. However, it is unclear how estrogen deficiency triggers reactive oxygen species (ROS) accumulation. Recent studies provide evidence that the B lymphoma Mo-MLV insertion region 1 (BMI-1) plays a critical role in protection against oxidative stress and that this gene is directly regulated by estrogen via estrogen receptor (ER) at the transcriptional level. In this study, ovariectomized mice were given drinking water with/without antioxidant N-acetyl-cysteine (NAC, 1 mg/mL) supplementation, and compared with each other and with sham mice. Results showed that ovariectomy resulted in bone loss with increased osteoclast surface, increased ROS levels, T cell activation, and increased TNF and RANKL levels in serum and in CD4 T cells; NAC supplementation largely prevented these alterations. BMI-1 expression levels were dramatically downregulated in CD4 T cells from ovariectomized mice. We supplemented drinking water to BMI-1-deficient mice with/without NAC and compared them with each other and with wild-type (WT) mice. We found that BMI-1 deficiency mimicked alterations observed in ovariectomy whereas NAC supplementation reversed all alterations induced by BMI-1 deficiency. Because T cells are critical in mediating ovariectomy-induced bone loss, we further assessed whether BMI-1 overexpression in lymphocytes can protect against estrogen deficiency-induced osteoclastogenesis and bone loss by inhibiting oxidative stress, T cell activation, and RANKL production. When WT and Eμ-BMI-1 transgenic mice with BMI-1 specifically overexpressed in lymphocytes were ovariectomized and compared with each other and with WT sham mice, we found that BMI-1 overexpression in lymphocytes clearly reversed all alterations induced by ovariectomy. Results from this study indicate that estrogen deficiency downregulates BMI-1 and subsequently increases ROS, T cell activation, and

  16. Association of ATM and BMI-1 genetic variation with breast cancer risk in Han Chinese.

    Science.gov (United States)

    Yue, Li-Ling; Wang, Fu-Chao; Zhang, Ming-Long; Liu, Dan; Chen, Ping; Mei, Qing-Bu; Li, Peng-Hui; Pan, Hong-Ming; Zheng, Li-Hong

    2018-04-24

    We tested the hypothesis that genetic variation in ATM and BMI-1 genes can alter the risk of breast cancer through genotyping 6 variants among 524 breast cancer cases and 518 cancer-free controls of Han nationality. This was an observational, hospital-based, case-control association study. Analyses of single variant, linkage, haplotype, interaction and nomogram were performed. Risk was expressed as odds ratio (OR) and 95% confidence interval (CI). All studied variants were in the Hardy-Weinberg equilibrium and were not linked. The mutant allele frequencies of rs1890637, rs3092856 and rs1801516 in ATM gene were significantly higher in cases than in controls (P = .005, ATM gene were significantly associated with 1.98-fold and 6.04-fold increased risk of breast cancer (95% CI: 1.36-2.90 and 1.65-22.08, respectively). Nomogram analysis estimated that the cumulative proportion of 3 significant variants in ATM gene was about 12.5%. Our findings collectively indicated that ATM gene was a candidate gene in susceptibility to breast cancer in Han Chinese. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  17. Oncoprotein metastasis and its suppression revisited

    Directory of Open Access Journals (Sweden)

    Radulescu Razvan T

    2010-04-01

    Full Text Available Abstract The past two decades have witnessed an increasing appreciation of the role of the tumor microenvironment, of genetic and epigenetic alterations in normal cells adjacent to tumors and of the migration of normal cells with aberrant intrinsic properties in cancer pathophysiology. Aside from these insights, a novel concept termed "oncoprotein metastasis" (OPM has recently been advanced and proposed to reflect protein-based neoplastic phenomena that might occur even before any modifications relating to the morphology, location or (epigenetic outfit of cells during the malignant process. Here, evidence is presented that supports the OPM perception and thus should contribute not only to further rethink the definition of a normal cell, but also the treatment of cancer disease in the years to come.

  18. [Effect of silencing Bmi-1 expression in reversing cisplatin resistance in lung cancer cells and its mechanism].

    Science.gov (United States)

    Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin

    2014-06-01

    To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.

  19. Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma

    International Nuclear Information System (INIS)

    Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S

    2014-01-01

    Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC

  20. MiR-495 Promotes Senescence of Mesenchymal Stem Cells by Targeting Bmi-1

    Directory of Open Access Journals (Sweden)

    Xiujun Li

    2017-06-01

    Full Text Available Background/Aims: Mesenchymal stem cells (MSCs play an important role in regulating angiogenesis and immune balance. Abnormal proliferation and function of MSCs were reported at maternal fetal interface in patients with pre-eclampsia (PE. Micro-RNA-495 was known to be upregulated in the MSCs derived from patients with PE. However, it is not clear whether the up-regulated miR-495 is related to the pathogenesis of PE. Methods: We analyzed the expression of miR-495 in MSCs and umbilical cords derived from healthy pregnancies (NC and PE, then we upregulated or downregulated the expression of miR-495 in MSCs derived from NC and tested the proliferation, apoptosis, migration, invasion, tube formation and senescence. Results: In the current study, we found that the expression of miR-495 was significantly increased in both umbilical cord tissues and MSCs in patients with severe PE. Overexpressing miR-495 arrested cell cycle in S phase and promoted cell apoptosis. The supernatants from miR-495-overexpressed-MSCs inhibited the migration of MSCs and HTR-8/SVneo, invasion of HTR-8/SVneo and tube formation of HUVEC, while si-miR-495 had the opposite effects. Furthermore, we analyzed the senescence related β-galactosidase activity and CD146 and found that miR-495 induced the senescence of MSCs. Molecular mechanism studies confirmed that Bmi-1 mediated these effects of miR-495 on MSCs. Conclusion: Taken together, our data demonstrated that miR-495 induced senescence of MSCs may be involved in the pathogenesis of PE.

  1. [PRODUCT OF THE BMI1--A KEY COMPONENT OF POLYCOMB--POSITIVELY REGULATES ADIPOCYTE DIFFERENTIATION OF MOUSE MESENCHYMAL STEM CELLS].

    Science.gov (United States)

    Petrov, N S; Vereschagina, N A; Sushilova, E N; Kropotov, A V; Miheeva, N F; Popov, B V

    2016-01-01

    Bmil is a key component of Polycomb (PcG), which in mammals controls the basic functions of mammalian somatic stem cells (SSC) such as self-renewal and differentiation. Bmi1 supports SSC via transcriptional suppression of genes associated with cell cycle and differentiation. The most studied target genes of Bmi1 are the genes of Ink4 locus, CdkI p16(Ink4a) and p1(Arf), suppression of which due to activating mutations of the BMI1 results in formation of cancer stem cells (CSC) and carcinomas in various tissues. In contrast, inactivation of BMI1 results in cell cycle arrest and cell senescence. Although clinical phenomena of hypo- and hyperactivation of BMI1 are well known, its targets and mechanisms of regulation of tissue specific SSC are still obscure. The goal of this study was to evaluate the regulatory role of BMI1 in adipocyte differentiation (AD) of mouse mesenchymal stem cells (MSC). Induction of AD in mouse MSC of the C3H10T1/2 cell line was associated with an increase in the expression levels of BMI1, the genes of pRb family (RB, p130) and demethylase UTX, but not methyltransferase EZH2, whose products regulate the methylation levels of H3K27. It was observed earlier that H3K27me3 may play the role of the epigenetic switch by promoting AD of human MSC via activating expression of the PPARγ2, the master gene of AD (Hemming et al., 2014). Here we show that inactivation of BMI1 using specific siRNA slows and decreases the levels of AD, but does not abolish it. This is associated with a complete inhibition of the expression of adipogenic marker genes--PPARγ2, ADIPOQ and a decrease in the expression of RB, p130, but not UTX. The results obtained give evidence that the epigenetic mechanism regulating AD differentiation in mouse and human MSC is different.

  2. MicroRNA-330-3p Expression Indicates Good Prognosis and Suppresses Cell Proliferation by Targeting Bmi-1 in Osteosarcoma

    Directory of Open Access Journals (Sweden)

    Zhenxin Zheng

    2018-03-01

    Full Text Available Background/Aims: Growing evidence has shown that miR-330-3p is closely related to the biological behavior of cancer, including proliferation, metastasis, and prognosis. However, there have been no reports on miR-330-3p expression and function in osteosarcoma. Methods: Expression of miR-330-3p in osteosarcoma tissues and cell lines was examined by quantitative PCR. Effects of miR-330-3p on osteosarcoma cell proliferation were investigated in vitro with the Cell Counting Kit-8 colorimetric assay. Targets of miR-330-3p were identified by dual-luciferase reporter assay. Results: The results showed that expression of miR-330 decreased in osteosarcoma tissues and cell lines. Prognosis of patients with high miR-330-3p expression was much better than that of those with low expression (P=0.001, and multivariate analysis suggested that miR-330-3p is an independent prognostic factor for osteosarcoma. In addition, miR-330-3p overexpression significantly inhibited the growth of MG-63 and U2OS osteosarcoma cells. Dual-luciferase reporter assay demonstrated that Bmi-1 was a direct target gene of miR-330-3p, and in a recovery experiment, miR-330-3p suppressed osteosarcoma cell proliferation by directly targeting Bmi-1. Conclusion: Our results suggest that miR-330-3p acts as a tumor suppressor by regulating Bmi-1 expression in osteosarcoma. Thus, miR-330-3p may represent a novel therapeutic target for the treatment of osteosarcoma.

  3. Regulation of the Wnt/β-Catenin Signaling Pathway by Human Papillomavirus E6 and E7 Oncoproteins

    Directory of Open Access Journals (Sweden)

    Jesus Omar Muñoz Bello

    2015-08-01

    Full Text Available Cell signaling pathways are the mechanisms by which cells transduce external stimuli, which control the transcription of genes, to regulate diverse biological effects. In cancer, distinct signaling pathways, such as the Wnt/β-catenin pathway, have been implicated in the deregulation of critical molecular processes that affect cell proliferation and differentiation. For example, changes in β-catenin localization have been identified in Human Papillomavirus (HPV-related cancers as the lesion progresses. Specifically, β-catenin relocates from the membrane/cytoplasm to the nucleus, suggesting that this transcription regulator participates in cervical carcinogenesis. The E6 and E7 oncoproteins are responsible for the transforming activity of HPV, and some studies have implicated these viral oncoproteins in the regulation of the Wnt/β-catenin pathway. Nevertheless, new interactions of HPV oncoproteins with cellular proteins are emerging, and the study of the biological effects of such interactions will help to understand HPV-related carcinogenesis. Viruses 2015, 7 4735 This review addresses the accumulated evidence of the involvement of the HPV E6 and E7 oncoproteins in the activation of the Wnt/β-catenin pathway.

  4. Expression of BMI-1 and Mel-18 in breast tissue--a diagnostic marker in patients with breast cancer.

    Science.gov (United States)

    Riis, Margit L H; Lüders, Torben; Nesbakken, Anne-Jorunn; Vollan, Hilde S; Kristensen, Vessela; Bukholm, Ida R K

    2010-12-16

    Polycomb Group (PcG) proteins are epigenetic silencers involved in maintaining cellular identity, and their deregulation can result in cancer. Expression of Mel-18 and Bmi-1 has been studied in tumor tissue, but not in adjacent non-cancerous breast epithelium. Our study compares the expression of the two genes in normal breast epithelium of cancer patients and relates it to the level of expression in the corresponding tumors as well as in breast epithelium of healthy women. A total of 79 tumors, of which 71 malignant tumors of the breast, 6 fibroadenomas, and 2 DCIS were studied and compared to the reduction mammoplastic specimens of 11 healthy women. In addition there was available adjacent cancer free tissue for 23 of the malignant tumors. The tissue samples were stored in RNAlater, RNA was isolated to create expression microarray profile. These two genes were then studied more closely first on mRNA transcription level by microarrays (Agilent 44 K) and quantitative RT-PCR (TaqMan) and then on protein expression level using immunohistochemistry. Bmi-1 mRNA is significantly up-regulated in adjacent normal breast tissue in breast cancer patients compared to normal breast tissue from noncancerous patients. Conversely, mRNA transcription level of Mel-18 is lower in normal breast from patients operated for breast cancer compared to breast tissue from mammoplasty. When protein expression of these two genes was evaluated, we observed that most of the epithelial cells were positive for Bmi-1 in both groups of tissue samples, although the expression intensity was stronger in normal tissue from cancer patients compared to mammoplasty tissue samples. Protein expression of Mel-18 showed inversely stronger intensity in tissue samples from mammoplasty compared to normal breast tissue from patients operated for breast cancer. Bmi-1 mRNA level is consistently increased and Mel-18 mRNA level is consistently decreased in adjacent normal breast tissue of cancer patients as compared

  5. ETS-1 oncoprotein expression is decreased in aggressive papillary ...

    African Journals Online (AJOL)

    So far, there is no reliable prognostic marker has been proved for detection of the tumor progression and recurrence. Objectives: To analyze the correlation between ETS-1 oncoprotein immunohistochemical expression and the different stages and grades of the primary papillary transitional cell carcinoma of the urinary ...

  6. Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmi1-deficient mice

    NARCIS (Netherlands)

    Bruggeman, SWM; Valk-Lingbeek, ME; van der Stoop, PPM; Jacobs, JJL; Kieboom, K; Tanger, E; Hulsman, D; Leung, C; Arsenijevic, Y; Marino, S; van Lohuizen, M

    2005-01-01

    The Polycomb group (PcG) gene Bmi1 promotes cell proliferation and stem cell self-renewal by repressing the Ink4a/Arf locus. We used a genetic approach to investigate whether Ink4a or Arf is more critical for relaying Bmi1 function in lymphoid cells, neural progenitors, and neural stem cells. We

  7. BMI1 and H-RAS Cooperate to Drive Breast Cancer Metastasis | Center for Cancer Research

    Science.gov (United States)

    There have been significant improvements in the diagnosis of breast cancer at early stages of the disease. However, even when patients are identified early, there is a 30 percent chance of recurrence after apparently successful treatment of the initial tumor. The major cause of death for breast cancer patients is metastasis of the tumor to other organs but, unfortunately, the mechanisms of metastatic progression and cancer recurrence are poorly understood.

  8. [In vitro study of joint intervention of E-cad and Bmi-1 mediated by transcription activator-like effector nuclease in nasopharyngeal carcinoma].

    Science.gov (United States)

    Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong

    2018-03-28

    To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells.
 Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay.
 Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all Pcad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.

  9. p38 MAPK-Mediated Bmi-1 Down-Regulation and Defective Proliferation in ATM-Deficient Neural Stem Cells Can Be Restored by Akt Activation

    Science.gov (United States)

    Kim, Jeesun; Hwangbo, Jeon; Wong, Paul K. Y.

    2011-01-01

    A-T (ataxia telangiectasia) is a genetic disease caused by a mutation in the Atm (A-T mutated) gene that leads to neurodegeneration. Despite an increase in the numbers of studies in this area in recent years, the mechanisms underlying neurodegeneration in human A-T are still poorly understood. Previous studies demonstrated that neural stem cells (NSCs) isolated from the subventricular zone (SVZ) of Atm -/- mouse brains show defective self-renewal and proliferation, which is accompanied by activation of chronic p38 mitogen-activated protein kinase (MAPK) and a lower level of the polycomb protein Bmi-1. However, the mechanism underlying Bmi-1 down-regulation and its relevance to defective proliferation in Atm-/- NSCs remained unclear. Here, we show that over-expression of Bmi-1 increases self-renewal and proliferation of Atm-/- NSCs to normal, indicating that defective proliferation in Atm-/- NSCs is a consequence of down-regulation of Bmi-1. We also demonstrate that epidermal growth factor (EGF)-induced Akt phosphorylation renders Bmi-1 resistant to the proteasomal degradation, leading to its stabilization and accumulation in the nucleus. However, inhibition of the Akt-dependent Bmi-1 stabilizing process by p38 MAPK signaling reduces the levels of Bmi-1. Treatment of the Atm-/- NSCs with a specific p38 MAPK inhibitor SB203580 extended Bmi-1 posttranscriptional turnover and H2A ubiquitination in Atm-/- NSCs. Our observations demonstrate the molecular basis underlying the impairment of self-renewal and proliferation in Atm-/- NSCs through the p38 MAPK-Akt-Bmi-1-p21 signaling pathway. PMID:21305053

  10. ERG oncoprotein expression in prostate carcinoma patients of different ethnicities

    OpenAIRE

    KELLY, GREGORY M.; KONG, YINK HEAY; DOBI, ALBERT; SRIVASTAVA, SHIV; SESTERHENN, ISABELL A.; PATHMANATHAN, RAJADURAI; TAN, HUI MENG; TAN, SHYH-HAN; CHEONG, SOK CHING

    2014-01-01

    Overexpression of the erythroblast transformation-specific-related gene (ERG) oncoprotein due to transmembrane protease, serine 2 (TMPRSS2)-ERG fusion, the most prevalent genomic alteration in prostate cancer (CaP), is more frequently observed among Caucasian patients compared to patients of African or Asian descent. To the best of our knowledge, this is the first study to investigate the prevalence of ERG alterations in a multiethnic cohort of CaP patients. A total of 191 formalin-fixed para...

  11. Dysregulation of the Bmi-1/p16Ink4a pathway provokes an aging-associated decline of submandibular gland function

    Science.gov (United States)

    Yamakoshi, Kimi; Katano, Satoshi; Iida, Mayu; Kimura, Hiromi; Okuma, Atsushi; Ikemoto-Uezumi, Madoka; Ohtani, Naoko; Hara, Eiji; Maruyama, Mitsuo

    2015-01-01

    Bmi-1 prevents stem cell aging, at least partly, by blocking expression of the cyclin-dependent kinase inhibitor p16Ink4a. Therefore, dysregulation of the Bmi-1/p16Ink4a pathway is considered key to the loss of tissue homeostasis and development of associated degenerative diseases during aging. However, because Bmi-1 knockout (KO) mice die within 20 weeks after birth, it is difficult to determine exactly where and when dysregulation of the Bmi-1/p16Ink4a pathway occurs during aging in vivo. Using real-time in vivo imaging of p16Ink4a expression in Bmi-1-KO mice, we uncovered a novel function of the Bmi-1/p16Ink4a pathway in controlling homeostasis of the submandibular glands (SMGs), which secrete saliva into the oral cavity. This pathway is dysregulated during aging in vivo, leading to induction of p16Ink4a expression and subsequent declined SMG function. These findings will advance our understanding of the molecular mechanisms underlying the aging-related decline of SMG function and associated salivary gland hypofunction, which is particularly problematic among the elderly. PMID:25832744

  12. MicroRNA-128 suppresses paclitaxel-resistant lung cancer by inhibiting MUC1-C and BMI-1 in cancer stem cells.

    Science.gov (United States)

    Koh, Hyebin; Park, Hyeri; Chandimali, Nisansala; Huynh, Do Luong; Zhang, Jiao Jiao; Ghosh, Mrinmoy; Gera, Meeta; Kim, Nameun; Bak, Yesol; Yoon, Do-Young; Park, Yang Ho; Kwon, Taeho; Jeong, Dong Kee

    2017-12-15

    The existence of cancer stem cells (CSCs) is the main reason for failure of cancer treatment caused by drug resistance. Therefore, eradicating cancers by targeting CSCs remains a significant challenge. In the present study, because of the important role of BMI-1 proto-oncogene, polycomb ring finger (BMI-1) and C-terminal Mucin1 (MUC1-C) in tumor growth and maintenance of CSCs, we aimed to confirm that microRNA miR-128, as an inhibitor of BMI-1 and MUC1-C, could effectively suppress paclitaxel (PTX)-resistant lung cancer stem cells. We showed that CSCs have significantly higher expression levels of BMI-1, MUC1-C, stemness proteins, signaling factors, and higher malignancy compared with normal tumor cells. After transfection with miR-128, the BMI-1 and MUC1-C levels in CSCs were suppressed. When miR-128 was stably expressed in PTX-resistant lung cancer stem cells, the cells showed decreased proliferation, metastasis, self-renewal, migration, invasive ability, clonogenicity, and tumorigenicity in vitro and in vivo and increased apoptosis compared with miR-NC (negative control) CSCs. Furthermore, miR-128 effectively decreased the levels of β-catenin and intracellular signaling pathway-related factors in CSCs. MiR-128 also decreased the luciferase activity of MUC1 reporter constructs and reduced the levels of transmembrane MUC1-C and BMI-1. These results suggested miR-128 as an attractive therapeutic strategy for PTX-resistant lung cancer via inhibition of BMI-1 and MUC1-C.

  13. Recombinant TAT-BMI-1 fusion protein induces ex vivo expansion of human umbilical cord blood-derived hematopoietic stem cells.

    Science.gov (United States)

    Codispoti, Bruna; Rinaldo, Nicola; Chiarella, Emanuela; Lupia, Michela; Spoleti, Cristina Barbara; Marafioti, Maria Grazia; Aloisio, Annamaria; Scicchitano, Stefania; Giordano, Marco; Nappo, Giovanna; Lucchino, Valeria; Moore, Malcolm A S; Zhou, Pengbo; Mesuraca, Maria; Bond, Heather Mandy; Morrone, Giovanni

    2017-07-04

    Transplantation of hematopoietic stem cells (HSCs) is a well-established therapeutic approach for numerous disorders. HSCs are typically derived from bone marrow or peripheral blood after cytokine-induced mobilization. Umbilical cord blood (CB) represents an appealing alternative HSC source, but the small amounts of the individual CB units have limited its applications. The availability of strategies for safe ex vivo expansion of CB-derived HSCs (CB-HSCs) may allow to extend the use of these cells in adult patients and to avoid the risk of insufficient engraftment or delayed hematopoietic recovery.Here we describe a system for the ex vivo expansion of CB-HSCs based on their transient exposure to a recombinant TAT-BMI-1 chimeric protein. BMI-1 belongs to the Polycomb family of epigenetic modifiers and is recognized as a central regulator of HSC self-renewal. Recombinant TAT-BMI-1 produced in bacteria was able to enter the target cells via the HIV TAT-derived protein transduction peptide covalently attached to BMI-1, and conserved its biological activity. Treatment of CB-CD34+ cells for 3 days with repeated addition of 10 nM purified TAT-BMI-1 significantly enhanced total cell expansion as well as that of primitive hematopoietic progenitors in culture. Importantly, TAT-BMI-1-treated CB-CD34+ cells displayed a consistently higher rate of multi-lineage long-term repopulating activity in primary and secondary xenotransplants in immunocompromised mice. Thus, recombinant TAT-BMI-1 may represent a novel, effective reagent for ex vivo expansion of CB-HSC for therapeutic purposes.

  14. c-Myb and its target Bmi1 are required for p190BCR/ABL leukemogenesis in mouse and human cells.

    Science.gov (United States)

    Waldron, T; De Dominici, M; Soliera, A R; Audia, A; Iacobucci, I; Lonetti, A; Martinelli, G; Zhang, Y; Martinez, R; Hyslop, T; Bender, T P; Calabretta, B

    2012-04-01

    Expression of c-Myb is required for normal hematopoiesis and for proliferation of myeloid leukemia blasts and a subset of T-cell leukemia, but its role in B-cell leukemogenesis is unknown. We tested the role of c-Myb in p190(BCR/ABL)-dependent B-cell leukemia in mice transplanted with p190(BCR/ABL)-transduced marrow cells with a c-Myb allele (Myb(f/d)) and in double transgenic p190(BCR/ABL)/Myb(w/d) mice. In both models, loss of a c-Myb allele caused a less aggressive B-cell leukemia. In p190(BCR/ABL)-expressing human B-cell leukemia lines, knockdown of c-Myb expression suppressed proliferation and colony formation. Compared with c-Myb(w/f) cells, expression of Bmi1, a regulator of stem cell proliferation and maintenance, was decreased in pre-B cells from Myb(w/d) p190(BCR/ABL) transgenic mice. Ectopic expression of a mutant c-Myb or Bmi1 enhanced the proliferation and colony formation of Myb(w/d) p190(BCR/ABL) B-cells; by contrast, Bmi1 downregulation inhibited colony formation of p190(BCR/ABL)-expressing murine B cells and human B-cell leukemia lines. Moreover, c-Myb interacted with a segment of the human Bmi1 promoter and enhanced its activity. In blasts from 19 Ph(1) adult acute lymphoblastic leukemia patients, levels of c-Myb and Bmi1 showed a positive correlation. Together, these findings support the existence of a c-Myb-Bmi1 transcription-regulatory pathway required for p190(BCR/ABL) leukemogenesis.

  15. Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

    Energy Technology Data Exchange (ETDEWEB)

    Tatrai, Peter, E-mail: peter.tatrai@biomembrane.hu [Institute of Enzymology, Research Center for Natural Sciences, Hungarian Academy of Sciences, Karolina ut 29, H-1113 Budapest (Hungary); Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Szepesi, Aron, E-mail: aron.szepesi@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Matula, Zsolt, E-mail: matula.zsolt@gmail.com [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Szigeti, Anna, E-mail: anna.szigeti@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Buchan, Gyoengyi, E-mail: buchan@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Madi, Andras, E-mail: madi@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Stem Cell, Apoptosis and Genomics Research Group of the Hungarian Academy of Sciences, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Uher, Ferenc, E-mail: uher@biomembrane.hu [Stem Cell Laboratory, Hungarian National Blood Transfusion Service, Dioszegi ut 64, H-1113 Budapest (Hungary); and others

    2012-05-25

    Highlights: Black-Right-Pointing-Pointer We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. Black-Right-Pointing-Pointer hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. Black-Right-Pointing-Pointer SV40T introduced along with hTERT abrogates proliferation control and multipotency. Black-Right-Pointing-Pointer hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC{sup hTERT}, ASC{sup Bmi-1}, ASC{sup Bmi-1+hTERT} and ASC{sup SV40T+hTERT} were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC{sup Bmi-1} had limited replicative potential, while the rapidly proliferating ASC{sup SV40T+hTERT} acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC{sup hTERT} and ASC{sup hTERT+Bmi-1}, on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC{sup hTERT} also acquired aberrant karyotype and showed signs of transformation after long-term culture

  16. Combined introduction of Bmi-1 and hTERT immortalizes human adipose tissue-derived stromal cells with low risk of transformation

    International Nuclear Information System (INIS)

    Tátrai, Péter; Szepesi, Áron; Matula, Zsolt; Szigeti, Anna; Buchan, Gyöngyi; Mádi, András; Uher, Ferenc

    2012-01-01

    Highlights: ► We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. ► hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. ► SV40T introduced along with hTERT abrogates proliferation control and multipotency. ► hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC hTERT , ASC Bmi-1 , ASC Bmi-1+hTERT and ASC SV40T+hTERT were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC Bmi-1 had limited replicative potential, while the rapidly proliferating ASC SV40T+hTERT acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC hTERT and ASC hTERT+Bmi-1 , on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC hTERT also acquired aberrant karyotype and showed signs of transformation after long-term culture. In conclusion, hTERT alone was sufficient to extend the life span of human ASC, but ASC hTERT are prone to transformation during extensive

  17. miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    McKenna, Declan J., E-mail: dj.mckenna@ulster.ac.uk [Biomedical Sciences Research Institute, University of Ulster, Coleraine, Co. Derry BT52 1SA (United Kingdom); Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); Patel, Daksha, E-mail: d.patel@qub.ac.uk [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom); McCance, Dennis J., E-mail: d.mccance@qub.ac.uk [Centre for Cancer Research and Cell Biology, School of Medicine, Dentistry and Biomedical Science, Queen' s University Belfast, Belfast BT9 7BL (United Kingdom)

    2014-01-05

    A screen of microRNA (miRNA) expression following differentiation in human foreskin keratinocytes (HFKs) identified changes in several miRNAs, including miR-24 and miR-205. We investigated how expression of Human Papilloma Virus Type-16 (HPV16) onco-proteins E6 and E7 affected expression of miR-24 and miR-205 during proliferation and differentiation of HFKs. We show that the induction of both miR-24 and miR-205 observed during differentiation of HFKs is lost in HFKs expressing E6 and E7. We demonstrate that the effect on miR-205 is due to E7 activity, as miR-205 expression is dependent on pRb expression. Finally, we provide evidence that miR-24 effects in the cell may be due to targeting of cyclin dependent kinase inhibitor p27. In summary, these results indicate that expression of both miR-24 and miR-205 are impacted by E6 and/or E7 expression, which may be one mechanism by which HPV onco-proteins can disrupt the balance between proliferation and differentiation in keratinocytes. - Highlights: • miR-24 and miR-205 are induced during keratinocyte differentiation. • This induction is lost in keratinocytes expressing HPV onco-proteins E6 and E7. • miR-205 is dependent upon pRb expression. • miR-24 targets p27 in cycling keratinocytes.

  18. miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes

    International Nuclear Information System (INIS)

    McKenna, Declan J.; Patel, Daksha; McCance, Dennis J.

    2014-01-01

    A screen of microRNA (miRNA) expression following differentiation in human foreskin keratinocytes (HFKs) identified changes in several miRNAs, including miR-24 and miR-205. We investigated how expression of Human Papilloma Virus Type-16 (HPV16) onco-proteins E6 and E7 affected expression of miR-24 and miR-205 during proliferation and differentiation of HFKs. We show that the induction of both miR-24 and miR-205 observed during differentiation of HFKs is lost in HFKs expressing E6 and E7. We demonstrate that the effect on miR-205 is due to E7 activity, as miR-205 expression is dependent on pRb expression. Finally, we provide evidence that miR-24 effects in the cell may be due to targeting of cyclin dependent kinase inhibitor p27. In summary, these results indicate that expression of both miR-24 and miR-205 are impacted by E6 and/or E7 expression, which may be one mechanism by which HPV onco-proteins can disrupt the balance between proliferation and differentiation in keratinocytes. - Highlights: • miR-24 and miR-205 are induced during keratinocyte differentiation. • This induction is lost in keratinocytes expressing HPV onco-proteins E6 and E7. • miR-205 is dependent upon pRb expression. • miR-24 targets p27 in cycling keratinocytes

  19. Acute myeloid leukemia stem cell markers in prognosis and targeted therapy: potential impact of BMI-1, TIM-3 and CLL-1.

    Science.gov (United States)

    Darwish, Noureldien H E; Sudha, Thangirala; Godugu, Kavitha; Elbaz, Osama; Abdelghaffar, Hasan A; Hassan, Emad E A; Mousa, Shaker A

    2016-09-06

    Acute myeloid leukemia (AML) patients show high relapse rates and some develop conventional chemotherapy resistance. Leukemia Stem Cells (LSCs) are the main player for AML relapses and drug resistance. LSCs might rely on the B-cell-specific Moloney murine leukemia virus integration site-1 (BMI-1) in promoting cellular proliferation and survival. Growth of LSCs in microenvironments that are deprived of nutrients leads to up-regulation of the signaling pathways during the progression of the disease, which may illustrate the sensitivity of LSCs to inhibitors of those signaling pathways as compared to normal cells. We analyzed the expression of LSC markers (CD34, CLL-1, TIM-3 and BMI-1) using quantitative RT-PCR in bone marrow samples of 40 AML patients of different FAB types (M1, M2, M3, M4, M5, and M7). We also studied the expression of these markers in 2 AML cell lines (Kasumi-1 and KG-1a) using flow cytometry and quantitative RT-PCR. The overexpression of TIM-3, CLL-1, and BMI-1 was markedly correlated with poor prognosis in these patients. Our in vitro findings demonstrate that targeting BMI-1, which markedly increased in the leukemic cells, was associated with marked decrease in leukemic burden. This study also presents results for blocking LSCs' surface markers CD44, CLL-1, and TIM-3. These markers may play an important role in elimination of AML. Our study indicates a correlation between the expression of markers TIM-3, CLL-1, and especially of BMI-1 and the aggressiveness of AML and thus the potential impact of prognosis and therapies that target LSCs on improving the cure rates.

  20. The oncoprotein BCL11A binds to orphan nuclear receptor TLX and potentiates its transrepressive function.

    Directory of Open Access Journals (Sweden)

    Sara B Estruch

    Full Text Available Nuclear orphan receptor TLX (NR2E1 functions primarily as a transcriptional repressor and its pivotal role in brain development, glioblastoma, mental retardation and retinopathologies make it an attractive drug target. TLX is expressed in the neural stem cells (NSCs of the subventricular zone and the hippocampus subgranular zone, regions with persistent neurogenesis in the adult brain, and functions as an essential regulator of NSCs maintenance and self-renewal. Little is known about the TLX social network of interactors and only few TLX coregulators are described. To identify and characterize novel TLX-binders and possible coregulators, we performed yeast-two-hybrid (Y2H screens of a human adult brain cDNA library using different TLX constructs as baits. Our screens identified multiple clones of Atrophin-1 (ATN1, a previously described TLX interactor. In addition, we identified an interaction with the oncoprotein and zinc finger transcription factor BCL11A (CTIP1/Evi9, a key player in the hematopoietic system and in major blood-related malignancies. This interaction was validated by expression and coimmunoprecipitation in human cells. BCL11A potentiated the transrepressive function of TLX in an in vitro reporter gene assay. Our work suggests that BCL11A is a novel TLX coregulator that might be involved in TLX-dependent gene regulation in the brain.

  1. The oncoprotein BCL11A binds to orphan nuclear receptor TLX and potentiates its transrepressive function.

    Science.gov (United States)

    Estruch, Sara B; Buzón, Víctor; Carbó, Laia R; Schorova, Lenka; Lüders, Jens; Estébanez-Perpiñá, Eva

    2012-01-01

    Nuclear orphan receptor TLX (NR2E1) functions primarily as a transcriptional repressor and its pivotal role in brain development, glioblastoma, mental retardation and retinopathologies make it an attractive drug target. TLX is expressed in the neural stem cells (NSCs) of the subventricular zone and the hippocampus subgranular zone, regions with persistent neurogenesis in the adult brain, and functions as an essential regulator of NSCs maintenance and self-renewal. Little is known about the TLX social network of interactors and only few TLX coregulators are described. To identify and characterize novel TLX-binders and possible coregulators, we performed yeast-two-hybrid (Y2H) screens of a human adult brain cDNA library using different TLX constructs as baits. Our screens identified multiple clones of Atrophin-1 (ATN1), a previously described TLX interactor. In addition, we identified an interaction with the oncoprotein and zinc finger transcription factor BCL11A (CTIP1/Evi9), a key player in the hematopoietic system and in major blood-related malignancies. This interaction was validated by expression and coimmunoprecipitation in human cells. BCL11A potentiated the transrepressive function of TLX in an in vitro reporter gene assay. Our work suggests that BCL11A is a novel TLX coregulator that might be involved in TLX-dependent gene regulation in the brain.

  2. MiR-218-targeting-Bmi-1 mediates the suppressive effect of 1,6,7-trihydroxyxanthone on liver cancer cells.

    Science.gov (United States)

    Fu, Wei-Ming; Tang, Li-Peng; Zhu, Xiao; Lu, Ying-Fei; Zhang, Yan-Ling; Lee, Wayne Yuk-Wai; Wang, Hua; Yu, Yang; Liang, Wei-Cheng; Ko, Chun-Hay; Xu, Hong-Xi; Kung, Hsiang-Fu; Zhang, Jin-Fang

    2015-01-01

    Traditional Chinese medicine is recently emerged as anti-cancer therapy or adjuvant with reduced side-effects and improved quality of life. In the present study, an active ingredient, 1,6,7-trihydroxyxanthone (THA), derived from Goodyera oblongifolia was found to strongly suppress cell growth and induce apoptosis in liver cancer cells. MicroRNAs are a group of small non-coding RNAs that regulate gene expression at post-transcriptional levels. Our results demonstrated that miR-218 was up-regulated and oncogene Bmi-1 was down-regulated by THA treatment. Further investigation showed that THA-induced-miR-218 up-regulation could lead to activation of tumor suppressor P16(Ink4a) and P14(ARF), the main down-stream targets of Bmi-1. In conclusion, THA might be a potential anti-cancer drug candidate, at least in part, through the activation of miR-218 and suppression of Bmi-1 expression.

  3. MicroRNA 128a increases intracellular ROS level by targeting Bmi-1 and inhibits medulloblastoma cancer cell growth by promoting senescence.

    Directory of Open Access Journals (Sweden)

    Sujatha Venkataraman

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are a class of short non-coding RNAs that regulate cell homeostasis by inhibiting translation or degrading mRNA of target genes, and thereby can act as tumor suppressor genes or oncogenes. The role of microRNAs in medulloblastoma has only recently been addressed. We hypothesized that microRNAs differentially expressed during normal CNS development might be abnormally regulated in medulloblastoma and are functionally important for medulloblastoma cell growth. METHODOLOGY AND PRINCIPAL FINDINGS: We examined the expression of microRNAs in medulloblastoma and then investigated the functional role of one specific one, miR-128a, in regulating medulloblastoma cell growth. We found that many microRNAs associated with normal neuronal differentiation are significantly down regulated in medulloblastoma. One of these, miR-128a, inhibits growth of medulloblastoma cells by targeting the Bmi-1 oncogene. In addition, miR-128a alters the intracellular redox state of the tumor cells and promotes cellular senescence. CONCLUSIONS AND SIGNIFICANCE: Here we report the novel regulation of reactive oxygen species (ROS by microRNA 128a via the specific inhibition of the Bmi-1 oncogene. We demonstrate that miR-128a has growth suppressive activity in medulloblastoma and that this activity is partially mediated by targeting Bmi-1. This data has implications for the modulation of redox states in cancer stem cells, which are thought to be resistant to therapy due to their low ROS states.

  4. Viral oncoprotein antibodies as a marker for recurrence of Merkel cell carcinoma: A prospective validation study.

    Science.gov (United States)

    Paulson, Kelly G; Lewis, Christopher W; Redman, Mary W; Simonson, William T; Lisberg, Aaron; Ritter, Deborah; Morishima, Chihiro; Hutchinson, Kathleen; Mudgistratova, Lola; Blom, Astrid; Iyer, Jayasri; Moshiri, Ata S; Tarabadkar, Erica S; Carter, Joseph J; Bhatia, Shailender; Kawasumi, Masaoki; Galloway, Denise A; Wener, Mark H; Nghiem, Paul

    2017-04-15

    Merkel cell carcinoma (MCC) is an aggressive skin cancer with a recurrence rate of >40%. Of the 2000 MCC cases per year in the United States, most are caused by the Merkel cell polyomavirus (MCPyV). Antibodies to MCPyV oncoprotein (T-antigens) have been correlated with MCC tumor burden. The present study assesses the clinical utility of MCPyV-oncoprotein antibody titers for MCC prognostication and surveillance. MCPyV-oncoprotein antibody detection was optimized in a clinical laboratory. A cohort of 219 patients with newly diagnosed MCC were followed prospectively (median follow-up, 1.9 years). Among the seropositive patients, antibody titer and disease status were serially tracked. Antibodies to MCPyV oncoproteins were rare among healthy individuals (1%) but were present in most patients with MCC (114 of 219 patients [52%]; P < .01). Seropositivity at diagnosis independently predicted decreased recurrence risk (hazard ratio, 0.58; P = .04) in multivariate analyses adjusted for age, sex, stage, and immunosuppression. After initial treatment, seropositive patients whose disease did not recur had rapidly falling titers that became negative by a median of 8.4 months. Among seropositive patients who underwent serial evaluation (71 patients; 282 time points), an increasing oncoprotein titer had a positive predictive value of 66% for clinically evident recurrence, whereas a decreasing titer had a negative predictive value of 97%. Determination of oncoprotein antibody titer assists in the clinical management of patients with newly diagnosed MCC by stratifying them into a higher risk seronegative cohort, in which radiologic imaging may play a more prominent role, and into a lower risk seropositive cohort, in which disease status can be tracked in part by oncoprotein antibody titer. Cancer 2017;123:1464-1474. © 2016 American Cancer Society. © 2016 American Cancer Society.

  5. Animal-specific C-terminal domain links myeloblastosis oncoprotein (Myb) to an ancient repressor complex

    Science.gov (United States)

    Andrejka, Laura; Wen, Hong; Ashton, Jonathan; Grant, Megan; Iori, Kevin; Wang, Amy; Manak, J. Robert; Lipsick, Joseph S.

    2011-01-01

    Members of the Myb oncoprotein and E2F-Rb tumor suppressor protein families are present within the same highly conserved multiprotein transcriptional repressor complex, named either as Myb and synthetic multivuval class B (Myb-MuvB) or as Drosophila Rb E2F and Myb-interacting proteins (dREAM). We now report that the animal-specific C terminus of Drosophila Myb but not the more highly conserved N-terminal DNA-binding domain is necessary and sufficient for (i) adult viability, (ii) proper localization to chromosomes in vivo, (iii) regulation of gene expression in vivo, and (iv) interaction with the highly conserved core of the MuvB/dREAM transcriptional repressor complex. In addition, we have identified a conserved peptide motif that is required for this interaction. Our results imply that an ancient function of Myb in regulating G2/M genes in both plants and animals appears to have been transferred from the DNA-binding domain to the animal-specific C-terminal domain. Increased expression of B-MYB/MYBL2, the human ortholog of Drosophila Myb, correlates with poor prognosis in human patients with breast cancer. Therefore, our results imply that the specific interaction of the C terminus of Myb with the MuvB/dREAM core complex may provide an attractive target for the development of cancer therapeutics. PMID:21969598

  6. The HTLV-1 oncoprotein Tax is modified by the ubiquitin related modifier 1 (Urm1).

    Science.gov (United States)

    Hleihel, Rita; Khoshnood, Behzad; Dacklin, Ingrid; Omran, Hayssam; Mouawad, Carine; Dassouki, Zeina; El-Sabban, Marwan; Shirinian, Margret; Grabbe, Caroline; Bazarbachi, Ali

    2018-04-17

    Adult T-cell leukemia/lymphoma (ATL) is an aggressive malignancy secondary to chronic human T-cell lymphotropic virus 1 infection, triggered by the virally encoded oncoprotein Tax. The transforming activity and subcellular localization of Tax is strongly influenced by posttranslational modifications, among which ubiquitylation and SUMOylation have been identified as key regulators of the nuclear/cytoplasmic shuttling of Tax, as well as its ability to activate NF-κB signaling. Adding to the complex posttranslational modification landscape of Tax, we here demonstrate that Tax also interacts with the ubiquitin-related modifier 1 (Urm1). Conjugation of Urm1 to Tax results in a redistribution of Tax to the cytoplasm and major increase in the transcription of the NF-ĸB targets Rantes and interleukin-6. Utilizing a tax-transgenic Drosophila model, we show that the Urm1-dependent subcellular targeting of Tax is evolutionary conserved, and that the presence of Urm1 is strongly correlated with the transcriptional output of Diptericin, an antimicrobial peptide and established downstream target of NF-κB in flies. These data put forward Urm1 as a novel Tax modifier that modulates its oncogenic activity and hence represents a potential novel target for developing new strategies for treating ATL.

  7. Elucidation of Ligand-Dependent Modulation of Disorder-Order Transitions in the Oncoprotein MDM2.

    Directory of Open Access Journals (Sweden)

    Juan A Bueren-Calabuig

    2015-06-01

    Full Text Available Numerous biomolecular interactions involve unstructured protein regions, but how to exploit such interactions to enhance the affinity of a lead molecule in the context of rational drug design remains uncertain. Here clarification was sought for cases where interactions of different ligands with the same disordered protein region yield qualitatively different results. Specifically, conformational ensembles for the disordered lid region of the N-terminal domain of the oncoprotein MDM2 in the presence of different ligands were computed by means of a novel combination of accelerated molecular dynamics, umbrella sampling, and variational free energy profile methodologies. The resulting conformational ensembles for MDM2, free and bound to p53 TAD (17-29 peptide identify lid states compatible with previous NMR measurements. Remarkably, the MDM2 lid region is shown to adopt distinct conformational states in the presence of different small-molecule ligands. Detailed analyses of small-molecule bound ensembles reveal that the ca. 25-fold affinity improvement of the piperidinone family of inhibitors for MDM2 constructs that include the full lid correlates with interactions between ligand hydrophobic groups and the C-terminal lid region that is already partially ordered in apo MDM2. By contrast, Nutlin or benzodiazepinedione inhibitors, that bind with similar affinity to full lid and lid-truncated MDM2 constructs, interact additionally through their solubilizing groups with N-terminal lid residues that are more disordered in apo MDM2.

  8. ERG oncoprotein expression in prostate carcinoma patients of different ethnicities.

    Science.gov (United States)

    Kelly, Gregory M; Kong, Yink Heay; Dobi, Albert; Srivastava, Shiv; Sesterhenn, Isabell A; Pathmanathan, Rajadurai; Tan, Hui Meng; Tan, Shyh-Han; Cheong, Sok Ching

    2015-01-01

    Overexpression of the erythroblast transformation-specific-related gene (ERG) oncoprotein due to transmembrane protease, serine 2 ( TMPRSS2 ) -ERG fusion, the most prevalent genomic alteration in prostate cancer (CaP), is more frequently observed among Caucasian patients compared to patients of African or Asian descent. To the best of our knowledge, this is the first study to investigate the prevalence of ERG alterations in a multiethnic cohort of CaP patients. A total of 191 formalin-fixed paraffin-embedded sections of transrectal ultrasound-guided prostate biopsy specimens, collected from 120 patients treated at the Sime Darby Medical Centre, Subang Jaya, Malaysia, were analyzed for ERG protein expression by immunohistochemistry using the anti-ERG monoclonal antibody 9FY as a surrogate for the detection of ERG fusion events. The overall frequency of ERG protein expression in the population evaluated in this study was 39.2%. Although seemingly similar to rates reported in other Asian communities, the expression of ERG was distinct amongst different ethnic groups (P=0.004). Malaysian Indian (MI) patients exhibited exceedingly high expression of ERG in their tumors, almost doubling that of Malaysian Chinese (MC) patients, whereas ERG expression was very low amongst Malay patients (12.5%). When collectively analyzing data, we observed a significant correlation between younger patients and higher ERG expression (P=0.04). The prevalence of ERG expression was significantly different amongst CaP patients of different ethnicities. The higher number of ERG-expressing tumors among MI patients suggested that the TMPRSS2-ERG fusion may be particularly important in the pathogenesis of CaP amongst this group of patients. Furthermore, the more frequent expression of ERG among the younger patients analyzed suggested an involvement of ERG in the early onset of CaP. The results of this study underline the value of using ERG status to better understand the differences in the

  9. Efficient immortalization of primary human cells by p16INK4a-specific short hairpin RNA or Bmi-1, combined with introduction of hTERT.

    Science.gov (United States)

    Haga, Kei; Ohno, Shin-ichi; Yugawa, Takashi; Narisawa-Saito, Mako; Fujita, Masatoshi; Sakamoto, Michiie; Galloway, Denise A; Kiyono, Tohru

    2007-02-01

    Activation of telomerase is sufficient for immortalization of some types of human cells but additional factors may also be essential. It has been proposed that stress imposed by inadequate culture conditions induces senescence due to accumulation of p16(INK4a). Here, we present evidence that many human cell types undergo senescence by activation of the p16(INK4a)/Rb pathway, and that introduction of Bmi-1 can inhibit p16(INK4a) expression and extend the life span of human epithelial cells derived from skin, mammary gland and lung. Introduction of p16(INK4a)-specific short hairpin RNA, as well as Bmi-1, suppressed p16(INK4a) expression in human mammary epithelial cells without promoter methylation, and extended their life span. Subsequent introduction of hTERT, the telomerase catalytic subunit, into cells with low p16(INK4a) levels resulted in efficient immortalization of three cell types without crisis or growth arrest. The majority of the human mammary epithelial cells thus immortalized showed almost normal ploidy as judged by G-banding and spectral karyotyping analysis. Our data suggest that inhibition of p16(INK4a) and introduction of hTERT can immortalize many human cell types with little chromosomal instability.

  10. Multistage modeling of protein dynamics with monomeric Myc oncoprotein as an example.

    Science.gov (United States)

    Liu, Jiaojiao; Dai, Jin; He, Jianfeng; Niemi, Antti J; Ilieva, Nevena

    2017-03-01

    We propose to combine a mean-field approach with all-atom molecular dynamics (MD) into a multistage algorithm that can model protein folding and dynamics over very long time periods yet with atomic-level precision. As an example, we investigate an isolated monomeric Myc oncoprotein that has been implicated in carcinomas including those in colon, breast, and lungs. Under physiological conditions a monomeric Myc is presumed to be an example of intrinsically disordered proteins that pose a serious challenge to existing modeling techniques. We argue that a room-temperature monomeric Myc is in a dynamical state, it oscillates between different conformations that we identify. For this we adopt the Cα backbone of Myc in a crystallographic heteromer as an initial ansatz for the monomeric structure. We construct a multisoliton of the pertinent Landau free energy to describe the Cα profile with ultrahigh precision. We use Glauber dynamics to resolve how the multisoliton responds to repeated increases and decreases in ambient temperature. We confirm that the initial structure is unstable in isolation. We reveal a highly degenerate ground-state landscape, an attractive set towards which Glauber dynamics converges in the limit of vanishing ambient temperature. We analyze the thermal stability of this Glauber attractor using room-temperature molecular dynamics. We identify and scrutinize a particularly stable subset in which the two helical segments of the original multisoliton align in parallel next to each other. During the MD time evolution of a representative structure from this subset, we observe intermittent quasiparticle oscillations along the C-terminal α helix, some of which resemble a translating Davydov's Amide-I soliton. We propose that the presence of oscillatory motion is in line with the expected intrinsically disordered character of Myc.

  11. Positive selection on a bacterial oncoprotein associated with gastric cancer

    Directory of Open Access Journals (Sweden)

    Delgado-Rosado Gisela

    2011-11-01

    Full Text Available Background Helicobacter pylori is a vertically inherited gut commensal that is carcinogenic if it possesses the cag pathogenicity island (cag PaI; infection with H.pylori is the major risk factor for gastric cancer, the second leading cause of death from cancer worldwide (WHO. The cag PaI locus encodes the cagA gene, whose protein product is injected into stomach epithelial cells via a Type IV secretion system, also encoded by the cag PaI. Once there, the cagA protein binds to various cellular proteins, resulting in dysregulation of cell division and carcinogenesis. For this reason, cagA may be described as an oncoprotein. A clear understanding of the mechanism of action of cagA and its benefit to the bacteria is lacking. Results Here, we reveal that the cagA gene displays strong signatures of positive selection in bacteria isolated from amerindian populations, using the Ka/Ks ratio. Weaker signatures are also detected in the gene from bacteria isolated from asian populations, using the Ka/Ks ratio and the more sensitive branches-sites model of the PAML package. When the cagA gene isolated from amerindian populations was examined in more detail it was found that the region under positive selection contains the EPIYA domains, which are known to modulate the carcinogenicity of the gene. This means that the carcinogenicity modulating region of the gene is undergoing adaptation. The results are discussed in relation to the high incidences of stomach cancer in some latin american and asian populations. Conclusion Positive selection on cagA indicates antagonistic coevolution between host and bacteria, which appears paradoxical given that cagA is detrimental to the human host upon which the bacteria depends. This suggests several non-exclusive possibilities; that gastric cancer has not been a major selective pressure on human populations, that cagA has an undetermined benefit to the human host, or that horizontal transmission of H.pylori between hosts

  12. Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer

    Science.gov (United States)

    2014-11-01

    separated by infiltrates of inflammatory cells and the presence of crypt abscess (lower left panel). With progression to dysplasia, the crypts are...Rajabi, H, et al., MUC1-C oncoprotein induces TCF7L2 activation and promotes cyclin D1 expression in human breast cancer cells. J Biol Chem, 2012

  13. Peptide-DNA conjugates as tailored bivalent binders of the oncoprotein c-Jun.

    Science.gov (United States)

    Pazos, Elena; Portela, Cecilia; Penas, Cristina; Vázquez, M Eugenio; Mascareñas, José L

    2015-05-21

    We describe a ds-oligonucleotide-peptide conjugate that is able to efficiently dismount preformed DNA complexes of the bZIP regions of oncoproteins c-Fos and c-Jun (AP-1), and therefore might be useful as disrupters of AP-1-mediated gene expression pathways.

  14. The oncoprotein HBXIP suppresses gluconeogenesis through modulating PCK1 to enhance the growth of hepatoma cells.

    Science.gov (United States)

    Shi, Hui; Fang, Runping; Li, Yinghui; Li, Leilei; Zhang, Weiying; Wang, Huawei; Chen, Fuquan; Zhang, Shuqin; Zhang, Xiaodong; Ye, Lihong

    2016-11-28

    Hepatitis B X-interacting protein (HBXIP) as an oncoprotein plays crucial roles in the development of cancer, involving glucose metabolism reprogramming. In this study, we are interested in whether the oncoprotein HBXIP is involved in the modulation of gluconeogenesis in liver cancer. Here, we showed that the expression level of phosphoenolpyruvate carboxykinase (PCK1), a key enzyme of gluconeogenesis, was lower in clinical hepatocellular carcinoma (HCC) tissues than that in normal tissues. Mechanistically, HBXIP inhibited the expression of PCK1 through down-regulating transcription factor FOXO1 in hepatoma cells, and up-regulated miR-135a targeting the 3'UTR of FOXO1 mRNA in the cells. In addition, HBXIP increased the phosphorylation levels of FOXO1 protein by activating PI3K/Akt pathway, leading to the export of FOXO1 from nucleus to cytoplasm. Strikingly, over-expression of PCK1 could abolish the HBXIP-promoted growth of hepatoma cells in vitro and in vivo. Thus, we conclude that the oncoprotein HBXIP is able to depress the gluconeogenesis through suppressing PCK1 to promote hepatocarcinogenesis, involving miR-135a/FOXO1 axis and PI3K/Akt/p-FOXO1 pathway. Our finding provides new insights into the mechanism by which oncoprotein HBXIP modulates glucose metabolism reprogramming in HCC. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Problem-Solving Test: The Mechanism of Action of a Human Papilloma Virus Oncoprotein

    Science.gov (United States)

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: human papilloma virus; cervical cancer; oncoproteins; malignant transformation; retinoblastoma protein; cell cycle; quiescent and cycling cells; cyclin/cyclin-dependent kinase (Cdk) complexes; E2F; S-phase genes; enhancer element; proto-oncogenes; tumor suppressor genes; radioactive…

  16. Modulation of DNA methylation by human papillomavirus E6 and E7 oncoproteins in cervical cancer

    Science.gov (United States)

    Sen, Prakriti; Ganguly, Pooja; Ganguly, Niladri

    2018-01-01

    Human papillomaviruses (HPVs) are double stranded circular DNA viruses that infect cutaneous and mucosal epithelial cells. Almost 99% of cervical cancer has a HPV infection. The early oncoproteins E6 and E7 are important in this cellular transformation process. Epigenetic mechanisms have long been known to result in decisive alterations in DNA, leading to alterations in DNA-protein interactions, alterations in chromatin structure and compaction and significant alterations in gene expression. The enzymes responsible for these epigenetic modifications are DNA methyl transferases (DNMTs), histone acetylases and deacetylases. Epigenetics has an important role in cancer development by modifying the cellular micro environment. In this review, the authors discuss the role of HPV oncoproteins E6 and E7 in modulating the epigenetic mechanisms inside the host cell. The oncoproteins induce the expression of DNMTs which lead to aberrant DNA methylations and disruption of the normal epigenetic processes. The E7 oncoprotein may additionally directly bind and induce methyl transferase activity of the enzyme. These modulations lead to altered gene expression levels, particularly the genes involved in apoptosis, cell cycle and cell adhesion. In addition, the present review discusses how epigenetic mechanisms may be targeted for possible therapeutic interventions for HPV mediated cervical cancer. PMID:29285184

  17. Loss of BMI-1 dampens migration and EMT of colorectal cancer in inflammatory microenvironment through TLR4/MD-2/MyD88-mediated NF-κB signaling.

    Science.gov (United States)

    Ye, Kai; Chen, Qi-Wei; Sun, Ya-Feng; Lin, Jian-An; Xu, Jian-Hua

    2018-02-01

    Increasing evidence from various clinical and experimental studies has demonstrated that the inflammatory microenvironment created by immune cells facilitates tumor migration. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in an inflammatory microenvironment. B-lymphoma Moloney murine leukemia virus insertion region 1 (BMI-1) acts as an oncogene in various tumors. Ectopic expression of Bmi-1 have an effect on EMT and invasiveness. The purpose of this study was to investigate the efficacy of BMI-1 on inflammation-induced tumor migration and EMT and the underlying mechanism. We observed that the expression of BMI-1, TNF-α, and IL-1β was significantly increased in HT29 and HCT116 cells after THP-1 Conditioned-Medium (THP-1-CM) stimulation. Additionally, inhibition of BMI-1 impeded cell invasion induced by THP-1-CM-stimulation in both HT29 and HCT116 cells. BMI-1 knockdown remarkably repressed THP-1-CM-induced EMT by regulating the expression of EMT biomarkers with an increase in E-cadherin accompanied by decrease in N-cadherin and vimentin. Furthermore, downregulation of BMI-1 dramatically impeded THP-1-CM-triggered Toll-like receptor 4(TLR4)/myeloid differentiation protein 2(MD-2)/myeloid differentiation factor 88(MyD88) activity by repressing the expression of the TLR4/MD-2 complex and MyD88. Further data demonstrated that knockout of BMI-1 also dampened NF-κB THP-1-CM-triggered activity. Taken all data together, our findings established that BMI-1 modulated TLR4/MD-2/MyD88 complex-mediated NF-κB signaling involved in inflammation-induced cancer cells invasion and EMT, and therefore, could be a potential chemopreventive agent against inflammation-associated colorectal cancer. Establishment of an inflammatory microenvironment. Suppression of BMI-1 reverses THP-1-CM-induced inflammatory cytokine production in CRC. Loss of BMI-1 suppressed TLR4/MD-2/MyD88 complex-mediated NF-κB signaling. © 2017 Wiley

  18. Effect of the Flexible Regions of the Oncoprotein Mouse Double Minute X on Inhibitor Binding Affinity.

    Science.gov (United States)

    Qin, Lingyun; Liu, Huili; Chen, Rong; Zhou, Jingjing; Cheng, Xiyao; Chen, Yao; Huang, Yongqi; Su, Zhengding

    2017-11-07

    The oncoprotein MdmX (mouse double minute X) is highly homologous to Mdm2 (mouse double minute 2) in terms of their amino acid sequences and three-dimensional conformations, but Mdm2 inhibitors exhibit very weak affinity for MdmX, providing an excellent model for exploring how protein conformation distinguishes and alters inhibitor binding. The intrinsic conformation flexibility of proteins plays pivotal roles in determining and predicting the binding properties and the design of inhibitors. Although the molecular dynamics simulation approach enables us to understand protein-ligand interactions, the mechanism underlying how a flexible binding pocket adapts an inhibitor has been less explored experimentally. In this work, we have investigated how the intrinsic flexible regions of the N-terminal domain of MdmX (N-MdmX) affect the affinity of the Mdm2 inhibitor nutlin-3a using protein engineering. Guided by heteronuclear nuclear Overhauser effect measurements, we identified the flexible regions that affect inhibitor binding affinity around the ligand-binding pocket on N-MdmX. A disulfide engineering mutant, N-MdmX C25-C110/C76-C88 , which incorporated two staples to rigidify the ligand-binding pocket, allowed an affinity for nutlin-3a higher than that of wild-type N-MdmX (K d ∼ 0.48 vs K d ∼ 20.3 μM). Therefore, this mutant provides not only an effective protein model for screening and designing of MdmX inhibitors but also a valuable clue for enhancing the intermolecular interactions of the pharmacophores of a ligand with pronounced flexible regions. In addition, our results revealed an allosteric ligand-binding mechanism of N-MdmX in which the ligand initially interacts with a compact core, followed by augmenting intermolecular interactions with intrinsic flexible regions. This strategy should also be applicable to many other protein targets to accelerate drug discovery.

  19. Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

    Science.gov (United States)

    Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

    2017-12-01

    This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with

  20. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes ▿

    Science.gov (United States)

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393

  1. Evidence for alteration of EZH2, BMI1, and KDM6A and epigenetic reprogramming in human papillomavirus type 16 E6/E7-expressing keratinocytes.

    Science.gov (United States)

    Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha

    2011-11-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.

  2. The human papillomavirus (HPV) E6 oncoproteins promotes nuclear localization of active caspase 8

    International Nuclear Information System (INIS)

    Manzo-Merino, Joaquin; Massimi, Paola; Lizano, Marcela; Banks, Lawrence

    2014-01-01

    The HPV-16 E6 and E6 ⁎ proteins have been shown previously to be capable of regulating caspase 8 activity. We now show that the capacity of E6 to interact with caspase 8 is common to diverse HPV types, being also seen with HPV-11 E6, HPV-18 E6 and HPV-18 E6 ⁎ . Unlike most E6-interacting partners, caspase 8 does not appear to be a major proteasomal target of E6, but instead E6 appears able to stimulate caspase 8 activation, without affecting the overall apoptotic activity. This would appear to be mediated in part by the ability of the HPV E6 oncoproteins to recruit active caspase 8 to the nucleus. - Highlights: • Multiple HPV E6 oncoproteins interact with the caspase 8 DED domain. • HPV E6 stimulates activation of caspase 8. • HPV E6 promotes nuclear accumulation of caspase 8

  3. The human papillomavirus (HPV) E6 oncoproteins promotes nuclear localization of active caspase 8

    Energy Technology Data Exchange (ETDEWEB)

    Manzo-Merino, Joaquin [Unidad de Investigación Biomédica en Cáncer, Instituto Nacional de Cancerología, México/Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México. Av. San Fernando No. 22, Col. Sección XVI, Tlalpan 14080 (Mexico); Massimi, Paola [International Centre for Genetic Engineering and Biotechnology, Padriciano 99, I-34149 Trieste (Italy); Lizano, Marcela, E-mail: lizanosoberon@gmail.com [Unidad de Investigación Biomédica en Cáncer, Instituto Nacional de Cancerología, México/Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México. Av. San Fernando No. 22, Col. Sección XVI, Tlalpan 14080 (Mexico); Banks, Lawrence, E-mail: banks@icgeb.org [International Centre for Genetic Engineering and Biotechnology, Padriciano 99, I-34149 Trieste (Italy)

    2014-02-15

    The HPV-16 E6 and E6{sup ⁎} proteins have been shown previously to be capable of regulating caspase 8 activity. We now show that the capacity of E6 to interact with caspase 8 is common to diverse HPV types, being also seen with HPV-11 E6, HPV-18 E6 and HPV-18 E6{sup ⁎}. Unlike most E6-interacting partners, caspase 8 does not appear to be a major proteasomal target of E6, but instead E6 appears able to stimulate caspase 8 activation, without affecting the overall apoptotic activity. This would appear to be mediated in part by the ability of the HPV E6 oncoproteins to recruit active caspase 8 to the nucleus. - Highlights: • Multiple HPV E6 oncoproteins interact with the caspase 8 DED domain. • HPV E6 stimulates activation of caspase 8. • HPV E6 promotes nuclear accumulation of caspase 8.

  4. Bcr-Abl oncoproteins bind directly to activators of the Ras signalling pathway.

    OpenAIRE

    Puil, L; Liu, J; Gish, G; Mbamalu, G; Bowtell, D; Pelicci, P G; Arlinghaus, R; Pawson, T

    1994-01-01

    The cytosolic 185 and 210 kDa Bcr-Abl protein tyrosine kinases play important roles in the development of Philadelphia chromosome positive (Ph+) chronic myelogenous leukemia (CML) and acute lymphoblastic leukemia (Ph+ ALL). p185 and p210 Bcr-Abl contain identical abl-encoded sequences juxtaposed to a variable number of bcr-derived amino acids. As the mitogenic and transforming activities of tyrosine kinases involve stimulation of the Ras pathway, we analyzed Bcr-Abl oncoproteins for interacti...

  5. The oncoprotein HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote the proliferation of breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China); Zhang, Xiaodong, E-mail: zhangxd@nankai.edu.cn [Department of Cancer Research, Institute for Molecular Biology, College of Life Sciences, Nankai University, Tianjin 300071 (China); Ye, Lihong, E-mail: yelihong@nankai.edu.cn [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China)

    2013-05-03

    Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells.

  6. The oncoprotein HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote the proliferation of breast cancer cells

    International Nuclear Information System (INIS)

    Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli; Zhang, Xiaodong; Ye, Lihong

    2013-01-01

    Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells

  7. Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer

    Science.gov (United States)

    2013-09-01

    effect- level isobologram analysis is shown for ED 90 (), ED 75 (+) and ED 50 (×) with the right side panel indicating the CI index for the...was generated by exposing the cells to fixed IC50 ratios of GO-203, GSK1120212 and the GO- 203/GSK1120212 combination. The multiple effect- level ...Kharbanda S, and Kufe D, MUC1 oncoprotein blocks GSK3β -mediated phosphorylation and degradation of β-catenin. Cancer Res, 2005. 65:10413-22. 11. Rajabi

  8. Expression of a single, viral oncoprotein in skin epithelium is sufficient to recruit lymphocytes.

    Directory of Open Access Journals (Sweden)

    Allison Choyce

    Full Text Available Established cancers are frequently associated with a lymphocytic infiltrate that fails to clear the tumour mass. In contrast, the importance of recruited lymphocytes during premalignancy is less well understood. In a mouse model of premalignant skin epithelium, transgenic mice that express the human papillomavirus type 16 (HPV16 E7 oncoprotein under a keratin 14 promoter (K14E7 mice display epidermal hyperplasia and have a predominant infiltrate of lymphocytes consisting of both CD4 and CD8 T cells. Activated, but not naïve T cells, were shown to preferentially traffic to hyperplastic skin with an increased frequency of proliferative CD8+ T cells and CD4+ T cells expressing CCR6 within the tissue. Disruption of the interaction between E7 protein and retinoblastoma tumour suppressor protein (pRb led to reduced epithelial hyperplasia and T cell infiltrate. Finally, while K14E7 donor skin grafts are readily accepted onto syngeneic, non-transgenic recipients, these same skin grafts lacking skin-resident lymphocytes were rejected. Our data suggests that expression of a single oncoprotein in the epidermis is sufficient for lymphocyte trafficking (including immunosuppressive lymphocytes to premalignant skin.

  9. The Msi Family of RNA-Binding Proteins Function Redundantly as Intestinal Oncoproteins

    Directory of Open Access Journals (Sweden)

    Ning Li

    2015-12-01

    Full Text Available Members of the Msi family of RNA-binding proteins have recently emerged as potent oncoproteins in a range of malignancies. MSI2 is highly expressed in hematopoietic cancers, where it is required for disease maintenance. In contrast to the hematopoietic system, colorectal cancers can express both Msi family members, MSI1 and MSI2. Here, we demonstrate that, in the intestinal epithelium, Msi1 and Msi2 have analogous oncogenic effects. Further, comparison of Msi1/2-induced gene expression programs and transcriptome-wide analyses of Msi1/2-RNA-binding targets reveal significant functional overlap, including induction of the PDK-Akt-mTORC1 axis. Ultimately, we demonstrate that concomitant loss of function of both MSI family members is sufficient to abrogate the growth of human colorectal cancer cells, and Msi gene deletion inhibits tumorigenesis in several mouse models of intestinal cancer. Our findings demonstrate that MSI1 and MSI2 act as functionally redundant oncoproteins required for the ontogeny of intestinal cancers.

  10. Calmodulin promotes matrix metalloproteinase 9 production and cell migration by inhibiting the ubiquitination and degradation of TBC1D3 oncoprotein in human breast cancer cells.

    Science.gov (United States)

    Zhao, Huzi; Zhang, Lina; Zhang, Yongchen; Zhao, Lei; Wan, Qing; Wang, Bei; Bu, Xiaodong; Wan, Meiling; Shen, Chuanlu

    2017-05-30

    The hominoid oncoprotein TBC1D3 enhances growth factor (GF) signaling and GF signaling, conversely, induces the ubiquitination and subsequent degradation of TBC1D3. However, little is known regarding the regulation of this degradation, and the role of TBC1D3 in the progression of tumors has also not been defined. In the present study, we demonstrated that calmodulin (CaM), a ubiquitous cellular calcium sensor, specifically interacted with TBC1D3 in a Ca2+-dependent manner and inhibited GF signaling-induced ubiquitination and degradation of the oncoprotein in both cytoplasm and nucleus of human breast cancer cells. The CaM-interacting site of TBC1D3 was mapped to amino acids 157~171, which comprises two 1-14 hydrophobic motifs and one lysine residue (K166). Deletion of these motifs was shown to abolish interaction between TBC1D3 and CaM. Surprisingly, this deletion mutation caused inability of GF signaling to induce the ubiquitination and subsequent degradation of TBC1D3. In agreement with this, we identified lysine residue 166 within the CaM-interacting motifs of TBC1D3 as the actual site for the GF signaling-induced ubiquitination using mutational analysis. Point mutation of this lysine residue exhibited the same effect on TBC1D3 as the deletion mutant, suggesting that CaM inhibits GF signaling-induced degradation of TBC1D3 by occluding its ubiquitination at K166. Notably, we found that TBC1D3 promoted the expression and activation of MMP-9 and the migration of MCF-7 cells. Furthermore, interaction with CaM considerably enhanced such effect of TBC1D3. Taken together, our work reveals a novel model by which CaM promotes cell migration through inhibiting the ubiquitination and degradation of TBC1D3.

  11. DNA binding-independent transcriptional activation of the vascular endothelial growth factor gene (VEGF) by the Myb oncoprotein

    International Nuclear Information System (INIS)

    Lutwyche, Jodi K.; Keough, Rebecca A.; Hunter, Julie; Coles, Leeanne S.; Gonda, Thomas J.

    2006-01-01

    Myb is a key transcription factor that can regulate proliferation, differentiation, and apoptosis, predominantly in the haemopoietic system. Abnormal expression of Myb is associated with a number of cancers, both haemopoietic and non-haemopoietic. In order to better understand the role of Myb in normal and tumorigenic processes, we undertook a cDNA array screen to identify genes that are regulated by this factor. In this way, we identified the gene encoding vascular endothelial growth factor (VEGF) as being potentially regulated by the Myb oncoprotein in myeloid cells. To determine whether this was a direct effect on VEGF gene transcription, we examined the activity of the murine VEGF promoter in the presence of either wild-type (WT) or mutant forms of Myb. It was found that WT Myb was able to activate the VEGF promoter and that a minimal promoter region of 120 bp was sufficient to confer Myb responsiveness. Surprisingly, activation of the VEGF promoter was independent of DNA binding by Myb. This was shown by the use of DNA binding-defective Myb mutants and by mutagenesis of a potential Myb-binding site in the minimal promoter. Mutation of Sp1 sites within this region abolished Myb-mediated regulation of a reporter construct, suggesting that Myb DNA binding-independent activation of VEGF expression occurs via these Sp1 binding elements. Regulation of VEGF production by Myb has implications for the potential role of Myb in myeloid leukaemias and in solid tumours where VEGF may be functioning as an autocrine growth factor

  12. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan, E-mail: drqzliu@hotmail.com

    2016-08-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  13. Epigenetic silencing of miR-218 by the lncRNA CCAT1, acting via BMI1, promotes an altered cell cycle transition in the malignant transformation of HBE cells induced by cigarette smoke extract

    International Nuclear Information System (INIS)

    Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan

    2016-01-01

    Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.

  14. MYCN: From Oncoprotein To Tumor-Associated Antigen

    Directory of Open Access Journals (Sweden)

    Vito ePistoia

    2012-11-01

    Full Text Available MYCN is a well known oncogene overexpressed in different human malignancies including neuroblastoma, rhabdomyosarcoma, medulloblastoma, astrocytoma, Wilms’ tumor and small cell lung cancer. In the case of neuroblastoma (NB, MYCN amplification is an established biomarker of poor prognosis. MYCN belongs to a family of transcription factors (the most important of which is CMYC that show a high degree of homology. Downregulation of MYC protein expression leads to tumor regression in animal models, indicating that MYC proteins represent interesting therapeutic targets.Pre-requisites for a candidate tumor-associated antigen (TAA to be targeted by immunotherapeutic approaches are the following, i expression should be tumor-restricted, ii the putative TAA should be up-regulated in cancer cells and iii protein should be processed into immunogenic peptides capable of associating to MHC molecules with high affinity. Indeed, the MYCN protein is not expressed in human adult tissues and upregulated variably in NB cells, and MYCN peptides capable of associating to HLA-A1 or –A2 molecules with high affinity have been identified. Thus the MYCN protein qualifies as putative TAA in NB.Additional issues that determine the feasibility of targeting a putative TAA with cytotoxic T lymphocytes (CTL and will be here discussed are the following, i the inadequacy of tumor cells per se to act as antigen-presenting cells witnessed, in the case of NB cells, by the low to absent expression of HLA- class I molecules, the lack of costimulatory molecules and multiple defects in the HLA class I related antigen processing machinery, and ii the immune evasion mechanisms operated by cancer cells to fool the host immune system, such as up-regulation of soluble immunosuppressive molecules (e.g. soluble MICA and HLA-G in the case of NB or generation of immunosuppressive cells in the tumor microenvironment. A final issue that deserves consideration is the strategy used to generate

  15. Micro-RNA-128 (miRNA-128) down-regulation in glioblastoma targets ARP5 (ANGPTL6), Bmi-1 and E2F-3a, key regulators of brain cell proliferation.

    Science.gov (United States)

    Cui, J G; Zhao, Y; Sethi, P; Li, Y Y; Mahta, A; Culicchia, F; Lukiw, W J

    2010-07-01

    High density micro-RNA (miRNA) arrays, fluorescent-reporter miRNA assay and Northern miRNA dot-blot analysis show that a brain-enriched miRNA-128 is significantly down-regulated in glioblastoma multiforme (GBM) and in GBM cell lines when compared to age-matched controls. The down-regulation of miRNA-128 was found to inversely correlate with WHO tumor grade. Three bioinformatics-verified miRNA-128 targets, angiopoietin-related growth factor protein 5 (ARP5; ANGPTL6), a transcription suppressor that promotes stem cell renewal and inhibits the expression of known tumor suppressor genes involved in senescence and differentiation, Bmi-1, and a transcription factor critical for the control of cell-cycle progression, E2F-3a, were found to be up-regulated. Addition of exogenous miRNA-128 to CRL-1690 and CRL-2610 GBM cell lines (a) restored 'homeostatic' ARP5 (ANGPTL6), Bmi-1 and E2F-3a expression, and (b) significantly decreased the proliferation of CRL-1690 and CRL-2610 cell lines. Our data suggests that down-regulation of miRNA-128 may contribute to glioma and GBM, in part, by coordinately up-regulating ARP5 (ANGPTL6), Bmi-1 and E2F-3a, resulting in the proliferation of undifferentiated GBM cells.

  16. MYCN: from oncoprotein to tumor-associated antigen

    International Nuclear Information System (INIS)

    Pistoia, Vito; Morandi, Fabio; Pezzolo, Annalisa; Raffaghello, Lizzia; Prigione, Ignazia

    2012-01-01

    MYCN is a well-known oncogene over-expressed in different human malignancies including neuroblastoma (NB), rhabdomyosarcoma, medulloblastoma, astrocytoma, Wilms’ tumor, and small cell lung cancer. In the case of NB, MYCN amplification is an established biomarker of poor-prognosis. MYCN belongs to a family of transcription factors (the most important of which is C-MYC) that show a high degree of homology. Down-regulation of MYC protein expression leads to tumor regression in animal models, indicating that MYC proteins represent interesting therapeutic targets. Pre-requisites for a candidate tumor-associated antigen (TAA) to be targeted by immunotherapeutic approaches are the following, (i) expression should be tumor-restricted, (ii) the putative TAA should be up-regulated in cancer cells, and (iii) protein should be processed into immunogenic peptides capable of associating to major histocompatibility complex molecules with high affinity. Indeed, the MYCN protein is not expressed in human adult tissues and up-regulated variably in NB cells, and MYCN peptides capable of associating to HLA-A1 or HLA-A2 molecules with high affinity have been identified. Thus the MYCN protein qualifies as putative TAA in NB. Additional issues that determine the feasibility of targeting a putative TAA with cytotoxic T lymphocytes (CTLs) and will be here discussed are the following, (i) the inadequacy of tumor cells per se to act as antigen-presenting cells witnessed, in the case of NB cells, by the low to absent expression of HLA class I molecules, the lack of co-stimulatory molecules and multiple defects in the HLA class I related antigen processing machinery, and (ii) the immune evasion mechanisms operated by cancer cells to fool the host immune system, such as up-regulation of soluble immunosuppressive molecules (e.g., soluble MICA and HLA-G in the case of NB) or generation of immunosuppressive cells in the tumor microenvironment. A final issue that deserves consideration is the

  17. MYCN: from oncoprotein to tumor-associated antigen

    Energy Technology Data Exchange (ETDEWEB)

    Pistoia, Vito; Morandi, Fabio; Pezzolo, Annalisa; Raffaghello, Lizzia; Prigione, Ignazia, E-mail: vitopistoia@ospedale-gaslini.ge.it [Laboratory of Oncology, Translational Research and Laboratory Medicine, G. Gaslini Institute, Genoa (Italy)

    2012-11-16

    MYCN is a well-known oncogene over-expressed in different human malignancies including neuroblastoma (NB), rhabdomyosarcoma, medulloblastoma, astrocytoma, Wilms’ tumor, and small cell lung cancer. In the case of NB, MYCN amplification is an established biomarker of poor-prognosis. MYCN belongs to a family of transcription factors (the most important of which is C-MYC) that show a high degree of homology. Down-regulation of MYC protein expression leads to tumor regression in animal models, indicating that MYC proteins represent interesting therapeutic targets. Pre-requisites for a candidate tumor-associated antigen (TAA) to be targeted by immunotherapeutic approaches are the following, (i) expression should be tumor-restricted, (ii) the putative TAA should be up-regulated in cancer cells, and (iii) protein should be processed into immunogenic peptides capable of associating to major histocompatibility complex molecules with high affinity. Indeed, the MYCN protein is not expressed in human adult tissues and up-regulated variably in NB cells, and MYCN peptides capable of associating to HLA-A1 or HLA-A2 molecules with high affinity have been identified. Thus the MYCN protein qualifies as putative TAA in NB. Additional issues that determine the feasibility of targeting a putative TAA with cytotoxic T lymphocytes (CTLs) and will be here discussed are the following, (i) the inadequacy of tumor cells per se to act as antigen-presenting cells witnessed, in the case of NB cells, by the low to absent expression of HLA class I molecules, the lack of co-stimulatory molecules and multiple defects in the HLA class I related antigen processing machinery, and (ii) the immune evasion mechanisms operated by cancer cells to fool the host immune system, such as up-regulation of soluble immunosuppressive molecules (e.g., soluble MICA and HLA-G in the case of NB) or generation of immunosuppressive cells in the tumor microenvironment. A final issue that deserves consideration is the

  18. The HPV16 E7 oncoprotein increases the expression of Oct3/4 and stemness-related genes and augments cell self-renewal

    Energy Technology Data Exchange (ETDEWEB)

    Organista-Nava, Jorge; Gómez-Gómez, Yazmín [Programa de Doctorado en Ciencias Biomédicas, Instituto de Fisiología Celular (IFC), Universidad Nacional Autónoma de México (UNAM), Ciudad de México 04510, México (Mexico); Departamento de Genética y Biología Molecular, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN), Ciudad de México 07360, México (Mexico); Ocadiz-Delgado, Rodolfo; García-Villa, Enrique [Departamento de Genética y Biología Molecular, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN), Ciudad de México 07360, México (Mexico); Bonilla-Delgado, José [Unidad de Investigación, Hospital Juárez de México, Ciudad de México 07760, México (Mexico); Lagunas-Martínez, Alfredo [División de Biología Molecular de Patógenos, CISEI, Instituto Nacional de Salud Pública, Cuernavaca, Morelos, México (Mexico); and others

    2016-12-15

    Oct3/4 is a transcription factor involved in maintenance of the pluripotency and self-renewal of stem cells. The E7 oncoprotein and 17β-estradiol (E{sub 2}) are key factors in cervical carcinogenesis. In the present study, we aimed to investigate the effect of the HPV16 E7 oncoprotein and E{sub 2} on the expression pattern of Oct3/4, Sox2, Nanog and Fgf4. We also determined whether the E7 oncoprotein is associated with cell self-renewal. The results showed that Oct3/4, Sox2, Nanog and Fgf4 were upregulated by the E7 oncoprotein in vivo and in vitro and implicate E{sub 2} in the upregulation of these factors in vivo. We also demonstrated that E7 is involved in cell self-renewal, suggesting that the HPV16 E7 oncoprotein upregulates Oct3/4, Sox2, Nanog and Fgf4 expression to maintain the self-renewal capacity of cancer stem cells. -- Graphical abstract: The HPV16 E7 oncoprotein and 17β-estradiol are involved in the upregulation of Oct3/4, Sox2, Nanog and Fgf4 expression to maintain the self-renewal ability of cancer stem cells in cervical cancer. - Highlights: •The HPV16 E7 oncoprotein enhances cellular proliferation and dedifferentiation. •The E7 oncoprotein induces stemness-related genes expression in vivo and in vitro. •The 17β-estradiol induces stemness-related genes expression in vivo. •The HPV16 E7 oncoprotein is involved in the cell self-renewal of cancer cells.

  19. The HPV16 E7 oncoprotein increases the expression of Oct3/4 and stemness-related genes and augments cell self-renewal

    International Nuclear Information System (INIS)

    Organista-Nava, Jorge; Gómez-Gómez, Yazmín; Ocadiz-Delgado, Rodolfo; García-Villa, Enrique; Bonilla-Delgado, José; Lagunas-Martínez, Alfredo

    2016-01-01

    Oct3/4 is a transcription factor involved in maintenance of the pluripotency and self-renewal of stem cells. The E7 oncoprotein and 17β-estradiol (E 2 ) are key factors in cervical carcinogenesis. In the present study, we aimed to investigate the effect of the HPV16 E7 oncoprotein and E 2 on the expression pattern of Oct3/4, Sox2, Nanog and Fgf4. We also determined whether the E7 oncoprotein is associated with cell self-renewal. The results showed that Oct3/4, Sox2, Nanog and Fgf4 were upregulated by the E7 oncoprotein in vivo and in vitro and implicate E 2 in the upregulation of these factors in vivo. We also demonstrated that E7 is involved in cell self-renewal, suggesting that the HPV16 E7 oncoprotein upregulates Oct3/4, Sox2, Nanog and Fgf4 expression to maintain the self-renewal capacity of cancer stem cells. -- Graphical abstract: The HPV16 E7 oncoprotein and 17β-estradiol are involved in the upregulation of Oct3/4, Sox2, Nanog and Fgf4 expression to maintain the self-renewal ability of cancer stem cells in cervical cancer. - Highlights: •The HPV16 E7 oncoprotein enhances cellular proliferation and dedifferentiation. •The E7 oncoprotein induces stemness-related genes expression in vivo and in vitro. •The 17β-estradiol induces stemness-related genes expression in vivo. •The HPV16 E7 oncoprotein is involved in the cell self-renewal of cancer cells.

  20. Bovine papillomavirus type 2 (BPV-2) E5 oncoprotein binds to the subunit D of the V₁-ATPase proton pump in naturally occurring urothelial tumors of the urinary bladder of cattle.

    Science.gov (United States)

    Roperto, Sante; Russo, Valeria; Borzacchiello, Giuseppe; Urraro, Chiara; Lucà, Roberta; Esposito, Iolanda; Riccardi, Marita Georgia; Raso, Cinzia; Gaspari, Marco; Ceccarelli, Dora Maria; Galasso, Rocco; Roperto, Franco

    2014-01-01

    Active infection by bovine papillomavirus type 2 (BPV-2) was documented for fifteen urinary bladder tumors in cattle. Two were diagnosed as papillary urothelial neoplasm of low malignant potential (PUNLMP), nine as papillary and four as invasive urothelial cancers. In all cancer samples, PCR analysis revealed a BPV-2-specific 503 bp DNA fragment. E5 protein, the major oncoprotein of the virus, was shown both by immunoprecipitation and immunohistochemical analysis. E5 was found to bind to the activated (phosphorylated) form of the platelet derived growth factor β receptor. PDGFβR immunoprecipitation from bladder tumor samples and from normal bladder tissue used as control revealed a protein band which was present in the pull-down from bladder cancer samples only. The protein was identified with mass spectrometry as "V₁-ATPase subunit D", a component of the central stalk of the V₁-ATPase vacuolar pump. The subunit D was confirmed in this complex by coimmunoprecipitation investigations and it was found to colocalize with the receptor. The subunit D was also shown to be overexpressed by Western blot, RT-PCR and immunofluorescence analyses. Immunoprecipitation and immunofluorescence also revealed that E5 oncoprotein was bound to the subunit D. For the first time, a tri-component complex composed of E5/PDGFβR/subunit D has been documented in vivo. Previous in vitro studies have shown that the BPV-2 E5 oncoprotein binds to the proteolipid c ring of the V₀-ATPase sector. We suggest that the E5/PDGFβR/subunit D complex may perturb proteostasis, organelle and cytosol homeostasis, which can result in altered protein degradation and in autophagic responses.

  1. Oncoprotein MDM2 Overexpression is Associated with Poor Prognosis in Distinct Non-Hodgkin's Lymphoma Entities

    DEFF Research Database (Denmark)

    Møller, Michael Boe; Nielsen, O; Pedersen, Niels Tinggaard

    1999-01-01

    MDM2 is an oncoprotein involved in the regulation of p53. MDM2 exerts its tumorigenic potential through p53-dependent and -independent mechanisms. It is frequently overexpressed in various malignancies. Little is known about the prognostic value of MDM2 expression in non-Hodgkin's lymphomas (NHL...... overexpression was present in 42 (22%) of 188 cases. The frequency was highest in aggressive/very aggressive NHL (P lymphomas, MDM2 overexpression was associated with higher-grade disease (P = .008). MDM2 overexpression was not related to a phenotype indicating...... altered p53. In univariate analysis MDM2 overexpression associated with short survival in follicle center lymphomas (P = .0256), extranodal marginal zone lymphomas (P lymphomas (P = .0047). The relation to poor prognosis was maintained in a Cox regression analysis including known...

  2. hrHPV E5 oncoprotein: immune evasion and related immunotherapies.

    Science.gov (United States)

    de Freitas, Antonio Carlos; de Oliveira, Talita Helena Araújo; Barros, Marconi Rego; Venuti, Aldo

    2017-05-25

    The immune response is a key factor in the fight against HPV infection and related cancers, and thus, HPV is able to promote immune evasion through the expression of oncogenes. In particular, the E5 oncogene is responsible for modulation of several immune mechanisms, including antigen presentation and inflammatory pathways. Moreover, E5 was suggested as a promising therapeutic target, since there is still no effective medical therapy for the treatment of HPV-related pre-neoplasia and cancer. Indeed, several studies have shown good prospective for E5 immunotherapy, suggesting that it could be applied for the treatment of pre-cancerous lesions. Thus, insofar as the majority of cervical, oropharyngeal and anal cancers are caused by high-risk HPV (hrHPV), mainly by HPV16, the aim of this review is to discuss the immune pathways interfered by E5 oncoprotein of hrHPV highlighting the various aspects of the potential immunotherapeutic approaches.

  3. Karyopherin β3: A new cellular target for the HPV-16 E5 oncoprotein

    International Nuclear Information System (INIS)

    Krawczyk, Ewa; Hanover, John A.; Schlegel, Richard; Suprynowicz, Frank A.

    2008-01-01

    Epidemiological and experimental studies have shown that high-risk human papillomaviruses (HPVs) are the causative agents of cervical cancer worldwide, and that HPV-16 is associated with more than half of these cases. In addition to the well-characterized E6 and E7 oncoproteins of HPV-16, recent evidence increasingly has implicated the HPV-16 E5 protein (16E5) as an important mediator of oncogenic transformation. Since 16E5 has no known intrinsic enzymatic activity, its effects on infected cells are most likely mediated by interactions with various cellular proteins and/or its documented association with lipid rafts. In the present study, we describe a new cellular target that binds to 16E5 in COS cells and in stable human ectocervical cell lines. This target is karyopherin β3, a member of the nuclear import receptor family with critical roles in the nuclear import of ribosomal proteins and in the secretory pathway

  4. Identification of GPC2 as an Oncoprotein and Candidate Immunotherapeutic Target in High-Risk Neuroblastoma.

    Science.gov (United States)

    Bosse, Kristopher R; Raman, Pichai; Zhu, Zhongyu; Lane, Maria; Martinez, Daniel; Heitzeneder, Sabine; Rathi, Komal S; Kendsersky, Nathan M; Randall, Michael; Donovan, Laura; Morrissy, Sorana; Sussman, Robyn T; Zhelev, Doncho V; Feng, Yang; Wang, Yanping; Hwang, Jennifer; Lopez, Gonzalo; Harenza, Jo Lynne; Wei, Jun S; Pawel, Bruce; Bhatti, Tricia; Santi, Mariarita; Ganguly, Arupa; Khan, Javed; Marra, Marco A; Taylor, Michael D; Dimitrov, Dimiter S; Mackall, Crystal L; Maris, John M

    2017-09-11

    We developed an RNA-sequencing-based pipeline to discover differentially expressed cell-surface molecules in neuroblastoma that meet criteria for optimal immunotherapeutic target safety and efficacy. Here, we show that GPC2 is a strong candidate immunotherapeutic target in this childhood cancer. We demonstrate high GPC2 expression in neuroblastoma due to MYCN transcriptional activation and/or somatic gain of the GPC2 locus. We confirm GPC2 to be highly expressed on most neuroblastomas, but not detectable at appreciable levels in normal childhood tissues. In addition, we demonstrate that GPC2 is required for neuroblastoma proliferation. Finally, we develop a GPC2-directed antibody-drug conjugate that is potently cytotoxic to GPC2-expressing neuroblastoma cells. Collectively, these findings validate GPC2 as a non-mutated neuroblastoma oncoprotein and candidate immunotherapeutic target. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. A molecular model for the differential activation of STAT3 and STAT6 by the herpesviral oncoprotein tip.

    Directory of Open Access Journals (Sweden)

    Eman Dey Mazumder

    Full Text Available Constitutive STAT signaling provides growth promoting signals in many forms of malignancy. We performed molecular modeling and molecular dynamics studies of the interaction between the regulatory Src homology 2 (SH2 domains of STAT3 and 6 with phosphorylated peptides of the herpesviral oncoprotein Tip, which facilitates Src kinase mediated STAT-activation and T cell proliferation. The studies give insight into the ligand binding specificity of the STAT SH2 domains and provide the first model for the differential activation of STAT3 or STAT6 by two distinct regions of the viral Tip protein. The biological relevance of the modeled interactions was then confirmed by activation studies using corresponding recombinant oncoproteins, and finally by respective recombinant viruses. The functional data give experimental validation of the molecular dynamics study, and provide evidence for the involvement of STAT6 in the herpesvirus induced T cell proliferation.

  6. Human Papillomavirus Type 16 E6 and E7 Oncoproteins Act Synergistically to Cause Head and Neck Cancer in Mice

    Science.gov (United States)

    Jabbar, Sean; Strati, Katerina; Shin, Myeong Kyun; Pitot, Henry C.; Lambert, Paul F.

    2010-01-01

    High-risk human papillomaviruses (HPVs) contribute to cervical and other anogenital cancers, and they are also linked etiologically to a subset of head and neck squamous cell carcinomas (HNSCC). We previously established a model for HPV-associated HNSCC in which we treated transgenic mice expressing the papillomaviral oncoproteins with the chemical carcinogen 4-nitroquinoline-1-oxide (4-NQO). We found that the HPV-16 E7 oncoprotein was highly potent in causing HNSCC, and its dominance masked any potential oncogenic contribution of E6, a second papillomaviral oncoprotein commonly expressed in human cancers. In the current study, we shortened the duration of treatment with 4-NQO to reduce the incidence of cancers and discovered a striking synergy between E6 and E7 in causing HNSCC. Comparing the oncogenic properties of wild-type versus mutant E6 genes in this model for HNSCC uncovered a role for some but not other cellular targets of E6 previously shown to contribute to cervical cancer. PMID:20797753

  7. Hijacking of the O-GlcNAcZYME complex by the HTLV-1 Tax oncoprotein facilitates viral transcription.

    Science.gov (United States)

    Groussaud, Damien; Khair, Mostafa; Tollenaere, Armelle I; Waast, Laetitia; Kuo, Mei-Shiue; Mangeney, Marianne; Martella, Christophe; Fardini, Yann; Coste, Solène; Souidi, Mouloud; Benit, Laurence; Pique, Claudine; Issad, Tarik

    2017-07-01

    The viral Tax oncoprotein plays a key role in both Human T-cell lymphotropic virus type 1 (HTLV-1)-replication and HTLV-1-associated pathologies, notably adult T-cell leukemia. Tax governs the transcription from the viral 5'LTR, enhancing thereby its own expression, via the recruitment of dimers of phosphorylated CREB to cAMP-response elements located within the U3 region (vCRE). In addition to phosphorylation, CREB is also the target of O-GlcNAcylation, another reversible post-translational modification involved in a wide range of diseases, including cancers. O-GlcNAcylation consists in the addition of O-linked-N-acetylglucosamine (O-GlcNAc) on Serine or Threonine residues, a process controlled by two enzymes: O-GlcNAc transferase (OGT), which transfers O-GlcNAc on proteins, and O-GlcNAcase (OGA), which removes it. In this study, we investigated the status of O-GlcNAcylation enzymes in HTLV-1-transformed T cells. We found that OGA mRNA and protein expression levels are increased in HTLV-1-transformed T cells as compared to control T cell lines while OGT expression is unchanged. However, higher OGA production coincides with a reduction in OGA specific activity, showing that HTLV-1-transformed T cells produce high level of a less active form of OGA. Introducing Tax into HEK-293T cells or Tax-negative HTLV-1-transformed TL-om1 T cells is sufficient to inhibit OGA activity and increase total O-GlcNAcylation, without any change in OGT activity. Furthermore, Tax interacts with the OGT/OGA complex and inhibits the activity of OGT-bound OGA. Pharmacological inhibition of OGA increases CREB O-GlcNAcylation as well as HTLV-1-LTR transactivation by Tax and CREB recruitment to the LTR. Moreover, overexpression of wild-type CREB but not a CREB protein mutated on a previously described O-GlcNAcylation site enhances Tax-mediated LTR transactivation. Finally, both OGT and OGA are recruited to the LTR. These findings reveal the interplay between Tax and the O-GlcNAcylation pathway

  8. Expression of myc family oncoproteins in small-cell lung-cancer cell lines and xenografts

    DEFF Research Database (Denmark)

    Rygaard, K; Vindeløv, L L; Spang-Thomsen, M

    1993-01-01

    A number of genes have altered activity in small-cell lung cancer (SCLC), but especially genes of the myc family (c-myc, L-myc and N-myc) are expressed at high levels in SCLC. Most studies have explored expression at the mRNA level, whereas studies of myc family oncoprotein expression are sparse....... WE examined the expression of myc proto-oncogenes at the mRNA and protein level in 23 cell lines or xenografts. In the cell lines, the doubling time and the cell-cycle distribution, as determined by flow-cytometric DNA analysis, were examined to establish whether the level of myc......-myc. In general, the level of expression of c-myc and N-myc was similar at the mRNA and the protein level. Expression of c-myc was positively correlated with the proliferative index (sum of S and G2+M phases) of cell lines, but not with the population doubling time. In general, L-myc-expressing cell lines had...

  9. The oncoprotein gankyrin interacts with RelA and suppresses NF-κB activity

    International Nuclear Information System (INIS)

    Higashitsuji, Hiroaki; Higashitsuji, Hisako; Liu, Yu; Masuda, Tomoko; Fujita, Takanori; Abdel-Aziz, H. Ismail; Kongkham, Supranee; Dawson, Simon; John Mayer, R.; Itoh, Yoshito; Sakurai, Toshiharu; Itoh, Katsuhiko; Fujita, Jun

    2007-01-01

    Gankyrin is an oncoprotein commonly overexpressed in hepatocellular carcinomas. It interacts with multiple proteins and accelerates degradation of tumor suppressors Rb and p53. Since gankyrin consists of 7 ankyrin repeats and is structurally similar to IκBs, we investigated its interaction with NF-κB. We found that gankyrin directly binds to RelA. In HeLa and 293 cells, overexpression of gankyrin suppressed the basal as well as TNFα-induced transcriptional activity of NF-κB, whereas down-regulation of gankyrin increased it. Gankyrin did not affect the NF-κB DNA-binding activity or nuclear translocation of RelA induced by TNFα in these cells. Leptomycin B that inhibits nuclear export of RelA suppressed the NF-κB activity, which was further suppressed by gankyrin. The inhibitory effect of gankyrin was abrogated by nicotinamide as well as down-regulation of SIRT1, a class III histone deacetylase. Thus, gankyrin binds to NF-κB and suppresses its activity at the transcription level by modulating acetylation via SIRT1

  10. The S100A4 Oncoprotein Promotes Prostate Tumorigenesis in a Transgenic Mouse Model

    DEFF Research Database (Denmark)

    Siddique, Hifzur R; Adhami, Vaqar M; Parray, Aijaz

    2013-01-01

    earlier showed that S100A4 expression progressively increases in prostatic tissues with the advancement of prostate cancer (CaP) in TRAMP, an autochthonous mouse model. To study the functional significance of S100A4 in CaP, we generated a heterozygously deleted S100A4 (TRAMP/S100A4(+/-)) genotype...... (intracellular and extracellular) forms. We observed that 1) the growth-promoting effect of S100A4 is due to its activation of NFκB, 2) S100A4-deficient tumors exhibit reduced NFκB activity, 3) S100A4 regulates NFκB through the RAGE receptor, and 4) S100A4 and RAGE co-localize in prostatic tissues of mice......S100A4, a calcium-binding protein, is known for its role in the metastatic spread of tumor cells, a late event of cancer disease. This is the first report showing that S100A4 is not merely a metastatic protein but also an oncoprotein that plays a critical role in the development of tumors. We...

  11. The HPV16 E7 oncoprotein increases the expression of Oct3/4 and stemness-related genes and augments cell self-renewal.

    Science.gov (United States)

    Organista-Nava, Jorge; Gómez-Gómez, Yazmín; Ocadiz-Delgado, Rodolfo; García-Villa, Enrique; Bonilla-Delgado, José; Lagunas-Martínez, Alfredo; Tapia, Jesús Santa-Olalla; Lambert, Paul F; García-Carrancá, Alejandro; Gariglio, Patricio

    2016-12-01

    Oct3/4 is a transcription factor involved in maintenance of the pluripotency and self-renewal of stem cells. The E7 oncoprotein and 17β-estradiol (E 2 ) are key factors in cervical carcinogenesis. In the present study, we aimed to investigate the effect of the HPV16 E7 oncoprotein and E 2 on the expression pattern of Oct3/4, Sox2, Nanog and Fgf4. We also determined whether the E7 oncoprotein is associated with cell self-renewal. The results showed that Oct3/4, Sox2, Nanog and Fgf4 were upregulated by the E7 oncoprotein in vivo and in vitro and implicate E 2 in the upregulation of these factors in vivo. We also demonstrated that E7 is involved in cell self-renewal, suggesting that the HPV16 E7 oncoprotein upregulates Oct3/4, Sox2, Nanog and Fgf4 expression to maintain the self-renewal capacity of cancer stem cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. The transcription elongation factor ELL2 is specifically upregulated in HTLV-1-infected T-cells and is dependent on the viral oncoprotein Tax.

    Science.gov (United States)

    Mann, Melanie C; Strobel, Sarah; Fleckenstein, Bernhard; Kress, Andrea K

    2014-09-01

    The oncoprotein Tax of human T-cell leukemia virus type 1 (HTLV-1) is a potent transactivator of viral and cellular transcription. Here, we identified ELL2 as the sole transcription elongation factor to be specifically upregulated in HTLV-1-/Tax-transformed T-cells. Tax contributes to regulation of ELL2, since transient transfection of Tax increases ELL2 mRNA, Tax transactivates the ELL2 promoter, and repression of Tax results in decrease of ELL2 in transformed T-lymphocytes. However, we also measured upregulation of ELL2 in HTLV-1-transformed cells exhibiting undetectable amounts of Tax, suggesting that ELL2 can still be maintained independent of continuous Tax expression. We further show that Tax and ELL2 synergistically activate the HTLV-1 promoter, indicating that ELL2 cooperates with Tax in viral transactivation. This is supported by our findings that Tax and ELL2 accumulate in nuclear fractions and that they co-precipitate upon co-expression in transiently-transfected cells. Thus, upregulation of ELL2 could contribute to HTLV-1 gene regulation. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. The transcription elongation factor ELL2 is specifically upregulated in HTLV-1-infected T-cells and is dependent on the viral oncoprotein Tax

    Energy Technology Data Exchange (ETDEWEB)

    Mann, Melanie C., E-mail: melanie.mann@viro.med.uni-erlangen.de; Strobel, Sarah, E-mail: sarah.strobel@viro.med.uni-erlangen.de; Fleckenstein, Bernhard, E-mail: bernhard.fleckenstein@viro.med.uni-erlangen.de; Kress, Andrea K., E-mail: andrea.kress@viro.med.uni-erlangen.de

    2014-09-15

    The oncoprotein Tax of human T-cell leukemia virus type 1 (HTLV-1) is a potent transactivator of viral and cellular transcription. Here, we identified ELL2 as the sole transcription elongation factor to be specifically upregulated in HTLV-1-/Tax-transformed T-cells. Tax contributes to regulation of ELL2, since transient transfection of Tax increases ELL2 mRNA, Tax transactivates the ELL2 promoter, and repression of Tax results in decrease of ELL2 in transformed T-lymphocytes. However, we also measured upregulation of ELL2 in HTLV-1-transformed cells exhibiting undetectable amounts of Tax, suggesting that ELL2 can still be maintained independent of continuous Tax expression. We further show that Tax and ELL2 synergistically activate the HTLV-1 promoter, indicating that ELL2 cooperates with Tax in viral transactivation. This is supported by our findings that Tax and ELL2 accumulate in nuclear fractions and that they co-precipitate upon co-expression in transiently-transfected cells. Thus, upregulation of ELL2 could contribute to HTLV-1 gene regulation. - Highlights: • ELL2, a transcription elongation factor, is upregulated in HTLV-1-positive T-cells. • Tax transactivates the ELL2 promoter. • Tax and ELL2 synergistically activate the HTLV-1 promoter. • Tax and ELL2 interact in vivo.

  14. The transcription elongation factor ELL2 is specifically upregulated in HTLV-1-infected T-cells and is dependent on the viral oncoprotein Tax

    International Nuclear Information System (INIS)

    Mann, Melanie C.; Strobel, Sarah; Fleckenstein, Bernhard; Kress, Andrea K.

    2014-01-01

    The oncoprotein Tax of human T-cell leukemia virus type 1 (HTLV-1) is a potent transactivator of viral and cellular transcription. Here, we identified ELL2 as the sole transcription elongation factor to be specifically upregulated in HTLV-1-/Tax-transformed T-cells. Tax contributes to regulation of ELL2, since transient transfection of Tax increases ELL2 mRNA, Tax transactivates the ELL2 promoter, and repression of Tax results in decrease of ELL2 in transformed T-lymphocytes. However, we also measured upregulation of ELL2 in HTLV-1-transformed cells exhibiting undetectable amounts of Tax, suggesting that ELL2 can still be maintained independent of continuous Tax expression. We further show that Tax and ELL2 synergistically activate the HTLV-1 promoter, indicating that ELL2 cooperates with Tax in viral transactivation. This is supported by our findings that Tax and ELL2 accumulate in nuclear fractions and that they co-precipitate upon co-expression in transiently-transfected cells. Thus, upregulation of ELL2 could contribute to HTLV-1 gene regulation. - Highlights: • ELL2, a transcription elongation factor, is upregulated in HTLV-1-positive T-cells. • Tax transactivates the ELL2 promoter. • Tax and ELL2 synergistically activate the HTLV-1 promoter. • Tax and ELL2 interact in vivo

  15. The HPV-16 E7 oncoprotein induces centriole multiplication through deregulation of Polo-like kinase 4 expression

    Directory of Open Access Journals (Sweden)

    Duensing Stefan

    2011-05-01

    Full Text Available Abstract Background Infection with high-risk human papillomaviruses (HPVs such as HPV-16 is intimately associated with squamous cell carcinomas (SCCs of the anogenital tract and a subset of oropharyngeal carcinomas. Such lesions, including pre-invasive precursors, frequently show multipolar mitoses and aneuploidy. The high-risk HPV-16-encoded E7 oncoprotein has been shown to rapidly induce centrosome abnormalities thereby causing the formation of supernumerary mitotic spindle poles and increasing the risk for chromosome missegregation. HPV-16 E7 has been found to rapidly induce centriole overduplication, in part, through the simultaneous formation of more than one daughter centriole at single maternal centrioles (centriole multiplication. The precise molecular mechanism that underlies HPV-16 E7-induced centriole multiplication, however, remains poorly understood. Findings Here, we show that human keratinocytes engineered to stably express the HPV-16 E7 oncoprotein exhibit aberrant Polo-like kinase 4 (PLK4 protein expression at maternal centrioles. Real-time quantitative reverse transcriptase (qRT-PCR analysis of these cells revealed an increase of PLK4 mRNA levels compared to control cells. Importantly, the ability of the HPV-16 E7 oncoprotein to induce centriole multiplication was found to correlate with its ability to activate the PLK4 promoter and to up-regulate PLK4 mRNA. Conclusions These results highlight the critical role of PLK4 transcriptional deregulation in centriole multiplication in HPV-16 E7-expressing cells. Our findings encourage further experiments to test transcriptional inhibitors or small molecules targeting PLK4 to prevent centriole abnormalities, mitotic infidelity and malignant progression in HPV-associated neoplasms and other tumors in which PLK4 regulation is disrupted.

  16. Production of Human Papilloma Virus Type 16 E6 Oncoprotein as a Recombinant Protein in Eukaryotic Cells

    Science.gov (United States)

    Mirshahabi, H; Soleimanjahi, H; Pourpak, Z; Meshkat, Z; Hassan, ZM

    2012-01-01

    Background Cervical cancer is one of the most important and widespread cancer which affects women. There are several causes of cervical cancer; among them HPV types 16 and 18 are the most prominent ones which are recurrent and persistent infections. These genotypes are currently about 70% of cervical cancer causes in developing countries. Due to the importance of these viruses in cervical cancer, we pioneered the production of Human Papilloma Virus type16 E6 oncoprotein as a recombinant protein in order to develop a vaccine. Two HPV oncoproteins, E6 and E7, are consistently expressed in HPV-associated cancer cells and are responsible for malignant transformation. These oncogenic proteins represent ideal target antigens for developing vaccine and immunotherapeutic strategies against HPV-associated neoplasm. Methods In the present study, the cloned E6-oncoprotein of HPV16 in pTZ57R/T-E6 vector was used to produce professional expression vector. The target gene was subcloned in a eukaryotic expression vector. The pcDNA3-E6 vector was propagated in E.coli strain DH5α and transfected into CHO cells 72 hours post-transfection. Results The transfected cells were harvested; mRNA detection and the interest protein production were confirmed by western blot analysis using specific anti E6 monoclonal antibody. Conclusion HPV16-E6 target protein recognized by specific antibody could be an appropriate form of protein, which can be used for further studies. Due to potential effect of this protein, its DNA construction can be used for DNA vaccine in future studies. PMID:25780534

  17. A novel basolateral type IV secretion model for the CagA oncoprotein of Helicobacter pylori

    Directory of Open Access Journals (Sweden)

    Silja Wessler

    2017-12-01

    Full Text Available Intercellular junctions are crucial structural elements for the formation and maintenance of epithelial barrier functions to control homeostasis or protect against intruding pathogens in humans. Alterations in these complexes represent key events in the development and progression of numerous cancers as well as multiple infectious diseases. Many bacterial pathogens harbor type IV secretion systems (T4SSs, which translocate virulence factors into host cells to hijack cellular processes. The pathology of the gastric pathogen and type-I carcinogen Helicobacter pylori strongly depends on a T4SS encoded by the cag pathogenicity island (cagPAI. This T4SS forms a needle-like pilus and its activity is accomplished by the pilus-associated factors CagL, CagI and CagY which target the host integrin-β1 receptor followed by injection of the CagA oncoprotein into non-polarized AGS gastric epithelial cells. The finding of a T4SS receptor, however, suggested the presence of a sophisticated control mechanism for the injection of CagA. In fact, integrins constitute a group of basolateral receptors, which are normally absent at apical surfaces of the polarized epithelium in vivo. Our new results demonstrate that T4SS-pilus formation during H. pylori infection of polarized epithelial cells occurs preferentially at basolateral sites, and not at apical membranes (Tegtmeyer et al., 2017. We propose a stepwise process how H. pylori interacts with components of intercellular tight junctions (TJs and adherens junctions (AJs, followed by contacting integrin-based focal adhesions to disrupt and transform the epithelial cell layer in the human stomach. The possible impact of this novel signaling cascade on pathogenesis during infection is reviewed.

  18. Insight into the tumor suppressor function of CBP through the viral oncoprotein tax.

    Science.gov (United States)

    Van Orden, K; Nyborg, J K

    2000-01-01

    CREB binding protein (CBP) is a cellular coactivator protein that regulates essentially all known pathways of gene expression. The transcriptional coactivator properties of CBP are utilized by at least 25 different transcription factors representing nearly all known classes of DNA binding proteins. Once bound to their target genes, these transcription factors are believed to tether CBP to the promoter, leading to activated transcription. CBP functions to stimulate transcription through direct recruitment of the general transcription machinery as well as acetylation of both histone and transcription factor substrates. Recent observations indicate that a critical dosage of CBP is required for normal development and tumor suppression, and that perturbations in CBP concentrations may disrupt cellular homeostasis. Furthermore, there is accumulating evidence that CBP deregulation plays a direct role in hematopoietic malignancies. However, the molecular events linking CBP deregulation and malignant transformation are unclear. Further insight into the function of CBP, and its role as a tumor suppressor, can be gained through recent studies of the human T-cell leukemia virus, type I (HTLV-I) Tax oncoprotein. Tax is known to utilize CBP to stimulate transcription from the viral promoter. However, recent data suggest that as a consequence of the Tax-CBP interaction, many cellular transcription factor pathways may be deregulated. Tax disruption of CBP function may play a key role in transformation of the HTLV-I-infected cell. Thus, Tax derailment of CBP may lend important information about the tumor suppressor properties of CBP and serve as a model for the role of CBP in hematopoietic malignancies.

  19. Electrostatic environment surrounding the activation loop phosphotyrosine in the oncoprotein v-Fps.

    Science.gov (United States)

    Leon, B C; Tsigelny, I; Adams, J A

    2001-08-28

    Autophosphorylation of Tyr-1073 in the activation loop of the oncoprotein v-Fps enhances the phosphoryl transfer reaction without influencing substrate, ATP, or metal ion binding affinities [Saylor, P., et al. (1998) Biochemistry 37, 17875-17881]. A structural model of v-Fps, generated from the insulin receptor, indicates that pTyr-1073 chelates two arginines. Mutation of these residues to alanine (R1042A and R1066A) results in weakly phosphorylated enzymes, indicating that one electropositive center is insufficient for attaining maximum loop phosphorylation and concomitant high catalytic activity. While the turnover rate for R1066A is similar to that for a mutant lacking a phosphorylatable residue in the activation loop, the rate for R1042A is 50-fold slower. While solvent perturbation studies suggest that the former is due to a slow phosphoryl transfer step, the latter effect results from a slow conformational change in the mutant, potentially linked to motions in the catalytic loop. Binding of a stoichiometric quantity of Mg(2+) is essential for ATP binding and catalysis, while binding of an additional Mg(2+) ion activates further the wild-type enzyme. The affinity of the R1066A enzyme for the second Mg(2+) ion is 23-fold higher than that of the phosphorylated or unphosphorylated form of wild-type v-Fps, with substrate binding unaffected. Conversely, the affinity of R1066A for a substrate mimic lacking a phosphorylation site is 12-fold higher than that for the phosphorylated or unphosphorylated form of wild-type v-Fps, with binding of the second Mg(2+) ion unaffected. A comparison of these enzyme-independent parameters indicates that Arg-1042 and Arg-1066 induce strain in the active site in the repressed form of the enzyme. While this strain is not relieved in the phosphorylated form, the improvements in catalysis in activated v-Fps compensate for reduced metal and substrate binding affinities.

  20. CORRELATION BETWEEN SERUM HER-2 ONCOPROTEIN AND PATIENTS WITH BREAST CANCER

    Institute of Scientific and Technical Information of China (English)

    Peng Yuan; Bing-he Xu; Da-tong Chu

    2004-01-01

    Objective To detect serum HER-2 oncoprotein levels in patients with operable and metastatic breast cancers, and to study the correlations between serum HER-2 level and lymph node status as well as other clinical parameters.Methods A total of 120 women were studied consisting of 10 healthy volunteers, 31 benign breast disease, 53 operable breast cancer, and 26 metastatic breast cancer patients. The levels of serum HER-2 were measured using an enzyme-liked immunosorbent assay (ELISA).Results The mean serum HER-2 levels were 9.6 + 1.5 ng/mL in healthy volunteers, 11.9 + 1.6 ng/mL in benign breast disease, 13.2 + 4.2 ng/mL in operable breast cancer, and 30.5 + 30.8 ng/mL in metastatic breast cancer patients. The former is much lower than the latter three (P=0.02, 0.001, 0.03, respectively). If using 15 ng/mL as a normal baseline, elevated serum HER-2 levels were observed in none of the healthy volunteers as well as patients with benign disease, but in 18.9% (10/53)operable breast cancer patients and 61.5% (16/26) metastatic patients. In patients with operable breast cancer, there was a positive correlation between serum concentrations of HER-2 and the size of primary rumor (P < 0.05), whereas there was no correlation between serum concentration and axillary lymph node or estrogen receptor status. In patients with metastatic disease, there was no correlation with site of metastases (P > 0.05).Conclusion Serum HER-2 level was strongly correlated with rumor loads and clinical stages, thus acting as a promising predictor of cancer recurrence in breast cancer patients.

  1. The Human Papillomavirus Type 16 E6 Oncoprotein Activates mTORC1 Signaling and Increases Protein Synthesis ▿ †

    OpenAIRE

    Spangle, Jennifer M.; Münger, Karl

    2010-01-01

    The mammalian target of rapamycin (mTOR) kinase acts as a cellular rheostat that integrates signals from a variety of cellular signal transduction pathways that sense growth factor and nutrient availability as well as intracellular energy status. It was previously reported that the human papillomavirus type 16 (HPV16) E6 oncoprotein may activate the S6 protein kinase (S6K) through binding and E6AP-mediated degradation of the mTOR inhibitor tuberous sclerosis complex 2 (TSC2) (Z. Lu, X. Hu, Y....

  2. Discovery of multiple interacting partners of gankyrin, a proteasomal chaperone and an oncoprotein--evidence for a common hot spot site at the interface and its functional relevance.

    Science.gov (United States)

    Nanaware, Padma P; Ramteke, Manoj P; Somavarapu, Arun K; Venkatraman, Prasanna

    2014-07-01

    Gankyrin, a non-ATPase component of the proteasome and a chaperone of proteasome assembly, is also an oncoprotein. Gankyrin regulates a variety of oncogenic signaling pathways in cancer cells and accelerates degradation of tumor suppressor proteins p53 and Rb. Therefore gankyrin may be a unique hub integrating signaling networks with the degradation pathway. To identify new interactions that may be crucial in consolidating its role as an oncogenic hub, crystal structure of gankyrin-proteasome ATPase complex was used to predict novel interacting partners. EEVD, a four amino acid linear sequence seems a hot spot site at this interface. By searching for EEVD in exposed regions of human proteins in PDB database, we predicted 34 novel interactions. Eight proteins were tested and seven of them were found to interact with gankyrin. Affinity of four interactions is high enough for endogenous detection. Others require gankyrin overexpression in HEK 293 cells or occur endogenously in breast cancer cell line- MDA-MB-435, reflecting lower affinity or presence of a deregulated network. Mutagenesis and peptide inhibition confirm that EEVD is the common hot spot site at these interfaces and therefore a potential polypharmacological drug target. In MDA-MB-231 cells in which the endogenous CLIC1 is silenced, trans-expression of Wt protein (CLIC1_EEVD) and not the hot spot site mutant (CLIC1_AAVA) resulted in significant rescue of the migratory potential. Our approach can be extended to identify novel functionally relevant protein-protein interactions, in expansion of oncogenic networks and in identifying potential therapeutic targets. © 2013 Wiley Periodicals, Inc.

  3. The Sumo-targeted ubiquitin ligase RNF4 regulates the localization and function of the HTLV-1 oncoprotein Tax

    Science.gov (United States)

    Fryrear, Kimberly A.; Guo, Xin

    2012-01-01

    The Really Interesting New Gene (RING) Finger Protein 4 (RNF4) represents a class of ubiquitin ligases that target Small Ubiquitin-like Modifier (SUMO)–modified proteins for ubiquitin modification. To date, the regulatory function of RNF4 appears to be ubiquitin-mediated degradation of sumoylated cellular proteins. In the present study, we show that the Human T-cell Leukemia Virus Type 1 (HTLV-1) oncoprotein Tax is a substrate for RNF4 both in vivo and in vitro. We mapped the RNF4-binding site to a region adjacent to the Tax ubiquitin/SUMO modification sites K280/K284. Interestingly, RNF4 modification of Tax protein results in relocalization of the oncoprotein from the nucleus to the cytoplasm. Overexpression of RNF4, but not the RNF4 RING mutant, resulted in cytoplasmic enrichment of Tax. The RNF4-induced nucleus-to-cytoplasm relocalization was associated with increased NF-κB–mediated and decreased cAMP Response Element-Binding (CREB)–mediated Tax activity. Finally, depletion of RNF4 by RNAi prevented the DNA damage–induced nuclear/cytoplasmic translocation of Tax. These results provide important new insight into STUbL-mediated pathways that regulate the subcellular localization and functional dynamics of viral oncogenes. PMID:22106342

  4. Differential gene expression between skin and cervix induced by the E7 oncoprotein in a transgenic mouse model

    Science.gov (United States)

    Ibarra Sierra, E; Díaz Chávez, J; Cortés-Malagón, EM; Uribe-Figueroa, L; Hidalgo-Miranda, A; Lambert, PF; Gariglio, P

    2013-01-01

    HPV16 E7 oncoprotein expression in K14E7 transgenic mice induces cervical cancer after 6 months of treatment with the co-carcinogen 17β-estradiol. In untreated mice, E7 also induces skin tumors late in life albeit at low penetrance. These findings indicate that E7 alters cellular functions in cervix and skin so as to predispose these organs to tumorigenesis. Using microarrays, we determined the global genes expression profile in cervical and skin tissue of young adult K14E7 transgenic mice without estrogen treatment. In these tissues, the E7 oncoprotein altered the transcriptional pattern of genes involved in several biological processes including signal transduction, transport, metabolic process, cell adhesion, apoptosis, cell differentiation, immune response and inflammatory response. Among the E7-dysregulated genes were ones not previously known to be involved in cervical neoplasia including DMBT1, GLI1 and 17βHSD2 in cervix, as well as MMP2, 12, 14, 19 and 27 in skin. PMID:22980503

  5. Prevalence of human papilloma virus with risk of cervical cancer among south Indian women: A genotypic study with meta-analysis and molecular dynamics of HPV E6 oncoprotein.

    Science.gov (United States)

    Akram Husain, R S; Rajakeerthana, R; Sreevalsan, Anoop; Prema Jayaprasad, P; Ahmed, Shiek S S J; Ramakrishnan, V

    2018-04-23

    Cervical cancer (CC) is a major fatal health problem in women with high mortality worldwide. Human Papilloma Virus (HPV) is considered as one of the causative factors for CC. The HPV prevalence and their genotype distribution among women population are essential to evaluate the deteriorating impact of HPV. A cross-sectional study was performed involving 212 participants to identify the prevalence of high-risk HPV genotypes in south India using PCR and DNA Sequencing. The results obtained from cross-sectional study were used to conduct a meta-analysis of the previous published studies on HPV prevalence and genotype distribution across six geographical regions (North, Northeast, East, Central, West, and South) of India. Additionally, molecular simulation was performed using GROMACS software to determine the structural differences of E6 oncoprotein in HPV-16 and 18 genotypes, characterized from Indian subjects. Among the study participants, the HPV prevalence was found to be 81.70% in CC, 71.42% in HSIL and 61.30% in LSIL. The meta-analysis showed a high prevalence of HPV-16 in CC across the entire six regions. Of which, South and North India were found to have high HPV prevalence among Indian regions. Further, simulation of E6 oncoprotein revealed structural differences between HPV-16 and 18 which may be associated with their oncogenic nature. The HPV-16 and 18 were noticed to be highly prevalent in Indian women. Health awareness and vaccination programs are regularly needed to protect Indian women community. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. ERP, a new member of the ets transcription factor/oncoprotein family: cloning, characterization, and differential expression during B-lymphocyte development.

    Science.gov (United States)

    Lopez, M; Oettgen, P; Akbarali, Y; Dendorfer, U; Libermann, T A

    1994-05-01

    The ets gene family encodes a group of proteins which function as transcription factors under physiological conditions and, if aberrantly expressed, can cause cellular transformation. We have recently identified two regulatory elements in the murine immunoglobulin heavy-chain (IgH) enhancer, pi and microB, which exhibit striking similarity to binding sites for ets-related proteins. To identify ets-related transcriptional regulators expressed in pre-B lymphocytes that may interact with either the pi or the microB site, we have used a PCR approach with degenerate oligonucleotides encoding conserved sequences in all members of the ets family. We have cloned the gene for a new ets-related transcription factor, ERP (ets-related protein), from the murine pre-B cell line BASC 6C2 and from mouse lung tissue. The ERP protein contains a region of high homology with the ETS DNA-binding domain common to all members of the ets transcription factor/oncoprotein family. Three additional smaller regions show homology to the ELK-1 and SAP-1 genes, a subgroup of the ets gene family that interacts with the serum response factor. Full-length ERP expresses only negligible DNA-binding activity by itself. Removal of the carboxy terminus enables ERP to interact with a variety of ets-binding sites including the E74 site, the IgH enhancer pi site, and the lck promoter ets site, suggesting a carboxy-terminal negative regulatory domain. At least three ERP-related transcripts are expressed in a variety of tissues. However, within the B-cell lineage, ERP is highly expressed primarily at early stages of B-lymphocyte development, and expression declines drastically upon B-cell maturation, correlating with the enhancer activity of the IgH pi site. These data suggest that ERP might play a role in B-cell development and in IgH gene regulation.

  7. CAPERalpha is a novel Rel-TAD-interacting factor that inhibits lymphocyte transformation by the potent Rel/NF-kappaB oncoprotein v-Rel.

    Science.gov (United States)

    Dutta, Jui; Fan, Gaofeng; Gélinas, Céline

    2008-11-01

    The Rel/NF-kappaB transcription factors are constitutively activated in many human cancers. The Rel proteins in this family are implicated in leukemia/lymphomagenesis, but the mechanism is not completely understood. Previous studies showed that the transcription activation domains (TADs) of the viral oncoprotein v-Rel and its cellular Rel/NF-kappaB homologues c-Rel and RelA are key determinants of their different transforming activities in primary lymphocytes. Substitution of a Rel TAD for that of RelA conferred a strong transforming phenotype upon RelA, which otherwise failed to transform cells. To gain insights into protein interactions that influence cell transformation by the Rel TADs, we identified factors that interact with the TAD of v-Rel, the most oncogenic member of the Rel/NF-kappaB family. We report that the coactivator for transcription factors AP-1 and estrogen receptors, CAPERalpha, interacts with the v-Rel TAD and potently synergizes v-Rel-mediated transactivation. Importantly, coexpression of CAPERalpha markedly reduced and delayed v-Rel's transforming activity in primary lymphocytes, whereas a dominant-negative mutant enhanced the kinetics of v-Rel-mediated transformation. Furthermore, small interfering RNA-mediated knockdown of CAPERalpha in v-Rel-transformed lymphocytes significantly enhanced colony formation in soft agar. Since the potency of Rel-mediated transactivation is an important determinant of lymphocyte transformation, as is Rel's ability to induce transcriptional repression, these data suggest that CAPERalpha's interaction with the Rel TAD could modulate Rel/NF-kappaB's transforming activity by facilitating expression or dampening repression of specific gene subsets important for oncogenesis. Overall, this study identifies CAPERalpha as a new transcriptional coregulator for v-Rel and reveals an important role in modulating Rel's oncogenic activity.

  8. Expression of Human papillomavirus 16 E7ggg oncoprotein on N- and C-terminus of Potato virus X coat protein in bacterial and plant cells

    Czech Academy of Sciences Publication Activity Database

    Plchová, Helena; Moravec, Tomáš; Hoffmeisterová, Hana; Folwarczna, Jitka; Čeřovská, Noemi

    2011-01-01

    Roč. 77, č. 2 (2011), s. 146-152 ISSN 1046-5928 R&D Projects: GA ČR GA521/09/1525 Institutional research plan: CEZ:AV0Z50380511 Keywords : Bacterial expression * Human papillomavirus * Oncoprotein E7 Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.587, year: 2011

  9. PCOTH, a novel gene overexpressed in prostate cancers, promotes prostate cancer cell growth through phosphorylation of oncoprotein TAF-Ibeta/SET.

    Science.gov (United States)

    Anazawa, Yoshio; Nakagawa, Hidewaki; Furihara, Mutsuo; Ashida, Shingo; Tamura, Kenji; Yoshioka, Hiroki; Shuin, Taro; Fujioka, Tomoaki; Katagiri, Toyomasa; Nakamura, Yusuke

    2005-06-01

    Through genome-wide cDNA microarray analysis coupled with microdissection of prostate cancer cells, we identified a novel gene, prostate collagen triple helix (PCOTH), showing overexpression in prostate cancer cells and its precursor cells, prostatic intraepithelial neoplasia (PIN). Immunohistochemical analysis using polyclonal anti-PCOTH antibody confirmed elevated expression of PCOTH, a 100-amino-acid protein containing collagen triple-helix repeats, in prostate cancer cells and PINs. Knocking down PCOTH expression by small interfering RNA (siRNA) resulted in drastic attenuation of prostate cancer cell growth, and concordantly, LNCaP derivative cells that were designed to constitutively express exogenous PCOTH showed higher growth rate than LNCaP cells transfected with mock vector, suggesting the growth-promoting effect of PCOTH on prostate cancer cell. To investigate the biological mechanisms of this growth-promoting effect, we applied two-dimensional differential gel electrophoresis (2D-DIGE) to analyze the phospho-protein fractions in LNCaP cells transfected with PCOTH. We found that the phosphorylation level of oncoprotein TAF-Ibeta/SET was significantly elevated in LNCaP cells transfected with PCOTH than control LNCaP cells, and these findings were confirmed by Western blotting and in-gel kinase assay. Furthermore, knockdown of endogenous TAF-Ibeta expression by siRNA also attenuated viability of prostate cancer cells as well. These findings suggest that PCOTH is involved in growth and survival of prostate cancer cells thorough, in parts, the TAF-Ibeta pathway, and that this molecule should be a promising target for development of new therapeutic strategies for prostate cancers.

  10. Mitotic control of human papillomavirus genome-containing cells is regulated by the function of the PDZ-binding motif of the E6 oncoprotein

    Science.gov (United States)

    Marsh, Elizabeth K.; Delury, Craig P.; Davies, Nicholas J.; Weston, Christopher J.; Miah, Mohammed A.L.; Banks, Lawrence; Parish, Joanna L.

    2017-01-01

    The function of a conserved PDS95/DLG1/ZO1 (PDZ) binding motif (E6 PBM) at the C-termini of E6 oncoproteins of high-risk human papillomavirus (HPV) types contributes to the development of HPV-associated malignancies. Here, using a primary human keratinocyte-based model of the high-risk HPV18 life cycle, we identify a novel link between the E6 PBM and mitotic stability. In cultures containing a mutant genome in which the E6 PBM was deleted there was an increase in the frequency of abnormal mitoses, including multinucleation, compared to cells harboring the wild type HPV18 genome. The loss of the E6 PBM was associated with a significant increase in the frequency of mitotic spindle defects associated with anaphase and telophase. Furthermore, cells carrying this mutant genome had increased chromosome segregation defects and they also exhibited greater levels of genomic instability, as shown by an elevated level of centromere-positive micronuclei. In wild type HPV18 genome-containing organotypic cultures, the majority of mitotic cells reside in the suprabasal layers, in keeping with the hyperplastic morphology of the structures. However, in mutant genome-containing structures a greater proportion of mitotic cells were retained in the basal layer, which were often of undefined polarity, thus correlating with their reduced thickness. We conclude that the ability of E6 to target cellular PDZ proteins plays a critical role in maintaining mitotic stability of HPV infected cells, ensuring stable episome persistence and vegetative amplification. PMID:28061478

  11. Mitotic control of human papillomavirus genome-containing cells is regulated by the function of the PDZ-binding motif of the E6 oncoprotein.

    Science.gov (United States)

    Marsh, Elizabeth K; Delury, Craig P; Davies, Nicholas J; Weston, Christopher J; Miah, Mohammed A L; Banks, Lawrence; Parish, Joanna L; Higgs, Martin R; Roberts, Sally

    2017-03-21

    The function of a conserved PDS95/DLG1/ZO1 (PDZ) binding motif (E6 PBM) at the C-termini of E6 oncoproteins of high-risk human papillomavirus (HPV) types contributes to the development of HPV-associated malignancies. Here, using a primary human keratinocyte-based model of the high-risk HPV18 life cycle, we identify a novel link between the E6 PBM and mitotic stability. In cultures containing a mutant genome in which the E6 PBM was deleted there was an increase in the frequency of abnormal mitoses, including multinucleation, compared to cells harboring the wild type HPV18 genome. The loss of the E6 PBM was associated with a significant increase in the frequency of mitotic spindle defects associated with anaphase and telophase. Furthermore, cells carrying this mutant genome had increased chromosome segregation defects and they also exhibited greater levels of genomic instability, as shown by an elevated level of centromere-positive micronuclei. In wild type HPV18 genome-containing organotypic cultures, the majority of mitotic cells reside in the suprabasal layers, in keeping with the hyperplastic morphology of the structures. However, in mutant genome-containing structures a greater proportion of mitotic cells were retained in the basal layer, which were often of undefined polarity, thus correlating with their reduced thickness. We conclude that the ability of E6 to target cellular PDZ proteins plays a critical role in maintaining mitotic stability of HPV infected cells, ensuring stable episome persistence and vegetative amplification.

  12. The human papillomavirus type 16 E6 oncoprotein activates mTORC1 signaling and increases protein synthesis.

    Science.gov (United States)

    Spangle, Jennifer M; Münger, Karl

    2010-09-01

    The mammalian target of rapamycin (mTOR) kinase acts as a cellular rheostat that integrates signals from a variety of cellular signal transduction pathways that sense growth factor and nutrient availability as well as intracellular energy status. It was previously reported that the human papillomavirus type 16 (HPV16) E6 oncoprotein may activate the S6 protein kinase (S6K) through binding and E6AP-mediated degradation of the mTOR inhibitor tuberous sclerosis complex 2 (TSC2) (Z. Lu, X. Hu, Y. Li, L. Zheng, Y. Zhou, H. Jiang, T. Ning, Z. Basang, C. Zhang, and Y. Ke, J. Biol. Chem. 279:35664-35670, 2004; L. Zheng, H. Ding, Z. Lu, Y. Li, Y. Pan, T. Ning, and Y. Ke, Genes Cells 13:285-294, 2008). Our results confirmed that HPV16 E6 expression causes an increase in mTORC1 activity through enhanced phosphorylation of mTOR and activation of downstream signaling pathways S6K and eukaryotic initiation factor binding protein 1 (4E-BP1). However, we did not detect a decrease in TSC2 levels in HPV16 E6-expressing cells. We discovered, however, that HPV16 E6 expression causes AKT activation through the upstream kinases PDK1 and mTORC2 under conditions of nutrient deprivation. We show that HPV16 E6 expression causes an increase in protein synthesis by enhancing translation initiation complex assembly at the 5' mRNA cap and an increase in cap-dependent translation. The increase in cap-dependent translation likely results from HPV16 E6-induced AKT/mTORC1 activation, as the assembly of the translation initiation complex and cap-dependent translation are rapamycin sensitive. Lastly, coexpression of the HPV16 E6 and E7 oncoproteins does not affect HPV16 E6-induced activation of mTORC1 and cap-dependent translation. HPV16 E6-mediated activation of mTORC1 signaling and cap-dependent translation may be a mechanism to promote viral replication under conditions of limited nutrient supply in differentiated, HPV oncoprotein-expressing proliferating cells.

  13. MUC1-C Oncoprotein Integrates a Program of EMT, Epigenetic Reprogramming and Immune Evasion in Human Carcinomas.

    Science.gov (United States)

    Rajabi, Hasan; Kufe, Donald

    2017-08-01

    The MUC1 gene evolved in mammalian species to provide protection of epithelia. The transmembrane MUC1 C-terminal subunit (MUC1-C) signals stress to the interior of the epithelial cell and, when overexpressed as in most carcinomas, functions as an oncoprotein. MUC1-C induces the epithelial-mesenchymal transition (EMT) by activating the inflammatory NF-κB p65 pathway and, in turn, the EMT-transcriptional repressor ZEB1. Emerging evidence has indicated that MUC1-C drives a program integrating the induction of EMT with activation of stem cell traits, epigenetic reprogramming and immune evasion. This mini-review focuses on the potential importance of this MUC1-C program in cancer progression. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Human papillomavirus type 16 E7 oncoprotein engages but does not abrogate the mitotic spindle assembly checkpoint

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Yueyang [Division of Infectious Diseases, Brigham and Women' s Hospital and Biological and Biomedical Sciences Program, Harvard Medical School, Boston, MA 02115 (United States); Munger, Karl, E-mail: kmunger@rics.bwh.harvard.edu [Division of Infectious Diseases, Brigham and Women' s Hospital and Biological and Biomedical Sciences Program, Harvard Medical School, Boston, MA 02115 (United States)

    2012-10-10

    The mitotic spindle assembly checkpoint (SAC) ensures faithful chromosome segregation during mitosis by censoring kinetochore-microtubule interactions. It is frequently rendered dysfunctional during carcinogenesis causing chromosome missegregation and genomic instability. There are conflicting reports whether the HPV16 E7 oncoprotein drives chromosomal instability by abolishing the SAC. Here we report that degradation of mitotic cyclins is impaired in cells with HPV16 E7 expression. RNAi-mediated depletion of Mad2 or BubR1 indicated the involvement of the SAC, suggesting that HPV16 E7 expression causes sustained SAC engagement. Mutational analyses revealed that HPV16 E7 sequences that are necessary for retinoblastoma tumor suppressor protein binding as well as sequences previously implicated in binding the nuclear and mitotic apparatus (NuMA) protein and in delocalizing dynein from the mitotic spindle contribute to SAC engagement. Importantly, however, HPV16 E7 does not markedly compromise the SAC response to microtubule poisons.

  15. Efficient expression of Human papillomavirus 16 E7 oncoprotein fused to C-terminus of Tobacco mosaic virus (TMV) coat protein using molecular chaperones in Escherichia coli

    Czech Academy of Sciences Publication Activity Database

    Folwarczna, Jitka; Moravec, Tomáš; Plchová, Helena; Hoffmeisterová, Hana; Čeřovská, Noemi

    2012-01-01

    Roč. 85, č. 1 (2012), s. 152-157 ISSN 1046-5928 R&D Projects: GA ČR GA521/09/1525; GA ČR GAP501/12/1761 Institutional research plan: CEZ:AV0Z50380511 Keywords : Bacterial expression * Human papillomavirus * E7 oncoprotein Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.429, year: 2012

  16. Nuclear export of cutaneous HPV8 E7 oncoprotein is mediated by a leucine-rich nuclear export signal via a CRM1 pathway

    Energy Technology Data Exchange (ETDEWEB)

    Onder, Zeynep; Chang, Vivian; Moroianu, Junona, E-mail: moroianu@bc.edu

    2015-01-01

    We recently determined that the nuclear import of cutaneous beta genus HPV8 E7 oncoprotein it is mediated by its zinc-binding domain via direct hydrophobic interactions with the FG nucleoporins Nup62 and Nup153 (Onder and Moroianu, 2014). Here we investigated the nuclear export of HPV8 E7 oncoprotein using confocal microscopy after transfections of HeLa cells with EGFP–8cE7 and mutant plasmids and treatment with Ratjadone A nuclear export inhibitor. We determined that HPV8 E7 contains a leucine-rich nuclear export signal (NES), {sub 76}IRTFQELLF{sub 84}, within its zinc-binding domain that mediates its nuclear export via a CRM1 pathway. We found that HPV8 E7 interacts with CRM1 and that the hydrophobic amino acid residues I76, F79 and L82 of the NES are essential for this interaction and for nuclear export of HPV8 E7 oncoprotein. - Highlights: • HPV8 E7 has a leucine-rich NES within its zinc-binding domain that mediates its nuclear export. • CRM1 nuclear export receptor interacts with HPV8 E7 and mediates its export. • Identification of the critical hydrophobic amino acids of the NES of HPV8 E7.

  17. Nuclear export of cutaneous HPV8 E7 oncoprotein is mediated by a leucine-rich nuclear export signal via a CRM1 pathway.

    Science.gov (United States)

    Onder, Zeynep; Chang, Vivian; Moroianu, Junona

    2015-01-01

    We recently determined that the nuclear import of cutaneous beta genus HPV8 E7 oncoprotein it is mediated by its zinc-binding domain via direct hydrophobic interactions with the FG nucleoporins Nup62 and Nup153 (Onder and Moroianu, 2014). Here we investigated the nuclear export of HPV8 E7 oncoprotein using confocal microscopy after transfections of HeLa cells with EGFP-8cE7 and mutant plasmids and treatment with Ratjadone A nuclear export inhibitor. We determined that HPV8 E7 contains a leucine-rich nuclear export signal (NES), 76IRTFQELLF84, within its zinc-binding domain that mediates its nuclear export via a CRM1 pathway. We found that HPV8 E7 interacts with CRM1 and that the hydrophobic amino acid residues I76, F79 and L82 of the NES are essential for this interaction and for nuclear export of HPV8 E7 oncoprotein. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Retinoblastoma-independent antiproliferative activity of novel intracellular antibodies against the E7 oncoprotein in HPV 16-positive cells

    International Nuclear Information System (INIS)

    Accardi, Luisa; Tommasino, Massimo; Banks, Lawrence; Chirullo, Barbara; Giorgi, Colomba; Donà, Maria Gabriella; Mileo, Anna M; Paggi, Marco G; Federico, Antonio; Torreri, Paola; Petrucci, Tamara C; Accardi, Rosita; Pim, David

    2011-01-01

    'High risk' Human Papillomavirus strains are the causative agents of the vast majority of carcinomas of the uterine cervix. In these tumors, the physical integration of the HPV genome is a frequent, though not invariable occurrence, but the constitutive expression of the E6 and E7 viral genes is always observed, suggesting key roles for the E6 and E7 oncoproteins in the process of malignant transformation. The 'intracellular antibody' technology using recombinant antibodies in single-chain format offers the possibility of targeting a protein in its intracellular environment even at the level of definite domains thus representing a valuable strategy to 'knock out' the function of specific proteins. In this study, we investigate the in vitro activity of two single-chain antibody fragments directed against the 'high-risk' HPV 16 E7 oncoprotein, scFv 43M2 and scFv 51. These scFvs were expressed by retroviral system in different cell compartments of the HPV16-positive SiHa cells, and cell proliferation was analyzed by Colony Formation Assay and EZ4U assay. The binding of these scFvs to E7, and their possible interference with the interaction between E7 and its main target, the tumor suppressor pRb protein, were then investigated by immunoassays, PepSet™technology and Surface Plasmon Resonance. The expression of the two scFvs in the nucleus and the endoplasmic reticulum of SiHa cells resulted in the selective growth inhibition of these cells. Analysis of binding showed that both scFvs bind E7 via distinct but overlapping epitopes not corresponding to the pRb binding site. Nevertheless, the binding of scFv 43M2 to E7 was inhibited by pRb in a non-competitive manner. Based on the overall results, the observed inhibition of HPV-positive SiHa cells proliferation could be ascribed to an interaction between scFv and E7, involving non-pRb targets. The study paves the way for the employment of specific scFvs in immunotherapeutic

  19. Ubiquitination and degradation of the hominoid-specific oncoprotein TBC1D3 is regulated by protein palmitoylation

    Energy Technology Data Exchange (ETDEWEB)

    Kong, Chen; Lange, Jeffrey J.; Samovski, Dmitri [Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO 63110 (United States); Su, Xiong [Department of Internal Medicine, Center for Human Nutrition Washington University School of Medicine, St. Louis, MO 63110 (United States); Liu, Jialiu [Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO 63110 (United States); Sundaresan, Sinju [Department of Internal Medicine, Center for Human Nutrition Washington University School of Medicine, St. Louis, MO 63110 (United States); Stahl, Philip D., E-mail: pstahl@wustl.edu [Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO 63110 (United States)

    2013-05-03

    Highlights: •Hominoid-specific oncogene TBC1D3 is targeted to plasma membrane by palmitoylation. •TBC1D3 is palmitoylated on two cysteine residues: 318 and 325. •TBC1D3 palmitoylation governs growth factors-induced TBC1D3 degradation. •Post-translational modifications may regulate oncogenic properties of TBC1D3. -- Abstract: Expression of the hominoid-specific oncoprotein TBC1D3 promotes enhanced cell growth and proliferation by increased activation of signal transduction through several growth factors. Recently we documented the role of CUL7 E3 ligase in growth factors-induced ubiquitination and degradation of TBC1D3. Here we expanded our study to discover additional molecular mechanisms that control TBC1D3 protein turnover. We report that TBC1D3 is palmitoylated on two cysteine residues: 318 and 325. The expression of double palmitoylation mutant TBC1D3:C318/325S resulted in protein mislocalization and enhanced growth factors-induced TBC1D3 degradation. Moreover, ubiquitination of TBC1D3 via CUL7 E3 ligase complex was increased by mutating the palmitoylation sites, suggesting that depalmitoylation of TBC1D3 makes the protein more available for ubiquitination and degradation. The results reported here provide novel insights into the molecular mechanisms that govern TBC1D3 protein degradation. Dysregulation of these mechanisms in vivo could potentially result in aberrant TBC1D3 expression and promote oncogenesis.

  20. H-Ras and K-Ras Oncoproteins Induce Different Tumor Spectra When Driven by the Same Regulatory Sequences.

    Science.gov (United States)

    Drosten, Matthias; Simón-Carrasco, Lucía; Hernández-Porras, Isabel; Lechuga, Carmen G; Blasco, María T; Jacob, Harrys K C; Fabbiano, Salvatore; Potenza, Nicoletta; Bustelo, Xosé R; Guerra, Carmen; Barbacid, Mariano

    2017-02-01

    Genetic studies in mice have provided evidence that H-Ras and K-Ras proteins are bioequivalent. However, human tumors display marked differences in the association of RAS oncogenes with tumor type. Thus, to further assess the bioequivalence of oncogenic H-Ras and K-Ras, we replaced the coding region of the murine K-Ras locus with H-Ras G12V oncogene sequences. Germline expression of H-Ras G12V or K-Ras G12V from the K-Ras locus resulted in embryonic lethality. However, expression of these genes in adult mice led to different tumor phenotypes. Whereas H-Ras G12V elicited papillomas and hematopoietic tumors, K-Ras G12V induced lung tumors and gastric lesions. Pulmonary expression of H-Ras G12V created a senescence-like state caused by excessive MAPK signaling. Likewise, H-Ras G12V but not K-Ras G12V induced senescence in mouse embryonic fibroblasts. Label-free quantitative analysis revealed that minor differences in H-Ras G12V expression levels led to drastically different biological outputs, suggesting that subtle differences in MAPK signaling confer nonequivalent functions that influence tumor spectra induced by RAS oncoproteins. Cancer Res; 77(3); 707-18. ©2016 AACR. ©2016 American Association for Cancer Research.

  1. Interplay Between Oncoproteins and Antioxidant Enzymes in Esophageal Carcinoma Treated Without and With Chemoradiotherapy: A Prospective Study

    International Nuclear Information System (INIS)

    Kaur, Tranum; Gupta, Rajesh; Vaiphei, Kim; Kapoor, Rakesh; Gupta, N.M.; Khanduja, K.L.

    2008-01-01

    Purpose: To analyze p53, bcl-2, c-myc, and cyclooxygenase-2 protein expression changes and examine their relationship with various antioxidant enzymes in esophageal carcinoma patients. Methods and Materials: Patients in Group 1 underwent transhiatal esophagectomy and those in Group 2 were administered chemoradiotherapy followed by surgery after 4 weeks of neoadjuvant therapy. Results: The relationship analysis among the various protein markers and antioxidant enzymes showed an inverse correlation between bcl-2 and superoxide dismutase/catalase in tumor tissues, irrespective of the treatment arm followed. An important positive association was observed between bcl-2 and reduced glutathione levels in the tumor tissue of patients receiving neoadjuvant therapy. Another apoptosis-modulating marker, c-myc, in the tumor tissue of Group 2 patients showed similar pattern levels (high and low) as that of superoxide dismutase/catalase. The association of cyclooxygenase-2 and p53 with various antioxidant enzymes showed a significant positive correlation between cyclooxygenase-2 expression and catalase activity and an inverse trend between p53 expression and superoxide dismutase and catalase activity in the tumor tissue of patients given neoadjuvant therapy. In addition, patients with overexpressed p53 protein levels had lower glutathione peroxidase enzyme levels and vice versa in the tumor tissue of patients who had undergone surgery as their main mode of treatment. Conclusion: The results of this study broaden the insight into the relationships shared among oncoproteins and the antioxidant defense system, and this could be helpful in the clinical management of esophageal carcinoma

  2. HTLV-1 Tax Oncoprotein Subverts the Cellular DNA Damage Response via Binding to DNA-dependent Protein Kinase*S⃞

    Science.gov (United States)

    Durkin, Sarah S.; Guo, Xin; Fryrear, Kimberly A.; Mihaylova, Valia T.; Gupta, Saurabh K.; Belgnaoui, S. Mehdi; Haoudi, Abdelali; Kupfer, Gary M.; Semmes, O. John

    2008-01-01

    Human T-cell leukemia virus type-1 is the causative agent for adult T-cell leukemia. Previous research has established that the viral oncoprotein Tax mediates the transformation process by impairing cell cycle control and cellular response to DNA damage. We showed previously that Tax sequesters huChk2 within chromatin and impairs the response to ionizing radiation. Here we demonstrate that DNA-dependent protein kinase (DNA-PK) is a member of the Tax·Chk2 nuclear complex. The catalytic subunit, DNA-PKcs, and the regulatory subunit, Ku70, were present. Tax-containing nuclear extracts showed increased DNA-PK activity, and specific inhibition of DNA-PK prevented Tax-induced activation of Chk2 kinase activity. Expression of Tax induced foci formation and phosphorylation of H2AX. However, Tax-induced constitutive signaling of the DNA-PK pathway impaired cellular response to new damage, as reflected in suppression of ionizing radiation-induced DNA-PK phosphorylation and γH2AX stabilization. Tax co-localized with phospho-DNA-PK into nuclear speckles and a nuclear excluded Tax mutant sequestered endogenous phospho-DNA-PK into the cytoplasm, suggesting that Tax interaction with DNA-PK is an initiating event. We also describe a novel interaction between DNA-PK and Chk2 that requires Tax. We propose that Tax binds to and stabilizes a protein complex with DNA-PK and Chk2, resulting in a saturation of DNA-PK-mediated damage repair response. PMID:18957425

  3. Alternative Splicing and Caspase-Mediated Cleavage Generate Antagonistic Variants of the Stress Oncoprotein LEDGF/p75

    Science.gov (United States)

    Brown-Bryan, Terry A.; Leoh, Lai S.; Ganapathy, Vidya; Pacheco, Fabio J.; Mediavilla-Varela, Melanie; Filippova, Maria; Linkhart, Thomas A.; Gijsbers, Rik; Debyser, Zeger; Casiano, Carlos A.

    2009-01-01

    There is increasing evidence that an augmented state of cellular oxidative stress modulates the expression of stress genes implicated in diseases associated with health disparities such as certain cancers and diabetes. Lens epithelium–derived growth factor p75 (LEDGF/p75), also known as DFS70 autoantigen, is emerging as a survival oncoprotein that promotes resistance to oxidative stress–induced cell death and chemotherapy. We previously showed that LEDGF/p75 is targeted by autoantibodies in prostate cancer patients and is overexpressed in prostate tumors, and that its stress survival activity is abrogated during apoptosis. LEDGF/p75 has a COOH-terminally truncated splice variant, p52, whose role in stress survival and apoptosis has not been thoroughly investigated. We observed unbalanced expression of these proteins in a panel of tumor cell lines, with LEDGF/p75 generally expressed at higher levels. During apoptosis, caspase-3 cleaved p52 to generate a p38 fragment that lacked the NH2-terminal PWWP domain and failed to transactivate the Hsp27 promoter in reporter assays. However, p38 retained chromatin association properties and repressed the transactivation potential of LEDGF/p75. Overexpression of p52 or its variants with truncated PWWP domains in several tumor cell lines induced apoptosis, an activity that was linked to the presence of an intron-derived COOH-terminal sequence. These results implicate the PWWP domain of p52 in transcription function but not in chromatin association and proapoptotic activities. Consistent with their unbalanced expression in tumor cells, LEDGF/p75 and p52 seem to play antagonistic roles in the cellular stress response and could serve as targets for novel antitumor therapies. PMID:18708362

  4. Identification of target genes of synovial sarcoma-associated fusion oncoprotein using human pluripotent stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Hayakawa, Kazuo [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya (Japan); Ikeya, Makoto [Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Fukuta, Makoto [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya (Japan); Woltjen, Knut [Department of Reprogramming Sciences, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Tamaki, Sakura; Takahara, Naoko; Kato, Tomohisa; Sato, Shingo [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Otsuka, Takanobu [Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya (Japan); Toguchida, Junya, E-mail: togjun@frontier.kyoto-u.ac.jp [Department of Tissue Regeneration, Institute for Frontier Medical Sciences, Kyoto University, Kyoto (Japan); Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto (Japan); Department of Orthopaedic Surgery, Graduate School of Medicine, Kyoto University, Kyoto (Japan)

    2013-03-22

    Highlights: ► We tried to identify targets of synovial sarcoma (SS)-associated SYT–SSX fusion gene. ► We established pluripotent stem cell (PSC) lines with inducible SYT–SSX gene. ► SYT–SSX responsive genes were identified by the induction of SYT–SSX in PSC. ► SS-related genes were selected from database by in silico analyses. ► 51 genes were finally identified among SS-related genes as targets of SYT–SSX in PSC. -- Abstract: Synovial sarcoma (SS) is a malignant soft tissue tumor harboring chromosomal translocation t(X; 18)(p11.2; q11.2), which produces SS-specific fusion gene, SYT–SSX. Although precise function of SYT–SSX remains to be investigated, accumulating evidences suggest its role in gene regulation via epigenetic mechanisms, and the product of SYT–SSX target genes may serve as biomarkers of SS. Lack of knowledge about the cell-of-origin of SS, however, has placed obstacle in the way of target identification. Here we report a novel approach to identify SYT–SSX2 target genes using human pluripotent stem cells (hPSCs) containing a doxycycline-inducible SYT–SSX2 gene. SYT–SSX2 was efficiently induced both at mRNA and protein levels within three hours after doxycycline administration, while no morphological change of hPSCs was observed until 24 h. Serial microarray analyses identified genes of which the expression level changed more than twofold within 24 h. Surprisingly, the majority (297/312, 95.2%) were up-regulated genes and a result inconsistent with the current concept of SYT–SSX as a transcriptional repressor. Comparing these genes with SS-related genes which were selected by a series of in silico analyses, 49 and 2 genes were finally identified as candidates of up- and down-regulated target of SYT–SSX, respectively. Association of these genes with SYT–SSX in SS cells was confirmed by knockdown experiments. Expression profiles of SS-related genes in hPSCs and human mesenchymal stem cells (hMSCs) were strikingly

  5. Modulation of microRNA-mRNA Target Pairs by Human Papillomavirus 16 Oncoproteins

    Directory of Open Access Journals (Sweden)

    Mallory E. Harden

    2017-01-01

    Full Text Available The E6 and E7 proteins are the major oncogenic drivers encoded by high-risk human papillomaviruses (HPVs. While many aspects of the transforming activities of these proteins have been extensively studied, there are fewer studies that have investigated how HPV E6/E7 expression affects the expression of cellular noncoding RNAs. The goal of our study was to investigate HPV16 E6/E7 modulation of cellular microRNA (miR levels and to determine the potential consequences for cellular gene expression. We performed deep sequencing of small and large cellular RNAs in primary undifferentiated cultures of human foreskin keratinocytes (HFKs with stable expression of HPV16 E6/E7 or a control vector. After integration of the two data sets, we identified 51 differentially expressed cellular miRs associated with the modulation of 1,456 potential target mRNAs in HPV16 E6/E7-expressing HFKs. We discovered that the degree of differential miR expression in HFKs expressing HPV16 E6/E7 was not necessarily predictive of the number of corresponding mRNA targets or the potential impact on gene expression. Additional analyses of the identified miR-mRNA pairs suggest modulation of specific biological activities and biochemical pathways. Overall, our study supports the model that perturbation of cellular miR expression by HPV16 E6/E7 importantly contributes to the rewiring of cellular regulatory circuits by the high-risk HPV E6 and E7 proteins that contribute to oncogenic transformation.

  6. Aspirin therapy reduces the ability of platelets to promote colon and pancreatic cancer cell proliferation: Implications for the oncoprotein c-MYC

    Science.gov (United States)

    Sylman, Joanna L.; Ngo, Anh T. P.; Pang, Jiaqing; Sears, Rosalie C.; Williams, Craig D.; McCarty, Owen J. T.

    2017-01-01

    Aspirin, an anti-inflammatory and antithrombotic drug, has become the focus of intense research as a potential anticancer agent owing to its ability to reduce tumor proliferation in vitro and to prevent tumorigenesis in patients. Studies have found an anticancer effect of aspirin when used in low, antiplatelet doses. However, the mechanisms through which low-dose aspirin works are poorly understood. In this study, we aimed to determine the effect of aspirin on the cross talk between platelets and cancer cells. For our study, we used two colon cancer cell lines isolated from the same donor but characterized by different metastatic potential, SW480 (nonmetastatic) and SW620 (metastatic) cancer cells, and a pancreatic cancer cell line, PANC-1 (nonmetastatic). We found that SW480 and PANC-1 cancer cell proliferation was potentiated by human platelets in a manner dependent on the upregulation and activation of the oncoprotein c-MYC. The ability of platelets to upregulate c-MYC and cancer cell proliferation was reversed by an antiplatelet concentration of aspirin. In conclusion, we show for the first time that inhibition of platelets by aspirin can affect their ability to induce cancer cell proliferation through the modulation of the c-MYC oncoprotein. PMID:27903583

  7. Down-regulation of lipid raft-associated onco-proteins via cholesterol-dependent lipid raft internalization in docosahexaenoic acid-induced apoptosis.

    Science.gov (United States)

    Lee, Eun Jeong; Yun, Un-Jung; Koo, Kyung Hee; Sung, Jee Young; Shim, Jaegal; Ye, Sang-Kyu; Hong, Kyeong-Man; Kim, Yong-Nyun

    2014-01-01

    Lipid rafts, plasma membrane microdomains, are important for cell survival signaling and cholesterol is a critical lipid component for lipid raft integrity and function. DHA is known to have poor affinity for cholesterol and it influences lipid rafts. Here, we investigated a mechanism underlying the anti-cancer effects of DHA using a human breast cancer cell line, MDA-MB-231. We found that DHA decreased cell surface levels of lipid rafts via their internalization, which was partially reversed by cholesterol addition. With DHA treatment, caveolin-1, a marker for rafts, and EGFR were colocalized with LAMP-1, a lysosomal marker, in a cholesterol-dependent manner, indicating that DHA induces raft fusion with lysosomes. DHA not only displaced several raft-associated onco-proteins, including EGFR, Hsp90, Akt, and Src, from the rafts but also decreased total levels of those proteins via multiple pathways, including the proteasomal and lysosomal pathways, thereby decreasing their activities. Hsp90 overexpression maintained its client proteins, EGFR and Akt, and attenuated DHA-induced cell death. In addition, overexpression of Akt or constitutively active Akt attenuated DHA-induced apoptosis. All these data indicate that the anti-proliferative effect of DHA is mediated by targeting of lipid rafts via decreasing cell surface lipid rafts by their internalization, thereby decreasing raft-associated onco-proteins via proteasomal and lysosomal pathways and decreasing Hsp90 chaperone function. © 2013.

  8. Direct binding of the N-terminus of HTLV-1 tax oncoprotein to cyclin-dependent kinase 4 is a dominant path to stimulate the kinase activity.

    Science.gov (United States)

    Li, Junan; Li, Hongyuan; Tsai, Ming-Daw

    2003-06-10

    The involvement of Tax oncoprotein in the INK4-CDK4/6-Rb pathway has been regarded as a key factor for immortalization and transformation of human T-cell leukemia virus 1 (HTLV-1) infected cells. In both p16 -/- and +/+ cells, expression of Tax has been correlated with an increase in CDK4 activity, which subsequently increases the phosphorylation of Rb and drives the infected cells into cell cycle progression. In relation to these effects, Tax has been shown to interact with two components of the INK4-CDK4/6-Rb pathway, p16 and cyclin D(s). While Tax competes with CDK4 for p16 binding, thus suppressing p16 inhibition of CDK4, Tax also binds to cyclin D(s) with concomitant increases in both CDK4 activity and the phosphorylation of cyclin D(s). Here we show that both Tax and residues 1-40 of the N-terminus of Tax, Tax40N, bind to and activate CDK4 in vitro. In the presence of INK4 proteins, binding of Tax and Tax40N to CDK4 counteracts against the inhibition of p16 and p18 and acts as the major path to regulate Tax-mediated activation of CDK4. We also report that Tax40N retains the transactivation ability. These results of in vitro studies demonstrate a potentially novel, p16-independent route to regulate CDK4 activity by the Tax oncoprotein in HTLV-1 infected cells.

  9. Human papillomavirus E6 and E7 oncoproteins alter cell cycle progression but not radiosensitivity of carcinoma cells treated with low-dose-rate radiation

    International Nuclear Information System (INIS)

    DeWeese, Theodore L.; Walsh, Jonathan C.; Dillehay, Larry E.; Kessis, Theodore D.; Hedrick, Lora; Cho, Kathleen R.; Nelson, William G.

    1997-01-01

    Purpose: Low-dose-rate radiation therapy has been widely used in the treatment of urogenital malignancies. When continuously exposed to low-dose-rate ionizing radiation, target cancer cells typically exhibit abnormalities in replicative cell-cycle progression. Cancer cells that arrest in the G2 phase of the cell cycle when irradiated may become exquisitely sensitive to killing by further low-dose-rate radiation treatment. Oncogenic human papillomaviruses (HPVs), which play a major role in the pathogenesis of uterine cervix cancers and other urogenital cancers, encode E6 and E7 transforming proteins known to abrogate a p53-dependent G1 cell-cycle checkpoint activated by conventional acute-dose radiation exposure. This study examined whether expression of HPV E6 and E7 oncoproteins by cancer cells alters the cell-cycle redistribution patterns accompanying low-dose-rate radiation treatment, and whether such alterations in cell-cycle redistribution affect cancer cell killing. Methods and Materials: RKO carcinoma cells, which contain wild-type P53 alleles, and RKO cell sublines genetically engineered to express HPV E6 and E7 oncoproteins, were treated with low-dose-rate (0.25-Gy/h) radiation and then assessed for p53 and p21WAF1/CIP1 polypeptide induction by immunoblot analysis, for cell-cycle redistribution by flow cytometry, and for cytotoxicity by clonogenic survival assay. Results: Low-dose-rate radiation of RKO carcinoma cells triggered p53 polypeptide elevations, p21WAF1/CIP1 induction, and arrest in the G1 and G2 phases of the cell cycle. In contrast, RKO cells expressing E6 and E7 transforming proteins from high-risk oncogenic HPVs (HPV 16) arrested in G2, but failed to arrest in G1, when treated with low-dose-rate ionizing radiation. Abrogation of the G1 cell-cycle checkpoint activated by low-dose-rate radiation exposure appeared to be a characteristic feature of transforming proteins from high-risk oncogenic HPVs: RKO cells expressing E6 from a low

  10. c-Jun Proto-Oncoprotein Plays a Protective Role in Lung Epithelial Cells Exposed to Staphylococcal α-Toxin

    Directory of Open Access Journals (Sweden)

    Alejandro J. Moyano

    2018-05-01

    Full Text Available c-Jun is a member of the early mammalian transcriptional regulators belonging to the AP-1 family, which participates in a wide range of cellular processes such as proliferation, apoptosis, tumorigenesis, and differentiation. Despite its established role in cell survival upon stress, its participation in the stress response induced by bacterial infections has been poorly investigated. To study the potential role of c-Jun in this context we choose the widely studied α-toxin produced by Staphylococcus aureus, a pore-forming toxin that is a critical virulence factor in the pathogenesis of these bacteria. We analyzed the effect of α-toxin treatment in the activation, expression, and protein levels of c-Jun in A549 lung epithelial cells. Furthermore, we explored the role of c-Jun in the cellular fate after exposure to α-toxin. Our results show that staphylococcal α-toxin per se is able to activate c-Jun by inducing phosphorylation of its Serine 73 residue. Silencing of the JNK (c-Jun N-terminal Kinase signaling pathway abrogated most of this activation. On the contrary, silencing of the ERK (Extracellular Signal-Regulated Kinase pathway exacerbated this response. Intriguingly, while the exposure to α-toxin induced a marked increase in the levels of c-Jun transcripts, c-Jun protein levels noticeably decreased in the same time-frame as a consequence of active proteolytic degradation through the proteasome-dependent pathway. In addition, we established that c-Jun promoted cell survival when cells were challenged with α-toxin. Similarly, c-Jun phosphorylation was also induced in cells upon intoxication with the cytolysin produced by Vibrio cholerae in a JNK-dependent manner, suggesting that c-Jun-JNK axis would be a conserved responsive cellular pathway to pore-forming toxins. This study contributes to understanding the role of the multifaceted c-Jun proto-oncoprotein in cell response to bacterial pore-forming toxins, positioning it as a relevant

  11. UV Radiation Activates Toll-Like Receptor 9 Expression in Primary Human Keratinocytes, an Event Inhibited by Human Papillomavirus 38 E6 and E7 Oncoproteins.

    Science.gov (United States)

    Pacini, Laura; Ceraolo, Maria Grazia; Venuti, Assunta; Melita, Giusi; Hasan, Uzma A; Accardi, Rosita; Tommasino, Massimo

    2017-10-01

    Several lines of evidence indicate that cutaneous human papillomavirus (HPV) types belonging to the beta genus of the HPV phylogenetic tree synergize with UV radiation in the development of skin cancer. Accordingly, the E6 and E7 oncoproteins from some beta HPV types are able to deregulate pathways related to immune response and cellular transformation. Toll-like receptor 9 (TLR9), in addition to playing a role in innate immunity, has been shown to be involved in the cellular stress response. Using primary human keratinocytes as experimental models, we have shown that UV irradiation (and other cellular stresses) activates TLR9 expression. This event is closely linked to p53 activation. Silencing the expression of p53 or deleting its encoding gene affected the activation of TLR9 expression after UV irradiation. Using various strategies, we have also shown that the transcription factors p53 and c-Jun are recruited onto a specific region of the TLR9 promoter after UV irradiation. Importantly, the E6 and E7 oncoproteins from beta HPV38, by inducing the accumulation of the p53 antagonist ΔNp73α, prevent the UV-mediated recruitment of these transcription factors onto the TLR9 promoter, with subsequent impairment of TLR9 gene expression. This study provides new insight into the mechanism that mediates TLR9 upregulation in response to cellular stresses. In addition, we show that HPV38 E6 and E7 are able to interfere with this mechanism, providing another explanation for the possible cooperation of beta HPV types with UV radiation in skin carcinogenesis. IMPORTANCE Beta HPV types have been suggested to act as cofactors in UV-induced skin carcinogenesis by altering several cellular mechanisms activated by UV radiation. We show that the expression of TLR9, a sensor of damage-associated molecular patterns produced during cellular stress, is activated by UV radiation in primary human keratinocytes (PHKs). Two transcription factors known to be activated by UV radiation, p53

  12. Role of adapter function in oncoprotein-mediated activation of NF-kappaB. Human T-cell leukemia virus type I Tax interacts directly with IkappaB kinase gamma.

    Science.gov (United States)

    Jin, D Y; Giordano, V; Kibler, K V; Nakano, H; Jeang, K T

    1999-06-18

    Mechanisms by which the human T-cell leukemia virus type I Tax oncoprotein activates NF-kappaB remain incompletely understood. Although others have described an interaction between Tax and a holo-IkappaB kinase (IKK) complex, the exact details of protein-protein contact are not fully defined. Here we show that Tax binds to neither IKK-alpha nor IKK-beta but instead complexes directly with IKK-gamma, a newly characterized component of the IKK complex. This direct interaction with IKK-gamma correlates with Tax-induced IkappaB-alpha phosphorylation and NF-kappaB activation. Thus, our findings establish IKK-gamma as a key molecule for adapting an oncoprotein-specific signaling to IKK-alpha and IKK-beta.

  13. Restoration of type 1 iodothyronine deiodinase expression in renal cancer cells downregulates oncoproteins and affects key metabolic pathways as well as anti-oxidative system.

    Science.gov (United States)

    Popławski, Piotr; Wiśniewski, Jacek R; Rijntjes, Eddy; Richards, Keith; Rybicka, Beata; Köhrle, Josef; Piekiełko-Witkowska, Agnieszka

    2017-01-01

    Type 1 iodothyronine deiodinase (DIO1) contributes to deiodination of 3,5,3',5'-tetraiodo-L-thyronine (thyroxine, T4) yielding of 3,5,3'-triiodothyronine (T3), a powerful regulator of cell differentiation, proliferation, and metabolism. Our previous work showed that loss of DIO1 enhances proliferation and migration of renal cancer cells. However, the global effects of DIO1 expression in various tissues affected by cancer remain unknown. Here, the effects of stable DIO1 re-expression were analyzed on the proteome of renal cancer cells, followed by quantitative real-time PCR validation in two renal cancer-derived cell lines. DIO1-induced changes in intracellular concentrations of thyroid hormones were quantified by L-MS/MS and correlations between expression of DIO1 and potential target genes were determined in tissue samples from renal cancer patients. Stable re-expression of DIO1, resulted in 26 downregulated proteins while 59 proteins were overexpressed in renal cancer cells. The 'downregulated' group consisted mainly of oncoproteins (e.g. STAT3, ANPEP, TGFBI, TGM2) that promote proliferation, migration and invasion. Furthermore, DIO1 re-expression enhanced concentrations of two subunits of thyroid hormone transporter (SLC7A5, SLC3A2), enzymes of key pathways of cellular energy metabolism (e.g. TKT, NAMPT, IDH2), sex steroid metabolism and anti-oxidative response (AKR1C2, AKR1B10). DIO1 expression resulted in elevated intracellular concentration of T4. Expression of DIO1-affected genes strongly correlated with DIO1 transcript levels in tissue samples from renal cancer patients as well as with their poor survival. This first study addressing effects of deiodinase re-expression on proteome of cancer cells demonstrates that induced DIO1 re-expression in renal cancer robustly downregulates oncoproteins, affects key metabolic pathways, and triggers proteins involved in anti-oxidative protection. This data supports the notion that suppressed DIO1 expression and changes

  14. Restoration of type 1 iodothyronine deiodinase expression in renal cancer cells downregulates oncoproteins and affects key metabolic pathways as well as anti-oxidative system.

    Directory of Open Access Journals (Sweden)

    Piotr Popławski

    Full Text Available Type 1 iodothyronine deiodinase (DIO1 contributes to deiodination of 3,5,3',5'-tetraiodo-L-thyronine (thyroxine, T4 yielding of 3,5,3'-triiodothyronine (T3, a powerful regulator of cell differentiation, proliferation, and metabolism. Our previous work showed that loss of DIO1 enhances proliferation and migration of renal cancer cells. However, the global effects of DIO1 expression in various tissues affected by cancer remain unknown. Here, the effects of stable DIO1 re-expression were analyzed on the proteome of renal cancer cells, followed by quantitative real-time PCR validation in two renal cancer-derived cell lines. DIO1-induced changes in intracellular concentrations of thyroid hormones were quantified by L-MS/MS and correlations between expression of DIO1 and potential target genes were determined in tissue samples from renal cancer patients. Stable re-expression of DIO1, resulted in 26 downregulated proteins while 59 proteins were overexpressed in renal cancer cells. The 'downregulated' group consisted mainly of oncoproteins (e.g. STAT3, ANPEP, TGFBI, TGM2 that promote proliferation, migration and invasion. Furthermore, DIO1 re-expression enhanced concentrations of two subunits of thyroid hormone transporter (SLC7A5, SLC3A2, enzymes of key pathways of cellular energy metabolism (e.g. TKT, NAMPT, IDH2, sex steroid metabolism and anti-oxidative response (AKR1C2, AKR1B10. DIO1 expression resulted in elevated intracellular concentration of T4. Expression of DIO1-affected genes strongly correlated with DIO1 transcript levels in tissue samples from renal cancer patients as well as with their poor survival. This first study addressing effects of deiodinase re-expression on proteome of cancer cells demonstrates that induced DIO1 re-expression in renal cancer robustly downregulates oncoproteins, affects key metabolic pathways, and triggers proteins involved in anti-oxidative protection. This data supports the notion that suppressed DIO1 expression

  15. Targeting MUC1-C suppresses polycomb repressive complex 1 in multiple myeloma.

    Science.gov (United States)

    Tagde, Ashujit; Markert, Tahireh; Rajabi, Hasan; Hiraki, Masayuki; Alam, Maroof; Bouillez, Audrey; Avigan, David; Anderson, Kenneth; Kufe, Donald

    2017-09-19

    The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM cell survival. The present studies show that targeting MUC1-C with (i) stable and inducible silencing and CRISPR/Cas9 editing and (ii) the pharmacologic inhibitor GO-203, which blocks MUC1-C function, downregulates BMI1, RING1 and RING2 expression. The results demonstrate that MUC1-C drives BMI1 transcription by a MYC-dependent mechanism. MUC1-C thus promotes MYC occupancy on the BMI1 promoter and thereby activates BMI1 expression. We also show that the MUC1-C→MYC pathway induces RING2 expression. Moreover, in contrast to BMI1 and RING2, we found that MUC1-C drives RING1 by an NF-κB p65-dependent mechanism. Targeting MUC1-C and thereby the suppression of these key PRC1 proteins was associated with downregulation of the PRC1 E3 ligase activity as evidenced by decreases in ubiquitylation of histone H2A. Targeting MUC1-C also resulted in activation of the PRC1-repressed tumor suppressor genes, PTEN, CDNK2A and BIM . These findings identify a heretofore unrecognized role for MUC1-C in the epigenetic regulation of MM cells.

  16. PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein augments the transforming activity in a rat fibroblast cell line

    International Nuclear Information System (INIS)

    Hirata, Akira; Higuchi, Masaya; Niinuma, Akiko; Ohashi, Minako; Fukushi, Masaya; Oie, Masayasu; Akiyama, Tetsu; Tanaka, Yuetsu; Gejyo, Fumitake; Fujii, Masahiro

    2004-01-01

    While human T-cell leukemia virus type 1 (HTLV-1) is associated with the development of adult T-cell leukemia (ATL), HTLV-2 has not been reported to be associated with such malignant leukemias. HTLV-1 Tax1 oncoprotein transforms a rat fibroblast cell line (Rat-1) to form multiple large colonies in soft agar, and this activity is much greater than that of HTLV-2 Tax2. We have demonstrated here that the increased number of transformed colonies induced by Tax1 relative to Tax2 was mediated by a PDZ domain-binding motif (PBM) in Tax1, which is absent in Tax2. Tax1 PBM mediated the interaction of Tax1 with the discs large (Dlg) tumor suppressor containing PDZ domains, and the interaction correlated well with the transforming activities of Tax1 and the mutants. Through this interaction, Tax1 altered the subcellular localization of Dlg from the detergent-soluble to the detergent-insoluble fraction in a fibroblast cell line as well as in HTLV-1-infected T-cell lines. These results suggest that the interaction of Tax1 with PDZ domain protein(s) is critically involved in the transforming activity of Tax1, the activity of which may be a crucial factor in malignant transformation of HTLV-1-infected cells in vivo

  17. The E7 oncoprotein of high-risk human papillomavirus type 16 enters the nucleus via a nonclassical Ran-dependent pathway

    International Nuclear Information System (INIS)

    Angeline, Michael; Merle, Eric; Moroianu, Junona

    2003-01-01

    E7, the major transforming protein of high-risk human papillomavirus (HPV), type 16, binds and inactivates the retinoblastoma protein (pRb), and the Rb-related proteins p107 and p130. HPV16 E7 is a nuclear protein lacking a classical basic nuclear localization signal. In this study we investigated the nuclear import of HPV16 E7 oncoprotein in digitonin-permeabilized HeLa cells. HPV16 E7 nuclear import was independent of pRb, as an E7 ΔDLYC variant defective in pRb binding was imported into the nuclei of digitonin-permeabilized cells as efficiently as wild-type E7 in the presence of exogenous cytosol. Interestingly, we discovered that HPV16 E7 is imported into the nuclei via a novel pathway different from those mediated by Kap α2β1 heterodimers, Kap β1, or Kap β2. Nuclear accumulation of E7 required Ran and was not inhibited by the RanG19V-GTP variant, an inhibitor of Kap β mediated import pathways. Together the data suggest that HPV16 E7 translocates through the nuclear pores via a nonclassical Ran-dependent pathway, independent of the main cytosolic Kap β import receptors

  18. Changes in global gene expression profiles induced by HPV 16 E6 oncoprotein variants in cervical carcinoma C33-A cells

    International Nuclear Information System (INIS)

    Zacapala-Gómez, Ana Elvira; Del Moral-Hernández, Oscar; Villegas-Sepúlveda, Nicolás; Hidalgo-Miranda, Alfredo; Romero-Córdoba, Sandra Lorena

    2016-01-01

    We analyzed the effects of the expression of HPV 16 E6 oncoprotein variants (AA-a, AA-c, E-A176/G350, E-C188/G350, E-G350), and the E-Prototype in global gene expression profiles in an in vitro model. E6 gene was cloned into an expression vector fused to GFP and was transfected in C33-A cells. Affymetrix GeneChip Human Transcriptome Array 2.0 platform was used to analyze the expression of over 245,000 coding transcripts. We found that HPV16 E6 variants altered the expression of 387 different genes in comparison with E-Prototype. The altered genes are involved in cellular processes related to the development of cervical carcinoma, such as adhesion, angiogenesis, apoptosis, differentiation, cell cycle, proliferation, transcription and protein translation. Our results show that polymorphic changes in HPV16 E6 natural variants are sufficient to alter the overall gene expression profile in C33-A cells, explaining in part the observed differences in oncogenic potential of HPV16 variants. - Highlights: • Amino acid changes in HPV16 E6 variants modulate the transciption of specific genes. • This is the first comparison of global gene expression profile of HPV 16 E6 variants. • Each HPV 16 E6 variant appears to have its own molecular signature.

  19. Changes in global gene expression profiles induced by HPV 16 E6 oncoprotein variants in cervical carcinoma C33-A cells

    Energy Technology Data Exchange (ETDEWEB)

    Zacapala-Gómez, Ana Elvira, E-mail: zak_ana@yahoo.com.mx [Laboratorio de Biomedicina Molecular, Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma de Guerrero, Chilpancingo, Gro., México (Mexico); Del Moral-Hernández, Oscar, E-mail: odelmoralh@gmail.com [Laboratorio de Biomedicina Molecular, Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma de Guerrero, Chilpancingo, Gro., México (Mexico); Villegas-Sepúlveda, Nicolás, E-mail: nvillega@cinvestav.mx [Departamento de Biomedicina Molecular, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional (CINVESTAV-IPN), México, D.F., México (Mexico); Hidalgo-Miranda, Alfredo, E-mail: ahidalgo@inmegen.gob.mx [Laboratorio de Genómica del Cáncer, Instituto Nacional de Medicina Genómica (INMEGEN), México, D.F., México (Mexico); Romero-Córdoba, Sandra Lorena, E-mail: sromero_cordoba@hotmail.com [Laboratorio de Genómica del Cáncer, Instituto Nacional de Medicina Genómica (INMEGEN), México, D.F., México (Mexico); and others

    2016-01-15

    We analyzed the effects of the expression of HPV 16 E6 oncoprotein variants (AA-a, AA-c, E-A176/G350, E-C188/G350, E-G350), and the E-Prototype in global gene expression profiles in an in vitro model. E6 gene was cloned into an expression vector fused to GFP and was transfected in C33-A cells. Affymetrix GeneChip Human Transcriptome Array 2.0 platform was used to analyze the expression of over 245,000 coding transcripts. We found that HPV16 E6 variants altered the expression of 387 different genes in comparison with E-Prototype. The altered genes are involved in cellular processes related to the development of cervical carcinoma, such as adhesion, angiogenesis, apoptosis, differentiation, cell cycle, proliferation, transcription and protein translation. Our results show that polymorphic changes in HPV16 E6 natural variants are sufficient to alter the overall gene expression profile in C33-A cells, explaining in part the observed differences in oncogenic potential of HPV16 variants. - Highlights: • Amino acid changes in HPV16 E6 variants modulate the transciption of specific genes. • This is the first comparison of global gene expression profile of HPV 16 E6 variants. • Each HPV 16 E6 variant appears to have its own molecular signature.

  20. Nuclear import of cutaneous beta genus HPV8 E7 oncoprotein is mediated by hydrophobic interactions between its zinc-binding domain and FG nucleoporins

    Energy Technology Data Exchange (ETDEWEB)

    Onder, Zeynep; Moroianu, Junona, E-mail: moroianu@bc.edu

    2014-01-20

    We have previously discovered and characterized the nuclear import pathways for the E7 oncoproteins of mucosal alpha genus HPVs, type 16 and 11. Here we investigated the nuclear import of cutaneous beta genus HPV8 E7 protein using confocal microscopy after transfections of HeLa cells with EGFP-8E7 and mutant plasmids and nuclear import assays in digitonin-permeabilized HeLa cells. We determined that HPV8 E7 contains a nuclear localization signal (NLS) within its zinc-binding domain that mediates its nuclear import. Furthermore, we discovered that a mostly hydrophobic patch {sub 65}LRLFV{sub 69} within the zinc-binding domain is essential for the nuclear import and localization of HPV8 E7 via hydrophobic interactions with the FG nucleoporins Nup62 and Nup153. Substitution of the hydrophobic residues within the {sub 65}LRLFV{sub 69} patch to alanines, and not R66A mutation, disrupt the interactions between the 8E7 zinc-binding domain and Nup62 and Nup153 and consequently inhibit nuclear import of HPV8 E7. - Highlights: • HPV8 E7 has a cNLS within its zinc-binding domain that mediates its nuclear import. • Discovery of a hydrophobic patch that is critical for the nuclear import of HPV8 E7. • HPV8 E7 nuclear import is mediated by hydrophobic interactions with FG-Nups, Nup62 and Nup153.

  1. Rhodium(II) Proximity-Labeling Identifies a Novel Target Site on STAT3 for Inhibitors with Potent Anti-Leukemia Activity.

    Science.gov (United States)

    Minus, Matthew B; Liu, Wei; Vohidov, Farrukh; Kasembeli, Moses M; Long, Xin; Krueger, Michael J; Stevens, Alexandra; Kolosov, Mikhail I; Tweardy, David J; Sison, Edward Allan R; Redell, Michele S; Ball, Zachary T

    2015-10-26

    Nearly 40 % of children with acute myeloid leukemia (AML) suffer relapse arising from chemoresistance, often involving upregulation of the oncoprotein STAT3 (signal transducer and activator of transcription 3). Herein, rhodium(II)-catalyzed, proximity-driven modification identifies the STAT3 coiled-coil domain (CCD) as a novel ligand-binding site, and we describe a new naphthalene sulfonamide inhibitor that targets the CCD, blocks STAT3 function, and halts its disease-promoting effects in vitro, in tumor growth models, and in a leukemia mouse model, validating this new therapeutic target for resistant AML. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Human T-cell leukemia virus type 1 Tax oncoprotein represses the expression of the BCL11B tumor suppressor in T-cells

    Science.gov (United States)

    Takachi, Takayuki; Takahashi, Masahiko; Takahashi-Yoshita, Manami; Higuchi, Masaya; Obata, Miki; Mishima, Yukio; Okuda, Shujiro; Tanaka, Yuetsu; Matsuoka, Masao; Saitoh, Akihiko; Green, Patrick L; Fujii, Masahiro

    2015-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is the etiological agent of adult T cell leukemia (ATL), which is an aggressive form of T-cell malignancy. HTLV-1 oncoproteins, Tax and HBZ, play crucial roles in the immortalization of T-cells and/or leukemogenesis by dysregulating the cellular functions in the host. Recent studies show that HTLV-1-infected T-cells have reduced expression of the BCL11B tumor suppressor protein. In the present study, we explored whether Tax and/or HBZ play a role in downregulating BCL11B in HTLV-1-infected T-cells. Lentiviral transduction of Tax in a human T-cell line repressed the expression of BCL11B at both the protein and mRNA levels, whereas the transduction of HBZ had little effect on the expression. Tax mutants with a decreased activity for the NF-κB, CREB or PDZ protein pathways still showed a reduced expression of the BCL11B protein, thereby implicating a different function of Tax in BCL11B downregulation. In addition, the HTLV-2 Tax2 protein reduced the BCL11B protein expression in T-cells. Seven HTLV-1-infected T-cell lines, including three ATL-derived cell lines, showed reduced BCL11B mRNA and protein expression relative to an uninfected T-cell line, and the greatest reductions were in the cells expressing Tax. Collectively, these results indicate that Tax is responsible for suppressing BCL11B protein expression in HTLV-1-infected T-cells; Tax-mediated repression of BCL11B is another mechanism that Tax uses to promote oncogenesis of HTLV-1-infected T-cells. PMID:25613934

  3. Evaluation of tumor markers (HER-2/neu oncoprotein, CEA, and CA 15.3) in patients with locoregional breast cancer: prognostic value.

    Science.gov (United States)

    Molina, Rafael; Augé, Jose M; Escudero, Jose M; Filella, Xavier; Zanon, Gabriel; Pahisa, Jaume; Farrus, Blanca; Muñoz, Montserrat; Velasco, Martin

    2010-06-01

    Tumor markers were studied in the sera of 883 untreated patients with primary breast cancer diagnosed between 1989 and 2007. Abnormal human epidermal growth factor receptor 2 (HER-2)/neu levels (>15 ng/mL) were found in 9.5%, carcinoembryonic antigen (CEA) in 15.9%, and cancer antigen (CA) 15.3 in 19.7% of the patients. One or more tumor markers were abnormal in 305 (34.5%) of the 883 studied patients. Significantly higher serum HER-2/neu levels were found in patients with tissue overexpression of this oncoprotein (p CEA, CA 15.3, and HER-2/neu (only in those patients with tissue overexpression) serum levels were related with tumor stage (tumor size and nodal involvement) and steroid receptors (higher values in estrogen receptor-negative (ER-) tumors). Univariate analysis showed that HER-2/neu serum levels were prognostic factors in disease-free survival (DFS) and overall survival (OS) only in patients with tissue overexpression. Multivariate analysis in 834 patients show that nodal involvement, tumor size, ER, CEA, and adjuvant treatment were independent prognostic factors in DFS and OS. When only patients with HER-2/neu overexpression in tissue were studied, tumor size, nodal involvement, and tumor markers (one or another positive) were independent prognostic factors for both DFS and OS. HER-2/neu serum levels were also an independent prognostic factor, with CEA, ER, and nodes in 106 patients treated with neoadjuvant treatment. In summary, serum HER-2/neu, CEA, and CA 15.3 are useful tools in the prognostic evaluation of patients with primary breast cancer.

  4. Phosphorylation of the Mdm2 oncoprotein by the c-Abl tyrosine kinase regulates p53 tumor suppression and the radiosensitivity of mice.

    Science.gov (United States)

    Carr, Michael I; Roderick, Justine E; Zhang, Hong; Woda, Bruce A; Kelliher, Michelle A; Jones, Stephen N

    2016-12-27

    The p53 tumor suppressor acts as a guardian of the genome by preventing the propagation of DNA damage-induced breaks and mutations to subsequent generations of cells. We have previously shown that phosphorylation of the Mdm2 oncoprotein at Ser394 by the ATM kinase is required for robust p53 stabilization and activation in cells treated with ionizing radiation, and that loss of Mdm2 Ser394 phosphorylation leads to spontaneous tumorigenesis and radioresistance in Mdm2 S394A mice. Previous in vitro data indicate that the c-Abl kinase phosphorylates Mdm2 at the neighboring residue (Tyr393) in response to DNA damage to regulate p53-dependent apoptosis. In this present study, we have generated an Mdm2 mutant mouse (Mdm2 Y393F ) to determine whether c-Abl phosphorylation of Mdm2 regulates the p53-mediated DNA damage response or p53 tumor suppression in vivo. The Mdm2 Y393F mice develop accelerated spontaneous and oncogene-induced tumors, yet display no defects in p53 stabilization and activity following acute genotoxic stress. Although apoptosis is unaltered in these mice, they recover more rapidly from radiation-induced bone marrow ablation and are more resistant to whole-body radiation-induced lethality. These data reveal an in vivo role for c-Abl phosphorylation of Mdm2 in regulation of p53 tumor suppression and bone marrow failure. However, c-Abl phosphorylation of Mdm2 Tyr393 appears to play a lesser role in governing Mdm2-p53 signaling than ATM phosphorylation of Mdm2 Ser394. Furthermore, the effects of these phosphorylation events on p53 regulation are not additive, as Mdm2 Y393F/S394A mice and Mdm2 S394A mice display similar phenotypes.

  5. The small Rho GTPase Rac1 controls normal human dermal fibroblasts proliferation with phosphorylation of the oncoprotein c-myc

    International Nuclear Information System (INIS)

    Nikolova, Ekaterina; Mitev, Vanio; Zhelev, Nikolai; Deroanne, Christophe F.; Poumay, Yves

    2007-01-01

    Proliferation of dermal fibroblasts is crucial for the maintenance of skin. The small Rho GTPase, Rac1, has been identified as a key transducer of proliferative signals in various cell types, but in normal human dermal fibroblasts its significance to cell growth control has not been studied. In this study, we applied the method of RNA interference to suppress endogenous Rac1 expression and examined the consequences on human skin fibroblasts. Rac1 knock-down resulted in inhibition of DNA synthesis. This effect was not mediated by inhibition of the central transducer of proliferative stimuli, ERK1/2 or by activation of the pro-apoptotic p38. Rather, as a consequence of the suppressed Rac1 expression we observed a significant decrease in phosphorylation of c-myc, revealing for the first time that in human fibroblasts Rac1 exerts control on proliferation through c-myc phosphorylation. Thus Rac1 activates proliferation of normal fibroblasts through stimulation of c-myc phosphorylation without affecting ERK1/2 activity

  6. Human papillomavirus E5 oncoproteins bind the A4 endoplasmic reticulum protein to regulate proliferative ability upon differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Kotnik Halavaty, Katarina; Regan, Jennifer; Mehta, Kavi; Laimins, Laimonis, E-mail: l-laimins@northwestern.edu

    2014-03-15

    Human papillomaviruses (HPV) infect stratified epithelia and link their life cycles to epithelial differentiation. The HPV E5 protein plays a role in the productive phase of the HPV life cycle but its mechanism of action is still unclear. We identify a new binding partner of E5, A4, using a membrane-associated yeast-two hybrid system. The A4 protein co-localizes with HPV 31 E5 in perinuclear regions and forms complexes with E5 and Bap31. In normal keratinocytes, A4 is found primarily in basal cells while in HPV positive cells high levels of A4 are seen in both undifferentiated and differentiated cells. Reduction of A4 expression by shRNAs, enhanced HPV genome amplification and increased cell proliferation ability following differentiation but this was not seen in cells lacking E5. Our studies suggest that the A4 protein is an important E5 binding partner that plays a role in regulating cell proliferation ability upon differentiation. - Highlights: • A4 associates with HPV 31 E5 proteins. • A4 is localized to endoplasmic reticulum. • HPV proteins induce A4 expression in suprabasal layers of stratified epithelium. • E5 is important for proliferation ability of differentiating HPV positive cells.

  7. Differential expression of galectin-3, CK19, HBME1, and Ret oncoprotein in the diagnosis of thyroid neoplasms by fine needle aspiration biopsy

    Directory of Open Access Journals (Sweden)

    Saleh Husain

    2009-01-01

    Full Text Available Background: Fine needle aspiration biopsy (FNAB is a common and excellent procedure for the evaluation of thyroid lesions that require surgical resection. At times, the FNAB diagnosis can be difficult, particularly of follicular-patterned lesions. Previous studies have shown that some immunohistochemical (IHC markers may be helpful in establishing more accurate diagnosis. In this study, our goal was to evaluate four of the recently investigated markers in differentiating benign from malignant thyroid nodules on FNABs. Materials and Methods: We performed IHC staining of galectin-3, Ret oncoprotein (Ret, HBME-1, and cytokeratin 19 (CK19, on cell block sections of thyroid FNAB cases that had corresponding surgical resections. They included 44 benign lesions (37 hyperplastic or cellular nodules, HN; and 7 follicular adenomas, FA and 27 malignant tumors (6 follicular carcinoma, FC; 19 classic papillary carcinoma, PTC; and 2 follicular variant of papillary carcinoma, FVPC. The stains were done according to the standard avidin-biotin-peroxidase method. Results: Statistical analysis showed that immunoexpression was significantly higher in the malignant group for all four markers. The sensitivity for positive expression for all benign lesions versus malignant tumors was as follows: 10/44 (22.7% versus 25/27 (92.6% for galectin-3; 14/44 (31.8% versus 23/27 (85% for Ret; 12/44 (27.3% versus 24/27 (88.8% for HBME-1; and 13/44 (29.5% versus 23/27 (85% for CK19. The sensitivity and specificity was highest for galectin-3 (92.6% and 77.3%, respectively followed by HMBE-1 (88.9% and 72.7%, respectively. When combining the markers′ expressions, the panel of galectin-3 + HBME-1 showed the highest sensitivity and specificity (90.7% and 75%, respectively, but this was, however, lower than galectin-3 alone (92.3% and 77.3%, respectively. Conclusion: We conclude that galectin-3 is the best single marker in differentiating benign from malignant thyroid lesions with

  8. Induction of Epstein-Barr Virus Oncoprotein LMP1 by Transcription Factors AP-2 and Early B Cell Factor

    Science.gov (United States)

    Noda, Chieko; Narita, Yohei; Watanabe, Takahiro; Yoshida, Masahiro; Ashio, Keiji; Sato, Yoshitaka; Goshima, Fumi; Kanda, Teru; Yoshiyama, Hironori; Tsurumi, Tatsuya; Kimura, Hiroshi

    2016-01-01

    ABSTRACT Latent membrane protein 1 (LMP1) is a major oncogene essential for primary B cell transformation by Epstein-Barr virus (EBV). Previous studies suggested that some transcription factors, such as PU.1, RBP-Jκ, NF-κB, and STAT, are involved in this expression, but the underlying mechanism is unclear. Here, we identified binding sites for PAX5, AP-2, and EBF in the proximal LMP1 promoter (ED-L1p). We first confirmed the significance of PU.1 and POU domain transcription factor binding for activation of the promoter in latency III. We then focused on the transcription factors AP-2 and early B cell factor (EBF). Interestingly, among the three AP-2-binding sites in the LMP1 promoter, two motifs were also bound by EBF. Overexpression, knockdown, and mutagenesis in the context of the viral genome indicated that AP-2 plays an important role in LMP1 expression in latency II in epithelial cells. In latency III B cells, on the other hand, the B cell-specific transcription factor EBF binds to the ED-L1p and activates LMP1 transcription from the promoter. IMPORTANCE Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) is crucial for B cell transformation and oncogenesis of other EBV-related malignancies, such as nasopharyngeal carcinoma and T/NK lymphoma. Its expression is largely dependent on the cell type or condition, and some transcription factors have been implicated in its regulation. However, these previous reports evaluated the significance of specific factors mostly by reporter assay. In this study, we prepared point-mutated EBV at the binding sites of such transcription factors and confirmed the importance of AP-2, EBF, PU.1, and POU domain factors. Our results will provide insight into the transcriptional regulation of the major oncogene LMP1. PMID:26819314

  9. Oncoprotein protein kinase antibody kit

    Science.gov (United States)

    Karin, Michael [San Diego, CA; Hibi, Masahiko [San Diego, CA; Lin, Anning [La Jolla, CA

    2008-12-23

    An isolated polypeptide (JNK) characterized by having a molecular weight of 46 kD as determined by reducing SDS-PAGE, having serine and threonine kinase activity, phosphorylating the c-Jun N-terminal activation domain and polynucleotide sequences and method of detection of JNK are provided herein. JNK phosphorylates c-Jun N-terminal activation domain which affects gene expression from AP-1 sites.

  10. Acetylation of the c-MYC oncoprotein is required for cooperation with the HTLV-1 p30{sup II} accessory protein and the induction of oncogenic cellular transformation by p30{sup II}/c-MYC

    Energy Technology Data Exchange (ETDEWEB)

    Romeo, Megan M.; Ko, Bookyung; Kim, Janice; Brady, Rebecca; Heatley, Hayley C.; He, Jeffrey; Harrod, Carolyn K.; Barnett, Braden [Laboratory of Molecular Virology, Department of Biological Sciences, and The Dedman College Center for Drug Discovery, Design, and Delivery, Southern Methodist University, Dallas, TX 75275-0376 (United States); Ratner, Lee [Departments of Medicine and Molecular Microbiology, Washington University School of Medicine, St. Louis, MO 63110 (United States); Lairmore, Michael D. [University of California-Davis, School of Veterinary Medicine, One Shields Avenue, Davis, CA 95618 (United States); Martinez, Ernest [Department of Biochemistry, University of California, Riverside, CA 92521 (United States); Lüscher, Bernhard [Institute of Biochemistry, Klinikum, RWTH Aachen University, Pauwelsstrasse 30, 52057 Aachen (Germany); Robson, Craig N. [Northern Institute for Cancer Research, Newcastle University, The Medical School, Newcastle upon Tyne, NE2 4HH (United Kingdom); Henriksson, Marie [Department of Microbiology, Cell and Tumor Biology, Karolinska Institutet, Stockholm (Sweden); Harrod, Robert, E-mail: rharrod@smu.edu [Laboratory of Molecular Virology, Department of Biological Sciences, and The Dedman College Center for Drug Discovery, Design, and Delivery, Southern Methodist University, Dallas, TX 75275-0376 (United States)

    2015-02-15

    The human T-cell leukemia retrovirus type-1 (HTLV-1) p30{sup II} protein is a multifunctional latency-maintenance factor that negatively regulates viral gene expression and deregulates host signaling pathways involved in aberrant T-cell growth and proliferation. We have previously demonstrated that p30{sup II} interacts with the c-MYC oncoprotein and enhances c-MYC-dependent transcriptional and oncogenic functions. However, the molecular and biochemical events that mediate the cooperation between p30{sup II} and c-MYC remain to be completely understood. Herein we demonstrate that p30{sup II} induces lysine-acetylation of the c-MYC oncoprotein. Acetylation-defective c-MYC Lys→Arg substitution mutants are impaired for oncogenic transformation with p30{sup II} in c-myc{sup −/−} HO15.19 fibroblasts. Using dual-chromatin-immunoprecipitations (dual-ChIPs), we further demonstrate that p30{sup II} is present in c-MYC-containing nucleoprotein complexes in HTLV-1-transformed HuT-102 T-lymphocytes. Moreover, p30{sup II} inhibits apoptosis in proliferating cells expressing c-MYC under conditions of genotoxic stress. These findings suggest that c-MYC-acetylation is required for the cooperation between p30{sup II}/c-MYC which could promote proviral replication and contribute to HTLV-1-induced carcinogenesis. - Highlights: • Acetylation of c-MYC is required for oncogenic transformation by HTLV-1 p30{sup II}/c-MYC. • Acetylation-defective c-MYC mutants are impaired for foci-formation by p30{sup II}/c-MYC. • The HTLV-1 p30{sup II} protein induces lysine-acetylation of c-MYC. • p30{sup II} is present in c-MYC nucleoprotein complexes in HTLV-1-transformed T-cells. • HTLV-1 p30{sup II} inhibits apoptosis in c-MYC-expressing proliferating cells.

  11. High throughput testing of the SV40 Large T antigen binding to cellular p53 identifies putative drugs for the treatment of SV40-related cancers

    International Nuclear Information System (INIS)

    Carbone, Michele; Rudzinski, Jennifer; Bocchetta, Maurizio

    2003-01-01

    SV40 has been linked to some human malignancies, and the evidence that this virus plays a causative role in mesothelioma and brain tumors is mounting. The major SV40 oncoprotein is the Large tumor antigen (Tag). A key Tag transforming activity is connected to its capability to bind and inactivate cellular p53. In this study we developed an effective, high throughput, ELISA-based method to study Tag-p53 interaction in vitro. This assay allowed us to screen a chemical library and to identify a chemical inhibitor of the Tag binding to p53. We propose that our in vitro assay is a useful method to identify molecules that may be used as therapeutic agents for the treatment of SV40-related human cancers

  12. Thoughts on identifiers

    CERN Multimedia

    CERN. Geneva

    2005-01-01

    As business processes and information transactions have become an inextricably intertwined with the Web, the importance of assignment, registration, discovery, and maintenance of identifiers has increased. In spite of this, integrated frameworks for managing identifiers have been slow to emerge. Instead, identification systems arise (quite naturally) from immediate business needs without consideration for how they fit into larger information architectures. In addition, many legacy identifier systems further complicate the landscape, making it difficult for content managers to select and deploy identifier systems that meet both the business case and long term information management objectives. This presentation will outline a model for evaluating identifier applications and the functional requirements of the systems necessary to support them. The model is based on a layered analysis of the characteristics of identifier systems, including: * Functional characteristics * Technology * Policy * Business * Social T...

  13. Identifiability in stochastic models

    CERN Document Server

    1992-01-01

    The problem of identifiability is basic to all statistical methods and data analysis, occurring in such diverse areas as Reliability Theory, Survival Analysis, and Econometrics, where stochastic modeling is widely used. Mathematics dealing with identifiability per se is closely related to the so-called branch of ""characterization problems"" in Probability Theory. This book brings together relevant material on identifiability as it occurs in these diverse fields.

  14. Identifying Strategic Scientific Opportunities

    Science.gov (United States)

    As NCI's central scientific strategy office, CRS collaborates with the institute's divisions, offices, and centers to identify research opportunities to advance NCI's vision for the future of cancer research.

  15. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2011-10-01

    cells we observed that it promoted transformation of HMLE cells, suggesting a tumor suppressive role of Merlin in breast cancer (Figure 4B). A...08-1-0767 TITLE: Identifying Breast Cancer Oncogenes PRINCIPAL INVESTIGATOR: Yashaswi Shrestha...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 W81XWH-08-1-0767 Identifying Breast Cancer Oncogenes Yashaswi Shrestha Dana-Farber

  16. Identifying Knowledge and Communication

    Directory of Open Access Journals (Sweden)

    Eduardo Coutinho Lourenço de Lima

    2006-12-01

    Full Text Available In this paper, I discuss how the principle of identifying knowledge which Strawson advances in ‘Singular Terms and Predication’ (1961, and in ‘Identifying Reference and Truth-Values’ (1964 turns out to constrain communication. The principle states that a speaker’s use of a referring expression should invoke identifying knowledge on the part of the hearer, if the hearer is to understand what the speaker is saying, and also that, in so referring, speakers are attentive to hearers’ epistemic states. In contrasting it with Russell’s Principle (Evans 1982, as well as with the principle of identifying descriptions (Donnellan 1970, I try to show that the principle of identifying knowledge, ultimately a condition for understanding, makes sense only in a situation of conversation. This allows me to conclude that the cooperative feature of communication (Grice 1975 and reference (Clark andWilkes-Gibbs 1986 holds also at the understanding level. Finally, I discuss where Strawson’s views seem to be unsatisfactory, and suggest how they might be improved.

  17. Identifying and Managing Risk.

    Science.gov (United States)

    Abraham, Janice M.

    1999-01-01

    The role of the college or university chief financial officer in institutional risk management is (1) to identify risk (physical, casualty, fiscal, business, reputational, workplace safety, legal liability, employment practices, general liability), (2) to develop a campus plan to reduce and control risk, (3) to transfer risk, and (4) to track and…

  18. Detection of HPV and the role of p16INK4A overexpression as a surrogate marker for the presence of functional HPV oncoprotein E7 in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Lardon Filip

    2010-03-01

    Full Text Available Abstract Background Based on the well-recognized etiological role of human papillomavirus (HPV in cervical, anogenital and oropharyngeal carcinogenesis, a potential role of HPV in colorectal carcinogenesis has been suggested. For that reason, the aim of the present study was to investigate the presence of HPV DNA in colorectal carcinomas (CRC and to study overexpression of p16INK4A as a marker for the presence of an active HPV oncoprotein E7. These findings were correlated with clinical and pathological prognostic factors of CRC. Methods The presence of HPV was assessed using a multiplex PCR system of 10 non-biotinylated primers. The amplified fragments of HPV positive samples were further analyzed by a highly sensitive, broad spectrum SPF10 PCR and subsequently genotyped using reverse hybridization in a line probe assay. P16INK4A protein expression was investigated in a subset of 90 (30 HPV positive and 60 HPV negative CRC samples by immunohistochemistry. Results HPV DNA was found in 14.2% of the CRC samples with HPV16 as the most prevalent type. No significant differences in clinical and pathological variables were found between HPV positive and negative CRCs, except for age. HPV positive patients were significantly younger (p = 0.05. There was no significant correlation between the presence of HPV and overexpression of p16INK4A (p = 0.325. Conclusions In conclusion, the presence of oncogenic HPV DNA in a small cohort of CRC samples may suggest that HPV may be involved in the carcinogenesis of some CRC. However, contrary to what has been observed in head and neck squamous cell cancer and cancer of the uterine cervix, p16INK4A does not seem to be a surrogate marker for an active HPV infection in CRC. Therefore, further functional analyses are necessary to elucidate the role of HPV in CRC.

  19. Stimulation of interleukin-13 expression by human T-cell leukemia virus type 1 oncoprotein Tax via a dually active promoter element responsive to NF-kappaB and NFAT.

    Science.gov (United States)

    Silbermann, Katrin; Schneider, Grit; Grassmann, Ralph

    2008-11-01

    The human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein transforms human lymphocytes and is critical for the pathogenesis of HTLV-1-induced adult T-cell leukaemia. In HTLV-transformed cells, Tax upregulates interleukin (IL)-13, a cytokine with proliferative and anti-apoptotic functions that is linked to leukaemogenesis. Tax-stimulated IL-13 is thought to result in autocrine stimulation of HTLV-infected cells and thus may be relevant to their growth. The causal transactivation of the IL-13 promoter by Tax is predominantly dependent on a nuclear factor of activated T cells (NFAT)-binding P element. Here, it was shown that the isolated IL-13 Tax-responsive element (IL13TaxRE) was sufficient to mediate IL-13 transactivation by Tax and NFAT1. However, cyclosporin A, a specific NFAT inhibitor, revealed that Tax transactivation of IL13TaxRE or wild-type IL-13 promoter was independent of NFAT and that NFAT did not contribute to IL-13 upregulation in HTLV-transformed cells. By contrast, Tax stimulation was repressible by an efficient nuclear factor (NF)-kappaB inhibitor (IkBaDN), indicating the requirement for NF-kappaB. The capacity of NF-kappaB to stimulate IL13TaxRE was demonstrated by a strong response to NF-kappaB in reporter assays and by direct binding of NF-kappaB to IL13TaxRE. Thus, IL13TaxRE in the IL-13 promoter represents a dually active promoter element responsive to NF-kappaB and NFAT. Together, these results indicate that Tax causes IL-13 upregulation in HTLV-1-infected cells via NF-kappaB.

  20. Bmi1 regulates murine intestinal stem cell proliferation and self-renewal downstream of Notch

    DEFF Research Database (Denmark)

    López-Arribillaga, Erika; Rodilla, Verónica; Pellegrinet, Luca

    2015-01-01

    Genetic data indicate that abrogation of Notch-Rbpj or Wnt-β-catenin pathways results in the loss of the intestinal stem cells (ISCs). However, whether the effect of Notch is direct or due to the aberrant differentiation of the transit-amplifying cells into post-mitotic goblet cells is unknown. T...

  1. The Role of Polycomb Group Gene BMI-1 in the Development of Prostate Cancer

    Science.gov (United States)

    2013-07-01

    J Clin Invest. 2005; 115:1503-21. 13. Siddique HR, Liao DJ, Mishra SK, Schuster T, Wang L, Matter B et al. Epicatechin-rich cocoa polyphenol...growth factors may result in an upregulation of diverse gene products in CSCs and their differentiated progenies dur- ing the EMT process [32, 33

  2. Therapeutic Roles of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

    Science.gov (United States)

    2013-10-01

    ORGANIZATION NAME(S) AND ADDRESS(ES) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER New Jersey, University of Medicine and Dentistry ...classified according to postoperative Gleason score or clinical stage (TNM system ). Histological categories divided tumors with Gleason scores...On the basis of rapid adhesion on collagen, PCa cells were plated on a collagen-I dish for 5 min (5’=rapidly adherent) (3-5% of cells) were

  3. Expression and Clinicopathological Significance of Mel-18 and Bmi-1 in Esophageal Squamous Cell Carcinoma.

    Science.gov (United States)

    Ji, Huaijun; Cao, Ming; Ren, Kunlun; Sun, Ningbo; Wang, Wei; Zhu, Qiang; Zang, Qi; Jiang, Zhongmin

    2017-01-01

    The Polycomb group genes are a general class of regulators that are responsible for maintaining homeotic gene expression throughout cell division. Polycomb group expression plays an important role in oncogenesis of several types of human cancer. Melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 are key Polycomb group proteins. Studies have shown that melanoma nuclear protein 18 is a potential tumor suppression, and B-cell-specific Moloney leukemia virus insert site 1 is overexpressed in several human malignancies. However, the roles of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in esophageal squamous cell carcinoma are still unclear. In this study, we analyzed the expression levels of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in 89 esophageal cancer tissues and paired normal mucosal tissues using immunohistochemistry, Western blotting, and quantitative real-time polymerase chain reaction analyses. We found that the expression of melanoma nuclear protein 18 in the carcinoma tissues was significantly lower than that in the noncancerous mucosal tissues ( P .05). B-cell-specific Moloney leukemia virus insert site 1 expression was strongly correlated with the degree of differentiation, clinical stage, and lymph node metastasis ( P .05). Moreover, there was a negative correlation between melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 expressions in esophageal squamous cell carcinoma ( P < .05). Our study suggests that melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 may play a crucial role in esophageal squamous cell carcinoma. Melanoma nuclear protein 18 or B-cell-specific Moloney leukemia virus insert site 1 may be a potential biomarker for diagnosis and prognosis of esophageal squamous cell carcinoma.

  4. Targeted BMI1 inhibition impairs tumor growth in lung adenocarcinomas with low CEBP alpha expression

    Czech Academy of Sciences Publication Activity Database

    Yong, K.J.; Basseres, D.S.; Welner, R.S.; Zhang, W.C.; Yang, H.; Yan, B.; Alberich-Jorda, Meritxell; Zhang, J.; de Figueiredo-Pontes, L.L.; Battelli, C.; Hetherington, C.J.; Ye, M.; Zhang, H.; Maroni, G.; O'Brien, K.; Magli, M.C.; Borczuk, A.C.; Varticovski, L.; Kocher, O.; Zhang, P.; Moon, Y.C.; Sydorenko, N.; Cao, L.; Davis, T.W.; Thakkar, B.M.; Soo, R.A.; Iwama, A.; Lim, B.; Halmos, B.; Neuberg, D.; Tenen, D.G.; Levantini, E.

    2016-01-01

    Roč. 8, č. 350 (2016), č. článku 350ra104. ISSN 1946-6234 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : ccaat/enhancer-binding-protein * acute myeloid-leukemia * factor-c/ebp-alpha * posttranscriptional control * adjuvant chemotherapy * cell-proliferation * down-regulation * drug discovery * gene signature * self-renewal Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 16.796, year: 2016

  5. The Role of Polycomb Group Gene Bmi-1 in the Development of Prostate Cancer

    Science.gov (United States)

    2011-09-01

    new tricks. Cell Div. 2006 Jul 24;1:15. 17. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions... Pestell RG. Signal transduction mediated by cyclin D1: from mitogens to cell proliferation: a molecular target with therapeutic potential. Cancer...Datar 22 R, Cote R, Pestell R, Albanese C. ErbB-2 induces the cyclin D1 gene in prostate epithelial cells in vitro and in vivo. Cancer Res. 2007

  6. Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

    Science.gov (United States)

    2013-10-01

    methotrexate were from the Cancer Institute of New Jersey pharmacy . Both collagen I, IV and laminin were purchased from BD Biosciences, and athymicnu/nu mice...forming cells from human prostate [31]. We elected to use a strategy of combin- ing phenotypic and time-of-adherence assays to iso - late TICs from PCa

  7. Therapeutic Role of Bmi-1 Inhibitors in Eliminating Prostate Tumor Stem Cells

    Science.gov (United States)

    2015-10-01

    cellularity of the bone marrow of the treated and control mice. The smears demonstrated the presence of heterogeneous cell types including the larger...were supplemented with IL-3, rhTPO (Kirin brewery ), and FLT3-L (Peprotech) cytokines. Cells were suspended at 3 x 103 concentration in one ml of...flushed with a 23G (0.45 × 10 mm) syringe needle to collect single- cell suspensions. Bone marrow sections and blood May-Grünwald-Giemsa–stained

  8. Epigenetic Silencing of Eyes Absent 4 Gene by Acute Myeloid Leukemia 1-Eight-twenty-one Oncoprotein Contributes to Leukemogenesis in t(8;21 Acute Myeloid Leukemia

    Directory of Open Access Journals (Sweden)

    Sai Huang

    2016-01-01

    Conclusions: Our study identified EYA4 gene as targets for AML1-ETO and indicated it as a novel tumor suppressor gene. In addition, we provided evidence that EYA4 gene might be a novel therapeutic target and a potential candidate for treating AML1-ETO+ t (8;21 AML.

  9. Internally readable identifying tag

    International Nuclear Information System (INIS)

    Jefferts, K.B.; Jefferts, E.R.

    1980-01-01

    A method of identifying non-metallic objects by means of X-ray equipment is described in detail. A small metal pin with a number of grooves cut in a pre-determined equi-spaced pattern is implanted into the non-metallic object and by decoding the groove patterns using X-ray equipment, the object is uniquely identified. A specific example of such an application is in studying the migratory habits of fish. The pin inserted into the snout of the fish is 0.010 inch in diameter, 0.040 inch in length with 8 possible positions for grooves if spaced 0.005 inch apart. With 6 of the groove positions available for data, the capacity is 2 6 or 64 combinations; clearly longer pins would increase the data capacity. This method of identification is a major advance over previous techniques which necessitated destruction of the fish in order to recover the identification tag. (UK)

  10. Identifying Breast Cancer Oncogenes

    Science.gov (United States)

    2010-10-01

    tyrosine kinases with an SH3, SH2 and catalytic domain, it lacks a native myristylation signal shared by most members of this class [14], [38]. The...therapeutics and consequently, improve clinical outcomes. We aim to identify novel drivers of breast oncogenesis. We hypothesize that a kinase gain-of...human mammary epithelial cells. A pBabe-Puro-Myr-Flag kinase open reading frame (ORF) library was screened in immortalized human mammary epithelial

  11. Rock disposal problems identified

    Energy Technology Data Exchange (ETDEWEB)

    Knox, R

    1978-06-01

    Mathematical models are the only way of examining the return of radioactivity from nuclear waste to the environment over long periods of time. Work in Britain has helped identify areas where more basic data is required, but initial results look very promising for final disposal of high level waste in hard rock repositories. A report by the National Radiological Protection Board of a recent study, is examined.

  12. A promoter within the E6 ORF of human papillomavirus type 16 contributes to the expression of the E7 oncoprotein from a monocistronic mRNA

    DEFF Research Database (Denmark)

    Glahder, Jacob-Andreas Harald; Hansen, Christina N; Vinther, Jeppe

    2003-01-01

    RNA that encodes E7 as the first open reading frame (ORF) has been identified. We recently identified a transcription initiation site within the E6 ORF of HPV-16 at nt 542. In the present study we have characterized the P542 promoter, which putatively controls monocistronic expression of E7. The monocistronic m...... from nt 226 to 409. Furthermore, the translation initiation of E7 is most abundant from the monocistronic mRNA. We have also shown that the P542 promoter is downregulated by the transcription factor activator protein 4 (AP-4) and the differentiation-dependent factor hSkn-1a, both binding downstream...... of the transcription initiation site. In conclusion, we have found that P542 is a relatively weak promoter compared with P97 and may be downregulated in differentiated epithelial cells....

  13. Identifying phenomenal consciousness.

    Science.gov (United States)

    Schier, Elizabeth

    2009-03-01

    This paper examines the possibility of finding evidence that phenomenal consciousness is independent of access. The suggestion reviewed is that we should look for isomorphisms between phenomenal and neural activation spaces. It is argued that the fact that phenomenal spaces are mapped via verbal report is no problem for this methodology. The fact that activation and phenomenal space are mapped via different means does not mean that they cannot be identified. The paper finishes by examining how data addressing this theoretical question could be obtained.

  14. List identifies threatened ecosystems

    Science.gov (United States)

    Showstack, Randy

    2012-09-01

    The International Union for Conservation of Nature (IUCN) announced on 9 September that it will develop a new Red List of Ecosystems that will identify which ecosystems are vulnerable or endangered. The list, which is modeled on the group's Red List of Threatened Species™, could help to guide conservation activities and influence policy processes such as the Convention on Biological Diversity, according to the group. “We will assess the status of marine, terrestrial, freshwater, and subterranean ecosystems at local, regional, and global levels,” stated Jon Paul Rodriguez, leader of IUCN's Ecosystems Red List Thematic Group. “The assessment can then form the basis for concerted implementation action so that we can manage them sustainably if their risk of collapse is low or restore them if they are threatened and then monitor their recovery.”

  15. Global Microbial Identifier

    DEFF Research Database (Denmark)

    Wielinga, Peter; Hendriksen, Rene S.; Aarestrup, Frank Møller

    2017-01-01

    ) will likely also enable a much better understanding of the pathogenesis of the infection and the molecular basis of the host response to infection. But the full potential of these advances will only transpire if the data in this area become transferable and thereby comparable, preferably in open-source...... of microorganisms, for the identification of relevant genes and for the comparison of genomes to detect outbreaks and emerging pathogens. To harness the full potential of WGS, a shared global database of genomes linked to relevant metadata and the necessary software tools needs to be generated, hence the global...... microbial identifier (GMI) initiative. This tool will ideally be used in amongst others in the diagnosis of infectious diseases in humans and animals, in the identification of microorganisms in food and environment, and to track and trace microbial agents in all arenas globally. This will require...

  16. Radiograph identifying means

    International Nuclear Information System (INIS)

    Sheldon, A.D.

    1983-01-01

    A flexible character-indentable plastics embossing tape is backed by and bonded to a lead strip, not more than 0.025 inches thick, to form a tape suitable for identifying radiographs. The lead strip is itself backed by a relatively thin and flimsy plastics or fabric strip which, when removed, allows the lead plastic tape to be pressure-bonded to the surface to be radiographed. A conventional tape-embossing gun is used to indent the desired characters in succession into the lead-backed tape, without necessarily severing the lead; and then the backing strip is peeled away to expose the layer of adhesive which pressure-bonds the indented tape to the object to be radiographed. X-rays incident on the embossed tape will cause the raised characters to show up dark on the subsequently-developed film, whilst the raised side areas will show up white. Each character will thus stand out on the developed film. (author)

  17. Andrographolide downregulates the v-Src and Bcr-Abl oncoproteins and induces Hsp90 cleavage in the ROS-dependent suppression of cancer malignancy.

    Science.gov (United States)

    Liu, Sheng-Hung; Lin, Chao-Hsiung; Liang, Fong-Ping; Chen, Pei-Fen; Kuo, Cheng-Deng; Alam, Mohd Mujahid; Maiti, Barnali; Hung, Shih-Kai; Chi, Chin-Wen; Sun, Chung-Ming; Fu, Shu-Ling

    2014-01-15

    Andrographolide is a diterpenoid compound isolated from Andrographis paniculata that exhibits anticancer activity. We previously reported that andrographolide suppressed v-Src-mediated cellular transformation by promoting the degradation of Src. In the present study, we demonstrated the involvement of Hsp90 in the andrographolide-mediated inhibition of Src oncogenic activity. Using a proteomics approach, a cleavage fragment of Hsp90α was identified in andrographolide-treated cells. The concentration- and time-dependent induction of Hsp90 cleavage that accompanied the reduction in Src was validated in RK3E cells transformed with either v-Src or a human truncated c-Src variant and treated with andrographolide. In cancer cells, the induction of Hsp90 cleavage by andrographolide and its structural derivatives correlated well with decreased Src levels, the suppression of transformation, and the induction of apoptosis. Moreover, the andrographolide-induced Hsp90 cleavage, Src degradation, inhibition of transformation, and induction of apoptosis were abolished by a ROS inhibitor, N-acetyl-cysteine. Notably, Hsp90 cleavage, decreased levels of Bcr-Abl (another known Hsp90 client protein), and the induction of apoptosis were also observed in human K562 leukemia cells treated with andrographolide or its active derivatives. Together, we demonstrated a novel mechanism by which andrographolide suppressed cancer malignancy that involved inhibiting Hsp90 function and reducing the levels of Hsp90 client proteins. Our results broaden the molecular basis of andrographolide-mediated anticancer activity. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. The Putative PAX8/PPARγ Fusion Oncoprotein Exhibits Partial Tumor Suppressor Activity through Up-Regulation of Micro-RNA-122 and Dominant-Negative PPARγ Activity.

    Science.gov (United States)

    Reddi, Honey V; Madde, Pranathi; Milosevic, Dragana; Hackbarth, Jennifer S; Algeciras-Schimnich, Alicia; McIver, Bryan; Grebe, Stefan K G; Eberhardt, Norman L

    2011-01-01

    In vitro studies have demonstrated that the PAX8/PPARγ fusion protein (PPFP), which occurs frequently in follicular thyroid carcinomas (FTC), exhibits oncogenic activity. However, paradoxically, a meta-analysis of extant tumor outcome studies indicates that 68% of FTC-expressing PPFP are minimally invasive compared to only 32% of those lacking PPFP (χ(2) = 6.86, P = 0.008), suggesting that PPFP favorably impacts FTC outcomes. In studies designed to distinguish benign thyroid neoplasms from thyroid carcinomas, the previously identified tumor suppressor miR-122, a major liver micro-RNA (miR) that is decreased in hepatocellular carcinoma, was increased 8.9-fold (P negative PPARγ mutant in WRO cells was less effective than PPFP at inhibiting xenograft tumor progression (1.8-fold [P negative PPARγ activity. Up-regulation of miR-122 negatively regulates ADAM-17, a known downstream target, in thyroid cells, suggesting an antiangiogenic mechanism in thyroid carcinoma. This latter inference is directly supported by reduced CD-31 expression in WRO xenografts expressing PPFP, miR-122, and DN-PPARγ. We conclude that, in addition to its apparent oncogenic potential in vitro, PPFP exhibits paradoxical tumor suppressor activity in vivo, mediated by multiple mechanisms including up-regulation of miR-122 and dominant-negative inhibition of PPARγ activity.

  19. The heat shock protein-90 co-chaperone, Cyclophilin 40, promotes ALK-positive, anaplastic large cell lymphoma viability and its expression is regulated by the NPM-ALK oncoprotein

    International Nuclear Information System (INIS)

    Pearson, Joel D; Mohammed, Zubair; Bacani, Julinor T C; Lai, Raymond; Ingham, Robert J

    2012-01-01

    ability of this oncoprotein to signal. This is the first study demonstrating that the expression of immunophilin family co-chaperones is promoted by an oncogenic tyrosine kinase. Moreover, this is the first report establishing an important role for Cyp40 in lymphoma

  20. CRM1-mediated nuclear export is required for 26 S proteasome-dependent degradation of the TRIP-Br2 proto-oncoprotein.

    Science.gov (United States)

    Cheong, Jit Kong; Gunaratnam, Lakshman; Hsu, Stephen I-Hong

    2008-04-25

    Overexpression of the proto-oncogene TRIP-Br2 (SERTAD2) has been shown to induce E2F activity and promote tumorigenesis, whereas ablation of TRIP-Br2 arrests cell proliferation. Timely degradation of many cell cycle regulators is fundamental to the maintenance of proper cell cycle progression. Here we report novel mechanism(s) that govern the tight regulation of TRIP-Br2 levels during cell cycle progression. TRIP-Br2 was observed to be a short-lived protein in which the expression level peaks at the G(1)/S boundary. TRIP-Br2 accumulated in cells treated with 26 S proteasome inhibitors. Co-immunoprecipitation studies revealed that TRIP-Br2 forms ubiquitin conjugates. In silico analysis identified a putative leucine-rich nuclear export signal (NES) motif that overlaps with the PHD-Bromo interaction domain in the acidic C-terminal transactivation domain (TAD) of TRIP-Br2. This NES motif is highly conserved in widely divergent species and in all TRIP-Br family members. TRIP-Br2 was shown to be stabilized in G(2)/M phase cells through nuclear entrapment, either by deletion of the acidic C-terminal TAD, which includes the NES motif, or by leptomycin B-mediated inhibition of the CRM1-dependent nuclear export machinery. Mutation of leucine residue 238 of this NES motif abolished the interaction between CRM1 and TRIP-Br2, as well as the nuclear export of TRIP-Br2 and its subsequent 26 S proteasome-dependent degradation. These data suggest that CRM1-mediated nuclear export may be required for the proper execution of ubiquitin-proteasome-dependent degradation of TRIP-Br2.

  1. Acute dose and low dose-rate irradiation of carcinoma cells expressing human papillomavirus E6 and E7 oncoproteins - the significance of p53, Rb and G1 arrest status

    International Nuclear Information System (INIS)

    DeWeese, Theodore L.; Walsh, Jonathan C.; Dillehay, Larry E.; Shao, Y.; Kessis, Theodore D.; Cho, Kathleen R.; Nelson, William G.

    1995-01-01

    Purpose: The development of carcinomas in a number of sites including the cervix, vulva and anus have been associated with cellular infection by human papillomaviruses (HPV), including HPV 16 and HPV 18. The mechanism by which these viruses contribute to tumor development or progression seems in part to be related to the integration of the viral genome into the host cells DNA, and the binding of p53 protein by the HPV E6 oncoprotein as well as the binding of the retinoblastoma (Rb) protein and Rb-like proteins by the HPV E7 oncoprotein. These interactions lead to loss of p53 and Rb function including loss of the G 1 cell cycle checkpoint. Although it is believed that both p53 and Rb play a role in the radiosensitivity of the cell, whether alteration in either protein enhances or diminishes cellular radiation response is not clear from the literature. Because HPV-associated tumors such as cervical cancer are often treated with acute dose and/or low dose-rate radiation, we set out to evaluate the radiation response of several carcinoma cell sublines expressing either oncogenic E6 or E7 to both types of radiation, and to determine if p53/Rb dependent G 1 arrest is an important determinant of cell fate after irradiation. Materials and Methods: We have previously developed a series of RKO colorectal carcinoma cell sublines expressing both low-risk (HPV 11) and high-risk (HPV 16) E6 and E7 genes. p53-dependent G 1 arrest is intact in RKO parental cells and cells expressing low-risk E6 proteins, while the G 1 arrest is abrogated in cells expressing high-risk E6 or E7. Clonogenic survival was assessed after exposure to acute dose (1 Gy/min) and low dose-rate (0.25 Gy/hour) radiation. The radiobiologic parameters α, β and the surviving fraction at 2 Gy (SF2) were determined. SDS-PAGE/immunoblotting was carried out to assess both p53 and p21 WAF1/CIP1 levels after exposure to radiation. Flow cytometry was performed before and after exposure to low dose-rate radiation to

  2. SPARQL-enabled identifier conversion with Identifiers.org

    Science.gov (United States)

    Wimalaratne, Sarala M.; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-01-01

    Motivation: On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. Results: We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. Availability and implementation: The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. Contact: sarala@ebi.ac.uk PMID:25638809

  3. SPARQL-enabled identifier conversion with Identifiers.org.

    Science.gov (United States)

    Wimalaratne, Sarala M; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-06-01

    On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. © The Author 2015. Published by Oxford University Press.

  4. Near Identifiability of Dynamical Systems

    Science.gov (United States)

    Hadaegh, F. Y.; Bekey, G. A.

    1987-01-01

    Concepts regarding approximate mathematical models treated rigorously. Paper presents new results in analysis of structural identifiability, equivalence, and near equivalence between mathematical models and physical processes they represent. Helps establish rigorous mathematical basis for concepts related to structural identifiability and equivalence revealing fundamental requirements, tacit assumptions, and sources of error. "Structural identifiability," as used by workers in this field, loosely translates as meaning ability to specify unique mathematical model and set of model parameters that accurately predict behavior of corresponding physical system.

  5. Identifying Conformational-Selection and Induced-Fit Aspects in the Binding-Induced Folding of PMI from Markov State Modeling of Atomistic Simulations.

    Science.gov (United States)

    Paul, Fabian; Noé, Frank; Weikl, Thomas R

    2018-03-27

    Unstructured proteins and peptides typically fold during binding to ligand proteins. A challenging problem is to identify the mechanism and kinetics of these binding-induced folding processes in experiments and atomistic simulations. In this Article, we present a detailed picture for the folding of the inhibitor peptide PMI into a helix during binding to the oncoprotein fragment 25-109 Mdm2 obtained from atomistic, explicit-water simulations and Markov state modeling. We find that binding-induced folding of PMI is highly parallel and can occur along a multitude of pathways. Some pathways are induced-fit-like with binding occurring prior to PMI helix formation, while other pathways are conformational-selection-like with binding after helix formation. On the majority of pathways, however, binding is intricately coupled to folding, without clear temporal ordering. A central feature of these pathways is PMI motion on the Mdm2 surface, along the binding groove of Mdm2 or over the rim of this groove. The native binding groove of Mdm2 thus appears as an asymmetric funnel for PMI binding. Overall, binding-induced folding of PMI does not fit into the classical picture of induced fit or conformational selection that implies a clear temporal ordering of binding and folding events. We argue that this holds in general for binding-induced folding processes because binding and folding events in these processes likely occur on similar time scales and do exhibit the time-scale separation required for temporal ordering.

  6. The NOAA Dataset Identifier Project

    Science.gov (United States)

    de la Beaujardiere, J.; Mccullough, H.; Casey, K. S.

    2013-12-01

    The US National Oceanic and Atmospheric Administration (NOAA) initiated a project in 2013 to assign persistent identifiers to datasets archived at NOAA and to create informational landing pages about those datasets. The goals of this project are to enable the citation of datasets used in products and results in order to help provide credit to data producers, to support traceability and reproducibility, and to enable tracking of data usage and impact. A secondary goal is to encourage the submission of datasets for long-term preservation, because only archived datasets will be eligible for a NOAA-issued identifier. A team was formed with representatives from the National Geophysical, Oceanographic, and Climatic Data Centers (NGDC, NODC, NCDC) to resolve questions including which identifier scheme to use (answer: Digital Object Identifier - DOI), whether or not to embed semantics in identifiers (no), the level of granularity at which to assign identifiers (as coarsely as reasonable), how to handle ongoing time-series data (do not break into chunks), creation mechanism for the landing page (stylesheet from formal metadata record preferred), and others. Decisions made and implementation experience gained will inform the writing of a Data Citation Procedural Directive to be issued by the Environmental Data Management Committee in 2014. Several identifiers have been issued as of July 2013, with more on the way. NOAA is now reporting the number as a metric to federal Open Government initiatives. This paper will provide further details and status of the project.

  7. Identifying tier one key suppliers.

    Science.gov (United States)

    Wicks, Steve

    2013-01-01

    In today's global marketplace, businesses are becoming increasingly reliant on suppliers for the provision of key processes, activities, products and services in support of their strategic business goals. The result is that now, more than ever, the failure of a key supplier has potential to damage reputation, productivity, compliance and financial performance seriously. Yet despite this, there is no recognised standard or guidance for identifying a tier one key supplier base and, up to now, there has been little or no research on how to do so effectively. This paper outlines the key findings of a BCI-sponsored research project to investigate good practice in identifying tier one key suppliers, and suggests a scalable framework process model and risk matrix tool to help businesses effectively identify their tier one key supplier base.

  8. Football refereeing: Identifying innovative methods

    Directory of Open Access Journals (Sweden)

    Reza MohammadKazemi

    2014-08-01

    Full Text Available The aim of the present study is to identify the potentials innovation in football industry. Data were collected from 10 national and international referees, assistant referees and referees’ supervisors in Iran. In this study, technological innovations are identified that assist better refereeing performances. The analysis revealed a significant relationship between using new technologies and referees ‘performance. The results indicate that elite referees, assistant referees and supervisors agreed to use new technological innovations during the game. According to their comments, this kind of technology causes the referees’ performance development.

  9. SOCIODEMOGRAPHIC DATA USED FOR IDENTIFYING ...

    Science.gov (United States)

    Due to unique social and demographic characteristics, various segments of the population may experience exposures different from those of the general population, which, in many cases, may be greater. When risk assessments do not characterize subsets of the general population, the populations that may experience the greatest risk remain unidentified. When such populations are not identified, the social and demographic data relevant to these populations is not considered when preparing exposure estimates, which can underestimate exposure and risk estimates for at-risk populations. Thus, it is necessary for risk or exposure assessors characterizing a diverse population, to first identify and then enumerate certain groups within the general population who are at risk for greater contaminant exposures. The document entitled Sociodemographic Data Used for Identifying Potentially Highly Exposed Populations (also referred to as the Highly Exposed Populations document), assists assessors in identifying and enumerating potentially highly exposed populations. This document presents data relating to factors which potentially impact an individual or group's exposure to environmental contaminants based on activity patterns (how time is spent), microenvironments (locations where time is spent), and other socio-demographic data such as age, gender, race and economic status. Populations potentially more exposed to various chemicals of concern, relative to the general population

  10. SNP interaction pattern identifier (SIPI)

    DEFF Research Database (Denmark)

    Lin, Hui Yi; Chen, Dung Tsa; Huang, Po Yu

    2017-01-01

    Motivation: Testing SNP-SNP interactions is considered as a key for overcoming bottlenecks of genetic association studies. However, related statistical methods for testing SNP-SNP interactions are underdeveloped. Results: We propose the SNP Interaction Pattern Identifier (SIPI), which tests 45...

  11. Identifying the Gifted Child Humorist.

    Science.gov (United States)

    Fern, Tami L.

    1991-01-01

    This study attempted to identify gifted child humorists among 1,204 children in grades 3-6. Final identification of 13 gifted child humorists was determined through application of such criteria as funniness, originality, and exemplary performance or product. The influence of intelligence, development, social factors, sex differences, family…

  12. Identifying high-risk medication

    DEFF Research Database (Denmark)

    Sædder, Eva; Brock, Birgitte; Nielsen, Lars Peter

    2014-01-01

    salicylic acid, and beta-blockers; 30 drugs or drug classes caused 82 % of all serious MEs. The top ten drugs involved in fatal events accounted for 73 % of all drugs identified. CONCLUSION: Increasing focus on seven drugs/drug classes can potentially reduce hospitalizations, extended hospitalizations...

  13. Distributed Persistent Identifiers System Design

    Directory of Open Access Journals (Sweden)

    Pavel Golodoniuc

    2017-06-01

    Full Text Available The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID systems, of which there is a great variety in terms of technical and social implementation, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have, by in large, catered for identifier uniqueness, integrity, and persistence, regardless of the identifier’s application domain. Trustworthiness of these systems has been measured by the criteria first defined by Bütikofer (2009 and further elaborated by Golodoniuc 'et al'. (2016 and Car 'et al'. (2017. Since many PID systems have been largely conceived and developed by a single organisation they faced challenges for widespread adoption and, most importantly, the ability to survive change of technology. We believe that a cause of PID systems that were once successful fading away is the centralisation of support infrastructure – both organisational and computing and data storage systems. In this paper, we propose a PID system design that implements the pillars of a trustworthy system – ensuring identifiers’ independence of any particular technology or organisation, implementation of core PID system functions, separation from data delivery, and enabling the system to adapt for future change. We propose decentralisation at all levels — persistent identifiers and information objects registration, resolution, and data delivery — using Distributed Hash Tables and traditional peer-to-peer networks with information replication and caching mechanisms, thus eliminating the need for a central PID data store. This will increase overall system fault tolerance thus ensuring its trustworthiness. We also discuss important aspects of the distributed system’s governance, such as the notion of the authoritative source and data integrity

  14. ORCID: Author Identifiers for Librarians

    Directory of Open Access Journals (Sweden)

    Robyn B. Reed

    2017-10-01

    Full Text Available Generating accurate publication lists by researchers can be challenging when faced with scholars who have common names or who have published under name variations. This article describes ORCID and the goal of generating author identifiers for scholars to connect their research outputs. Included are the reasons for having author identifiers as well as the types of information within individual profiles. This article includes information on how academic libraries are playing a role with ORCID initiatives as well as describing how publishers, institutions, and funders are employing ORCID in their workflows. Highlighted is material on academic institutions in Pennsylvania using ORCID. The purpose of the article is to provide an overview of ORCID and its uses to inform librarians about this important initiative.

  15. Device for identifying fuel assembly

    International Nuclear Information System (INIS)

    Imai, Tetsuo; Miyazawa, Tatsuo.

    1982-01-01

    Purpose: To accurately identify a symbol printed on a hanging tool at the upper part of a fuel assembly. Constitution: Optical fibers are bundled to prepare a detector which is disposed at a predetermined position on a hanging tool. This position is set by a guide. Thus, the light emitted from an illumination lamp arrives at the bottom of a groove printed on the upper surface of the tool, and is divided into a weak light reflected upwardly and a strong light reflected on the surface lower than the groove. When these lights are received by the optical fibers, the fibers corresponding to the grooved position become dark, and the fibers corresponding to the ungrooved position become bright. Since the fuel assembly is identified by the dark and bright of the optical fibers as symbols, different machining can be performed every fuel assembly on the upper surface of the tool. (Yoshihara, H.)

  16. Identifying patient risks during hospitalization

    Directory of Open Access Journals (Sweden)

    Lucélia Ferreira Lima

    2008-12-01

    Full Text Available Objective: To identify the risks reported at a public institution andto know the main patient risks from the nursing staff point of view.Methods: A retrospective, descriptive and exploratory study. Thesurvey was developed at a hospital in the city of Taboão da Serra, SãoPaulo, Brazil. The study included all nurses working in care areas whoagreed to participate in the study. At the same time, sentinel eventsoccurring in the period from July 2006 to July 2007 were identified.Results: There were 440 sentinel events reported, and the main risksincluded patient falls, medication errors and pressure ulcers. Sixty-fivenurses were interviewed. They also reported patient falls, medicationerrors and pressure ulcers as the main risks. Conclusions: Riskassessment and implementation of effective preventive actions arenecessary to ensure patient’s safety. Involvement of a multidisciplinaryteam is one of the steps for a successful process.

  17. Identifying High Performance ERP Projects

    OpenAIRE

    Stensrud, Erik; Myrtveit, Ingunn

    2002-01-01

    Learning from high performance projects is crucial for software process improvement. Therefore, we need to identify outstanding projects that may serve as role models. It is common to measure productivity as an indicator of performance. It is vital that productivity measurements deal correctly with variable returns to scale and multivariate data. Software projects generally exhibit variable returns to scale, and the output from ERP projects is multivariate. We propose to use Data Envelopment ...

  18. Expression and associations of TRAF1, BMI-1, ALDH1, and Lin28B in oral squamous cell carcinoma.

    Science.gov (United States)

    Wu, Tian-Fu; Li, Yi-Cun; Ma, Si-Rui; Bing-Liu; Zhang, Wen-Feng; Sun, Zhi-Jun

    2017-04-01

    Tumor necrosis factor receptor-associated factor 1, an adaptor protein of tumor necrosis factor 2, is involved in classical nuclear factor (NF)-κB activation and lymphocyte recruitment. However, less is known about the expression and association of tumor necrosis factor receptor-associated factor 1 with cancer stem cell markers in oral squamous cell carcinoma. This study aimed to investigate the expression of tumor necrosis factor receptor-associated factor 1 and stem cell characteristic markers (lin28 homolog B, B cell-specific Moloney murine leukemia virus integration site 1, and aldehyde dehydrogenase 1) in oral squamous cell carcinoma and analyze their relations. Paraffin-embedded tissues of 78 oral squamous cell carcinomas, 39 normal oral mucosa, and 12 oral dysplasia tissues were employed in tissue microarrays, and the expression of tumor necrosis factor receptor-associated factor 1, B cell-specific Moloney murine leukemia virus integration site 1, aldehyde dehydrogenase 1, and lin28 homolog B was measured by immunohistostaining and digital pathological analysis. The expression of tumor necrosis factor receptor-associated factor 1 was higher in the oral squamous cell carcinoma group as compared with the expression in the oral mucosa (p oral dysplasia (p oral squamous cell carcinoma. The patient survival rate was lower in the highly expressed tumor necrosis factor receptor-associated factor 1 group, although the difference was not significant. The clustering analysis showed that tumor necrosis factor receptor-associated factor 1 was most related to aldehyde dehydrogenase 1. These findings suggest that tumor necrosis factor receptor-associated factor 1 has potential direct/indirect regulations with the cancer stem cell markers in oral squamous cell carcinoma, which may help in further analysis of the cancer stem cell characteristics.

  19. Detecção imunoistoquímica das oncoproteínas p21ras, c-myc E p53 no carcinoma hepatocelular e no tecido hepático não-neoplásico Immunohistochemical detection of p21ras, c-myc and p53 oncoproteins in hepatocellular carcinoma and in non-neoplastic liver tissue

    Directory of Open Access Journals (Sweden)

    Vera Lucia Nunes Pannain

    2004-12-01

    oncoproteins in hepatocellular carcinoma and non neoplastic tissue. Association of the immunoreactivity of these markers with histological grades and patterns, hepatitis B and C were additionally studied. METHODS: Detection of oncoproteins p21ras, c-myc and p53 was performed immunohistochemically in hepatocellular carcinoma (47 cases and surrounding non neoplastic liver tissue (40 cases. RESULTS: Oncoproteins p21ras, c-myc and p53 were detected in 44,7%, 53,2% and 36,2% of the hepatocellular carcinoma cases, respectively. The p21ras and c-myc immunoreactivity has shown a significant association. However there was no association of p21ras, c-myc and p53 detection with hepatitis B and C virus infections, histological grades and patterns. The same significant association between p21ras and c-myc was observed in non-neoplastic tissue with cirrhosis when compared with tissue without it. The p53 immunoreactivity was negative in all non-neoplastic liver tissue samples. CONCLUSIONS: The immunoreactivity detection of p21ras, c-myc and p53 corroborates previous evidence of their detection in hepatocellular carcinoma that suggest the participation of these proteins in human hepatocarcinogenesis. The significant association between p21ras and c-myc oncoproteins in hepatocellular carcinoma and in cirrhosis can point to an interaction between them mainly, in hepatocarcinogenesis that occurs through cirrhosis.

  20. Sparse Linear Identifiable Multivariate Modeling

    DEFF Research Database (Denmark)

    Henao, Ricardo; Winther, Ole

    2011-01-01

    and bench-marked on artificial and real biological data sets. SLIM is closest in spirit to LiNGAM (Shimizu et al., 2006), but differs substantially in inference, Bayesian network structure learning and model comparison. Experimentally, SLIM performs equally well or better than LiNGAM with comparable......In this paper we consider sparse and identifiable linear latent variable (factor) and linear Bayesian network models for parsimonious analysis of multivariate data. We propose a computationally efficient method for joint parameter and model inference, and model comparison. It consists of a fully...

  1. Identifying flares in rheumatoid arthritis

    DEFF Research Database (Denmark)

    Bykerk, Vivian P; Bingham, Clifton O; Choy, Ernest H

    2016-01-01

    to flare, with escalation planned in 61%. CONCLUSIONS: Flares are common in rheumatoid arthritis (RA) and are often preceded by treatment reductions. Patient/MD/DAS agreement of flare status is highest in patients worsening from R/LDA. OMERACT RA flare questions can discriminate between patients with...... Set. METHODS: Candidate flare questions and legacy measures were administered at consecutive visits to Canadian Early Arthritis Cohort (CATCH) patients between November 2011 and November 2014. The American College of Rheumatology (ACR) core set indicators were recorded. Concordance to identify flares...

  2. Persistent Identifiers as Boundary Objects

    Science.gov (United States)

    Parsons, M. A.; Fox, P. A.

    2017-12-01

    In 1989, Leigh Star and Jim Griesemer defined the seminal concept of `boundary objects'. These `objects' are what Latour calls `immutable mobiles' that enable communication and collaboration across difference by helping meaning to be understood in different contexts. As Star notes, they are a sort of arrangement that allow different groups to work together without (a priori) consensus. Part of the idea is to recognize and allow for the `interpretive flexibility' that is central to much of the `constructivist' approach in the sociology of science. Persistent Identifiers (PIDs) can clearly act as boundary objects, but people do not usually assume that they enable interpretive flexibility. After all, they are meant to be unambiguous, machine-interpretable identifiers of defined artifacts. In this paper, we argue that PIDs can fill at least two roles: 1) That of the standardized form, where there is strong agreement on what is being represented and how and 2) that of the idealized type, a more conceptual concept that allows many different representations. We further argue that these seemingly abstract conceptions actually help us implement PIDs more effectively to link data, publications, various other artifacts, and especially people. Considering PIDs as boundary objects can help us address issues such as what level of granularity is necessary for PIDs, what metadata should be directly associated with PIDs, and what purpose is the PID serving (reference, provenance, credit, etc.). In short, sociological theory can improve data sharing standards and their implementation in a way that enables broad interdisciplinary data sharing and reuse. We will illustrate this with several specific examples of Earth science data.

  3. RECOVIR Software for Identifying Viruses

    Science.gov (United States)

    Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

    2013-01-01

    Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

  4. Identifying ELIXIR Core Data Resources.

    Science.gov (United States)

    Durinx, Christine; McEntyre, Jo; Appel, Ron; Apweiler, Rolf; Barlow, Mary; Blomberg, Niklas; Cook, Chuck; Gasteiger, Elisabeth; Kim, Jee-Hyub; Lopez, Rodrigo; Redaschi, Nicole; Stockinger, Heinz; Teixeira, Daniel; Valencia, Alfonso

    2016-01-01

    The core mission of ELIXIR is to build a stable and sustainable infrastructure for biological information across Europe. At the heart of this are the data resources, tools and services that ELIXIR offers to the life-sciences community, providing stable and sustainable access to biological data. ELIXIR aims to ensure that these resources are available long-term and that the life-cycles of these resources are managed such that they support the scientific needs of the life-sciences, including biological research. ELIXIR Core Data Resources are defined as a set of European data resources that are of fundamental importance to the wider life-science community and the long-term preservation of biological data. They are complete collections of generic value to life-science, are considered an authority in their field with respect to one or more characteristics, and show high levels of scientific quality and service. Thus, ELIXIR Core Data Resources are of wide applicability and usage. This paper describes the structures, governance and processes that support the identification and evaluation of ELIXIR Core Data Resources. It identifies key indicators which reflect the essence of the definition of an ELIXIR Core Data Resource and support the promotion of excellence in resource development and operation. It describes the specific indicators in more detail and explains their application within ELIXIR's sustainability strategy and science policy actions, and in capacity building, life-cycle management and technical actions. The identification process is currently being implemented and tested for the first time. The findings and outcome will be evaluated by the ELIXIR Scientific Advisory Board in March 2017. Establishing the portfolio of ELIXIR Core Data Resources and ELIXIR Services is a key priority for ELIXIR and publicly marks the transition towards a cohesive infrastructure.

  5. DIA-datasnooping and identifiability

    Science.gov (United States)

    Zaminpardaz, S.; Teunissen, P. J. G.

    2018-04-01

    In this contribution, we present and analyze datasnooping in the context of the DIA method. As the DIA method for the detection, identification and adaptation of mismodelling errors is concerned with estimation and testing, it is the combination of both that needs to be considered. This combination is rigorously captured by the DIA estimator. We discuss and analyze the DIA-datasnooping decision probabilities and the construction of the corresponding partitioning of misclosure space. We also investigate the circumstances under which two or more hypotheses are nonseparable in the identification step. By means of a theorem on the equivalence between the nonseparability of hypotheses and the inestimability of parameters, we demonstrate that one can forget about adapting the parameter vector for hypotheses that are nonseparable. However, as this concerns the complete vector and not necessarily functions of it, we also show that parameter functions may exist for which adaptation is still possible. It is shown how this adaptation looks like and how it changes the structure of the DIA estimator. To demonstrate the performance of the various elements of DIA-datasnooping, we apply the theory to some selected examples. We analyze how geometry changes in the measurement setup affect the testing procedure, by studying their partitioning of misclosure space, the decision probabilities and the minimal detectable and identifiable biases. The difference between these two minimal biases is highlighted by showing the difference between their corresponding contributing factors. We also show that if two alternative hypotheses, say Hi and Hj , are nonseparable, the testing procedure may have different levels of sensitivity to Hi -biases compared to the same Hj -biases.

  6. NIH Researchers Identify OCD Risk Gene

    Science.gov (United States)

    ... News From NIH NIH Researchers Identify OCD Risk Gene Past Issues / Summer 2006 Table of Contents For ... and Alcoholism (NIAAA) have identified a previously unknown gene variant that doubles an individual's risk for obsessive- ...

  7. Ability of Slovakian Pupils to Identify Birds

    Science.gov (United States)

    Prokop, Pavol; Rodak, Rastislav

    2009-01-01

    A pupil's ability to identify common organisms is necessary for acquiring further knowledge of biology. We investigated how pupils were able to identify 25 bird species following their song, growth habits, or both features presented simultaneously. Just about 19% of birds were successfully identified by song, about 39% by growth habit, and 45% of…

  8. De-identifying an EHR Database

    DEFF Research Database (Denmark)

    Lauesen, Søren; Pantazos, Kostas; Lippert, Søren

    2011-01-01

    -identified a Danish EHR database with 437,164 patients. The goal was to generate a version with real medical records, but related to artificial persons. We developed a de-identification algorithm that uses lists of named entities, simple language analysis, and special rules. Our algorithm consists of 3 steps: collect...... lists of identifiers from the database and external resources, define a replacement for each identifier, and replace identifiers in structured data and free text. Some patient records could not be safely de-identified, so the de-identified database has 323,122 patient records with an acceptable degree...... of anonymity, readability and correctness (F-measure of 95%). The algorithm has to be adjusted for each culture, language and database....

  9. Parameter identifiability and redundancy: theoretical considerations.

    Directory of Open Access Journals (Sweden)

    Mark P Little

    Full Text Available BACKGROUND: Models for complex biological systems may involve a large number of parameters. It may well be that some of these parameters cannot be derived from observed data via regression techniques. Such parameters are said to be unidentifiable, the remaining parameters being identifiable. Closely related to this idea is that of redundancy, that a set of parameters can be expressed in terms of some smaller set. Before data is analysed it is critical to determine which model parameters are identifiable or redundant to avoid ill-defined and poorly convergent regression. METHODOLOGY/PRINCIPAL FINDINGS: In this paper we outline general considerations on parameter identifiability, and introduce the notion of weak local identifiability and gradient weak local identifiability. These are based on local properties of the likelihood, in particular the rank of the Hessian matrix. We relate these to the notions of parameter identifiability and redundancy previously introduced by Rothenberg (Econometrica 39 (1971 577-591 and Catchpole and Morgan (Biometrika 84 (1997 187-196. Within the widely used exponential family, parameter irredundancy, local identifiability, gradient weak local identifiability and weak local identifiability are shown to be largely equivalent. We consider applications to a recently developed class of cancer models of Little and Wright (Math Biosciences 183 (2003 111-134 and Little et al. (J Theoret Biol 254 (2008 229-238 that generalize a large number of other recently used quasi-biological cancer models. CONCLUSIONS/SIGNIFICANCE: We have shown that the previously developed concepts of parameter local identifiability and redundancy are closely related to the apparently weaker properties of weak local identifiability and gradient weak local identifiability--within the widely used exponential family these concepts largely coincide.

  10. Identifying Information Focuses in Listening Comprehension

    Science.gov (United States)

    Zhang, Hong-yan

    2011-01-01

    The study explains the process of learners' listening comprehension within Halliday's information theory in functional grammar, including the skills of identifying focuses while listening in college English teaching. Identifying information focuses in listening is proved to improve the students' communicative listening ability by the means of a…

  11. 29 CFR 4010.7 - Identifying information.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Identifying information. 4010.7 Section 4010.7 Labor Regulations Relating to Labor (Continued) PENSION BENEFIT GUARANTY CORPORATION CERTAIN REPORTING AND DISCLOSURE REQUIREMENTS ANNUAL FINANCIAL AND ACTUARIAL INFORMATION REPORTING § 4010.7 Identifying information...

  12. Water resources management in Tanzania: identifying research ...

    African Journals Online (AJOL)

    This paper aims at identifying research gaps and needs and recommendations for a research agenda on water resources management in Tanzania. We reviewed published literature on water resources management in Tanzania in order to highlight what is currently known, and to identify knowledge gaps, and suggest ...

  13. Identifying Opinion Leaders to Promote Behavior Change

    Science.gov (United States)

    Valente, Thomas W.; Pumpuang, Patchareeya

    2007-01-01

    This article reviews 10 techniques used to identify opinion leaders to promote behavior change. Opinion leaders can act as gatekeepers for interventions, help change social norms, and accelerate behavior change. Few studies document the manner in which opinion leaders are identified, recruited, and trained to promote health. The authors categorize…

  14. IDENTIFIABILITY VERSUS HETEROGENEITY IN GROUNDWATER MODELING SYSTEMS

    Directory of Open Access Journals (Sweden)

    A M BENALI

    2003-06-01

    Full Text Available Review of history matching of reservoirs parameters in groundwater flow raises the problem of identifiability of aquifer systems. Lack of identifiability means that there exists parameters to which the heads are insensitive. From the guidelines of the study of the homogeneous case, we inspect the identifiability of the distributed transmissivity field of heterogeneous groundwater aquifers. These are derived from multiple realizations of a random function Y = log T  whose probability distribution function is normal. We follow the identifiability of the autocorrelated block transmissivities through the measure of the sensitivity of the local derivatives DTh = (∂hi  ∕ ∂Tj computed for each sample of a population N (0; σY, αY. Results obtained from an analysis of Monte Carlo type suggest that the more a system is heterogeneous, the less it is identifiable.

  15. EZID: Long term identifiers made easy (Invited)

    Science.gov (United States)

    Starr, J.

    2013-12-01

    Scholarly research is producing ever increasing amounts of digital research data, and this data should be managed throughout the research life cycle both as part of good scientific practice, but also to comply with funder mandates, such as the 2013 OSTP Public Access Memo (http://www.whitehouse.gov/sites/default/files/microsites/ostp/ostp_public_access_memo_2013.pdf). By assigning unique and persistent identifiers to data objects, data managers can gain control and flexibility over what can be a daunting task. This is due to the fact that the objects can be moved to new locations without disruption to links, as long as the identifier target is maintained. EZID is a tool that makes assigning and maintaining unique, persistent identifiers easy. It was designed and built by California Digital Library (CDL) and has both a user interface and a RESTful API. EZID currently offers services for two globally unique, persistent identifier schemes: Digital Object Identifiers (DOIs) and Archival Resource Keys (ARKs). DOIs are identifiers originating from the publishing world and are in widespread use for journal articles. CDL is able to offer DOIs because of being a founding member of DataCite (http://www.datacite.org/), an international consortium established to provide easier access to scientific research data on the Internet. ARKs are identifiers originating from the library, archive and museum community. Like DOIs, they become persistent when the objects and identifier forwarding information is maintained. DOIs and ARKs have a key role in data management and, therefore, in data management plans. DOIs are the recommended identifier for use in data citation, and ARKs provide the maximum flexibility needed for data documentation and management throughout the early phases of a project. The two identifier schemes are able to be used together, and EZID is made to work with both. EZID clients, coming from education, research, government, and the private sector, are utilizing the

  16. Structural Identifiability of Dynamic Systems Biology Models.

    Science.gov (United States)

    Villaverde, Alejandro F; Barreiro, Antonio; Papachristodoulou, Antonis

    2016-10-01

    A powerful way of gaining insight into biological systems is by creating a nonlinear differential equation model, which usually contains many unknown parameters. Such a model is called structurally identifiable if it is possible to determine the values of its parameters from measurements of the model outputs. Structural identifiability is a prerequisite for parameter estimation, and should be assessed before exploiting a model. However, this analysis is seldom performed due to the high computational cost involved in the necessary symbolic calculations, which quickly becomes prohibitive as the problem size increases. In this paper we show how to analyse the structural identifiability of a very general class of nonlinear models by extending methods originally developed for studying observability. We present results about models whose identifiability had not been previously determined, report unidentifiabilities that had not been found before, and show how to modify those unidentifiable models to make them identifiable. This method helps prevent problems caused by lack of identifiability analysis, which can compromise the success of tasks such as experiment design, parameter estimation, and model-based optimization. The procedure is called STRIKE-GOLDD (STRuctural Identifiability taKen as Extended-Generalized Observability with Lie Derivatives and Decomposition), and it is implemented in a MATLAB toolbox which is available as open source software. The broad applicability of this approach facilitates the analysis of the increasingly complex models used in systems biology and other areas.

  17. Identifiability of PBPK Models with Applications to ...

    Science.gov (United States)

    Any statistical model should be identifiable in order for estimates and tests using it to be meaningful. We consider statistical analysis of physiologically-based pharmacokinetic (PBPK) models in which parameters cannot be estimated precisely from available data, and discuss different types of identifiability that occur in PBPK models and give reasons why they occur. We particularly focus on how the mathematical structure of a PBPK model and lack of appropriate data can lead to statistical models in which it is impossible to estimate at least some parameters precisely. Methods are reviewed which can determine whether a purely linear PBPK model is globally identifiable. We propose a theorem which determines when identifiability at a set of finite and specific values of the mathematical PBPK model (global discrete identifiability) implies identifiability of the statistical model. However, we are unable to establish conditions that imply global discrete identifiability, and conclude that the only safe approach to analysis of PBPK models involves Bayesian analysis with truncated priors. Finally, computational issues regarding posterior simulations of PBPK models are discussed. The methodology is very general and can be applied to numerous PBPK models which can be expressed as linear time-invariant systems. A real data set of a PBPK model for exposure to dimethyl arsinic acid (DMA(V)) is presented to illustrate the proposed methodology. We consider statistical analy

  18. Nanoscale Proteomic Analysis of Oncoproteins in Hematopoietic Cancers

    Science.gov (United States)

    2012-05-01

    can be measured. Quantitation of AKT2 phosphorylated and unphosphorylated protein peaks was performed using Compass (version 1.8.0) analysis soft...5a SDf → PD 12 112 81F RAEB-2 Highh 5d SDg → PD 14+ 117 75F RAEB-2 Highh 3c,e PD skin (mCR) Yes 5 121 80M RAEB-T Highh 1c PD Yes 3 122 76F RAEB-1

  19. The Oncoprotein BRD4-NUT Generates Aberrant Histone Modification Patterns.

    Directory of Open Access Journals (Sweden)

    Barry M Zee

    Full Text Available Defects in chromatin proteins frequently manifest in diseases. A striking case of a chromatin-centric disease is NUT-midline carcinoma (NMC, which is characterized by expression of NUT as a fusion partner most frequently with BRD4. ChIP-sequencing studies from NMC patients revealed that BRD4-NUT (B4N covers large genomic regions and elevates transcription within these domains. To investigate how B4N modulates chromatin, we performed affinity purification of B4N when ectopically expressed in 293-TREx cells and quantified the associated histone posttranslational modifications (PTM using proteomics. We observed significant enrichment of acetylation particularly on H3 K18 and of combinatorial patterns such as H3 K27 acetylation paired with K36 methylation. We postulate that B4N complexes override the preexisting histone code with new PTM patterns that reflect aberrant transcription and that epigenetically modulate the nucleosome environment toward the NMC state.

  20. human papillomaviruses E6 and E7 oncoproteins

    Indian Academy of Sciences (India)

    Unknown

    Recent work has uncovered new cellular partners for these .... Hence it is evident that a fine balance exists between these that govern ... still suggest that E7 can have a more global effect on the general .... towards malignancy), increases life span of the cells. E6 ..... nism when expressed alone in HPV positive/negative cell.

  1. Evaluation of Molecular Inhibitors of the c-Myc Oncoprotein

    National Research Council Canada - National Science Library

    Prochownik, Edward V

    2005-01-01

    .... All of these functions require that C-Myc physically associate with another protein. Max. Example of diseases in which c-Myc deregulation occurs include breast cancer (approx. 30% of cases), colon cancer (>85...

  2. ETS-1 oncoprotein expression is decreased in aggressive papillary ...

    African Journals Online (AJOL)

    E.A. Ibrahim

    2016-10-19

    Oct 19, 2016 ... aggressive papillary transitional cell carcinoma of the urinary bladder: An immunohistochemical study. E.A. Ibrahim. ∗. , M.R. Hassan, S.A. Sammour. Pathology Department, Faculty of Medicine, Ain Shams University, Egypt. Received 23 August 2015; received in revised form 11 October 2015; accepted 12 ...

  3. Parameter identifiability of linear dynamical systems

    Science.gov (United States)

    Glover, K.; Willems, J. C.

    1974-01-01

    It is assumed that the system matrices of a stationary linear dynamical system were parametrized by a set of unknown parameters. The question considered here is, when can such a set of unknown parameters be identified from the observed data? Conditions for the local identifiability of a parametrization are derived in three situations: (1) when input/output observations are made, (2) when there exists an unknown feedback matrix in the system and (3) when the system is assumed to be driven by white noise and only output observations are made. Also a sufficient condition for global identifiability is derived.

  4. MXLKID: a maximum likelihood parameter identifier

    International Nuclear Information System (INIS)

    Gavel, D.T.

    1980-07-01

    MXLKID (MaXimum LiKelihood IDentifier) is a computer program designed to identify unknown parameters in a nonlinear dynamic system. Using noisy measurement data from the system, the maximum likelihood identifier computes a likelihood function (LF). Identification of system parameters is accomplished by maximizing the LF with respect to the parameters. The main body of this report briefly summarizes the maximum likelihood technique and gives instructions and examples for running the MXLKID program. MXLKID is implemented LRLTRAN on the CDC7600 computer at LLNL. A detailed mathematical description of the algorithm is given in the appendices. 24 figures, 6 tables

  5. Identifiable Data Files - Health Outcomes Survey (HOS)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Medicare Health Outcomes Survey (HOS) identifiable data files are comprised of the entire national sample for a given 2-year cohort (including both respondents...

  6. Identifying mechanistic similarities in drug responses

    KAUST Repository

    Zhao, C.; Hua, J.; Bittner, M. L.; Ivanov, I.; Dougherty, a. E. R.

    2012-01-01

    Motivation: In early drug development, it would be beneficial to be able to identify those dynamic patterns of gene response that indicate that drugs targeting a particular gene will be likely or not to elicit the desired response. One approach

  7. Identifying structural damage with ground penetrating radar

    CSIR Research Space (South Africa)

    Van Schoor, Abraham M

    2008-07-01

    Full Text Available Ground penetrating radar (GPR) and electrical resistance tomography (ERT) surveys were conducted in an urban environment in an attempt to identify the cause of severe structural damage to a historically significant residential property...

  8. Identifying intelligent Building Management Systems (BMS) in ...

    African Journals Online (AJOL)

    Identifying intelligent Building Management Systems (BMS) in sustainable housing. ... Journal of Fundamental and Applied Sciences ... attention to the principles of sustainability of energy and organized approach to sustainable development.

  9. Study Identifies New Lymphoma Treatment Target

    Science.gov (United States)

    NCI researchers have identified new therapeutic targets for diffuse large B-cell lymphoma. Drugs that hit these targets are under clinical development and the researchers hope to begin testing them in clinical trials of patients with DLBCL.

  10. Identifying national freshwater ecosystem priority areas

    CSIR Research Space (South Africa)

    Nel, JL

    2012-10-01

    Full Text Available This presentation highlights the use of systematic conservation planning to identify priority areas for managing the health of freshwater ecosystems and their associated biodiversity and ecosystem services....

  11. Identifying Pornographic Materials with Judgment Analysis

    Science.gov (United States)

    Houston, Judith A.; Houston, Samuel R.

    1974-01-01

    The primary purpose of this study was to determine if a policy-capturing methodology (JAN) which has been successfully utilized in military and educational research could be adapted for use as a procedure in identifying pornographic material. (Author)

  12. Identifying knowledge in decision-making processes

    DEFF Research Database (Denmark)

    Jensen, Anna Rose Vagn; Ahmed-Kristensen, Saeema

    2010-01-01

    Managing knowledge reflects the innovation capability of a company. Mapping decision processes and links to knowledge is a way to learn more in structuring knowledge in innovation processes. Through an empirical study the paper aims to identify knowledge...

  13. International Team Identifies Biomarker for Scleroderma

    Science.gov (United States)

    ... Spotlight on Research International Team Identifies Biomarker for Scleroderma By Kirstie Saltsman, Ph.D. | May 5, 2014 ... molecule correlates with a more severe form of scleroderma, a chronic autoimmune disorder that involves the abnormal ...

  14. Identifying Needs and Opportunities for Local Government ...

    African Journals Online (AJOL)

    4carolinebell@gmail.com

    attainment of sustainable development goals and socio-ecological balance in ... However, policy and legislation fall short of identifying the range of a priori competences ..... the precautionary principle, risk identification, risk management and ...

  15. Identifying significant environmental features using feature recognition.

    Science.gov (United States)

    2015-10-01

    The Department of Environmental Analysis at the Kentucky Transportation Cabinet has expressed an interest in feature-recognition capability because it may help analysts identify environmentally sensitive features in the landscape, : including those r...

  16. OCRWM baseline management procedure for document identifiers

    International Nuclear Information System (INIS)

    1993-03-01

    This procedure establishes a uniform numbering system (document identifier) for all Program and project technical, cost, and schedule baselines, and selected management and procurement documents developed for and controlled by the Office of Civilian Radioactive Waste Management (OCRWM) for the Civilian Radioactive Waste Management System (CRWMS). The document identifier defined in this procedure is structured to ensure that the relational integrity between configuration items (CIs) and their associated documentation and software is maintained, traceable, categorical, and retrievable for the life of the program

  17. ORCID Author Identifiers: A Primer for Librarians.

    Science.gov (United States)

    Akers, Katherine G; Sarkozy, Alexandra; Wu, Wendy; Slyman, Alison

    2016-01-01

    The ORCID (Open Researcher and Contributor ID) registry helps disambiguate authors and streamline research workflows by assigning unique 16-digit author identifiers that enable automatic linkages between researchers and their scholarly activities. This article describes how ORCID works, the benefits of using ORCID, and how librarians can promote ORCID at their institutions by raising awareness of ORCID, helping researchers create and populate ORCID profiles, and integrating ORCID identifiers into institutional repositories and other university research information systems.

  18. Exploiting intrinsic fluctuations to identify model parameters.

    Science.gov (United States)

    Zimmer, Christoph; Sahle, Sven; Pahle, Jürgen

    2015-04-01

    Parameterisation of kinetic models plays a central role in computational systems biology. Besides the lack of experimental data of high enough quality, some of the biggest challenges here are identification issues. Model parameters can be structurally non-identifiable because of functional relationships. Noise in measured data is usually considered to be a nuisance for parameter estimation. However, it turns out that intrinsic fluctuations in particle numbers can make parameters identifiable that were previously non-identifiable. The authors present a method to identify model parameters that are structurally non-identifiable in a deterministic framework. The method takes time course recordings of biochemical systems in steady state or transient state as input. Often a functional relationship between parameters presents itself by a one-dimensional manifold in parameter space containing parameter sets of optimal goodness. Although the system's behaviour cannot be distinguished on this manifold in a deterministic framework it might be distinguishable in a stochastic modelling framework. Their method exploits this by using an objective function that includes a measure for fluctuations in particle numbers. They show on three example models, immigration-death, gene expression and Epo-EpoReceptor interaction, that this resolves the non-identifiability even in the case of measurement noise with known amplitude. The method is applied to partially observed recordings of biochemical systems with measurement noise. It is simple to implement and it is usually very fast to compute. This optimisation can be realised in a classical or Bayesian fashion.

  19. IDENTIFYING COLLISIONAL FAMILIES IN THE KUIPER BELT

    International Nuclear Information System (INIS)

    Marcus, Robert A.; Ragozzine, Darin; Murray-Clay, Ruth A.; Holman, Matthew J.

    2011-01-01

    The identification and characterization of numerous collisional families-clusters of bodies with a common collisional origin-in the asteroid belt has added greatly to the understanding of asteroid belt formation and evolution. More recent study has also led to an appreciation of physical processes that had previously been neglected (e.g., the Yarkovsky effect). Collisions have certainly played an important role in the evolution of the Kuiper Belt as well, though only one collisional family has been identified in that region to date, around the dwarf planet Haumea. In this paper, we combine insights into collisional families from numerical simulations with the current observational constraints on the dynamical structure of the Kuiper Belt to investigate the ideal sizes and locations for identifying collisional families. We find that larger progenitors (r ∼ 500 km) result in more easily identifiable families, given the difficulty in identifying fragments of smaller progenitors in magnitude-limited surveys, despite their larger spread and less frequent occurrence. However, even these families do not stand out well from the background. Identifying families as statistical overdensities is much easier than characterizing families by distinguishing individual members from interlopers. Such identification seems promising, provided the background population is well known. In either case, families will also be much easier to study where the background population is small, i.e., at high inclinations. Overall, our results indicate that entirely different techniques for identifying families will be needed for the Kuiper Belt, and we provide some suggestions.

  20. Distributed design approach in persistent identifiers systems

    Science.gov (United States)

    Golodoniuc, Pavel; Car, Nicholas; Klump, Jens

    2017-04-01

    The need to identify both digital and physical objects is ubiquitous in our society. Past and present persistent identifier (PID) systems, of which there is a great variety in terms of technical and social implementations, have evolved with the advent of the Internet, which has allowed for globally unique and globally resolvable identifiers. PID systems have catered for identifier uniqueness, integrity, persistence, and trustworthiness, regardless of the identifier's application domain, the scope of which has expanded significantly in the past two decades. Since many PID systems have been largely conceived and developed by small communities, or even a single organisation, they have faced challenges in gaining widespread adoption and, most importantly, the ability to survive change of technology. This has left a legacy of identifiers that still exist and are being used but which have lost their resolution service. We believe that one of the causes of once successful PID systems fading is their reliance on a centralised technical infrastructure or a governing authority. Golodoniuc et al. (2016) proposed an approach to the development of PID systems that combines the use of (a) the Handle system, as a distributed system for the registration and first-degree resolution of persistent identifiers, and (b) the PID Service (Golodoniuc et al., 2015), to enable fine-grained resolution to different information object representations. The proposed approach solved the problem of guaranteed first-degree resolution of identifiers, but left fine-grained resolution and information delivery under the control of a single authoritative source, posing risk to the long-term availability of information resources. Herein, we develop these approaches further and explore the potential of large-scale decentralisation at all levels: (i) persistent identifiers and information resources registration; (ii) identifier resolution; and (iii) data delivery. To achieve large-scale decentralisation

  1. Identifying glass compositions in fly ash

    Directory of Open Access Journals (Sweden)

    Katherine eAughenbaugh

    2016-01-01

    Full Text Available In this study, four Class F fly ashes were studied with a scanning electron microscope; the glassy phases were identified and their compositions quantified using point compositional analysis with k-means clustering and multispectral image analysis. The results showed that while the bulk oxide contents of the fly ashes were different, the four fly ashes had somewhat similar glassy phase compositions. Aluminosilicate glasses (AS, calcium aluminosilicate glasses (CAS, a mixed glass, and, in one case, a high iron glass were identified in the fly ashes. Quartz and iron crystalline phases were identified in each fly ash as well. The compositions of the three main glasses identified, AS, CAS, and mixed glass, were relatively similar in each ash. The amounts of each glass were varied by fly ash, with the highest calcium fly ash containing the most of calcium-containing glass. Some of the glasses were identified as intermixed in individual particles, particularly the calcium-containing glasses. Finally, the smallest particles in the fly ashes, with the most surface area available to react in alkaline solution, such as when mixed with portland cement or in alkali-activated fly ash, were not different in composition than the large particles, with each of the glasses represented. The method used in the study may be applied to a fly ash of interest for use as a cementing material in order to understand its potential for reactivity.

  2. Coherence method of identifying signal noise model

    International Nuclear Information System (INIS)

    Vavrin, J.

    1981-01-01

    The noise analysis method is discussed in identifying perturbance models and their parameters by a stochastic analysis of the noise model of variables measured on a reactor. The analysis of correlations is made in the frequency region using coherence analysis methods. In identifying an actual specific perturbance, its model should be determined and recognized in a compound model of the perturbance system using the results of observation. The determination of the optimum estimate of the perturbance system model is based on estimates of related spectral densities which are determined from the spectral density matrix of the measured variables. Partial and multiple coherence, partial transfers, the power spectral densities of the input and output variables of the noise model are determined from the related spectral densities. The possibilities of applying the coherence identification methods were tested on a simple case of a simulated stochastic system. Good agreement was found of the initial analytic frequency filters and the transfers identified. (B.S.)

  3. Identifying Adverse Drug Events by Relational Learning.

    Science.gov (United States)

    Page, David; Costa, Vítor Santos; Natarajan, Sriraam; Barnard, Aubrey; Peissig, Peggy; Caldwell, Michael

    2012-07-01

    The pharmaceutical industry, consumer protection groups, users of medications and government oversight agencies are all strongly interested in identifying adverse reactions to drugs. While a clinical trial of a drug may use only a thousand patients, once a drug is released on the market it may be taken by millions of patients. As a result, in many cases adverse drug events (ADEs) are observed in the broader population that were not identified during clinical trials. Therefore, there is a need for continued, post-marketing surveillance of drugs to identify previously-unanticipated ADEs. This paper casts this problem as a reverse machine learning task , related to relational subgroup discovery and provides an initial evaluation of this approach based on experiments with an actual EMR/EHR and known adverse drug events.

  4. Scientometric methods for identifying emerging technologies

    Science.gov (United States)

    Abercrombie, Robert K; Schlicher, Bob G; Sheldon, Frederick T

    2015-11-03

    Provided is a method of generating a scientometric model that tracks the emergence of an identified technology from initial discovery (via original scientific and conference literature), through critical discoveries (via original scientific, conference literature and patents), transitioning through Technology Readiness Levels (TRLs) and ultimately on to commercial application. During the period of innovation and technology transfer, the impact of scholarly works, patents and on-line web news sources are identified. As trends develop, currency of citations, collaboration indicators, and on-line news patterns are identified. The combinations of four distinct and separate searchable on-line networked sources (i.e., scholarly publications and citation, worldwide patents, news archives, and on-line mapping networks) are assembled to become one collective network (a dataset for analysis of relations). This established network becomes the basis from which to quickly analyze the temporal flow of activity (searchable events) for the example subject domain.

  5. Identifying motivational factors within a multinational company

    Directory of Open Access Journals (Sweden)

    Daniela Bradutanu

    2011-08-01

    Full Text Available The aim of the study is to identify the main motivational factors within a multinational company. The first objective is to identify work functions, formulated on Abraham Maslow’s pyramid, following the identification of the key characteristics that motivate an employee at the work place and last, but not least, the type of motivation that employees focus, intrinsic or extrinsic. The research method targeted a questionnaire based survey, including various company employees and an interview with the manager. The results confirmed that in Romania, employees put great emphasis on extrinsic motivation, a certain income and job security being primary. These results have implications for managers that in order to effectively motivate staff, first, must know their needs and expectations. To identify the main needs and motivational factors we had as a starting point Maslow's pyramid.

  6. Minimal covariant observables identifying all pure states

    Energy Technology Data Exchange (ETDEWEB)

    Carmeli, Claudio, E-mail: claudio.carmeli@gmail.com [D.I.M.E., Università di Genova, Via Cadorna 2, I-17100 Savona (Italy); I.N.F.N., Sezione di Genova, Via Dodecaneso 33, I-16146 Genova (Italy); Heinosaari, Teiko, E-mail: teiko.heinosaari@utu.fi [Turku Centre for Quantum Physics, Department of Physics and Astronomy, University of Turku (Finland); Toigo, Alessandro, E-mail: alessandro.toigo@polimi.it [Dipartimento di Matematica, Politecnico di Milano, Piazza Leonardo da Vinci 32, I-20133 Milano (Italy); I.N.F.N., Sezione di Milano, Via Celoria 16, I-20133 Milano (Italy)

    2013-09-02

    It has been recently shown by Heinosaari, Mazzarella and Wolf (2013) [1] that an observable that identifies all pure states of a d-dimensional quantum system has minimally 4d−4 outcomes or slightly less (the exact number depending on d). However, no simple construction of this type of minimal observable is known. We investigate covariant observables that identify all pure states and have minimal number of outcomes. It is shown that the existence of this kind of observables depends on the dimension of the Hilbert space.

  7. Leading change: 1--identifying the issue.

    Science.gov (United States)

    Kerridge, Joanna

    To enable sustainable change, nurses need to take the lead in managing it. Recent national initiatives have emphasised the importance of frontline staff in service improvement. The ability to influence and manage change has been identified as an essential skill for delivering new models of care. This article is the first in a three-part series designed to help nurses at all levels develop the knowledge and skills they will need to initiate and manage change. This article focuses on identifying what needs to be changed and why.

  8. Problems Identifying Independent and Dependent Variables

    Science.gov (United States)

    Leatham, Keith R.

    2012-01-01

    This paper discusses one step from the scientific method--that of identifying independent and dependent variables--from both scientific and mathematical perspectives. It begins by analyzing an episode from a middle school mathematics classroom that illustrates the need for students and teachers alike to develop a robust understanding of…

  9. Identifying Teaching Methods that Engage Entrepreneurship Students

    Science.gov (United States)

    Balan, Peter; Metcalfe, Mike

    2012-01-01

    Purpose: Entrepreneurship education particularly requires student engagement because of the complexity of the entrepreneurship process. The purpose of this paper is to describe how an established measure of engagement can be used to identify relevant teaching methods that could be used to engage any group of entrepreneurship students.…

  10. Cellular signaling identifiability analysis: a case study.

    Science.gov (United States)

    Roper, Ryan T; Pia Saccomani, Maria; Vicini, Paolo

    2010-05-21

    Two primary purposes for mathematical modeling in cell biology are (1) simulation for making predictions of experimental outcomes and (2) parameter estimation for drawing inferences from experimental data about unobserved aspects of biological systems. While the former purpose has become common in the biological sciences, the latter is less common, particularly when studying cellular and subcellular phenomena such as signaling-the focus of the current study. Data are difficult to obtain at this level. Therefore, even models of only modest complexity can contain parameters for which the available data are insufficient for estimation. In the present study, we use a set of published cellular signaling models to address issues related to global parameter identifiability. That is, we address the following question: assuming known time courses for some model variables, which parameters is it theoretically impossible to estimate, even with continuous, noise-free data? Following an introduction to this problem and its relevance, we perform a full identifiability analysis on a set of cellular signaling models using DAISY (Differential Algebra for the Identifiability of SYstems). We use our analysis to bring to light important issues related to parameter identifiability in ordinary differential equation (ODE) models. We contend that this is, as of yet, an under-appreciated issue in biological modeling and, more particularly, cell biology. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  11. Identifying jet quantum numbers event by event

    International Nuclear Information System (INIS)

    Teper, M.J.

    1979-12-01

    A method is proposed to identify the parton that gives rise to any particular jet. The method improves with the number of particles in the jet, and should indicate which of the jets in a three jet event at PETRA is the gluon jet. (author)

  12. Transverse momentum distributions of identified particles produced ...

    Indian Academy of Sciences (India)

    We assume that the transverse momentum distributions of identified particles measured in final state are contributed by a few energy sources which can be regarded as partons or quarks in the interacting system. The particle is contributed by each source with gluons which have transverse momentum distributions in an ...

  13. Identifying specific interstellar polycyclic aromatic hydrocarbons

    International Nuclear Information System (INIS)

    Mulas, Giacomo; Malloci, Giuliano; Porceddu, Ignazio

    2005-01-01

    Interstellar Polycyclic Aromatic Hydrocarbons (PAHs) have been thought to be ubiquitous for more than twenty years, yet no single species in this class has been identified in the Interstellar Medium (ISM) to date. The unprecedented sensitivity and resolution of present Infrared Space Observatory (ISO) and forthcoming Herschel observations in the far infrared spectral range will offer a unique way out of this embarrassing impasse

  14. Teaching science students to identify entrepreneurial opportunities

    NARCIS (Netherlands)

    Nab, J.

    2015-01-01

    This dissertation describes a research project on teaching science students to identify entrepreneurial opportunities, which is a core competence for entrepreneurs that should be emphasized in education. This research consists of four studies. The first case study aims at finding design strategies

  15. Identifying genetic relatives without compromising privacy.

    Science.gov (United States)

    He, Dan; Furlotte, Nicholas A; Hormozdiari, Farhad; Joo, Jong Wha J; Wadia, Akshay; Ostrovsky, Rafail; Sahai, Amit; Eskin, Eleazar

    2014-04-01

    The development of high-throughput genomic technologies has impacted many areas of genetic research. While many applications of these technologies focus on the discovery of genes involved in disease from population samples, applications of genomic technologies to an individual's genome or personal genomics have recently gained much interest. One such application is the identification of relatives from genetic data. In this application, genetic information from a set of individuals is collected in a database, and each pair of individuals is compared in order to identify genetic relatives. An inherent issue that arises in the identification of relatives is privacy. In this article, we propose a method for identifying genetic relatives without compromising privacy by taking advantage of novel cryptographic techniques customized for secure and private comparison of genetic information. We demonstrate the utility of these techniques by allowing a pair of individuals to discover whether or not they are related without compromising their genetic information or revealing it to a third party. The idea is that individuals only share enough special-purpose cryptographically protected information with each other to identify whether or not they are relatives, but not enough to expose any information about their genomes. We show in HapMap and 1000 Genomes data that our method can recover first- and second-order genetic relationships and, through simulations, show that our method can identify relationships as distant as third cousins while preserving privacy.

  16. Identifying the Multiple Intelligences of Your Students

    Science.gov (United States)

    McClellan, Joyce A.; Conti, Gary J.

    2008-01-01

    One way of addressing individual differences among adult learners is to identify the Multiple Intelligences of the learner. Multiple Intelligences refers to the concept developed by Howard Gardner that challenges the traditional view of intelligence and explains the presence of nine different Multiple Intelligences. The purpose of this study was…

  17. Congenital Heart Diseases associated with Identified Syndromes ...

    African Journals Online (AJOL)

    Recognised syndromes were seen in 69(68%) cases. Down syndrome with 54 children contributed 78.3% of those with known syndromes. Other identified syndromes and associations were Marfan's, Noonan's, Edwards, Prune Belly, Apert, Ellis-van creveld syndrome and congenital rubella syndrome. Congenital heart ...

  18. The Importance of identifiers: IWGSC Meeting 20170720

    OpenAIRE

    Haak, Laurel

    2017-01-01

    Presentation by Laure Haak at the 20 July 2017 meeting of the IWGSC, about use of identifiers in connecting researchers, funding, facilities, and publications. Description of approach and initial results of User Facilities and Publications Working Group, and applications for Scientific Collections.

  19. Structural identifiability of polynomial and rational systems

    NARCIS (Netherlands)

    J. Nemcová (Jana)

    2010-01-01

    htmlabstractSince analysis and simulation of biological phenomena require the availability of their fully specified models, one needs to be able to estimate unknown parameter values of the models. In this paper we deal with identifiability of parametrizations which is the property of one-to-one

  20. Having your radioactive objects identified and collected

    International Nuclear Information System (INIS)

    2012-12-01

    This brochure explains the risks linked with some ancient radioactive objects of domestic use (like radium products of medical use), how to identify them and to have them collected by the French national agency of radioactive wastes (Andra) for further processing. Some advice are given regarding the identification of the objects, their relative hazardousness and the precautions to take for their handling

  1. Interchange. Program Improvement Products Identified through Networking.

    Science.gov (United States)

    Ohio State Univ., Columbus. National Center for Research in Vocational Education.

    This catalog lists exemplary field-based program improvement products identified by the Dissemination and Utilization Products and Services Program (D&U) at the National Center for Research in Vocational Education. It is designed to increase awareness of these products among vocational educators and to provide information about them that…

  2. Identifying subgroup markers in heterogeneous populations

    NARCIS (Netherlands)

    de Ronde, Jorma J.; Rigaill, Guillem; Rottenberg, Sven; Rodenhuis, Sjoerd; Wessels, Lodewyk F. A.

    2013-01-01

    Traditional methods that aim to identify biomarkers that distinguish between two groups, like Significance Analysis of Microarrays or the t-test, perform optimally when such biomarkers show homogeneous behavior within each group and differential behavior between the groups. However, in many

  3. Identifying Effectiveness Criteria for Internet Payment Systems.

    Science.gov (United States)

    Shon, Tae-Hwan; Swatman, Paula M. C.

    1998-01-01

    Examines Internet payment systems (IPS): third-party, card, secure Web server, electronic token, financial electronic data interchange (EDI), and micropayment based. Reports the results of a Delphi survey of experts identifying and classifying IPS effectiveness criteria and classifying types of IPS providers. Includes the survey invitation letter…

  4. Using Persuasion Models to Identify Givers.

    Science.gov (United States)

    Ferguson, Mary Ann; And Others

    1986-01-01

    Assesses the feasibility of and suggests using W. J. McGuire's information processing theory and cognitive response analysis theory in research studies to identify "givers"--those who are likely to contribute money and resources to charities or volunteer to aid philanthropic organizations. (SRT)

  5. Identifying Ethical Hypernorms for Accounting Educators

    Science.gov (United States)

    Siegel, Philip H.; Mintz, Steven; Naser-Tavakolian, Mohsen; O'Shaughnessy, John

    2012-01-01

    Accounting educators have a unique role in academe because students learn about codes of ethics that will guide their actions as professionals. We identify hypernorms related to internal auditing educators that reflect unethical behaviors believed to be universally unacceptable by that community. We then compare the results to a prior survey of…

  6. Identify, Organize, and Retrieve Items Using Zotero

    Science.gov (United States)

    Clark, Brian; Stierman, John

    2009-01-01

    Librarians build collections. To do this they use tools that help them identify, organize, and retrieve items for the collection. Zotero (zoh-TAIR-oh) is such a tool that helps the user build a library of useful books, articles, web sites, blogs, etc., discovered while surfing online. A visit to Zotero's homepage, www.zotero.org, shows a number of…

  7. Identifying particular places through experimental walking

    Directory of Open Access Journals (Sweden)

    Henrik Schultz

    2016-11-01

    Full Text Available Experimental walking can be used to identify particular places, design strategies and spatial visions for urban landscapes. Walking designers can explore sites and, in particular, their temporal dynamics and atmospheric particularities – both essential elements in making particular places. This article illustrates the benefits of this method, using the changing German city of Freiburg as an example.

  8. Identifying Foods causing Allergies/ Intolerances among Diabetic ...

    African Journals Online (AJOL)

    Objective: This study was designed to identify the foods that caused allergies / intolerances and symptoms of reaction experienced by diabetic patients attending State Specialist Hospital, Akure. Materials and Methods: Ninety-eight diabetics aged 30-80 years (30 males and 68 females) were included in the study.

  9. Guidelines for identifying suspect/counterfeit material

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-09-01

    These guidelines are intended to assist users of products in identifying: substandard, misrepresented, or fraudulently marked items. The guidelines provide information about such topics as: precautions, inspection and testing, dispositioning identified items, installed inspection and reporting suspect/counterfeit materials. These guidelines apply to users who are developing procurement documents, product acceptance/verification methods, company procedures, work instructions, etc. The intent of these SM guidelines in relation to the Quality Assurance Program Description (QAPD) and implementing company Management Control Procedures is not to substitute or replace existing requirements, as defined in either the QAPD or company implementing instructions (Management Control Procedures). Instead, the guidelines are intended to provide a consolidated source of information addressing the issue of Suspect/Counterfeit materials. These guidelines provide an extensive suspect component listing and suspect indications listing. Users can quickly check their suspect items against the list of manufacturers products (i.e., type, LD. number, and nameplate information) by consulting either of these listings.

  10. Identifying the borders of mathematical knowledge

    International Nuclear Information System (INIS)

    Silva, Filipi Nascimento; Travencolo, Bruno A N; Viana, Matheus P; Costa, Luciano da Fontoura

    2010-01-01

    Based on a divide and conquer approach, knowledge about nature has been organized into a set of interrelated facts, allowing a natural representation in terms of graphs: each 'chunk' of knowledge corresponds to a node, while relationships between such chunks are expressed as edges. This organization becomes particularly clear in the case of mathematical theorems, with their intense cross-implications and relationships. We have derived a web of mathematical theorems from Wikipedia and, thanks to the powerful concept of entropy, identified its more central and frontier elements. Our results also suggest that the central nodes are the oldest theorems, while the frontier nodes are those recently added to the network. The network communities have also been identified, allowing further insights about the organization of this network, such as its highly modular structure.

  11. An Xpert screen to identify carbapenemases

    Directory of Open Access Journals (Sweden)

    Mubin Kazi

    2016-01-01

    Full Text Available To prevent the spread of carbapenemases-producing Enterobacteriaceae (CPE active surveillance, contact isolation and cohorting infected patients should be practiced. Rectal swabs for the Xpert MDRO-assay of 32 patients were included. 71.85% were positive for targets incorporated into the MDRO-assay; whereas 28% were phenotypically not CRE and Xpert negative (9.37% had different mechanism [bla OXA]. The assay identified 59.3%, 9.37% and 3.1% as bla NDM, bla NDM+VIM and bla VIM, respectively. The assay is a screening test that identifies CPE harbouring organism within an hour and can be installed at tertiary-care facilities to screen colonized patients.

  12. Persistent Identifiers for Dutch cultural heritage institutions

    Science.gov (United States)

    Ras, Marcel; Kruithof, Gijsbert

    2016-04-01

    Over the past years, more and more collections belonging to archives, libraries, media, museums, and knowledge institutes are being digitised and made available online. These are exciting times for ALM institutions. They are realising that, in the information society, their collections are goldmines. Unfortunately most heritage institutions in the Netherlands do not yet meet the basic preconditions for long-term availability of their collections. The digital objects often have no long lasting fixed reference yet. URL's and web addresses change. Some digital objects that were referenced in Europeana and other portals can no longer be found. References in scientific articles have a very short life span, which is damaging for scholarly research. In 2015, the Dutch Digital Heritage Network (NDE) has started a two-year work program to co-ordinate existing initiatives in order to improve the (long-term) accessibility of the Dutch digital heritage for a wide range of users, anytime, anyplace. The Digital Heritage Network is a partnership established on the initiative of the Ministry of Education, Culture and Science. The members of the NDE are large, national institutions that strive to professionally preserve and manage digital data, e.g. the National Library, The Netherlands Institute for Sound and Vision, the Netherlands Cultural Heritage Agency, the Royal Netherlands Academy of Arts and Sciences, the National Archive of the Netherlands and the DEN Foundation, and a growing number of associations and individuals both within and outside the heritage sector. By means of three work programmes the goals of the Network should be accomplished and improve the visibility, the usability and the sustainability of digital heritage. Each programme contains of a set of projects. Within the sustainability program a project on creating a model for persistent identifiers is taking place. The main goals of the project are (1) raise awareness among cultural heritage institutions on the

  13. Method for identifying particulate fluoride compounds

    Energy Technology Data Exchange (ETDEWEB)

    Tufts, B J

    1960-01-01

    A method is described for identifying particulates containing fluorides and other complex fluorine compounds such as fluorosilicate in samples collected on membrane filters. The filter is treated with lead chloride to precipitate lead chlorofluoride at each fluoride-containing spot. This microspot is identified by examination in a light microscope. Sulfate and phosphate, which also precipitate if present, can be distinguished and do not interfere. Calibrations are given for the fluorides and the more insoluble salts, relating the original particle size to the reaction site size. Thus, the mass of the particles can be calculated. Results of some field tests in an area of fluoride pollution are given, and compared with standard testing procedures.

  14. Trustworthy persistent identifier systems of the future

    Science.gov (United States)

    Golodoniuc, Pavel; Klump, Jens; Car, Nicholas

    2016-04-01

    Over the last two decades, persistent identifier (PID) systems have seen some significant changes in their governance policies, system capabilities, and technology. The development of most systems was driven by two main application areas, namely archives and libraries. Guidelines and criteria for trustworthy PID systems have been clearly devised (Bütikofer, 2009) and many PID system implementations for the identification of static digital objects have been built (e.g., PURL). However systems delivering persistent identifiers for dynamic datasets are not yet mature. There has been a rapid proliferation of different PID systems caused by the specific technical or organisational requirements of various communities that could not be met by existing systems such as DOI, ISBN, and EAN. Many of these different systems were limited by their inability to provide native means of persistent identifier resolution. This has prompted a decoupling of PID-associated data from the resolution service and this is where the Handle system has played a significant role. The Handle allowed to build a distributed system of independently managed resolver services. A trustworthy PID system must be designed to outlive the objects it provides persistent identifiers for, which may cease to exist or otherwise be deprecated, and the technology used to implement it, which will certainly need to change with time. We propose that such a system should rest on four pillars of agreements - (i) definitions, (ii) policies, (iii) services, and (iv) data services, to ensure longevity. While we believe all four pillars are equally important, we intentionally leave regulating aspects of issuing of identifiers and their registration out of the scope of this paper and focus on the agreements that have to be established between PID resolver services and the data sources indicated by the persistent identifiers. We propose an approach to development of PID systems that combines the use of (a) the Handle system

  15. Identifying the Universal part of TMDs

    CERN Document Server

    Van der Veken, F.F.

    2016-01-01

    We attempt to identify a path layout in the definition of transverse-momentum-dependent T-odd parton distribution functions (TMD)s which combines features of both, initial- and final-state interactions, so that it remains universal despite the fact that the Wilson lines entering such TMDs change their orientation. The generic structure of the quark correlator for this path layout is calculated.

  16. The Complexity of Identifying Large Equivalence Classes

    DEFF Research Database (Denmark)

    Skyum, Sven; Frandsen, Gudmund Skovbjerg; Miltersen, Peter Bro

    1999-01-01

    We prove that at least 3k−4/k(2k−3)(n/2) – O(k)equivalence tests and no more than 2/k (n/2) + O(n) equivalence tests are needed in the worst case to identify the equivalence classes with at least k members in set of n elements. The upper bound is an improvement by a factor 2 compared to known res...

  17. Identifying Topics in Microblogs Using Wikipedia.

    Directory of Open Access Journals (Sweden)

    Ahmet Yıldırım

    Full Text Available Twitter is an extremely high volume platform for user generated contributions regarding any topic. The wealth of content created at real-time in massive quantities calls for automated approaches to identify the topics of the contributions. Such topics can be utilized in numerous ways, such as public opinion mining, marketing, entertainment, and disaster management. Towards this end, approaches to relate single or partial posts to knowledge base items have been proposed. However, in microblogging systems like Twitter, topics emerge from the culmination of a large number of contributions. Therefore, identifying topics based on collections of posts, where individual posts contribute to some aspect of the greater topic is necessary. Models, such as Latent Dirichlet Allocation (LDA, propose algorithms for relating collections of posts to sets of keywords that represent underlying topics. In these approaches, figuring out what the specific topic(s the keyword sets represent remains as a separate task. Another issue in topic detection is the scope, which is often limited to specific domain, such as health. This work proposes an approach for identifying domain-independent specific topics related to sets of posts. In this approach, individual posts are processed and then aggregated to identify key tokens, which are then mapped to specific topics. Wikipedia article titles are selected to represent topics, since they are up to date, user-generated, sophisticated articles that span topics of human interest. This paper describes the proposed approach, a prototype implementation, and a case study based on data gathered during the heavily contributed periods corresponding to the four US election debates in 2012. The manually evaluated results (0.96 precision and other observations from the study are discussed in detail.

  18. Identifying Topics in Microblogs Using Wikipedia.

    Science.gov (United States)

    Yıldırım, Ahmet; Üsküdarlı, Suzan; Özgür, Arzucan

    2016-01-01

    Twitter is an extremely high volume platform for user generated contributions regarding any topic. The wealth of content created at real-time in massive quantities calls for automated approaches to identify the topics of the contributions. Such topics can be utilized in numerous ways, such as public opinion mining, marketing, entertainment, and disaster management. Towards this end, approaches to relate single or partial posts to knowledge base items have been proposed. However, in microblogging systems like Twitter, topics emerge from the culmination of a large number of contributions. Therefore, identifying topics based on collections of posts, where individual posts contribute to some aspect of the greater topic is necessary. Models, such as Latent Dirichlet Allocation (LDA), propose algorithms for relating collections of posts to sets of keywords that represent underlying topics. In these approaches, figuring out what the specific topic(s) the keyword sets represent remains as a separate task. Another issue in topic detection is the scope, which is often limited to specific domain, such as health. This work proposes an approach for identifying domain-independent specific topics related to sets of posts. In this approach, individual posts are processed and then aggregated to identify key tokens, which are then mapped to specific topics. Wikipedia article titles are selected to represent topics, since they are up to date, user-generated, sophisticated articles that span topics of human interest. This paper describes the proposed approach, a prototype implementation, and a case study based on data gathered during the heavily contributed periods corresponding to the four US election debates in 2012. The manually evaluated results (0.96 precision) and other observations from the study are discussed in detail.

  19. Identifying modular relations in complex brain networks

    DEFF Research Database (Denmark)

    Andersen, Kasper Winther; Mørup, Morten; Siebner, Hartwig

    2012-01-01

    We evaluate the infinite relational model (IRM) against two simpler alternative nonparametric Bayesian models for identifying structures in multi subject brain networks. The models are evaluated for their ability to predict new data and infer reproducible structures. Prediction and reproducibility...... and obtains comparable reproducibility and predictability. For resting state functional magnetic resonance imaging data from 30 healthy controls the IRM model is also superior to the two simpler alternatives, suggesting that brain networks indeed exhibit universal complex relational structure...

  20. Identifying chiral bands in real nuclei

    International Nuclear Information System (INIS)

    Shirinda, O.; Lawrie, E.A.

    2012-01-01

    The application of the presently used fingerprints of chiral bands (originally derived for strongly broken chirality) is investigated for real chiral systems. In particular the chiral fingerprints concerning the B(M1) staggering patterns and the energy staggering are studied. It is found that both fingerprints show considerable changes for real chiral systems, a behaviour that creates a significant risk for misinterpretation of the experimental data and can lead to a failure to identify real chiral systems. (orig.)

  1. Which functional unit to identify sustainable foods?

    Science.gov (United States)

    Masset, Gabriel; Vieux, Florent; Darmon, Nicole

    2015-09-01

    In life-cycle assessment, the functional unit defines the unit for calculation of environmental indicators. The objective of the present study was to assess the influence of two functional units, 100 g and 100 kcal (420 kJ), on the associations between three dimensions for identifying sustainable foods, namely environmental impact (via greenhouse gas emissions (GHGE)), nutritional quality (using two distinct nutrient profiling systems) and price. GHGE and price data were collected for individual foods, and were each expressed per 100 g and per 100 kcal. Two nutrient profiling models, SAIN,LIM and UK Ofcom, were used to assess foods' nutritional quality. Spearman correlations were used to assess associations between variables. Sustainable foods were identified as those having more favourable values for all three dimensions. The French Individual and National Dietary Survey (INCA2), 2006-2007. Three hundred and seventy-three foods highly consumed in INCA2, covering 65 % of total energy intake of adult participants. When GHGE and price were expressed per 100 g, low-GHGE foods had a lower price and higher SAIN,LIM and Ofcom scores (r=0·59, -0·34 and -0·43, respectively), suggesting a compatibility between the three dimensions; 101 and 100 sustainable foods were identified with SAIN,LIM and Ofcom, respectively. When GHGE and price were expressed per 100 kcal, low-GHGE foods had a lower price but also lower SAIN,LIM and Ofcom scores (r=0·67, 0·51 and 0·47, respectively), suggesting that more environment-friendly foods were less expensive but also less healthy; thirty-four sustainable foods were identified with both SAIN,LIM and Ofcom. The choice of functional unit strongly influenced the compatibility between the sustainability dimensions and the identification of sustainable foods.

  2. Identifying Tracks Duplicates via Neural Network

    CERN Document Server

    Sunjerga, Antonio; CERN. Geneva. EP Department

    2017-01-01

    The goal of the project is to study feasibility of state of the art machine learning techniques in track reconstruction. Machine learning techniques provide promising ways to speed up the pattern recognition of tracks by adding more intelligence in the algorithms. Implementation of neural network to process of track duplicates identifying will be discussed. Different approaches are shown and results are compared to method that is currently in use.

  3. Identifying Social Satisfaction from Social Media

    OpenAIRE

    Bai, Shuotian; Gao, Rui; Hao, Bibo; Yuan, Sha; Zhu, Tingshao

    2014-01-01

    We demonstrate the critical need to identify social situation and instability factors by acquiring public social satisfaction in this research. However, subject to the large amount of manual work cost in subject recruitment and data processing, conventional self-reported method cannot be implemented in real time or applied in large scale investigation. To solve the problem, this paper proposed an approach to predict users' social satisfaction, especially for the economy-related satisfaction b...

  4. Efforts to identify spore forming bacillus

    Energy Technology Data Exchange (ETDEWEB)

    Zuleiha, M.S.; Hilmy, N. (National Atomic Energy Agency, Jakarta (Indonesia). Pasar Djumat Research Centre)

    1982-04-01

    Efforts to identify 47 species of radioresistant spore forming bacillus sp. isolated from locally produced medical devices have been carried out. The identifications was conducted using 19 kinds of biochemical tests and compared to species to bacillus subtilis W. T.; bacillus pumilus E 601 and bacillus sphaericus Csub(I)A. The results showed that bacillus sp. examined could be divided into 6 groups, i.e. bacillus cereus; bacillus subtilis; bacillus stearothermophylus; bacillus coagulans; bacillus sphaericus and bacillus circulans.

  5. Efforts to identify spore forming bacillus

    International Nuclear Information System (INIS)

    Zuleiha, M.S.; Hilmy, Nazly

    1982-01-01

    Efforts to identify 47 species of radioresistant spore forming bacillus sp. isolated from locally produced medical devices have been carried out. The identifications was conducted using 19 kinds of biochemical tests and compared to species to bacillus subtilis W. T.; bacillus pumilus E 601 and bacillus sphaericus Csub(I)A. The results showed that bacillus sp. examined could be divided into 6 groups, i.e. bacillus cereus; bacillus subtilis; bacillus stearothermophylus; bacillus coagulans; bacillus sphaericus and bacillus circulans. (author)

  6. Identifying subgroups of CERME affect research papers

    OpenAIRE

    Hannula, Markku S.; Garcia Moreno-Esteva, Enrique

    2017-01-01

    Research in mathematics related affect uses a variety of theoretical frameworks. Three different dimensions have been suggested as significant to characterize concepts in this area: (1) emotional, motivational, and cognitive aspects of affect, (2) state and trait aspects of affect, and (3) physiological, psychological, and sociological level of theorizing affect. In this study, we used the information in reference lists and graph theory to identify Graph Communities (coherent clusters) of res...

  7. Identifying mechanistic similarities in drug responses

    KAUST Repository

    Zhao, C.

    2012-05-15

    Motivation: In early drug development, it would be beneficial to be able to identify those dynamic patterns of gene response that indicate that drugs targeting a particular gene will be likely or not to elicit the desired response. One approach would be to quantitate the degree of similarity between the responses that cells show when exposed to drugs, so that consistencies in the regulation of cellular response processes that produce success or failure can be more readily identified.Results: We track drug response using fluorescent proteins as transcription activity reporters. Our basic assumption is that drugs inducing very similar alteration in transcriptional regulation will produce similar temporal trajectories on many of the reporter proteins and hence be identified as having similarities in their mechanisms of action (MOA). The main body of this work is devoted to characterizing similarity in temporal trajectories/signals. To do so, we must first identify the key points that determine mechanistic similarity between two drug responses. Directly comparing points on the two signals is unrealistic, as it cannot handle delays and speed variations on the time axis. Hence, to capture the similarities between reporter responses, we develop an alignment algorithm that is robust to noise, time delays and is able to find all the contiguous parts of signals centered about a core alignment (reflecting a core mechanism in drug response). Applying the proposed algorithm to a range of real drug experiments shows that the result agrees well with the prior drug MOA knowledge. © The Author 2012. Published by Oxford University Press. All rights reserved.

  8. Identified particles in quark and gluon jets

    CERN Document Server

    Abreu, P; Adye, T; Ajinenko, I; Alekseev, G D; Alemany, R; Allport, P P; Almehed, S; Amaldi, Ugo; Amato, S; Andreazza, A; Andrieux, M L; Antilogus, P; Apel, W D; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barão, F; Barbi, M S; Barbiellini, Guido; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Bärring, O; Barrio, J A; Bartl, Walter; Bates, M J; Battaglia, Marco; Baubillier, M; Baudot, J; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Benvenuti, Alberto C; Berggren, M; Bertini, D; Bertrand, D; Besançon, M; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bizouard, M A; Bloch, D; Blume, M; Bolognese, T; Bonesini, M; Bonivento, W; Booth, P S L; Bosio, C; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Bricman, C; Brown, R C A; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Cabrera, S; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Cankocak, K; Cao, F; Carena, F; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Chabaud, V; Charpentier, P; Chaussard, L; Checchia, P; Chelkov, G A; Chen, M; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Chudoba, J; Cindro, V; Collins, P; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Cowell, J H; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; Dahl-Jensen, Erik; Dahm, J; D'Almagne, B; Dam, M; Damgaard, G; Dauncey, P D; Davenport, Martyn; Da Silva, W; Defoix, C; Deghorain, A; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; De Saint-Jean, C; Dijkstra, H; Di Ciaccio, Lucia; Di Diodato, A; Djama, F; Djannati, A; Dolbeau, J; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Durand, J D; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Elsing, M; Engel, J P; Erzen, B; Espirito-Santo, M C; Falk, E; Fassouliotis, D; Feindt, Michael; Ferrer, A; Fichet, S; Filippas-Tassos, A; Firestone, A; Fischer, P A; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frenkiel, P; Fries, D E C; Frodesen, A G; Frühwirth, R; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Gerdyukov, L N; Gokieli, R; Golob, B; Gopal, Gian P; Gorn, L; Górski, M; Guz, Yu; Gracco, Valerio; Graziani, E; Green, C; Grefrath, A; Gris, P; Grosdidier, G; Grzelak, K; Gumenyuk, S A; Gunnarsson, P; Günther, M; Guy, J; Hahn, F; Hahn, S; Hajduk, Z; Hallgren, A; Hamacher, K; Harris, F J; Hedberg, V; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Heuser, J M; Higón, E; Hilke, Hans Jürgen; Hill, T S; Holmgren, S O; Holt, P J; Holthuizen, D J; Hoorelbeke, S; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, C; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, Christian; Juillot, P; Kaiser, M; Kapusta, F; Karafasoulis, K; Karlsson, M; Karvelas, E; Katargin, A; Katsanevas, S; Katsoufis, E C; Keränen, R; Khokhlov, Yu A; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klapp, O; Klein, H; Klovning, A; Kluit, P M; Köne, B; Kokkinias, P; Koratzinos, M; Korcyl, K; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Krammer, Manfred; Kreuter, C; Kronkvist, I J; Krumshtein, Z; Krupinski, W; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Laktineh, I; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Lapin, V; Laugier, J P; Lauhakangas, R; Leder, Gerhard; Ledroit, F; Lefébure, V; Legan, C K; Leitner, R; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Libby, J; Liko, D; Lindner, R; Lipniacka, A; Lippi, I; Lörstad, B; Loken, J G; López, J M; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J N; Maehlum, G; Mahon, J R; Malmgren, T G M; Malychev, V; Mandl, F; Marco, J; Marco, R P; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Masik, J; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; Medbo, J; Merk, M; Meroni, C; Meyer, S; Meyer, W T; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Morettini, P; Müller, H; Münich, K; Mulders, M; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Nawrocki, K; Negri, P; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Niss, P; Nomerotski, A; Normand, Ainsley; Novák, M; Oberschulte-Beckmann, W; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Österberg, K; Ouraou, A; Paganini, P; Paganoni, M; Pagès, P; Pain, R; Palka, H; Papadopoulou, T D; Papageorgiou, K; Pape, L; Parkes, C; Parodi, F; Passeri, A; Pegoraro, M; Peralta, L; Pernicka, Manfred; Perrotta, A; Petridou, C; Petrolini, A; Petrovykh, M; Phillips, H T; Piana, G; Pierre, F; Pimenta, M; Podobnik, T; Podobrin, O; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Privitera, P; Pukhaeva, N; Pullia, Antonio; Radojicic, D; Ragazzi, S; Rahmani, H; Rames, J; Ratoff, P N; Read, A L; Reale, M; Rebecchi, P; Redaelli, N G; Regler, Meinhard; Reid, D; Reinhardt, R; Renton, P B; Resvanis, L K; Richard, F; Richardson, J; Rídky, J; Rinaudo, G; Ripp, I; Romero, A; Roncagliolo, I; Ronchese, P; Roos, L; Rosenberg, E I; Roudeau, Patrick; Rovelli, T; Rückstuhl, W; Ruhlmann-Kleider, V; Ruiz, A; Rybicki, K; Rybin, A; Saarikko, H; Sacquin, Yu; Sadovskii, A; Sahr, O; Sajot, G; Salt, J; Sánchez, J; Sannino, M; Schimmelpfennig, M; Schneider, H; Schwickerath, U; Schyns, M A E; Sciolla, G; Scuri, F; Seager, P; Sedykh, Yu; Segar, A M; Seitz, A; Sekulin, R L; Serbelloni, L; Shellard, R C; Siegrist, P; Silvestre, R; Simonetti, S; Simonetto, F; Sissakian, A N; Sitár, B; Skaali, T B; Smadja, G; Smirnov, N; Smirnova, O G; Smith, G R; Sosnowski, R; Souza-Santos, D; Spassoff, Tz; Spiriti, E; Sponholz, P; Squarcia, S; Stampfer, D; Stanescu, C; Stanic, S; Stapnes, Steinar; Stavitski, I; Stevenson, K; Stocchi, A; Strauss, J; Strub, R; Stugu, B; Szczekowski, M; Szeptycka, M; Tabarelli de Fatis, T; Tavernet, J P; Chikilev, O G; Thomas, J; Tilquin, A; Timmermans, J; Tkatchev, L G; Todorov, T; Todorova, S; Toet, D Z; Tomaradze, A G; Tomé, B; Tonazzo, A; Tortora, L; Tranströmer, G; Treille, D; Tristram, G; Trombini, A; Troncon, C; Tsirou, A L; Turluer, M L; Tyapkin, I A; Tyndel, M; Tzamarias, S; Überschär, B; Ullaland, O; Uvarov, V; Valenti, G; Vallazza, E; Van der Velde, C; van Apeldoorn, G W; van Dam, P; Van Doninck, W K; Van Eldik, J; Van Lysebetten, A; Vassilopoulos, N; Vegni, G; Ventura, L; Venus, W A; Verbeure, F; Verlato, M; Vertogradov, L S; Vilanova, D; Vincent, P; Vitale, L; Vlasov, E; Vodopyanov, A S; Vrba, V; Wahlen, H; Walck, C; Weierstall, M; Weilhammer, Peter; Weiser, C; Wetherell, Alan M; Wicke, D; Wickens, J H; Wielers, M; Wilkinson, G R; Williams, W S C; Winter, M; Witek, M; Wlodek, T; Woschnagg, K; Yip, K; Yushchenko, O P; Zach, F; Zaitsev, A; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zevgolatakos, E; Zimin, N I; Zito, M; Zontar, D; Zucchelli, G C; Zumerle, G

    1997-01-01

    A sample of about 1.4 million hadronic \\z decays, selected among the data recorded by the DELPHI detector at LEP during 1994, was used to measure for the first time the momentum spectra of \\kp, \\ko, \\p, \\l and their antiparticles in gluon and quark jets. As observed for inclusive charged particles, the production spectra of identified particles were found to be softer in gluon jets than in quark jets, with a higher total multiplicity.

  9. Identifying Broadband Rotational Spectra with Neural Networks

    Science.gov (United States)

    Zaleski, Daniel P.; Prozument, Kirill

    2017-06-01

    A typical broadband rotational spectrum may contain several thousand observable transitions, spanning many species. Identifying the individual spectra, particularly when the dynamic range reaches 1,000:1 or even 10,000:1, can be challenging. One approach is to apply automated fitting routines. In this approach, combinations of 3 transitions can be created to form a "triple", which allows fitting of the A, B, and C rotational constants in a Watson-type Hamiltonian. On a standard desktop computer, with a target molecule of interest, a typical AUTOFIT routine takes 2-12 hours depending on the spectral density. A new approach is to utilize machine learning to train a computer to recognize the patterns (frequency spacing and relative intensities) inherit in rotational spectra and to identify the individual spectra in a raw broadband rotational spectrum. Here, recurrent neural networks have been trained to identify different types of rotational spectra and classify them accordingly. Furthermore, early results in applying convolutional neural networks for spectral object recognition in broadband rotational spectra appear promising. Perez et al. "Broadband Fourier transform rotational spectroscopy for structure determination: The water heptamer." Chem. Phys. Lett., 2013, 571, 1-15. Seifert et al. "AUTOFIT, an Automated Fitting Tool for Broadband Rotational Spectra, and Applications to 1-Hexanal." J. Mol. Spectrosc., 2015, 312, 13-21. Bishop. "Neural networks for pattern recognition." Oxford university press, 1995.

  10. Metabolites of cannabidiol identified in human urine.

    Science.gov (United States)

    Harvey, D J; Mechoulam, R

    1990-03-01

    1. Urine from a dystonic patient treated with cannabidiol (CBD) was examined by g.l.c.-mass spectrometry for CBD metabolites. Metabolites were identified as their trimethylsilyl (TMS), [2H9]TMS, and methyl ester/TMS derivatives and as the TMS derivatives of the product of lithium aluminium deuteride reduction. 2. Thirty-three metabolites were identified in addition to unmetabolized CBD, and a further four metabolites were partially characterized. 3. The major metabolic route was hydroxylation and oxidation at C-7 followed by further hydroxylation in the pentyl and propenyl groups to give 1"-, 2"-, 3"-, 4"- and 10-hydroxy derivatives of CBD-7-oic acid. Other metabolites, mainly acids, were formed by beta-oxidation and related biotransformations from the pentyl side-chain and these were also hydroxylated at C-6 or C-7. The major oxidized metabolite was CBD-7-oic acid containing a hydroxyethyl side-chain. 4. Two 8,9-dihydroxy compounds, presumably derived from the corresponding epoxide were identified. 5. Also present were several cyclized cannabinoids including delta-6- and delta-1-tetrahydrocannabinol and cannabinol. 6. This is the first metabolic study of CBD in humans; most observed metabolic routes were typical of those found for CBD and related cannabinoids in other species.

  11. Anesthesiology leadership rounding: identifying opportunities for improvement.

    Science.gov (United States)

    Gravenstein, Dietrich; Ford, Susan; Enneking, F Kayser

    2012-01-01

    Rounding that includes participation of individuals with authority to implement changes has been advocated as important to the transformation of an institution into a high-quality and safe organization. We describe a Department of Anesthesiology's experience with leadership rounding. The Department Chair or other senior faculty designate, a quality coordinator, up to four residents, the ward charge nurse, and patient nurses participated in rounds at bedsides. During a 23-month period, 14 significant opportunities to improve care were identified. Nurses identified 5 of these opportunities, primary team physicians 2, the rounding team 4, and patients or their family members another 3. The anesthesiology service had sole or shared responsibility for 10 improvements. A variety of organizations track specific measures across all phases of the patient experience to gauge quality of care. Chart auditing tools for detecting threats to safety are often used. These measures and tools missed opportunities for improvement that were discovered only through rounding. We conclude that the introduction of leadership rounding by an anesthesiology service can identify opportunities for improving quality that are not captured by conventional efforts.

  12. Identifying web usage behavior of bank customers

    Science.gov (United States)

    Araya, Sandro; Silva, Mariano; Weber, Richard

    2002-03-01

    The bank Banco Credito e Inversiones (BCI) started its virtual bank in 1996 and its registered customers perform currently more than 10,000 Internet transactions daily, which typically cause les than 10% of traditional transaction costs. Since most of the customers are still not registered for online banking, one of the goals of the virtual bank is to increase then umber of registered customers. Objective of the presented work was to identify customers who are likely to perform online banking but still do not use this medium for their transactions. This objective has been reached by determining profiles of registered customers who perform many transactions online. Based on these profiles the bank's Data Warehouse is explored for twins of these heavy users that are still not registered for online banking. We applied clustering in order to group the registered customers into five classes. One of these classes contained almost 30% of all registered customers and could clearly be identified as class of heavy users. Next a neural network assigned online customers to the previously found five classes. Applying the network trained on online customers to all the bank customers identified twins of heavy users that, however had not performed online transactions so far. A mailing to these candidates informing about the advantages of online banking doubled the number of registrations compared to previous campaigns.

  13. Body linear traits for identifying prolific goats

    Directory of Open Access Journals (Sweden)

    Avijit Haldar

    2014-12-01

    Full Text Available Aim: The present study was conducted on prolific goat breed to identify body linear type traits that might be associated with prolificacy trait in goats. Materials and Methods: Two-stage stratified random sample survey based data were collected from 1427 non-pregnant goats with the history of single, twin and triplet litter sizes (LZ between January 2008 to February 2011 for 3 years in 68 villages located in East and North East India. Data on sixteen body linear traits were analyzed using logistic regression model to do the step-wise selection for identifying the body linear traits that could determine LZ. An average value for each identified body linear trait was determined for classifying the goats into three categories: Goats having the history of single LZ, goats having the history of twin LZ and goats having the history of triplet LZ. Results: The LZ proportions for single, twin and triplet, were 29.50, 59.14 and 11.36%, respectively, with the prolificacy rate of 181.85% in Indian Black Bengal goats. A total of eight body linear traits that could determine LZ in prolific goats were identified. Heart girth (HG measurement (>60.90 cm, paunch girth (PG (>70.22 cm, wither height (WH (>49.75 cm, neck length (>21.45 cm, ear length (>12.80 cm and distance between trochanter major (DTM bones (>12.28 cm, pelvic triangle area (PTA (>572.25 cm2 and clearance at udder (CU (>23.16 cm showed an increase likelihood of multiple LZ when compared to single LZ. Further, HG measurement (>62.29 cm, WH (>50.54 cm, PG (>71.85 cm and ear length (>13.00 cm, neck length (>22.01 cm, PTA (>589.64 cm2, CU (>23.20 cm and DTM bones (>12.47 cm were associated with increased likelihood of triplet LZ, when compared with that of twin LZ. Conclusion: HG measurement was the best discriminating factor, while PG, neck length, DTM bones, CU, PTA, WH and ear length measurements were other important factors that could be used for identifying prolific goats to achieve economic

  14. Persistent Identifiers, Discoverability and Open Science (Communication)

    Science.gov (United States)

    Murphy, Fiona; Lehnert, Kerstin; Hanson, Brooks

    2016-04-01

    Early in 2016, the American Geophysical Union announced it was incorporating ORCIDs into its submission workflows. This was accompanied by a strong statement supporting the use of other persistent identifiers - such as IGSNs, and the CrossRef open registry 'funding data'. This was partly in response to funders' desire to track and manage their outputs. However the more compelling argument, and the reason why the AGU has also signed up to the Center for Open Science's Transparency and Openness Promotion (TOP) Guidelines (http://cos.io/top), is that ultimately science and scientists will be the richer for these initiatives due to increased opportunities for interoperability, reproduceability and accreditation. The AGU has appealed to the wider community to engage with these initiatives, recognising that - unlike the introduction of Digital Object Identifiers (DOIs) for articles by CrossRef - full, enriched use of persistent identifiers throughout the scientific process requires buy-in from a range of scholarly communications stakeholders. At the same time, across the general research landscape, initiatives such as Project CRediT (contributor roles taxonomy), Publons (reviewer acknowledgements) and the forthcoming CrossRef DOI Event Tracker are contributing to our understanding and accreditation of contributions and impact. More specifically for earth science and scientists, the cross-functional Coalition for Publishing Data in the Earth and Space Sciences (COPDESS) was formed in October 2014 and is working to 'provide an organizational framework for Earth and space science publishers and data facilities to jointly implement and promote common policies and procedures for the publication and citation of data across Earth Science journals'. Clearly, the judicious integration of standards, registries and persistent identifiers such as ORCIDs and International Geo Sample Numbers (IGSNs) to the research and research output processes is key to the success of this venture

  15. Identifying and overcoming barriers to technology implementation

    International Nuclear Information System (INIS)

    Bailey, M.; Warren, S.; McCune, M.

    1996-01-01

    In a recent General Accounting Office report, the Department of Energy's (DOE) Office of Environmental Management was found to be ineffective in integrating their environmental technology development efforts with the cleanup actions. As a result of these findings, a study of remediation documents was performed by the Technology Applications Team within DOE's Office of Environmental Restoration (EM-40) to validate this finding and to understand why it was occurring. A second initiative built on the foundation of the remediation document study and evaluated solutions to the ineffective implementation of improved technologies. The Technology Applications Team examined over 50 remediation documents (17 projects) which included nearly 600 proposed remediation technologies. It was determined that very few technologies are reaching the Records of Decision documents. In fact, most are eliminated in the early stages of consideration. These observations stem from regulators' and stakeholders' uncertainties in cost and performance of the technology and the inability of the technology to meet site specific conditions. The Technology Applications Team also set out to identify and evaluate solutions to barriers to implementing innovative technology into the DOE's environmental management activities. Through the combined efforts of DOE and the Hazardous Waste Action Coalition (HWAC), a full day workshop was conducted at the annual HWAC meeting in June 1995 to solve barriers to innovative technology implementation. Three barriers were identified as widespread throughout the DOE complex and industry. Identified barriers included a lack of verified or certified cost and performance data for innovative technologies; risk of failure to reach cleanup goals using innovative technologies; and communication barriers that are present at virtually every stage of the characterization/remediation process from development through implementation

  16. Identifying novel drug indications through automated reasoning.

    Directory of Open Access Journals (Sweden)

    Luis Tari

    Full Text Available With the large amount of pharmacological and biological knowledge available in literature, finding novel drug indications for existing drugs using in silico approaches has become increasingly feasible. Typical literature-based approaches generate new hypotheses in the form of protein-protein interactions networks by means of linking concepts based on their cooccurrences within abstracts. However, this kind of approaches tends to generate too many hypotheses, and identifying new drug indications from large networks can be a time-consuming process.In this work, we developed a method that acquires the necessary facts from literature and knowledge bases, and identifies new drug indications through automated reasoning. This is achieved by encoding the molecular effects caused by drug-target interactions and links to various diseases and drug mechanism as domain knowledge in AnsProlog, a declarative language that is useful for automated reasoning, including reasoning with incomplete information. Unlike other literature-based approaches, our approach is more fine-grained, especially in identifying indirect relationships for drug indications.To evaluate the capability of our approach in inferring novel drug indications, we applied our method to 943 drugs from DrugBank and asked if any of these drugs have potential anti-cancer activities based on information on their targets and molecular interaction types alone. A total of 507 drugs were found to have the potential to be used for cancer treatments. Among the potential anti-cancer drugs, 67 out of 81 drugs (a recall of 82.7% are indeed known cancer drugs. In addition, 144 out of 289 drugs (a recall of 49.8% are non-cancer drugs that are currently tested in clinical trials for cancer treatments. These results suggest that our method is able to infer drug indications (original or alternative based on their molecular targets and interactions alone and has the potential to discover novel drug indications for

  17. Identifying suitable sites for Florida panther reintroduction

    Science.gov (United States)

    Thatcher, Cindy A.; van Manen, Frank T.; Clark, Joseph D.

    2006-01-01

    A major objective of the 1995 Florida Panther (Puma concolor cory) Recovery Plan is the establishment of 2 additional panther populations within the historic range. Our goal was to identify prospective sites for Florida panther reintroduction within the historic range based on quantitative landscape assessments. First, we delineated 86 panther home ranges using telemetry data collected from 1981 to 2001 in south Florida to develop a Mahalanobis distance (D2) habitat model, using 4 anthropogenic variables and 3 landscape variables mapped at a 500-m resolution. From that analysis, we identified 9 potential reintroduction sites of sufficient size to support a panther population. We then developed a similar D2 model at a higher spatial resolution to quantify the area of favorable panther habitat at each site. To address potential for the population to expand, we calculated the amount of favorable habitat adjacent to each prospective reintroduction site within a range of dispersal distances of female panthers. We then added those totals to the contiguous patches to estimate the total amount of effective panther habitat at each site. Finally, we developed an expert-assisted model to rank and incorporate potentially important habitat variables that were not appropriate for our empirical analysis (e.g., area of public lands, livestock density). Anthropogenic factors heavily influenced both the landscape and the expert-assisted models. Of the 9 areas we identified, the Okefenokee National Wildlife Refuge, Ozark National Forest, and Felsenthal National Wildlife Refuge regions had the highest combination of effective habitat area and expert opinion scores. Sensitivity analyses indicated that variability among key model parameters did not affect the high ranking of those sites. Those sites should be considered as starting points for the field evaluation of potential reintroduction sites.

  18. Identifying Relevant Studies in Software Engineering

    DEFF Research Database (Denmark)

    Zhang, He; Ali Babar, Muhammad; Tell, Paolo

    2011-01-01

    Context: Systematic literature review (SLR) has become an important research methodology in software engineering since the introduction of evidence-based software engineering (EBSE) in 2004. One critical step in applying this methodology is to design and execute appropriate and effective search....... Objective: The main objective of the research reported in this paper is to improve the search step of undertaking SLRs in software engineering (SE) by devising and evaluating systematic and practical approaches to identifying relevant studies in SE. Method: We have systematically selected and analytically...

  19. Identifying variables that influence manufacturing product quality

    Directory of Open Access Journals (Sweden)

    Marek Krynke

    2014-10-01

    Full Text Available In the article a risk analysis of the production process of selected products in a plant producing votive candles was conducted. The Pareto-Lorenz diagram and FMEA method were used which indicated the most important areas affecting the production of selected elements of candles. The synthesis of intangible factors affecting production in the audited company was also carried out with particular emphasis on the operation of the production system. The factors determining the validity of studies was examined, describing the principle of BOST 14 Toyota management. The most important areas of the company were identified, positively affecting the production process.

  20. Identifying Phase Space Boundaries with Voronoi Tessellations

    CERN Document Server

    Debnath, Dipsikha; Kilic, Can; Kim, Doojin; Matchev, Konstantin T.; Yang, Yuan-Pao

    2016-11-24

    Determining the masses of new physics particles appearing in decay chains is an important and longstanding problem in high energy phenomenology. Recently it has been shown that these mass measurements can be improved by utilizing the boundary of the allowed region in the fully differentiable phase space in its full dimensionality. Here we show that the practical challenge of identifying this boundary can be solved using techniques based on the geometric properties of the cells resulting from Voronoi tessellations of the relevant data. The robust detection of such phase space boundaries in the data could also be used to corroborate a new physics discovery based on a cut-and-count analysis.

  1. Identifying PHM market and network opportunities.

    Science.gov (United States)

    Grube, Mark E; Krishnaswamy, Anand; Poziemski, John; York, Robert W

    2015-11-01

    Two key processes for healthcare organizations seeking to assume a financially sustainable role in population health management (PHM), after laying the groundwork for the effort, are to identify potential PHM market opportunities and determine the scope of the PHM network. Key variables organizations should consider with respect to market opportunities include the patient population, the overall insurance/employer market, and available types of insurance products. Regarding the network's scope, organizations should consider both traditional strategic criteria for a viable network and at least five additional criteria: network essentiality and PHM care continuum, network adequacy, service distribution right-sizing, network growth strategy, and organizational agility.

  2. Subject Matter Expert Workshop to Identify Cybersecurity ...

    Science.gov (United States)

    Report In recognition of the growing need to better address cyber risk and cyber management, the U.S. Environmental Protection Agency’s (EPA) National Homeland Security Research Center (NHSRC) held a Subject Matter Expert Workshop to Identify Cybersecurity Research Gaps and Needs of the Nation’s Water and Wastewater Systems Sector on March 30th and 31st, 2016, at the Ronald Reagan Building in Washington, D.C. The workshop was designed to create a forum for subject matter experts (SMEs) to exchange ideas and address important cybersecurity challenges facing the water sector.

  3. Identifying QCD Transition Using Deep Learning

    Science.gov (United States)

    Zhou, Kai; Pang, Long-gang; Su, Nan; Petersen, Hannah; Stoecker, Horst; Wang, Xin-Nian

    2018-02-01

    In this proceeding we review our recent work using supervised learning with a deep convolutional neural network (CNN) to identify the QCD equation of state (EoS) employed in hydrodynamic modeling of heavy-ion collisions given only final-state particle spectra ρ(pT, V). We showed that there is a traceable encoder of the dynamical information from phase structure (EoS) that survives the evolution and exists in the final snapshot, which enables the trained CNN to act as an effective "EoS-meter" in detecting the nature of the QCD transition.

  4. Identifying MMORPG Bots: A Traffic Analysis Approach

    Science.gov (United States)

    Chen, Kuan-Ta; Jiang, Jhih-Wei; Huang, Polly; Chu, Hao-Hua; Lei, Chin-Laung; Chen, Wen-Chin

    2008-12-01

    Massively multiplayer online role playing games (MMORPGs) have become extremely popular among network gamers. Despite their success, one of MMORPG's greatest challenges is the increasing use of game bots, that is, autoplaying game clients. The use of game bots is considered unsportsmanlike and is therefore forbidden. To keep games in order, game police, played by actual human players, often patrol game zones and question suspicious players. This practice, however, is labor-intensive and ineffective. To address this problem, we analyze the traffic generated by human players versus game bots and propose general solutions to identify game bots. Taking Ragnarok Online as our subject, we study the traffic generated by human players and game bots. We find that their traffic is distinguishable by 1) the regularity in the release time of client commands, 2) the trend and magnitude of traffic burstiness in multiple time scales, and 3) the sensitivity to different network conditions. Based on these findings, we propose four strategies and two ensemble schemes to identify bots. Finally, we discuss the robustness of the proposed methods against countermeasures of bot developers, and consider a number of possible ways to manage the increasingly serious bot problem.

  5. Identifying MMORPG Bots: A Traffic Analysis Approach

    Directory of Open Access Journals (Sweden)

    Wen-Chin Chen

    2008-11-01

    Full Text Available Massively multiplayer online role playing games (MMORPGs have become extremely popular among network gamers. Despite their success, one of MMORPG's greatest challenges is the increasing use of game bots, that is, autoplaying game clients. The use of game bots is considered unsportsmanlike and is therefore forbidden. To keep games in order, game police, played by actual human players, often patrol game zones and question suspicious players. This practice, however, is labor-intensive and ineffective. To address this problem, we analyze the traffic generated by human players versus game bots and propose general solutions to identify game bots. Taking Ragnarok Online as our subject, we study the traffic generated by human players and game bots. We find that their traffic is distinguishable by 1 the regularity in the release time of client commands, 2 the trend and magnitude of traffic burstiness in multiple time scales, and 3 the sensitivity to different network conditions. Based on these findings, we propose four strategies and two ensemble schemes to identify bots. Finally, we discuss the robustness of the proposed methods against countermeasures of bot developers, and consider a number of possible ways to manage the increasingly serious bot problem.

  6. Identifying, meeting, and assessing customer expectations

    International Nuclear Information System (INIS)

    Danner, T.A.

    1995-01-01

    Maintaining proficiency in carrying out mission goals is fundamental to the success of any organization. The definitive mission of the Waste Management and Remedial Action Division (WMRAD) of Oak Ridge National Laboratory (ORNL) is open-quotes to conduct waste management activities in a compliant, publicly acceptable, technically sound, and cost-efficient mannerclose quotes. In order to effectively fulfill this mission, must meet or exceed several standards in respect to our customers. These include: (1) identifying current and future customer expectations; (2) managing our relationships with our customers; (3) ensuring our commitment to our customers; and (4) measuring our success m customer satisfaction. Our customers have a great variety of requirements and expectations. Many of these are in the form of local, state, and federal regulations and environmental standards. Others are brought to our attention through inquires made to the Department of Energy (DOE).Consumer surveys have proven to be effective tools which have been used to make improvements, enhance certain program elements, and identify beneficial areas in already existing programs. In addition, national working groups, technology transfer meetings, and manager/contractor's meeting offer excellent opportunities to assess our activities

  7. Identifying emotional intelligence in professional nursing practice.

    Science.gov (United States)

    Kooker, Barbara Molina; Shoultz, Jan; Codier, Estelle E

    2007-01-01

    The National Center for Health Workforce Analysis projects that the shortage of registered nurses in the United States will double by 2010 and will nearly quadruple to 20% by 2015 (Bureau of Health Professionals Health Resources and Services Administration. [2002]. Projected supply, demand, and shortages of registered nurses, 2000-2020 [On-line]. Available: http:bhpr.hrsa.gov/healthworkforce/reports/rnprojects/report.htm). The purpose of this study was to use the conceptual framework of emotional intelligence to analyze nurses' stories about their practice to identify factors that could be related to improved nurse retention and patient/client outcomes. The stories reflected evidence of the competencies and domains of emotional intelligence and were related to nurse retention and improved outcomes. Nurses recognized their own strengths and limitations, displayed empathy and recognized client needs, nurtured relationships, used personal influence, and acted as change agents. Nurses were frustrated when organizational barriers conflicted with their knowledge/intuition about nursing practice, their communications were disregarded, or their attempts to create a shared vision and teamwork were ignored. Elements of professional nursing practice, such as autonomy, nurse satisfaction, respect, and the professional practice environment, were identified in the excerpts of the stories. The shortage of practicing nurses continues to be a national issue. The use of emotional intelligence concepts may provide fresh insights into ways to keep nurses engaged in practice and to improve nurse retention and patient/client outcomes.

  8. Identifying influential spreaders in interconnected networks

    International Nuclear Information System (INIS)

    Zhao, Dawei; Li, Lixiang; Huo, Yujia; Yang, Yixian; Li, Shudong

    2014-01-01

    Identifying the most influential spreaders in spreading dynamics is of the utmost importance for various purposes for understanding or controlling these processes. The existing relevant works are limited to a single network. Most real networks are actually not isolated, but typically coupled and affected by others. The properties of epidemic spreading have recently been found to have some significant differences in interconnected networks from those in a single network. In this paper, we focus on identifying the influential spreaders in interconnected networks. We find that the well-known k-shell index loses effectiveness; some insignificant spreaders in a single network become the influential spreaders in the whole interconnected networks while some influential spreaders become no longer important. The simulation results show that the spreading capabilities of the nodes not only depend on their influence for the network topology, but also are dramatically influenced by the spreading rate. Based on this perception, a novel index is proposed for measuring the influential spreaders in interconnected networks. We then support the efficiency of this index with numerical simulations. (paper)

  9. Identifying Key Attributes for Protein Beverages.

    Science.gov (United States)

    Oltman, A E; Lopetcharat, K; Bastian, E; Drake, M A

    2015-06-01

    This study identified key attributes of protein beverages and evaluated effects of priming on liking of protein beverages. An adaptive choice-based conjoint study was conducted along with Kano analysis to gain insight on protein beverage consumers (n = 432). Attributes evaluated included label claim, protein type, amount of protein, carbohydrates, sweeteners, and metabolic benefits. Utility scores for levels and importance scores for attributes were determined. Subsequently, two pairs of clear acidic whey protein beverages were manufactured that differed by age of protein source or the amount of whey protein per serving. Beverages were evaluated by 151 consumers on two occasions with or without priming statements. One priming statement declared "great flavor," the other priming statement declared 20 g protein per serving. A two way analysis of variance was applied to discern the role of each priming statement. The most important attribute for protein beverages was sweetener type, followed by amount of protein, followed by type of protein followed by label claim. Beverages with whey protein, naturally sweetened, reduced sugar and ≥15 g protein per serving were most desired. Three consumer clusters were identified, differentiated by their preferences for protein type, sweetener and amount of protein. Priming statements positively impacted concept liking (P 0.05). Consistent with trained panel profiles of increased cardboard flavor with higher protein content, consumers liked beverages with 10 g protein more than beverages with 20 g protein (6.8 compared with 5.7, P appeal. © 2015 Institute of Food Technologists®

  10. Identifying Bitcoin users by transaction behavior

    Science.gov (United States)

    Monaco, John V.

    2015-05-01

    Digital currencies, such as Bitcoin, offer convenience and security to criminals operating in the black marketplace. Some Bitcoin marketplaces, such as Silk Road, even claim anonymity. This claim contradicts the findings in this work, where long term transactional behavior is used to identify and verify account holders. Transaction timestamps and network properties observed over time contribute to this finding. The timestamp of each transaction is the result of many factors: the desire purchase an item, daily schedule and activities, as well as hardware and network latency. Dynamic network properties of the transaction, such as coin flow and the number of edge outputs and inputs, contribute further to reveal account identity. In this paper, we propose a novel methodology for identifying and verifying Bitcoin users based on the observation of Bitcoin transactions over time. The behavior we attempt to quantify roughly occurs in the social band of Newell's time scale. A subset of the Blockchain 230686 is taken, selecting users that initiated between 100 and 1000 unique transactions per month for at least 6 different months. This dataset shows evidence of being nonrandom and nonlinear, thus a dynamical systems approach is taken. Classification and authentication accuracies are obtained under various representations of the monthly Bitcoin samples: outgoing transactions, as well as both outgoing and incoming transactions are considered, along with the timing and dynamic network properties of transaction sequences. The most appropriate representations of monthly Bitcoin samples are proposed. Results show an inherent lack of anonymity by exploiting patterns in long-term transactional behavior.

  11. Evidence for Alteration of EZH2, BMI1, and KDM6A and Epigenetic Reprogramming in Human Papillomavirus Type 16 E6/E7-Expressing Keratinocytes ▿

    OpenAIRE

    Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha

    2011-01-01

    A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2...

  12. Process Architecture for Managing Digital Object Identifiers

    Science.gov (United States)

    Wanchoo, L.; James, N.; Stolte, E.

    2014-12-01

    In 2010, NASA's Earth Science Data and Information System (ESDIS) Project implemented a process for registering Digital Object Identifiers (DOIs) for data products distributed by Earth Observing System Data and Information System (EOSDIS). For the first 3 years, ESDIS evolved the process involving the data provider community in the development of processes for creating and assigning DOIs, and guidelines for the landing page. To accomplish this, ESDIS established two DOI User Working Groups: one for reviewing the DOI process whose recommendations were submitted to ESDIS in February 2014; and the other recently tasked to review and further develop DOI landing page guidelines for ESDIS approval by end of 2014. ESDIS has recently upgraded the DOI system from a manually-driven system to one that largely automates the DOI process. The new automated feature include: a) reviewing the DOI metadata, b) assigning of opaque DOI name if data provider chooses, and c) reserving, registering, and updating the DOIs. The flexibility of reserving the DOI allows data providers to embed and test the DOI in the data product metadata before formally registering with EZID. The DOI update process allows the changing of any DOI metadata except the DOI name unless the name has not been registered. Currently, ESDIS has processed a total of 557 DOIs of which 379 DOIs are registered with EZID and 178 are reserved with ESDIS. The DOI incorporates several metadata elements that effectively identify the data product and the source of availability. Of these elements, the Uniform Resource Locator (URL) attribute has the very important function of identifying the landing page which describes the data product. ESDIS in consultation with data providers in the Earth Science community is currently developing landing page guidelines that specify the key data product descriptive elements to be included on each data product's landing page. This poster will describe in detail the unique automated process and

  13. Identifying people from gait pattern with accelerometers

    Science.gov (United States)

    Ailisto, Heikki J.; Lindholm, Mikko; Mantyjarvi, Jani; Vildjiounaite, Elena; Makela, Satu-Marja

    2005-03-01

    Protecting portable devices is becoming more important, not only because of the value of the devices themselves, but for the value of the data in them and their capability for transactions, including m-commerce and m-banking. An unobtrusive and natural method for identifying the carrier of portable devices is presented. The method uses acceleration signals produced by sensors embedded in the portable device. When the user carries the device, the acceleration signal is compared with the stored template signal. The method consists of finding individual steps, normalizing and averaging them, aligning them with the template and computing cross-correlation, which is used as a measure of similarity. Equal Error Rate of 6.4% is achieved in tentative experiments with 36 test subjects.

  14. Machine learning for identifying botnet network traffic

    DEFF Research Database (Denmark)

    Stevanovic, Matija; Pedersen, Jens Myrup

    2013-01-01

    . Due to promise of non-invasive and resilient detection, botnet detection based on network traffic analysis has drawn a special attention of the research community. Furthermore, many authors have turned their attention to the use of machine learning algorithms as the mean of inferring botnet......-related knowledge from the monitored traffic. This paper presents a review of contemporary botnet detection methods that use machine learning as a tool of identifying botnet-related traffic. The main goal of the paper is to provide a comprehensive overview on the field by summarizing current scientific efforts....... The contribution of the paper is three-fold. First, the paper provides a detailed insight on the existing detection methods by investigating which bot-related heuristic were assumed by the detection systems and how different machine learning techniques were adapted in order to capture botnet-related knowledge...

  15. Method of identifying features in indexed data

    Science.gov (United States)

    Jarman, Kristin H [Richland, WA; Daly, Don Simone [Richland, WA; Anderson, Kevin K [Richland, WA; Wahl, Karen L [Richland, WA

    2001-06-26

    The present invention is a method of identifying features in indexed data, especially useful for distinguishing signal from noise in data provided as a plurality of ordered pairs. Each of the plurality of ordered pairs has an index and a response. The method has the steps of: (a) providing an index window having a first window end located on a first index and extending across a plurality of indices to a second window end; (b) selecting responses corresponding to the plurality of indices within the index window and computing a measure of dispersion of the responses; and (c) comparing the measure of dispersion to a dispersion critical value. Advantages of the present invention include minimizing signal to noise ratio, signal drift, varying baseline signal and combinations thereof.

  16. High-PT Physics with Identified Particles

    Energy Technology Data Exchange (ETDEWEB)

    Fries, R.; Liu, W.

    2009-11-09

    The suppression of high-P{sub T} particles in heavy ion collisions was one of the key discoveries at the Relativistic Heavy Ion Collider. This is usually parameterized by the average rate of momentum-transfer squared to this particle, {cflx q}. Here we argue that measurements of identified particles at high P{sub T} can lead to complementary information about the medium. The leading particle of a jet can change its identity through interactions with the medium. Tracing such flavor conversions could allow us to constrain the mean free path. Here we review the basic concepts of flavor conversions and discuss applications to particle ratios and elliptic flow. We make a prediction that strangeness is enhanced at high P{sub T} at RHIC energies while its elliptic flow is suppressed.

  17. Identifying States of a Financial Market

    Science.gov (United States)

    Münnix, Michael C.; Shimada, Takashi; Schäfer, Rudi; Leyvraz, Francois; Seligman, Thomas H.; Guhr, Thomas; Stanley, H. Eugene

    2012-09-01

    The understanding of complex systems has become a central issue because such systems exist in a wide range of scientific disciplines. We here focus on financial markets as an example of a complex system. In particular we analyze financial data from the S&P 500 stocks in the 19-year period 1992-2010. We propose a definition of state for a financial market and use it to identify points of drastic change in the correlation structure. These points are mapped to occurrences of financial crises. We find that a wide variety of characteristic correlation structure patterns exist in the observation time window, and that these characteristic correlation structure patterns can be classified into several typical ``market states''. Using this classification we recognize transitions between different market states. A similarity measure we develop thus affords means of understanding changes in states and of recognizing developments not previously seen.

  18. Identifying links between origami and compliant mechanisms

    Directory of Open Access Journals (Sweden)

    H. C. Greenberg

    2011-12-01

    Full Text Available Origami is the art of folding paper. In the context of engineering, orimimetics is the application of folding to solve problems. Kinetic origami behavior can be modeled with the pseudo-rigid-body model since the origami are compliant mechanisms. These compliant mechanisms, when having a flat initial state and motion emerging out of the fabrication plane, are classified as lamina emergent mechanisms (LEMs. To demonstrate the feasibility of identifying links between origami and compliant mechanism analysis and design methods, four flat folding paper mechanisms are presented with their corresponding kinematic and graph models. Principles from graph theory are used to abstract the mechanisms to show them as coupled, or inter-connected, mechanisms. It is anticipated that this work lays a foundation for exploring methods for LEM synthesis based on the analogy between flat-folding origami models and linkage assembly.

  19. Identifying public expectations of genetic biobanks.

    Science.gov (United States)

    Critchley, Christine; Nicol, Dianne; McWhirter, Rebekah

    2017-08-01

    Understanding public priorities for biobanks is vital for maximising utility and efficiency of genetic research and maintaining respect for donors. This research directly assessed the relative importance the public place on different expectations of biobanks. Quantitative and qualitative results from a national sample of 800 Australians revealed that the majority attributed more importance to protecting privacy and ethical conduct than maximising new healthcare benefits, which was in turn viewed as more important than obtaining specific consent, benefit sharing, collaborating and sharing data. A latent class analysis identified two distinct classes displaying different patterns of expectations. One placed higher priority on behaviours that respect the donor ( n = 623), the other on accelerating science ( n = 278). Additional expectations derived from qualitative data included the need for biobanks to be transparent and to prioritise their research focus, educate the public and address commercialisation.

  20. Identifying systematic DFT errors in catalytic reactions

    DEFF Research Database (Denmark)

    Christensen, Rune; Hansen, Heine Anton; Vegge, Tejs

    2015-01-01

    Using CO2 reduction reactions as examples, we present a widely applicable method for identifying the main source of errors in density functional theory (DFT) calculations. The method has broad applications for error correction in DFT calculations in general, as it relies on the dependence...... of the applied exchange–correlation functional on the reaction energies rather than on errors versus the experimental data. As a result, improved energy corrections can now be determined for both gas phase and adsorbed reaction species, particularly interesting within heterogeneous catalysis. We show...... that for the CO2 reduction reactions, the main source of error is associated with the C[double bond, length as m-dash]O bonds and not the typically energy corrected OCO backbone....

  1. Identifying Multiquark Hadrons from Heavy Ion Collisions

    International Nuclear Information System (INIS)

    Cho, Sungtae; Furumoto, Takenori; Yazaki, Koichi; Hyodo, Tetsuo; Jido, Daisuke; Ohnishi, Akira; Ko, Che Ming; Lee, Su Houng; Nielsen, Marina; Sekihara, Takayasu; Yasui, Shigehiro

    2011-01-01

    Identifying hadronic molecular states and/or hadrons with multiquark components either with or without exotic quantum numbers is a long-standing challenge in hadronic physics. We suggest that studying the production of these hadrons in relativistic heavy ion collisions offers a promising resolution to this problem as yields of exotic hadrons are expected to be strongly affected by their structures. Using the coalescence model for hadron production, we find that, compared to the case of a nonexotic hadron with normal quark numbers, the yield of an exotic hadron is typically an order of magnitude smaller when it is a compact multiquark state and a factor of 2 or more larger when it is a loosely bound hadronic molecule. We further find that some of the newly proposed heavy exotic states could be produced and realistically measured in these experiments.

  2. A neural network to identify neutral mesons

    International Nuclear Information System (INIS)

    Lefevre, F.; Lautridou, P.; Marques, M.; Matulewicz, T.; Ostendorf, R.; Schutz, Y.

    1994-01-01

    Both π 0 and η mesons decay long before they can reach a detector. They predominantly decay by emission of two photons, and are identified by constructing the invariant mass of the photons. Misidentified mesons result from ambiguity in associating photons. Our work tries to select which pair is the most likely to be a physical one rather than a chance one. We first designed a Hopfield neural net, but all the activities converged rapidly towards zero except the highest one. To improve the solution we slew down the computation in order to let the network explore several states and to impose activities to converge towards one for all selected pairs. This was achieved by adding links connecting each cell to itself. The network performance is all the more interesting that the solid angle covered by the detector is greater than 15%. (D.L.). 5 refs

  3. BENCHMARKING - PRACTICAL TOOLS IDENTIFY KEY SUCCESS FACTORS

    Directory of Open Access Journals (Sweden)

    Olga Ju. Malinina

    2016-01-01

    Full Text Available The article gives a practical example of the application of benchmarking techniques. The object of study selected fashion store Company «HLB & M Hennes & Mauritz», located in the shopping center «Gallery», Krasnodar. Hennes & Mauritz. The purpose of this article is to identify the best ways to develop a fashionable brand clothing store Hennes & Mauritz on the basis of benchmarking techniques. On the basis of conducted market research is a comparative analysis of the data from different perspectives. The result of the author’s study is a generalization of the ndings, the development of the key success factors that will allow to plan a successful trading activities in the future, based on the best experience of competitors.

  4. Cooperative testing of a positive personnel identifier

    International Nuclear Information System (INIS)

    O'Callaghan, P.B.; Grambihler, A.J.; Graham, D.K.; Bradley, R.G.

    1980-06-01

    HEDL has a requirement to ensure the identification of remote computer terminal operators on a real-time nuclear inventory data base. The integrity of this data base depends on input from authorized individuals. Thus, a key to developing such a system is the ability to positively identify people attempting access to the system. Small scale tests of the Identimat 2000T hand geometry unit with an adjusting alogrithm have suggested a promising solution. To prove operational suitability, HEDL, in cooperation with Sandia Laboratories, has designed a large scale test of the Identimat 2000T. Data gathering on error rates, reliability, maintainability, and user acceptance will determine if the Identimat 2000T is suitable for the HEDL application. If proven acceptable, use of the Identimat 2000T can be broadened to many general applications where security information, locations and systems are required

  5. Identifying states of a financial market.

    Science.gov (United States)

    Münnix, Michael C; Shimada, Takashi; Schäfer, Rudi; Leyvraz, Francois; Seligman, Thomas H; Guhr, Thomas; Stanley, H Eugene

    2012-01-01

    The understanding of complex systems has become a central issue because such systems exist in a wide range of scientific disciplines. We here focus on financial markets as an example of a complex system. In particular we analyze financial data from the S&P 500 stocks in the 19-year period 1992-2010. We propose a definition of state for a financial market and use it to identify points of drastic change in the correlation structure. These points are mapped to occurrences of financial crises. We find that a wide variety of characteristic correlation structure patterns exist in the observation time window, and that these characteristic correlation structure patterns can be classified into several typical "market states". Using this classification we recognize transitions between different market states. A similarity measure we develop thus affords means of understanding changes in states and of recognizing developments not previously seen.

  6. Bacterial spoilage profiles to identify irradiated fish

    International Nuclear Information System (INIS)

    Alur, M.D.; Venugopal, V.; Nerkar, D.P.; Nair, P.M.

    1991-01-01

    Effects of low dose gamma-irradiation of fish product on spoilage potentials of bacteria (Aeromonas hydrophila, Salmonella typhimurium, Bacillus megaterium, and Pseudomonas marinoglutinosa) and mixed flora were examined for ability to proliferate in radurized fish and produce volatile acids (TVA) and bases (TVBN). Bacteria proliferated well in unirradiated and irradiated fish, but formation of VA and VB were lower in irradiated than unirradiated counterparts. This was found in Bombay duck, Indian mackerel, white pomfret, seer and shrimp gamma-irradiated at 0 to 5 kGy under ice. TVA and TVBN produced by the organisms or mixed flora from fish were only 30-50% those of controls. A method for identifying radiation-processed fish could evolve based on lower susceptibility of irradiated fish to bacterial spoilage

  7. Identifying New Members of Nearby Moving Groups

    Science.gov (United States)

    Holmbeck, Erika; Vican, Laura

    2014-06-01

    Our group has assembled a sample of 14,000 stars of spectral types B9-M9 with measured UVW Galactic space velocities and lying within 125 pc of Earth. We have identified candidate members of three nearby young (less than 100 Myr) moving groups. For stars of spectral types G5 and later, we have used the Kast spectrometer on the Shane 3m telescope at Lick Observatory to measure lithium abundance in order to determine stellar ages. With the data we have obtained from this run, we will be able to establish whether our candidates are bona fide members of the moving groups in question. I will be presenting the preliminary results from this survey, including spectra of the ~50 stars observed thus far. These nearby young stars will make excellent targets for direct imaging followup surveys, since any giant planets around young stars will still be warm, and will therefore be bright enough to detect with instruments like GPI.

  8. Identifying Reaction Pathways and their Environments

    DEFF Research Database (Denmark)

    Maronsson, Jon Bergmann

    Finding the mechanisms and estimating the rate of chemical reactions is an essential part of modern research of atomic scale systems. In this thesis, the application of well established methods for reaction rates and paths to important systems for hydrogen storage is considered before developing...... extensions to further identify the reaction environment for a more accurate rate. Complex borohydrides are materials of high hydrogen storage capacity and high thermodynamic stability (too high for hydrogen storage). In an effort to gain insight into the structural transitions of two such materials, Ca(BH4......-interstitial defects. In good agreement with the experiments, C3-type rotations activate at lower temperature than C2-type rotations. In order to investigate the environment of reaction pathways, a method for finding the ridge between first order saddle points on a multidimensional surface was developed...

  9. Strategic planning: Identifying organization information requirements

    Energy Technology Data Exchange (ETDEWEB)

    Moise, C.S.

    1993-12-01

    Historically, information resource management has been left to the ``data processing`` arm of the organization. With technological movements away from centralized mainframe-based information processing toward distributed client/server-based information processing, almost every part of an organization is becoming more involved with the information technology itself, and certainly more involved with budgeting for the technology. However, users and buyers of information technology frequently remain dependent upon the information systems department for planning what users need and should buy. This paper reviews techniques for identifying requirements throughout an organization and structuring information resources to meet organizational needs. This will include basing information resource needs on meeting business needs, utilizing ``internal`` and ``external`` information resource planners, using information mapping, assessing information resources, and developing partnerships.

  10. Identifying crucial parameter correlations maintaining bursting activity.

    Directory of Open Access Journals (Sweden)

    Anca Doloc-Mihu

    2014-06-01

    Full Text Available Recent experimental and computational studies suggest that linearly correlated sets of parameters (intrinsic and synaptic properties of neurons allow central pattern-generating networks to produce and maintain their rhythmic activity regardless of changing internal and external conditions. To determine the role of correlated conductances in the robust maintenance of functional bursting activity, we used our existing database of half-center oscillator (HCO model instances of the leech heartbeat CPG. From the database, we identified functional activity groups of burster (isolated neuron and half-center oscillator model instances and realistic subgroups of each that showed burst characteristics (principally period and spike frequency similar to the animal. To find linear correlations among the conductance parameters maintaining functional leech bursting activity, we applied Principal Component Analysis (PCA to each of these four groups. PCA identified a set of three maximal conductances (leak current, [Formula: see text]Leak; a persistent K current, [Formula: see text]K2; and of a persistent Na+ current, [Formula: see text]P that correlate linearly for the two groups of burster instances but not for the HCO groups. Visualizations of HCO instances in a reduced space suggested that there might be non-linear relationships between these parameters for these instances. Experimental studies have shown that period is a key attribute influenced by modulatory inputs and temperature variations in heart interneurons. Thus, we explored the sensitivity of period to changes in maximal conductances of [Formula: see text]Leak, [Formula: see text]K2, and [Formula: see text]P, and we found that for our realistic bursters the effect of these parameters on period could not be assessed because when varied individually bursting activity was not maintained.

  11. Ultrasonic Detectors Safely Identify Dangerous, Costly Leaks

    Science.gov (United States)

    2013-01-01

    In 1990, NASA grounded its space shuttle fleet. The reason: leaks detected in the hydrogen fuel systems of the Space Shuttles Atlantis and Columbia. Unless the sources of the leaks could be identified and fixed, the shuttles would not be safe to fly. To help locate the existing leaks and check for others, Kennedy Space Center engineers used portable ultrasonic detectors to scan the fuel systems. As a gas or liquid escapes from a leak, the resulting turbulence creates ultrasonic noise, explains Gary Mohr, president of Elmsford, New York-based UE Systems Inc., a long-time leader in ultrasonic detector technologies. "In lay terms, the leak is like a dog whistle, and the detector is like the dog ear." Because the ultrasound emissions from a leak are highly localized, they can be used not only to identify the presence of a leak but also to help pinpoint a leak s location. The NASA engineers employed UE s detectors to examine the shuttle fuel tanks and solid rocket boosters, but encountered difficulty with the devices limited range-certain areas of the shuttle proved difficult or unsafe to scan up close. To remedy the problem, the engineers created a long-range attachment for the detectors, similar to "a zoom lens on a camera," Mohr says. "If you are on the ground, and the leak is 50 feet away, the detector would now give you the same impression as if you were only 25 feet away." The enhancement also had the effect of reducing background noise, allowing for a clearer, more precise detection of a leak s location.

  12. Identifying hidden voice and video streams

    Science.gov (United States)

    Fan, Jieyan; Wu, Dapeng; Nucci, Antonio; Keralapura, Ram; Gao, Lixin

    2009-04-01

    Given the rising popularity of voice and video services over the Internet, accurately identifying voice and video traffic that traverse their networks has become a critical task for Internet service providers (ISPs). As the number of proprietary applications that deliver voice and video services to end users increases over time, the search for the one methodology that can accurately detect such services while being application independent still remains open. This problem becomes even more complicated when voice and video service providers like Skype, Microsoft, and Google bundle their voice and video services with other services like file transfer and chat. For example, a bundled Skype session can contain both voice stream and file transfer stream in the same layer-3/layer-4 flow. In this context, traditional techniques to identify voice and video streams do not work. In this paper, we propose a novel self-learning classifier, called VVS-I , that detects the presence of voice and video streams in flows with minimum manual intervention. Our classifier works in two phases: training phase and detection phase. In the training phase, VVS-I first extracts the relevant features, and subsequently constructs a fingerprint of a flow using the power spectral density (PSD) analysis. In the detection phase, it compares the fingerprint of a flow to the existing fingerprints learned during the training phase, and subsequently classifies the flow. Our classifier is not only capable of detecting voice and video streams that are hidden in different flows, but is also capable of detecting different applications (like Skype, MSN, etc.) that generate these voice/video streams. We show that our classifier can achieve close to 100% detection rate while keeping the false positive rate to less that 1%.

  13. Identifying Floppy and Rigid Regions in Proteins

    Science.gov (United States)

    Jacobs, D. J.; Thorpe, M. F.; Kuhn, L. A.

    1998-03-01

    In proteins it is possible to separate hard covalent forces involving bond lengths and bond angles from other weak forces. We model the microstructure of the protein as a generic bar-joint truss framework, where the hard covalent forces and strong hydrogen bonds are regarded as rigid bar constraints. We study the mechanical stability of proteins using FIRST (Floppy Inclusions and Rigid Substructure Topography) based on a recently developed combinatorial constraint counting algorithm (the 3D Pebble Game), which is a generalization of the 2D pebble game (D. J. Jacobs and M. F. Thorpe, ``Generic Rigidity: The Pebble Game'', Phys. Rev. Lett.) 75, 4051-4054 (1995) for the special class of bond-bending networks (D. J. Jacobs, "Generic Rigidity in Three Dimensional Bond-bending Networks", Preprint Aug (1997)). This approach is useful in identifying rigid motifs and flexible linkages in proteins, and thereby determines the essential degrees of freedom. We will show some preliminary results from the FIRST analysis on the myohemerythrin and lyozyme proteins.

  14. Featured Image: Identifying a Glowing Shell

    Science.gov (United States)

    Kohler, Susanna

    2018-05-01

    New nebulae are being discovered and classified every day and this false-color image reveals one of the more recent objects of interest. This nebula, IPHASX J210204.7+471015, was recently imaged by the Andalucia Faint Object Spectrograph and Camera mounted on the 2.5-m Nordic Optical Telescope in La Palma, Spain. J210204 was initially identified as a possible planetary nebula a remnant left behind at the end of a red giants lifetime. Based on the above imaging, however, a team of authors led by Martn Guerrero (Institute of Astrophysics of Andalusia, Spain) is arguing that this shell of glowing gas was instead expelled around a classical nova. In a classical nova eruption, a white dwarf and its binary companion come very close together, and mass transfers to form a thin atmosphere of hydrogen around the white dwarf. When this hydrogen suddenly ignites in runaway fusion, this outer atmosphere can be expelled, forming a short-lived nova remnant which is what Guerrero and collaborators think were seeing with J210204. If so, this nebula can reveal information about the novathat caused it. To find out more about what the authors learned from this nebula, check out the paper below.CitationMartn A. Guerrero et al 2018 ApJ 857 80. doi:10.3847/1538-4357/aab669

  15. Identifying Memory Allocation Patterns in HEP Software

    Science.gov (United States)

    Kama, S.; Rauschmayr, N.

    2017-10-01

    HEP applications perform an excessive amount of allocations/deallocations within short time intervals which results in memory churn, poor locality and performance degradation. These issues are already known for a decade, but due to the complexity of software frameworks and billions of allocations for a single job, up until recently no efficient mechanism has been available to correlate these issues with source code lines. However, with the advent of the Big Data era, many tools and platforms are now available to do large scale memory profiling. This paper presents, a prototype program developed to track and identify each single (de-)allocation. The CERN IT Hadoop cluster is used to compute memory key metrics, like locality, variation, lifetime and density of allocations. The prototype further provides a web based visualization back-end that allows the user to explore the results generated on the Hadoop cluster. Plotting these metrics for every single allocation over time gives a new insight into application’s memory handling. For instance, it shows which algorithms cause which kind of memory allocation patterns, which function flow causes how many short-lived objects, what are the most commonly allocated sizes etc. The paper will give an insight into the prototype and will show profiling examples for the LHC reconstruction, digitization and simulation jobs.

  16. Identifying health disparities across the tobacco continuum.

    Science.gov (United States)

    Fagan, Pebbles; Moolchan, Eric T; Lawrence, Deirdre; Fernander, Anita; Ponder, Paris K

    2007-10-01

    Few frameworks have addressed work-force diversity, inequities and inequalities as part of a comprehensive approach to eliminating tobacco-related health disparities. This paper summarizes the literature and describes the known disparities that exist along the tobacco disease continuum for minority racial and ethnic groups, those living in poverty, those with low education and blue-collar and service workers. The paper also discusses how work-force diversity, inequities in research practice and knowledge allocation and inequalities in access to and quality of health care are fundamental to addressing disparities in health. We examined the available scientific literature and existing public health reports to identify disparities across the tobacco disease continuum by minority racial/ethnic group, poverty status, education level and occupation. Results indicate that differences in risk indicators along the tobacco disease continuum do not explain fully tobacco-related cancer consequences among some minority racial/ethnic groups, particularly among the aggregate groups, blacks/African Americans and American Indians/Alaska Natives. The lack of within-race/ethnic group data and its interactions with socio-economic factors across the life-span contribute to the inconsistency we observe in the disease causal paradigm. More comprehensive models are needed to understand the relationships among disparities, social context, diversity, inequalities and inequities. A systematic approach will also help researchers, practitioners, advocates and policy makers determine critical points for interventions, the types of studies and programs needed and integrative approaches needed to eliminate tobacco-related disparities.

  17. Identifying influential neighbors in animal flocking.

    Directory of Open Access Journals (Sweden)

    Li Jiang

    2017-11-01

    Full Text Available Schools of fish and flocks of birds can move together in synchrony and decide on new directions of movement in a seamless way. This is possible because group members constantly share directional information with their neighbors. Although detecting the directionality of other group members is known to be important to maintain cohesion, it is not clear how many neighbors each individual can simultaneously track and pay attention to, and what the spatial distribution of these influential neighbors is. Here, we address these questions on shoals of Hemigrammus rhodostomus, a species of fish exhibiting strong schooling behavior. We adopt a data-driven analysis technique based on the study of short-term directional correlations to identify which neighbors have the strongest influence over the participation of an individual in a collective U-turn event. We find that fish mainly react to one or two neighbors at a time. Moreover, we find no correlation between the distance rank of a neighbor and its likelihood to be influential. We interpret our results in terms of fish allocating sequential and selective attention to their neighbors.

  18. Identifying ambassador species for conservation marketing

    Directory of Open Access Journals (Sweden)

    E.A. Macdonald

    2017-10-01

    Full Text Available Conservation relies heavily on external funding, much of it from a supportive public. Therefore it is important to know which species are most likely to catalyse such funding. Whilst previous work has looked at the physical attributes that contribute to a species' appeal, no previous studies have tried to examine the extent to which a species' sympatriots might contribute to it's potential as flagship for wider conservation. Therefore, here we estimate ‘flexibility’ and ‘appeal’ scores for all terrestrial mammals (n = 4320 and identify which of these might serve as ambassadors (defined as both highly appealing and flexible. Relatively few mammals (between 240 and 331 emerged as ambassadors, with carnivores featuring heavily in this group (representing 5% of terrestrial mammals but 39% of ambassadors. ‘Top ambassadors’ were defined as those with both flexibility and appeal scores greater than 1 standard deviation above the mean. Less than a quarter of the 20 most endangered and evolutionary distinct species in this study were classed as ambassadors, highlighting the need for surrogate species to catalyse conservation effort in areas with such priority species. This is the first global analysis bringing together flexibility and appeal for all terrestrial mammals, and demonstrates an approach for determining how best to market species in order to achieve maximal conservation gain in a world with urgent conservation need but limited resources.

  19. Identifying New Small Proteins in Escherichia coli.

    Science.gov (United States)

    VanOrsdel, Caitlin E; Kelly, John P; Burke, Brittany N; Lein, Christina D; Oufiero, Christopher E; Sanchez, Joseph F; Wimmers, Larry E; Hearn, David J; Abuikhdair, Fatimeh J; Barnhart, Kathryn R; Duley, Michelle L; Ernst, Sarah E G; Kenerson, Briana A; Serafin, Aubrey J; Hemm, Matthew R

    2018-04-12

    The number of small proteins (SPs) encoded in the Escherichia coli genome is unknown, as current bioinformatics and biochemical techniques make short gene and small protein identification challenging. One method of small protein identification involves adding an epitope tag to the 3' end of a short open reading frame (sORF) on the chromosome, with synthesis confirmed by immunoblot assays. In this study, this strategy was used to identify new E. coli small proteins, tagging 80 sORFs in the E. coli genome, and assayed for protein synthesis. The selected sORFs represent diverse sequence characteristics, including degrees of sORF conservation, predicted transmembrane domains, sORF direction with respect to flanking genes, ribosome binding site (RBS) prediction, and ribosome profiling results. Of 80 sORFs, 36 resulted in encoded synthesized proteins-a 45% success rate. Modeling of detected versus non-detected small proteins analysis showed predictions based on RBS prediction, transcription data, and ribosome profiling had statistically-significant correlation with protein synthesis; however, there was no correlation between current sORF annotation and protein synthesis. These results suggest substantial numbers of small proteins remain undiscovered in E. coli, and existing bioinformatics techniques must continue to improve to facilitate identification. © 2018 The Authors. Proteomics Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim, Towson University.

  20. Identifying pathways affected by cancer mutations.

    Science.gov (United States)

    Iengar, Prathima

    2017-12-16

    Mutations in 15 cancers, sourced from the COSMIC Whole Genomes database, and 297 human pathways, arranged into pathway groups based on the processes they orchestrate, and sourced from the KEGG pathway database, have together been used to identify pathways affected by cancer mutations. Genes studied in ≥15, and mutated in ≥10 samples of a cancer have been considered recurrently mutated, and pathways with recurrently mutated genes have been considered affected in the cancer. Novel doughnut plots have been presented which enable visualization of the extent to which pathways and genes, in each pathway group, are targeted, in each cancer. The 'organismal systems' pathway group (including organism-level pathways; e.g., nervous system) is the most targeted, more than even the well-recognized signal transduction, cell-cycle and apoptosis, and DNA repair pathway groups. The important, yet poorly-recognized, role played by the group merits attention. Pathways affected in ≥7 cancers yielded insights into processes affected. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Identifying Wind and Solar Ramping Events: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Florita, A.; Hodge, B. M.; Orwig, K.

    2013-01-01

    Wind and solar power are playing an increasing role in the electrical grid, but their inherent power variability can augment uncertainties in power system operations. One solution to help mitigate the impacts and provide more flexibility is enhanced wind and solar power forecasting; however, its relative utility is also uncertain. Within the variability of solar and wind power, repercussions from large ramping events are of primary concern. At the same time, there is no clear definition of what constitutes a ramping event, with various criteria used in different operational areas. Here the Swinging Door Algorithm, originally used for data compression in trend logging, is applied to identify variable generation ramping events from historic operational data. The identification of ramps in a simple and automated fashion is a critical task that feeds into a larger work of 1) defining novel metrics for wind and solar power forecasting that attempt to capture the true impact of forecast errors on system operations and economics, and 2) informing various power system models in a data-driven manner for superior exploratory simulation research. Both allow inference on sensitivities and meaningful correlations, as well as the ability to quantify the value of probabilistic approaches for future use in practice.

  2. Indexing molecules with chemical graph identifiers.

    Science.gov (United States)

    Gregori-Puigjané, Elisabet; Garriga-Sust, Rut; Mestres, Jordi

    2011-09-01

    Fast and robust algorithms for indexing molecules have been historically considered strategic tools for the management and storage of large chemical libraries. This work introduces a modified and further extended version of the molecular equivalence number naming adaptation of the Morgan algorithm (J Chem Inf Comput Sci 2001, 41, 181-185) for the generation of a chemical graph identifier (CGI). This new version corrects for the collisions recognized in the original adaptation and includes the ability to deal with graph canonicalization, ensembles (salts), and isomerism (tautomerism, regioisomerism, optical isomerism, and geometrical isomerism) in a flexible manner. Validation of the current CGI implementation was performed on the open NCI database and the drug-like subset of the ZINC database containing 260,071 and 5,348,089 structures, respectively. The results were compared with those obtained with some of the most widely used indexing codes, such as the CACTVS hash code and the new InChIKey. The analyses emphasize the fact that compound management activities, like duplicate analysis of chemical libraries, are sensitive to the exact definition of compound uniqueness and thus still depend, to a minor extent, on the type and flexibility of the molecular index being used. Copyright © 2011 Wiley Periodicals, Inc.

  3. Identifying a new particle with jet substructures

    International Nuclear Information System (INIS)

    Han, Chengcheng; Kim, Doojin; Kim, Minho; Postech, Pohang

    2017-01-01

    Here, we investigate a potential of determining properties of a new heavy resonance of mass O(1)TeV which decays to collimated jets via heavy Standard Model intermediary states, exploiting jet substructure techniques. Employing the Z gauge boson as a concrete example for the intermediary state, we utilize a "merged jet" defined by a large jet size to capture the two quarks from its decay. The use of the merged jet bene ts the identification of a Z-induced jet as a single, reconstructed object without any combinatorial ambiguity. We also find that jet substructure procedures may enhance features in some kinematic observables formed with subjet four-momenta extracted from a merged jet. This observation motivates us to feed subjet momenta into the matrix elements associated with plausible hypotheses on the nature of the heavy resonance, which are further processed to construct a matrix element method (MEM)-based observable. For both moderately and highly boosted Z bosons, we demonstrate that the MEM in combination with jet substructure techniques can be a very powerful tool for identifying its physical properties. Finally, we discuss effects from choosing different jet sizes for merged jets and jet-grooming parameters upon the MEM analyses.

  4. Identifying challenges in project consultants engagement practices

    Science.gov (United States)

    Shariffuddin, Nadia Alina Amir; Abidin, Nazirah Zainul

    2017-10-01

    Construction projects, green or conventional, involve multi-faceted disciplines engaged with the goal of delivering products i.e. building, infrastructure etc. at the best quality within stipulated budgets. For green projects, additional attention is added for environmental quality. Due to the various responsibilities and liabilities involved as well as the complexity of the construction process itself, formal engagement of multi-disciplinary professionals i.e. project consultants is required in any construction project. Poor selection of project consultants will lead to a multitude of complications resulting in delay, cost escalation, conflicts and poor quality. This paper explores the challenges that occur during the engagement of project consultants in a green project. As the engagement decision involves developers and architects, these two groups of respondents with green project backgrounds were approached qualitatively using interview technique. The challenges identified are limited experience and knowledge, consultants' fee vs. quality, green complexity, conflicts of interest, clients' extended expectation and less demand in green projects. The construction shifts to green project demands engagement of project consultants with added skills. It is expected that through the identification of challenges, better management and administration can be created which would give impact to the overall process of engagement in green projects.

  5. Process to identify and evaluate restoration options

    International Nuclear Information System (INIS)

    Strand, J.; Senner, S.; Weiner, A.; Rabinowitch, S.; Brodersen, M.; Rice, K.; Klinge, K.; MacMullin, S.; Yender, R.; Thompson, R.

    1993-01-01

    The restoration planning process has yielded a number of possible alternatives for restoring resources and services injured by the Exxon Valdez oil spill. They were developed by resource managers, scientists, and the public, taking into consideration the results of damage assessment and restoration studies and information from the scientific literature. The alternatives thus far identified include no action natural recovery, management of human uses, manipulation of resources, habitat protection and acquisition, acquisition of equivalent resources, and combinations of the above. Each alternative consists of a different mix of resource- or service-specific restoration options. To decide whether it was appropriate to spend restoration funds on a particular resource or service, first criteria had to be developed that evaluated available evidence for consequential injury and the adequacy and rate of natural recovery. Then, recognizing the range of effective restoration options, a second set of criteria was applied to determine which restoration options were the most beneficial. These criteria included technical feasibility, potential to improve the rate or degree of recovery, the relationship of expected costs to benefits, cost effectiveness, and the potential to restore the ecosystem as a whole. The restoration options considered to be most beneficial will be grouped together in several or more of the above alternatives and presented in a draft restoration plan. They will be further evaluated in a companion draft environmental impact statement

  6. Analytical methods to identify irradiated food

    International Nuclear Information System (INIS)

    Helle, N.; Schreiber, G.A.; Boegl, K.W.

    1992-01-01

    During the last years, three promising techniques for the identification of irradiated food were developed: - Studies of luminescence, mainly thermoluminescence measurements, of food containing mineral impurities like spices, dried vegetables: and fresh fuit and vegetables. This technique can probably be applied also to food with crystalline components like shells or bones. - Gaschromatographic/mass-spectrometric investigation of radiation-induced lipid changes. - Electron-spin-resonance measurements of dried products or of products containing dry components like bones, fish bones, shells or seeds. The thermoluminescence technique has been routinely applied for more than one year by several German Food Inspection Laboratories. The results suggest that there are scarcely any irradiated spices and dried vegetables in the German market. Gaschromatography/mass spectrometry of lipid components and electron-spin-resonance spectroscopy will be established in routine food inspections in Germany in the next two years. Further possibilities to identify irradiated food are the analysis of specific changes in amino acids, DNA and carbohydrates. Radiation-induced viscosity changes, and changes in electric properties (impedance) may be helpful in identifiying at least some irradiated products. Also microbiological and biological techniques as e.g. microbial flora shift or embryo development tests in citrus fruit have been considered. All activities concerning the development of identification techniques are now coordinated by the European Communities and by IAEA. (orig.) [de

  7. Identifying influential neighbors in animal flocking.

    Science.gov (United States)

    Jiang, Li; Giuggioli, Luca; Perna, Andrea; Escobedo, Ramón; Lecheval, Valentin; Sire, Clément; Han, Zhangang; Theraulaz, Guy

    2017-11-01

    Schools of fish and flocks of birds can move together in synchrony and decide on new directions of movement in a seamless way. This is possible because group members constantly share directional information with their neighbors. Although detecting the directionality of other group members is known to be important to maintain cohesion, it is not clear how many neighbors each individual can simultaneously track and pay attention to, and what the spatial distribution of these influential neighbors is. Here, we address these questions on shoals of Hemigrammus rhodostomus, a species of fish exhibiting strong schooling behavior. We adopt a data-driven analysis technique based on the study of short-term directional correlations to identify which neighbors have the strongest influence over the participation of an individual in a collective U-turn event. We find that fish mainly react to one or two neighbors at a time. Moreover, we find no correlation between the distance rank of a neighbor and its likelihood to be influential. We interpret our results in terms of fish allocating sequential and selective attention to their neighbors.

  8. Ebola Virus Infection Modelling and Identifiability Problems

    Directory of Open Access Journals (Sweden)

    Van-Kinh eNguyen

    2015-04-01

    Full Text Available The recent outbreaks of Ebola virus (EBOV infections have underlined the impact of the virus as a major threat for human health. Due to the high biosafety classification of EBOV (level 4, basic research is very limited. Therefore, the development of new avenues of thinking to advance quantitative comprehension of the virus and its interaction with the host cells is urgently neededto tackle this lethal disease. Mathematical modelling of the EBOV dynamics can be instrumental to interpret Ebola infection kinetics on quantitative grounds. To the best of our knowledge, a mathematical modelling approach to unravel the interaction between EBOV and the host cells isstill missing. In this paper, a mathematical model based on differential equations is used to represent the basic interactions between EBOV and wild-type Vero cells in vitro. Parameter sets that represent infectivity of pathogens are estimated for EBOV infection and compared with influenza virus infection kinetics. The average infecting time of wild-type Vero cells in EBOV is slower than in influenza infection. Simulation results suggest that the slow infecting time of EBOV could be compensated by its efficient replication. This study reveals several identifiability problems and what kind of experiments are necessary to advance the quantification of EBOV infection. A first mathematical approach of EBOV dynamics and the estimation of standard parametersin viral infections kinetics is the key contribution of this work, paving the way for future modelling work on EBOV infection.

  9. Identifying bully victims: definitional versus behavioral approaches.

    Science.gov (United States)

    Green, Jennifer Greif; Felix, Erika D; Sharkey, Jill D; Furlong, Michael J; Kras, Jennifer E

    2013-06-01

    Schools frequently assess bullying and the Olweus Bully/Victimization Questionnaire (BVQ; Olweus, 1996) is the most widely adopted tool for this purpose. The BVQ is a self-report survey that uses a definitional measurement method--describing "bullying" as involving repeated, intentional aggression in a relationship where there is an imbalance of power and then asking respondents to indicate how frequently they experienced this type of victimization. Few studies have examined BVQ validity and whether this definitional method truly identifies the repetition and power differential that distinguish bullying from other forms of peer victimization. This study examined the concurrent validity of the BVQ definitional question among 435 students reporting peer victimization. BVQ definitional responses were compared with responses to a behavioral measure that did not use the term "bullying" but, instead, included items that asked about its defining characteristics (repetition, intentionality, power imbalance). Concordance between the two approaches was moderate, with an area under the receiver operating curve of .72. BVQ responses were more strongly associated with students indicating repeated victimization and multiple forms of victimization, than with power imbalance in their relationship with the bully. Findings indicate that the BVQ is a valid measure of repeated victimization and a broad range of victimization experiences but may not detect the more subtle and complex power imbalances that distinguish bullying from other forms of peer victimization. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  10. Identifying hearing loss by means of iridology.

    Science.gov (United States)

    Stearn, Natalie; Swanepoel, De Wet

    2006-11-13

    Isolated reports of hearing loss presenting as markings on the iris exist, but to date the effectiveness of iridology to identify hearing loss has not been investigated. This study therefore aimed to determine the efficacy of iridological analysis in the identification of moderate to profound sensorineural hearing loss in adolescents. A controlled trial was conducted with an iridologist, blind to the actual hearing status of participants, analyzing the irises of participants with and without hearing loss. Fifty hearing impaired and fifty normal hearing subjects, between the ages of 15 and 19 years, controlled for gender, participated in the study. An experienced iridologist analyzed the randomised set of participants' irises. A 70% correct identification of hearing status was obtained by iridological analyses with a false negative rate of 41% compared to a 19% false positive rate. The respective sensitivity and specificity rates therefore came to 59% and 81%. Iridological analysis of hearing status indicated a statistically significant relationship to actual hearing status (P iridology were not comparable to those of traditional audiological screening procedures.

  11. Identifying lubricant options for compressor bearing designs

    Science.gov (United States)

    Karnaz, J.; Seeton, C.; Dixon, L.

    2017-08-01

    Today’s refrigeration and air conditioning market is not only driven by the environmental aspects of the refrigerants, but also by the energy efficiency and reliability of system operation. Numerous types of compressor designs are used in refrigeration and air conditioning applications which means that different bearings are used; and in some cases, multiple bearing types within a single compressor. Since only one lubricant is used, it is important to try to optimize the lubricant to meet the various demands and requirements for operation. This optimization entails investigating different types of lubricant chemistries, viscosities, and various formulation options. What makes evaluating these options more challenging is the refrigerant which changes the properties of the lubricant delivered to the bearing. Once the lubricant and refrigerant interaction are understood, through various test methods, then work can start on collaborating with compressor engineers on identifying the lubricant chemistry and formulation options. These interaction properties are important to the design engineer to make decisions on the adequacy of the lubricant before compressor tests are started. This paper will discuss the process to evaluate lubricants for various types of compressors and bearing design with focus on what’s needed for current refrigerant trends. In addition, the paper will show how the lubricant chemistry choice can be manipulated through understanding of the bearing design and knowledge of interaction with the refrigerant to maximize performance. Emphasis will be placed on evaluation of synthetic lubricants for both natural and synthetic low GWP refrigerants.

  12. Identifying User Profiles from Statistical Grouping Methods

    Directory of Open Access Journals (Sweden)

    Francisco Kelsen de Oliveira

    2018-02-01

    Full Text Available This research aimed to group users into subgroups according to their levels of knowledge about technology. Statistical hierarchical and non-hierarchical clustering methods were studied, compared and used in the creations of the subgroups from the similarities of the skill levels with these users’ technology. The research sample consisted of teachers who answered online questionnaires about their skills with the use of software and hardware with educational bias. The statistical methods of grouping were performed and showed the possibilities of groupings of the users. The analyses of these groups allowed to identify the common characteristics among the individuals of each subgroup. Therefore, it was possible to define two subgroups of users, one with skill in technology and another with skill with technology, so that the partial results of the research showed two main algorithms for grouping with 92% similarity in the formation of groups of users with skill with technology and the other with little skill, confirming the accuracy of the techniques of discrimination against individuals.

  13. The Protein Identifier Cross-Referencing (PICR service: reconciling protein identifiers across multiple source databases

    Directory of Open Access Journals (Sweden)

    Leinonen Rasko

    2007-10-01

    Full Text Available Abstract Background Each major protein database uses its own conventions when assigning protein identifiers. Resolving the various, potentially unstable, identifiers that refer to identical proteins is a major challenge. This is a common problem when attempting to unify datasets that have been annotated with proteins from multiple data sources or querying data providers with one flavour of protein identifiers when the source database uses another. Partial solutions for protein identifier mapping exist but they are limited to specific species or techniques and to a very small number of databases. As a result, we have not found a solution that is generic enough and broad enough in mapping scope to suit our needs. Results We have created the Protein Identifier Cross-Reference (PICR service, a web application that provides interactive and programmatic (SOAP and REST access to a mapping algorithm that uses the UniProt Archive (UniParc as a data warehouse to offer protein cross-references based on 100% sequence identity to proteins from over 70 distinct source databases loaded into UniParc. Mappings can be limited by source database, taxonomic ID and activity status in the source database. Users can copy/paste or upload files containing protein identifiers or sequences in FASTA format to obtain mappings using the interactive interface. Search results can be viewed in simple or detailed HTML tables or downloaded as comma-separated values (CSV or Microsoft Excel (XLS files suitable for use in a local database or a spreadsheet. Alternatively, a SOAP interface is available to integrate PICR functionality in other applications, as is a lightweight REST interface. Conclusion We offer a publicly available service that can interactively map protein identifiers and protein sequences to the majority of commonly used protein databases. Programmatic access is available through a standards-compliant SOAP interface or a lightweight REST interface. The PICR

  14. Collecting and identifying the radioactive waste

    International Nuclear Information System (INIS)

    Dogaru, C. GH.

    2001-01-01

    The procedure 'Collecting and identifying the radioactive waste' applied by the Radioactive Waste Management Department, STDR, complies with the requirements of the competent authority concerning the radioactive source management. One of the most important tasks, requiring the application of this procedure, is collecting and identification of 'historical wastes' for which a complete book keeping does not exist from different reasons. The chapter 1 presents the procedure's goal and the chapter 2 defines the applicability field. Chapter 3 enlists the reference documents while the chapter 4 gives the definitions and abbreviations used in the procedure. Chapter 5 defines responsibilities of the operators implied in collecting, identification and characterization of the radioactive wastes, the producers of the radioactive wastes being implied. Chapter 6 gives the preliminary conditions for applying the procedure. Among these, the transport, collecting, processing, storing and characterization costs are implied, as well as the compliance with technical and different other condition. The procedure structure is presented in the chapter 7. In collecting radioactive wastes, two situations are possible: 1- the producer is able to prepare the wastes for transport and to deliver them to STDR; 2 - the wastes are received from the producer by a delegate STDR operator, properly and technically prepared. The producer must demonstrate by documents the origin and possession, analysis bulletins specifying, the radionuclides activity and measurement date, physical state and, in addition, for spent radiation sources, the series/number of the container and producer. In case the producer is not able to display all this information, the wastes are taken into custody by the STDR labs in view of their analysis. A record in writing is completed specifying the transfer of radioactive wastes from the producer to the STDR, a record which is sent to the national authority in charge with the

  15. Identifying the Subtle Presentation of Decompression Sickness.

    Science.gov (United States)

    Alea, Kenneth

    2015-12-01

    Decompression sickness is an inherent occupational hazard that has the possibility to leave its victims with significant long-lasting effects that can potentially impact an aircrew's flight status. The relative infrequency of this hazard within the military flying community along with the potentially subtle presentation of decompression sickness (DCS) has the potential to result in delayed diagnosis and treatment, leading to residual deficits that can impact a patient's daily life or even lead to death. The patient presented in this work was diagnosed with a Type II DCS 21 h after a cabin decompression at 35,000 ft (10,668 m). The patient had been asymptomatic with a completely normal physical/neurological exam following his flight. The following day, he presented with excessive fatigue and on re-evaluation was recommended for hyperbaric therapy, during which his symptoms completely resolved. He was re-evaluated 14 d later and cleared to resume flight duties without further incident. The manifestation of this patient's decompression sickness was subtle and followed an evaluation that failed to identify any focal findings. A high index of suspicion with strict follow-up contributed to the identification of DCS in this case, resulting in definitive treatment and resolution of the patient's symptoms. Determination of the need for hyperbaric therapy following oxygen supplementation and a thorough history and physical is imperative. If the diagnosis is in question, consider preemptive hyperbaric therapy as the benefits of treatment in DCS outweigh the risks of treatment. Finally, this work introduces the future potential of neuropsychological testing for both the diagnosis of DCS as well as assessing the effectiveness of hyperbaric therapy in Type II DCS.

  16. Identifying enabling management practices for employee engagement

    Directory of Open Access Journals (Sweden)

    Marius Joubert

    2011-12-01

    Full Text Available Orientation: A currently emerging viewpoint is that today's management practices no longer add value to organisations. The focus of this article is to conduct a systematic review of the scholarly literature on management practices that could be related to employee engagement. Research purpose: This study searched for evidence in support of the notion of a management value chain, and enabling management practices within each value chain component that could relate to employee engagement. Motivation for the study: An alternative management value chain model could contribute towards a better understanding of which management practices may potentially impact employee engagement. Research design, approach, and method: This is a non-empirical (theoretical study, based on a systematic, in-depth literature review to identify the key management components and enabling practices within this proposed management value chain. Scholarly research databases were sourced for relevant peer reviewed research conducted since 1990, not excluding important contributions prior to 1990. The literature was systematically searched, selected, studied, and contextualized within this study. Main findings: Support was found for the notion of a management value chain, for enabling management practices within each proposed management value chain component, and it was also established these management practices indeed have an impact on employee engagement. Practical/managerial/implications: The possibility that management work can be presented as a generic management value chain allows managers to approach engaging management practices more systematically. Contribution/value-add: This study highlights the importance of some management practices that have never been seen as part of management work.

  17. From Invisibility to Transparency: Identifying the Implications

    Directory of Open Access Journals (Sweden)

    Nancy J. Turner

    2008-12-01

    Full Text Available This paper explores the need for a broader and more inclusive approach to decisions about land and resources, one that recognizes the legitimacy of cultural values and traditional knowledge in environmental decision making and policy. Invisible losses are those not widely recognized or accounted for in decisions about resource planning and decision making in resource- and land-use negotiations precisely because they involve considerations that tend to be ignored by managers and scientists or because they are often indirect or cumulative, resulting from a complex, often cumulative series of events, decisions, choices, or policies. First Nations communities in western North America have experienced many such losses that, together, have resulted in a decline in the overall resilience of individuals and communities. We have identified eight types invisible losses that are often overlapping and cumulative: cultural/lifestyle losses, loss of identity, health losses, loss of self-determination and influence, emotional and psychological losses, loss of order in the world, knowledge losses, and indirect economic losses and lost opportunities. To render such invisible losses more transparent, which represents the first step in developing a more positive and equitable basis for decision making and negotiations around land and resources, we recommend six processes: focusing on what matters to the people affected, describing what matters in meaningful ways, making a place for these concerns in decision making, evaluating future losses and gains from a historical baseline, recognizing culturally derived values as relevant, and creating better alternatives for decision making so that invisible losses will be diminished or eliminated in the future.

  18. Identifying organizational cultures that promote patient safety.

    Science.gov (United States)

    Singer, Sara J; Falwell, Alyson; Gaba, David M; Meterko, Mark; Rosen, Amy; Hartmann, Christine W; Baker, Laurence

    2009-01-01

    Safety climate refers to shared perceptions of what an organization is like with regard to safety, whereas safety culture refers to employees' fundamental ideology and orientation and explains why safety is pursued in the manner exhibited within a particular organization. Although research has sought to identify opportunities for improving safety outcomes by studying patterns of variation in safety climate, few empirical studies have examined the impact of organizational characteristics such as culture on hospital safety climate. This study explored how aspects of general organizational culture relate to hospital patient safety climate. In a stratified sample of 92 U.S. hospitals, we sampled 100% of senior managers and physicians and 10% of other hospital workers. The Patient Safety Climate in Healthcare Organizations and the Zammuto and Krakower organizational culture surveys measured safety climate and group, entrepreneurial, hierarchical, and production orientation of hospitals' culture, respectively. We administered safety climate surveys to 18,361 personnel and organizational culture surveys to a 5,894 random subsample between March 2004 and May 2005. Secondary data came from the 2004 American Hospital Association Annual Hospital Survey and Dun & Bradstreet. Hierarchical linear regressions assessed relationships between organizational culture and safety climate measures. Aspects of general organizational culture were strongly related to safety climate. A higher level of group culture correlated with a higher level of safety climate, but more hierarchical culture was associated with lower safety climate. Aspects of organizational culture accounted for more than threefold improvement in measures of model fit compared with models with controls alone. A mix of culture types, emphasizing group culture, seemed optimal for safety climate. Safety climate and organizational culture are positively related. Results support strategies that promote group orientation and

  19. Identifying Hendra virus diversity in pteropid bats.

    Directory of Open Access Journals (Sweden)

    Ina Smith

    Full Text Available Hendra virus (HeV causes a zoonotic disease with high mortality that is transmitted to humans from bats of the genus Pteropus (flying foxes via an intermediary equine host. Factors promoting spillover from bats to horses are uncertain at this time, but plausibly encompass host and/or agent and/or environmental factors. There is a lack of HeV sequence information derived from the natural bat host, as previously sequences have only been obtained from horses or humans following spillover events. In order to obtain an insight into possible variants of HeV circulating in flying foxes, collection of urine was undertaken in multiple flying fox roosts in Queensland, Australia. HeV was found to be geographically widespread in flying foxes with a number of HeV variants circulating at the one time at multiple locations, while at times the same variant was found circulating at disparate locations. Sequence diversity within variants allowed differentiation on the basis of nucleotide changes, and hypervariable regions in the genome were identified that could be used to differentiate circulating variants. Further, during the study, HeV was isolated from the urine of flying foxes on four occasions from three different locations. The data indicates that spillover events do not correlate with particular HeV isolates, suggesting that host and/or environmental factors are the primary determinants of bat-horse spillover. Thus future spillover events are likely to occur, and there is an on-going need for effective risk management strategies for both human and animal health.

  20. Identifying Fishes through DNA Barcodes and Microarrays.

    Directory of Open Access Journals (Sweden)

    Marc Kochzius

    2010-09-01

    Full Text Available International fish trade reached an import value of 62.8 billion Euro in 2006, of which 44.6% are covered by the European Union. Species identification is a key problem throughout the life cycle of fishes: from eggs and larvae to adults in fisheries research and control, as well as processed fish products in consumer protection.This study aims to evaluate the applicability of the three mitochondrial genes 16S rRNA (16S, cytochrome b (cyt b, and cytochrome oxidase subunit I (COI for the identification of 50 European marine fish species by combining techniques of "DNA barcoding" and microarrays. In a DNA barcoding approach, neighbour Joining (NJ phylogenetic trees of 369 16S, 212 cyt b, and 447 COI sequences indicated that cyt b and COI are suitable for unambiguous identification, whereas 16S failed to discriminate closely related flatfish and gurnard species. In course of probe design for DNA microarray development, each of the markers yielded a high number of potentially species-specific probes in silico, although many of them were rejected based on microarray hybridisation experiments. None of the markers provided probes to discriminate the sibling flatfish and gurnard species. However, since 16S-probes were less negatively influenced by the "position of label" effect and showed the lowest rejection rate and the highest mean signal intensity, 16S is more suitable for DNA microarray probe design than cty b and COI. The large portion of rejected COI-probes after hybridisation experiments (>90% renders the DNA barcoding marker as rather unsuitable for this high-throughput technology.Based on these data, a DNA microarray containing 64 functional oligonucleotide probes for the identification of 30 out of the 50 fish species investigated was developed. It represents the next step towards an automated and easy-to-handle method to identify fish, ichthyoplankton, and fish products.

  1. Identifying tectonic parameters that influence tsunamigenesis

    Science.gov (United States)

    van Zelst, Iris; Brizzi, Silvia; van Dinther, Ylona; Heuret, Arnauld; Funiciello, Francesca

    2017-04-01

    The role of tectonics in tsunami generation is at present poorly understood. However, the fact that some regions produce more tsunamis than others indicates that tectonics could influence tsunamigenesis. Here, we complement a global earthquake database that contains geometrical, mechanical, and seismicity parameters of subduction zones with tsunami data. We statistically analyse the database to identify the tectonic parameters that affect tsunamigenesis. The Pearson's product-moment correlation coefficients reveal high positive correlations of 0.65 between, amongst others, the maximum water height of tsunamis and the seismic coupling in a subduction zone. However, these correlations are mainly caused by outliers. The Spearman's rank correlation coefficient results in more robust correlations of 0.60 between the number of tsunamis in a subduction zone and subduction velocity (positive correlation) and the sediment thickness at the trench (negative correlation). Interestingly, there is a positive correlation between the latter and tsunami magnitude. In an effort towards multivariate statistics, a binary decision tree analysis is conducted with one variable. However, this shows that the amount of data is too scarce. To complement this limited amount of data and to assess physical causality of the tectonic parameters with regard to tsunamigenesis, we conduct a numerical study of the most promising parameters using a geodynamic seismic cycle model. We show that an increase in sediment thickness on the subducting plate results in a shift in seismic activity from outerrise normal faults to splay faults. We also show that the splay fault is the preferred rupture path for a strongly velocity strengthening friction regime in the shallow part of the subduction zone, which increases the tsunamigenic potential. A larger updip limit of the seismogenic zone results in larger vertical surface displacement.

  2. An approach to identify urban groundwater recharge

    Directory of Open Access Journals (Sweden)

    E. Vázquez-Suñé

    2010-10-01

    Full Text Available Evaluating the proportion in which waters from different origins are mixed in a given water sample is relevant for many hydrogeological problems, such as quantifying total recharge, assessing groundwater pollution risks, or managing water resources. Our work is motivated by urban hydrogeology, where waters with different chemical signature can be identified (losses from water supply and sewage networks, infiltration from surface runoff and other water bodies, lateral aquifers inflows, .... The relative contribution of different sources to total recharge can be quantified by means of solute mass balances, but application is hindered by the large number of potential origins. Hence, the need to incorporate data from a large number of conservative species, the uncertainty in sources concentrations and measurement errors. We present a methodology to compute mixing ratios and end-members composition, which consists of (i Identification of potential recharge sources, (ii Selection of tracers, (iii Characterization of the hydrochemical composition of potential recharge sources and mixed water samples, and (iv Computation of mixing ratios and reevaluation of end-members. The analysis performed in a data set from samples of the Barcelona city aquifers suggests that the main contributors to total recharge are the water supply network losses (22%, the sewage network losses (30%, rainfall, concentrated in the non-urbanized areas (17%, from runoff infiltration (20%, and the Besòs River (11%. Regarding species, halogens (chloride, fluoride and bromide, sulfate, total nitrogen, and stable isotopes (18O, 2H, and 34S behaved quite conservatively. Boron, residual alkalinity, EDTA and Zn did not. Yet, including these species in the computations did not affect significantly the proportion estimations.

  3. Identifying thresholds for ecosystem-based management.

    Directory of Open Access Journals (Sweden)

    Jameal F Samhouri

    Full Text Available BACKGROUND: One of the greatest obstacles to moving ecosystem-based management (EBM from concept to practice is the lack of a systematic approach to defining ecosystem-level decision criteria, or reference points that trigger management action. METHODOLOGY/PRINCIPAL FINDINGS: To assist resource managers and policymakers in developing EBM decision criteria, we introduce a quantitative, transferable method for identifying utility thresholds. A utility threshold is the level of human-induced pressure (e.g., pollution at which small changes produce substantial improvements toward the EBM goal of protecting an ecosystem's structural (e.g., diversity and functional (e.g., resilience attributes. The analytical approach is based on the detection of nonlinearities in relationships between ecosystem attributes and pressures. We illustrate the method with a hypothetical case study of (1 fishing and (2 nearshore habitat pressure using an empirically-validated marine ecosystem model for British Columbia, Canada, and derive numerical threshold values in terms of the density of two empirically-tractable indicator groups, sablefish and jellyfish. We also describe how to incorporate uncertainty into the estimation of utility thresholds and highlight their value in the context of understanding EBM trade-offs. CONCLUSIONS/SIGNIFICANCE: For any policy scenario, an understanding of utility thresholds provides insight into the amount and type of management intervention required to make significant progress toward improved ecosystem structure and function. The approach outlined in this paper can be applied in the context of single or multiple human-induced pressures, to any marine, freshwater, or terrestrial ecosystem, and should facilitate more effective management.

  4. Identifying hidden sexual bridging communities in Chicago.

    Science.gov (United States)

    Youm, Yoosik; Mackesy-Amiti, Mary Ellen; Williams, Chyvette T; Ouellet, Lawrence J

    2009-07-01

    Bridge populations can play a central role in the spread of human immunodeficiency virus (HIV) by providing transmission links between higher and lower prevalence populations. While social network methods are well suited to the study of bridge populations, analyses tend to focus on dyads (i.e., risk between drug and/or sex partners) and ignore bridges between distinct subpopulations. This study takes initial steps toward moving the analysis of sexual network linkages beyond individual and risk group levels to a community level in which Chicago's 77 community areas are examined as subpopulations for the purpose of identifying potential bridging communities. Of particular interest are "hidden" bridging communities; that is, areas with above-average levels of sexual ties with other areas but whose below-average AIDS prevalence may hide their potential importance for HIV prevention. Data for this analysis came from the first wave of recruiting at the Chicago Sexual Acquisition and Transmission of HIV Cooperative Agreement Program site. Between August 2005 through October 2006, respondent-driven sampling was used to recruit users of heroin, cocaine, or methamphetamine, men who have sex with men regardless of drug use, the sex partners of these two groups, and sex partners of the sex partners. In this cross-sectional study of the sexual transmission of HIV, participants completed a network-focused computer-assisted self-administered interview, which included questions about the geographic locations of sexual contacts with up to six recent partners. Bridging scores for each area were determined using a matrix representing Chicago's 77 community areas and were assessed using two measures: non-redundant ties and flow betweenness. Bridging measures and acquired immunodeficiency syndrome (AIDS) case prevalence rates were plotted for each community area on charts representing four conditions: below-average bridging and AIDS prevalence, below-average bridging and above

  5. Identifying the factors underlying discontinuation of triptans.

    Science.gov (United States)

    Wells, Rebecca E; Markowitz, Shira Y; Baron, Eric P; Hentz, Joseph G; Kalidas, Kavita; Mathew, Paul G; Halker, Rashmi; Dodick, David W; Schwedt, Todd J

    2014-02-01

    To identify factors associated with triptan discontinuation among migraine patients. It is unclear why many migraine patients who are prescribed triptans discontinue this treatment. This study investigated correlates of triptan discontinuation with a focus on potentially modifiable factors to improve compliance. This multicenter cross-sectional survey (n = 276) was performed at US tertiary care headache clinics. Headache fellows who were members of the American Headache Society Headache Fellows Research Consortium recruited episodic and chronic migraine patients who were current triptan users (use within prior 3 months and for ≥1 year) or past triptan users (no use within 6 months; prior use within 2 years). Univariate analyses were first completed to compare current triptan users to past users for: migraine characteristics, other migraine treatments, triptan education, triptan efficacy, triptan side effects, type of prescribing provider, Migraine Disability Assessment (MIDAS) scores and Beck Depression Inventory (BDI) scores. Then, a multivariable logistic regression model was selected from all possible combinations of predictor variables to determine the factors that best correlated with triptan discontinuation. Compared with those still using triptans (n = 207), those who had discontinued use (n = 69) had higher rates of medication overuse (30 vs. 18%, P = .04) and were more likely to have ever used opioids for migraine treatment (57 vs. 38%, P = .006) as well as higher MIDAS (mean 63 vs. 37, P = .001) and BDI scores (mean 10.4 vs. 7.4, P = .009). Compared with discontinued users, current triptan users were more likely to have had their triptan prescribed by a specialist (neurologist, headache specialist, or pain specialist) (74 vs. 54%, P = .002) and were more likely to report headache resolution (53 vs. 14%, P  24 (2.6, [1.5, 4.6]), BDI >4 (2.5, [1.4, 4.5]), and a history of ever using opioids for migraine therapy (2.2, [1

  6. CONVENTIONAL VIDEOENDOSCOPY CAN IDENTIFY HELICOBACTER PYLORI GASTRITIS?

    Science.gov (United States)

    Gomes, Alexandre; Skare, Thelma Larocca; Prestes, Manoel Alberto; Costa, Maiza da Silva; Petisco, Roberta Dombroski; Ramos, Gabriela Piovezani

    2016-01-01

    Studies with latest technologies such as endoscopy with magnification and chromoendoscopy showed that various endoscopic aspects are clearly related to infection by Helicobacter pylori (HP). The description of different patterns of erythema in gastric body under magnification of images revived interest in identifying these patterns by standard endoscopy. To validate the morphologic features of gastric mucosa related to H. pylori infection gastritis allowing predictability of their diagnosis as well as proper targeting biopsies. Prospective study of 339 consecutive patients with the standard videoendoscope image analysis were obtained, recorded and stored in a program database. These images were studied with respect to the presence or absence of H. pylori, diagnosed by rapid urease test and/or by histological analysis. Were studied: a) normal mucosa appearance; b) mucosal nodularity; c) diffuse nonspecific erythema or redness (with or without edema of folds and exudate) of antrum and body; d) mosaic pattern with focal area of hyperemia; e) erythema in streaks or bands (red streak); f) elevated (raised) erosion; g) flat erosions; h) fundic gland polyps. The main exclusion criteria were the use of drugs, HP pre-treatment and other entities that could affect results. Applying the exclusion criteria, were included 170 of the 339 patients, of which 52 (30.58%) were positive for HP and 118 negative. On the positive findings, the most associated with infection were: nodularity in the antrum (26.92%); presence of raised erosion (15.38%) and mosaic mucosa in the body (21.15%). On the negative group the normal appearance of the mucosa was 66.94%; erythema in streaks or bands in 9.32%; flat erosions 11.86%; and fundic gland polyps 11.86%. Endoscopic findings are useful in the predictability of the result and in directing biopsies. The most representative form of HP related gastritis was the nodularity of the antral mucosa. The raised erosion and mucosa in mosaic in the body

  7. Decision Level Fusion of Fingerprint Minutiae Based Pseudonymous Identifiers

    NARCIS (Netherlands)

    Yang, Bian; Busch, Christoph; de Groot, Koen; Xu, H.; Veldhuis, Raymond N.J.

    2011-01-01

    In a biometric template protected authentication system, a pseudonymous identifier is the part of a protected biometric template that can be compared directly against other pseudonymous identifiers. Each compared pair of pseudonymous identifiers results in a verification decision testing whether

  8. Obtaining subjects' consent to publish identifying personal information: current practices and identifying potential issues.

    Science.gov (United States)

    Yoshida, Akiko; Dowa, Yuri; Murakami, Hiromi; Kosugi, Shinji

    2013-11-25

    In studies publishing identifying personal information, obtaining consent is regarded as necessary, as it is impossible to ensure complete anonymity. However, current journal practices around specific points to consider when obtaining consent, the contents of consent forms and how consent forms are managed have not yet been fully examined. This study was conducted to identify potential issues surrounding consent to publish identifying personal information. Content analysis was carried out on instructions for authors and consent forms developed by academic journals in four fields (as classified by Journal Citation Reports): medicine general and internal, genetics and heredity, pediatrics, and psychiatry. An online questionnaire survey of editors working for journals that require the submission of consent forms was also conducted. Instructions for authors were reviewed for 491 academic journals (132 for medicine general and internal, 147 for genetics and heredity, 100 for pediatrics, and 112 for psychiatry). Approximately 40% (203: 74 for medicine general and internal, 31 for genetics and heredity, 58 for pediatrics, and 40 for psychiatry) stated that subject consent was necessary. The submission of consent forms was required by 30% (154) of the journals studied, and 10% (50) provided their own consent forms for authors to use. Two journals mentioned that the possible effects of publication on subjects should be considered. Many journal consent forms mentioned the difficulties in ensuring complete anonymity of subjects, but few addressed the study objective, the subjects' right to refuse consent and the withdrawal of consent. The main reason for requiring the submission of consent forms was to confirm that consent had been obtained. Approximately 40% of journals required subject consent to be obtained. However, differences were observed depending on the fields. Specific considerations were not always documented. There is a need to address issues around the study

  9. Obtaining subjects’ consent to publish identifying personal information: current practices and identifying potential issues

    Science.gov (United States)

    2013-01-01

    Background In studies publishing identifying personal information, obtaining consent is regarded as necessary, as it is impossible to ensure complete anonymity. However, current journal practices around specific points to consider when obtaining consent, the contents of consent forms and how consent forms are managed have not yet been fully examined. This study was conducted to identify potential issues surrounding consent to publish identifying personal information. Methods Content analysis was carried out on instructions for authors and consent forms developed by academic journals in four fields (as classified by Journal Citation Reports): medicine general and internal, genetics and heredity, pediatrics, and psychiatry. An online questionnaire survey of editors working for journals that require the submission of consent forms was also conducted. Results Instructions for authors were reviewed for 491 academic journals (132 for medicine general and internal, 147 for genetics and heredity, 100 for pediatrics, and 112 for psychiatry). Approximately 40% (203: 74 for medicine general and internal, 31 for genetics and heredity, 58 for pediatrics, and 40 for psychiatry) stated that subject consent was necessary. The submission of consent forms was required by 30% (154) of the journals studied, and 10% (50) provided their own consent forms for authors to use. Two journals mentioned that the possible effects of publication on subjects should be considered. Many journal consent forms mentioned the difficulties in ensuring complete anonymity of subjects, but few addressed the study objective, the subjects’ right to refuse consent and the withdrawal of consent. The main reason for requiring the submission of consent forms was to confirm that consent had been obtained. Conclusion Approximately 40% of journals required subject consent to be obtained. However, differences were observed depending on the fields. Specific considerations were not always documented. There is a need

  10. Post discharge issues identified by a call-back program: identifying improvement opportunities.

    Science.gov (United States)

    Ojeda, Patricia I; Kara, Areeba

    2017-12-01

    The period following discharge from the hospital is one of heightened vulnerability. Discharge instructions serve as a guide during this transition. Yet, clinicians receive little feedback on the quality of this document that ties into the patients' experience. We reviewed the issues voiced by discharged patients via a call-back program and compared them to the discharge instructions they had received. At our institution, patients receive an automated call forty-eight hours following discharge inquiring about progress. If indicated by the response to the call, they are directed to a nurse who assists with problem solving. We reviewed the nursing documentation of these encounters for a period of nine months. The issues voiced were grouped into five categories: communication, medications, durable medical equipment/therapies, follow up and new or ongoing symptoms. The discharge instructions given to each patient were reviewed. We retrieved data on the number of discharges from each specialty from the hospital over the same period. A total of 592 patients voiced 685 issues. The numbers of patients discharged from medical or surgical services identified as having issues via the call-back line paralleled the proportions discharged from medical and surgical services from the hospital during the same period. Nearly a quarter of the issues discussed had been addressed in the discharge instructions. The most common category of issues was related to communication deficits including missing or incomplete information which made it difficult for the patient to enact or understand the plan of care. Medication prescription related issues were the next most common. Resource barriers and questions surrounding medications were often unaddressed. Post discharge issues affect patients discharged from all services equally. Data from call back programs may provide actionable targets for improvement, identify the inpatient team's 'blind spots' and be used to provide feedback to clinicians.

  11. A study on the re-identifiability of Dutch citizens

    OpenAIRE

    Koot, M.R.; van 't Noordende, G.; de Laat, C.; Serjantov, A.; Troncoso, C.

    2010-01-01

    This paper analyses the re-identifiability of Dutch citizens by various demographics. Our analysis is based on registry office data of 2.7 million Dutch citizens, ~16% of the total population. We provide overall statistics on re-identifiability for a range of quasi-identifiers, and present an in-depth analysis of quasi-identifiers found in two de-identified data sets. We found that 67.0% of the sampled population is unambiguously identifiable by date of birth and four-digit postal code alone,...

  12. Genetic Screens in Yeast to Identify BRCA1 Modifiers

    National Research Council Canada - National Science Library

    Plon, Sharon E

    2004-01-01

    .... The yeast RAD9 protein has similar functions and sequence motifs as BRCA1 and we proposed to identify candidate modifier loci by identifying haploinsufficient mutations at a second locus that alters...

  13. Can a structured questionnaire identify patients with reduced renal function?

    DEFF Research Database (Denmark)

    Azzouz, Manal; Rømsing, Janne; Thomsen, Henrik

    2014-01-01

    To evaluate a structured questionnaire in identifying outpatients with renal dysfunction before MRI or CT in various age groups.......To evaluate a structured questionnaire in identifying outpatients with renal dysfunction before MRI or CT in various age groups....

  14. Identifying Critical Cross-Cultural School Psychology Competencies.

    Science.gov (United States)

    Rogers, Margaret R.; Lopez, Emilia C.

    2002-01-01

    Study sought to identify critical cross-cultural competencies for school psychologists. To identify the competencies, an extensive literature search about cross-cultural school psychology competencies was conducted, as well as a questionnaire to ask expert panelists. The 102 competencies identified cover 14 major domains of professional activities…

  15. Methods for identifying 30 chronic conditions: application to administrative data.

    Science.gov (United States)

    Tonelli, Marcello; Wiebe, Natasha; Fortin, Martin; Guthrie, Bruce; Hemmelgarn, Brenda R; James, Matthew T; Klarenbach, Scott W; Lewanczuk, Richard; Manns, Braden J; Ronksley, Paul; Sargious, Peter; Straus, Sharon; Quan, Hude

    2015-04-17

    Multimorbidity is common and associated with poor clinical outcomes and high health care costs. Administrative data are a promising tool for studying the epidemiology of multimorbidity. Our goal was to derive and apply a new scheme for using administrative data to identify the presence of chronic conditions and multimorbidity. We identified validated algorithms that use ICD-9 CM/ICD-10 data to ascertain the presence or absence of 40 morbidities. Algorithms with both positive predictive value and sensitivity ≥70% were graded as "high validity"; those with positive predictive value ≥70% and sensitivity <70% were graded as "moderate validity". To show proof of concept, we applied identified algorithms with high to moderate validity to inpatient and outpatient claims and utilization data from 574,409 people residing in Edmonton, Canada during the 2008/2009 fiscal year. Of the 40 morbidities, we identified 30 that could be identified with high to moderate validity. Approximately one quarter of participants had identified multimorbidity (2 or more conditions), one quarter had a single identified morbidity and the remaining participants were not identified as having any of the 30 morbidities. We identified a panel of 30 chronic conditions that can be identified from administrative data using validated algorithms, facilitating the study and surveillance of multimorbidity. We encourage other groups to use this scheme, to facilitate comparisons between settings and jurisdictions.

  16. Can "Federal Sanctuaries" be identified in Triphylia and Arkadia?

    DEFF Research Database (Denmark)

    Nielsen, Thomas Heine

    2013-01-01

    This paper discusses whether federal sanctuaries - such as are known from the Achaian and Aitolian Federations - can be identified in Triphylia and Arkadia in the Peloponnese. It is concluded that on present evidence it is not possible to identify such sanctuaries in these areas......This paper discusses whether federal sanctuaries - such as are known from the Achaian and Aitolian Federations - can be identified in Triphylia and Arkadia in the Peloponnese. It is concluded that on present evidence it is not possible to identify such sanctuaries in these areas...

  17. Novel lipid constituents identified in seeds of Nigella sativa (Linn)

    International Nuclear Information System (INIS)

    Mehta, B.K.; Verma, Manjul; Gupta, Meenal

    2008-01-01

    Novel lipids were isolated from the unsaponifiable matter extracted from seeds of Nigella sativa Linn by using n-hexane. The new dienoate and two monoesters were the new lipids identified by spectral (IR, 1 H- and 13 C-NMR spectra, mass spectrum, elemental analysis) and chemical analysis. The dienoate (1) was identified as methylnonadeca-15,17-dienoate and two monoesters were identified as pentyl hexadec-12-enoate (2) and pentyl pentadec-11-enoate (3). Linoleic acid, oleic acid, β-sitosterol and stigmasterol were identified as part of the lipid structures. All compounds exhibited moderate activity against Staphylococcus aureus and poor activity against shigella spp, and Klebsiella pneumoniae. (author)

  18. Genomic Regions Affecting Cheese Making Properties Identified in Danish Holsteins

    DEFF Research Database (Denmark)

    Gregersen, Vivi Raundahl; Bertelsen, Henriette Pasgaard; Poulsen, Nina Aagaard

    The cheese renneting process is affected by a number of factors associated to milk composition and a number of Danish Holsteins has previously been identified to have poor milk coagulation ability. Therefore, the aim of this study was to identify genomic regions affecting the technological...

  19. 34 CFR 5.16 - Deletion of identifying details.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Deletion of identifying details. 5.16 Section 5.16 Education Office of the Secretary, Department of Education AVAILABILITY OF INFORMATION TO THE PUBLIC PURSUANT TO PUB. L. 90-23 (Eff. until 7-14-10) What Records Are Available § 5.16 Deletion of identifying...

  20. 42 CFR 401.118 - Deletion of identifying details.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Deletion of identifying details. 401.118 Section 401.118 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN... Deletion of identifying details. When CMS publishes or otherwise makes available an opinion or order...

  1. 49 CFR 7.6 - Deletion of identifying detail.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Deletion of identifying detail. 7.6 Section 7.6... To Be Made Public by DOT § 7.6 Deletion of identifying detail. Whenever it is determined to be... the deletion will accompany the record published or made available for inspection. ...

  2. 30 CFR 47.21 - Identifying hazardous chemicals.

    Science.gov (United States)

    2010-07-01

    ..., subpart Z, Toxic and Hazardous Substances. (4) American Conference of Governmental Industrial Hygienists... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Identifying hazardous chemicals. 47.21 Section... TRAINING HAZARD COMMUNICATION (HazCom) Hazard Determination § 47.21 Identifying hazardous chemicals. The...

  3. Identifying individual fires from satellite-derived burned area data

    CSIR Research Space (South Africa)

    Archibald, S

    2009-07-01

    Full Text Available An algorithm for identifying individual fires from the Modis burned area data product is introduced for southern Africa. This algorithm gives the date of burning, size of fire, and location of the centroid for all fires identified over 8 years...

  4. Identifying Core Concepts of Cybersecurity: Results of Two Delphi Processes

    Science.gov (United States)

    Parekh, Geet; DeLatte, David; Herman, Geoffrey L.; Oliva, Linda; Phatak, Dhananjay; Scheponik, Travis; Sherman, Alan T.

    2018-01-01

    This paper presents and analyzes results of two Delphi processes that polled cybersecurity experts to rate cybersecurity topics based on importance, difficulty, and timelessness. These ratings can be used to identify core concepts--cross-cutting ideas that connect knowledge in the discipline. The first Delphi process identified core concepts that…

  5. Parents of Youth Who Identify as Transgender: An Exploratory Study

    Science.gov (United States)

    Johnson, Danielle; Sikorski, Jonathon; Savage, Todd A.; Woitaszewski, Scott A.

    2014-01-01

    This article explores the experiences, perceptions, support systems, and coping strategies on which parents of youth who identify as transgender rely. Based on data gathered via interviews with parents of youth who identify as transgender and analyzed using the consensual qualitative research method, parental challenges and concerns about their…

  6. Identifiability Results for Several Classes of Linear Compartment Models.

    Science.gov (United States)

    Meshkat, Nicolette; Sullivant, Seth; Eisenberg, Marisa

    2015-08-01

    Identifiability concerns finding which unknown parameters of a model can be estimated, uniquely or otherwise, from given input-output data. If some subset of the parameters of a model cannot be determined given input-output data, then we say the model is unidentifiable. In this work, we study linear compartment models, which are a class of biological models commonly used in pharmacokinetics, physiology, and ecology. In past work, we used commutative algebra and graph theory to identify a class of linear compartment models that we call identifiable cycle models, which are unidentifiable but have the simplest possible identifiable functions (so-called monomial cycles). Here we show how to modify identifiable cycle models by adding inputs, adding outputs, or removing leaks, in such a way that we obtain an identifiable model. We also prove a constructive result on how to combine identifiable models, each corresponding to strongly connected graphs, into a larger identifiable model. We apply these theoretical results to several real-world biological models from physiology, cell biology, and ecology.

  7. 28 CFR 22.22 - Revelation of identifiable data.

    Science.gov (United States)

    2010-07-01

    ... STATISTICAL INFORMATION § 22.22 Revelation of identifiable data. (a) Except as noted in paragraph (b) of this section, research and statistical information relating to a private person may be revealed in identifiable... sections 223(a)(12)(A), 223(a)(13), 223(a)(14), and 243 of the Juvenile Justice and Delinquency Prevention...

  8. 7 CFR 632.52 - Identifying typical classes of action.

    Science.gov (United States)

    2010-01-01

    ... § 632.52 Identifying typical classes of action. (a) The RFO will analyze the environmental assessment of....12. These actions are determined by a limited environmental assessment that reasonably identifies the... 632.52 Agriculture Regulations of the Department of Agriculture (Continued) NATURAL RESOURCES...

  9. Diagnostic tools for identifying sleepy drivers in the field.

    Science.gov (United States)

    2013-05-06

    The overarching goal of this project was to identify and evaluate cognitive and behavioral indices that are sensitive to sleep : deprivation and may help identify commercial motor vehicle drivers (CMV) who are at-risk for driving in a sleep deprived ...

  10. Application of artificial neural network to identify nuclear materials

    International Nuclear Information System (INIS)

    Xu Peng; Wang Zhe; Li Tiantuo

    2005-01-01

    Applying the neutral network, the article studied the technology of identifying the gamma spectra of the nuclear material in the nuclear components. In the article, theory of the network identifying the spectra is described, and the results of identification of gamma spectra are given.(authors)

  11. Loneliness, immigration background and self-identified ethnicity

    DEFF Research Database (Denmark)

    Madsen, Katrine Rich; Damsgaard, Mogens Trab; Jervelund, Signe Smith

    2016-01-01

    an increased risk of loneliness compared to adolescents with a Danish origin. The results also suggest that adolescents’ self-identified ethnicity plays an essential role but differently for immigrants and descendants: identifying with the Danish majority was protective against loneliness among immigrants...

  12. Identifying content for simulation-based curricula in urology

    DEFF Research Database (Denmark)

    Nayahangan, Leizl Joy; Hansen, Rikke Bolling; Lindorff-Larsen, Karen Gilboe

    2017-01-01

    to identify technical procedures in urology that should be included in a simulation-based curriculum for residency training. MATERIALS AND METHODS: A national needs assessment was performed using the Delphi method involving 56 experts with significant roles in the education of urologists. Round 1 identified...

  13. Identifying child abuse through text mining and machine learning

    NARCIS (Netherlands)

    Amrit, Chintan; Paauw, Tim; Aly, Robin; Lavric, Miha

    2017-01-01

    In this paper, we describe how we used text mining and analysis to identify and predict cases of child abuse in a public health institution. Such institutions in the Netherlands try to identify and prevent different kinds of abuse. A significant part of the medical data that the institutions have on

  14. 37 CFR 211.5 - Deposit of identifying material.

    Science.gov (United States)

    2010-07-01

    ... option, deposit four reproductions in the most complete form of the mask work as fixed in a semiconductor... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Deposit of identifying... COPYRIGHT OFFICE AND PROCEDURES MASK WORK PROTECTION § 211.5 Deposit of identifying material. (a) General...

  15. Identifying Interbank Loans, Rates, and Claims Networks from Transactional Data

    NARCIS (Netherlands)

    Leon Rincon, C.E.; Cely, Jorge; Cadena, Carlos

    2015-01-01

    We identify interbank (i.e. non-collateralized) loans from the Colombian large-value payment system by implementing Furfine’s method. After identifying interbank loans from transactional data we obtain the interbank rates and claims without relying on financial institutions’ reported data.

  16. An Application Of Receptor Modeling To Identify Airborne Particulate ...

    African Journals Online (AJOL)

    An Application Of Receptor Modeling To Identify Airborne Particulate Sources In Lagos, Nigeria. FS Olise, OK Owoade, HB Olaniyi. Abstract. There have been no clear demarcations between industrial and residential areas of Lagos with focus on industry as the major source. There is need to identify potential source types in ...

  17. Identifying a K-10 Developmental Framework for Teaching Philosophy

    Science.gov (United States)

    Poulton, Janette

    2014-01-01

    The intention of the study was to identify predictable opportunities for teachers to scaffold middle year students' philosophical learning. Such opportunities were identified in terms of students' readiness to learn certain behaviours in the context of a "community of inquiry". Thus it was hoped that the project would provide a useful…

  18. An improved model for identifying influential bloggers on the web ...

    African Journals Online (AJOL)

    The benefits of achieving competitive advantages in a blog community by identify influential blogger have created several research gaps and the popularity of these services has make the problem of identifying the most influential bloggers noteworthy, since its solution can lead to major benefits for the users of this services ...

  19. A genome-wide association meta-analysis identifies new childhood obesity loci

    Science.gov (United States)

    Bradfield, Jonathan P.; Taal, H. Rob; Timpson, Nicholas J.; Scherag, André; Lecoeur, Cecile; Warrington, Nicole M.; Hypponen, Elina; Holst, Claus; Valcarcel, Beatriz; Thiering, Elisabeth; Salem, Rany M.; Schumacher, Fredrick R.; Cousminer, Diana L.; Sleiman, Patrick M.A.; Zhao, Jianhua; Berkowitz, Robert I.; Vimaleswaran, Karani S.; Jarick, Ivonne; Pennell, Craig E.; Evans, David M.; St. Pourcain, Beate; Berry, Diane J.; Mook-Kanamori, Dennis O; Hofman, Albert; Rivadeinera, Fernando; Uitterlinden, André G.; van Duijn, Cornelia M.; van der Valk, Ralf J.P.; de Jongste, Johan C.; Postma, Dirkje S.; Boomsma, Dorret I.; Gauderman, William J.; Hassanein, Mohamed T.; Lindgren, Cecilia M.; Mägi, Reedik; Boreham, Colin A.G.; Neville, Charlotte E.; Moreno, Luis A.; Elliott, Paul; Pouta, Anneli; Hartikainen, Anna-Liisa; Li, Mingyao; Raitakari, Olli; Lehtimäki, Terho; Eriksson, Johan G.; Palotie, Aarno; Dallongeville, Jean; Das, Shikta; Deloukas, Panos; McMahon, George; Ring, Susan M.; Kemp, John P.; Buxton, Jessica L.; Blakemore, Alexandra I.F.; Bustamante, Mariona; Guxens, Mònica; Hirschhorn, Joel N.; Gillman, Matthew W.; Kreiner-Møller, Eskil; Bisgaard, Hans; Gilliland, Frank D.; Heinrich, Joachim; Wheeler, Eleanor; Barroso, Inês; O'Rahilly, Stephen; Meirhaeghe, Aline; Sørensen, Thorkild I.A.; Power, Chris; Palmer, Lyle J.; Hinney, Anke; Widen, Elisabeth; Farooqi, I. Sadaf; McCarthy, Mark I.; Froguel, Philippe; Meyre, David; Hebebrand, Johannes; Jarvelin, Marjo-Riitta; Jaddoe, Vincent W.V.; Smith, George Davey; Hakonarson, Hakon; Grant, Struan F.A.

    2012-01-01

    Multiple genetic variants have been associated with adult obesity and a few with severe obesity in childhood; however, less progress has been made to establish genetic influences on common early-onset obesity. We performed a North American-Australian-European collaborative meta-analysis of fourteen studies consisting of 5,530 cases (≥95th percentile of body mass index (BMI)) and 8,318 controls (<50th percentile of BMI) of European ancestry. Taking forward the eight novel signals yielding association with P < 5×10−6 in to nine independent datasets (n = 2,818 cases and 4,083 controls) we observed two loci that yielded a genome wide significant combined P-value, namely near OLFM4 on 13q14 (rs9568856; P=1.82×10−9; OR=1.22) and within HOXB5 on 17q21 (rs9299; P=3.54×10−9; OR=1.14). Both loci continued to show association when including two extreme childhood obesity cohorts (n = 2,214 cases and 2,674 controls). Finally, these two loci yielded directionally consistent associations in the GIANT meta-analysis of adult BMI1. PMID:22484627

  20. Identifying Opportunities for Vertical Integration of Biochemistry and Clinical Medicine.

    Science.gov (United States)

    Wendelberger, Karen J.; Burke, Rebecca; Haas, Arthur L.; Harenwattananon, Marisa; Simpson, Deborah

    1998-01-01

    Objectives: Retention of basic science knowledge, as judged by National Board of Medical Examiners' (NBME) data, suffers due to lack of apparent relevance and isolation of instruction from clinical application, especially in biochemistry. However, the literature reveals no systematic process for identifying key biochemical concepts and associated clinical conditions. This study systematically identified difficult biochemical concepts and their common clinical conditions as a critical step towards enhancing relevance and retention of biochemistry.Methods: A multi-step/ multiple stakeholder process was used to: (1) identify important biochemistry concepts; (2) determine students' perceptions of concept difficulty; (3) assess biochemistry faculty, student, and clinical teaching scholars' perceived relevance of identified concepts; and (4) identify associated common clinical conditions for relevant and difficult concepts. Surveys and a modified Delphi process were used to gather data, subsequently analyzed using SPSS for Windows.Results: Sixteen key biochemical concepts were identified. Second year medical students rated 14/16 concepts as extremely difficult while fourth year students rated nine concepts as moderately to extremely difficult. On average, each teaching scholar generated common clinical conditions for 6.2 of the 16 concepts, yielding a set of seven critical concepts and associated clinical conditions.Conclusions: Key stakeholders in the instructional process struggle to identify biochemistry concepts that are critical, difficult to learn and associated with common clinical conditions. However, through a systematic process beginning with identification of concepts and associated clinical conditions, relevance of basic science instruction can be enhanced.

  1. Target and identify: triazene linker helps identify azidation sites of labelled proteins via click and cleave strategy.

    Science.gov (United States)

    Lohse, Jonas; Schindl, Alexandra; Danda, Natasha; Williams, Chris P; Kramer, Karl; Kuster, Bernhard; Witte, Martin D; Médard, Guillaume

    2017-10-31

    A method for identifying probe modification of proteins via tandem mass spectrometry was developed. Azide bearing molecules are immobilized on functionalised sepharose beads via copper catalysed Huisgen-type click chemistry and selectively released under acidic conditions by chemical cleavage of the triazene linkage. We applied this method to identify the modification site of targeted-diazotransfer on BirA.

  2. Cervical Cancers Require the Continuous Expression of the Human Papillomavirus Type 16 E7 Oncoprotein Even in the Presence of the Viral E6 Oncoprotein

    Science.gov (United States)

    Jabbar, Sean F.; Park, Soyeong; Schweizer, Johannes; Berard-Bergery, Marthe; Pitot, Henry C.; Lee, Denis; Lambert, Paul F.

    2012-01-01

    High-risk human papillomaviruses (HPV), such as HPV-16, are etiologic agents of a variety of anogenital and oral malignancies, including nearly all cases of cervical cancer. Cervical cancers arising in transgenic mice that express HPV-16 E7 in an inducible manner require the continuous expression of E7 for their maintenance. However, in HPV-associated cancers in vivo, E6 and E7 invariably are co-expressed. In this study, we investigated whether cervical cancers rely on the continuous expression of E7 in the context of constitutively expressed E6. We placed the inducible HPV-16 E7 transgene onto a background in which HPV-16 E6 was constitutively expressed. In transgenic mice with high-grade cervical dysplastic lesions and cervical cancer, repressing the expression of E7 led to the regression of all cancers and the vast majority of high-grade dysplastic lesions. In addition, cervical cancers were occasionally observed in transgenic mice in which E7 was repressed and then re-expressed. Our findings therefore indicate that even in the presence of constitutively expressed E6, the continuous expression of E7 is required for the maintenance of cervical cancers and most precancerous lesions. These data have important implications for the potential clinical use of drugs designed to inhibit the expression and/or function of E7 to treat HPV-associated cancers. PMID:22700879

  3. Numerical identifiability of the parameters of induction machines

    Energy Technology Data Exchange (ETDEWEB)

    Corcoles, F.; Pedra, J.; Salichs, M. [Dep. d' Eng. Electrica ETSEIB. UPC, Barcelona (Spain)

    2000-08-01

    This paper analyses the numerical identifiability of the electrical parameters of induction machines. Relations between parameters and the impossibility to estimate all of them - when only external measures are used: voltage, current, speed and torque - are shown. Formulations of the single and double-cage induction machine, with and without core losses in both models, are developed. The proposed solution is the formulation of machine equations by using the minimum number of parameters (which are identifiable parameters). As an application example, the parameters of a double-cage induction machine are identified using steady-state measurements corresponding to different angular speeds. (orig.)

  4. Identifying salt stress-responsive transcripts from Roselle ( Hibiscus ...

    African Journals Online (AJOL)

    Hibiscus sabdariffa L.). Identifying the potentially novel transcripts responsible for salt stress tolerance in roselle will increase knowledge of the molecular mechanism underlying salt stress responses. In this study, differential display reverse ...

  5. Identifying factors affecting destination choice of medical tourists: a ...

    African Journals Online (AJOL)

    medical tourism”, has emerged as a new source of competitive advantage all over the world. The present study seeks to identify the factors that affect destination choice of medical tourists. Methods: We systematically searched relevant databases ...

  6. Identifying customer-focused performance measures : final report 655.

    Science.gov (United States)

    2010-10-01

    The Arizona Department of Transportation (ADOT) completed a comprehensive customer satisfaction : assessment in July 2009. ADOT commissioned the assessment to acquire statistically valid data from residents : and community leaders to help it identify...

  7. Experiences of female partners of masculine-identifying trans persons.

    Science.gov (United States)

    Theron, Liesl; Collier, Kate L

    2013-01-01

    This paper explores the intimate relationship experiences of the cisgender (i.e., not transgender) female partners of masculine-identifying transgender persons, with a particular focus on these partners' self-understanding of their sexual orientation. Limited research about this topic has been conducted to date. Semi-structured interviews were conducted with eight South African women who are or have been cisgender female partners of masculine-identifying trans persons. Although the interviews showed that the relationship experiences of female partners of masculine-identifying trans persons are diverse, several common themes emerged in the narratives. The way that participants labelled their sexual orientation did not change from before to after their relationship with a transgender partner. The participants reported varied family and community responses to their relationships. Specific emotional and informational support needs for women with transgender partners were identified.

  8. Preserving Privacy by De-identifying Facial Images

    National Research Council Canada - National Science Library

    Newton, Elaine; Sweeney, Latanya; Malin, Bradley

    2003-01-01

    .... A trivial solution to de-identifying faces involves blacking out each face. This thwarts any possible face recognition, but because all facial details are obscured, the result is of limited use...

  9. An improved anti-leech mechanism based on session identifier

    Science.gov (United States)

    Zhang, Jianbiao; Zhu, Tong; Zhang, Han; Lin, Li

    2012-01-01

    With the rapid development of information technology and extensive requirement of network resource sharing, plenty of resource hotlinking phenomenons appear on the internet. The hotlinking problem not only harms the interests of legal websites but also leads to a great affection to fair internet environment. The anti-leech technique based on session identifier is highly secure, but the transmission of session identifier in plaintext form causes some security flaws. In this paper, a proxy hotlinking technique based on session identifier is introduced firstly to illustrate these security flaws; next, this paper proposes an improved anti-leech mechanism based on session identifier, the mechanism takes the random factor as the core and detects hotlinking request using a map table that contains random factor, user's information and time stamp; at last the paper analyzes the security of mechanism in theory. The result reveals that the improved mechanism has the merits of simple realization, high security and great flexibility.

  10. NREL Analysis Identifies Where Commercial Customers Might Benefit from

    Science.gov (United States)

    Battery Energy Storage | NREL | News | NREL NREL Analysis Identifies Where Commercial Customers Customers Might Benefit from Battery Energy Storage August 24, 2017 After upfront costs, batteries may reduce operating costs for customers paying demand charges Commercial electricity customers who are

  11. Comparing complete and partial classification for identifying customers at risk

    NARCIS (Netherlands)

    Bloemer, J.M.M.; Brijs, T.; Swinnen, S.P.; Vanhoof, K.

    2003-01-01

    This paper evaluates complete versus partial classification for the problem of identifying customers at risk. We define customers at risk as customers reporting overall satisfaction, but these customers also possess characteristics that are strongly associated with dissatisfied customers. This

  12. Structural parameter identifiability analysis for dynamic reaction networks

    DEFF Research Database (Denmark)

    Davidescu, Florin Paul; Jørgensen, Sten Bay

    2008-01-01

    method based on Lie derivatives. The proposed systematic two phase methodology is illustrated on a mass action based model for an enzymatically catalyzed reaction pathway network where only a limited set of variables is measured. The methodology clearly pinpoints the structurally identifiable parameters...... where for a given set of measured variables it is desirable to investigate which parameters may be estimated prior to spending computational effort on the actual estimation. This contribution addresses the structural parameter identifiability problem for the typical case of reaction network models....... The proposed analysis is performed in two phases. The first phase determines the structurally identifiable reaction rates based on reaction network stoichiometry. The second phase assesses the structural parameter identifiability of the specific kinetic rate expressions using a generating series expansion...

  13. Using the National Provider Identifier for Health Care...

    Data.gov (United States)

    U.S. Department of Health & Human Services — The establishment in recent years of a National Provider Identifier (NPI) offers a new method for counting and categorizing physicians and other health care...

  14. Identifying risk factors that contribute to acute mountain sickness

    African Journals Online (AJOL)

    Acute mountain sickness (AMS) is an ever-increasing burden on the health sector. With reported incidences .... schedule to reduce the likelihood of AMS. The data ... of Health and. Multidisciplinary Board on Exercise to identify individuals who.

  15. Identifying mechanistic indicators of childhood asthma from blood gene expression

    Science.gov (United States)

    Asthmatic individuals have been identified as a susceptible subpopulation for air pollutants. However, asthma represents a syndrome with multiple probable etiologies, and the identification of these asthma endotypes is critical to accurately define the most susceptible subpopula...

  16. Identifiability of Additive Actuator and Sensor Faults by State Augmentation

    Science.gov (United States)

    Joshi, Suresh; Gonzalez, Oscar R.; Upchurch, Jason M.

    2014-01-01

    A class of fault detection and identification (FDI) methods for bias-type actuator and sensor faults is explored in detail from the point of view of fault identifiability. The methods use state augmentation along with banks of Kalman-Bucy filters for fault detection, fault pattern determination, and fault value estimation. A complete characterization of conditions for identifiability of bias-type actuator faults, sensor faults, and simultaneous actuator and sensor faults is presented. It is shown that FDI of simultaneous actuator and sensor faults is not possible using these methods when all sensors have unknown biases. The fault identifiability conditions are demonstrated via numerical examples. The analytical and numerical results indicate that caution must be exercised to ensure fault identifiability for different fault patterns when using such methods.

  17. Genetic Screens in Yeast to Identify BRCA1 Modifiers

    National Research Council Canada - National Science Library

    Plon, Sharon E

    2005-01-01

    .... The yeast RAD9 protein has similar functions and sequence motifs as BRCA1 and we proposed to identify haploinsufficient mutations at a second locus that alters the chromosome loss rate of our rad9-/- diploid strains...

  18. Identifying Importance-Performance Matrix Analysis (IPMA) of ...

    African Journals Online (AJOL)

    Identifying Importance-Performance Matrix Analysis (IPMA) of intellectual capital and Islamic work ethics in Malaysian SMES. ... capital and Islamic work ethics significantly influenced business performance. ... AJOL African Journals Online.

  19. A novel stroke locus identified in a northern Sweden pedigree

    DEFF Research Database (Denmark)

    Janunger, T.; Nilsson-Ardnor, S.; Wiklund, P.-G.

    2009-01-01

    OBJECTIVES: The population of northern Sweden is characterized by reduced genetic diversity and a high incidence of stroke. We sought to reduce genetic variation further, using genealogic analysis in a set of nuclear families affected by stroke, and we subsequently performed a genome-wide scan...... to identify novel stroke susceptibility loci. METHODS: Through genealogy, 7 nuclear families with a common ancestor, connected over 8 generations, were identified. A genome-wide scan using 449 microsatellite markers was performed with subsequent haplotype analyses. RESULTS: A maximum allele-sharing lod score...... of 4.81 on chromosome 9q31-q33 was detected. Haplotype analysis identified a common 2.2-megabase interval in the chromosomal region in 4 of the nuclear families, where an overrepresentation of intracerebral hemorrhage was observed. CONCLUSIONS: We have identified a novel susceptibility locus for stroke...

  20. Identifying victims of violence using register-based data

    DEFF Research Database (Denmark)

    Kruse, Marie; Sørensen, Jan; Brønnum-Hansen, Henrik

    2010-01-01

    AIMS: The aim of this study was twofold. Firstly we identified victims of violence in national registers and discussed strengths and weaknesses of this approach. Secondly we assessed the magnitude of violence and the characteristics of the victims using register-based data. METHODS: We used three...... nationwide registers to identify victims of violence: The National Patient Register, the Victim Statistics, and the Causes of Death Register. We merged these data and assessed the degree of overlap between data sources. We identified a reference population by selecting all individuals in Denmark over 15....... RESULTS: In 2006, 22,000 individuals were registered as having been exposed to violence. About 70% of these victims were men. Most victims were identified from emergency room contacts and police records, and few from the Causes of Death Register. There was some overlap between the two large data sources...

  1. Identifying Factors for Worker Motivation in Zambia's Rural Health Facilities.

    Science.gov (United States)

    Cross, Samuel S; Baernholdt, Dr Marianne

    2017-01-01

    Within Zambia there is a shortage of health workers in rural areas. This study aims to identify motivating factors for retaining rural health workers. Sixty rural health workers completed surveys and 46 were interviewed. They rated the importance of six motivating factors and discussed these and other factors in interviews. An interview was conducted with a Government Human Resources Manager (HR Manager) to elicit contextual information. All six factors were identified as being very important motivators, as were two additional factors. Additional career training was identified by many as the most important factor. Comparison of results and the HR Manager interview revealed that workers lacked knowledge about opportunities and that the HR manager was aware of barriers to career development. The Zambian government might better motivate and retain rural health workers by offering them any combination of identified factors, and by addressing the barriers to career development.

  2. 40 CFR 255.10 - Criteria for identifying regions.

    Science.gov (United States)

    2010-07-01

    ... institutional gaps or inadequacies are found, regions should be identified keeping in mind which agencies would... section 208 of the Federal Water Pollution Control Act, with underground injection control agencies...

  3. Novel lipid constituents identified in seeds of Nigella sativa (Linn)

    Energy Technology Data Exchange (ETDEWEB)

    Mehta, B.K.; Verma, Manjul; Gupta, Meenal [Vikram University (India). School of Studies in Chemistry and Biochemistry]. E-mail: bkmehta11@yahoo.com

    2008-07-01

    Novel lipids were isolated from the unsaponifiable matter extracted from seeds of Nigella sativa Linn by using n-hexane. The new dienoate and two monoesters were the new lipids identified by spectral (IR, {sup 1}H- and {sup 13}C-NMR spectra, mass spectrum, elemental analysis) and chemical analysis. The dienoate (1) was identified as methylnonadeca-15,17-dienoate and two monoesters were identified as pentyl hexadec-12-enoate (2) and pentyl pentadec-11-enoate (3). Linoleic acid, oleic acid, {beta}-sitosterol and stigmasterol were identified as part of the lipid structures. All compounds exhibited moderate activity against Staphylococcus aureus and poor activity against shigella spp, and Klebsiella pneumoniae. (author)

  4. Expression profiling identifies genes involved in emphysema severity

    Directory of Open Access Journals (Sweden)

    Bowman Rayleen V

    2009-09-01

    Full Text Available Abstract Chronic obstructive pulmonary disease (COPD is a major public health problem. The aim of this study was to identify genes involved in emphysema severity in COPD patients. Gene expression profiling was performed on total RNA extracted from non-tumor lung tissue from 30 smokers with emphysema. Class comparison analysis based on gas transfer measurement was performed to identify differentially expressed genes. Genes were then selected for technical validation by quantitative reverse transcriptase-PCR (qRT-PCR if also represented on microarray platforms used in previously published emphysema studies. Genes technically validated advanced to tests of biological replication by qRT-PCR using an independent test set of 62 lung samples. Class comparison identified 98 differentially expressed genes (p p Gene expression profiling of lung from emphysema patients identified seven candidate genes associated with emphysema severity including COL6A3, SERPINF1, ZNHIT6, NEDD4, CDKN2A, NRN1 and GSTM3.

  5. Guidance for Identifying, Selecting and Evaluating Open Literature Studies

    Science.gov (United States)

    This guidance for Office of Pesticide Program staff will assist in their evaluation of open literature studies of pesticides. It also describes how we identify, select, and ensure that data we use in risk assessments is of sufficient scientific quality.

  6. TCGA study identifies genomic features of cervical cancer

    Science.gov (United States)

    Investigators with The Cancer Genome Atlas (TCGA) Research Network have identified novel genomic and molecular characteristics of cervical cancer that will aid in subclassification of the disease and may help target therapies that are most appropriate for each patient.

  7. The valuation of nursing begins with identifying value drivers.

    Science.gov (United States)

    Rutherford, Marcella M

    2010-03-01

    Adequate investment in a profession links to its ability to define and document its value. This requires identifying those elements or value drivers that demonstrate its worth. To completely identify nursing's value drivers requires meshing the economic, technical, and caring aspects of its profession. Nursing's valuation includes assessing nursing's tangible and intangible assets and documenting these assets. This information communicates nursing's worth and ensures adequate economic investment in its services.

  8. IDENTIFYING COMPETENCIES OF VOLUNTEER BOARD MEMBERS OF COMMUNITY SPORTS CLUBS

    OpenAIRE

    A. BALDUCK; A. VAN ROSSEM; M. BUELENS

    2009-01-01

    This study contributes to the emerging empirical studies on roles and responsibilities of boards in nonprofit organizations by identifying competencies of volunteer board members. We identified how two types of constituents—volunteer board members and sports members—perceived competencies of volunteer board members in community sports clubs. We used the repertory grid technique to draw cognitive maps and to reveal the perceived reality of these constituents. Our results suggest that constitue...

  9. Use of DNA barcodes to identify flowering plants

    OpenAIRE

    Kress, W. John; Wurdack, Kenneth J.; Zimmer, Elizabeth A.; Weigt, Lee A.; Janzen, Daniel H.

    2005-01-01

    Methods for identifying species by using short orthologous DNA sequences, known as “DNA barcodes,” have been proposed and initiated to facilitate biodiversity studies, identify juveniles, associate sexes, and enhance forensic analyses. The cytochrome c oxidase 1 sequence, which has been found to be widely applicable in animal barcoding, is not appropriate for most species of plants because of a much slower rate of cytochrome c oxidase 1 gene evolution in higher plants than in animals. We ther...

  10. Communication difficulties in children identified with psychiatric problems

    OpenAIRE

    Helland, Wenche Andersen

    2010-01-01

    Several studies have pointed to an overlap between different developmental psychopathological conditions and language impairments, and difficulties with communication have been identified in children of various diagnostic backgrounds. This thesis is based on three empirical studies, and the purposes are to investigate communication difficulties as reported by parents, in children identified with psychiatric problems as well as to evaluate a Norwegian adaptation of the Children’...

  11. A Note on the Identifiability of Generalized Linear Mixed Models

    DEFF Research Database (Denmark)

    Labouriau, Rodrigo

    2014-01-01

    I present here a simple proof that, under general regularity conditions, the standard parametrization of generalized linear mixed model is identifiable. The proof is based on the assumptions of generalized linear mixed models on the first and second order moments and some general mild regularity...... conditions, and, therefore, is extensible to quasi-likelihood based generalized linear models. In particular, binomial and Poisson mixed models with dispersion parameter are identifiable when equipped with the standard parametrization...

  12. IDENTIFYING DEMENTIA IN ELDERLY POPULATION : A CAMP APPROACH

    OpenAIRE

    Anand P; Chaukimath; Srikanth; Koli

    2015-01-01

    BACKGROUND: Dementia is an emerging medico social problem affecting elderly, and poses a challenge to clinician and caregivers. It is usually identified in late stage where management becomes difficult. AIM: The aim of camp was to identify dementia in elderly population participating in screening camp. MATERIAL AND METHODS : The geriatric clinic and department of psychiatry jointly organised screening camp to detect dementia in elderly for five days in Sept...

  13. Identifying Cancer Driver Genes Using Replication-Incompetent Retroviral Vectors

    Directory of Open Access Journals (Sweden)

    Victor M. Bii

    2016-10-01

    Full Text Available Identifying novel genes that drive tumor metastasis and drug resistance has significant potential to improve patient outcomes. High-throughput sequencing approaches have identified cancer genes, but distinguishing driver genes from passengers remains challenging. Insertional mutagenesis screens using replication-incompetent retroviral vectors have emerged as a powerful tool to identify cancer genes. Unlike replicating retroviruses and transposons, replication-incompetent retroviral vectors lack additional mutagenesis events that can complicate the identification of driver mutations from passenger mutations. They can also be used for almost any human cancer due to the broad tropism of the vectors. Replication-incompetent retroviral vectors have the ability to dysregulate nearby cancer genes via several mechanisms including enhancer-mediated activation of gene promoters. The integrated provirus acts as a unique molecular tag for nearby candidate driver genes which can be rapidly identified using well established methods that utilize next generation sequencing and bioinformatics programs. Recently, retroviral vector screens have been used to efficiently identify candidate driver genes in prostate, breast, liver and pancreatic cancers. Validated driver genes can be potential therapeutic targets and biomarkers. In this review, we describe the emergence of retroviral insertional mutagenesis screens using replication-incompetent retroviral vectors as a novel tool to identify cancer driver genes in different cancer types.

  14. IDENTIFYING DEMENTIA IN ELDERLY POPULATION : A CAMP APPROACH

    Directory of Open Access Journals (Sweden)

    Anand P

    2015-06-01

    Full Text Available BACKGROUND: Dementia is an emerging medico social problem affecting elderly, and poses a challenge to clinician and caregivers. It is usually identified in late stage where management becomes difficult. AIM: The aim of camp was to identify dementia in elderly population participating in screening camp. MATERIAL AND METHODS : The geriatric clinic and department of psychiatry jointly organised screening camp to detect dementia in elderly for five days in September 2014 to commemorate world Alzheimer’s day. The invitation regarding camp was sent to all senio r citizen forums and also published in leading Kannada daily newspaper. Mini Mental Status Examination and Diagnostic and Statistical Manual of Mental Disorders, 4 th edition criteria (DSM IV was used to identify dementia. RESULTS: Elderly male participate d in camp in more number than females and dementia was identified in 36% elderly with education less than 9 th standard. Dementia was found in 18% in our study population. CONCLUSION: The camp help identify elderly suffering from dementia and also created a wareness about it. Hypertension and diabetes mellitus were common co morbidity in study population. Our study suggested organising screening camp will help identify elderly living with dementia.

  15. Improving applicant selection: identifying qualities of the unsuccessful otolaryngology resident.

    Science.gov (United States)

    Badran, Karam W; Kelley, Kanwar; Conderman, Christian; Mahboubi, Hossein; Armstrong, William B; Bhandarkar, Naveen D

    2015-04-01

    To identify the prevalence and management of problematic residents. Additionally, we hope to identify the factors associated with successful remediation of unsuccessful otolaryngology residents. Self-reported Internet and paper-based survey. An anonymous survey was distributed to 152 current and former program directors (PDs) in 2012. The factors associated with unsuccessful otolaryngology residents and those associated with the successful remediation of problematic residents were investigated. An unsuccessful resident is defined as one who quit or was removed from the program for any reason, or one whose actions resulted in criminal action or citation against their medical license after graduation from residency. Remediation is defined as an individualized program implemented to correct documented weaknesses. The overall response rate was 26% (40 PDs). Seventy-three unsuccessful or problematic residents were identified. Sixty-six problematic or unsuccessful residents were identified during residency, with 58 of 66 (88%) undergoing remediation. Thirty-one (47%) residents did not graduate. The most commonly identified factors of an unsuccessful resident were: change in specialty (21.5%), interpersonal and communication skills with health professionals (13.9%), and clinical judgment (10.1%). Characteristics of those residents who underwent successful remediation include: poor performance on in-training examination (17%, P otolaryngology PDs in this sample identified at least one unsuccessful resident. Improved methods of applicant screening may assist in optimizing otolaryngology resident selection. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.

  16. IDGenerator: unique identifier generator for epidemiologic or clinical studies

    Directory of Open Access Journals (Sweden)

    Matthias Olden

    2016-09-01

    Full Text Available Abstract Background Creating study identifiers and assigning them to study participants is an important feature in epidemiologic studies, ensuring the consistency and privacy of the study data. The numbering system for identifiers needs to be random within certain number constraints, to carry extensions coding for organizational information, or to contain multiple layers of numbers per participant to diversify data access. Available software can generate globally-unique identifiers, but identifier-creating tools meeting the special needs of epidemiological studies are lacking. We have thus set out to develop a software program to generate IDs for epidemiological or clinical studies. Results Our software IDGenerator creates unique identifiers that not only carry a random identifier for a study participant, but also support the creation of structured IDs, where organizational information is coded into the ID directly. This may include study center (for multicenter-studies, study track (for studies with diversified study programs, or study visit (baseline, follow-up, regularly repeated visits. Our software can be used to add a check digit to the ID to minimize data entry errors. It facilitates the generation of IDs in batches and the creation of layered IDs (personal data ID, study data ID, temporary ID, external data ID to ensure a high standard of data privacy. The software is supported by a user-friendly graphic interface that enables the generation of IDs in both standard text and barcode 128B format. Conclusion Our software IDGenerator can create identifiers meeting the specific needs for epidemiologic or clinical studies to facilitate study organization and data privacy. IDGenerator is freeware under the GNU General Public License version 3; a Windows port and the source code can be downloaded at the Open Science Framework website: https://osf.io/urs2g/ .

  17. Two statistics for evaluating parameter identifiability and error reduction

    Science.gov (United States)

    Doherty, John; Hunt, Randall J.

    2009-01-01

    Two statistics are presented that can be used to rank input parameters utilized by a model in terms of their relative identifiability based on a given or possible future calibration dataset. Identifiability is defined here as the capability of model calibration to constrain parameters used by a model. Both statistics require that the sensitivity of each model parameter be calculated for each model output for which there are actual or presumed field measurements. Singular value decomposition (SVD) of the weighted sensitivity matrix is then undertaken to quantify the relation between the parameters and observations that, in turn, allows selection of calibration solution and null spaces spanned by unit orthogonal vectors. The first statistic presented, "parameter identifiability", is quantitatively defined as the direction cosine between a parameter and its projection onto the calibration solution space. This varies between zero and one, with zero indicating complete non-identifiability and one indicating complete identifiability. The second statistic, "relative error reduction", indicates the extent to which the calibration process reduces error in estimation of a parameter from its pre-calibration level where its value must be assigned purely on the basis of prior expert knowledge. This is more sophisticated than identifiability, in that it takes greater account of the noise associated with the calibration dataset. Like identifiability, it has a maximum value of one (which can only be achieved if there is no measurement noise). Conceptually it can fall to zero; and even below zero if a calibration problem is poorly posed. An example, based on a coupled groundwater/surface-water model, is included that demonstrates the utility of the statistics. ?? 2009 Elsevier B.V.

  18. Identifying risk event in Indonesian fresh meat supply chain

    Science.gov (United States)

    Wahyuni, H. C.; Vanany, I.; Ciptomulyono, U.

    2018-04-01

    The aim of this paper is to identify risk issues in Indonesian fresh meat supply chain from the farm until to the “plate”. The critical points for food safety in physical fresh meat product flow are also identified. The paper employed one case study in the Indonesian fresh meat company by conducting observations and in-depth three stages of interviews. At the first interview, the players, process, and activities in the fresh meat industry were identified. In the second interview, critical points for food safety were recognized. The risk events in each player and process were identified in the last interview. The research will be conducted in three stages, but this article focuses on risk identification process (first stage) only. The second stage is measuring risk and the third stage focuses on determining the value of risk priority. The results showed that there were four players in the fresh meat supply chain: livestock (source), slaughter (make), distributor and retail (deliver). Each player has different activities and identified 16 risk events in the fresh meat supply chain. Some of the strategies that can be used to reduce the occurrence of such risks include improving the ability of laborers on food safety systems, improving cutting equipment and distribution processes

  19. Fungi identify the geographic origin of dust samples.

    Directory of Open Access Journals (Sweden)

    Neal S Grantham

    Full Text Available There is a long history of archaeologists and forensic scientists using pollen found in a dust sample to identify its geographic origin or history. Such palynological approaches have important limitations as they require time-consuming identification of pollen grains, a priori knowledge of plant species distributions, and a sufficient diversity of pollen types to permit spatial or temporal identification. We demonstrate an alternative approach based on DNA sequencing analyses of the fungal diversity found in dust samples. Using nearly 1,000 dust samples collected from across the continental U.S., our analyses identify up to 40,000 fungal taxa from these samples, many of which exhibit a high degree of geographic endemism. We develop a statistical learning algorithm via discriminant analysis that exploits this geographic endemicity in the fungal diversity to correctly identify samples to within a few hundred kilometers of their geographic origin with high probability. In addition, our statistical approach provides a measure of certainty for each prediction, in contrast with current palynology methods that are almost always based on expert opinion and devoid of statistical inference. Fungal taxa found in dust samples can therefore be used to identify the origin of that dust and, more importantly, we can quantify our degree of certainty that a sample originated in a particular place. This work opens up a new approach to forensic biology that could be used by scientists to identify the origin of dust or soil samples found on objects, clothing, or archaeological artifacts.

  20. SitesIdentify: a protein functional site prediction tool

    Directory of Open Access Journals (Sweden)

    Doig Andrew J

    2009-11-01

    Full Text Available Abstract Background The rate of protein structures being deposited in the Protein Data Bank surpasses the capacity to experimentally characterise them and therefore computational methods to analyse these structures have become increasingly important. Identifying the region of the protein most likely to be involved in function is useful in order to gain information about its potential role. There are many available approaches to predict functional site, but many are not made available via a publicly-accessible application. Results Here we present a functional site prediction tool (SitesIdentify, based on combining sequence conservation information with geometry-based cleft identification, that is freely available via a web-server. We have shown that SitesIdentify compares favourably to other functional site prediction tools in a comparison of seven methods on a non-redundant set of 237 enzymes with annotated active sites. Conclusion SitesIdentify is able to produce comparable accuracy in predicting functional sites to its closest available counterpart, but in addition achieves improved accuracy for proteins with few characterised homologues. SitesIdentify is available via a webserver at http://www.manchester.ac.uk/bioinformatics/sitesidentify/