Polycomb Group Proteins RING1A and RING1B Regulate the Vegetative Phase Transition in Arabidopsis
Directory of Open Access Journals (Sweden)
Jian Li
2017-05-01
Full Text Available Polycomb group (PcG protein-mediated gene silencing is a major regulatory mechanism in higher eukaryotes that affects gene expression at the transcriptional level. Here, we report that two conserved homologous PcG proteins, RING1A and RING1B (RING1A/B, are required for global H2A monoubiquitination (H2Aub in Arabidopsis. The mutation of RING1A/B increased the expression of members of the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL gene family and caused an early vegetative phase transition. The early vegetative phase transition observed in ring1a ring1b double mutant plants was dependent on an SPL family gene, and the H2Aub status of the chromatin at SPL locus was dependent on RING1A/B. Moreover, mutation in RING1A/B affected the miRNA156a-mediated vegetative phase transition, and RING1A/B and the AGO7-miR390-TAS3 pathway were found to additively regulate this transition in Arabidopsis. Together, our results demonstrate that RING1A/B regulates the vegetative phase transition in Arabidopsis through the repression of SPL family genes.
Balasubramanian, Sivaprakasam; Scharadin, Tiffany M.; Han, Bingshe; Xu, Wen; Eckert, Richard L.
2016-01-01
The Bmi-1 Polycomb group (PcG) protein is an important epigenetic regulator of chromatin status. Elevated Bmi-1 expression is observed in skin cancer and contributes to cancer cell survival. (–) Epigallocatechin-3-gallate (EGCG), an important green tea-derived cancer prevention agent, reduces Bmi-1 level resulting in reduced skin cancer cell survival. This is associated with increased p21Cip1 and p27Kip1 expression, reduced cyclin, and cyclin dependent kinase expression, and increased cleavage of apoptotic markers. These EGCG-dependent changes are attenuated by vector-mediated maintenance of Bmi-1 expression. In the present study, we identify Bmi-1 functional domains that are required for this response. Bmi-1 expression reverses the EGCG-dependent reduction in SCC-13 cell survival, but Bmi-1 mutants lacking the helix–turn–helix–turn–helix–turn (Bmi-1ΔHT) or ring finger (Bmi-1ΔRF) domains do not reverse the EGCG impact. The reduction in Ring1B ubiquitin ligase activity, observed in the presence of mutant Bmi-1, is associated with reduced ability of these mutants to interact with and activate Ring1B ubiquitin ligase, the major ligase responsible for the ubiquitination of histone H2A during chromatin condensation. This results in less chromatin condensation leading to increased tumor suppressor gene expression and reduced cell survival; thereby making the cells more susceptible to the anti-survival action of EGCG. We further show that these mutants act in a dominant-negative manner to inhibit the action of endogenous Bmi-1. Our results suggest that the HT and RF domains are required for Bmi-1 ability to maintain skin cancer cell survival in response to cancer preventive agents. PMID:25843776
Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.
Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D
2007-07-01
Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.
Targeting MUC1-C suppresses polycomb repressive complex 1 in multiple myeloma.
Tagde, Ashujit; Markert, Tahireh; Rajabi, Hasan; Hiraki, Masayuki; Alam, Maroof; Bouillez, Audrey; Avigan, David; Anderson, Kenneth; Kufe, Donald
2017-09-19
The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM cell survival. The present studies show that targeting MUC1-C with (i) stable and inducible silencing and CRISPR/Cas9 editing and (ii) the pharmacologic inhibitor GO-203, which blocks MUC1-C function, downregulates BMI1, RING1 and RING2 expression. The results demonstrate that MUC1-C drives BMI1 transcription by a MYC-dependent mechanism. MUC1-C thus promotes MYC occupancy on the BMI1 promoter and thereby activates BMI1 expression. We also show that the MUC1-C→MYC pathway induces RING2 expression. Moreover, in contrast to BMI1 and RING2, we found that MUC1-C drives RING1 by an NF-κB p65-dependent mechanism. Targeting MUC1-C and thereby the suppression of these key PRC1 proteins was associated with downregulation of the PRC1 E3 ligase activity as evidenced by decreases in ubiquitylation of histone H2A. Targeting MUC1-C also resulted in activation of the PRC1-repressed tumor suppressor genes, PTEN, CDNK2A and BIM . These findings identify a heretofore unrecognized role for MUC1-C in the epigenetic regulation of MM cells.
Directory of Open Access Journals (Sweden)
James eReynolds
2015-03-01
Full Text Available Exposure of the brain to brief, non-harmful seizures can activate protective mechanisms that temporarily generate a damage-refractory state. This process, termed epileptic tolerance, is associated with large-scale down-regulation of gene expression. Polycomb group proteins are master controllers of gene silencing during development that are re-activated by injury to the brain. Here we explored the transcriptional response of genes associated with polycomb repressor complex (PRC 1 (Ring1A and Ring1B and Bmi1 and PRC2 (Ezh1, Ezh2 and Suz12, as well as additional transcriptional regulators Sirt1, Yy1 and Yy2, in a mouse model of status epilepticus. Findings were contrasted to changes after status epilepticus in mice previously given brief seizures to evoke tolerance. Real-time quantitative PCR showed status epilepticus prompted an early (1 h increase in expression of several genes in PRC1 and PRC2 in the hippocampus, followed by down-regulation of many of the same genes at later times points (4 , 8 and 24 h. Spatio-temporal differences were found among PRC2 genes in epileptic tolerance, including increased expression of Ezh2, Suz12 and Yy2 relative to the normal injury response to status epilepticus. In contrast, PRC1 complex genes including Ring 1B and Bmi1 displayed differential down-regulation in epileptic tolerance. The present study characterizes polycomb group gene expression following status epilepticus and shows prior seizure exposure produces select changes to PRC1 and PRC2 composition that may influence differential gene expression in epileptic tolerance.
Wong, Sarah J.; Gearhart, Micah D.; Taylor, Alexander B.; Nanyes, David R.; Ha, Daniel J.; Robinson, Angela K.; Artigas, Jason A.; Lee, Oliver J.; Demeler, Borries; Hart, P. John; Bardwell, Vivian J.; Kim, Chongwoo A.
2016-01-01
KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and the ...
Lineage specific expression of Polycomb Group Proteins in human embryonic stem cells in vitro.
Pethe, Prasad; Pursani, Varsha; Bhartiya, Deepa
2015-05-01
Human embryonic (hES) stem cells are an excellent model to study lineage specification and differentiation into various cell types. Differentiation necessitates repression of specific genes not required for a particular lineage. Polycomb Group (PcG) proteins are key histone modifiers, whose primary function is gene repression. PcG proteins form complexes called Polycomb Repressive Complexes (PRCs), which catalyze histone modifications such as H2AK119ub1, H3K27me3, and H3K9me3. PcG proteins play a crucial role during differentiation of stem cells. The expression of PcG transcripts during differentiation of hES cells into endoderm, mesoderm, and ectoderm lineage is yet to be shown. In-house derived hES cell line KIND1 was differentiated into endoderm, mesoderm, and ectoderm lineages; followed by characterization using RT-PCR for HNF4A, CDX2, MEF2C, TBX5, SOX1, and MAP2. qRT-PCR and western blotting was performed to compare expression of PcG transcripts and proteins across all the three lineages. We observed that cells differentiated into endoderm showed upregulation of RING1B, BMI1, EZH2, and EED transcripts. Mesoderm differentiation was characterized by significant downregulation of all PcG transcripts during later stages. BMI1 and RING1B were upregulated while EZH2, SUZ12, and EED remained low during ectoderm differentiation. Western blotting also showed distinct expression of BMI1 and EZH2 during differentiation into three germ layers. Our study shows that hES cells differentiating into endoderm, mesoderm, and ectoderm lineages show distinct PcG expression profile at transcript and protein level. © 2015 International Federation for Cell Biology.
Wong, Sarah J; Gearhart, Micah D; Taylor, Alexander B; Nanyes, David R; Ha, Daniel J; Robinson, Angela K; Artigas, Jason A; Lee, Oliver J; Demeler, Borries; Hart, P John; Bardwell, Vivian J; Kim, Chongwoo A
2016-10-04
KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes, and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA-binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and PCGF1, a core component of PRC1.1. The crystal structure of the KDM2B/SKP1/BCORL1/PCGF1 complex illustrates the crucial role played by the PCGF1/BCORL1 heterodimer. The BCORL1 PUFD domain positions residues preceding the RAWUL domain of PCGF1 to create an extended interface for interaction with KDM2B, which is unique to the PCGF1-containing PRC1.1 complex. The structure also suggests how KDM2B might simultaneously function in PRC1.1 and an SCF ubiquitin ligase complex and the possible molecular consequences of BCOR PUFD internal tandem duplications found in pediatric kidney and brain tumors. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Justin W Leung
2014-03-01
Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.
2017-10-01
that inhibiting BMI1 decreased prostate cancer tumor growth in VCaP murine xenograft. 15. SUBJECT TERMS: Polycomb, BMI1, Androgen Receptor ...Repressive Complex, Androgen Receptor , Castration- Resistant Prostate Cancer , small molecule inhibitor 4 ACCOMPLISHMENTS A. What were the major...Qi Cao. A Novel Role of BMI1 in Androgen Receptor Pathway. 23rd Prostate Cancer Foundation Annual Scientific Retreat, Oct 26-29, 2016, Carlsbad, CA
BMI-1, a promising therapeutic target for human cancer
WANG, MIN-CONG; LI, CHUN-LI; CUI, JIE; JIAO, MIN; WU, TAO; JING, LI; NAN, KE-JUN
2015-01-01
BMI-1 oncogene is a member of the polycomb-group gene family and a transcriptional repressor. Overexpression of BMI-1 has been identified in various human cancer tissues and is known to be involved in cancer cell proliferation, cell invasion, distant metastasis, chemosensitivity and patient survival. Accumulating evidence has revealed that BMI-1 is also involved in the regulation of self-renewal, differentiation and tumor initiation of cancer stem cells (CSCs). However, the molecular mechanisms underlying these biological processes remain unclear. The present review summarized the function of BMI-1 in different human cancer types and CSCs, and discussed the signaling pathways in which BMI-1 is potentially involved. In conclusion, BMI-1 may represent a promising target for the prevention and therapy of various cancer types. PMID:26622537
EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer
Pietersen, Alexandra M.; Horlings, Hugo M.; Hauptmann, Michael; Langerod, Anita; Ajouaou, Abderrahim; Cornelissen-Steijger, Paulien; Wessels, Lodewijk F.; Jonkers, Jos; van de Vijver, Marc J.; van Lohuizen, Maarten
2008-01-01
Introduction PolycombGroup (PcG) proteins maintain gene repression through histone modifications and have been implicated in stem cell regulation and cancer. EZH2 is part of Polycomb Repressive Complex 2 (PRC2) and trimethylates H3K27. This histone mark recruits the BMI1-containing PRC1 that
Bmi1 confers resistance to oxidative stress on hematopoietic stem cells.
Directory of Open Access Journals (Sweden)
Shunsuke Nakamura
Full Text Available The polycomb-group (PcG proteins function as general regulators of stem cells. We previously reported that retrovirus-mediated overexpression of Bmi1, a gene encoding a core component of polycomb repressive complex (PRC 1, maintained self-renewing hematopoietic stem cells (HSCs during long-term culture. However, the effects of overexpression of Bmi1 on HSCs in vivo remained to be precisely addressed.In this study, we generated a mouse line where Bmi1 can be conditionally overexpressed under the control of the endogenous Rosa26 promoter in a hematopoietic cell-specific fashion (Tie2-Cre;R26Stop(FLBmi1. Although overexpression of Bmi1 did not significantly affect steady state hematopoiesis, it promoted expansion of functional HSCs during ex vivo culture and efficiently protected HSCs against loss of self-renewal capacity during serial transplantation. Overexpression of Bmi1 had no effect on DNA damage response triggered by ionizing radiation. In contrast, Tie2-Cre;R26Stop(FLBmi1 HSCs under oxidative stress maintained a multipotent state and generally tolerated oxidative stress better than the control. Unexpectedly, overexpression of Bmi1 had no impact on the level of intracellular reactive oxygen species (ROS.Our findings demonstrate that overexpression of Bmi1 confers resistance to stresses, particularly oxidative stress, onto HSCs. This thereby enhances their regenerative capacity and suggests that Bmi1 is located downstream of ROS signaling and negatively regulated by it.
DEFF Research Database (Denmark)
Vandamme, Julien; Völkel, Pamela; Rosnoblet, Claire
2011-01-01
Polycomb group (PcG) proteins maintain transcriptional repression of hundreds of genes involved in development, signaling or cancer using chromatin-based epigenetic mechanisms. Biochemical studies in Drosophila have revealed that PcG proteins associate in at least two classes of protein complexes...... known as Polycomb repressive complexes 1 and 2 (PRC1 and PRC2). Drosophila core PRC1 is composed of four subunits, Polycomb (Pc), Sex combs extra (Sce), Polyhomeotic (Ph), and Posterior sex combs (Psc). Each of these proteins has multiple orthologs in vertebrates classified respectively as the CBX, RING...... in order to identify interacting partners of CBX family proteins under the same experimental conditions. Our analysis identified with high confidence about 20 proteins co-eluted with CBX2 and CBX7 tagged proteins, about 40 with CBX4, and around 60 with CBX6 and CBX8. We provide evidences that the CBX...
Petrov, N S; Vereschagina, N A; Sushilova, E N; Kropotov, A V; Miheeva, N F; Popov, B V
2016-01-01
Bmil is a key component of Polycomb (PcG), which in mammals controls the basic functions of mammalian somatic stem cells (SSC) such as self-renewal and differentiation. Bmi1 supports SSC via transcriptional suppression of genes associated with cell cycle and differentiation. The most studied target genes of Bmi1 are the genes of Ink4 locus, CdkI p16(Ink4a) and p1(Arf), suppression of which due to activating mutations of the BMI1 results in formation of cancer stem cells (CSC) and carcinomas in various tissues. In contrast, inactivation of BMI1 results in cell cycle arrest and cell senescence. Although clinical phenomena of hypo- and hyperactivation of BMI1 are well known, its targets and mechanisms of regulation of tissue specific SSC are still obscure. The goal of this study was to evaluate the regulatory role of BMI1 in adipocyte differentiation (AD) of mouse mesenchymal stem cells (MSC). Induction of AD in mouse MSC of the C3H10T1/2 cell line was associated with an increase in the expression levels of BMI1, the genes of pRb family (RB, p130) and demethylase UTX, but not methyltransferase EZH2, whose products regulate the methylation levels of H3K27. It was observed earlier that H3K27me3 may play the role of the epigenetic switch by promoting AD of human MSC via activating expression of the PPARγ2, the master gene of AD (Hemming et al., 2014). Here we show that inactivation of BMI1 using specific siRNA slows and decreases the levels of AD, but does not abolish it. This is associated with a complete inhibition of the expression of adipogenic marker genes--PPARγ2, ADIPOQ and a decrease in the expression of RB, p130, but not UTX. The results obtained give evidence that the epigenetic mechanism regulating AD differentiation in mouse and human MSC is different.
Directory of Open Access Journals (Sweden)
Frank Spaapen
Full Text Available Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3 blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis.
Energy Technology Data Exchange (ETDEWEB)
Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)
2015-01-02
Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.
Polycomb group protein-mediated repression of transcription
DEFF Research Database (Denmark)
Morey, Lluís; Helin, Kristian
2010-01-01
The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work as transcri......The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work...... as transcriptional repressors is incompletely understood, but involves post-translational modifications of histones by two major PcG protein complexes: polycomb repressive complex 1 and polycomb repressive complex 2....
Bruggeman, SWM; Valk-Lingbeek, ME; van der Stoop, PPM; Jacobs, JJL; Kieboom, K; Tanger, E; Hulsman, D; Leung, C; Arsenijevic, Y; Marino, S; van Lohuizen, M
2005-01-01
The Polycomb group (PcG) gene Bmi1 promotes cell proliferation and stem cell self-renewal by repressing the Ink4a/Arf locus. We used a genetic approach to investigate whether Ink4a or Arf is more critical for relaying Bmi1 function in lymphoid cells, neural progenitors, and neural stem cells. We
Directory of Open Access Journals (Sweden)
Cristina Bartocci
2014-05-01
Full Text Available When telomeres become critically short, DNA damage response factors are recruited at chromosome ends, initiating a cellular response to DNA damage. We performed proteomic isolation of chromatin fragments (PICh in order to define changes in chromatin composition that occur upon onset of acute telomere dysfunction triggered by depletion of the telomere-associated factor TRF2. This unbiased purification of telomere-associated proteins in functional or dysfunctional conditions revealed the dynamic changes in chromatin composition that take place at telomeres upon DNA damage induction. On the basis of our results, we describe a critical role for the polycomb group protein Ring1b in nonhomologous end-joining (NHEJ-mediated end-to-end chromosome fusions. We show that cells with reduced levels of Ring1b have a reduced ability to repair uncapped telomeric chromatin. Our data represent an unbiased isolation of chromatin undergoing DNA damage and are a valuable resource to map the changes in chromatin composition in response to DNA damage activation.
Koh, Hyebin; Park, Hyeri; Chandimali, Nisansala; Huynh, Do Luong; Zhang, Jiao Jiao; Ghosh, Mrinmoy; Gera, Meeta; Kim, Nameun; Bak, Yesol; Yoon, Do-Young; Park, Yang Ho; Kwon, Taeho; Jeong, Dong Kee
2017-12-15
The existence of cancer stem cells (CSCs) is the main reason for failure of cancer treatment caused by drug resistance. Therefore, eradicating cancers by targeting CSCs remains a significant challenge. In the present study, because of the important role of BMI-1 proto-oncogene, polycomb ring finger (BMI-1) and C-terminal Mucin1 (MUC1-C) in tumor growth and maintenance of CSCs, we aimed to confirm that microRNA miR-128, as an inhibitor of BMI-1 and MUC1-C, could effectively suppress paclitaxel (PTX)-resistant lung cancer stem cells. We showed that CSCs have significantly higher expression levels of BMI-1, MUC1-C, stemness proteins, signaling factors, and higher malignancy compared with normal tumor cells. After transfection with miR-128, the BMI-1 and MUC1-C levels in CSCs were suppressed. When miR-128 was stably expressed in PTX-resistant lung cancer stem cells, the cells showed decreased proliferation, metastasis, self-renewal, migration, invasive ability, clonogenicity, and tumorigenicity in vitro and in vivo and increased apoptosis compared with miR-NC (negative control) CSCs. Furthermore, miR-128 effectively decreased the levels of β-catenin and intracellular signaling pathway-related factors in CSCs. MiR-128 also decreased the luciferase activity of MUC1 reporter constructs and reduced the levels of transmembrane MUC1-C and BMI-1. These results suggested miR-128 as an attractive therapeutic strategy for PTX-resistant lung cancer via inhibition of BMI-1 and MUC1-C.
Cardiac Bmi1(+) cells contribute to myocardial renewal in the murine adult heart.
Valiente-Alandi, Iñigo; Albo-Castellanos, Carmen; Herrero, Diego; Arza, Elvira; Garcia-Gomez, Maria; Segovia, José C; Capecchi, Mario; Bernad, Antonio
2015-10-26
The mammalian adult heart maintains a continuous, low cardiomyocyte turnover rate throughout life. Although many cardiac stem cell populations have been studied, the natural source for homeostatic repair has not yet been defined. The Polycomb protein BMI1 is the most representative marker of mouse adult stem cell systems. We have evaluated the relevance and role of cardiac Bmi1 (+) cells in cardiac physiological homeostasis. Bmi1 (CreER/+);Rosa26 (YFP/+) (Bmi1-YFP) mice were used for lineage tracing strategy. After tamoxifen (TM) induction, yellow fluorescent protein (YFP) is expressed under the control of Rosa26 regulatory sequences in Bmi1 (+) cells. These cells and their progeny were tracked by FACS, immunofluorescence and RT-qPCR techniques from 5 days to 1 year. FACS analysis of non-cardiomyocyte compartment from TM-induced Bmi1-YFP mice showed a Bmi1 (+)-expressing cardiac progenitor cell (Bmi1-CPC: B-CPC) population, SCA-1 antigen-positive (95.9 ± 0.4 %) that expresses some stemness-associated genes. B-CPC were also able to differentiate in vitro to the three main cardiac lineages. Pulse-chase analysis showed that B-CPC remained quite stable for extended periods (up to 1 year), which suggests that this Bmi1 (+) population contains cardiac progenitors with substantial self-maintenance potential. Specific immunostaining of Bmi1-YFP hearts serial sections 5 days post-TM induction indicated broad distribution of B-CPC, which were detected in variably sized clusters, although no YFP(+) cardiomyocytes (CM) were detected at this time. Between 2 to 12 months after TM induction, YFP(+) CM were clearly identified (3 ± 0.6 % to 6.7 ± 1.3 %) by immunohistochemistry of serial sections and by flow cytometry of total freshly isolated CM. B-CPC also contributed to endothelial and smooth muscle (SM) lineages in vivo. High Bmi1 expression identifies a non-cardiomyocyte resident cardiac population (B-CPC) that contributes to the main lineages of the heart in
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B
2015-01-01
BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Bmi-1: At the crossroads of physiological and pathological biology
Bhattacharya, Resham; Mustafi, Soumyajit Banerjee; Street, Mark; Dey, Anindya; Dwivedi, Shailendra Kumar Dhar
2015-01-01
Bmi-1 is a member of the Polycomb Repressor Complex1 that mediates gene silencing by regulating chromatin structure and is indispensable for self-renewal of both normal and cancer stem cells. Despite three decades of research that have elucidated the transcriptional regulation, post-translational modifications and functions of Bmi-1 in regulating the DNA damage response, cellular bioenergetics, and pathologies, the entire potential of a protein with such varied function remains to be realized. This review attempts to synthesize the current knowledge on Bmi-1 with an emphasis on its role in both normal physiology and cancer. Additionally, since cancer stem cells are emerging as a new paradigm for therapy resistance, the role of Bmi-1 in this perspective is also highlighted. The wide spectrum of malignancies that implicate Bmi-1 as a signature for stemness and oncogenesis also make it a suitable candidate for therapy. Nonetheless new approaches are vitally needed to further characterize physiological roles of Bmi-1 with the long-term goal of using Bmi-1 as a prognostic marker and a therapeutic target. PMID:26448339
Polycomb Group Protein YY1 Is an Essential Regulator of Hematopoietic Stem Cell Quiescence
Directory of Open Access Journals (Sweden)
Zhanping Lu
2018-02-01
Full Text Available Yin yang 1 (YY1 is a ubiquitous transcription factor and mammalian polycomb group protein (PcG with important functions to regulate embryonic development, lineage differentiation, and cell proliferation. YY1 mediates stable PcG-dependent transcriptional repression via recruitment of PcG proteins that catalyze histone modifications. Many questions remain unanswered regarding how cell- and tissue-specificity is achieved by PcG proteins. Here, we demonstrate that a conditional knockout of Yy1 in hematopoietic stem cells (HSCs decreases long-term repopulating activity and ectopic YY1 expression expands HSCs. Although the YY1 PcG domain is required for Igκ chain rearrangement in B cells, the YY1 mutant lacking the PcG domain retained the capacity to stimulate HSC self-renewal. YY1 deficiency deregulated the genetic network governing HSC cell proliferation and impaired stem cell factor/c-Kit signaling, disrupting mechanisms conferring HSC quiescence. These results reveal a mechanism for how a ubiquitously expressed transcriptional repressor mediates lineage-specific functions to control adult hematopoiesis.
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Directory of Open Access Journals (Sweden)
Mehdi Hayat Shahi
Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*
Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long
2013-01-01
Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668
Transcriptional regulation by Polycomb group proteins
DEFF Research Database (Denmark)
Di Croce, Luciano; Helin, Kristian
2013-01-01
Polycomb group (PcG) proteins are epigenetic regulators of transcription that have key roles in stem-cell identity, differentiation and disease. Mechanistically, they function within multiprotein complexes, called Polycomb repressive complexes (PRCs), which modify histones (and other proteins......) and silence target genes. The dynamics of PRC1 and PRC2 components has been the focus of recent research. Here we discuss our current knowledge of the PRC complexes, how they are targeted to chromatin and how the high diversity of the PcG proteins allows these complexes to influence cell identity....
The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
2014-03-01
8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression
Bmi-1-targeting suppresses osteosarcoma aggressiveness through the NF-κB signaling pathway
Liu, Jiaguo; Luo, Bin; Zhao, Meng
2017-01-01
Bone cancer is one of the most lethal malignancies and the specific causes of tumor initiation are not well understood. B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been reported to be associated with the initiation and progression of osteosarcoma, and as a prognostic indicator in the clinic. In the current study, a full-length antibody targeting Bmi-1 (AbBmi-1) was produced and the preclinical value of Bmi-1-targeted therapy was evaluated in bone carcinoma cells and tumor xenograft mice. The results indicated that the Bmi-1 expression level was markedly upregulated in bone cancer cell lines, and inhibition of Bmi-1 by AbBmi-1 reduced the invasiveness and migration of osteosarcoma cells. Overexpression of Bmi-1 promoted proliferation and angiogenesis, and increased apoptosis resistance induced by cisplatin via the nuclear factor-κB (NF-κB) signal pathway. In addition, AbBmi-1 treatment inhibited the tumorigenicity of osteosarcoma cells in vivo. Furthermore, AbBmi-1 blocked NF-κB signaling and reduced MMP-9 expression. Furthermore, Bmi-1 promoted osteosarcoma tumor growth, whereas AbBmi-1 significantly inhibited osteosarcoma tumor growth in vitro and in vivo. Notably, AbBmi-1 decreased the percentages of Ki67-positive cells and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive cells in tumors compared with Bmi-1-treated and PBS controls. Notably, MMP-9 and NF-κB expression were downregulated by treatment with AbBmi-1 in MG-63 osteosarcoma cells. In conclusion, the data provides evidence that AbBmi-1 inhibited the progression of osteosarcoma, suggesting that AbBmi-1 may be a novel anti-cancer agent through the inhibition of Bmi-1 via activating the NF-κB pathway in osteosarcoma. PMID:28983587
Directory of Open Access Journals (Sweden)
Katarzyna Taran
2016-02-01
Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.
Clarifying the impact of polycomb complex component disruption in human cancers.
Yamamoto, Yukiya; Abe, Akihiro; Emi, Nobuhiko
2014-04-01
The dysregulation of proper transcriptional control is a major cause of developmental diseases and cancers. Polycomb proteins form chromatin-modifying complexes that transcriptionally silence genome regions in higher eukaryotes. The BCL6 corepressor (BCOR) complex comprises ring finger protein 1B (RNF2/RING1B), polycomb group ring finger 1 (PCGF1), and lysine-specific demethylase 2B (KDM2B) and is uniquely recruited to nonmethylated CpG islands, where it removes histone H3K36me2 and induces repressive histone H2A monoubiquitylation. Germline BCOR mutations have been detected in patients with oculofaciocardiodental and Lenz microphthalmia syndromes, which are inherited conditions. Recently, several variants of BCOR and BCOR-like 1 (BCORL1) chimeric fusion transcripts were reported in human cancers, including acute promyelocytic leukemia, bone sarcoma, and hepatocellular carcinoma. In addition, massively parallel sequencing has identified inactivating somatic BCOR and BCORL1 mutations in patients with acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia, medulloblastoma, and retinoblastoma. More importantly, patients with AML and MDS with BCOR mutations exhibit poor prognosis. This perspective highlights the detection of BCOR mutations and fusion transcripts of BCOR and BCORL1 and discusses their importance for diagnosing cancer subtypes and estimating the treatment responses of patients. Furthermore, this perspective proposes the need for additional functional studies to clarify the oncogenic mechanism by which BCOR and BCORL1 are disrupted in cancers, and how this may lead to the development of novel therapeutics. Mol Cancer Res; 12(4); 479-84. ©2014 AACR.
Ji, Huaijun; Cao, Ming; Ren, Kunlun; Sun, Ningbo; Wang, Wei; Zhu, Qiang; Zang, Qi; Jiang, Zhongmin
2017-01-01
The Polycomb group genes are a general class of regulators that are responsible for maintaining homeotic gene expression throughout cell division. Polycomb group expression plays an important role in oncogenesis of several types of human cancer. Melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 are key Polycomb group proteins. Studies have shown that melanoma nuclear protein 18 is a potential tumor suppression, and B-cell-specific Moloney leukemia virus insert site 1 is overexpressed in several human malignancies. However, the roles of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in esophageal squamous cell carcinoma are still unclear. In this study, we analyzed the expression levels of melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 in 89 esophageal cancer tissues and paired normal mucosal tissues using immunohistochemistry, Western blotting, and quantitative real-time polymerase chain reaction analyses. We found that the expression of melanoma nuclear protein 18 in the carcinoma tissues was significantly lower than that in the noncancerous mucosal tissues ( P .05). B-cell-specific Moloney leukemia virus insert site 1 expression was strongly correlated with the degree of differentiation, clinical stage, and lymph node metastasis ( P .05). Moreover, there was a negative correlation between melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 expressions in esophageal squamous cell carcinoma ( P < .05). Our study suggests that melanoma nuclear protein 18 and B-cell-specific Moloney leukemia virus insert site 1 may play a crucial role in esophageal squamous cell carcinoma. Melanoma nuclear protein 18 or B-cell-specific Moloney leukemia virus insert site 1 may be a potential biomarker for diagnosis and prognosis of esophageal squamous cell carcinoma.
Expression and clinicopathological significance of Mel-18 and Bmi-1 mRNA in gastric carcinoma.
Lu, You-Wei; Li, Jin; Guo, Wei-Jian
2010-11-08
The Polycomb group (PcG) genes are a class of regulators responsible for maintaining homeotic gene expression throughout cell division. PcG expression is deregulated in some types of human cancer. Both Bmi-1 and Mel-18 are of the key PcG proteins. We investigate the expression and clinicopathological roles of Mel-18 and Bmi-1 mRNA in gastric cancer. The expression of Mel-18 and Bmi-1 in a series of 71 gastric cancer tissues and paired normal mucosal tissues distant from the tumorous lesion was assayed by quantitative real time RT-PCR. The correlation between Mel-18 and Bmi-1 mRNA expression, and between Mel-18 or Bmi-1 mRNA level and clinicopathological characteristics were analyzed. Expression of Mel-18 and Bmi-1 genes was variably detected, but overexpression of Bmi-1 mRNA and decreased expression of Mel-18 mRNA were the most frequent alteration. In addition, the expression of Bmi-1 and Mel-18 mRNA inversely correlates in gastric tumors. Moreover, a significant positive correlation between Bmi-1 overexpression and tumor size, depth of invasion, or lymph node metastasis, and a significant negative correlation between Mel-18 low-expression with lymph node metastasis or the clinical stage were observed. Our data suggest that Mel-18 and Bmi-1 may play crucial but opposite roles in gastric cancer. Decreased Mel-18 and increased Bmi-1 mRNA expression was associated with the carcinogenesis and progression of gastric cancer. It is possible to list Bmi-1 and Mel-18 as biomarkers for predicting the prognosis of gastric cancer.
GFAP-Cre-mediated transgenic activation of Bmi1 results in pituitary tumors.
Directory of Open Access Journals (Sweden)
Bart A Westerman
Full Text Available Bmi1 is a member of the polycomb repressive complex 1 and plays different roles during embryonic development, depending on the developmental context. Bmi1 over expression is observed in many types of cancer, including tumors of astroglial and neural origin. Although genetic depletion of Bmi1 has been described to result in tumor inhibitory effects partly through INK4A/Arf mediated senescence and apoptosis and also through INK4A/Arf independent effects, it has not been proven that Bmi1 can be causally involved in the formation of these tumors. To see whether this is the case, we developed two conditional Bmi1 transgenic models that were crossed with GFAP-Cre mice to activate transgenic expression in neural and glial lineages. We show here that these mice generate intermediate and anterior lobe pituitary tumors that are positive for ACTH and beta-endorphin. Combined transgenic expression of Bmi1 together with conditional loss of Rb resulted in pituitary tumors but was insufficient to induce medulloblastoma therefore indicating that the oncogenic function of Bmi1 depends on regulation of p16(INK4A/Rb rather than on regulation of p19(ARF/p53. Human pituitary adenomas show Bmi1 overexpression in over 50% of the cases, which indicates that Bmi1 could be causally involved in formation of these tumors similarly as in our mouse model.
DEFF Research Database (Denmark)
Negishi, Masamitsu; Saraya, Atsunori; Mochizuki, Shinobu
2010-01-01
. METHODOLOGY/PRINCIPAL FINDINGS: We examined the function of Zinc finger domain-containing protein 277 (Zfp277), a novel zinc finger protein that interacts with the PcG protein Bmi1. Zfp277 binds to the Ink4a/Arf locus in a Bmi1-independent manner and interacts with polycomb repressor complex (PRC) 1 through...... is essential for the recruitment of PRC1 to the Ink4a/Arf locus. Our findings also highlight dynamic regulation of both Zfp277 and PcG proteins by the oxidative stress pathways....
Liu, Qipeng; Li, Qiaqia; Zhu, Sen; Yi, Yang; Cao, Qi
2018-06-01
B lymphoma Moloney murine leukemia virus insertion region 1 (BMI1), a core member of polycomb repressive complex 1 (PRC1), has been intensely investigated in the field of cancer epigenetics for decades. Widely known as a critical regulator in cellular physiology, BMI1 is essential in self-renewal and differentiation in different lineages of stem cells. BMI1 also plays a significant role in cancer etiology for its involvement in pathological progress such as epithelial-mesenchymal transition (EMT) and cancer stem cell maintenance, propagation, and differentiation. Importantly, overexpression of BMI1 is predictive for drug resistance, tumor recurrence, and eventual therapy failure of various cancer subtypes, which renders the pharmacological targeting at BMI1 as a novel and promising therapeutic approach. The study on prostate cancer, a prevalent hormone-related cancer among men, has promoted enormous research advancements in cancer genetics and epigenetics. This review summarizes the role of BMI1 as an oncogenic and epigenetic regulator in tumor initiation, progression, and relapse of prostate cancer.
The Role of Polycomb Group Gene Bmi-1 in the Development of Prostate Cancer
2011-09-01
new tricks. Cell Div. 2006 Jul 24;1:15. 17. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions... Pestell RG. Signal transduction mediated by cyclin D1: from mitogens to cell proliferation: a molecular target with therapeutic potential. Cancer...Datar 22 R, Cote R, Pestell R, Albanese C. ErbB-2 induces the cyclin D1 gene in prostate epithelial cells in vitro and in vivo. Cancer Res. 2007
Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira
2008-01-01
DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embryonic and adult stem cells. By screening proteins responding to DNA damage using laser micro-irradiation, we found that PHF1, a human homolog of Drosophila polycomb-like, Pcl, protein, was recruited to DSBs immediately after irradiation and dissociated within 10 min. The accumulation at DSBs is Ku70/Ku80-dependent, and knockdown of PHF1 leads to X-ray sensitivity and increases the frequency of homologous recombination in HeLa cell. We found that PHF1 interacts physically with Ku70/Ku80, suggesting that PHF1 promotes nonhomologous end-joining processes. Furthermore, we found that PHF1 interacts with a number of proteins involved in DNA damage responses, RAD50, SMC1, DHX9 and p53, further suggesting that PHF1, besides the function in PcG, is involved in genome maintenance processes. PMID:18385154
Directory of Open Access Journals (Sweden)
Mohamed Abdouh
Full Text Available Aging increases the risk to develop several neurodegenerative diseases, although the underlying mechanisms are poorly understood. Inactivation of the Polycomb group gene Bmi1 in mice results in growth retardation, cerebellar degeneration, and development of a premature aging-like phenotype. This progeroid phenotype is characterized by formation of lens cataracts, apoptosis of cortical neurons, and increase of reactive oxygen species (ROS concentrations, owing to p53-mediated repression of antioxidant response (AOR genes. Herein we report that Bmi1 expression progressively declines in the neurons of aging mouse and human brains. In old brains, p53 accumulates at the promoter of AOR genes, correlating with a repressed chromatin state, down-regulation of AOR genes, and increased oxidative damages to lipids and DNA. Comparative gene expression analysis further revealed that aging brains display an up-regulation of the senescence-associated genes IL-6, p19(Arf and p16(Ink4a, along with the pro-apoptotic gene Noxa, as seen in Bmi1-null mice. Increasing Bmi1 expression in cortical neurons conferred robust protection against DNA damage-induced cell death or mitochondrial poisoning, and resulted in suppression of ROS through activation of AOR genes. These observations unveil that Bmi1 genetic deficiency recapitulates aspects of physiological brain aging and that Bmi1 over-expression is a potential therapeutic modality against neurodegeneration.
BMI1 loss delays photoreceptor degeneration in Rd1 mice. Bmi1 loss and neuroprotection in Rd1 mice.
Zencak, Dusan; Crippa, Sylvain V; Tekaya, Meriem; Tanger, Ellen; Schorderet, Daniel E; Munier, Francis L; van Lohuizen, Maarten; Arsenijevic, Yvan
2006-01-01
Retinitis pigmentosa (RP) is a heterogeneous group of genetic disorders leading to blindness, which remain untreatable at present. Rd1 mice represent a recognized model of RP, and so far only GDNF treatment provided a slight delay in the retinal degeneration in these mice. Bmi1, a transcriptional repressor, has recently been shown to be essential for neural stem cell (NSC) renewal in the brain, with an increased appearance of glial cells in vivo in Bmi1 knockout (Bmi1-/-) mice. One of the roles of glial cells is to sustain neuronal function and survival. In the view of a role of the retinal Miller glia as a source of neural protection in the retina, the increased astrocytic population in the Bmi1-/- brain led us to investigate the effect of Bmi1 loss in Rd1 mice. We observed an increase of Müller glial cells in Rd1-Bmi1-/- retinas compared to Rd1. Moreover, Rd1-Bmi1-/- mice showed 7-8 rows of photoreceptors at 30 days of age (P30), while in Rd1 littermates there was a complete disruption of the outer nuclear layer (ONL). Preliminary ERG results showed a responsiveness of Rd1-Bmi1-/- mice in scotopic vision at P35. In conclusion, Bmi1 loss prevented, or rescued, photoreceptors from degeneration to an unanticipated extent in Rd1 mice. In this chapter, we will first provide a brief review of our work on the cortical NSCs and introduce the Bmi1 oncogene, thus offering a rational to our observations on the retina.
Kajiume, Teruyuki; Ohno, Norioki; Sera, Yasuhiko; Kawahara, Yumi; Yuge, Louis; Kobayashi, Masao
2009-07-01
The Polycomb-group (PcG) genes regulate global gene expression in many biological processes, including hematopoiesis, by manipulating specific target genes. It is known that various PcG genes regulate self-renewal of hematopoietic stem cells (HSCs). Here we have shown that the reciprocal expression of PcG proteins regulates self-renewal and differentiation of HSCs. We used murine and human bone marrow cells and evaluated the reciprocal expression of PcG proteins on the basis of their respective intranuclear distributions. PcG-gene expression in HSCs was knocked down by small interfering RNAs. The function of each gene in HSCs was analyzed in vitro and in vivo. Cells were either Bmi1-positive or Mel-18-positive. The Bmi1-positive cells contained very little amounts of Mel-18 and vice versa. The bmi1-knockdown marrow cells did not show HSC function, while the mel-18-knockdown marrow cells showed increased stem cell function. Results of the analysis on human cells were similar to those observed in case of murine cells. In a clinical investigation, transplantation using sources with a low Bmi1 to Mel-18 ratio was associated with early hematopoietic recovery. Reciprocal expression of Bmi1 and Mel-18 regulated HSC function. Here, we observed that expression of the PcG genes-bmi1 and mel-18-is correlated with self-renewal and differentiation of HSCs. Thus, it was suggested that the balance between Bmi1 and Mel-18 regulates self-renewal of HSCs.
Epigenetic regulation of HIV-1 latency: focus on polycomb group (PcG) proteins.
Khan, Sheraz; Iqbal, Mazhar; Tariq, Muhammad; Baig, Shahid M; Abbas, Wasim
2018-01-01
HIV-1 latency allows the virus to persist until reactivation, in a transcriptionally silent form in its cellular reservoirs despite the presence of effective cART. Such viral persistence represents a major barrier to HIV eradication since treatment interruption leads to rebound plasma viremia. Polycomb group (PcG) proteins have recently got a considerable attention in regulating HIV-1 post-integration latency as they are involved in the repression of proviral gene expression through the methylation of histones. This epigenetic regulation plays an important role in the establishment and maintenance of HIV-1 latency. In fact, PcG proteins act in complexes and modulate the epigenetic signatures of integrated HIV-1 promoter. Key role played by PcG proteins in the molecular control of HIV-1 latency has led to hypothesize that PcG proteins may represent a valuable target for future HIV-1 therapy in purging HIV-1 reservoirs. In this regard, various small molecules have been synthesized or explored to specifically block the epigenetic activity of PcG. In this review, we will highlight the possible therapeutic approaches to achieve either a functional or sterilizing cure of HIV-1 infection with special focus on histone methylation by PcG proteins together with current and novel pharmacological approaches to reactivate HIV-1 from latency that could ultimately lead towards a better clearance of viral latent reservoirs.
Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway
International Nuclear Information System (INIS)
Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng
2012-01-01
The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic
Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway
Directory of Open Access Journals (Sweden)
Jiang Lili
2012-09-01
Full Text Available Abstract Background The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1 has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. Methods A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Results Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Conclusions Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB
DEFF Research Database (Denmark)
Gjerstorff, Morten Frier; Relster, Mette Marie; Greve, Katrine Buch Viden
2014-01-01
Polycomb group (PcG) complexes regulate cellular identity through epigenetic programming of chromatin. Here, we show that SSX2, a germline-specific protein ectopically expressed in melanoma and other types of human cancers, is a chromatin-associated protein that antagonizes BMI1 and EZH2 PcG body...... formation and derepresses PcG target genes. SSX2 further negatively regulates the level of the PcG-associated histone mark H3K27me3 in melanoma cells, and there is a clear inverse correlation between SSX2/3 expression and H3K27me3 in spermatogenesis. However, SSX2 does not affect the overall composition...
Polycomb group protein bodybuilding: working out the routines.
Sievers, Cem; Paro, Renato
2013-09-30
Polycomb group (PcG) proteins regulate gene expression by modifying chemical and structural properties of chromatin. Isono et al. (2013) now report in Developmental Cell a polymerization-dependent mechanism used by PcG proteins to form higher-order chromatin structures, referred to as Polycomb bodies, and demonstrate its necessity for gene silencing. Copyright © 2013 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Bracken, Adrian P; Kleine-Kohlbrecher, Daniela; Dietrich, Nikolaj
2007-01-01
The p16INK4A and p14ARF proteins, encoded by the INK4A-ARF locus, are key regulators of cellular senescence, yet the mechanisms triggering their up-regulation are not well understood. Here, we show that the ability of the oncogene BMI1 to repress the INK4A-ARF locus requires its direct association...... and is dependent on the continued presence of the EZH2-containing Polycomb-Repressive Complex 2 (PRC2) complex. Significantly, EZH2 is down-regulated in stressed and senescing populations of cells, coinciding with decreased levels of associated H3K27me3, displacement of BMI1, and activation of transcription...
Structural Basis of Polycomb Bodies
Czech Academy of Sciences Publication Activity Database
Šmigová, J.; Juda, P.; Krejčí, Jana; Raška, I.
2014-01-01
Roč. 60, č. 1 (2014), s. 13-20 ISSN 0015-5500 R&D Projects: GA ČR(CZ) GBP302/12/G157; GA MŠk(CZ) EE2.3.30.0030 Institutional support: RVO:68081707 Keywords : Polycomb group proteins * Polycomb body * post-translational chromatin modifications Subject RIV: BO - Biophysics Impact factor: 1.000, year: 2014
Fisher, C.L.; Lee, I.; Bloyer, S.; Bozza, S.; Chevalier, J.; Dahl, A; Bodner, C.; Helgason, C. D.; Hess, J.L.; Humphries, R.K.; Brock, H.W.
2009-01-01
The Additional sex combs (Asx) gene of Drosophila behaves genetically as an enhancer of trithorax and Polycomb (ETP) in displaying bidirectional homeotic phenotypes, suggesting that is required for maintenance of both activation and silencing of Hox genes. There are 3 murine homologs of Asx called Additional sex combs-like1, 2, and-3. Asxl1 is required for normal adult hematopoiesis; however its embryonic function is unknown. We used a targeted mouse mutant line Asxl1tm1Bc to determine if Asxl1 is required to silence and activate Hox genes in mice during axial patterning. The mutant embryos exhibit simultaneous anterior and posterior transformations of the axial skeleton, consistent with a role for Asxl1 in activation and silencing of Hox genes. Transformations of the axial skeleton are enhanced in compound mutant embryos for the Polycomb group gene M33/Cbx2. Hox a4, a7, and c8 are derepressed in Asxl1tm1Bc mutants in the antero-posterior axis, but Hox c8 expression is reduced in the brain of mutants, consistent with Asxl1 being required both for activation and repression of Hox genes. We discuss the genetic and molecular definition of ETPs, and suggest that the function of Asxl1 depends on its cellular context. PMID:19833123
Modeling Late-Onset Sporadic Alzheimer’s Disease through BMI1 Deficiency
Directory of Open Access Journals (Sweden)
Anthony Flamier
2018-05-01
Full Text Available Late-onset sporadic Alzheimer’s disease (AD is the most prevalent form of dementia, but its origin remains poorly understood. The Bmi1/Ring1 protein complex maintains transcriptional repression of developmental genes through histone H2A mono-ubiquitination, and Bmi1 deficiency in mice results in growth retardation, progeria, and neurodegeneration. Here, we demonstrate that BMI1 is silenced in AD brains, but not in those with early-onset familial AD, frontotemporal dementia, or Lewy body dementia. BMI1 expression was also reduced in cortical neurons from AD patient-derived induced pluripotent stem cells but not in neurons overexpressing mutant APP and PSEN1. BMI1 knockout in human post-mitotic neurons resulted in amyloid beta peptide secretion and deposition, p-Tau accumulation, and neurodegeneration. Mechanistically, BMI1 was required to repress microtubule associated protein tau (MAPT transcription and prevent GSK3beta and p53 stabilization, which otherwise resulted in neurodegeneration. Restoration of BMI1 activity through genetic or pharmaceutical approaches could represent a therapeutic strategy against AD.
Soulez, M; Saurin, A J; Freemont, P S; Knight, J C
1999-04-29
Chromosome translocation t(X;18)(p11.2;q11.2) is unique to synovial sarcomas and results in an 'in frame' fusion of the SYT gene with the SSX1 or closely-related SSX2 gene. Wild-type SYT and SSX proteins, and the SYT-SSX chimaeric proteins, can modulate transcription in gene reporter assays. To help elucidate the role of these proteins in cell function and neoplasia we have performed immunolabelling experiments to determine their subcellular localization in three cell types. Transient expression of epitope-tagged proteins produced distinctive nuclear staining patterns. The punctate staining of SYT and SYT-SSX proteins showed some similarities. We immunolabelled a series of endogenous nuclear antigens and excluded the SYT and SYT-SSX focal staining from association with these domains (e.g. sites of active transcription, snRNPs). In further experiments we immunolabelled the Polycomb group (PcG) proteins RING1 or BMI-1 and showed that SSX and SYT-SSX proteins, but not SYT, co-localized with these markers. Consistent with this we show that SSX and SYT-SSX associate with chromatin, and also associate with condensed chromatin at metaphase. Noteably, SSX produced a dense signal over the surface of metaphase chromosomes whereas SYT-SSX produced discrete focal staining. Our data indicate that SSX and SYT-SSX proteins are recruited to nuclear domains occupied by PcG complexes, and this provides us with a new insight into the possible function of wild-type SSX and the mechanism by which the aberrant SYT-SSX protein might disrupt fundamental mechanisms controlling cell division and cell fate.
Chen, Jiangzhi; Xu, Hong; Zou, Xiuqun; Wang, Jiamin; Zhu, Yi; Chen, Hao; Shen, Baiyong; Deng, Xiaxing; Zhou, Aiwu; Chin, Y Eugene; Rauscher, Frank J; Peng, Chenghong; Hou, Zhaoyuan
2014-08-15
Transcriptional repressor Snail is a master regulator of epithelial-mesenchymal transition (EMT), yet the epigenetic mechanism governing Snail to induce EMT is not well understood. Here, we report that in pancreatic ductal adenocarcinoma (PDAC), elevated levels of the ubiquitin E3 ligase Ring1B and Snail, along with elevated monoubiquitination of H2A at K119 (H2AK119Ub1), are highly correlated with poor survival. Mechanistic investigations identified Ring1B as a Snail-interacting protein and showed that the carboxyl zinc fingers of Snail recruit Ring1B and its paralog Ring1A to repress its target promoters. Simultaneous depletion of Ring1A and Ring1B in pancreatic cancer cells decreased Snail binding to the target chromatin, abolished H2AK119Ub1 modification, and thereby compromised Snail-mediated transcriptional repression and cell migration. We found that Ring1B and the SNAG-associated chromatin modifier EZH2 formed distinct protein complexes with Snail and that EZH2 was required for Snail-Ring1A/B recruitment to the target promoter. Collectively, our results unravel an epigenetic mechanism underlying transcriptional repression by Snail, suggest Ring1A/B as a candidate therapeutic target, and identify H2AK119Ub1 as a potential biomarker for PDAC diagnosis and prognosis. ©2014 American Association for Cancer Research.
Hecker, Andreas; Brand, Luise H; Peter, Sébastien; Simoncello, Nathalie; Kilian, Joachim; Harter, Klaus; Gaudin, Valérie; Wanke, Dierk
2015-07-01
Polycomb-repressive complexes (PRCs) play key roles in development by repressing a large number of genes involved in various functions. Much, however, remains to be discovered about PRC-silencing mechanisms as well as their targeting to specific genomic regions. Besides other mechanisms, GAGA-binding factors in animals can guide PRC members in a sequence-specific manner to Polycomb-responsive DNA elements. Here, we show that the Arabidopsis (Arabidopsis thaliana) GAGA-motif binding factor protein basic pentacysteine6 (BPC6) interacts with like heterochromatin protein1 (LHP1), a PRC1 component, and associates with vernalization2 (VRN2), a PRC2 component, in vivo. By using a modified DNA-protein interaction enzyme-linked immunosorbant assay, we could show that BPC6 was required and sufficient to recruit LHP1 to GAGA motif-containing DNA probes in vitro. We also found that LHP1 interacts with VRN2 and, therefore, can function as a possible scaffold between BPC6 and VRN2. The lhp1-4 bpc4 bpc6 triple mutant displayed a pleiotropic phenotype, extreme dwarfism and early flowering, which disclosed synergistic functions of LHP1 and group II plant BPC members. Transcriptome analyses supported this synergy and suggested a possible function in the concerted repression of homeotic genes, probably through histone H3 lysine-27 trimethylation. Hence, our findings suggest striking similarities between animal and plant GAGA-binding factors in the recruitment of PRC1 and PRC2 components to Polycomb-responsive DNA element-like GAGA motifs, which must have evolved through convergent evolution. © 2015 American Society of Plant Biologists. All Rights Reserved.
Human Polycomb group EED protein negatively affects HIV-1 assembly and release
Directory of Open Access Journals (Sweden)
Darlix Jean-Luc
2007-06-01
Full Text Available Abstract Background The human EED protein, a member of the superfamily of Polycomb group (PcG proteins with WD-40 repeats, has been found to interact with three HIV-1 components, namely the structural Gag matrix protein (MA, the integrase enzyme (IN and the Nef protein. The aim of the present study was to analyze the possible biological role of EED in HIV-1 replication, using the HIV-1-based vector HIV-Luc and EED protein expressed by DNA transfection of 293T cells. Results During the early phase of HIV-1 infection, a slight negative effect on virus infectivity occurred in EED-expressing cells, which appeared to be dependent on EED-MA interaction. At late times post infection, EED caused an important reduction of virus production, from 20- to 25-fold as determined by CAp24 immunoassay, to 10- to 80-fold based on genomic RNA levels, and this decrease was not due to a reduction of Gag protein synthesis. Coexpression of WTNef, or the non-N-myristoylated mutant NefG2A, restored virus yields to levels obtained in the absence of exogenous EED protein. This effect was not observed with mutant NefΔ57 mimicking the Nef core, or with the lipid raft-retargeted fusion protein LAT-Nef. LATAA-Nef, a mutant defective in the lipid raft addressing function, had the same anti-EED effect as WTNef. Cell fractionation and confocal imaging showed that, in the absence of Nef, EED mainly localized in membrane domains different from the lipid rafts. Upon co-expression with WTNef, NefG2A or LATAA-Nef, but not with NefΔ57 or LAT-Nef, EED was found to relocate into an insoluble fraction along with Nef protein. Electron microscopy of HIV-Luc producer cells overexpressing EED showed significant less virus budding at the cell surface compared to control cells, and ectopic assembly and clustering of nuclear pore complexes within the cytoplasm. Conclusion Our data suggested that EED exerted an antiviral activity at the late stage of HIV-1 replication, which included genomic
Directory of Open Access Journals (Sweden)
Yoshikawa Reigetsu
2012-10-01
Full Text Available Abstract Background The polycomb group (PcG family BMI1, acting downstream of the hedgehog (Hh pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated that Hh signalling activation can predict very earlier relapse of oesophageal cancers. As data were not available on the clinical role of BMI1 expression in oesophageal cancers after chemoradiotherapy (CRT, we analysed whether it could be also used to predict disease progression and prognosis in oesophageal cancer patients undergoing trimodality therapy of preoperative CRT and oesophagectomy. Methods Expressions of BMI1 and p16INK4A, a downstream target of PcG, were analysed in 78 patients with histologically confirmed oesophageal squamous cell carcinoma (ESCC after preoperative CRT by immunohistochemical staining. The association of BMI1 and p16INK4A expression with clinicopathologic characteristics was analysed by χ2-test. Survival analysis was carried out by the log-rank test using Kaplan-Meier method. Results Among 78 ESCC patients, 24 patients (30.8% showed BMI1 positivity, mainly localised in the nuclei of tumour cells. Patients harbouring BMI1-positive tumour cells showed significantly poorer prognoses than those without such cells or residual tumours (mean disease-free survival (DFS time 16.8 vs 71.2 months; 3-yr DFS 13.3% vs 49.9%, P=0.002; mean OS time 21.8 vs 76.6 months; 3-yr OS 16.2% vs 54.9%, P=0.0005. There was no significant correlation between p16INK4A expression and BMI1 expression. Conclusions Our study shows that BMI1 expression is a predictor of early relapse and poor prognosis in ESCC after CRT. These findings suggest that BMI1 signal activation might be involved in promoting cancer regrowth and progression after CRT, and might be indicative of emergence of ‘more aggressive’ cancer progenitor cells.
DEFF Research Database (Denmark)
Nguyen, Phi Hung; Dao, Trong Tuan; Kim, Jayeon
2011-01-01
.9 ± 1.6 to 19.2 ± 1.1 μM), while compounds (3, 5, and 9) with 2,2-dimethylpyrano ring showed less inhibitory effect (IC₅₀ 22.6 ± 2.3 to 72.9 ± 9.7 μM). These results suggest that prenyl and methoxy groups may be responsible for the increase on the activity of 5-deoxyflavonoids against PTP1B......, but the presence of 2,2-dimethylpyrano ring on the B ring may be induced the decrease of PTP1B inhibitory activity....
2016-10-01
we discovered that BMI1 directly binds to Androgen Receptor and prevents it from MDM2-mediated protein degradation. We further demonstrated that...lysates. As shown in Fig. 1B, IP with anti-BMI1 pulled down full-length and AR-NTD, but not AR-DBD or AR-LBD. On the other hand , pulldown with Halo...harvested at the indicated time points and immunoblot analysis with anti-AR and anti-β-actin antibodies on the same membrane ( left panel). Density of
Codispoti, Bruna; Rinaldo, Nicola; Chiarella, Emanuela; Lupia, Michela; Spoleti, Cristina Barbara; Marafioti, Maria Grazia; Aloisio, Annamaria; Scicchitano, Stefania; Giordano, Marco; Nappo, Giovanna; Lucchino, Valeria; Moore, Malcolm A S; Zhou, Pengbo; Mesuraca, Maria; Bond, Heather Mandy; Morrone, Giovanni
2017-07-04
Transplantation of hematopoietic stem cells (HSCs) is a well-established therapeutic approach for numerous disorders. HSCs are typically derived from bone marrow or peripheral blood after cytokine-induced mobilization. Umbilical cord blood (CB) represents an appealing alternative HSC source, but the small amounts of the individual CB units have limited its applications. The availability of strategies for safe ex vivo expansion of CB-derived HSCs (CB-HSCs) may allow to extend the use of these cells in adult patients and to avoid the risk of insufficient engraftment or delayed hematopoietic recovery.Here we describe a system for the ex vivo expansion of CB-HSCs based on their transient exposure to a recombinant TAT-BMI-1 chimeric protein. BMI-1 belongs to the Polycomb family of epigenetic modifiers and is recognized as a central regulator of HSC self-renewal. Recombinant TAT-BMI-1 produced in bacteria was able to enter the target cells via the HIV TAT-derived protein transduction peptide covalently attached to BMI-1, and conserved its biological activity. Treatment of CB-CD34+ cells for 3 days with repeated addition of 10 nM purified TAT-BMI-1 significantly enhanced total cell expansion as well as that of primitive hematopoietic progenitors in culture. Importantly, TAT-BMI-1-treated CB-CD34+ cells displayed a consistently higher rate of multi-lineage long-term repopulating activity in primary and secondary xenotransplants in immunocompromised mice. Thus, recombinant TAT-BMI-1 may represent a novel, effective reagent for ex vivo expansion of CB-HSC for therapeutic purposes.
Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.
2010-01-01
Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and othe...
MK3 modulation affects BMI1-dependent and independent cell cycle check-points.
Directory of Open Access Journals (Sweden)
Peggy Prickaerts
Full Text Available Although the MK3 gene was originally found deleted in some cancers, it is highly expressed in others. The relevance of MK3 for oncogenesis is currently not clear. We recently reported that MK3 controls ERK activity via a negative feedback mechanism. This prompted us to investigate a potential role for MK3 in cell proliferation. We here show that overexpression of MK3 induces a proliferative arrest in normal diploid human fibroblasts, characterized by enhanced expression of replication stress- and senescence-associated markers. Surprisingly, MK3 depletion evokes similar senescence characteristics in the fibroblast model. We previously identified MK3 as a binding partner of Polycomb Repressive Complex 1 (PRC1 proteins. In the current study we show that MK3 overexpression results in reduced cellular EZH2 levels and concomitant loss of epigenetic H3K27me3-marking and PRC1/chromatin-occupation at the CDKN2A/INK4A locus. In agreement with this, the PRC1 oncoprotein BMI1, but not the PCR2 protein EZH2, bypasses MK3-induced senescence in fibroblasts and suppresses P16INK4A expression. In contrast, BMI1 does not rescue the MK3 loss-of-function phenotype, suggesting the involvement of multiple different checkpoints in gain and loss of MK3 function. Notably, MK3 ablation enhances proliferation in two different cancer cells. Finally, the fibroblast model was used to evaluate the effect of potential tumorigenic MK3 driver-mutations on cell proliferation and M/SAPK signaling imbalance. Taken together, our findings support a role for MK3 in control of proliferation and replicative life-span, in part through concerted action with BMI1, and suggest that the effect of MK3 modulation or mutation on M/SAPK signaling and, ultimately, proliferation, is cell context-dependent.
Expression of BMI-1 and Mel-18 in breast tissue--a diagnostic marker in patients with breast cancer.
Riis, Margit L H; Lüders, Torben; Nesbakken, Anne-Jorunn; Vollan, Hilde S; Kristensen, Vessela; Bukholm, Ida R K
2010-12-16
Polycomb Group (PcG) proteins are epigenetic silencers involved in maintaining cellular identity, and their deregulation can result in cancer. Expression of Mel-18 and Bmi-1 has been studied in tumor tissue, but not in adjacent non-cancerous breast epithelium. Our study compares the expression of the two genes in normal breast epithelium of cancer patients and relates it to the level of expression in the corresponding tumors as well as in breast epithelium of healthy women. A total of 79 tumors, of which 71 malignant tumors of the breast, 6 fibroadenomas, and 2 DCIS were studied and compared to the reduction mammoplastic specimens of 11 healthy women. In addition there was available adjacent cancer free tissue for 23 of the malignant tumors. The tissue samples were stored in RNAlater, RNA was isolated to create expression microarray profile. These two genes were then studied more closely first on mRNA transcription level by microarrays (Agilent 44 K) and quantitative RT-PCR (TaqMan) and then on protein expression level using immunohistochemistry. Bmi-1 mRNA is significantly up-regulated in adjacent normal breast tissue in breast cancer patients compared to normal breast tissue from noncancerous patients. Conversely, mRNA transcription level of Mel-18 is lower in normal breast from patients operated for breast cancer compared to breast tissue from mammoplasty. When protein expression of these two genes was evaluated, we observed that most of the epithelial cells were positive for Bmi-1 in both groups of tissue samples, although the expression intensity was stronger in normal tissue from cancer patients compared to mammoplasty tissue samples. Protein expression of Mel-18 showed inversely stronger intensity in tissue samples from mammoplasty compared to normal breast tissue from patients operated for breast cancer. Bmi-1 mRNA level is consistently increased and Mel-18 mRNA level is consistently decreased in adjacent normal breast tissue of cancer patients as compared
Cooperativity, Specificity, and Evolutionary Stability of Polycomb Targeting in Drosophila
Directory of Open Access Journals (Sweden)
Bernd Schuettengruber
2014-10-01
Full Text Available Summary: Metazoan genomes are partitioned into modular chromosomal domains containing active or repressive chromatin. In flies, Polycomb group (PcG response elements (PREs recruit PHO and other DNA-binding factors and act as nucleation sites for the formation of Polycomb repressive domains. The sequence specificity of PREs is not well understood. Here, we use comparative epigenomics and transgenic assays to show that Drosophila domain organization and PRE specification are evolutionarily conserved despite significant cis-element divergence within Polycomb domains, whereas cis-element evolution is strongly correlated with transcription factor binding divergence outside of Polycomb domains. Cooperative interactions of PcG complexes and their recruiting factor PHO stabilize PHO recruitment to low-specificity sequences. Consistently, PHO recruitment to sites within Polycomb domains is stabilized by PRC1. These data suggest that cooperative rather than hierarchical interactions among low-affinity sequences, DNA-binding factors, and the Polycomb machinery are giving rise to specific and strongly conserved 3D structures in Drosophila. : Schuettengruber et al. present an extensive comparative epigenomics data set, providing new insights into cis-driven versus buffered evolution of Polycomb recruitment and Polycomb domain specificity. Using chromatin immunoprecipitation sequencing and transgenic assays, they demonstrate an extremely high conservation of Polycomb repressive domains in five Drosophila species. Using Hi-C and knockout experiments, they challenge the standard hierarchical Polycomb recruitment model and demonstrate that cooperative rather than hierarchical interactions among DNA motifs, transcription factors, and Polycomb group complexes define Polycomb domains.
Kim, Jeesun; Hwangbo, Jeon; Wong, Paul K. Y.
2011-01-01
A-T (ataxia telangiectasia) is a genetic disease caused by a mutation in the Atm (A-T mutated) gene that leads to neurodegeneration. Despite an increase in the numbers of studies in this area in recent years, the mechanisms underlying neurodegeneration in human A-T are still poorly understood. Previous studies demonstrated that neural stem cells (NSCs) isolated from the subventricular zone (SVZ) of Atm -/- mouse brains show defective self-renewal and proliferation, which is accompanied by activation of chronic p38 mitogen-activated protein kinase (MAPK) and a lower level of the polycomb protein Bmi-1. However, the mechanism underlying Bmi-1 down-regulation and its relevance to defective proliferation in Atm-/- NSCs remained unclear. Here, we show that over-expression of Bmi-1 increases self-renewal and proliferation of Atm-/- NSCs to normal, indicating that defective proliferation in Atm-/- NSCs is a consequence of down-regulation of Bmi-1. We also demonstrate that epidermal growth factor (EGF)-induced Akt phosphorylation renders Bmi-1 resistant to the proteasomal degradation, leading to its stabilization and accumulation in the nucleus. However, inhibition of the Akt-dependent Bmi-1 stabilizing process by p38 MAPK signaling reduces the levels of Bmi-1. Treatment of the Atm-/- NSCs with a specific p38 MAPK inhibitor SB203580 extended Bmi-1 posttranscriptional turnover and H2A ubiquitination in Atm-/- NSCs. Our observations demonstrate the molecular basis underlying the impairment of self-renewal and proliferation in Atm-/- NSCs through the p38 MAPK-Akt-Bmi-1-p21 signaling pathway. PMID:21305053
Expression of Bmi-1 is a prognostic marker in bladder cancer
Directory of Open Access Journals (Sweden)
Xu Li-Hua
2009-02-01
Full Text Available Abstract Background The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. Methods We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Results Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P P P P P > 0.5. In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P P P > 0.05. Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P P Conclusion Expression of Bmi-1 was greater in bladder cancers than in the adjacent normal tissues. The examination of Bmi-1 protein expression is potentially valuable in prognostic evaluation of bladder cancer.
Analysis list: BMI1 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available BMI1 Blood,Digestive tract,Neural,Prostate + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI...1.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.5.tsv http://db...archive.biosciencedbc.jp/kyushu-u/hg19/target/BMI1.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI...1.Blood.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Diges...tive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/BMI1.Neural.tsv,http://dbarchive.bioscie
Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira
2008-01-01
DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embry...
Directory of Open Access Journals (Sweden)
Hua-Bing Li
2013-04-01
Full Text Available Polycomb bodies are foci of Polycomb proteins in which different Polycomb target genes are thought to co-localize in the nucleus, looping out from their chromosomal context. We have shown previously that insulators, not Polycomb response elements (PREs, mediate associations among Polycomb Group (PcG targets to form Polycomb bodies. Here we use live imaging and 3C interactions to show that transgenes containing PREs and endogenous PcG-regulated genes are targeted by insulator proteins to different nuclear structures depending on their state of activity. When two genes are repressed, they co-localize in Polycomb bodies. When both are active, they are targeted to transcription factories in a fashion dependent on Trithorax and enhancer specificity as well as the insulator protein CTCF. In the absence of CTCF, assembly of Polycomb bodies is essentially reduced to those representing genomic clusters of Polycomb target genes. The critical role of Trithorax suggests that stable association with a specialized transcription factory underlies the cellular memory of the active state.
Expression of Bmi-1 is a prognostic marker in bladder cancer
International Nuclear Information System (INIS)
Qin, Zi-Ke; Zeng, Mu-Sheng; Yang, Jian-An; Ye, Yun-lin; Zhang, Xing; Xu, Li-Hua; Zhou, Fang-Jian; Han, Hui; Liu, Zuo-Wei; Song, Li-Bing
2009-01-01
The molecular mechanisms of the development and progression of bladder cancer are poorly understood. The objective of this study was to analyze the expression of Bmi-1 protein and its clinical significance in human bladder cancer. We examined the expression of Bmi-1 mRNA and Bmi-1 protein by RT-PCR and Western blot, respectively in 14 paired bladder cancers and the adjacent normal tissues. The expression of Bmi-1 protein in 137 specimens of bladder cancer and 30 specimens of adjacent normal bladder tissue was determined by immunohistochemistry. Statistical analyses were applied to test the relationship between expression of Bmi-1, and clinicopathologic features and prognosis. Expression of Bmi-1 mRNA and protein was higher in bladder cancers than in the adjacent normal tissues in 14 paired samples (P < 0.01). By immunohistochemical examination, five of 30 adjacent normal bladder specimens (16.7%) versus 75 of 137 bladder cancers (54.3%) showed Bmi-1 protein expression (P < 0.05). Bmi-1 protein expression was intense in 20.6%, 54.3%, and 78.8% of tumors of histopathological stages G1, G2, and G3, respectively (P < 0.05). Expression of Bmi-1 protein was greater in invasive bladder cancers than in superficial bladder cancers (81.5% versus 32.5%, P < 0.05). In invasive bladder cancers, the expression of Bmi-1 protein in progression-free cancers was similar to that of cancers that have progressed (80.0% versus 82.4%, P > 0.5). In superficial bladder cancers, the expression of Bmi-1 protein in recurrent cases was higher than in recurrence-free cases (62.5% versus 13.7%, P < 0.05). Bmi-1 expression was positively correlated with tumor classification and TNM stage (P < 0.05), but not with tumor number (P > 0.05). Five-year survival in the group with higher Bmi-1 expression was 50.8%, while it was 78.5% in the group with lower Bmi-1 expression (P < 0.05). Patients with higher Bmi-1 expression had shorter survival time, whereas patients with lower Bmi-1 expression had longer
Bmi-1 expression modulates non-small cell lung cancer progression
Xiong, Dan; Ye, Yunlin; Fu, Yujie; Wang, Jinglong; Kuang, Bohua; Wang, Hongbo; Wang, Xiumin; Zu, Lidong; Xiao, Gang; Hao, Mingang; Wang, Jianhua
2015-01-01
Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we report that the Bmi-1 level is highly increased in primary NSCLC tissues compared to matched adjacent non-cancerous tissues and required for lung tumor growth in xenograft model. Furthermore, we also demonstrate that Bmi-1 level is lower in matched involved lymph node cancerous tissues than the respective primary NSCLC tissues. We find that Bmi-1 does not affect cell cycle and apoptosis in lung cancer cell lines as it does not affect the expression of p16/p19, Pten, AKT and P-AKT. Mechanistic analyses note that reduction of Bmi-1 expression inversely regulates invasion and metastasis of NSCLC cells in vitro and in vivo, followed by induction of epithelial-mesenchymal transition (EMT). Using genome microarray assays, we find that RNAi-mediated silence of Bmi-1 modulates some important molecular genetics or signaling pathways, potentially associated with NSCLC development. Taken together, our findings disclose for the first time that Bmi-1 level accumulates strongly in early stage and then declines in late stage, which is potentially important for NSCLC cell invasion and metastasis during progression. PMID:25880371
The Role of Polycomb Group Gene BMI-1 in the Development of Prostate Cancer
2013-07-01
J Clin Invest. 2005; 115:1503-21. 13. Siddique HR, Liao DJ, Mishra SK, Schuster T, Wang L, Matter B et al. Epicatechin-rich cocoa polyphenol...growth factors may result in an upregulation of diverse gene products in CSCs and their differentiated progenies dur- ing the EMT process [32, 33
Expression of Bmi-1, P16, and CD44v6 in Uterine Cervical Carcinoma and Its Clinical Significance
International Nuclear Information System (INIS)
Weng, Mei-ying; Li, Lin; Feng, Shu-ying; Hong, Shun-jia
2012-01-01
Bmi-1, a putative proto-oncogene, is a core member of the polycomb gene family, which is expressed in many human tumors. The p16 protein negatively regulated cell proliferation, whereas CD44v6 is associated with proliferation as an important protein. Additionally, CD44v6 is an important nuclear antigen closely correlated to tumor metastasis. The present study aims to investigate the expression and significance of Bmi-1, p16, and CD44v6 in uterine cervical carcinoma (UCC). A total of 62 UCC, 30 cervical neoplasic, and 20 normal cervical mucosal tissues were used in the current study. The expression of Bmi-1, p16, and CD44v6 in these tissues was determined using immunohistochemical assay. The relationships among the expression of these indices, the clinicopathologic features of UCC, and the survival rate of UCC patients were also discussed. The correlation between Bmi-1 protein expression and p16 or CD44v6 protein in UCC was analyzed. The expression of Bmi-1, p16, and CD44v6 was significantly high in cervical carcinoma compared with that in the cervical neoplasia and normal colorectal mucosa (P<0.05). The over-expression of Bmi-1 protein in UCC was apparently related to the distant metastasis (P<0.01) and the tumor, nodes and metastasis-classification, i.e. the TNM staging, World Health Organization (P<0.05). Nevertheless, the positive expression of p16 protein in UCC was not significantly associated with the clinicopathologic features (P>0.05). The Kaplan–Meier survival analysis showed that the over-expression of Bmi-1 significantly decreased the survival rate of UCC patients (P<0.05). A strong correlation indicated that there was statistical significance between the expression of Bmi-1 and CD44V6 proteins in UCC (r=0.419, P=0.001). The over-expression of Bmi-1 and CD44v6 protein closely correlate to the tumorigenesis, metastasis, and prognosis of UCC. Bmi-1 and CD44v6 may be used to predict the prognosis of cervical carcinoma. Bmi-1 may indirectly regulate the
Directory of Open Access Journals (Sweden)
Lluis Morey
2013-01-01
Full Text Available The Polycomb repressive complex 1 (PRC1 is required for decisions of stem cell fate. In mouse embryonic stem cells (ESCs, two major variations of PRC1 complex, defined by the mutually exclusive presence of Cbx7 or RYBP, have been identified. Here, we show that although the genomic localization of the Cbx7- and RYBP-containing PRC1 complexes overlaps in certain genes, it can also be mutually exclusive. At the molecular level, Cbx7 is necessary for recruitment of Ring1B to chromatin, whereas RYBP enhances the PRC1 enzymatic activity. Genes occupied by RYBP show lower levels of Ring1B and H2AK119ub and are consequently more highly transcribed than those bound by Cbx7. At the functional level, we show that genes occupied by RYBP are primarily involved in the regulation of metabolism and cell-cycle progression, whereas those bound by Cbx7 predominantly control early-lineage commitment of ESCs. Altogether, our results indicate that different PRC1 subtypes establish a complex pattern of gene regulation that regulates common and nonoverlapping aspects of ESC pluripotency and differentiation.
Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro
2012-01-01
Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent ...
Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan
2017-09-01
The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.
Ye, Kai; Chen, Qi-Wei; Sun, Ya-Feng; Lin, Jian-An; Xu, Jian-Hua
2018-02-01
Increasing evidence from various clinical and experimental studies has demonstrated that the inflammatory microenvironment created by immune cells facilitates tumor migration. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in an inflammatory microenvironment. B-lymphoma Moloney murine leukemia virus insertion region 1 (BMI-1) acts as an oncogene in various tumors. Ectopic expression of Bmi-1 have an effect on EMT and invasiveness. The purpose of this study was to investigate the efficacy of BMI-1 on inflammation-induced tumor migration and EMT and the underlying mechanism. We observed that the expression of BMI-1, TNF-α, and IL-1β was significantly increased in HT29 and HCT116 cells after THP-1 Conditioned-Medium (THP-1-CM) stimulation. Additionally, inhibition of BMI-1 impeded cell invasion induced by THP-1-CM-stimulation in both HT29 and HCT116 cells. BMI-1 knockdown remarkably repressed THP-1-CM-induced EMT by regulating the expression of EMT biomarkers with an increase in E-cadherin accompanied by decrease in N-cadherin and vimentin. Furthermore, downregulation of BMI-1 dramatically impeded THP-1-CM-triggered Toll-like receptor 4(TLR4)/myeloid differentiation protein 2(MD-2)/myeloid differentiation factor 88(MyD88) activity by repressing the expression of the TLR4/MD-2 complex and MyD88. Further data demonstrated that knockout of BMI-1 also dampened NF-κB THP-1-CM-triggered activity. Taken all data together, our findings established that BMI-1 modulated TLR4/MD-2/MyD88 complex-mediated NF-κB signaling involved in inflammation-induced cancer cells invasion and EMT, and therefore, could be a potential chemopreventive agent against inflammation-associated colorectal cancer. Establishment of an inflammatory microenvironment. Suppression of BMI-1 reverses THP-1-CM-induced inflammatory cytokine production in CRC. Loss of BMI-1 suppressed TLR4/MD-2/MyD88 complex-mediated NF-κB signaling. © 2017 Wiley
Wang, Liangjun; Jahren, Neal; Miller, Ellen L; Ketel, Carrie S; Mallin, Daniel R; Simon, Jeffrey A
2010-06-01
Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets.
Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.
2010-01-01
Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets. PMID:20351181
Quteineh, Lina; Vandenberghe, Frederik; Saigi Morgui, Nuria; Delacré taz, Auré lie; Choong, Eva; Gholam-Rezaee, Mehdi; Magistretti, Pierre J.; Bondolfi, Guido; Von Gunten, Armin; Preisig, Martin A.; Castelao, Enrique; Vollenweider, Peter; Waeber, Gé rard; Bochud, Murielle; Kutalik, Zoltá n; Conus, Philippe O.; Eap, Chin Bin
2015-01-01
Background Metabolic syndrome (MetS) associated with psychiatric disorders and psychotropic treatments represents a major health issue. 11β-Hydroxysteroid dehydrogenase type 1 (11β-HSD1) is an enzyme that catalyzes tissue regeneration of active cortisol from cortisone. Elevated enzymatic activity of 11β-HSD1 may lead to the development of MetS. Methods We investigated the association between seven HSD11B1 gene (encoding 11β-HSD1) polymorphisms and BMI and MetS components in a psychiatric sample treated with potential weight gain-inducing psychotropic drugs (n=478). The polymorphisms that survived Bonferroni correction were analyzed in two independent psychiatric samples (n R1 =168, n R2 =188) and in several large population-based samples (n 1 =5338; n 2 =123 865; n 3 >100 000). Results HSD11B1 rs846910-A, rs375319-A, and rs4844488-G allele carriers were found to be associated with lower BMI, waist circumference, and diastolic blood pressure compared with the reference genotype (P corrected <0.05). These associations were exclusively detected in women (n=257) with more than 3.1 kg/m 2, 7.5 cm, and 4.2 mmHg lower BMI, waist circumference, and diastolic blood pressure, respectively, in rs846910-A, rs375319-A, and rs4844488-G allele carriers compared with noncarriers (P corrected <0.05). Conversely, carriers of the rs846906-T allele had significantly higher waist circumference and triglycerides and lower high-density lipoprotein-cholesterol exclusively in men (P corrected =0.028). The rs846906-T allele was also associated with a higher risk of MetS at 3 months of follow-up (odds ratio: 3.31, 95% confidence interval: 1.53-7.17, P corrected =0.014). No association was observed between HSD11B1 polymorphisms and BMI and MetS components in the population-based samples. Conclusions Our results indicate that HSD11B1 polymorphisms may contribute toward the development of MetS in psychiatric patients treated with potential weight gain-inducing psychotropic drugs, but do not
26 CFR 301.6223(b)-1 - Notice group.
2010-04-01
... 26 Internal Revenue 18 2010-04-01 2010-04-01 false Notice group. 301.6223(b)-1 Section 301.6223(b... ADMINISTRATION PROCEDURE AND ADMINISTRATION Assessment In General § 301.6223(b)-1 Notice group. (a) In general. If a group of partners having in the aggregate a 5 percent or more interest in the profits of a...
Interactions of Polyhomeotic with Polycomb Group Genes of Drosophila Melanogaster
Cheng, N. N.; Sinclair, DAR.; Campbell, R. B.; Brock, H. W.
1994-01-01
The Polycomb (Pc) group genes of Drosophila are negative regulators of homeotic genes, but individual loci have pleiotropic phenotypes. It has been suggested that Pc group genes might form a regulatory hierarchy, or might be members of a multimeric complex that obeys the law of mass action. Recently, it was shown that polyhomeotic (ph) immunoprecipitates in a multimeric complex that includes Pc. Here, we show that duplications of ph suppress homeotic transformations of Pc and Pcl, supporting ...
Expression and associations of TRAF1, BMI-1, ALDH1, and Lin28B in oral squamous cell carcinoma.
Wu, Tian-Fu; Li, Yi-Cun; Ma, Si-Rui; Bing-Liu; Zhang, Wen-Feng; Sun, Zhi-Jun
2017-04-01
Tumor necrosis factor receptor-associated factor 1, an adaptor protein of tumor necrosis factor 2, is involved in classical nuclear factor (NF)-κB activation and lymphocyte recruitment. However, less is known about the expression and association of tumor necrosis factor receptor-associated factor 1 with cancer stem cell markers in oral squamous cell carcinoma. This study aimed to investigate the expression of tumor necrosis factor receptor-associated factor 1 and stem cell characteristic markers (lin28 homolog B, B cell-specific Moloney murine leukemia virus integration site 1, and aldehyde dehydrogenase 1) in oral squamous cell carcinoma and analyze their relations. Paraffin-embedded tissues of 78 oral squamous cell carcinomas, 39 normal oral mucosa, and 12 oral dysplasia tissues were employed in tissue microarrays, and the expression of tumor necrosis factor receptor-associated factor 1, B cell-specific Moloney murine leukemia virus integration site 1, aldehyde dehydrogenase 1, and lin28 homolog B was measured by immunohistostaining and digital pathological analysis. The expression of tumor necrosis factor receptor-associated factor 1 was higher in the oral squamous cell carcinoma group as compared with the expression in the oral mucosa (p oral dysplasia (p oral squamous cell carcinoma. The patient survival rate was lower in the highly expressed tumor necrosis factor receptor-associated factor 1 group, although the difference was not significant. The clustering analysis showed that tumor necrosis factor receptor-associated factor 1 was most related to aldehyde dehydrogenase 1. These findings suggest that tumor necrosis factor receptor-associated factor 1 has potential direct/indirect regulations with the cancer stem cell markers in oral squamous cell carcinoma, which may help in further analysis of the cancer stem cell characteristics.
From Flies to Mice: The Emerging Role of Non-Canonical PRC1 Members in Mammalian Development
Directory of Open Access Journals (Sweden)
Izabella Bajusz
2018-02-01
Full Text Available Originally two types of Polycomb Repressive Complexes (PRCs were described, canonical PRC1 (cPRC1 and PRC2. Recently, a versatile set of complexes were identified and brought up several dilemmas in PRC mediated repression. These new class of complexes were named as non-canonical PRC1s (ncPRC1s. Both cPRC1s and ncPRC1s contain Ring finger protein (RING1, RNF2 and Polycomb group ring finger catalytic (PCGF core, but in ncPRCs, RING and YY1 binding protein (RYBP, or YY1 associated factor 2 (YAF2, replaces the Chromobox (CBX and Polyhomeotic (PHC subunits found in cPRC1s. Additionally, ncPRC1 subunits can associate with versatile accessory proteins, which determine their functional specificity. Homozygous null mutations of the ncPRC members in mice are often lethal or cause infertility, which underlines their essential functions in mammalian development. In this review, we summarize the mouse knockout phenotypes of subunits of the six major ncPRCs. We highlight several aspects of their discovery from fly to mice and emerging role in target recognition, embryogenesis and cell-fate decision making. We gathered data from stem cell mediated in vitro differentiation assays and genetically engineered mouse models. Accumulating evidence suggests that ncPRC1s play profound role in mammalian embryogenesis by regulating gene expression during lineage specification of pluripotent stem cells.
Altered expression of polycomb group genes in glioblastoma multiforme.
Directory of Open Access Journals (Sweden)
Gang Li
Full Text Available The Polycomb group (PcG proteins play a critical role in histone mediated epigenetics which has been implicated in the malignant evolution of glioblastoma multiforme (GBM. By systematically interrogating The Cancer Genome Atlas (TCGA, we discovered widespread aberrant expression of the PcG members in GBM samples compared to normal brain. The most striking differences were upregulation of EZH2, PHF19, CBX8 and PHC2 and downregulation of CBX7, CBX6, EZH1 and RYBP. Interestingly, changes in EZH2, PHF19, CBX7, CBX6 and EZH1 occurred progressively as astrocytoma grade increased. We validated the aberrant expression of CBX6, CBX7, CBX8 and EZH2 in GBM cell lines by Western blotting and qRT-PCR, and further the aberrant expression of CBX6 in GBM tissue samples by immunohistochemical staining. To determine if there was functional significance to the diminished CBX6 levels in GBM, CBX6 was overexpressed in GBM cells resulting in decreased proliferative capacity. In conclusion, aberrant expression of PcG proteins in GBMs may play a role in the development or maintenance of the malignancy.
BMI-1 Promotes Self-Renewal of Radio- and Temozolomide (TMZ)-Resistant Breast Cancer Cells.
Yan, Yanfang; Wang, Ying; Zhao, Pengxin; Ma, Weiyuan; Hu, Zhigang; Zhang, Kaili
2017-12-01
Breast cancer is a hormone-dependent malignancy and is the most prevalent cause of cancer-related mortality among females. Radiation therapy and chemotherapy are common treatments of breast cancer. However, tumor relapse and metastasis following therapy are major clinical challenges. The importance of B-lymphoma Moloney murine leukemia virus insertion region-1 (BMI-1) was implicated in cell proliferation, stem cell maintenance, and tumor initiation. We established radio- and temozolomide (TMZ)-resistant (IRC-R) MCF-7 and MDA-MB-231 cell lines to investigate the mechanism involved in therapeutic resistance. Cell proliferation and sphere number were dramatically elevated, and BMI-1 was remarkably upregulated, in IRC-R cells compared to parental cells. Silencing BMI-1 by RNA interference only affected the cell proliferation of IRC-R but not parental cells, suggesting the critical role of BMI-1 in radio- and TMZ resistance. We used a xenograft mice model to elucidate that BMI-1 was necessary in tumor development by assessing tumor volume and Ki67 expression. We found that Hedgehog (Hhg) signaling exerted synergized functions together with BMI-1, implicating the importance of BMI-1 in Hhg signaling. Downregulation of BMI-1 could be an effective strategy to suppress tumor growth, which supports the potential clinical use of targeting BMI-1 in breast cancer treatment.
Prognostic Significance of BMI-1 But Not MEL-18 Expression in Pulmonary Squamous Cell Carcinoma.
Abe, Sosei; Yamashita, Shin-Ichi; Miyahara, S O; Wakahara, Junichi; Yamamoto, Leona; Mori, Ryo; Imamura, Naoko; Yoshida, Yasuhiro; Waseda, Ryuichi; Hiratsuka, Masafumi; Shiraishi, Takeshi; Nabeshima, Kazuki; Iwasaki, Akinori
2017-04-01
We investigated the possibility of BMI-1 and MEL-18 to predict survival in patients with pulmonary squamous cell carcinoma. One hundred and ninety-nine patients underwent surgery in our Institute between 1995 and 2005. We used immunohistochemical (IHC) analysis to determine the expressions of BMI-1 and MEL-18 and compared them with clinicopathological factors and survival. Forty-one of 199 cases (21%) were BMI-1-positive. No correlation was found between BMI-1 and MEL-18 expression by IHC and clinicopathological factors. Five-year overall survival in the BMI-1-positive group (66.8%), but not MEL-18, was significantly better than that in the negative group (45.5%, p=0.04). In multivariate analysis, positive BMI-1 was a better prognostic factor of overall survival (hazard ratio (HR)=0.561, 95% confidence interval (CI)=0.271-1.16, p=0.12). BMI-1 expression, but not MEL-18, is associated with a favorable prognosis and is a possible prognostic factor of pulmonary squamous cell carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Bmi1 Is Required for Hedgehog Pathway-Driven Medulloblastoma Expansion
Directory of Open Access Journals (Sweden)
Lowell Evan Michael
2008-12-01
Full Text Available Inappropriate Hedgehog (Hh signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in transgenic mice expressing an oncogenic Hh effector, SmoA1, driven by a glial fibrillary acidic protein (GFAP promoter. Whereas 100% of SmoA1; Bmi1+/+ or SmoA1;Bmi1+/- mice examined between postnatal (P days 14 and 26 had typical medulloblastomas (N = 29, tumors were not detected in any of the SmoA1;Bmi1-/- animals examined (N = 6. Instead, small ectopic collections of cells were present in the region of greatest tumor load in SmoA1 animals, suggesting that medulloblastomas were initiated but failed to undergo expansion into frank tumors. Cells within these Bmi1-/- lesions expressed SmoA1 but were largely nonproliferative, in contrast to cells in Bmi1+/+ tumors (6.2% vs 81.9% PCNA-positive, respectively. Ectopic cells were negative for the progenitor marker nestin, strongly GFAP-positive, and highly apoptotic, relative to Bmi1+/+ tumor cells (29.6% vs 6.3% TUNEL-positive. The alterations in proliferation and apoptosis in SmoA1;Bmi1-/- ectopic cells are associated with reduced levels of Cyclin D1 and elevated expression of cyclin-dependent kinase inhibitor p19Arf, two inversely regulated downstream targets of Bmi1. These data provide the first demonstration that Bmi1 is required for spontaneous de novo development of a solid tumor arising in the brain, suggest a crucial role for Bmi1-dependent, nestin-expressing progenitor cells in medulloblastoma expansion, and implicate Bmi1 as a key factor required for Hh pathway-driven tumorigenesis.
Directory of Open Access Journals (Sweden)
Fabiana Perna
2015-04-01
Full Text Available Epigenetic regulation of key transcriptional programs is a critical mechanism that controls hematopoietic development, and, thus, aberrant expression patterns or mutations in epigenetic regulators occur frequently in hematologic malignancies. We demonstrate that the Polycomb protein L3MBTL1, which is monoallelically deleted in 20q- myeloid malignancies, represses the ability of stem cells to drive hematopoietic-specific transcriptional programs by regulating the expression of SMAD5 and impairing its recruitment to target regulatory regions. Indeed, knockdown of L3MBTL1 promotes the development of hematopoiesis and impairs neural cell fate in human pluripotent stem cells. We also found a role for L3MBTL1 in regulating SMAD5 target gene expression in mature hematopoietic cell populations, thereby affecting erythroid differentiation. Taken together, we have identified epigenetic priming of hematopoietic-specific transcriptional networks, which may assist in the development of therapeutic approaches for patients with anemia.
Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien; Pira, Dorcas; Angrand, Pierre-Olivier
2012-05-01
Polycomb repression controls the expression of hundreds of genes involved in development and is mediated by essentially two classes of chromatin-associated protein complexes. The Polycomb repressive complex 2 (PRC2) trimethylates histone H3 at lysine 27, an epigenetic mark that serves as a docking site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain. Using biochemical approaches and a novel in vivo imaging assay, we show that the short CBX2-2 isoform lacking the Pc box, does not participate in PRC1 protein complexes, but self-associates in vivo and forms complexes of high molecular weight. Furthermore, the CBX2 short isoform is still able to repress transcription, suggesting that Polycomb repression might occur in the absence of PRC1 formation.
DEFF Research Database (Denmark)
Cooper, Sarah; Grijzenhout, Anne; Underwood, Elizabeth
2016-01-01
crosstalk between these modifications is critical for the formation of stable Polycomb domains at target gene loci. While the molecular mechanism for recognition of H3K27me3 by PRC1 is well defined, the interaction of PRC2 with H2AK119u1 is poorly understood. Here we demonstrate a critical role for the PRC2...... cofactor Jarid2 in mediating the interaction of PRC2 with H2AK119u1. We identify a ubiquitin interaction motif at the amino-terminus of Jarid2, and demonstrate that this domain facilitates PRC2 localization to H2AK119u1 both in vivo and in vitro. Our findings ascribe a critical function to Jarid2...... and define a key mechanism that links PRC1 and PRC2 in the establishment of Polycomb domains....
Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan
2017-10-06
We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.
Bmi-1 Regulates Extensive Erythroid Self-Renewal
Directory of Open Access Journals (Sweden)
Ah Ram Kim
2015-06-01
Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.
Report of the B-factory Group: 1, Physics and techniques
International Nuclear Information System (INIS)
Feldman, G.J.; Cassel, D.G.; Siemann, R.H.
1989-01-01
The study of B meson decay appears to offer a unique opportunity to measure basic parameters of the Standard Model, probe for interactions mediated by higher mass particles, and investigate the origin of CP violation. These opportunities have been enhanced by the results of two measurements. The first is the measurement of a long B meson lifetime. In addition to allowing a simpler identification of B mesons and a measurement of the time of their decay, this observation implies that normal decays are suppressed, making rare decays more prevalent. The second measurement is that neutral B mesons are strongly mixed. This enhances the possibilities for studying CP violation in the B system. The CESR storage ring is likely to dominate the study of B physics in e + e/sup /minus// annihilations for about the next five years. First, CESR has already reached a luminosity of 10 32 cm/sup /minus/1/ sec/sup /minus/1/ and has plans for improvements which may increase the luminosity by a factor of about five. Second, a second-generation detector, CLEO II, will start running in 1989. Given this background, the main focus of this working group was to ask what is needed for the mid- to late-1990 s. Many laboratories are thinking about new facilities involving a variety of techniques. To help clarify the choices, we focused on one example of CP violation and estimated the luminosity required to measure it using different techniques. We will briefly describe the requirements for detectors matched to these techniques. In particular, we will give a conceptual design of a possible detector for asymmetric collisions at the Υ(4S) resonance, one of the attractive techniques which will emerge from this study. A discussion of accelerator technology issues for using these techniques forms the second half of the B-factory Group report, and it follows in these proceedings. 34 refs., 2 figs., 2 tabs
Polycomb complexes and silencing mechanisms
DEFF Research Database (Denmark)
Lund, Anders H; van Lohuizen, Maarten
2004-01-01
Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....
Wang, Min-Cong; Jiao, Min; Wu, Tao; Jing, Li; Cui, Jie; Guo, Hui; Tian, Tao; Ruan, Zhi-ping; Wei, Yong-Chang; Jiang, Li-Li; Sun, Hai-Feng; Huang, Lan-Xuan; Nan, Ke-Jun; Li, Chun-Li
2016-01-01
Cancer stem cell theory indicates cancer stem cells are the key to promote tumor invasion and metastasis. Studies showed that BMI-1 could promote self-renew, differentiation and tumor formation of CSCs and invasion/metastasis of human cancer. However, whether BMI-1 could regulate invasion and metastasis ability of CSCs is still unclear. In our study, we found that up-regulated expression of BMI-1 was associated with tumor invasion, metastasis and poor survival of pancreatic cancer patients. CD133+ cells were obtained by using magnetic cell sorting and identified of CSCs properties such as self-renew, multi-differentiation and tumor formation ability. Then, we found that BMI-1 expression was up-regulated in pancreatic cancer stem cells. Knockdown of BMI-1 expression attenuated invasion ability of pancreatic cancer stem cells in Transwell system and liver metastasis capacity in nude mice which were injected CSCs through the caudal vein. We are the first to reveal that BMI-1 could promote invasion and metastasis ability of pancreatic cancer stem cells. Finally, we identified that BMI-1 expression activating PI3K/AKT singing pathway by negative regulating PTEN was the main mechanism of promoting invasion and metastasis ability of pancreatic CSCs. In summary, our findings indicate that BMI-1 could be used as the therapeutic target to inhibiting CSCs-mediated pancreatic cancer metastasis. PMID:26840020
DEFF Research Database (Denmark)
Hernández-Muñoz, Inmaculada; Lund, Anders H; van der Stoop, Petra
2005-01-01
X inactivation involves the stable silencing of one of the two X chromosomes in XX female mammals. Initiation of this process occurs during early development and involves Xist (X-inactive-specific transcript) RNA coating and the recruitment of Polycomb repressive complex (PRC) 2 and PRC1 proteins...
Tan, Xue Fei; Uddin, Zia; Park, Chanin; Song, Yeong Hun; Son, Minky; Lee, Keun Woo; Park, Ki Hun
2017-04-15
Protein tyrosine phosphatase 1B (PTP1B) plays important role in diabetes, obesity and cancer. The methanol extract of the gum resin of Garcinia hanburyi (G. hanburyi) showed potent PTP1B inhibition at 10µg/ml. The active compounds were identified as prenylated caged xanthones (1-9) which inhibited PTP1B in dose-dependent manner. Carboxybutenyl group within caged motif (A ring) was found to play a critical role in enzyme inhibition such as 1-6 (IC 50 s=0.47-4.69µM), whereas compounds having hydroxymethylbutenyl 7 (IC 50 =70.25µM) and methylbutenyl 8 (IC 50 >200µM) showed less activity. The most potent inhibitor, gambogic acid 1 (IC 50 =0.47µM) showed 30-fold more potency than ursolic acid (IC 50 =15.5µM), a positive control. In kinetic study, all isolated xanthones behaved as competitive inhibitors which were fully demonstrated with K m , V max and K ik /K iv ratio. It was also proved that inhibitor 1 operated under the enzyme isomerization model having k 5 =0.0751µM - 1 S - 1 , k 6 =0.0249µM - 1 S - 1 and K i app =0.499µM. To develop a pharmacophore model, we explored the binding sites of compound 1 and 7 in PTP1B. These modeling results were in agreement with our findings, which revealed that the inhibitory activities are tightly related to caged motif and prenyl group in A ring. Copyright © 2017 Elsevier Ltd. All rights reserved.
26 CFR 301.6226(b)-1 - 5-percent group.
2010-04-01
... 26 Internal Revenue 18 2010-04-01 2010-04-01 false 5-percent group. 301.6226(b)-1 Section 301.6226... ADMINISTRATION PROCEDURE AND ADMINISTRATION Assessment In General § 301.6226(b)-1 5-percent group. (a) In general. All members of a 5-percent group shall join in filing any petition for judicial review. The...
2-[1-(Methylsulfanylnaphtho[2,1-b]furan-2-yl]acetic acid
Directory of Open Access Journals (Sweden)
Uk Lee
2008-02-01
Full Text Available The title compound, C15H12O3S, was prepared by alkaline hydrolysis of ethyl 2-{1-(methylsulfanylnaphtho[2,1-b]furan-2-yl}acetate. The crystal structure is stabilized by CH2—H...π interactions between the methyl H atoms of the methylsulfanyl substituent and the central benzene ring of the naphthofuran system, and by inversion-related intermolecular O—H...O hydrogen bonds between the carboxyl groups.
Algebra 1 groups, rings, fields and arithmetic
Lal, Ramji
2017-01-01
This is the first in a series of three volumes dealing with important topics in algebra. It offers an introduction to the foundations of mathematics together with the fundamental algebraic structures, namely groups, rings, fields, and arithmetic. Intended as a text for undergraduate and graduate students of mathematics, it discusses all major topics in algebra with numerous motivating illustrations and exercises to enable readers to acquire a good understanding of the basic algebraic structures, which they can then use to find the exact or the most realistic solutions to their problems.
Bmi1 is required for hedgehog pathway-driven medulloblastoma expansion
Michael, Lowell Evan; Westerman, Bart A.; Ermilov, Alexandre N.; Wang, Aiqin; Ferris, Jennifer; Liu, Jianhong; Blom, Marleen; Ellison, David W.; van Lohuizen, Maarten; Dlugosz, Andrzej A.
2008-01-01
Inappropriate Hedgehog (Hh) signaling underlies development of a subset of medulloblastomas, and tumors with elevated HH signaling activity express the stem cell self-renewal gene BMI1. To test whether Bmi1 is required for Hh-driven medulloblastoma development, we varied Bmi1 gene dosage in
Namgoong, Suhg; Cheong, Hyun Sub; Kim, Ji On; Kim, Lyoung Hyo; Na, Han Sung; Koh, In Song; Chung, Myeon Woo; Shin, Hyoung Doo
2015-11-01
Organic anion-transporting polypeptide (OATP; gene symbol, SLCO) transporters are generally involved in the uptake of multiple drugs and their metabolites at most epithelial barriers. The pattern of single-nucleotide polymorphisms (SNPs) in these transporters may be determinants of interindividual variability in drug disposition and response. The objective of this study was to define the distribution of SNPs of three SLCO genes, SLCO1B1, SLCO1B3, and SLCO2B1, in a Korean population and other ethnic groups. The study was screened using the Illumina GoldenGate assay for genomic DNA from 450 interethnic subjects, including 11 pharmacogenetic core variants and 76 HapMap tagging SNPs. The genotype distribution of the Korean population was similar to East Asian populations, but significantly different from African American and European American cohorts. These interethnic differences will be useful information for prospective studies, including genetic association and pharmacogenetic studies of drug metabolism by SLCO families. Copyright © 2015 Elsevier B.V. All rights reserved.
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias
2016-01-07
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.
Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali
2016-07-21
Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.
Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin
2016-01-01
Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837
c-Myb and its target Bmi1 are required for p190BCR/ABL leukemogenesis in mouse and human cells.
Waldron, T; De Dominici, M; Soliera, A R; Audia, A; Iacobucci, I; Lonetti, A; Martinelli, G; Zhang, Y; Martinez, R; Hyslop, T; Bender, T P; Calabretta, B
2012-04-01
Expression of c-Myb is required for normal hematopoiesis and for proliferation of myeloid leukemia blasts and a subset of T-cell leukemia, but its role in B-cell leukemogenesis is unknown. We tested the role of c-Myb in p190(BCR/ABL)-dependent B-cell leukemia in mice transplanted with p190(BCR/ABL)-transduced marrow cells with a c-Myb allele (Myb(f/d)) and in double transgenic p190(BCR/ABL)/Myb(w/d) mice. In both models, loss of a c-Myb allele caused a less aggressive B-cell leukemia. In p190(BCR/ABL)-expressing human B-cell leukemia lines, knockdown of c-Myb expression suppressed proliferation and colony formation. Compared with c-Myb(w/f) cells, expression of Bmi1, a regulator of stem cell proliferation and maintenance, was decreased in pre-B cells from Myb(w/d) p190(BCR/ABL) transgenic mice. Ectopic expression of a mutant c-Myb or Bmi1 enhanced the proliferation and colony formation of Myb(w/d) p190(BCR/ABL) B-cells; by contrast, Bmi1 downregulation inhibited colony formation of p190(BCR/ABL)-expressing murine B cells and human B-cell leukemia lines. Moreover, c-Myb interacted with a segment of the human Bmi1 promoter and enhanced its activity. In blasts from 19 Ph(1) adult acute lymphoblastic leukemia patients, levels of c-Myb and Bmi1 showed a positive correlation. Together, these findings support the existence of a c-Myb-Bmi1 transcription-regulatory pathway required for p190(BCR/ABL) leukemogenesis.
DEFF Research Database (Denmark)
Andersson, Ehm A; Holst, Birgitte; Sparsø, Thomas
2010-01-01
OBJECTIVE: Common variants in the melatonin receptor type 1B (MTNR1B) locus have been shown to increase fasting plasma glucose (FPG) and the risk of type 2 diabetes. The aims of this study were to evaluate whether nonsynonymous variants in MTNR1B associate with monogenic forms of hyperglycemia...... specific, and none of the investigated MTNR1B variants associated with type 2 diabetes. The common 24E variant associated with increased prevalence of obesity (odds ratio 1.20 [1.08-1.34]; P = 8.3 x 10(-4)) and increased BMI (beta = 0.5 kg/m(2); P = 1.2 x 10(-5)) and waist circumference (beta = 1.2 cm; P...
REST-mediated recruitment of polycomb repressor complexes in mammalian cells
DEFF Research Database (Denmark)
Dietrich, Nikolaj; Lerdrup, Mads; Landt, Eskild
2012-01-01
Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1......, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest¿/¿ and Eed¿/¿ mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently...... of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest¿/¿ mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context...
Polycomb group proteins in cell cycle progression and cancer
DEFF Research Database (Denmark)
Pasini, Diego; Bracken, Adrian P; Helin, Kristian
2004-01-01
Epigenetic deregulation of gene expression is emerging as key mechanism in tumorigenesis. Deregulated activity of the chromatin remodeling Polycomb Repressive Complex 2 (PRC2) has recently been shown to be a frequent event in human tumors. Here we discuss these findings and speculate on the role ...
Polycomb complexes act redundantly to repress genomic repeats and genes
DEFF Research Database (Denmark)
Leeb, Martin; Pasini, Diego; Novatchkova, Maria
2010-01-01
Polycomb complexes establish chromatin modifications for maintaining gene repression and are essential for embryonic development in mice. Here we use pluripotent embryonic stem (ES) cells to demonstrate an unexpected redundancy between Polycomb-repressive complex 1 (PRC1) and PRC2 during...... the formation of differentiated cells. ES cells lacking the function of either PRC1 or PRC2 can differentiate into cells of the three germ layers, whereas simultaneous loss of PRC1 and PRC2 abrogates differentiation. On the molecular level, the differentiation defect is caused by the derepression of a set...
Energy Technology Data Exchange (ETDEWEB)
Guebitz, Raphael [Asklepios Hospital Altona, Hamburg (Germany). Dept. of Radiology and Neuroradiology; Lange, Tobias; Gosheger, Georg [University Hospital Muenster (Germany). Dept. of Orthopaedics and Tumor Orthopaedics; Heindel, Walter; Allkemper, Thomas [University Hospital Muenster (Germany). Dept. of Clinical Radiology; Stehling, Christoph [Sankt-Barbara Hospital Ham-Heessen, Hamm (Germany). Clinic for Radiology and Neuroradiology; Gerss, Joachim [Muenster Univ. (Germany). Inst. of Biostatistics and Clinical Research; Kanthak, Christian [Fraunhofer MEVIS, Bremen (Germany). Inst. for Medical Image Computing; Schulte, Tobias L. [Bochum Univ. St. Josef Hospital (Germany). Dept. of Orthopaedics and Trauma Surgery
2018-02-15
To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.
International Nuclear Information System (INIS)
Guebitz, Raphael; Lange, Tobias; Gosheger, Georg; Heindel, Walter; Allkemper, Thomas; Stehling, Christoph; Gerss, Joachim; Kanthak, Christian; Schulte, Tobias L.
2018-01-01
To assess the T1ρ range of lumbar intervertebral discs in healthy asymptomatic individuals at 1.5 T and to investigate the influence of age, body mass index (BMI), gender, and lumbar level on T1ρ relaxation. In a prospective study, a total of 81 volunteers aged 20 - 80 years were included in this study and divided into three age groups (A: 20 - 39y; B: 40 - 59y; C: 60 - 80y). All of the volunteers underwent magnetic resonance imaging (MRI) at 1.5 T with acquisition of sagittal T1ρ images. The calculated T1ρ relaxation times were correlated with age, BMI, gender, and lumbar level relative to the total disc, the annulus fibrosus, and the nucleus pulposus. Age had a significant influence on T1ρ relaxation times at all lumbar levels, with increasing age being associated with reduced relaxation times. There was also a significant difference between age groups A vs. C and B vs. C (P = 0.0008 and P = 0.0149, respectively). No significant differences in T1ρ relaxation time were observed between men and women (P > 0.05). BMI showed a significant negative correlation with T1ρ relaxation times (P < 0.0001). Analysis of the lumbar level revealed a significant decrease in relaxation times from L1/2 to L5 / S1 (P = 0.0013). Increasing age correlated significantly with advanced lumbar disc degeneration in asymptomatic individuals, particularly in those aged 60 or older. Increasing BMI correlated significantly with increasing degeneration. The lower discs showed more degeneration than the upper ones.
BMI trajectory groups in veterans of the Iraq and Afghanistan wars.
Rosenberger, Patricia H; Ning, Yuming; Brandt, Cynthia; Allore, Heather; Haskell, Sally
2011-09-01
The study sought to determine BMI trajectories in Iraq/Afghanistan veterans over 6 years and to examine sociodemographic factors associated with BMI trajectory membership. Our study sample included 16,656 veterans post-deployment and entering the Veteran Healthcare Administration (VHA) healthcare system. We used national VHA administrative sociodemographic data, tracked veteran BMI for 6 years, and used trajectory modeling to identify BMI trajectories and sociodemographic characteristics associated with trajectory membership. Five trajectory groups determined in the full sample were primarily differentiated by their post-deployment initial BMI: "healthy" (14.1%), "overweight" (36.3%), "borderline obese" (27.9%), "obese" (15.7%), and "severely obese" (6.0). Being female, younger, and white were associated with lower initial BMI trajectory group membership (p'seducation and white female Veterans were associated with the lowest initial BMI group (p'sEducation level and racial status are differentially related to BMI trajectory by gender. Published by Elsevier Inc.
BMI1 and Mel-18 oppositely regulate carcinogenesis and progression of gastric cancer.
Zhang, Xiao-Wei; Sheng, Ya-Ping; Li, Qian; Qin, Wei; Lu, You-Wei; Cheng, Yu-Fan; Liu, Bing-Ya; Zhang, Feng-Chun; Li, Jin; Dimri, Goberdhan P; Guo, Wei-Jian
2010-02-21
The BMI1 oncogene is overexpressed in several human malignancies including gastric cancer. In addition to BMI1, mammalian cells also express Mel-18, which is closely related to BMI1. We have reported that Mel-18 functions as a potential tumor suppressor by repressing the expression of BMI1 and consequent downregulation of activated AKT in breast cancer cells. However, the mechanisms of BMI1 overexpression and the role of Mel-18 in other cancers are still not clear. The purpose of this study is to investigate the role of BMI1 and Mel-18 in gastric cancer. BMI1 was found to be overexpressed in gastric cancer cell lines and gastric tumors. Overexpression of BMI1 correlated with advanced clinical stage and lymph node metastasis; while the expression of Mel-18 negatively correlated with BMI1. BMI1 but not Mel-18 was found to be an independent prognostic factor. Downregulation of BMI1 by Mel-18 overexpression or knockdown of BMI1 expression in gastric cancer cell lines led to upregulation of p16 (p16INK4a or CDKN2A) in p16 positive cell lines and reduction of phospho-AKT in both p16-positive and p16-negative cell lines. Downregulation of BMI1 was also accompanied by decreased transformed phenotype and migration in both p16- positive and p16-negative gastric cancer cell lines. In the context of gastric cancer, BMI1 acts as an oncogene and Mel-18 functions as a tumor suppressor via downregulation of BMI1. Mel-18 and BMI1 may regulate tumorigenesis, cell migration and cancer metastasis via both p16- and AKT-dependent growth regulatory pathways.
The associations of Bmi-1 with progression of glomerular chronic kidney disease .
Yang, Xiaoxia; Bai, Ming; Ning, Xiaoxuan; Ma, Feng; Liu, Limin; Liu, Ting; Liu, Minna; Wang, Hanmin; Sun, Shiren
2018-02-01
Our previous studies indicated that Bmi-1 plays an important role in hypoxia-induced tubular epithelial-mesenchymal transition and the development of kidney fibrosis in cellular and animal models. However, circulating Bmi-1 levels in human chronic kidney disease (CKD) and their relation to progression remains unknown. We conducted a post-hoc analysis of a prospective cohort study. The blood samples and clinical data of 230 patients with glomerular CKD and 67 healthy adults were prospectively collected between January 2010 and June 2012. Serum Bmi-1 was measured using enzyme-linked immunosorbent assay (ELISA). CKD patients had significantly higher serum Bmi-1 concentrations than the healthy controls (496.4 (363.1 - 675.4) pg/mL compared with 257.3 (235.4 - 303.8) pg/mL, p Bmi-1 level inversely correlated with the estimated glomerular filtration rate (eGFR) (r = -0.346, p Bmi-1 levels and serum creatinine, blood urea nitrogen, cystatin C concentration, and the severity of tubulointerstitial fibrosis (r = 0.248, p Bmi-1 level was associated with a shorter duration of renal survival. Cox multivariate analyses further demonstrated that serum Bmi-1 concentration was an independent prognostic factor for CKD patients (HR = 6.48, p Bmi-1 levels were associated with adverse kidney disease outcome, suggesting that Bmi-1 is a novel biomarker for glomerular CKD progression. More data from larger longitudinal studies are required to validate our findings. .
Fu, Wei-Ming; Tang, Li-Peng; Zhu, Xiao; Lu, Ying-Fei; Zhang, Yan-Ling; Lee, Wayne Yuk-Wai; Wang, Hua; Yu, Yang; Liang, Wei-Cheng; Ko, Chun-Hay; Xu, Hong-Xi; Kung, Hsiang-Fu; Zhang, Jin-Fang
2015-01-01
Traditional Chinese medicine is recently emerged as anti-cancer therapy or adjuvant with reduced side-effects and improved quality of life. In the present study, an active ingredient, 1,6,7-trihydroxyxanthone (THA), derived from Goodyera oblongifolia was found to strongly suppress cell growth and induce apoptosis in liver cancer cells. MicroRNAs are a group of small non-coding RNAs that regulate gene expression at post-transcriptional levels. Our results demonstrated that miR-218 was up-regulated and oncogene Bmi-1 was down-regulated by THA treatment. Further investigation showed that THA-induced-miR-218 up-regulation could lead to activation of tumor suppressor P16(Ink4a) and P14(ARF), the main down-stream targets of Bmi-1. In conclusion, THA might be a potential anti-cancer drug candidate, at least in part, through the activation of miR-218 and suppression of Bmi-1 expression.
Lower Bmi-1 Expression May Predict Longer Survival of Colon Cancer Patients
Directory of Open Access Journals (Sweden)
Xiaodong Li
2016-11-01
Full Text Available Background: This study aimed to investigate the Bmi-1 expression and the clinical significance in colon cancer (CC. Patients and Methods: Bmi-1 expression in tumor tissue and the corresponding normal tissue was detected using immunohistological staining. The correlations between Bmi-1 expression and clinicopathological characteristics and the overall survival (OS time were analyzed. Results: The median H-scores of Bmi-1 in CC tissues and the corresponding tissues were 80.0 (0-270 and 5.0 (0-90, with no statistically significant difference (Z=-13.7, PP = 0.123. The survival rates of patients with low Bmi-1 expression were higher than those of patients with high Bmi-1 expression but the differences were not statistically significant. Conclusion: Bmi-1 expression in CC tissue is significantly higher than that in corresponding normal tissue. While there may be a trend towards improved survival, this is not statistically significant.
Practical route to the left wing of CTX1B and total syntheses of CTX1B and 54-deoxyCTX1B.
Yamashita, Shuji; Takeuchi, Katsutoshi; Koyama, Takuya; Inoue, Masayuki; Hayashi, Yujiro; Hirama, Masahiro
2015-02-02
Ciguatoxins, the principal causative agents of ciguatera seafood poisoning, are extremely large polycyclic ethers. We report herein a reliable route for constructing the left wing of CTX1B, which possesses the acid/base/oxidant-sensitive bisallylic ether moiety, by a 6-exo radical cyclization/ring-closing metathesis strategy. This new route enabled us to achieve the second-generation total synthesis of CTX1B and the first synthesis of 54-deoxyCTX1B. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Polycomb-group genes sustaining the stem cell activity
International Nuclear Information System (INIS)
Takihara, Yoshihiro
2006-01-01
Polycomb-group genes (PcG) have a role in constituting the cellular memory mechanisms through which the once expressed phenotypes during development are transmitted thereafter and this review describes, together with authors' findings of sustaining hematopoietic stem cell activity by the PcG products, what molecular bases, involving the control of histone code, are concerned in the memory. Recent investigations have gradually elucidated the outline of epigenetic control mechanisms of the memory: messages are set up as a histone code in the chromatin and the PcG complex recruited by recognition of the code regulates the chromatin structure leading to DNA transcription and maintenance of the phenotype. Proliferation of hematopoietic stem cells ex vivo will be possible if exact and detailed mechanisms for PcG are made clear in future. Such ex vivo techniques are especially awaited for marrow remodeling treatment of hematopoietic failure induced by radiation exposure. (T.I.)
Bmi-1 confers adaptive radioresistance to KYSE-150R esophageal carcinoma cells
Energy Technology Data Exchange (ETDEWEB)
Wang, Guanyu [Department of General Surgery, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Liu, Luying [Department of Radiotherapy, Zhejiang Cancer Hospital, Hangzhou (China); Sharma, Sherven [David Geffen School of Medicine at UCLA, and the Department of Veterans Affairs, Los Angeles, CA (United States); Liu, Hai; Yang, Weifang; Sun, Xiaonan [Department of Radiotherapy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China); Dong, Qinghua, E-mail: dongqinghua@zju.edu.cn [Biomedical Research Center, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou (China)
2012-08-24
Highlights: Black-Right-Pointing-Pointer Adaptive radioresistant KYSE-150R cells expressed high level of Bmi-1. Black-Right-Pointing-Pointer Bmi-1 depletion sensitized KYSE-150R cells to RT. Black-Right-Pointing-Pointer Bmi-1 depletion increased the generation of ROS in KYSE-150R cells exposed to radiation. Black-Right-Pointing-Pointer Bmi-1 depletion impaired DNA repair capacities in KYSE-150R cells exposed to radiation. -- Abstract: Radiotherapy (RT) is a major modality of cancer treatment. However, tumors often acquire radioresistance, which causes RT to fail. The exact mechanisms by which tumor cells subjected to fractionated irradiation (FIR) develop an adaptive radioresistance are largely unknown. Using the radioresistant KYSE-150R esophageal squamous cell carcinoma (ESCC) model, which was derived from KYSE-150 parental cells using FIR, the role of Bmi-1 in mediating the radioadaptive response of ESCC cells to RT was investigated. The results showed that the level of Bmi-1 expression was significantly higher in KYSE-150R cells than in the KYSE-150 parental cells. Bmi-1 depletion sensitized the KYSE-150R cells to RT mainly through the induction of apoptosis, partly through the induction of senescence. A clonogenic cell survival assay showed that Bmi-1 depletion significantly decreased the radiation survival fraction in KYSE-150R cells. Furthermore, Bmi-1 depletion increased the generation of reactive oxygen species (ROS) and the expression of oxidase genes (Lpo, Noxo1 and Alox15) in KYSE-150R cells exposed to irradiation. DNA repair capacities assessed by {gamma}-H2AX foci formation were also impaired in the Bmi-1 down-regulated KYSE-150R cells. These results suggest that Bmi-1 plays an important role in tumor radioadaptive resistance under FIR and may be a potent molecular target for enhancing the efficacy of fractionated RT.
Darwish, Noureldien H E; Sudha, Thangirala; Godugu, Kavitha; Elbaz, Osama; Abdelghaffar, Hasan A; Hassan, Emad E A; Mousa, Shaker A
2016-09-06
Acute myeloid leukemia (AML) patients show high relapse rates and some develop conventional chemotherapy resistance. Leukemia Stem Cells (LSCs) are the main player for AML relapses and drug resistance. LSCs might rely on the B-cell-specific Moloney murine leukemia virus integration site-1 (BMI-1) in promoting cellular proliferation and survival. Growth of LSCs in microenvironments that are deprived of nutrients leads to up-regulation of the signaling pathways during the progression of the disease, which may illustrate the sensitivity of LSCs to inhibitors of those signaling pathways as compared to normal cells. We analyzed the expression of LSC markers (CD34, CLL-1, TIM-3 and BMI-1) using quantitative RT-PCR in bone marrow samples of 40 AML patients of different FAB types (M1, M2, M3, M4, M5, and M7). We also studied the expression of these markers in 2 AML cell lines (Kasumi-1 and KG-1a) using flow cytometry and quantitative RT-PCR. The overexpression of TIM-3, CLL-1, and BMI-1 was markedly correlated with poor prognosis in these patients. Our in vitro findings demonstrate that targeting BMI-1, which markedly increased in the leukemic cells, was associated with marked decrease in leukemic burden. This study also presents results for blocking LSCs' surface markers CD44, CLL-1, and TIM-3. These markers may play an important role in elimination of AML. Our study indicates a correlation between the expression of markers TIM-3, CLL-1, and especially of BMI-1 and the aggressiveness of AML and thus the potential impact of prognosis and therapies that target LSCs on improving the cure rates.
Prognostic relevance of Bmi-1 expression and autoantibodies in esophageal squamous cell carcinoma
International Nuclear Information System (INIS)
Liu, Wan-li; Li, Man-zhi; Song, Li-bing; Zeng, Mu-sheng; Guo, Xian-zhi; Zhang, Lan-jun; Wang, Jun-ye; Zhang, Ge; Guan, Su; Chen, Yu-min; Kong, Qing-li; Xu, Li-hua
2010-01-01
Overexpression of Bmi-1 has been observed in a variety of cancers, and it has been suggested to be an independent prognostic marker for the patients. The objective of this study was to determine the level of Bmi-1 expression or its autoantibodies in human esophageal squamous cell carcinoma (ESCC) and to correlate it with clinicopathologic data. We first examined Bmi-1 expression in ESCC cell lines and tumor samples by RT-PCR and Western blot analysis. We then analyzed Bmi-1 protein expression in 171 clinicopathologically characterized ESCC cases by immunohistochemistry. In addition, we detected its autoantibodies in sera of patients with ESCC by ELISA. We found that Bmi-1 expression was higher in the immortalized cells, cancer cell lines and most cancer tissue than in non-tumorous control tissue at both mRNA and protein level. In addition, Bmi-1 expression was observed in 64.3% (110 of 171) archive ESCC specimen by immunohistochemistry analysis, and the location of Bmi-1 in ESCC was in the nuclei instead of cytoplasm of tumor cells. There was a significant difference of Bmi-1 expression in patients categorized according to stage (P = 0.003) and pN classification (P = 0.047). Multivariate analysis suggested that Bmi-1 expression was an independent prognostic marker for ESCC patients. A prognostic significance of Bmi-1 was also found in the subgroup of T3~T4 and N1 tumor classification. Bmi-1 autoantibodies were detected in sera of 39.0% (62 of 159) ESCC patients. The correlations between anti-Bmi-1 antibodies and tumor stage (P = 0.040), or lymph node status (P < 0.001) were significant. Our results suggest that Bmi-1 protein is a valuable marker of ESCC progression. The presence of Bmi-1 autoantibodies in sera from patients with ESCC may have clinical utility in esophageal cancer diagnosis
Convergence of BMI1 and CHD7 on ERK Signaling in Medulloblastoma
Directory of Open Access Journals (Sweden)
Sara Badodi
2017-12-01
Full Text Available Summary: We describe molecular convergence between BMI1 and CHD7 in the initiation of medulloblastoma. Identified in a functional genomic screen in mouse models, a BMI1High;CHD7Low expression signature within medulloblastoma characterizes patients with poor overall survival. We show that BMI1-mediated repression of the ERK1/2 pathway leads to increased proliferation and tumor burden in primary human MB cells and in a xenograft model, respectively. We provide evidence that repression of the ERK inhibitor DUSP4 by BMI1 is dependent on a more accessible chromatin configuration in G4 MB cells with low CHD7 expression. These findings extend current knowledge of the role of BMI1 and CHD7 in medulloblastoma pathogenesis, and they raise the possibility that pharmacological targeting of BMI1 or ERK may be particularly indicated in a subgroup of MB with low expression levels of CHD7. : Badodi et al. find convergence of the chromatin modifiers BMI1 and CHD7 in medulloblastoma pathogenesis, and they show that this pathway regulates tumor proliferation and growth via ERK signaling. Keywords: BMI1, CHD7, DUSP4, ERK, medulloblastoma, PcG genes, mouse models, epigenetics, chromatin
Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L
2003-02-01
Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.
Transcription factors AS1 and AS2 interact with LHP1 to repress KNOX genes in Arabidopsis.
Li, Zhongfei; Li, Bin; Liu, Jian; Guo, Zhihao; Liu, Yuhao; Li, Yan; Shen, Wen-Hui; Huang, Ying; Huang, Hai; Zhang, Yijing; Dong, Aiwu
2016-12-01
Polycomb group proteins are important repressors of numerous genes in higher eukaryotes. However, the mechanism by which Polycomb group proteins are recruited to specific genes is poorly understood. In Arabidopsis, LIKE HETEROCHROMATIN PROTEIN 1 (LHP1), also known as TERMINAL FLOWER 2, was originally proposed as a subunit of polycomb repressive complex 1 (PRC1) that could bind the tri-methylated lysine 27 of histone H3 (H3K27me3) established by the PRC2. In this work, we show that LHP1 mainly functions with PRC2 to establish H3K27me3, but not with PRC1 to catalyze monoubiquitination at lysine 119 of histone H2A. Our results show that complexes of the transcription factors ASYMMETRIC LEAVES 1 (AS1) and AS2 could help to establish the H3K27me3 modification at the chromatin regions of Class-I KNOTTED1-like homeobox (KNOX) genes BREVIPEDICELLUS and KNAT2 via direct interactions with LHP1. Additionally, our transcriptome analysis indicated that there are probably more common target genes of AS1 and LHP1 besides Class-I KNOX genes during leaf development in Arabidopsis. © 2016 Institute of Botany, Chinese Academy of Sciences.
File list: Oth.Neu.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.10.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.10.BMI1.AllCell.bed ...
File list: Oth.Neu.05.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.05.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.05.BMI1.AllCell.bed ...
File list: Oth.Neu.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.50.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.50.BMI1.AllCell.bed ...
File list: Oth.Neu.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Neu.20.BMI1.AllCell hg19 TFs and others BMI1 Neural SRX109477,SRX109480,SRX1094...82,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Neu.20.BMI1.AllCell.bed ...
Soekadar, Surjo R; Witkowski, Matthias; Mellinger, Jürgen; Ramos, Ander; Birbaumer, Niels; Cohen, Leonardo G
2011-10-01
Event-related desynchronization (ERD) of sensori-motor rhythms (SMR) can be used for online brain-machine interface (BMI) control, but yields challenges related to the stability of ERD and feedback strategy to optimize BMI learning.Here, we compared two approaches to this challenge in 20 right-handed healthy subjects (HS, five sessions each, S1-S5) and four stroke patients (SP, 15 sessions each, S1-S15). ERD was recorded from a 275-sensor MEG system. During daily training,motor imagery-induced ERD led to visual and proprioceptive feedback delivered through an orthotic device attached to the subjects' hand and fingers. Group A trained with a heterogeneous reference value (RV) for ERD detection with binary feedback and Group B with a homogenous RV and graded feedback (10 HS and 2 SP in each group). HS in Group B showed better BMI performance than Group A (p learning was significantly better (p learning relative to use of a heterogeneous RV and binary feedback.
Yang, Xing-Xiao; Ma, Ming; Sang, Mei-Xiang; Zhang, Xue-Yuan; Liu, Zhi-Kun; Song, Heng; Zhu, Shu-Chai
2018-02-01
B-cell‑specific Moloney murine leukaemia virus integration site-1 (BMI-1) contributes to the growth of tumour cells post-irradiation (IR). The aim of the present study was to characterize the effects of BMI-1 on cell viability, radiosensitivity and its mechanisms of action in oesophageal squamous cell cancer (ESCC). Western blotting and immunohistochemistry were employed to evaluate the protein expression of BMI-1 in ESCC cells and specimens, respectively. Additionally, the protein expression levels of BMI-1, H2AK119ub and γH2AX in ESCC cells were detected following different doses of IR and at different times after IR. The protein expression levels of MDC1 and 53BP1 were also measured. Flow cytometry and MTT assays were used to determine cell cycle progression, apoptosis and cell viability. The phosphatidylinositol 3-kinase inhibitor LY294002 and the agonist IGF-1 were employed to suppress or induce the phosphorylation of Akt to determine whether BMI-1 induces radioresistance in ESCC cells via activation of the PI3K/Akt pathway. The expression of BMI-1 was higher in ESCC tissues and cells compared with that in normal oesophageal tissues and cells. In addition, BMI-1 was positively related to tumour size and lymph node metastases and negatively to the overall survival of ESCC patients. IR induced the expression of BMI-1, H2AK119ub and γH2AX in a dose- and time-dependent manner. BMI-1 knockdown lowered the expression of γH2AX, MDC1 and 53BP1, suppressed cell viability and increased radiosensitivity. G2/M phase arrest was eliminated; this was followed by an increased proportion of cells entering the G0/G1 phase after IR and BMI-1 knockdown via the upregulation of P16 and downregulation of cyclin D2 and cyclin-dependent kinase-4. Moreover, BMI-1 knockdown increased cell apoptosis, downregulated MCL-1 and p-Akt and upregulated Bax. Additionally, the inhibitory effect of the downregulation of p-Akt by LY294002 on tumour cell viability was identical to that of
Fusion Rings for Quantum Groups
DEFF Research Database (Denmark)
Andersen, Henning Haahr; Stroppel, Catharina
2014-01-01
We study the fusion rings of tilting modules for a quantum group at a root of unity modulo the tensor ideal of negligible tilting modules. We identify them in type A with the combinatorial rings from Korff, C., Stroppel, C.: The sl(ˆn)k-WZNW fusion ring: a combinato-rial construction...... and a realisation as quotient of quantum cohomology. Adv. Math. 225(1), 200–268, (2010) and give a similar description of the sp2n-fusion ring in terms of non-commutative symmetric functions. Moreover we give a presentation of all fusion rings in classical types as quotients of polynomial rings. Finally we also...... compute the fusion rings for type G2....
File list: Oth.ALL.05.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.05.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX644721,SRX109477...79,SRX149715,SRX359986,SRX644717,SRX644709,SRX644713 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.05.BMI1.AllCell.bed ...
File list: Oth.ALL.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.20.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...17,SRX113591,SRX644729,SRX359986,SRX109479,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.BMI1.AllCell.bed ...
File list: Oth.ALL.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.10.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...86,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.BMI1.AllCell.bed ...
File list: Oth.ALL.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.ALL.50.BMI1.AllCell hg19 TFs and others BMI1 All cell types SRX109477,SRX109480...08,SRX644729,SRX113591,SRX359986,SRX644717,SRX109479 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.50.BMI1.AllCell.bed ...
Excess BMI in Childhood: A Modifiable Risk Factor for Type 1 Diabetes Development?
Ferrara, Christine Therese; Geyer, Susan Michelle; Liu, Yuk-Fun; Evans-Molina, Carmella; Libman, Ingrid M; Besser, Rachel; Becker, Dorothy J; Rodriguez, Henry; Moran, Antoinette; Gitelman, Stephen E; Redondo, Maria J
2017-05-01
We aimed to determine the effect of elevated BMI over time on the progression to type 1 diabetes in youth. We studied 1,117 children in the TrialNet Pathway to Prevention cohort (autoantibody-positive relatives of patients with type 1 diabetes). Longitudinally accumulated BMI above the 85th age- and sex-adjusted percentile generated a cumulative excess BMI (ceBMI) index. Recursive partitioning and multivariate analyses yielded sex- and age-specific ceBMI thresholds for greatest type 1 diabetes risk. Higher ceBMI conferred significantly greater risk of progressing to type 1 diabetes. The increased diabetes risk occurred at lower ceBMI values in children <12 years of age compared with older subjects and in females versus males. Elevated BMI is associated with increased risk of diabetes progression in pediatric autoantibody-positive relatives, but the effect varies by sex and age. © 2017 by the American Diabetes Association.
File list: Oth.Kid.10.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.10.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX149704,SRX644725,SRX1497...08,SRX644729,SRX149712,SRX644709,SRX644713,SRX644717,SRX113591,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.10.BMI1.AllCell.bed ...
File list: Oth.Kid.20.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.20.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644713,SRX644709,SRX149708,SRX644717,SRX113591,SRX644729,SRX644721 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.20.BMI1.AllCell.bed ...
File list: Oth.Kid.50.BMI1.AllCell [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Oth.Kid.50.BMI1.AllCell hg19 TFs and others BMI1 Kidney SRX644725,SRX149704,SRX1497...12,SRX644709,SRX644713,SRX644721,SRX149708,SRX644729,SRX113591,SRX644717 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Kid.50.BMI1.AllCell.bed ...
1,3-Diphenyl-3,4-dihydrobenzo[b][1,6]naphthyridine
Directory of Open Access Journals (Sweden)
Werner Seebacher
2010-05-01
Full Text Available The title compound, C24H18N2, is the first structural example containing the 3,4-dihydrobenzo[b][1,6]naphthyridine fragment. It was synthesized from 2,4,6,8-tetraphenyl-3,7-diazabicyclo[3.3.1]nonan-9-one and was crystallized from a methanol–ethanol solution over two years as a racemate. The C=N double bond [1.2868 (15 Å] is bent significantly out of the plane of the aromatic bicyclic ring system [N—C—C—C = −157.63 (12°] and out of the plane of the phenyl ring bonded at the 1-position [N—C—C—C = 41.15 (16°].
Fountoulakis, Stelios; Papanastasiou, Labrini; Gryparis, Alexandros; Markou, Athina; Piaditis, George
2015-01-01
To monitor and control the blood glucose levels in inefficiently insulin-treated patients with type 1 and 2 diabetes mellitus (DM) using a telemonitoring system and determine whether the improvement of HbA1c has a lasting effect following its discontinuation. Seventy inefficiently controlled insulin-treated DM patients using telemonitoring (telemonitoring group-TG) [HbA1c 9.9±2.3% (85±24.9mmol/mol)] and 35 age-, body mass index (BMI)- and Hba1c-matched insulin-treated patients receiving outpatient care (control group-CG) [HbA1c 9.7±2.1% (82±23.4mmol/mol)] were enrolled. Data of TG were transmitted from the glucose-meters to our computers via modem. Communication was achieved via e-mails and mobile phone text-messages through integrated software. HbA1c and BMI were evaluated at enrollment, 3 and 6 months, and 6 months after telemonitoring discontinuation. Frequency of hypo- and hyperglycemias and cost were also analyzed. Significant reduction in HbA1c was observed in TG both at 3 [7.1±1.0% (54±10.5mmol/mol) p<0.001] and 6 months [6.9±0.9% (52±9.5mmol/mol) p<0.001], compared to the CG group at the same timepoints. Significant reduction was also observed in the TG subgroups with ΗbA1c≥10% and 10>HbA1c≥7.5% at 3 and 6 months, compared to CG. No statistically significant differences in BMI were observed between TG and CG. Six months after telemonitoring discontinuation, HbA1c in TG was slightly increased [7.3±1.0% (56±10.4mol/mol)]. Attenuation was also observed in both TG subgroups. Compared to CG, the number of monthly hypo- and hyperglycemias was reduced in TG. The intervention had a financial benefit for patients living more than 100 km from the health care provider. Telemonitoring can result in reduction of HbA1c and frequency of hypo- and hyperglycemias. This beneficial effect is slightly attenuated 6 months after terminating telemonitoring.
2011-01-01
Background B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) acts as an oncogene in various tumors, and its overexpression correlates with a poor outcome in several human cancers. Ectopic expression of Bmi-1 can induce epithelial-mesenchymal transition (EMT) and enhance the motility and invasiveness of human nasopharyngeal epithelial cells (NPECs), whereas silencing endogenous Bmi-1 expression can reverse EMT and reduce the metastatic potential of nasopharyngeal cancer cells (NPCs). Mouse xenograft studies indicate that coexpression of Bmi-1 and H-Ras in breast cancer cells can induce an aggressive and metastatic phenotype with an unusual occurrence of brain metastasis; although, Bmi-1 overexpression did not result in oncogenic transformation of MCF-10A cells. However, the underlying molecular mechanism of Bmi-1-mediated progression and the metastasis of breast cancer are not fully elucidated at this time. Results Bmi-1 expression is more pronouncedly increased in primary cancer tissues compared to matched adjacent non-cancerous tissues. High Bmi-1 expression is correlated with advanced clinicopathologic classifications (T, N, and M) and clinical stages. Furthermore, a high level of Bmi-1 indicates an unfavorable overall survival and serves as a high risk marker for breast cancer. In addition, inverse transcriptional expression levels of Bmi-1 and E-cadherin are detected between the primary cancer tissues and the matched adjacent non-cancerous tissues. Higher Bmi-1 levels are found in the cancer tissue, whereas the paired adjacent non-cancer tissue shows higher E-cadherin levels. Overexpression of Bmi-1 increases the motility and invasive properties of immortalized human mammary epithelial cells, which is concurrent with the increased expression of mesenchymal markers, the decreased expression of epithelial markers, the stabilization of Snail and the dysregulation of the Akt/GSK3β pathway. Consistent with these observations, the repression of Bmi
Directory of Open Access Journals (Sweden)
Narsimha Reddy Penthala
2016-05-01
Full Text Available (Z-5-[2-(Benzo[b]thiophen-2-yl-1-(3,5-dimethoxyphenylethenyl]-1H-tetrazole methanol monosolvate, C19H16N4O2S·CH3OH, (I, was prepared by the reaction of (Z-3-(benzo[b]thiophen-2-yl-2-(3,5-dimethoxyphenylacrylonitrile with tributyltin azide via a [3 + 2]cycloaddition azide condensation reaction. The structurally related compound (Z-5-[2-(benzo[b]thiophen-3-yl-1-(3,4,5-trimethoxyphenylethenyl]-1H-tetrazole, C20H18N4O3S, (II, was prepared by the reaction of (Z-3-(benzo[b]thiophen-3-yl-2-(3,4,5-trimethoxyphenylacrylonitrile with tributyltin azide. Crystals of (I have two molecules in the asymmetric unit (Z′ = 2, whereas crystals of (II have Z′ = 1. The benzothiophene rings in (I and (II are almost planar, with r.m.s deviations from the mean plane of 0.0084 and 0.0037 Å in (I and 0.0084 Å in (II. The tetrazole rings of (I and (II make dihedral angles with the mean planes of the benzothiophene rings of 88.81 (13 and 88.92 (13° in (I, and 60.94 (6° in (II. The dimethoxyphenyl and trimethoxyphenyl rings make dihedral angles with the benzothiophene rings of 23.91 (8 and 24.99 (8° in (I and 84.47 (3° in (II. In both structures, molecules are linked into hydrogen-bonded chains. In (I, these chains involve both tetrazole and methanol, and are parallel to the b axis. In (II, molecules are linked into chains parallel to the a axis by N—H...N hydrogen bonds between adjacent tetrazole rings.
Li, Jinbo; Wang, Qian; Yang, Renlei; Zhang, Jiaqi; Li, Xing; Zhou, Xichao; Miao, Dengshun
2017-05-01
Previous studies have shown that estrogen regulates bone homeostasis through regulatory effects on oxidative stress. However, it is unclear how estrogen deficiency triggers reactive oxygen species (ROS) accumulation. Recent studies provide evidence that the B lymphoma Mo-MLV insertion region 1 (BMI-1) plays a critical role in protection against oxidative stress and that this gene is directly regulated by estrogen via estrogen receptor (ER) at the transcriptional level. In this study, ovariectomized mice were given drinking water with/without antioxidant N-acetyl-cysteine (NAC, 1 mg/mL) supplementation, and compared with each other and with sham mice. Results showed that ovariectomy resulted in bone loss with increased osteoclast surface, increased ROS levels, T cell activation, and increased TNF and RANKL levels in serum and in CD4 T cells; NAC supplementation largely prevented these alterations. BMI-1 expression levels were dramatically downregulated in CD4 T cells from ovariectomized mice. We supplemented drinking water to BMI-1-deficient mice with/without NAC and compared them with each other and with wild-type (WT) mice. We found that BMI-1 deficiency mimicked alterations observed in ovariectomy whereas NAC supplementation reversed all alterations induced by BMI-1 deficiency. Because T cells are critical in mediating ovariectomy-induced bone loss, we further assessed whether BMI-1 overexpression in lymphocytes can protect against estrogen deficiency-induced osteoclastogenesis and bone loss by inhibiting oxidative stress, T cell activation, and RANKL production. When WT and Eμ-BMI-1 transgenic mice with BMI-1 specifically overexpressed in lymphocytes were ovariectomized and compared with each other and with WT sham mice, we found that BMI-1 overexpression in lymphocytes clearly reversed all alterations induced by ovariectomy. Results from this study indicate that estrogen deficiency downregulates BMI-1 and subsequently increases ROS, T cell activation, and
Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro
2012-01-01
Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524) and BmScm (331 out of 532), and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.
Directory of Open Access Journals (Sweden)
Zhiqing Li
Full Text Available Polycomb group (PcG proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1, Polycomb repressive complex 2 (PRC2, and Pleiohomeotic repressive complex (PhoRC, to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524 and BmScm (331 out of 532, and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.
International Nuclear Information System (INIS)
1983-12-01
The conceptual design of a moving ring reactor ''Karin-1'' has been carried out to advance fusion system design, to clarify the research and development problems, and to decide their priority. In order to attain these objectives, a D-T reactor with tritium breeding blanket is designed, a commercial reactor with net power output of 500 MWe is designed, the compatibility of plasma physics with fusion engineering is demonstrated, and some other guideline is indicated. A moving ring reactor is composed mainly of three parts. In the first formation section, a plasma ring is formed and heated up to ignition temperature. The plasma ring of compact torus is transported from the formation section through the next burning section to generate fusion power. Then the plasma ring moves into the last recovery section, and the energy and particles of the plasma ring are recovered. The outline of a moving ring reactor ''Karin-1'' is described. As a candidate material for the first wall, SiC was adopted to reduce the MHD effect and to minimize the interaction with neutrons and charged particles. The thin metal lining was applied to the SiC surface to solve the problem of the compatibility with lithium blanket. Plasma physics, the engineering aspect and the items of research and development are described. (Kako, I.)
Directory of Open Access Journals (Sweden)
INGRID C. CHIPOLINE
2018-02-01
Full Text Available ABSTRACT The 1,2-naphthoquinone compound was previously considered active against solid tumors. Moreover, glycosidase inhibitors such as 1,2,3-1H triazoles has been pointed out as efficient compounds in anticancer activity studies. Thus, a series of eleven 1,2-naphthoquinones tethered in C2 to 1,2,3-1H-triazoles 9a-k were designed, synthesized and their cytotoxic activity evaluated using HCT-116 (colon adenocarcinoma, MCF-7 (breast adenocarcinoma and RPE (human nontumor cell line from retinal epithelium. The chemical synthesis was performed from C-3 allylation of lawsone followed by iodocyclization with subsequent nucleophilic displacement with sodium azide and, finally, the 1,3-dipolar cycloaddition catalyzed by Cu(I with terminal alkynes led to the formation of 1H-1,2,3-Triazol-1-ylmethyl-2,3-dihydronaphtho[1,2-b]furan-4,5-diones in good yields. Compounds containing aromatic group linked to 1,2,3-triazole ring (9c, 9d, 9e, 9i presented superior cytotoxic activity against cancer cell lines with IC50 in the range of 0.74 to 4.4 µM indicating that the presence of aromatic rings substituents in the 1,2,3-1H-triazole moiety is probably responsible for the improved cytotoxic activity.
p21/Cyclin E pathway modulates anticlastogenic function of Bmi-1 in cancer cells
Deng, Wen; Zhou, Yuan; Tiwari, Agnes FY; Su, Hang; Yang, Jie; Zhu, Dandan; Lau, Victoria Ming Yi; Hau, Pok Man; Yip, Yim Ling; Cheung, Annie LM; Guan, Xin-Yuan; Tsao, Sai Wah
2015-01-01
Apart from regulating stem cell self-renewal, embryonic development and proliferation, Bmi-1 has been recently reported to be critical in the maintenance of genome integrity. In searching for novel mechanisms underlying the anticlastogenic function of Bmi-1, we observed, for the first time, that Bmi-1 positively regulates p21 expression. We extended the finding that Bmi-1 deficiency induced chromosome breaks in multiple cancer cell models. Interestingly, we further demonstrated that knockdown of cyclin E or ectopic overexpression of p21 rescued Bmi-1 deficiency-induced chromosome breaks. We therefore conclude that p21/cyclin E pathway is crucial in modulating the anticlastogenic function of Bmi-1. As it is well established that the overexpression of cyclin E potently induces genome instability and p21 suppresses the function of cyclin E, the novel and important implication from our findings is that Bmi-1 plays an important role in limiting genomic instability in cylin E-overexpressing cancer cells by positive regulation of p21. PMID:25131797
Directory of Open Access Journals (Sweden)
David Latrasse
Full Text Available Polycomb Repressive Complexes (PRC modulate the epigenetic status of key cell fate and developmental regulators in eukaryotes. The chromo domain protein like heterochromatin protein1 (LHP1 is a subunit of a plant PRC1-like complex in Arabidopsis thaliana and recognizes histone H3 lysine 27 trimethylation, a silencing epigenetic mark deposited by the PRC2 complex. We have identified and studied an LHP1-Interacting Factor2 (LIF2. LIF2 protein has RNA recognition motifs and belongs to the large hnRNP protein family, which is involved in RNA processing. LIF2 interacts in vivo, in the cell nucleus, with the LHP1 chromo shadow domain. Expression of LIF2 was detected predominantly in vascular and meristematic tissues. Loss-of-function of LIF2 modifies flowering time, floral developmental homeostasis and gynoecium growth determination. lif2 ovaries have indeterminate growth and produce ectopic inflorescences with severely affected flowers showing proliferation of ectopic stigmatic papillae and ovules in short-day conditions. To look at how LIF2 acts relative to LHP1, we conducted transcriptome analyses in lif2 and lhp1 and identified a common set of deregulated genes, which showed significant enrichment in stress-response genes. By comparing expression of LHP1 targets in lif2, lhp1 and lif2 lhp1 mutants we showed that LIF2 can either antagonize or act with LHP1. Interestingly, repression of the FLC floral transcriptional regulator in lif2 mutant is accompanied by an increase in H3K27 trimethylation at the locus, without any change in LHP1 binding, suggesting that LHP1 is targeted independently from LIF2 and that LHP1 binding does not strictly correlate with gene expression. LIF2, involved in cell identity and cell fate decision, may modulate the activity of LHP1 at specific loci, during specific developmental windows or in response to environmental cues that control cell fate determination. These results highlight a novel link between plant RNA
International Nuclear Information System (INIS)
Silva Junior, Luiz F.; Sousa, Raquel M.F.; Ferraz, Helena M.C.; Aguilar, Andrea M.
2005-01-01
The oxidation of a series of 1,2-dihydronaphthalenes substituted in the aromatic ring was investigated with thallium trinitrate (TTN) in methanol or in trimethylorthoformate (TMOF) as solvent. In all cases, indans are produced, although the yield varied from excellent to poor, depending on the structure of the substrate. The presence of an electron-donating group in the substrate favors the rearrangement, whereas significant amounts of glycolic derivatives, as well as naphthalenes, were obtained in the oxidation of 1,2-dihydronaphthalenes bearing electron-withdrawing groups, such as Br and NO 2 . Mechanisms for the formation of each of these products are proposed. (author)
Fadeyi, Emmanuel A; Stratta, Robert J; Farney, Alan C; Pomper, Gregory J
2016-08-01
Transplantation of the blood group A2B in a recipient was successfully performed in the setting of receiving a deceased donor kidney from an "incompatible" A1B donor. The donor and recipient were both typed for ABO blood group, including ABO genotyping. The donor and recipient were tested for ABO, non-ABO, and human leukocyte antigen (HLA) antibodies. The donor and recipient were typed for HLA antigens, including T- and B-flow cytometry crossmatch tests. The recipient's RBCs were negative with A1 lectin, and immunoglobulin G anti-A1 was demonstrated in the recipient's plasma. The donor-recipient pair was a four-antigen HLA mismatch, but final T- and B-flow cytometry crossmatch tests were compatible. The transplant procedure was uneventful; the patient experienced immediate graft function with no episodes of rejection or readmissions more than 2 years later. It may be safe to transplant across the A1/A2 blood group AB mismatch barrier in the setting of low titer anti-A1 isoagglutinins without the need for pretransplant desensitization even if the antibody produced reacts with anti-human globulin. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
2-Isobutyl-6-(4-methoxyphenylimidazo[2,1-b][1,3,4]thiadiazole
Directory of Open Access Journals (Sweden)
Hoong-Kun Fun
2011-02-01
Full Text Available In the title compound, C15H17N3OS, the dihedral angle between the statistically planar imidazo[2,1-b][1,3,4]thiadiazole fused-ring system (r.m.s. deviation = 0.002 Å and the methyoxbenzene ring is 4.52 (6°. In the crystal, molecules are arranged into columns and stacked down the a axis. The crystal structure is stabilized by weak C—H...π and π–π interactions [centroid–centroid separations = 3.6053 (8 and 3.7088 (7 Å].
Omori, Yoshihiro; Kubo, Shun; Kon, Tetsuo; Furuhashi, Mayu; Narita, Hirotaka; Kominami, Taro; Ueno, Akiko; Tsutsumi, Ryotaro; Chaya, Taro; Yamamoto, Haruka; Suetake, Isao; Ueno, Shinji; Koseki, Haruhiko; Nakagawa, Atsushi; Furukawa, Takahisa
2017-09-26
Precise transcriptional regulation controlled by a transcription factor network is known to be crucial for establishing correct neuronal cell identities and functions in the CNS. In the retina, the expression of various cone and rod photoreceptor cell genes is regulated by multiple transcription factors; however, the role of epigenetic regulation in photoreceptor cell gene expression has been poorly understood. Here, we found that Samd7, a rod-enriched sterile alpha domain (SAM) domain protein, is essential for silencing nonrod gene expression through H3K27me3 regulation in rod photoreceptor cells. Samd7- null mutant mice showed ectopic expression of nonrod genes including S-opsin in rod photoreceptor cells and rod photoreceptor cell dysfunction. Samd7 physically interacts with Polyhomeotic homologs (Phc proteins), components of the Polycomb repressive complex 1 (PRC1), and colocalizes with Phc2 and Ring1B in Polycomb bodies. ChIP assays showed a significant decrease of H3K27me3 in the genes up-regulated in the Samd7 -deficient retina, showing that Samd7 deficiency causes the derepression of nonrod gene expression in rod photoreceptor cells. The current study suggests that Samd7 is a cell type-specific PRC1 component epigenetically defining rod photoreceptor cell identity.
DEFF Research Database (Denmark)
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice
2016-01-01
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...
Cisplatin Induces Bmi-1 and Enhances the Stem Cell Fraction in Head and Neck Cancer
Directory of Open Access Journals (Sweden)
Carolina Nör
2014-02-01
Full Text Available Recent evidence has unveiled a subpopulation of highly tumorigenic, multipotent cells capable of self-renewal in head and neck squamous cell carcinomas (HNSCCs. These unique cells, named here cancer stem cells (CSCs, proliferate slowly and might be involved in resistance to conventional chemotherapy. We have shown that CSCs are found in perivascular niches and rely on endothelial cell-secreted factors [particularly interleukin-6 (IL-6] for their survival and self-renewal in HNSCC. Here, we hypothesized that cisplatin enhances the stem cell fraction in HNSCC. To address this hypothesis, we generated xenograft HNSCC tumors with University of Michigan-squamous cell carcinoma 22B (UM-SCC-22B cells and observed that cisplatin treatment increased (P = .0013 the fraction of CSCs [i.e., aldehyde dehydrogenase activity high and cluster of differentiation 44 high (ALDHhighCD44high]. Cisplatin promoted self-renewal and survival of CSCs in vitro, as seen by an increase in the number of orospheres in ultralow attachment plates and induction in B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1 and octamer-binding transcription factor 4 expression. Cisplatin-resistant cells expressed more Bmi-1 than cisplatinsensitive cells. IL-6 potentiated cisplatin-induced orosphere formation generated when primary human HNSCC cells were sorted for ALDHhighCD44high immediately after surgery and plated onto ultralow attachment plates. IL-6-induced signal transducer and activator of transcription 3 (STAT3 phosphorylation (indicative of stemness was unaffected by treatment with cisplatin in UM-SCC-22B cells, whereas IL-6-induced extracellular signal-regulated kinase (ERK phosphorylation (indicative of differentiation processes was partially inhibited by cisplatin. Notably, cisplatin-induced Bmi-1 was inhibited by interleukin-6 receptor blockade in parental and cisplatin-resistant cells. Taken together, these results demonstrate that cisplatin enhances the fraction of CSCs
Auslander, Maurice
2014-01-01
This classic monograph is geared toward advanced undergraduates and graduate students. The treatment presupposes some familiarity with sets, groups, rings, and vector spaces. The four-part approach begins with examinations of sets and maps, monoids and groups, categories, and rings. The second part explores unique factorization domains, general module theory, semisimple rings and modules, and Artinian rings. Part three's topics include localization and tensor products, principal ideal domains, and applications of fundamental theorem. The fourth and final part covers algebraic field extensions
Working group 1B - basis for the standard-liquid pathway
International Nuclear Information System (INIS)
Budnitz, R.
1993-01-01
This paper presents a summary of the progress made by working group 1B (Basis for the Standard-Liquid Pathway) during the Electric Power Research Institute's EPRI Workshop on the technical basis of EPA HLW Disposal Criteria, March 1993. This group discussed the containment requirements of Environmental Protection Agency (EPA) standard 40 CFR Part 191. This is a major issue when considering the liquid pathway of contamination during the disposal of high-level radioactive wastes. Questions that were raised by this group were (1) What were the problems with Table 1 of 40 CFR Part 191?; (2) What would be fixed with the person-rem alternative that is offered?; and (3) What would be fixed if Table 1 were supplemented with additional columns for other pathways? Other topics that were touched on were the definition of the term open-quotes reasonable expectationsclose quotes and 100,000 year criteria
Discovery Of B Ring Propellers In Cassini UVIS, And ISS
Sremcevic, Miodrag; Stewart, G. R.; Albers, N.; Esposito, L. W.
2012-10-01
We present evidence for the existence of propellers in Saturn's B ring by combining data from Cassini Ultraviolet Imaging Spectrograph (UVIS) and Imaging Science Subsystem (ISS) experiments. We identify two propeller populations: (1) tens of degrees wide propellers in the dense B ring core, and (2) smaller, more A ring like, propellers populating the inner B ring. The prototype of the first population is an object observed at 18 different epochs between 2005 and 2010. The ubiquitous propeller "S" shape is seen both in UVIS occultations as an optical depth depletion and in ISS as a 40 degrees wide bright stripe in unlit geometries and dark in lit geometries. Combining the available Cassini data we infer that the object is a partial gap embedded in the high optical depth region of the B ring. The gap moves at orbital speed consistent with its radial location. From the radial separation of the propeller wings we estimate that the embedded body, which causes the propeller structure, is about 1.5km in size located at a=112,921km. The UVIS occultations indicate an asymmetric propeller "S" shape. Since the object is located at an edge between high and relatively low optical depth, this asymmetry is most likely a consequence of the strong surface mass density gradient. We estimate that there are possibly dozen up to 100 other propeller objects in Saturn's B ring. The location of the discovered body, at an edge of a dense ringlet within the B ring, suggests a novel mechanism for the up to now illusive B ring irregular large-scale structure of alternating high and low optical depth ringlets. We propose that this B ring irregular structure may have its cause in the presence of many embedded bodies that shepherd the individual B ring ringlets.
Ruled by Ubiquitylation: A New Order for Polycomb Recruitment
Directory of Open Access Journals (Sweden)
Yuri B. Schwartz
2014-07-01
Full Text Available Polycomb complexes are found in most cells, but they must be targeted to specific genes in specific cell types in order to regulate pluripotency and differentiation. The recruitment of Polycomb complexes to specific targets has been widely thought to occur in two steps: first, one complex, PRC2, produces histone H3 lysine 27 (H3K27 trimethylation at a specific gene, and then the PRC1 complex is recruited by its ability to bind to H3K27me3. Now, three new articles turn this model upside-down by showing that binding of a variant PRC1 complex and subsequent H2A ubiquitylation of surrounding chromatin is sufficient to trigger the recruitment of PRC2 and H3K27 trimethylation. These studies also show that ubiquitylated H2A is directly sensed by PRC2 and that ablation of PRC1-mediated H2A ubiquitylation impairs genome-wide PRC2 binding and disrupts mouse development.
Uniquely Strongly Clean Group Rings
Institute of Scientific and Technical Information of China (English)
WANG XIU-LAN
2012-01-01
A ring R is called clean if every element is the sum of an idempotent and a unit,and R is called uniquely strongly clean (USC for short) if every element is uniquely the sum of an idempotent and a unit that commute.In this article,some conditions on a ring R and a group G such that RG is clean are given.It is also shown that if G is a locally finite group,then the group ring RG is USC if and only if R is USC,and G is a 2-group.The left uniquely exchange group ring,as a middle ring of the uniquely clean ring and the USC ring,does not possess this property,and so does the uniquely exchange group ring.
Directory of Open Access Journals (Sweden)
Hourinaz Behesti
2013-01-01
BMI1 is a potent inducer of neural stem cell self-renewal and neural progenitor cell proliferation during development and in adult tissue homeostasis. It is overexpressed in numerous human cancers – including medulloblastomas, in which its functional role is unclear. We generated transgenic mouse lines with targeted overexpression of Bmi1 in the cerebellar granule cell lineage, a cell type that has been shown to act as a cell of origin for medulloblastomas. Overexpression of Bmi1 in granule cell progenitors (GCPs led to a decrease in cerebellar size due to decreased GCP proliferation and repression of the expression of cyclin genes, whereas Bmi1 overexpression in postmitotic granule cells improved cell survival in response to stress by altering the expression of genes in the mitochondrial cell death pathway and of Myc and Lef-1. Although no medulloblastomas developed in ageing cohorts of transgenic mice, crosses with Trp53−/− mice resulted in a low incidence of medulloblastoma formation. Furthermore, analysis of a large collection of primary human medulloblastomas revealed that tumours with a BMI1high TP53low molecular profile are significantly enriched in Group 4 human medulloblastomas. Our data suggest that different levels and timing of Bmi1 overexpression yield distinct cellular outcomes within the same cellular lineage. Importantly, Bmi1 overexpression at the GCP stage does not induce tumour formation, suggesting that BMI1 overexpression in GCP-derived human medulloblastomas probably occurs during later stages of oncogenesis and might serve to enhance tumour cell survival.
Jin, Jianliang; Lv, Xianhui; Chen, Lulu; Zhang, Wei; Li, Jinbo; Wang, Qian; Wang, Rong; Lu, Xiang; Miao, Dengshun
2014-01-01
To determine whether Bmi-1 deficiency could lead to renal tubulointerstitial injury by mitochondrial dysfunction and increased oxidative stress in the kidney, 3-week-old Bmi-1-/- mice were treated with the antioxidant N-acetylcysteine (NAC, 1 mg mL−1) in their drinking water, or pyrro-quinoline quinone (PQQ, 4 mg kg−1 diet) in their diet for 2 weeks, and their renal phenotypes were compared with vehicle-treated Bmi1-/- and wild-type mice. Bmi-1 was knocked down in human renal proximal tubular epithelial (HK2) cells which were treated with 1 mm NAC for 72 or 96 h, and their phenotypes were compared with control cells. Five-week-old vehicle-treated Bmi-1-/- mice displayed renal interstitial fibrosis, tubular atrophy, and severe renal function impairment with decreased renal cell proliferation, increased renal cell apoptosis and senescence, and inflammatory cell infiltration. Impaired mitochondrial structure, decreased mitochondrial numbers, and increased oxidative stress occurred in Bmi-1-/- mice; subsequently, this caused DNA damage, the activation of TGF-β1/Smad signaling, and the imbalance between extracellular matrix synthesis and degradation. Oxidative stress-induced epithelial-to-mesenchymal transition of renal tubular epithelial cells was enhanced in Bmi-1 knocked down HK2 cells. All phenotypic alterations caused by Bmi-1 deficiency were ameliorated by antioxidant treatment. These findings indicate that Bmi-1 plays a critical role in protection from renal tubulointerstitial injury by maintaining redox balance and will be a novel therapeutic target for preventing renal tubulointerstitial injury. PMID:24915841
Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong
2018-03-28
To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells. Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay. Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all Pcad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.
Gao, Hong-Wei; Zhuo, Hai-Long; Zhang, Xue; Ji, Shou-Ping; Tan, Ying-Xia; Li, Su-Bo; Jia, Yan-Jun; Xu, Hua; Wu, Qing-Fa; Yun, Zhi-Min; Luo, Qun; Gong, Feng
2016-01-01
Background Enzymatic conversion of blood group A1B red blood cells (RBC) to group O RBC (ECO) was achieved by combined treatment with α-galactosidase and α-N-acetylgalactosaminidase. The aim of this study was to evaluate the function and safety of these A1B-ECO RBC in vitro. Materials and methods A 20% packed volume of A1B RBC was treated with enzymes in 250 mM glycine buffer, pH 6.8. The efficiency of the conversion of A and B antigen was evaluated by traditional typing in test tubes, gel column agglutination technology and fluorescence-activated cell sorting (FACS) analysis. The physiological and metabolic parameters of native and ECO RBC were compared, including osmotic fragility, erythrocyte deformation index, levels of 2,3-diphosphoglycerate, ATP, methaemoglobin, free Na+, and free K+. The morphology of native and ECO RBC was observed by scanning electron microscopy. Residual α-galactosidase or α-N-acetylgalactosaminidase in A1B-ECO RBC was detected by double-antibody sandwich ELISA method. Manual cross-matching was applied to ensure blood compatibility. Results The RBC agglutination tests and FACS results showed that A1B RBC were efficiently converted to O RBC. Functional analysis suggested that the conversion process had little impact on the physiological and metabolic parameters of the RBC. The residual amounts of either α-galactosidase or α-N-acetylgalactosaminidase in the A1B-ECO RBC were less than 10 ng/mL of packed RBC. About 18% of group B and 55% of group O sera reacted with the A1B-ECO RBC in a sensitive gel column cross-matching test. Discussion The conversion process does not appear to affect the morphological, physiological or metabolic parameters of A1B-ECO RBC. However, the A1B-ECO RBC still reacted with some antigens. More research on group O and B sera, which may partly reflect the complexity of group A1 the safety of A1B-ECO RBC is necessary before the application of these RBC in clinical transfusion. PMID:26509826
Directory of Open Access Journals (Sweden)
A. Sowmya
2016-10-01
Full Text Available In the title imidazo[2,1-b][1,3,4]thiadiazole derivative, C19H14ClN3OS, the 4-methylbenzyl and chlorophenyl rings are inclined to the planar imidazo[2,1-b][1,3,4]thiadiazole moiety (r.m.s. deviation = 0.012 Å by 64.5 (1 and 3.7 (1°, respectively. The molecular structure is primarily stabilized by a strong intramolecular C—H...O hydrogen bond, leading to the formation of a pseudo-seven-membered S(7 ring motif, and a short intramolecular C—H...N contact forming an S(5 ring motif. In the crystal, molecules are linked by pairs of C—H...S hydrogen bonds, forming inversion dimers. The dimers are linked by C—H...O and C—H...π interactions, forming chains propagating along [110].
Rajabi, Hasan; Hiraki, Masayuki; Kufe, Donald
2018-04-01
The PRC2 and PRC1 complexes are aberrantly expressed in human cancers and have been linked to decreases in patient survival. MUC1-C is an oncoprotein that is also overexpressed in diverse human cancers and is associated with a poor prognosis. Recent studies have supported a previously unreported function for MUC1-C in activating PRC2 and PRC1 in cancer cells. In the regulation of PRC2, MUC1-C (i) drives transcription of the EZH2 gene, (ii) binds directly to EZH2, and (iii) enhances occupancy of EZH2 on target gene promoters with an increase in H3K27 trimethylation. Regarding PRC1, which is recruited to PRC2 sites in the hierarchical model, MUC1-C induces BMI1 transcription, forms a complex with BMI1, and promotes H2A ubiquitylation. MUC1-C thereby contributes to the integration of PRC2 and PRC1-mediated repression of tumor suppressor genes, such as CDH1, CDKN2A, PTEN and BRCA1. Like PRC2 and PRC1, MUC1-C is associated with the epithelial-mesenchymal transition (EMT) program, cancer stem cell (CSC) state, and acquisition of anticancer drug resistance. In concert with these observations, targeting MUC1-C downregulates EZH2 and BMI1, inhibits EMT and the CSC state, and reverses drug resistance. These findings emphasize the significance of MUC1-C as a therapeutic target for inhibiting aberrant PRC function and reprogramming the epigenome in human cancers.
Davis, Kaitlin A; Morelli, Marco; Patton, John T
2017-08-29
The rotavirus nonstructural protein NSP1 repurposes cullin-RING E3 ubiquitin ligases (CRLs) to antagonize innate immune responses. By functioning as substrate adaptors of hijacked CRLs, NSP1 causes ubiquitination and proteasomal degradation of host proteins that are essential for expression of interferon (IFN) and IFN-stimulated gene products. The target of most human and porcine rotaviruses is the β-transducin repeat-containing protein (β-TrCP), a regulator of NF-κB activation. β-TrCP recognizes a phosphorylated degron (DSGΦXS) present in the inhibitor of NF-κB (IκB); phosphorylation of the IκB degron is mediated by IκB kinase (IKK). Because NSP1 contains a C-terminal IκB-like degron (ILD; DSGXS) that recruits β-TrCP, we investigated whether the NSP1 ILD is similarly activated by phosphorylation and whether this modification is required to trigger the incorporation of NSP1 into CRLs. Based on mutagenesis and phosphatase treatment studies, we found that both serine residues of the NSP1 ILD are phosphorylated, a pattern mimicking phosphorylation of IκB. A three-pronged approach using small-molecule inhibitors, small interfering RNAs, and mutagenesis demonstrated that NSP1 phosphorylation is mediated by the constitutively active casein kinase II (CKII), rather than IKK. In coimmunoprecipitation assays, we found that this modification was essential for NSP1 recruitment of β-TrCP and induced changes involving the NSP1 N-terminal RING motif that allowed formation of Cul3-NSP1 complexes. Taken together, our results indicate a highly regulated stepwise process in the formation of NSP1-Cul3 CRLs that is initiated by CKII phosphorylation of NSP1, followed by NSP1 recruitment of β-TrCP and ending with incorporation of the NSP1-β-TrCP complex into the CRL via interactions dependent on the highly conserved NSP1 RING motif. IMPORTANCE Rotavirus is a segmented double-stranded RNA virus that causes severe diarrhea in young children. A primary mechanism used by the
Ion rings for magnetic fusion. Technical progress report, August 1, 1993--June 1, 1994
International Nuclear Information System (INIS)
Sudan, R.N.
1994-01-01
In Our Proposal ''Ion Rings for Magnetic Fusion'' of January 6, 1993, Stage I of our Proposed Program plan (the 12 months) consisted of the following tasks: Experiments on the existing ion ring experimental system IREX to test a new magnetically-controlled anode plasma source (MAP) for the ion beam diode injector; numerical simulations of ion ring formation to optimize design parameters for the field reversed ion ring experiment (FIREX) to be built and operated in Stage II; and designing the power supply for the FIREX injector and the magnetic field system using results for A and B. During the past 7 1/2 months our work has progressed according to the above plan. In addition to testing the MAP diode on IREX we have tested the EMFAPS (evaporating metal film anode plasma source) anode on the Sandia National Laboratories funded LION pulsed power generator. As a result of these experiments, described this paper, we have arrived at the conclusion that EMFAPS anode for the ion at present because the MAP diode beam diode injector is our preferred choice for is still in an early stage of development
CIRS High-Resolution Thermal Scans and the Structure of Saturn's B Ring
Brooks, S. M.; Spilker, L. J.; Showalter, M.; Pilorz, S.; Edgington, S. G.
2017-12-01
The flyby of Titan on November 29, 2016, sent the Cassini spacecraft on a trajectory that would take it within 10,000 kilometers of Saturn's F ring multiple times before a subsequent Titan encounter on April 22, 2017, would send it on ballistic trajectory carrying it between Saturn's cloud tops and the planet's D ring for several flybys. This geometry has proven beneficial for high-resolution studies of the rings, not just because of Cassini's proximity to the rings, but also because of the spacecraft's high elevation angle above the rings, which reduces the foreshortening that tends to degrade resolution in the ring plane. We will report on several observations of Saturn's main rings at the high spatial resolutions enabled by the end-of-mission geometry, particulary the B ring, with the Composite Infrared Spectrometer onboard Cassini during the F-ring and proximal orbits. CIRS' three infrared detectors cover a combined spectral range of 10 to 1400 cm-1 (1 mm down to 7 microns). We focus on data from Focal Plane 1, which covers the 10 to 600 cm-1 range (1 mm to 16 microns). The apodized spectral resolution of the instrument can be varied from 15 cm-1 to 0.5 cm-1 (Flasar et al. 2004). FP1's wavelength range makes it well-suited to sensing thermal emission from objects at temperatures typical of Saturn's rings. Correlating ring optical depth with temperatures retrieved from scans of the face of the rings exposed to direct solar illumination (the lit face) and the opposite (unlit) face suggests differences in ring structure or particle transport between the lit and unlit sides of the rings in different regions of the B ring. Lit side temperatures in the core of the B ring range between 82 and 87 K; temperatures on the unlit side of the core vary from 66 K up to 74 K. Ferrari and Reffet (2013) and Pilorz et al. (2015) published thorough analyses of the thermal throughput across this optically thick ring. We will discuss these recent CIRS rings observations and their
Photochemical Ring-Opening Reaction in 2(1H)-Pyrimidinones: A Matrix Isolation Study
Lapinski, Leszek; Rostkowska, Hanna; Khvorostov, Artem; Fausto, Rui; Nowak, Maciej J.
2003-01-01
Photoreactions induced by UV-B (290−320 nm) irradiation were studied for 1-methyl-2(1H)-pyrimidinone and 1-methylcytosine monomers isolated in low-temperature inert gas matrixes. A Norrish type I α-cleavage reaction leading to open-ring conjugated isocyanate was observed for 1-methyl-2(1H)-pyrimidinone. The structure of the photoproduct was identified by comparison of its experimental IR spectrum with the spectrum theoretically calculated at the DFT(B3LYP)/6-31++G(d,p) level. The main indicat...
Tie, Feng; Banerjee, Rakhee; Saiakhova, Alina R.; Howard, Benny; Monteith, Kelsey E.; Scacheri, Peter C.; Cosgrove, Michael S.; Harte, Peter J.
2014-01-01
Trithorax (TRX) antagonizes epigenetic silencing by Polycomb group (PcG) proteins, stimulates enhancer-dependent transcription, and establishes a ‘cellular memory’ of active transcription of PcG-regulated genes. The mechanisms underlying these TRX functions remain largely unknown, but are presumed to involve its histone H3K4 methyltransferase activity. We report that the SET domains of TRX and TRX-related (TRR) have robust histone H3K4 monomethyltransferase activity in vitro and that Tyr3701 of TRX and Tyr2404 of TRR prevent them from being trimethyltransferases. The trxZ11 missense mutation (G3601S), which abolishes H3K4 methyltransferase activity in vitro, reduces the H3K4me1 but not the H3K4me3 level in vivo. trxZ11 also suppresses the impaired silencing phenotypes of the Pc3 mutant, suggesting that H3K4me1 is involved in antagonizing Polycomb silencing. Polycomb silencing is also antagonized by TRX-dependent H3K27 acetylation by CREB-binding protein (CBP). We show that perturbation of Polycomb silencing by TRX overexpression requires CBP. We also show that TRX and TRR are each physically associated with CBP in vivo, that TRX binds directly to the CBP KIX domain, and that the chromatin binding patterns of TRX and TRR are highly correlated with CBP and H3K4me1 genome-wide. In vitro acetylation of H3K27 by CBP is enhanced on K4me1-containing H3 substrates, and independently altering the H3K4me1 level in vivo, via the H3K4 demethylase LSD1, produces concordant changes in H3K27ac. These data indicate that the catalytic activities of TRX and CBP are physically coupled and suggest that both activities play roles in antagonizing Polycomb silencing, stimulating enhancer activity and cellular memory. PMID:24550119
PRC1 Prevents Replication Stress during Chondrogenic Transit Amplification
Directory of Open Access Journals (Sweden)
Frank Spaapen
2017-12-01
Full Text Available Transit amplification (TA, a state of combined, rapid proliferative expansion and differentiation of stem cell-descendants, remains poorly defined at the molecular level. The Polycomb Repressive Complex 1 (PRC1 protein BMI1 has been localized to TA compartments, yet its exact role in TA is unclear. PRC1 proteins control gene expression, cell proliferation and DNA-damage repair. Coordination of such DNA-templated activities during TA is predicted to be crucial to support DNA replication and differentiation-associated transcriptional programming. We here examined whether chondrogenesis provides a relevant biological context for synchronized coordination of these chromatin-based tasks by BMI1. Taking advantage of a prominently featuring TA-phase during chondrogenesis in vitro and in vivo, we here report that TA is completely dependent on intact PRC1 function. BMI1-depleted chondrogenic progenitors rapidly accumulate double strand DNA breaks during DNA replication, present massive non-H3K27me3-directed transcriptional deregulation and fail to undergo chondrogenic TA. Genome-wide accumulation of Topoisomerase 2α and Geminin suggests a model in which PRC1 synchronizes replication and transcription during rapid chondrogenic progenitor expansion. Our combined data reveals for the first time a vital cell-autonomous role for PRC1 during chondrogenesis. We provide evidence that chondrocyte hyper-replication and hypertrophy represent a unique example of programmed senescence in vivo. These findings provide new perspectives on PRC1 function in development and disease.
Use of a Vaginal Ring Containing Dapivirine for HIV-1 Prevention in Women
Baeten, J.M.; Palanee-Phillips, T.; Brown, E.R.; Schwartz, K.; Soto-Torres, L.E.; Govender, V.; Mgodi, N.M.; Kiweewa, F. Matovu; Nair, G.; Mhlanga, F.; Siva, S.; Bekker, L.-G.; Jeenarain, N.; Gaffoor, Z.; Martinson, F.; Makanani, B.; Pather, A.; Naidoo, L.; Husnik, M.; Richardson, B.A.; Parikh, U.M.; Mellors, J.W.; Marzinke, M.A.; Hendrix, C.W.; van der Straten, A.; Ramjee, G.; Chirenje, Z.M.; Nakabiito, C.; Taha, T.E.; Jones, J.; Mayo, A.; Scheckter, R.; Berthiaume, J.; Livant, E.; Jacobson, C.; Ndase, P.; White, R.; Patterson, K.; Germuga, D.; Galaska, B.; Bunge, K.; Singh, D.; Szydlo, D.W.; Montgomery, E.T.; Mensch, B.S.; Torjesen, K.; Grossman, C.I.; Chakhtoura, N.; Nel, A.; Rosenberg, Z.; McGowan, I.; Hillier, S.
2016-01-01
BACKGROUND Antiretroviral medications that are used as prophylaxis can prevent acquisition of human immunodeficiency virus type 1 (HIV-1) infection. However, in clinical trials among African women, the incidence of HIV-1 infection was not reduced, probably because of low adherence. Longer-acting methods of drug delivery, such as vaginal rings, may simplify use of antiretroviral medications and provide HIV-1 protection. METHODS We conducted a phase 3, randomized, double-blind, placebo-controlled trial of a monthly vaginal ring containing dapivirine, a non-nucleoside HIV-1 reverse-transcriptase inhibitor, involving women between the ages of 18 and 45 years in Malawi, South Africa, Uganda, and Zimbabwe. RESULTS Among the 2629 women who were enrolled, 168 HIV-1 infections occurred: 71 in the dapivirine group and 97 in the placebo group (incidence, 3.3 and 4.5 per 100 person-years, respectively). The incidence of HIV-1 infection in the dapivirine group was lower by 27% (95% confidence interval [CI], 1 to 46; P = 0.05) than that in the placebo group. In an analysis that excluded data from two sites that had reduced rates of retention and adherence, the incidence of HIV-1 infection in the dapivirine group was lower by 37% (95% CI, 12 to 56; P = 0.007) than that in the placebo group. In a post hoc analysis, higher rates of HIV-1 protection were observed among women over the age of 21 years (56%; 95% CI, 31 to 71; P<0.001) but not among those 21 years of age or younger (-27%; 95% CI, −133 to 31; P = 0.45), a difference that was correlated with reduced adherence. The rates of adverse medical events and antiretroviral resistance among women who acquired HIV-1 infection were similar in the two groups. CONCLUSIONS A monthly vaginal ring containing dapivirine reduced the risk of HIV-1 infection among African women, with increased efficacy in subgroups with evidence of increased adherence. (Funded by the National Institutes of Health; ClinicalTrials.gov number, NCT01617096
Drosophila DNA-Binding Proteins in Polycomb Repression
Directory of Open Access Journals (Sweden)
Maksim Erokhin
2018-01-01
Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.
DEFF Research Database (Denmark)
Comet, Itys; Schuettengruber, Bernd; Sexton, Tom
2011-01-01
to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....
Been, L F; Hatfield, J L; Shankar, A; Aston, C E; Ralhan, S; Wander, G S; Mehra, N K; Singh, J R; Mulvihill, J J; Sanghera, D K
2012-11-01
Two common variants (rs1387153, rs10830963) in MTNR1B have been reported to have independent effects on fasting blood glucose (FBG) levels with increased risk to type 2 diabetes (T2D) in recent genome-wide association studies (GWAS). In this investigation, we report the association of these two variants, and an additional variant (rs1374645) within the GWAS locus of MTNR1B with FBG, 2h glucose, insulin resistance (HOMA IR), β-cell function (HOMA B), and T2D in our sample of Asian Sikhs from India. Our cohort comprised 2222 subjects [1201 T2D, 1021 controls]. None of these SNPs was associated with T2D in this cohort. Our data also could not confirm association of rs1387153 and rs10830963 with FBG phenotype. However, upon stratifying data according to body mass index (BMI) (low ≤ 25 kg/m(2) and high > 25 kg/m(2)) in normoglycemic subjects (n = 1021), the rs1374645 revealed a strong association with low FBG levels in low BMI group (β = -0.073, p = 0.002, Bonferroni p = 0.01) compared to the high BMI group (β = 0.015, p = 0.50). We also detected a strong evidence of interaction between rs1374645 and BMI with respect to FBG levels (p = 0.002). Our data provide new information about the significant impact of another MTNR1B variant on FBG levels that appears to be modulated by BMI. Future confirmation on independent datasets and functional studies will be required to define the role of this variant in fasting glucose variation. Published by Elsevier B.V.
Yang, Xuejin
2016-06-07
Benzo[4,5]cyclohepta[1,2-b]fluorene (5a), a new π-conjugated polycyclic hydrocarbon containing linearly fused six-, five-, six-, seven- and six-membered rings (C6-C5-C6-C7-C6), was designed and its stable derivatives 5b and 5c were synthesized. With 22 π electrons, 5a is an isomer of pentacene with quinoidal, dipolar ionic and diradical resonance forms. Molecules 5b and 5c were experimentally investigated with cyclic voltammetry, electronic absorption spectroscopy and X-ray crystallographic analysis, and theoretically studied by calculating the NICS value, diradical character and dipole moment. A comparison of 5a–c with pentacene and other pentacene analogues containing linearly fused five- or seven- membered rings was also conducted and discussed. It was found that 5b behaved as a p-type organic semiconductor in solution-processed thin film transistors with field effect mobility of up to 0.025 cm2/Vs.
Yang, Xuejin; Shi, Xueliang; Aratani, Naoki; Goncalves, Theo; Huang, Kuo-Wei; Yamada, Hiroko; Chi, Chunyan; Miao, Qian
2016-01-01
Benzo[4,5]cyclohepta[1,2-b]fluorene (5a), a new π-conjugated polycyclic hydrocarbon containing linearly fused six-, five-, six-, seven- and six-membered rings (C6-C5-C6-C7-C6), was designed and its stable derivatives 5b and 5c were synthesized. With 22 π electrons, 5a is an isomer of pentacene with quinoidal, dipolar ionic and diradical resonance forms. Molecules 5b and 5c were experimentally investigated with cyclic voltammetry, electronic absorption spectroscopy and X-ray crystallographic analysis, and theoretically studied by calculating the NICS value, diradical character and dipole moment. A comparison of 5a–c with pentacene and other pentacene analogues containing linearly fused five- or seven- membered rings was also conducted and discussed. It was found that 5b behaved as a p-type organic semiconductor in solution-processed thin film transistors with field effect mobility of up to 0.025 cm2/Vs.
The relationship between BMI and striatal dopamine transporter with 99Tcm-TRODAT-1 brain SPECT
International Nuclear Information System (INIS)
Lu Rongbin; Liu Xingdang; Liu Congjin; Wang Yuankai; Zhang Guangming; Tang Jie; Chen Zhengqing; Luo Shineng
2011-01-01
Objective: To assess the relationship between the BMI and the brain DAT, and the influence of BMI on the brain SPECT imaging with 99 Tc m -TRODAT-1. Methods: MRI and 99 Tc m -TRODAT-1SPECT imaging were performed in 31 healthy volunteers (16 males and 15 females), and then the three-dimensional reconstruction of SPECT images were completed. Based on the MRI images, right striatum (RST) and the left striatum (LST) were drawn as ROI on the 4 most clearly consecutive transverse slices.The cerebellum (CB) was taken as the background reference area and the corresponding uptake ratios of ST/CB, LST/CB and RST/CB were calculated. The Pearson correlation tests for radio-uptake ratios (ST/CB, LST/CB, RST/CB), BMI and age were performed, Then multiple linear regression analysis using ST/CB as dependent variable and BMI and age as independent variables was performed. SPSS 15.0 was used in data analysis. Results: The ST imaging was symmetrical. The radioactivity was higher in the ST front area than that of the back area. The average uptake ratios of ST/CB, LST/CB, RST/CB were 1.71±0.16,1.70±0.16 and 1.72±0.17 respectively, in which the three ratios of the female were 1.74±0.18, 1.71±0.19 and 1.76±0.19 respectively and those of the male were 1.68±0.14, 1.68±0.13 and 1.69±0.15 respectively. ST/CB, LST/CB and RST/CB were negatively correlated with patients' BMI (r = -0.53, -0.57, -0.47, all P<0.05). The ST/CB was negatively correlated with patients' age (r=-0.39, P=0.03). The multiple linear regression analysis showed that the BMI was significant independent variable (β=-0.53, t= -3.36, P=0.002). Conclusions: The ST DAT level may decrease as patients' BMI and age increase. Females' DAT level is slightly higher than males'. For ST DAT imaging, age, gender and BMI should be all taken into consideration. (authors)
A repetitive elements perspective in Polycomb epigenetics.
Directory of Open Access Journals (Sweden)
Valentina eCasa
2012-10-01
Full Text Available Repetitive elements comprise over two-thirds of the human genome. For a long time, these elements have received little attention since they were considered non functional. On the contrary, recent evidence indicates that they play central roles in genome integrity, gene expression and disease. Indeed, repeats display meiotic instability associated with disease and are located within common fragile sites, which are hotspots of chromosome rearrangements in tumors. Moreover, a variety of diseases have been associated with aberrant transcription of repetitive elements. Overall this indicates that appropriate regulation of repetitive elements’ activity is fundamental.Polycomb group (PcG proteins are epigenetic regulators that are essential for the normal development of multicellular organisms. Mammalian PcG proteins are involved in fundamental processes, such as cellular memory, cell proliferation, genomic imprinting, X-inactivation, and cancer development. PcG proteins can convey their activity through long-distance interactions also on different chromosomes. This indicates that the 3D organization of PcG proteins contributes significantly to their function. However, it is still unclear how these complex mechanisms are orchestrated and which role PcG proteins play in the multi-level organization of gene regulation. Intriguingly, the greatest proportion of Polycomb-mediated chromatin modifications is located in genomic repeats and it has been suggested that they could provide a binding platform for Polycomb proteins.Here, these lines of evidence are woven together to discuss how repetitive elements could contribute to chromatin organization in the 3D nuclear space.
Zhu, Jinjin; Ordway, Alison J; Weber, Lena; Buddika, Kasun; Kumar, Justin P
2018-04-04
How different cells and tissues commit to and determine their fates has been a central question in developmental biology since the seminal embryological experiments conducted by Wilhelm Roux and Hans Driesch in sea urchins and frogs. Here, we demonstrate that Polycomb group (PcG) proteins maintain Drosophila eye specification by suppressing the activation of alternative fate choices. The loss of PcG in the developing eye results in a cellular reprogramming event in which the eye is redirected to a wing fate. This fate transformation occurs with either the individual loss of Polycomb proteins or the simultaneous reduction of the Pleiohomeotic repressive complex and Pax6. Interestingly, the requirement for retinal selector genes is limited to Pax6, as the removal of more downstream members does not lead to the eye-wing transformation. We also show that distinct PcG complexes are required during different developmental windows throughout eye formation. These findings build on earlier observations that the eye can be reprogrammed to initiate head epidermis, antennal and leg development. © 2018. Published by The Company of Biologists Ltd.
Fuel shipment experience, fuel movements from the BMI-1 transport cask
International Nuclear Information System (INIS)
Bauer, Thomas L.; Krause, Michael G.
1986-01-01
The University of Texas at Austin received two shipments of irradiated fuel elements from Northrup Aircraft Corporation on April 11 and 16, 1985. A total of 59 elements consisting of standard and instrumented TRIGA fuel were unloaded from the BMI-1 shipping cask. At the time of shipment, the Northrup core burnup was approximately 50 megawatt days with fuel element radiation levels, after a cooling time of three months, of approximately 1.75 rem/hr at 3 feet. In order to facilitate future planning of fuel shipment at the UT facility and other facilities, a summary of the recent transfer process including several factors which contributed to its success are presented. Numerous color slides were made of the process for future reference by UT and others involved in fuel transfer and handling of the BMI-1 cask
Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.
2011-01-01
The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-te...
Induction of neural stem cell-like cells (NSCLCs) from mouse astrocytes by Bmi1
International Nuclear Information System (INIS)
Moon, Jai-Hee; Yoon, Byung Sun; Kim, Bona; Park, Gyuman; Jung, Hye-Youn; Maeng, Isaac; Jun, Eun Kyoung; Yoo, Seung Jun; Kim, Aeree; Oh, Sejong; Whang, Kwang Youn; Kim, Hyunggee; Kim, Dong-Wook; Kim, Ki Dong; You, Seungkwon
2008-01-01
Recently, Bmi1 was shown to control the proliferation and self-renewal of neural stem cells (NSCs). In this study, we demonstrated the induction of NSC-like cells (NSCLCs) from mouse astrocytes by Bmi1 under NSC culture conditions. These NSCLCs exhibited the morphology and growth properties of NSCs, and expressed NSC marker genes, including nestin, CD133, and Sox2. In vitro differentiation of NSCLCs resulted in differentiated cell populations containing astrocytes, neurons, and oligodendrocytes. Following treatment with histone deacetylase inhibitors (trichostatin A and valproic acid), the potential of NSCLCs for proliferation, dedifferentiation, and self-renewal was significantly inhibited. Our data indicate that multipotent NSCLCs can be generated directly from astrocytes by the addition of Bmi1
Participation of Polycomb group gene extra sex combs in hedgehog signaling pathway
International Nuclear Information System (INIS)
Shindo, Norihisa; Sakai, Atsushi; Yamada, Kouji; Higashinakagawa, Toru
2004-01-01
Polycomb group (PcG) genes are required for stable inheritance of epigenetic states across cell divisions, a phenomenon termed cellular memory. PcG proteins form multimeric nuclear complex which modifies the chromatin structure of target site. Drosophila PcG gene extra sex combs (esc) and its vertebrate orthologs constitute a member of ESC-E(Z) complex, which possesses histone methyltransferase activity. Here we report isolation and characterization of medaka esc homolog, termed oleed. Hypomorphic knock-down of oleed using morpholino antisense oligonucleotides resulted in the fusion of eyes, termed cyclopia. Prechordal plate formation was not substantially impaired, but expression of hedgehog target genes was dependent on oleed, suggesting some link with hedgehog signaling. In support of this implication, histone methylation, which requires the activity of esc gene product, is increased in hedgehog stimulated mouse NIH-3T3 cells. Our data argue for the novel role of esc in hedgehog signaling and provide fundamental insight into the epigenetic mechanisms in general
Cytoplasmic tethering of a RING protein RBCK1 by its splice variant lacking the RING domain
International Nuclear Information System (INIS)
Yoshimoto, Nobuo; Tatematsu, Kenji; Koyanagi, Tomoyoshi; Okajima, Toshihide; Tanizawa, Katsuyuki; Kuroda, Shun'ichi
2005-01-01
RBCC protein interacting with PKC 1 (RBCK1) is a transcription factor belonging to the RING-IBR protein family and has been shown to shuttle between the nucleus and cytoplasm, possessing both the nuclear export and localization signals within its amino acid sequence. RBCK2, lacking the C-terminal half of RBCK1 including the RING-IBR domain, has also been identified as an alternative splice variant of RBCK1. RBCK2 shows no transcriptional activity and instead it represses the transcriptional activity of RBCK1. Here, we show that RBCK2 is present usually in the cytoplasm containing two Leu-rich regions that presumably serve as a nuclear export signal (NES). Moreover, an NES-disrupted RBCK1 that is mostly localized within the nucleus is translocated to the cytoplasm when coexpressed with RBCK2, suggesting that RBCK2 serves as a cytoplasmic tethering protein for RBCK1. We propose a novel and general function of RING-lacking splice variants of RING proteins to control the intracellular localization and functions of the parental RING proteins by forming a hetero-oligomeric complex
Niu, Qingli; Bonsergent, Claire; Rogniaux, Hélène; Guan, Guiquan; Malandrin, Laurence; Moreau, Emmanuelle
2016-12-15
Babesia sp. BQ1 (Lintan) is one of the parasites isolated from infected sheep in China that belongs to the B. motasi-like phylogenetic group. The rhoptry-associated-protein 1 (rap-1) locus in this group consists of a complex organization of 12 genes of three main types: 6 rap-1a variants intercalated with 5 identical copies of rap-1b and a single 3' ending rap-1c gene. In the present study, transcription analysis performed by standard RT-PCR demonstrated that the three different rap-1 gene types and the four rap-1a variants were transcribed by the parasite cultivated in vitro. Peptides, specific for each rap-1 type gene, were selected in putative linear B-epitopes and used to raise polyclonal rabbit antisera. Using these sera, the same expression pattern of RAP-1 proteins was found in parasites cultivated in vitro or collected from acute infection whereas only RAP-1a67 was detectable in merozoite extracts. However, ELISA performed with recombinant RAP-1a67, RAP-1b or RAP-1c and sera from infected sheep demonstrated that RAP-1a67 is the main RAP-1 recognized during infection, even if some infected sheep also recognized RAP-1b and/or RAP-1c. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Naghavi, Mojgan H.; Nowak, Piotr; Andersson, Jan; Soennerborg, Anders; Yang Huan; Tracey, Kevin J.; Vahlne, Anders
2003-01-01
We investigated whether the high mobility group B 1 (HMGB1), an abundant nuclear protein in all mammalian cells, affects HIV-1 transcription. Intracellular expression of human HMGB1 repressed HIV-1 gene expression in epithelial cells. This inhibitory effect of HMGB1 was caused by repression of long terminal repeat (LTR)-mediated transcription. Other viral promoters/enhancers, including simian virus 40 or cytomegalovirus, were not inhibited by HMGB1. In addition, HMGB1 inhibition of HIV-1 subtype C expression was dependent on the number of NFκB sites in the LTR region. The inhibitory effect of HMGB1 on viral gene expression observed in HeLa cells was confirmed by an upregulation of viral replication in the presence of antisense HMGB1 in monocytic cells. In contrast to what was found in HeLa cells and monocytic cells, endogenous HMGB1 expression did not affect HIV-1 replication in unstimulated Jurkat cells. Thus, intracellular HMGB1 affects HIV-1 LTR-directed transcription in a promoter- and cell-specific manner
Chen, H; Tuck-Muller, C M; Batista, D A; Wertelecki, W
1995-03-27
We report on a 15-year-old black boy with severe mental retardation, multiple congenital anomalies, and a supernumerary ring chromosome mosaicism. Fluorescence in situ hybridization with a chromosome 1 painting probe (pBS1) identified the ring as derived from chromosome 1. The karyotype was 46,XY/47,XY,+r(1)(p13q23). A review showed 8 reports of ring chromosome 1. In 5 cases, the patients had a non-supernumerary ring chromosome 1 resulting in partial monosomies of the short and/or long arm of chromosome 1. In 3 cases, the presence of a supernumerary ring resulted in partial trisomy of different segments of chromosome 1. In one of these cases the supernumerary ring was composed primarily of the centromere and the heterochromatic region of chromosome 1, resulting in normal phenotype. Our patient represents the third report of a supernumerary ring chromosome 1 resulting in abnormal phenotype.
Genome-wide analysis of Polycomb targets in Drosophila
Energy Technology Data Exchange (ETDEWEB)
Schwartz, Yuri B.; Kahn, Tatyana G.; Nix, David A.; Li,Xiao-Yong; Bourgon, Richard; Biggin, Mark; Pirrotta, Vincenzo
2006-04-01
Polycomb Group (PcG) complexes are multiprotein assemblages that bind to chromatin and establish chromatin states leading to epigenetic silencing. PcG proteins regulate homeotic genes in flies and vertebrates but little is known about other PcG targets and the role of the PcG in development, differentiation and disease. We have determined the distribution of the PcG proteins PC, E(Z) and PSC and of histone H3K27 trimethylation in the Drosophila genome. At more than 200 PcG target genes, binding sites for the three PcG proteins colocalize to presumptive Polycomb Response Elements (PREs). In contrast, H3 me3K27 forms broad domains including the entire transcription unit and regulatory regions. PcG targets are highly enriched in genes encoding transcription factors but receptors, signaling proteins, morphogens and regulators representing all major developmental pathways are also included.
Phosphorylation of Nanog is Essential to Regulate Bmi1 and Promote Tumorigenesis
Xie, Xiujie; Piao, Longzhu; Cavey, Greg S.; Old, Matthew; Teknos, Theodoros N.; Mapp, Anna K; Pan, Quintin
2014-01-01
Emerging evidence indicates that Nanog is intimately involved in tumorigenesis in part through regulation of the cancer initiating cell population. However, the regulation and role of Nanog in tumorigenesis are still poorly understood. In this study, human Nanog was identified to be phosphorylated by human PKCε at multiple residues including T200 and T280. Our work indicated that phosphorylation at T200 and T280 modulates Nanog function through several regulatory mechanisms. Results with phosphorylation-insensitive and phosphorylation-mimetic mutant Nanog revealed that phosphorylation at T200 and T280 enhance Nanog protein stability. Moreover, phosphorylation-insensitive T200A and T280A mutant Nanog had a dominant-negative function to inhibit endogenous Nanog transcriptional activity. Inactivation of Nanog was due to impaired homodimerization, DNA binding, promoter occupancy, and p300, a transcriptional co-activator, recruitment resulting in a defect in target gene promoter activation. Ectopic expression of phosphorylation-insensitive T200A or T280A mutant Nanog reduced cell proliferation, colony formation, invasion, migration, and the cancer initiating cell population in head and neck squamous cell carcinoma (HNSCC) cells. The in vivo cancer initiating ability was severely compromised in HNSCC cells expressing phosphorylation-insensitive T200A or T280A mutant Nanog; 87.5% (14/16), 12.5% (1/8), and 0% (0/8) for control, T200A, and T280A, respectively. Nanog occupied the Bmi1 promoter to directly transactivate and regulate Bmi1. Genetic ablation and rescue experiments demonstrated that Bmi1 is a critical downstream signaling node for the pleiotropic, pro-oncogenic effects of Nanog. Taken together, our study revealed, for the first time, that post-translational phosphorylation of Nanog is essential to regulate Bmi1 and promote tumorigenesis. PMID:23708658
Earlier BMI rebound and lower pre-rebound BMI as risk of obesity among Japanese preschool children.
Kato, N; Isojima, T; Yokoya, S; Tanaka, T; Ono, A; Yokomichi, H; Yamagata, Z; Tanaka, S; Matsubara, H; Ishikuro, M; Kikuya, M; Chida, S; Hosoya, M; Kuriyama, S; Kure, S
2018-01-01
Longitudinal growth data of children were analyzed to clarify the relationship between the timing of body mass index (BMI) rebound and obesity risk in later ages. Of 54 558 children born between April 2004 and March 2005 and longitudinally measured in April and October every year in the preschool period, 15 255 children were analyzed wherein no longitudinal measurement is missing after 1 year of age. BMI rebound age was determined as the age with smallest BMI value across longitudinal individual data after 1 year of age. Rebound age was compared between overweight and non-overweight groups. The subjects were divided into groups based on the timing of rebound. The sex- and age-adjusted mean of the BMI, height and weight s.d. scores for age group, along with 6 months weight and height gain, were compared among groups using analysis of covariance. Among those who were overweight at 66-71 months of age, BMI rebound age obtained at approximately 3 years of age was compared with the non-overweight group, whose BMI rebound age was utmost 66 months or later (PBMI age group showed that earlier BMI rebound results in larger BMI (PBMI rebound earlier than 30 months of age, low BMI was observed (PBMI rebound among groups with rebound age earlier than 60 months of age (PBMI rebound timing with pre-rebound low BMI leads to greater childhood obesity risk; hence, early detection and prevention is necessary for such cases.
Directory of Open Access Journals (Sweden)
Nikolai V. Rostovskii
2015-03-01
Full Text Available Strained azirinium ylides derived from 2H-azirines and α-diazoketones under Rh(II-catalysis can undergo either irreversible ring opening across the N–C2 bond to 2-azabuta-1,3-dienes that further cyclize to 2H-1,4-oxazines or reversibly undergo a 1,5-cyclization to dihydroazireno[2,1-b]oxazoles. Dihydroazireno[2,1-b]oxazoles derived from 3-aryl-2H-azirines and 3-diazoacetylacetone or ethyl diazoacetoacetate are able to cycloadd to acetyl(methylketene generated from 3-diazoacetylacetone under Rh(II catalysis to give 4,6-dioxa-1-azabicyclo[3.2.1]oct-2-ene and/or 5,7-dioxa-1-azabicyclo[4.3.1]deca-3,8-diene-2-one derivatives. According to DFT calculations (B3LYP/6-31+G(d,p, the cycloaddition can involve two modes of nucleophilic attack of the dihydroazireno[2,1-b]oxazole intermediate on acetyl(methylketene followed by aziridine ring opening into atropoisomeric oxazolium betaines and cyclization. Azirinium ylides generated from 2,3-di- and 2,2,3-triaryl-substituted azirines give rise to only 2-azabuta-1,3-dienes and/or 2H-1,4-oxazines.
Yusuff, Shamila; Davis, Stephani; Flaherty, Kathleen; Huselid, Eric; Patrizii, Michele; Jones, Daniel; Cao, Liangxian; Sydorenko, Nadiya; Moon, Young-Choon; Zhong, Hua; Medina, Daniel J.; Kerrigan, John; Stein, Mark N.; Kim, Isaac Y.; Davis, Thomas W.; DiPaola, Robert S.; Bertino, Joseph R.; Sabaawy, Hatem E.
2016-01-01
Purpose Current prostate cancer (PCa) management calls for identifying novel and more effective therapies. Self-renewing tumor-initiating cells (TICs) hold intrinsic therapy-resistance and account for tumor relapse and progression. As BMI-1 regulates stem cell self-renewal, impairing BMI-1 function for TICs-tailored therapies appears to be a promising approach. Experimental design We have previously developed a combined immunophenotypic and time-of-adherence assay to identify CD49bhiCD29hiCD44hi cells as human prostate TICs. We utilized this assay with patient derived prostate cancer cells and xenograft models to characterize the effects of pharmacological inhibitors of BMI-1. Results We demonstrate that in cell lines and patient-derived TICs, BMI-1 expression is upregulated and associated with stem cell-like traits. From a screened library, we identified a number of post-transcriptional small molecules that target BMI-1 in prostate TICs. Pharmacological inhibition of BMI-1 in patient-derived cells significantly decreased colony formation in vitro and attenuated tumor initiation in vivo, thereby functionally diminishing the frequency of TICs, particularly in cells resistant to proliferation- and androgen receptor (AR)-directed therapies, without toxic effects on normal tissues. Conclusions Our data offer a paradigm for targeting TICs and support the development of BMI-1-targeting therapy for a more effective PCa treatment. PMID:27307599
Directory of Open Access Journals (Sweden)
Andrew Hollands
Full Text Available Epidemiological studies of group A streptococcus (GAS have noted an inverse relationship between SpeB expression and invasive disease. However, the role of SpeB in the course of infection is still unclear. In this study we utilize a SpeB-negative M1T1 clinical isolate, 5628, with a naturally occurring mutation in the gene encoding the regulator RopB, to elucidate the role of RopB and SpeB in systemic virulence. Allelic exchange mutagenesis was used to replace the mutated ropB allele in 5628 with the intact allele from the well characterized isolate 5448. The inverse allelic exchange was also performed to replace the intact ropB in 5448 with the mutated allele from 5628. An intact ropB was found to be essential for SpeB expression. While the ropB mutation was shown to have no effect on hemolysis of RBC's, extracellular DNase activity or survival in the presence of neutrophils, strains with the mutated ropB allele were less virulent in murine systemic models of infection. An isogenic SpeB knockout strain containing an intact RopB showed similarly reduced virulence. Microarray analysis found genes of the SpeB operon to be the primary target of RopB regulation. These data show that an intact RopB and efficient SpeB production are necessary for systemic infection with GAS.
Mao, Nan; He, Guansheng; Rao, Jinjun; Lv, Lin
2014-06-01
To investigate the effect of silencing Bmi-1 expression in reversing cisplatin resistance in human lung cancer cells and explore the possible mechanisms. Cisplatin-resistant A549/DDP cells with small interference RNA (siRNA)-mediated Bmi-1 expression silencing were examined for cisplatin sensitivity using MTT assay and alterations in cell cycle distribution and apoptosis with flow cytometry, and the changes in cell senescence was assessed using β-galactosidase staining. The protein expressions of Bmi-1, P14(ARF), P16(INK4a), P53, P21, Rb and ubi-H2AK119 in the cells were determined with Western blotting. A549/DDP cells showed significantly higher Bmi-1 expression than A549 cells. After siRNA-mediated Bmi-1 silencing, A549/DDP cells showed significantly enhanced cisplatin sensitivity with an increased IC50 from 40.3±4.1 µmol/L to 18.3±2.8 µmol/L (Pcisplatin possibly by regulating INK4a/ARF/Rb senescence pathway.
AN N-BODY INTEGRATOR FOR GRAVITATING PLANETARY RINGS, AND THE OUTER EDGE OF SATURN'S B RING
International Nuclear Information System (INIS)
Hahn, Joseph M.; Spitale, Joseph N.
2013-01-01
A new symplectic N-body integrator is introduced, one designed to calculate the global 360° evolution of a self-gravitating planetary ring that is in orbit about an oblate planet. This freely available code is called epi i nt, and it is distinct from other such codes in its use of streamlines to calculate the effects of ring self-gravity. The great advantage of this approach is that the perturbing forces arise from smooth wires of ring matter rather than discreet particles, so there is very little gravitational scattering and so only a modest number of particles are needed to simulate, say, the scalloped edge of a resonantly confined ring or the propagation of spiral density waves. The code is applied to the outer edge of Saturn's B ring, and a comparison of Cassini measurements of the ring's forced response to simulations of Mimas's resonant perturbations reveals that the B ring's surface density at its outer edge is σ 0 = 195 ± 60 g cm –2 , which, if the same everywhere across the ring, would mean that the B ring's mass is about 90% of Mimas's mass. Cassini observations show that the B ring-edge has several free normal modes, which are long-lived disturbances of the ring-edge that are not driven by any known satellite resonances. Although the mechanism that excites or sustains these normal modes is unknown, we can plant such a disturbance at a simulated ring's edge and find that these modes persist without any damping for more than ∼10 5 orbits or ∼100 yr despite the simulated ring's viscosity ν s = 100 cm 2 s –1 . These simulations also indicate that impulsive disturbances at a ring can excite long-lived normal modes, which suggests that an impact in the recent past by perhaps a cloud of cometary debris might have excited these disturbances, which are quite common to many of Saturn's sharp-edged rings
Effects of oral administration of aflatoxin B1 and fumonisin B1 in rabbits (Oryctolagus cuniculus).
Orsi, R B; Oliveira, C A F; Dilkin, P; Xavier, J G; Direito, G M; Corrêa, B
2007-12-15
The effects of prolonged oral administration (21 days) of fumonisin B(1) (FB(1)) and aflatoxin B(1) (AFB(1)) were studied in male New Zealand rabbits by clinical, pathological, biochemical and sphingolipid analyses. Twenty-four animals were randomly divided into the following four experimental groups: (A) 0 mg FB(1)+0 microg AFB(1)/(kg body weight(bw)day) (control); (B) 0 mg FB(1)+30 microg AFB(1)/(kg bw day); (C) 1.5 mg FB(1)/(kg bw day)+30 microg AFB(1)/(kg bw day); (D) 1.5 mg FB(1)/(kg bw day)+0 microg AFB(1). Animals from group B and principally from group C presented clinical signs of intoxication. Rabbits from group C presented a lower body weight gain than controls. Differences were observed between intoxicated rabbits and controls with respect to absolute and relative liver and kidney weight, hepatic function, serum urea and creatinine levels and Sa/So ratio. The most frequent hepatic and renal injuries were vacuolar degeneration of the liver and kidney as shown by the histopathological and serum biochemical results. Combined administration of AFB(1) and FB(1) resulted in synergistic toxic effects both in the liver and in the kidney, but hepatic injuries were more marked.
Study of improvement in 1st ring`s gas-seal; Top ring no gas seal seino kojo no kento
Energy Technology Data Exchange (ETDEWEB)
Ando, H; Tateishi, Y; Fujimura, K; Hitosugi, H [Nippon Piston Ring Co. Ltd., Tokyo (Japan)
1997-10-01
The authors studied the effect of an angle of 1st ring twist on the amount of blow-by concerning higher speed/higher output engines for motorcycles. As a result, the authors found the twist made the ring restrained in a ring groove of piston , and confirmed its suitable range for blow-by. By means of the developed optimization method, the authors have achieved significant reduction in blow-by at high engine speed. 1 ref., 9 figs., 2 tabs.
Chromatin-bound IκBα regulates a subset of polycomb target genes in differentiation and cancer.
Mulero, María Carmen; Ferres-Marco, Dolors; Islam, Abul; Margalef, Pol; Pecoraro, Matteo; Toll, Agustí; Drechsel, Nils; Charneco, Cristina; Davis, Shelly; Bellora, Nicolás; Gallardo, Fernando; López-Arribillaga, Erika; Asensio-Juan, Elena; Rodilla, Verónica; González, Jessica; Iglesias, Mar; Shih, Vincent; Mar Albà, M; Di Croce, Luciano; Hoffmann, Alexander; Miyamoto, Shigeki; Villà-Freixa, Jordi; López-Bigas, Nuria; Keyes, William M; Domínguez, María; Bigas, Anna; Espinosa, Lluís
2013-08-12
IκB proteins are the primary inhibitors of NF-κB. Here, we demonstrate that sumoylated and phosphorylated IκBα accumulates in the nucleus of keratinocytes and interacts with histones H2A and H4 at the regulatory region of HOX and IRX genes. Chromatin-bound IκBα modulates Polycomb recruitment and imparts their competence to be activated by TNFα. Mutations in the Drosophila IκBα gene cactus enhance the homeotic phenotype of Polycomb mutants, which is not counteracted by mutations in dorsal/NF-κB. Oncogenic transformation of keratinocytes results in cytoplasmic IκBα translocation associated with a massive activation of Hox. Accumulation of cytoplasmic IκBα was found in squamous cell carcinoma (SCC) associated with IKK activation and HOX upregulation. Copyright © 2013 Elsevier Inc. All rights reserved.
Use of a Vaginal Ring Containing Dapivirine for HIV-1 Prevention in Women.
Baeten, Jared M; Palanee-Phillips, Thesla; Brown, Elizabeth R; Schwartz, Katie; Soto-Torres, Lydia E; Govender, Vaneshree; Mgodi, Nyaradzo M; Matovu Kiweewa, Flavia; Nair, Gonasagrie; Mhlanga, Felix; Siva, Samantha; Bekker, Linda-Gail; Jeenarain, Nitesha; Gaffoor, Zakir; Martinson, Francis; Makanani, Bonus; Pather, Arendevi; Naidoo, Logashvari; Husnik, Marla; Richardson, Barbra A; Parikh, Urvi M; Mellors, John W; Marzinke, Mark A; Hendrix, Craig W; van der Straten, Ariane; Ramjee, Gita; Chirenje, Zvavahera M; Nakabiito, Clemensia; Taha, Taha E; Jones, Judith; Mayo, Ashley; Scheckter, Rachel; Berthiaume, Jennifer; Livant, Edward; Jacobson, Cindy; Ndase, Patrick; White, Rhonda; Patterson, Karen; Germuga, Donna; Galaska, Beth; Bunge, Katherine; Singh, Devika; Szydlo, Daniel W; Montgomery, Elizabeth T; Mensch, Barbara S; Torjesen, Kristine; Grossman, Cynthia I; Chakhtoura, Nahida; Nel, Annalene; Rosenberg, Zeda; McGowan, Ian; Hillier, Sharon
2016-12-01
Antiretroviral medications that are used as prophylaxis can prevent acquisition of human immunodeficiency virus type 1 (HIV-1) infection. However, in clinical trials among African women, the incidence of HIV-1 infection was not reduced, probably because of low adherence. Longer-acting methods of drug delivery, such as vaginal rings, may simplify use of antiretroviral medications and provide HIV-1 protection. We conducted a phase 3, randomized, double-blind, placebo-controlled trial of a monthly vaginal ring containing dapivirine, a non-nucleoside HIV-1 reverse-transcriptase inhibitor, involving women between the ages of 18 and 45 years in Malawi, South Africa, Uganda, and Zimbabwe. Among the 2629 women who were enrolled, 168 HIV-1 infections occurred: 71 in the dapivirine group and 97 in the placebo group (incidence, 3.3 and 4.5 per 100 person-years, respectively). The incidence of HIV-1 infection in the dapivirine group was lower by 27% (95% confidence interval [CI], 1 to 46; P=0.046) than that in the placebo group. In an analysis that excluded data from two sites that had reduced rates of retention and adherence, the incidence of HIV-1 infection in the dapivirine group was lower by 37% (95% CI, 12 to 56; P=0.007) than that in the placebo group. In a post hoc analysis, higher rates of HIV-1 protection were observed among women over the age of 21 years (56%; 95% CI, 31 to 71; Pdapivirine reduced the risk of HIV-1 infection among African women, with increased efficacy in subgroups with evidence of increased adherence. (Funded by the National Institutes of Health; ClinicalTrials.gov number, NCT01617096 .).
Moloney, G P; Martin, G R; Mathews, N; Milne, A; Hobbs, H; Dodsworth, S; Sang, P Y; Knight, C; Williams, M; Maxwell, M; Glen, R C
1999-07-15
The synthesis and vascular 5-HT(1B)-like receptor activity of a novel series of substituted 2, N-benzylcarboxamido-5-(2-ethyl-1-dioxoimidazolidinyl)-N, N-dimethyltryptamine derivatives are described. Modifications to the 5-ethylene-linked heterocycle and to substituents on the 2-benzylamide side chain have been explored. Several compounds were identified which exhibited affinity at the vascular 5-HT(1B)-like receptor of pK(B) > 7.0, up to 100-fold selectivity over alpha(1)-adrenoceptor affinity and 5-HT(2A) receptor affinity, and which exhibited a favorable pharmacokinetic profile. N-Benzyl-3-[2-(dimethylamino)ethyl]-5-[2-(4,4-dimethyl-2, 5-dioxo-1-imidazolidinyl)ethyl]-1H-indole-2-carboxamide (23) was identified as a highly potent, silent (as judged by the inability of angiotensin II to unmask 5-HT(1B)-like receptor-mediated agonist activity in the rabbit femoral artery), and competitive vascular 5-HT(1B)-like receptor antagonist with a plasma elimination half-life of approximately 4 h in dog plasma and with good oral bioavailability. The selectivity of compounds from this series for the vascular 5-HT(1B)-like receptors over other receptor subtypes is discussed as well as a proposed mode of binding to the receptor pharmacophore. It has been proposed that the aromatic ring of the 2, N-benzylcarboxamide group can occupy an aromatic binding site rather than the indole ring. The resulting conformation allows an amine-binding site to be occupied by the ethylamine nitrogen and a hydrogen-bonding site to be occupied by one of the hydantoin carbonyls. The electronic nature of the 2,N-benzylcarboxamide aromatic group as well as the size of substituents on this aromatic group is crucial for producing potent and selective antagonists. The structural requirement on the 3-ethylamine side chain incorporating the protonatable nitrogen is achieved by the bulky 2, N-benzylcarboxamide group and its close proximity to the 3-side chain.
AKR1B10 induces cell resistance to daunorubicin and idarubicin by reducing C13 ketonic group
International Nuclear Information System (INIS)
Zhong Linlin; Shen Honglin; Huang Chenfei; Jing, Hongwu; Cao Deliang
2011-01-01
Daunorubicin, idarubicin, doxorubicin and epirubicin are anthracyclines widely used for the treatment of lymphoma, leukemia, and breast, lung, and liver cancers, but tumor resistance limits their clinical success. Aldo-keto reductase family 1 B10 (AKR1B10) is an NADPH-dependent enzyme overexpressed in liver and lung carcinomas. This study was aimed to determine the role of AKR1B10 in tumor resistance to anthracyclines. AKR1B10 activity toward anthracyclines was measured using recombinant protein. Cell resistance to anthracycline was determined by ectopic expression of AKR1B10 or inhibition by epalrestat. Results showed that AKR1B10 reduces C13-ketonic group on side chain of daunorubicin and idarubicin to hydroxyl forms. In vitro, AKR1B10 converted daunorubicin to daunorubicinol at V max of 837.42 ± 81.39 nmol/mg/min, K m of 9.317 ± 2.25 mM and k cat /K m of 3.24. AKR1B10 showed better catalytic efficiency toward idarubicin with V max at 460.23 ± 28.12 nmol/mg/min, K m at 0.461 ± 0.09 mM and k cat /K m at 35.94. AKR1B10 was less active toward doxorubicin and epirubicin with a C14-hydroxyl group. In living cells, AKR1B10 efficiently catalyzed reduction of daunorubicin (50 nM) and idarubicin (30 nM) to corresponding alcohols. Within 24 h, approximately 20 ± 2.7% of daunorubicin (1 μM) or 23 ± 2.3% of idarubicin (1 μM) was converted to daunorubicinol or idarubicinol in AKR1B10 expression cells compared to 7 ± 0.9% and 5 ± 1.5% in vector control. AKR1B10 expression led to cell resistance to daunorubicin and idarubicin, but inhibitor epalrestat showed a synergistic role with these agents. Together our data suggest that AKR1B10 participates in cellular metabolism of daunorubicin and idarubicin, resulting in drug resistance. These data are informative for the clinical use of idarubicin and daunorubicin. - Highlights: → This study defines enzyme activity of AKR1B10 protein towards daunorubicin, idarubicin, doxorubicin, and epirubicin. → This study pinpoints
DEFF Research Database (Denmark)
Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien
2012-01-01
site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial...... diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites...... and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain...
Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu
2017-12-01
This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with
The Cogollo Group and the oceanic anoxic events 1a and 1b, Maracaibo basin, Venezuela
Directory of Open Access Journals (Sweden)
José Alejandro Méndez Dot
Full Text Available ABSTRACTCarbonates of Cogollo Group (Apón, Lisure and Maraca formations constitute the broader calcareous platform system originated during Aptian and Albian of Cretaceous in north-western South America, Maracaibo Basin, Venezuela. On the shallow shelf, a variety of calcareous sedimentary facies were deposited during marine transgressive and regressive cycles. Some of them developed porosity and constitute important hydrocarbon reservoirs. Due to some major marine transgressions, from early Aptian, the anoxic environment and characteristic facies of a pelagic environment moved from the outer slope and basin to the shallow shelf, during specific time intervals, favouring the sedimentation of organic matter-rich facies, which correspond to the oceanic anoxic events (OAEs 1a and 1b. The source rock of Machiques Member (Apón Formation was deposited during early Aptian OAE 1a (~ 120 Ma. The source rock of Piché Member, located at the top of the Apón Formation, was deposited during late Aptian OAE 1b (~ 113 Ma. Finally, La Luna Formation, from Cenomanian, that covers the OAE 2 (~ 93 Ma, represents the most important source rock in the Maracaibo Basin. In this way and based on sedimentological and organic geochemistry results from the determinations performed on 247 samples belonging to six cores in the Maracaibo Basin, we propose these two organic-rich levels, deposited on the shallow shelf of the Cogollo Group, as "effective source rocks", additional to La Luna Formation, with oil migration in relatively small distances to the porosity facies.
Xie, Chunfeng; Jin, Jianliang; Lv, Xianhui; Tao, Jianguo; Wang, Rong; Miao, Dengshun
2015-01-01
To determine whether transplanted amniotic membrane mesenchymal stem cells (AMSCs) ameliorated the premature senescent phenotype of Bmi-1-deficient mice, postnatal 2-day-old Bmi-1−/− mice were injected intraperitoneally with the second-passage AMSCs from amniotic membranes of β-galactosidase (β-gal) transgenic mice or wild-type (WT) mice labeled with DiI. Three reinjections were given, once every seven days. Phenotypes of 5-week-old β-gal+ AMSC-transplanted or 6-week-old DiI+ AMSC-transplanted Bmi-1−/− mice were compared with vehicle-transplanted Bmi-1−/− and WT mice. Vehicle-transplanted Bmi-1−/− mice displayed growth retardation and premature aging with decreased cell proliferation and increased cell apoptosis; a decreased ratio and dysmaturity of lymphocytic series; premature osteoporosis with reduced osteogenesis and increased adipogenesis; redox imbalance and DNA damage in multiple organs. Transplanted AMSCs carried Bmi-1 migrated into multiple organs, proliferated and differentiated into multiple tissue cells, promoted growth and delayed senescence in Bmi-1−/− transplant recipients. The dysmaturity of lymphocytic series were ameliorated, premature osteoporosis were rescued by promoting osteogenesis and inhibiting adipogenesis, the oxidative stress and DNA damage in multiple organs were inhibited by the AMSC transplantation in Bmi-1−/− mice. These findings indicate that AMSC transplantation ameliorated the premature senescent phenotype of Bmi-1-deficient mice and could be a novel therapy to delay aging and prevent aging-associated degenerative diseases. PMID:26370922
International Nuclear Information System (INIS)
Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang
2017-01-01
The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 −/− ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN.
DEFF Research Database (Denmark)
Pasini, Diego; Malatesta, Martina; Jung, Hye Ryung
2010-01-01
Polycomb group (PcG) proteins are transcriptional repressors, which regulate proliferation and cell fate decisions during development, and their deregulated expression is a frequent event in human tumours. The Polycomb repressive complex 2 (PRC2) catalyzes trimethylation (me3) of histone H3 lysine...... are poorly understood. To gain insight into these mechanisms, we have determined the global changes in histone modifications in embryonic stem (ES) cells lacking the PcG protein Suz12 that is essential for PRC2 activity. We show that loss of PRC2 activity results in a global increase in H3K27 acetylation....... The methylation to acetylation switch correlates with the transcriptional activation of PcG target genes, both during ES cell differentiation and in MLL-AF9-transduced hematopoietic stem cells. Moreover, we provide evidence that the acetylation of H3K27 is catalyzed by the acetyltransferases p300 and CBP. Based...
The impact of sex and BMI on the clinical course of COPD and bronchial asthma
Directory of Open Access Journals (Sweden)
Krzysztof Wytrychowski
2016-09-01
Full Text Available Background. Bronchial asthma is a heterogeneous disease, and is one phenotype of asthma with obesity. Chronic obstructive pulmonary disease is the fourth most frequent cause of death in the world. Objectives. The aim of the study was to assess the influence of BMI and sex on the clinical course of uncontrolled asthma and COPD with moderate to severe airflow limitation. Material and methods . The study was performed on 2 groups. Group A: 72 adults suffering from asthma (38 F – females, 34 M – males with at least 1 exacerbation requiring treatment with systemic corticosteroids in the year before the study. Group B: 79 patients (34 F, 45 M with COPD Grades 2 and 3 according to GOLD. Data including age, gender, BMI, disease duration, treatment, concomitant diseases, pack-years, and number of exacerbations in the last year were collected. Asthma Control Questionnaire scores in group A and COPD Assessment Test scores in group B were collected. Pulmonary function tests were performed in both groups. Results . There were no differences between females and males in the analyzed variables in both groups. Obese patients (BMI > 30.0 kg/m2 were selected for analysis from group A (18 F, 10 M and from group B (13 F, 16 M. In group A, the number of exacerbations was significantly lower in males (M 1.3 vs. F 1.9; p = 0.01. In group B the age of obese patients was higher than in patients with BMI ≤ 30.0 (68.3 vs. 62.5; p = 0.002. Conclusion . Poorer control of asthma in obese patients was associated with the female gender. Age is a risk factor for obesity development in patients with COPD.
Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei
2018-03-01
Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.
Lv, Xianhui; Yu, Zhenzhen; Xie, Chunfeng; Dai, Xiuliang; Li, Qing; Miao, Dengshun; Jin, Jianliang
2017-01-22
The regeneration of injured tubular cell occurs primarily from intrinsic renal stem/progenitor cells (RSCs) labeled with CD24 and CD133 after acute tubular necrosis (ATN). Bmi-1 plays a crucial role in regulating self-renewal, differentiation and aging of multiple adult stem cells and progenitor cells. Bmi-1 was rapidly elevated in the induction of adult kidney regeneration by renal injury. To determine whether Bmi-1 maintained mobilization of RSCs in the protection from ATN, glycerol-rhabdomyolysis-induced ATN were performed in wild type (WT) and Bmi-1-deficient (Bmi-1 -/- ) mice. Their ATN phenotypes were analyzed; CD24 and CD133 double positive (CD24 + CD133 + ) cells were measured; and the levels of serum urea nitrogen (SUN) and serum creatinine (SCr) were detected. We found that CD24 + CD133 + RSCs were mobilized in WT ATN mice with the increased expression of Bmi-1; Bmi-1 deficiency led to increased tubular cast formation and necrosis, elevated levels of SUN and SCr, decreased tubular proliferation, and immobilized ratio of RSCs in ATN. These findings indicated that Bmi-1 played a critical role in the protection from ATN by maintaining mobilization of RSCs and would be a novel therapeutic target for preventing the progression of ATN. Copyright © 2016 Elsevier Inc. All rights reserved.
Luo, Mengcheng; Zhou, Jian; Leu, N. Adrian; Abreu, Carla M.; Wang, Jianle; Anguera, Montserrat C.; de Rooij, Dirk G.; Jasin, Maria; Wang, P. Jeremy
2015-01-01
Polycomb group proteins mediate transcriptional silencing in diverse developmental processes. Sex chromosomes undergo chromosome-wide transcription silencing during male meiosis. Here we report that mouse SCML2 (Sex comb on midleg-like 2), an X chromosome-encoded polycomb protein, is specifically
Fröhlich-Reiterer, Elke E; Rosenbauer, Joachim; Bechtold-Dalla Pozza, Susanne; Hofer, Sabine E; Schober, Edith; Holl, Reinhard W
2014-08-01
Increased weight gain has been reported prior to disease onset (accelerator hypothesis) and as a side effect of intensified insulin therapy in type 1 diabetes (T1D). Paediatric studies are complicated by the age-dependency and gender-dependency of BMI, and also by a trend towards obesity in the general population. The aim of this study was to evaluate factors related to the increase in BMI during the course of diabetes in children and adolescents with T1D in a large multicentre survey. Within the DPV database (Diabetespatienten Verlaufsdokumentation) a standardised, prospective, computer-based documentation programme, data of 53,108 patients with T1D, aged 12,774 patients (53% male, mean age 13.4±3.9, mean diabetes duration 4.7±3.0 years and mean age at diabetes onset 8.7±4.0 years) were included in this analysis. Population-based German reference data were used to calculate BMI-SDS and define overweight and obesity. 12.5% of T1D patients were overweight and 2.8% were obese. Multiple longitudinal regression analysis revealed that female gender, low BMI at diabetes onset, intensified insulin therapy and higher insulin dose, as well as pubertal diabetes onset, long diabetes duration and onset in earlier calendar years among girls, were related to higher BMI-SDS increase during the course of diabetes (p1; all). Intensified insulin regimen is associated with weight gain during T1D treatment, in addition to demographic variables. Optimisation of diabetes management, especially in females, might limit weight gain in order to reduce overweight and obesity together with comorbidities among paediatric T1D patients. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Ethyl 2-(6-bromo-2-phenyl-1H-imidazo[4,5-b]pyridin-1-ylacetate
Directory of Open Access Journals (Sweden)
Mohammed Yassin Hjouji
2016-05-01
Full Text Available In the title compound, C16H14BrN3O2, the fused-ring system is essentially planar, with the largest deviation from the mean plane being 0.0216 (15 Å for the substituted N atom of the five-membered ring, the plane of which makes dihedral angles of 28.50 (7 and 77.48 (7° with the terminal phenyl ring and the ethoxycarbonylmethyl group mean planes, respectively. In the crystal, C—H...N hydrogen bonds link the molecules into inversion dimers. These combine with weak C—H...N contacts to stack the molecules into columns along the b-axis direction.
Smith, Matthew; Mallin, Daniel R; Simon, Jeffrey A; Courey, Albert J
2011-04-01
The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE.
Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.
2011-01-01
The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE. PMID:21278366
Ni, Su-Jie; Zhao, Li-Qin; Wang, Xiao-Feng; Wu, Zhen-Hua; Hua, Rui-Xi; Wan, Chun-Hua; Zhang, Jie-Yun; Zhang, Xiao-Wei; Huang, Ming-Zhu; Gan, Lu; Sun, Hua-Lin; Dimri, Goberdhan P; Guo, Wei-Jian
2018-02-08
Chromobox protein homolog 7 (CBX7), a member of the polycomb group (PcG) family of proteins, is involved in the regulation of cell proliferation and cancer progression. PcG family members, such as BMI, Mel-18, and EZH2, are integral constituents of the polycomb repressive complexes (PRCs) and have been known to regulate cancer stem cell (CSC) phenotype. However, the role of other PRCs' constituents such as CBX7 in the regulation of CSC phenotype remains largely elusive. This study was to investigate the role of CBX7 in regulating stem cell-like properties of gastric cancer and the underlying mechanisms. Firstly, the role of CBX7 in regulating stem cell-like properties of gastric cancer was investigated using sphere formation, Western blot, and xenograft tumor assays. Next, RNA interference and ectopic CBX7 expression were employed to determine the impact of CBX7 on the expression of CSC marker proteins and CSC characteristics. The expression of CBX7, its downstream targets, and stem cell markers were analyzed in gastric stem cell spheres, common cancer cells, and gastric cancer tissues. Finally, the pathways by which CBX7 regulates stem cell-like properties of gastric cancer were explored. We found that CBX7, a constituent of the polycomb repressive complex 1 (PRC1), plays an important role in maintaining stem cell-like characteristics of gastric cancer cells via the activation of AKT pathway and the downregulation of p16. Spearman rank correlation analysis showed positive correlations among the expression of CBX7 and phospho-AKT (pAKT), stem cell markers OCT-4, and CD133 in gastric cancer tissues. In addition, CBX7 was found to upregulate microRNA-21 (miR-21) via the activation of AKT-NF-κB pathway, and miR-21 contributes to CBX7-mediated CSC characteristics. CBX7 positively regulates stem cell-like characteristics of gastric cancer cells by inhibiting p16 and activating AKT-NF-κB-miR-21 pathway.
Directory of Open Access Journals (Sweden)
Michael Anthony Ruiz
Full Text Available Glucose-induced augmented vascular endothelial growth factor (VEGF production is a key event in diabetic retinopathy. We have previously demonstrated that downregulation of miR-200b increases VEGF, mediating structural and functional changes in the retina in diabetes. However, mechanisms regulating miR-200b in diabetes are not known. Histone methyltransferase complex, Polycomb Repressive Complex 2 (PRC2, has been shown to repress miRNAs in neoplastic process. We hypothesized that, in diabetes, PRC2 represses miR-200b through its histone H3 lysine-27 trimethylation mark. We show that human retinal microvascular endothelial cells exposed to high levels of glucose regulate miR-200b repression through histone methylation and that inhibition of PRC2 increases miR-200b while reducing VEGF. Furthermore, retinal tissue from animal models of diabetes showed increased expression of major PRC2 components, demonstrating in vivo relevance. This research established a repressive relationship between PRC2 and miR-200b, providing evidence of a novel mechanism of miRNA regulation through histone methylation.
Hyland, Paula L; McDade, Simon S; McCloskey, Rachel; Dickson, Glenda J; Arthur, Ken; McCance, Dennis J; Patel, Daksha
2011-11-01
A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future.
4,4′-([4,4′-Bipyridine]-1,1′-diium-1,1′-diyldibenzoate dihydrate
Directory of Open Access Journals (Sweden)
Mark A. Rodriguez
2016-06-01
Full Text Available We report here the synthesis of a neutral viologen derivative, C24H16N2O4·2H2O. The non-solvent portion of the structure (Z-Lig is a zwitterion, consisting of two positively charged pyridinium cations and two negatively charged carboxylate anions. The carboxylate group is almost coplanar [dihedral angle = 2.04 (11°] with the benzene ring, whereas the dihedral angle between pyridine and benzene rings is 46.28 (5°. The Z-Lig molecule is positioned on a center of inversion (Fig. 1. The presence of the twofold axis perpendicular to the c-glide plane in space group C2/c generates a screw-axis parallel to the b axis that is shifted from the origin by 1/4 in the a and c directions. This screw-axis replicates the molecule (and solvent water molecules through space. The Z-Lig molecule links to adjacent molecules via O—H...O hydrogen bonds involving solvent water molecules as well as intermolecular C—H...O interactions. There are also π–π interactions between benzene rings on adjacent molecules.
Sabbattini, Pierangela; Sjoberg, Marcela; Nikic, Svetlana; Frangini, Alberto; Holmqvist, Per-Henrik; Kunowska, Natalia; Carroll, Tom; Brookes, Emily; Arthur, Simon J; Pombo, Ana; Dillon, Niall
2014-03-01
Methylated histones H3K9 and H3K27 are canonical epigenetic silencing modifications in metazoan organisms, but the relationship between the two modifications has not been well characterized. H3K9me3 coexists with H3K27me3 in pluripotent and differentiated cells. However, we find that the functioning of H3K9me3 is altered by H3S10 phosphorylation in differentiated postmitotic osteoblasts and cycling B cells. Deposition of H3K9me3/S10ph at silent genes is partially mediated by the mitogen- and stress-activated kinases (MSK1/2) and the Aurora B kinase. Acquisition of H3K9me3/S10ph during differentiation correlates with loss of paused S5 phosphorylated RNA polymerase II, which is present on Polycomb-regulated genes in embryonic stem cells. Reduction of the levels of H3K9me3/S10ph by kinase inhibition results in increased binding of RNAPIIS5ph and the H3K27 methyltransferase Ezh1 at silent promoters. Our results provide evidence of a novel developmentally regulated methyl-phospho switch that modulates Polycomb regulation in differentiated cells and stabilizes repressed states.
Yang, Bin; Vasbinder, Melissa M; Hird, Alexander W; Su, Qibin; Wang, Haixia; Yu, Yan; Toader, Dorin; Lyne, Paul D; Read, Jon A; Breed, Jason; Ioannidis, Stephanos; Deng, Chun; Grondine, Michael; DeGrace, Nancy; Whitston, David; Brassil, Patrick; Janetka, James W
2018-02-08
Checkpoint kinase 1 (CHK1) inhibitors are potential cancer therapeutics that can be utilized for enhancing the efficacy of DNA damaging agents. Multiple small molecule CHK1 inhibitors from different chemical scaffolds have been developed and evaluated in clinical trials in combination with chemotherapeutics and radiation treatment. Scaffold morphing of thiophene carboxamide ureas (TCUs), such as AZD7762 (1) and a related series of triazoloquinolines (TZQs), led to the identification of fused-ring bicyclic CHK1 inhibitors, 7-carboxamide thienopyridines (7-CTPs), and 7-carboxamide indoles. X-ray crystal structures reveal a key intramolecular noncovalent sulfur-oxygen interaction in aligning the hinge-binding carboxamide group to the thienopyridine core in a coplanar fashion. An intramolecular hydrogen bond to an indole NH was also effective in locking the carboxamide in the preferred bound conformation to CHK1. Optimization on the 7-CTP series resulted in the identification of lead compound 44, which displayed respectable drug-like properties and good in vitro and in vivo potency.
1,10,10-Trimethyl-5-phenyl-3-oxa-4-azatricyclo[5.2.1.02,6]dec-4-en-2-ol
Directory of Open Access Journals (Sweden)
Moha Berraho
2013-08-01
Full Text Available The title compound, C17H21NO2, was synthesized by the reaction of (1R-(+-3-benzylcamphor and hydroxylamine. The oxazole ring makes a dihedral angle of 23.42 (16° with the phenyl ring. The six-membered ring of the norboryl group adopts a boat conformation, whereas each of the five-membered rings of the norboryl group displays a flattened envelope conformation, with the C atom carrying the methyl groups representing the flap for both rings. In the crystal, molecules are linked into zigzag chains propagating along the b axis by O—H...N hydrogen bonds.
Alternative epigenetic chromatin states of polycomb target genes.
Directory of Open Access Journals (Sweden)
Yuri B Schwartz
2010-01-01
Full Text Available Polycomb (PcG regulation has been thought to produce stable long-term gene silencing. Genomic analyses in Drosophila and mammals, however, have shown that it targets many genes, which can switch state during development. Genetic evidence indicates that critical for the active state of PcG target genes are the histone methyltransferases Trithorax (TRX and ASH1. Here we analyze the repertoire of alternative states in which PcG target genes are found in different Drosophila cell lines and the role of PcG proteins TRX and ASH1 in controlling these states. Using extensive genome-wide chromatin immunoprecipitation analysis, RNAi knockdowns, and quantitative RT-PCR, we show that, in addition to the known repressed state, PcG targets can reside in a transcriptionally active state characterized by formation of an extended domain enriched in ASH1, the N-terminal, but not C-terminal moiety of TRX and H3K27ac. ASH1/TRX N-ter domains and transcription are not incompatible with repressive marks, sometimes resulting in a "balanced" state modulated by both repressors and activators. Often however, loss of PcG repression results instead in a "void" state, lacking transcription, H3K27ac, or binding of TRX or ASH1. We conclude that PcG repression is dynamic, not static, and that the propensity of a target gene to switch states depends on relative levels of PcG, TRX, and activators. N-ter TRX plays a remarkable role that antagonizes PcG repression and preempts H3K27 methylation by acetylation. This role is distinct from that usually attributed to TRX/MLL proteins at the promoter. These results have important implications for Polycomb gene regulation, the "bivalent" chromatin state of embryonic stem cells, and gene expression in development.
Correlation between solid gastric emptying and endoscopy after silastic ring vertical gastroplasty
International Nuclear Information System (INIS)
Furtado, P.C.; Brunetto, S.Q.; Etchebehere, E.C.S.C.; Sansana, C.R.; Santos, A.O.; Lima, M.C.L.; Ramos, C.D.; Camargo, E.E.; Pareja, J.C.
2002-01-01
Bariatric surgeries have been used in the treatment of obese patients. Silastic ring vertical gastroplasty (SRVG) consists of creating a gastric pouch which will lead to changes in the mechanism of digestion and to weight loss Aim: To determine the solid gastric emptying T1/2 in patients who underwent SRVG, and to correlate these findings with endoscopy, body mass index (BMI) and percent loss of excess body weight (PLEBW). Materials and Methods: Thirty six obese patients (30 women and 6 men, mean age 40.3 years) were submitted to SRVG. Endoscopy was performed 6 to 12 months after SRVG to classify the ring introduced into the neo stomach as tight, medium and large. Twelve to 18 months after SRVG the patients were submitted to scintigraphy and evaluation of BMI and PLEBW. Gastric emptying was performed with a solid meal which consisted of a cooked egg labeled with 99m Tc-microcolloid. Patients were placed in the upright position and acquisition was begun after ingestion of the radioactive meal. The gastric emptying T1/2 was calculated. Results: The T1/2 was 53.44 ± 40.26 minutes for patients with a tight ring (47.2% of the patient population); 68.03 ± 43.06 minutes for patients with a medium ring (22.2% of the patient population); and 23.06 ± 25.15 minutes for patients with a large ring (30.6% of the patient population). There was a significant correlation between T1/2 and endoscopic findings (p = 0.0482; ANOVA). Within 18 months after SRVG, patients showed BMI = 32.48 ± 7.51 and PLEBW = 77.41 ± 21.22 %. Statistical analyses showed that there was a tendency towards a direct correlation between T1/2 and PLEBW (r = 0.46; p 0.0045) and a tendency towards an inverse correlation with the BMI (r -0.48; p=0.0028). Conclusions: Despite the significant correlation between T1/2 and the endoscopic, BMI and PLEBW findings, this method was unable to differentiate the ring sizes, probably because endoscopy was performed at least 6 months prior to the gastric emptying study
Analysis of association of clinical aspects and IL1B tagSNPs with severe preeclampsia.
Leme Galvão, Larissa Paes; Menezes, Filipe Emanuel; Mendonca, Caio; Barreto, Ikaro; Alvim-Pereira, Claudia; Alvim-Pereira, Fabiano; Gurgel, Ricardo
2016-01-01
This study investigates the association between IL1B genotypes using a tag SNP (single polymorphism) approach, maternal and environmental factors in Brazilian women with severe preeclampsia. A case-control study with a total of 456 patients (169 preeclamptic women and 287 controls) was conducted in the two reference maternity hospitals of Sergipe state, Northeast Brazil. A questionnaire was administered and DNA was extracted to genotype the population for four tag SNPs of the IL1Beta: rs 1143643, rs 1143633, rs 1143634 and rs 1143630. Haplotype association analysis and p-values were calculated using the THESIAS test. Odds ratio (OR) estimation, confidence interval (CI) and multivariate logistic regression were performed. High pregestational body mass index (pre-BMI), first gestation, cesarean section, more than six medical visits, low level of consciousness on admission and TC and TT genotype in rs1143630 of IL1Beta showed association with the preeclamptic group in univariate analysis. After multivariate logistic regression pre-BMI, first gestation and low level of consciousness on admission remained associated. We identified an association between clinical variables and preeclampsia. Univariate analysis suggested that inflammatory process-related genes, such as IL1B, may be involved and should be targeted in further studies. The identification of the genetic background involved in preeclampsia host response modulation is mandatory in order to understand the preeclampsia process.
Fusion Rings for Quantum Groups
DEFF Research Database (Denmark)
Andersen, Henning Haahr; Stroppel, Catharina
2012-01-01
We study the fusion rings of tilting modules for a quantum group at a root of unity modulo the tensor ideal of negligible tilting modules. We identify them in type A with the combinatorial rings from [12] and give a similar description of the sp2n-fusion ring in terms of noncommutative symmetric...
Directory of Open Access Journals (Sweden)
Hoong-Kun Fun
2012-09-01
Full Text Available The asymmetric unit of the title compound, C27H16F2N2O4, consists of two crystallographically independent molecules (A and B. In molecule B, the isoindoline-1,3-dione ring system is disordered over two set of sites with a site-occupancy ratio of 0.658 (12:0.342 (12. In molecule A, the fluoro-substituted benzene rings make dihedral angles of 18.36 (8 and 46.37 (8° with the central benzene ring, whereas the corresponding angles are 40.90 (8 and 52.89 (9° in molecule B. The isoindoline ring system in molecule A and the major and minor components of the disordered isoindoline ring system in molecule B make dihedral angles of 58.50 (4, 54.13 (16 and 70.01 (28 °, respectively, with their attached benzene rings, linked through the amide group. An intramolecular O—H...O hydrogen bond generates an S(6 ring in each molecule. In the crystal, molecules are linked by N—H...O, C—H...F and C—H...O hydrogen bonds into sheets lying parallel to the bc plane. The crystal studied was a non-merohedral twin with a refined twin component ratio of 0.9316 (8:0.0684 (8.
The stability boundary of group-III transition metal diboride ScB 2 (0 0 0 1) surfaces
Zhao, Hui; Qin, Na
2012-01-01
Experimental observations and theoretical investigations exhibit that a group-IV(V) transition metal diboride (0 0 0 1) surface is terminated with a 1 × 1 TM(B) layer. As to a group-III transition metal diboride, we have investigated the stability boundary of ScB2 (0 0 0 1) surfaces using first principles total energy plane-wave pseudopotential method based on density functional theory. The Mulliken charge population analysis shows that Sc atoms in the second layer cannot provide B atoms in the first layer with sufficient electrons to form a complete graphene-like boron layer. We also found that the charge transfer between the first and the second layer for the B-terminated surface is more than that for Sc-terminated surface. It elucidates the reason that the outermost interlayer spacing contract more strongly in the B-terminated surface than in the Sc-terminated surface. The surface energies of both terminated ScB2 (0 0 0 1) surfaces as a function of the chemical potential of B are also calculated to check the relative stability of the two surface structures.
Directory of Open Access Journals (Sweden)
J. F. Pankow
2008-05-01
Full Text Available The SIMPOL.1 group contribution method is developed for predicting the liquid vapor pressure poL (atm and enthalpy of vaporization Δ Hvap (kJ mol-1 of organic compounds as functions of temperature (T. For each compound i, the method assumes log10poL,i (T=∑kνk,ibk(T where νk,i is the number of groups of type k, and bk (T is the contribution to log10poL,i (T by each group of type k. A zeroeth group is included that uses b0 (T with ν0,i=1 for all i. A total of 30 structural groups are considered: molecular carbon, alkyl hydroxyl, aromatic hydroxyl, alkyl ether, alkyl ring ether, aromatic ether, aldehyde, ketone, carboxylic acid, ester, nitrate, nitro, alkyl amine (primary, secondary, and tertiary, aromatic amine, amide (primary, secondary, and tertiary, peroxide, hydroperoxide, peroxy acid, C=C, carbonylperoxynitrate, nitro-phenol, nitro-ester, aromatic rings, non-aromatic rings, C=C–C=O in a non-aromatic ring, and carbon on the acid-side of an amide. The T dependence in each of the bk (T is assumed to follow b(T=B1/T+B2+B3T+B4ln T. Values of the B coefficients are fit using an initial basis set of 272 compounds for which experimentally based functions po L,i=fi (T are available. The range of vapor pressure considered spans fourteen orders of magnitude. The ability of the initially fitted B coefficients to predict poL values is examined using a test set of 184 compounds and a T range that is as wide as 273
Hyland, Paula L.; McDade, Simon S.; McCloskey, Rachel; Dickson, Glenda J.; Arthur, Ken; McCance, Dennis J.; Patel, Daksha
2011-01-01
A number of epigenetic alterations occur in both the virus and host cellular genomes during human papillomavirus (HPV)-associated carcinogenesis, and investigations of such alterations, including changes in chromatin proteins and histone modifications, have the potential to lead to therapeutic epigenetic reversion. We report here that transformed HPV16 E6/E7-expressing primary human foreskin keratinocytes (HFKs) (E6/E7 cells) demonstrate increased expression of the PRC2 methyltransferase EZH2 at both the mRNA and protein levels but do not exhibit the expected increase in trimethylated H3K27 (H3K27me3) compared to normal keratinocytes. In contrast, these cells show a reduction in global H3K27me3 levels in vitro, as well as upregulation of the KDM6A demethylase. We further show for the first time that transformation with the HPV16 E6 and E7 oncogenes also results in an increase in phosphorylated EZH2 serine 21 (P-EZH2-Ser21), mediated by active Akt, and in a downregulation of the PRC1 protein BMI1 in these cells. High-grade squamous cervical intraepithelial lesions also showed a loss of H3K27me3 in the presence of increased expression of EZH2. Correlating with the loss of H3K27me3, E6/E7 cells exhibited derepression of specific EZH2-, KMD6A-, and BMI1-targeted HOX genes. These results suggest that the observed reduction in H3K27me3 may be due to a combination of reduced activities/levels of specific polycomb proteins and increases in demethylases. The dysregulation of multiple chromatin proteins resulting in the loss of global H3K27me3 and the transcriptional reprogramming in HPV16 E6/E7-infected cells could provide an epigenetic signature associated with risk and/or progression of HPV16-associated cancers, as well as the potential for epigenetic reversion in the future. PMID:21865393
Lim, Chae Woo; Hwang, Byung Kook; Lee, Sung Chul
2015-09-01
Plants are constantly exposed to a variety of biotic and abiotic stresses, which include pathogens and conditions of high salinity, low temperature, and drought. Abscisic acid (ABA) is a major plant hormone involved in signal transduction pathways that mediate the defense response of plants to abiotic stress. Previously, we isolated Ring finger protein gene (CaRING1) from pepper (Capsicum annuum), which is associated with resistance to bacterial pathogens, accompanied by hypersensitive cell death. Here, we report a new function of the CaRING1 gene product in the ABA-mediated defense responses of plants to dehydration stress. The expression of the CaRING1 gene was induced in pepper leaves treated with ABA or exposed to dehydration or NaCl. Virus-induced gene silencing of CaRING1 in pepper plants exhibited low degree of ABA-induced stomatal closure and high levels of transpirational water loss in dehydrated leaves. These led to be more vulnerable to dehydration stress in CaRING1-silenced pepper than in the control pepper, accompanied by reduction of ABA-regulated gene expression and low accumulation of ABA and H2O2. In contrast, CaRING1-overexpressing transgenic plants showed enhanced sensitivity to ABA during the seedling growth and establishment. These plants were also more tolerant to dehydration stress than the wild-type plants because of high ABA accumulation, enhanced stomatal closure and increased expression of stress-responsive genes. Together, these results suggest that the CaRING1 acts as positive factor for dehydration tolerance in Arabidopsis by modulating ABA biosynthesis and ABA-mediated stomatal closing and gene expression.
Crystal structure of (E-3-(2,4-dimethoxyphenyl-1-(1-hydroxynaphthalen-2-ylprop-2-en-1-one
Directory of Open Access Journals (Sweden)
Dongsoo Koh
2014-09-01
Full Text Available In the title compound, C21H18O4, the C=C bond of the central enone group adopts an E conformation. The dihedral angle formed by the benzene ring and the naphthalene ring system is 6.60 (2°. The methoxy groups on the benzene ring are essentially coplanar with the ring; the C—C—O—C torsion angles being 1.6 (2 and −177.1 (1°. The hydroxy group attached to the naphthalene ring is involved in an intramolecular O—H...O hydrogen bond. The relative conformation of the two double bonds in the enone group is s-cisoid. In the crystal, weak C—H...O hydrogen bonds link the molecules into chains propagating along [010].
BMI and BMI SDS in childhood: annual increments and conditional change
Brannsether-Ellingsen, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Juliusson, Petur Benedikt
2016-01-01
Background: Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim: To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods: The distributions of 1-year increments of BMI (kg/m2) and BMI SDS are summarised by...
Bmi1 regulates murine intestinal stem cell proliferation and self-renewal downstream of Notch.
López-Arribillaga, Erika; Rodilla, Verónica; Pellegrinet, Luca; Guiu, Jordi; Iglesias, Mar; Roman, Angel Carlos; Gutarra, Susana; González, Susana; Muñoz-Cánoves, Pura; Fernández-Salguero, Pedro; Radtke, Freddy; Bigas, Anna; Espinosa, Lluís
2015-01-01
Genetic data indicate that abrogation of Notch-Rbpj or Wnt-β-catenin pathways results in the loss of the intestinal stem cells (ISCs). However, whether the effect of Notch is direct or due to the aberrant differentiation of the transit-amplifying cells into post-mitotic goblet cells is unknown. To address this issue, we have generated composite tamoxifen-inducible intestine-specific genetic mouse models and analyzed the expression of intestinal differentiation markers. Importantly, we found that activation of β-catenin partially rescues the differentiation phenotype of Rbpj deletion mutants, but not the loss of the ISC compartment. Moreover, we identified Bmi1, which is expressed in the ISC and progenitor compartments, as a gene that is co-regulated by Notch and β-catenin. Loss of Bmi1 resulted in reduced proliferation in the ISC compartment accompanied by p16(INK4a) and p19(ARF) (splice variants of Cdkn2a) accumulation, and increased differentiation to the post-mitotic goblet cell lineage that partially mimics Notch loss-of-function defects. Finally, we provide evidence that Bmi1 contributes to ISC self-renewal. © 2015. Published by The Company of Biologists Ltd.
Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma
International Nuclear Information System (INIS)
Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S
2014-01-01
Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC
Kakoly, Nadira Sultana; Earnest, Arul; Moran, Lisa J; Teede, Helena J; Joham, Anju E
2017-11-06
Obesity is common in young women, increasing insulin resistance (IR) and worsening pregnancy complications, including gestational diabetes (GDM). Women with polycystic ovary syndrome (PCOS) are commonly obese, which aggravates the severity of PCOS clinical expression. Relationships between these common insulin-resistant conditions, however, remain unclear. We conducted a secondary analysis of the Australian Longitudinal Study on Women's Health (ALSWH) database, including data from 8009 women aged 18-36 years across six surveys. We used latent-curve growth modelling to identify distinct body mass index (BMI) trajectories and multinomial logistic regression to explore sociodemographic and health variables characterizing BMI group membership. Logistic regression was used to assess independent risk of GDM. A total of 662 women (8.29%, 95% CI 7.68-8.89) reported PCOS. Three distinct BMI trajectories emerged, namely low stable (LSG) (63.8%), defined as an average trajectory remaining at ~25 kg/m 2 ; moderately rising (MRG) (28.8%), a curvilinear trajectory commencing in a healthy BMI and terminating in the overweight range; and high-rising (HRG) (7.4%), a curvilinear trajectory starting and terminating in the obese range. A high BMI in early reproductive life predicted membership in higher trajectories. The HRG BMI trajectory was independently associated with GDM (OR 2.50, 95% CI 1.80-3.48) and was a stronger correlate than PCOS (OR 1.89, 95% CI 1.41-2.54), maternal age, socioeconomic status, or parity. Our results suggest heterogeneity in BMI change among Australian women of reproductive age, with and without PCOS. Reducing early adult life weight represents an ideal opportunity to intervene at an early stage of reproductive life and decreases the risk of long-term metabolic complications such as GDM.
Directory of Open Access Journals (Sweden)
Nada Kheira Sebbar
2015-06-01
Full Text Available In the title compound, C25H20N2O2S, the dihydroisoxazole ring exhibits an envelope conformation with the methine atom being the flap, while the 1,4-thiazine ring displays a screw-boat conformation. The six-membered ring fused to the 1,4-thiazine ring makes dihedral angles of 63.04 (2 and 54.7 (2° with the mean planes through the five-membered heterocycle and the attached phenyl ring, respectively. The phenyl group connected to the 1,4-thiazine ring is disordered over two sites [major component = 0.57 (2]. The most prominent interactions in the crystal structure are C—H...O hydrogen bonds that link molecules, forming inversion dimers, and C—H...N hydrogen bonds that link the dimers into columns parallel to the b axis.
Directory of Open Access Journals (Sweden)
Anne-Lise Bjørke-Monsen
2016-11-01
Full Text Available Maternal nutrition and inflammation have been suggested as mediators in the development of various adverse pregnancy outcomes associated with maternal obesity. We have investigated the relation between pre-pregnancy BMI, B vitamin status, and inflammatory markers in a group of healthy pregnant women. Cobalamin, folate, pyridoxal 5′-phosphate, and riboflavin; and the metabolic markers homocysteine, methylmalonic acid, and 3-hydroxykynurenine/xanthurenic acid ratio (HK/XA; and markers of cellular inflammation, neopterin and kynurenine/tryptophan ratio (KTR were determined in pregnancy week 18 and related to pre-pregnancy body mass index (BMI, in 2797 women from the Norwegian Mother and Child Cohort Study (MoBa. Pre-pregnancy BMI was inversely related to folate, cobalamin, pyridoxal 5′-phosphate (PLP, and riboflavin (p < 0.001, and associated with increased neopterin and KTR levels (p < 0.001. Inflammation seemed to be an independent predictor of low vitamin B6 status, as verified by low PLP and high HK/XA ratio. A high pre-pregnancy BMI is a risk factor for low B vitamin status and increased cellular inflammation. As an optimal micronutrient status is vital for normal fetal development, the observed lower B vitamin levels may contribute to adverse pregnancy outcomes associated with maternal obesity and B vitamin status should be assessed in women with high BMI before they get pregnant.
Comparative analysis between P1 and B1 equations for neutron moderation
International Nuclear Information System (INIS)
Martinez, Aquilino Senra; Silva, Fernando Carvalho da; Cardoso, Carlos Eduardo Santos
2000-01-01
In order to calculate the neutron flux in nuclear reactors, B1 or P1 equations are solved by numerical methods for several groups of energy. The neutron fluxes obtained from the solutions of the B1 and P1 equations are similar when they are applied to large nuclear power reactors. However, an important difference between the two fluxes is that the system of P1 equations uses one more approximation than the B1 system and then, its flux is less precise. The present work shows the relations between both equations and analyzes for what conditions the two equations systems are equivalent. Furthermore, this equations are numerically solved in 54 groups of energy for a quadrangular arrange. (author)
Yamakoshi, Kimi; Katano, Satoshi; Iida, Mayu; Kimura, Hiromi; Okuma, Atsushi; Ikemoto-Uezumi, Madoka; Ohtani, Naoko; Hara, Eiji; Maruyama, Mitsuo
2015-01-01
Bmi-1 prevents stem cell aging, at least partly, by blocking expression of the cyclin-dependent kinase inhibitor p16Ink4a. Therefore, dysregulation of the Bmi-1/p16Ink4a pathway is considered key to the loss of tissue homeostasis and development of associated degenerative diseases during aging. However, because Bmi-1 knockout (KO) mice die within 20 weeks after birth, it is difficult to determine exactly where and when dysregulation of the Bmi-1/p16Ink4a pathway occurs during aging in vivo. Using real-time in vivo imaging of p16Ink4a expression in Bmi-1-KO mice, we uncovered a novel function of the Bmi-1/p16Ink4a pathway in controlling homeostasis of the submandibular glands (SMGs), which secrete saliva into the oral cavity. This pathway is dysregulated during aging in vivo, leading to induction of p16Ink4a expression and subsequent declined SMG function. These findings will advance our understanding of the molecular mechanisms underlying the aging-related decline of SMG function and associated salivary gland hypofunction, which is particularly problematic among the elderly. PMID:25832744
DEFF Research Database (Denmark)
Klauke, Karin; Radulović, Višnja; Broekhuis, Mathilde
2013-01-01
The balance between self-renewal and differentiation of adult stem cells is essential for tissue homeostasis. Here we show that in the haematopoietic system this process is governed by polycomb chromobox (Cbx) proteins. Cbx7 is specifically expressed in haematopoietic stem cells (HSCs), and its...... overexpression enhances self-renewal and induces leukaemia. This effect is dependent on integration into polycomb repressive complex-1 (PRC1) and requires H3K27me3 binding. In contrast, overexpression of Cbx2, Cbx4 or Cbx8 results in differentiation and exhaustion of HSCs. ChIP-sequencing analysis shows that Cbx......7 and Cbx8 share most of their targets; we identified approximately 200 differential targets. Whereas genes targeted by Cbx8 are highly expressed in HSCs and become repressed in progenitors, Cbx7 targets show the opposite expression pattern. Thus, Cbx7 preserves HSC self-renewal by repressing...
Kleinian singularities and the ground ring of c=1 string theory
International Nuclear Information System (INIS)
Ghoshal, D.; Jatkar, D.P.; Mukhi, S.
1993-01-01
We investigate the nature of the ground ring of c=1 string theory at the special ADE points in the c=1 moduli space associated to discrete subgroups of SU(2). The chiral ground rings at these points are shown to define the ADE series of singular varieties introduced by Klein. The non-chiral ground rings relevant to closed-string theory are 3 real dimensional singular varieties obtained as U(1) quotients of the kleinian varieties. The unbroken symmetries of the theory at these points are the volume-preserving diffeomorphisms of these varieties. The theory of kleinian singularities has a close relation to that of complex hyperKaehler surfaces, or gravitational instantons. We speculate on the relevance of these instantons and of self-dual gravity in c=1 string theory. (orig.)
2,2′-{1,1′-[Butane-1,4-diylbis(oxynitrilo]diethylidyne}di-1-naphthol
Directory of Open Access Journals (Sweden)
Wen-Kui Dong
2009-06-01
Full Text Available The title compound, C28H28N2O4, was synthesized by the reaction of 2-acetyl-1-naphthol with 1,4-bis(aminooxybutane in ethanol. The molecule, which lies about an inversion centre, adopts a linear structure, in which the oxime groups and naphthalene ring systems assume an anti conformation. The intramolecular interplanar distance between parallel naphthalene rings is 1.054 (3 Å. Intramolecular O—H...N hydrogen bonds are formed between the oxime nitrogen and hydroxy groups.
BMI and Lifetime Changes in BMI and Cancer Mortality Risk
Taghizadeh, Niloofar; Boezen, H. Marike; Schouten, Jan P.; Schröder, Carolien P.; de Vries, E. G. Elisabeth; Vonk, Judith M.
2015-01-01
Body Mass Index (BMI) is known to be associated with cancer mortality, but little is known about the link between lifetime changes in BMI and cancer mortality in both males and females. We studied the association of BMI measurements (at baseline, highest and lowest BMI during the study-period) and lifetime changes in BMI (calculated over different time periods (i.e. short time period: annual change in BMI between successive surveys, long time period: annual change in BMI over the entire study period) with mortality from any cancer, and lung, colorectal, prostate and breast cancer in a large cohort study (n=8,645. Vlagtwedde-Vlaardingen, 1965-1990) with a follow-up on mortality status on December 31st 2008. We used multivariate Cox regression models with adjustments for age, smoking, sex, and place of residence. Being overweight at baseline was associated with a higher risk of prostate cancer mortality (hazard ratio (HR) =2.22; 95% CI 1.19-4.17). Obesity at baseline was associated with a higher risk of any cancer mortality [all subjects (1.23 (1.01-1.50)), and females (1.40 (1.07-1.84))]. Chronically obese females (females who were obese during the entire study-period) had a higher risk of mortality from any cancer (2.16 (1.47-3.18), lung (3.22 (1.06-9.76)), colorectal (4.32 (1.53-12.20)), and breast cancer (2.52 (1.15-5.54)). We found no significant association between long-term annual change in BMI and cancer mortality risk. Both short-term annual increase and decrease in BMI were associated with a lower mortality risk from any cancer [all subjects: (0.67 (0.47-0.94)) and (0.73 (0.55-0.97)), respectively]. In conclusion, a higher BMI is associated with a higher cancer mortality risk. This study is the first to show that short-term annual changes in BMI were associated with lower mortality from any type of cancer. PMID:25881129
Seco-B-Ring Steroidal Dienynes with Aromatic D Ring: Design, Synthesis and Biological Evaluation
Directory of Open Access Journals (Sweden)
Marcin Szybinski
2017-10-01
Full Text Available Continuing our structure-activity studies on the vitamin D analogs with the altered intercyclic seco-B-ring fragment, we designed compounds possessing dienyne system conjugated with the benzene D ring. Analysis of the literature data and the docking experiments seemed to indicate that the target compounds could mimic the ligands with a good affinity to the vitamin D receptor (VDR. Multi-step synthesis of the C/D-ring building block of the tetralone structure was achieved and its enol triflate was coupled with the known A-ring fragments, possessing conjugated enyne moiety, using Sonogashira protocol. The structures of the final products were confirmed by NMR, UV and mass spectroscopy. Their binding affinities for the full-length human VDR were determined and it was established that compound substituted at C-2 with exomethylene group showed significant binding to the receptor. This analog was also able to induce monocytic differentiation of HL-60 cells.
1,3-Dibenzyl-6-bromo-1H-imidazo[4,5-b]pyridin-2(3H-one
Directory of Open Access Journals (Sweden)
S. Dahmani
2010-04-01
Full Text Available The imidazopyridine fused-ring in the title compound, C20H16BrN3O, is planar (r.m.s. deviation = 0.011 Å. The phenyl rings of the benzyl substitutents twist away from the central five-membered ring in opposite directions; the rings are aligned at 61.3 (1 and 71.2 (1° with respect to this ring.
BMI and BMI SDS in childhood: annual increments and conditional change.
Brannsether, Bente; Eide, Geir Egil; Roelants, Mathieu; Bjerknes, Robert; Júlíusson, Pétur Benedikt
2017-02-01
Background Early detection of abnormal weight gain in childhood may be important for preventive purposes. It is still debated which annual changes in BMI should warrant attention. Aim To analyse 1-year increments of Body Mass Index (BMI) and standardised BMI (BMI SDS) in childhood and explore conditional change in BMI SDS as an alternative method to evaluate 1-year changes in BMI. Subjects and methods The distributions of 1-year increments of BMI (kg/m 2 ) and BMI SDS are summarised by percentiles. Differences according to sex, age, height, weight, initial BMI and weight status on the BMI and BMI SDS increments were assessed with multiple linear regression. Conditional change in BMI SDS was based on the correlation between annual BMI measurements converted to SDS. Results BMI increments depended significantly on sex, height, weight and initial BMI. Changes in BMI SDS depended significantly only on the initial BMI SDS. The distribution of conditional change in BMI SDS using a two-correlation model was close to normal (mean = 0.11, SD = 1.02, n = 1167), with 3.2% (2.3-4.4%) of the observations below -2 SD and 2.8% (2.0-4.0%) above +2 SD. Conclusion Conditional change in BMI SDS can be used to detect unexpected large changes in BMI SDS. Although this method requires the use of a computer, it may be clinically useful to detect aberrant weight development.
International Nuclear Information System (INIS)
Tátrai, Péter; Szepesi, Áron; Matula, Zsolt; Szigeti, Anna; Buchan, Gyöngyi; Mádi, András; Uher, Ferenc
2012-01-01
Highlights: ► We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. ► hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. ► SV40T introduced along with hTERT abrogates proliferation control and multipotency. ► hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC hTERT , ASC Bmi-1 , ASC Bmi-1+hTERT and ASC SV40T+hTERT were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC Bmi-1 had limited replicative potential, while the rapidly proliferating ASC SV40T+hTERT acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC hTERT and ASC hTERT+Bmi-1 , on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC hTERT also acquired aberrant karyotype and showed signs of transformation after long-term culture. In conclusion, hTERT alone was sufficient to extend the life span of human ASC, but ASC hTERT are prone to transformation during extensive
Absence of torsion for NK_1(R) over associative rings
Basu, Rabeya
2010-01-01
When R is a commutative ring with identity, and if k is a natural number with kR = R, then C. Weibel proved that SK_1(R[X]) has no k-torsion. We reprove his result for any associative ring R with identity in which kR = R.
CD133 and BMI1 expressions and its prognostic role in primary ...
Indian Academy of Sciences (India)
This study aimed to analyse the expression of CD133 mRNA and its correlations ... CD133 mRNA and BMI1 protein expression could independently predict the glioblastoma .... treatment at the National Institute of Mental Health and Neu- .... Low. 16 (76.2). High. 53 mutations of which 38 were exonic and 15 were intronic.
The effect of prenatal maternal cigarette smoking on children's BMI z-score with SGA as a mediator.
Salahuddin, Meliha; Pérez, Adriana; Ranjit, Nalini; Hoelscher, Deanna M; Kelder, Steven H
2018-02-21
The goal of this study was to assess the effect of prenatal maternal cigarette smoking on children's BMI z-score trajectories, and to evaluate whether small-for-gestational-age (SGA) acts as a potential mediator between prenatal maternal cigarette smoking and child's BMI z-score at 4 years of age. Group-based trajectory modeling (GBTM) methods were employed to describe and classify developmental BMI z-score trajectories (the outcome of interest) in children from 9 months to 4 years of age (n = 5221) in the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B) study (2001-2005). Further analysis examined whether the identified BMI z-score trajectories varied with the exposure, prenatal maternal cigarette smoking. Mediation analyses were utilized to examine whether being SGA (binary measure) acted as a potential mediator in the relationship between prenatal maternal cigarette smoking and BMI z-score among 4-year-old children. Using GBTM, two BMI z-score trajectory groups were identified: normal BMI z-score (57.8%); and high BMI z-score (42.2%). Children of mothers who smoked cigarettes during pregnancy were 2.1 times (RR 95% CI: 1.1-4.0, P value = 0.023) more at risk of being in the high BMI z-score trajectory group. Prenatal cigarette smoking was positively related to SGA at birth, but SGA was inversely related to BMI z-score at 4 years. The direct effect (0.19, 95% CI: 0.18, 0.19; P value BMI z-score among 4-year-old children was stronger and in the opposite direction of the indirect effect (-0.04, 95% CI: -0.04, -0.04; P value BMI z-score group, as well with SGA. The effects of prenatal smoking on BMI z-score at 4 years appears to act through pathways other than SGA.
Platinum Catalyzed Ring-Opening of 1,2-Cyclopropanated Sugars with O-Nucleophiles
DEFF Research Database (Denmark)
Beyer, Jürgen; Skaanderup, Philip Robert; Madsen, Robert
1999-01-01
In the presence of a catalytic amount of Zeise's dimer 1,2-cyclopropanated sugars undergo regioselective ring-opening at C-1 with O-nucleophiles including alcohols, phenols and water to produce 2-C-branched carbohydrates.......In the presence of a catalytic amount of Zeise's dimer 1,2-cyclopropanated sugars undergo regioselective ring-opening at C-1 with O-nucleophiles including alcohols, phenols and water to produce 2-C-branched carbohydrates....
Status of the PEP-II B-factory high energy ring
International Nuclear Information System (INIS)
Wienands, U.; Reuter, E.; Bellomo, P.; Daly, E.; Fisher, A.; Gracia, J.; Kulikov, A.; Kurita, N.; Pietryka, M.; Seeman, J.T.; Taylor; Belser, C.; Bertolini, L.; Mugge, M.; Swan, J.
1996-01-01
The 9 GeV High Energy Ring (HER) of the PEP-II B Factory is an electron storage ring under construction at SLAC. Significant progress has been made in the last year on all systems. As of mid 1996, all 192 dipoles have been installed, with installation of the quadrupoles underway. The vacuum system, for design currents up to 3 A average, is in production using a recently commissioned e-beam welder. Beam instrumentation systems are being fabricated. The interaction region will bring the HER beam into collision with the 3 GeV beam of the Low Energy Ring; design of this section of the HER is in an advanced stage. 8 refs., 3 figs., 1 tab
SF3B1-initiating mutations in MDS-RSs target lymphomyeloid hematopoietic stem cells.
Mortera-Blanco, Teresa; Dimitriou, Marios; Woll, Petter S; Karimi, Mohsen; Elvarsdottir, Edda; Conte, Simona; Tobiasson, Magnus; Jansson, Monika; Douagi, Iyadh; Moarii, Matahi; Saft, Leonie; Papaemmanuil, Elli; Jacobsen, Sten Eirik W; Hellström-Lindberg, Eva
2017-08-17
Mutations in the RNA splicing gene SF3B1 are found in >80% of patients with myelodysplastic syndrome with ring sideroblasts (MDS-RS). We investigated the origin of SF3B1 mutations within the bone marrow hematopoietic stem and progenitor cell compartments in patients with MDS-RS. Screening for recurrently mutated genes in the mononuclear cell fraction revealed mutations in SF3B1 in 39 of 40 cases (97.5%), combined with TET2 and DNMT3A in 11 (28%) and 6 (15%) patients, respectively. All recurrent mutations identified in mononuclear cells could be tracked back to the phenotypically defined hematopoietic stem cell (HSC) compartment in all investigated patients and were also present in downstream myeloid and erythroid progenitor cells. While in agreement with previous studies, little or no evidence for clonal ( SF3B1 mutation) involvement could be found in mature B cells, consistent involvement at the pro-B-cell progenitor stage was established, providing definitive evidence for SF3B1 mutations targeting lymphomyeloid HSCs and compatible with mutated SF3B1 negatively affecting lymphoid development. Assessment of stem cell function in vitro as well as in vivo established that only HSCs and not investigated progenitor populations could propagate the SF3B1 mutated clone. Upon transplantation into immune-deficient mice, SF3B1 mutated MDS-RS HSCs differentiated into characteristic ring sideroblasts, the hallmark of MDS-RS. Our findings provide evidence of a multipotent lymphomyeloid HSC origin of SF3B1 mutations in MDS-RS patients and provide a novel in vivo platform for mechanistically and therapeutically exploring SF3B1 mutated MDS-RS. © 2017 by The American Society of Hematology.
International Nuclear Information System (INIS)
King, N.M.
1980-01-01
The Storage Ring Group set out to identify and pursue salient problems in accelerator physics for heavy ion fusion, divorced from any particular reference design concept. However, it became apparent that some basic parameter framework was required to correlate the different study topics. As the Workshop progressed, ring parameters were modified and updated. Consequently, the accompanying papers on individual topics will be found to refer to slightly varied parameters, according to the stage at which the different problems were tackled
25Gb/s 1V-driving CMOS ring modulator with integrated thermal tuning.
Li, Guoliang; Zheng, Xuezhe; Yao, Jin; Thacker, Hiren; Shubin, Ivan; Luo, Ying; Raj, Kannan; Cunningham, John E; Krishnamoorthy, Ashok V
2011-10-10
We report a high-speed ring modulator that fits many of the ideal qualities for optical interconnect in future exascale supercomputers. The device was fabricated in a 130 nm SOI CMOS process, with 7.5 μm ring radius. Its high-speed section, employing PN junction that works at carrier-depletion mode, enables 25 Gb/s modulation and an extinction ratio >5 dB with only 1V peak-to-peak driving. Its thermal tuning section allows the device to work in broad wavelength range, with a tuning efficiency of 0.19 nm/mW. Based on microwave characterization and circuit modeling, the modulation energy is estimated ~7 fJ/bit. The whole device fits in a compact 400 μm2 footprint.
Noahsen, Paneeraq; Andersen, Stig
2013-01-01
To identify thresholds of BMI at which similar levels of serum lipids occur in Inuit and in non-Inuit as the impact of obesity on metabolic risk factors differ in Inuit compared to other ethnic groups. Published comparative data among Inuit and non-Inuit whites on BMI and HDL-cholesterol and triglyceride were identified for analysis. A literature search was done for BMI, lipids, Inuit and Greenland or Canada. Studies with data on triglycerides and HDL-cholesterol in Inuit and non-Inuit Caucasians were selected and data were retrieved. Regression equations were computed for BMI and HDL-cholesterol and BMI and triglycerides. BMI for similar levels of lipids in Inuit and non-Inuit and ratios of Inuit/non-Inuit BMI's were calculated. At BMI 25 kg/m2 HDL-cholesterol was 1.7/1.6 mM in Greenland Inuit/non-Inuit women and 1.7/1.5 mM in men in a major comparative study. HDL cholesterol decreased by 0.09 for each 1 kg/m2 increase in BMI. Serum triglycerides were 1.0/1.1 mM for Greenland Inuit/non-Inuit women and 0.9/ 1.4 mM for men at BMI 25 kg/m2. Slopes were around 0.1. A comparative study in Canadian Inuit/non-Inuit gave similar results. The BMI levels required for similar HDL-cholesterol or triglycerides were around 27.5 kg/m2, and Inuit/non-Inuit BMI-ratios were around 1.1. The same degree of dyslipidaemia was seen when Inuit had a 10% higher BMI compared to non-Inuit. This may support the establishment of Inuit-specific BMI cut-offs for the purposes of health screening and population health surveillance.
Effects of prolonged oral administration of fumonisin B1 and aflatoxin B1 in rats.
Pozzi, C R; Corrêa, B; Xavier, J G; Direito, G M; Orsi, R B; Matarazzo, S V
2001-01-01
The effects of prolonged oral administration (21 days) of fumonisin B1 (FB1) and aflatoxin B1 (AFB1) were evaluated on male Wistar rats. The animals were housed in individual metabolic cages and submitted to the following treatments: 1-0 microg AFB1 + 0 mg FB1/100g bw.; 2-72 microg AFB1+ 0 mg FB1/100 g bw; 3-0 microg AFB1 + 0.5 mg FB1 g bw; 4-0 microg AFB1 + 1.5 mg FB1/100 g bw; 5-72 microg AFB1 + 0.5 mg FB1/100g bw; 6-72 microgAFB1 + 1.5 mg FB1/100g bw. On day 21, the rats were sacrificed for evaluation. The results showed that treated animals presented differences in body weight and absolute/relative weights of liver and kidney as well as altered hepatic function and cholesterol blood levels. Rats fed with the greatest doses of AFB1 and FB1 gained less weight (2.79 g/day) at the end of the experimental period; their blood concentrations of liver enzymes aspartate aminotransferase (AST) and alkaline phosphatase (AP) were above control levels (130.35 micro/l and 471.00 micro/l, respectively). Blood cholesterol increased in the groups treated with the highest dose of FB1 or FB1 associated with AFB1. Histopathology revealed the occurrence of apoptosis in the liver of rats exposed to FB1. The association of aflatoxin B1 with fumonisin B1 at higher dose probably potentiated the effects of the higher dose of fumonisin B1 acting singly.
Energy Technology Data Exchange (ETDEWEB)
Tatrai, Peter, E-mail: peter.tatrai@biomembrane.hu [Institute of Enzymology, Research Center for Natural Sciences, Hungarian Academy of Sciences, Karolina ut 29, H-1113 Budapest (Hungary); Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Szepesi, Aron, E-mail: aron.szepesi@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Matula, Zsolt, E-mail: matula.zsolt@gmail.com [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Szigeti, Anna, E-mail: anna.szigeti@biomembrane.hu [Creative Cell Ltd., Puskas Tivadar utca 13, H-1119 Budapest (Hungary); Buchan, Gyoengyi, E-mail: buchan@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Madi, Andras, E-mail: madi@med.unideb.hu [Department of Biochemistry and Molecular Biology, Medical and Health Science Center, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Stem Cell, Apoptosis and Genomics Research Group of the Hungarian Academy of Sciences, University of Debrecen, Egyetem ter 1, H-4032 Debrecen (Hungary); Uher, Ferenc, E-mail: uher@biomembrane.hu [Stem Cell Laboratory, Hungarian National Blood Transfusion Service, Dioszegi ut 64, H-1113 Budapest (Hungary); and others
2012-05-25
Highlights: Black-Right-Pointing-Pointer We immortalized human adipose stromal cells (ASCs) with hTERT, Bmi-1, and SV40T. Black-Right-Pointing-Pointer hTERT-only ASCs are prone to transformation, while Bmi-only ASCs become senescent. Black-Right-Pointing-Pointer SV40T introduced along with hTERT abrogates proliferation control and multipotency. Black-Right-Pointing-Pointer hTERT combined with Bmi-1 yields stable phenotype up to 140 population doublings. -- Abstract: Adipose tissue-derived stromal cells (ASCs) are increasingly being studied for their usefulness in regenerative medicine. However, limited life span and donor-dependent variation of primary cells such as ASCs present major hurdles to controlled and reproducible experiments. We therefore aimed to establish immortalized ASC cell lines that provide steady supply of homogeneous cells for in vitro work while retain essential features of primary cells. To this end, combinations of human telomerase reverse transcriptase (hTERT), murine Bmi-1, and SV40 large T antigen (SV40T) were introduced by lentiviral transduction into ASCs. The resulting cell lines ASC{sup hTERT}, ASC{sup Bmi-1}, ASC{sup Bmi-1+hTERT} and ASC{sup SV40T+hTERT} were tested for transgene expression, telomerase activity, surface immunomarkers, proliferation, osteogenic and adipogenic differentiation, karyotype, tumorigenicity, and cellular senescence. All cell lines have maintained expression of characteristic surface immunomarkers, and none was tumorigenic. However, ASC{sup Bmi-1} had limited replicative potential, while the rapidly proliferating ASC{sup SV40T+hTERT} acquired chromosomal aberrations, departed from MSC phenotype, and lost differentiation capacity. ASC{sup hTERT} and ASC{sup hTERT+Bmi-1}, on the other hand, preserved all essential MSC features and did not senesce after 100 population doublings. Notably, a subpopulation of ASC{sup hTERT} also acquired aberrant karyotype and showed signs of transformation after long-term culture
Directory of Open Access Journals (Sweden)
Catherine Creppe
2014-12-01
Full Text Available Polycomb proteins play an essential role in maintaining the repression of developmental genes in self-renewing embryonic stem cells. The exact mechanism allowing the derepression of polycomb target genes during cell differentiation remains unclear. Our project aimed to identify Cbx8 binding sites in differentiating mouse embryonic stem cells. Therefore, we used a genome-wide chromatin immunoprecipitation of endogenous Cbx8 coupled to direct massive parallel sequencing (ChIP-Seq. Our analysis identified 171 high confidence peaks. By crossing our data with previously published microarray analysis, we show that several differentiation genes transiently recruit Cbx8 during their early activation. Depletion of Cbx8 partially impairs the transcriptional activation of these genes. Both interaction analysis, as well as chromatin immunoprecipitation experiments support the idea that activating Cbx8 acts in the context of an intact PRC1 complex. Prolonged gene activation results in eviction of PRC1 despite persisting H3K27me3 and H2A ubiquitination. The composition of PRC1 is highly modular and changes when embryonic stem cells commit to differentiation. We further demonstrate that the exchange of Cbx7 for Cbx8 is required for the effective activation of differentiation genes. Taken together, our results establish a function for a Cbx8-containing complex in facilitating the transition from a Polycomb-repressed chromatin state to an active state. As this affects several key regulatory differentiation genes this mechanism is likely to contribute to the robust execution of differentiation programs.
Bent Shaped 1,3,4-Oxadiazole/Thiadiazole heterocyclic rings ...
Indian Academy of Sciences (India)
Two series of bent shaped 1,3,4-oxadiazole/thiadiazole heterocyclic ring containing liquid crystalline (LC) compounds were synthesized and characterized by FT-IR, 1H, 13C-NMR and ESI-Mass spectro-scopic techniques. Liquid crystal properties were investigated by polarized optical microscopy and differential scanning ...
5-[(1-Benzyl-1H-1,2,3-triazol-4-ylmethyl]-5H-dibenzo[b,f]azepine
Directory of Open Access Journals (Sweden)
N. K. Lokanath
2013-12-01
Full Text Available In the title compound, C24H20N4, the azepine ring adopts a boat conformation. The dihedral angle between the benzene rings fused to the azepine ring is 49.40 (9°. The triazole ring makes a dihedral angle of 77.88 (9° with the terminal phenyl ring. In the crystal, molecules are linked via C—H...π interactions and a parallel slipped π–π interaction [centroid–centroid distance = 3.7324 (9, normal distance = 3.4060 (6 and slippage = 1.526 Å], forming a three-dimensional network.
Directory of Open Access Journals (Sweden)
Lip Lin Koh
2011-01-01
Full Text Available In the title compound, C16H13N7O, the 1,2,4-triazolo[1,5-a][1,3,5]triazine heterocyclic system is essentially planar (r.m.s. deviation = 0.0375 Å. The attached benzene ring lies almost in the mean plane of 1,2,4-triazolo[1,5-a][1,3,5]triazine [dihedral angle = 1.36 (23°], while the pyridine ring is turned out of this plane by the aminomethyl bridge [dihedral angle = 69.22 (9°]. The amino group H atom is involved in intramolecular hydrogen bonding with a triazole N atom. In the crystal, molecules are connected via C(=ONH...N hydrogen bonds into C(11 chains parallel to [100]. The amino group H atom acts as a hydrogen-bond donor, forming an NH...O=C hydrogen bond with the carbonyl O atom, which links the molecules into C(6 chains running along [011] and [01overline{1}].
Directory of Open Access Journals (Sweden)
Hind Jabli
2010-01-01
Full Text Available The reaction of 1,5-dibenzyl-3-propargyl-1,5-benzodiazepine-2,4-dione with ethyl azidoacetate in the presence of copper sulfate pentahydrate and sodium ascorbate leads to the formation of the title regioisomer, C30H29N5O4, which features a phenylene ring fused with a seven-membered diazepinyl ring. The latter ring adopts a boat conformation (with the methyltriazolylacetate-bearing C atom as the prow and the fused-ring C atoms as the stern. The benzyl groups connected to the diazepinyl ring jprotrude from the sides; the methyltriazolylacetate substituent occupies an axial position.
2-Methylsulfanyl-5,6-dihydro-2H-1,3-dithiolo[4,5-b][1,4]dioxin-2-ium tetrafluoroborate
Directory of Open Access Journals (Sweden)
Guoquan Zhou
2012-04-01
Full Text Available The title compound, C6H7O2S3+·BF4−, consists of a planar 2-thioxo-1,3-dithiol-4,5-yl unit [maximum deviation from the ring plane = 0.020 (3 Å], with an ethylenedioxy group fused at the 4,5-positions; the ethylenedioxy C atoms are disordered over two positions with site-occupancy factors of 0.5. The 1,4-dioxine ring has a twist-chair conformation. Weak cation–anion S...F interactions [3.022 (4–3.095 (4 Å] and an S...O [3.247 (4 Å] interaction are present.
A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins
Lengsfeld, Bettina M.; Berry, Kayla N.; Ghosh, Sharmistha; Takahashi, Masateru; Francis, Nicole J.
2012-01-01
Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.
A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins
Lengsfeld, Bettina M.
2012-09-17
Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.
26 CFR 1.267(b)-1 - Relationships.
2010-04-01
... 26 Internal Revenue 3 2010-04-01 2010-04-01 false Relationships. 1.267(b)-1 Section 1.267(b)-1...) INCOME TAXES Items Not Deductible § 1.267(b)-1 Relationships. (a) In general. (1) The persons referred to... partnership separately. Therefore, if the other person and a partner are within any one of the relationships...
Redox shuttles having an aromatic ring fused to a 1,1,4,4-tetrasubstituted cyclohexane ring
Weng, Wei; Zhang, Zhengcheng; Amine, Khalil
2015-12-01
An electrolyte includes an alkali metal salt; an aprotic solvent; and a redox shuttle additive including an aromatic compound having at least one aromatic ring fused with at least one non-aromatic ring, the aromatic ring having two or more oxygen or phosphorus-containing substituents.
Microstructure, texture, and magnetic properties of backward extruded NdFeB ring magnets
International Nuclear Information System (INIS)
Gruenberger, W.; Hinz, D.; Schlaefer, D.; Schultz, L.
1996-01-01
Radially-oriented NdFeB ring magnets have been prepared by backward extrusion of melt-spun material. The average remanence measured in the radial direction reaches values above 1.2 T. Due to the inhomogeneity of the deformation, the magnetic properties and X-ray diffraction patterns revealed a gradual improvement of the alignment from the outer shell to regions near the inner surface of the ring. (orig.)
Community-Specific BMI Cutoff Points for South Indian Females
Directory of Open Access Journals (Sweden)
K. B. Kishore Mohan
2011-01-01
Full Text Available Objective. To analyze multiparameters related to total body composition, with specific emphasis on obesity in South Indian females, in order to derive community-specific BMI cutoff points. Patients and Methods. A total number of 87 females (of age 37.33±13.12 years from South Indian Chennai urban population participated in this clinical study. Body composition analysis and anthropometric measurements were acquired after conducting careful clinical examination. Results. BMI demonstrated high significance when normal group (21.02±1.47 kg/m2 was compared with obese group (29.31±3.95 kg/m2, <0.0001. BFM displayed high significance when normal group (14.92±4.28 kg was compared with obese group (29.94 ± 8.1 kg, <0.0001. Conclusion. Community-specific BMI cutoffs are necessary to assess obesity in different ethnic groups, and relying on WHO-based universal BMI cutoff points would be a wrong strategy.
The Impact of Waiting List BMI Changes on the Short-term Outcomes of Lung Transplantation.
Jomphe, Valérie; Mailhot, Geneviève; Damphousse, Véronic; Tahir, Muhammad-Ramzan; Receveur, Olivier; Poirier, Charles; Ferraro, Pasquale
2018-02-01
Obesity and underweight are associated with a higher postlung transplantation (LTx) mortality. This study aims to assess the impact of the changes in body mass index (BMI) during the waiting period for LTx on early postoperative outcomes. Medical records of 502 consecutive cases of LTx performed at our institution between 1999 and 2015 were reviewed. Patients were stratified per change in BMI category between pre-LTx assessment (candidate BMI) and transplant BMI as follows: A-candidate BMI, less than 18.5 or 18.5 to 29.9 and transplant BMI, less than 18.5; B-candidate BMI, less than 18.5 and transplant BMI, 18.5 to 29.9; C-candidate BMI, 18.5 to 29.9 and transplant BMI, 18.5 to 29.9; D-candidate BMI, 30 or greater and transplant BMI, 18.5 to 29.9; and E-candidate BMI, 30 or greater or 18.5 to 29.9 and transplant BMI, 30 or greater. Our primary outcome was in-hospital mortality and secondary outcomes were length of mechanical ventilation, intensive care unit length of stay (LOS), hospital LOS and postoperative complications. BMI variation during the waiting time was common, as 1/3 of patients experienced a change in BMI category. Length of mechanical ventilation (21 days vs 9 days; P = 0.018), intensive care unit LOS (26 days vs 15 days; P = 0.035), and rates of surgical complications (76% vs 44%; P = 0.018) were significantly worse in patients of group E versus group D. Obese candidates who failed to decrease BMI less than 30 by transplant exhibited an increased risk of postoperative mortality (odds ratio, 2.62; 95% confidence interval, 1.01-6.48) compared with patients in group C. Pre-LTx BMI evolution had no impact on postoperative morbidity and mortality in underweight patients. Our results suggest that obese candidates with an unfavorable pretransplant BMI evolution are at greater risk of worse post-LTx outcomes.
Energy Technology Data Exchange (ETDEWEB)
Martinez, Aquilino Senra; Silva, Fernando Carvalho da; Cardoso, Carlos Eduardo Santos [Universidade Federal, Rio de Janeiro, RJ (Brazil). Coordenacao dos Programas de Pos-graduacao de Engenharia. Programa de Engenharia Nuclear
2000-07-01
In order to calculate the neutron flux in nuclear reactors, B1 or P1 equations are solved by numerical methods for several groups of energy. The neutron fluxes obtained from the solutions of the B1 and P1 equations are similar when they are applied to large nuclear power reactors. However, an important difference between the two fluxes is that the system of P1 equations uses one more approximation than the B1 system and then, its flux is less precise. The present work shows the relations between both equations and analyzes for what conditions the two equations systems are equivalent. Furthermore, this equations are numerically solved in 54 groups of energy for a quadrangular arrange. (author)
6-Bromo-1,3-di-2-propynyl-1H-imidazo[4,5-b]pyridin-2(3H-one
Directory of Open Access Journals (Sweden)
S. Dahmani
2010-04-01
Full Text Available The room-temperature reaction of propargyl bromide and 6-bromo-1,3-dihydroimidazo[4,5-b]pyridin-2-one in dimethylformamide yields the title compound, C12H8BrN3O, which features nitrogen-bound propynyl substituents. The imidazopyridine fused ring is almost planar (r.m.s. deviation = 0.011 Å; the propynyl chains point in opposite directions relative to the fused ring. One acetylenic H atom is hydrogen bonded to the carbonyl O atom of an inversion-related molecule, forming a dimer; adjacent dimers are linked by a second acetylene–pyridine C—H...N interaction, forming a layer motif.
Wang, Chen; Sun, Zuo-Bang; Xu, Qing-Wen; Zhao, Cui-Hua
2016-11-14
It is a challenging issue to achieve propeller chirality for triarylboranes owing to the low transition barrier between the P and M forms of the boron center. Herein, we report a new strategy to achieve propeller chirality of triarylboranes. It was found that the chirality relay from axially chiral 1,1'-binaphthyl to propeller chirality of the trivalent boron center can be realized when a Me 2 N and a Mes 2 B group (Mes=mesityl) are introduced at the 2,2'-positions of the 1,1'-binaphthyl skeleton (BN-BNaph) owing to the strong π-π interaction between the Me 2 N-bonded naphthyl ring and the phenyl ring of one adjacent Mes group, which not only exerts great steric hindrance on the rotation of the two Mes groups but also gives unequal stability to the two configurations of the boron center for a given configuration of the binaphthyl moiety. The stereostructures of the boron center were fully characterized through 1 H NMR spectroscopy, X-ray crystal analyses, and theoretical calculations. Detailed comparisons with the analog BN-Ph-BNaph, in which the Mes 2 B group is separated from 1,1'-binaphthyl by a para-phenylene spacer, confirmed the essential role of π-π interaction for the successful chirality relay in BN-BNaph. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Kasi Viswanatharaju Ruddraraju
2015-04-01
Full Text Available The title compound, C24H32N4O8S, (I, crystallizes as a zwitterion. The terminal amine N atom of the [(2-{2-[2-(2-ammonioethoxyethoxy]ethoxy}ethylcarbamoyl] side chain is protonated, while the 1,2,5-thiadiazolidin-3-one 1,1-dioxide N atom is deprotonated. The side chain is turned over on itself with an intramolecular N—H...O hydrogen bond. The 1,2,5-thiadiazolidin-3-one 1,1-dioxide ring has an envelope conformation with the aryl-substituted N atom as the flap. Its mean plane is inclined by 62.87 (8° to the aryl ring to which it is attached, while the aryl rings of the biphenyl unit are inclined to one another by 20.81 (8°. In the crystal, molecules are linked by N—H...O and N—H...N hydrogen bonds, forming slabs lying parallel to (010. Within the slabs there are C—H...O and C—H...N hydrogen bonds and C—H...π interactions present.
Directory of Open Access Journals (Sweden)
Zarogoulidis Kostas
2011-01-01
Full Text Available Abstract Background The World Health Organization alert for the H1N1 influenza pandemic led to the implementation of certain measures regarding admission of patients with flu-like symptoms. All these instructions were adopted by the Greek National Health System. The aim of this study was to retrospectively examine the characteristics of all subjects admitted to the Unit of Infectious Diseases with symptoms indicating H1N1 infection, and to identify any differences between H1N1 positive or negative patients. Patients from the ED (emergency department with flu-like symptoms (sore throat, cough, rhinorhea, or nasal congestion and fever >37.5°C were admitted in the Unit of Infectious diseases and gave pharyngeal or nasopharyngeal swabs. Swabs were tested with real-time reverse-transcriptase-polymerase-chain-reaction (RT-PCR. Findings Patients were divided into two groups. Group A comprised 33 H1N1 positive patients and Group B (control group comprised of 27 H1N1 negative patients. The two groups did not differ in terms of patient age, co-morbidities, length of hospitalization, temperature elevation, hypoxemia, as well as renal and liver function. There were also no significant differences in severity on admission. C-reactive protein (CRP (mean 12.8 vs. 5.74 and white blood count (WBC (mean 10.528 vs. 7.114 were significantly higher in group B than in group A upon admission. Obesity was noted in 8 patients of Group A (mean 31.67 and 14 patients of Group B (mean 37.78. Body mass index (BMI was lower in H1N1 positive than in H1N1 negative patients (mean 31.67 vs. 37.78, respectively; p = 0.009. Conclusions The majority of patients in both groups were young male adults. CRP, WBC and BMI were higher among H1N1 negative patients. Finally, clinical course of patients in both groups was mild and uneventful.
Mohamed, Hany M; Fouda, Ahmed M; Khattab, Essam S A E H; Agrody, Ahmed M El-; Afifi, Tarek H
2017-05-01
A series of 1H-benzo[f]chromene-2-carbonitriles was synthesized and evaluated for their cytotoxic activities against MCF-7, HCT-116, and HepG-2 cancer cells. The SAR studies reported that the substitution in the phenyl ring at 1-position of 1H-benzo[f]chromene nucleus with the specific group, H atom, or methoxy group at 9-position increases the ability of the molecule against the different cell lines.
DEFF Research Database (Denmark)
Gehani, Simmi Suman; Agrawal-Singh, Shuchi; Dietrich, Nikolaj
2010-01-01
Epigenetic regulation of chromatin structure is essential for the expression of genes determining cellular specification and function. The Polycomb repressive complex 2 (PRC2) di- and trimethylates histone H3 on lysine 27 (H3K27me2/me3) to establish repression of specific genes in embryonic stem ...
Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H
1990-04-01
Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.
BEAM EXTRACTION FROM THE RECYCLER RING TO P1 LINE AT FERMILAB
Energy Technology Data Exchange (ETDEWEB)
Xiao, M. [Fermilab; Capista, D. [Fermilab; Adams, P. [Fermilab; Morris, D. [Fermilab; Yang, M. J. [Fermilab; Hazewood, K. [Fermilab
2016-10-03
The transfer line for beam extraction from the Recycler ring to P1 line provides a way to deliver 8 GeV kinetic energy protons from the Booster to the Delivery ring, via the Recycler, using existing beam transport lines, and without the need for new civil construction. It was designed in 2012. The kicker magnets at RR520 and the lambertson magnet at RR522 in the RR were installed in 2014 Summer Shutdown, the elements of RR to P1 Stub (permanent quads, trim quads, correctors, BPMs, the toroid at 703 and vertical bending dipole at V703 (ADCW) were installed in 2015 Summer Shutdown. On Tuesday, June 21, 2016, beam line from the Recycler Ring to P1 line was commissioned. The detailed results will be presented in this report.
DEFF Research Database (Denmark)
Piunti, Andrea; Rossi, Alessandra; Cerutti, Aurora
2014-01-01
The ability of PRC1 and PRC2 to promote proliferation is a main feature that links polycomb (PcG) activity to cancer. PcGs silence the expression of the tumour suppressor locus Ink4a/Arf, whose products positively regulate pRb and p53 functions. Enhanced PcG activity is a frequent feature of human...
Crystal structure of [1,1':3',1''-ter-phenyl]-2',3,3''-tri-carb-oxy-lic acid.
Decato, Daniel A; Berryman, Orion B
2015-09-01
The asymmetric unit of the title compound, C21H14O6, com-prises two symmetrically independent mol-ecules that form a locally centrosymmetric hydrogen-bonded dimer, with the planes of the corresponding carb-oxy-lic acid groups rotated by 15.8 (1) and 17.5 (1)° relative to those of the adjacent benzene rings. The crystal as a whole, however, exhibits a noncentrosymmetric packing, described by the polar space group Pca21. The dimers form layers along the ab plane, being inter-connected by hydrogen bonds involving the remaining carb-oxy-lic acid groups. The plane of the central carb-oxy-lic acid group forms dihedral angles of 62.5 (1) and 63.0 (1)° with those of the adjacent benzene rings and functions as a hydrogen-bond donor and acceptor. As a donor, it inter-connects adjacent layers, while as an acceptor it stabilizes the packing within the layers. The 'distal' carb-oxy-lic acid groups are nearly coplanar with the planes of the adjacent benzene rings, forming dihedral angles of 1.8 (1) and 7.1 (1)°. These groups also form intra- and inter-layer hydrogen bonds, but with 'reversed' functionality, as compared with the central carb-oxy-lic acid groups.
Jabli, Hind; Kandri Rodi, Y; Ladeira, Sonia; Essassi, El Mokhtar; Ng, Seik Weng
2009-12-12
The reaction of 1,5-dibenzyl-3-propargyl-1,5-benzodiazepine-2,4-dione with ethyl azido-acetate in the presence of copper sulfate pentahydrate and sodium ascorbate leads to the formation of the title regioisomer, C(30)H(29)N(5)O(4), which features a phenyl-ene ring fused with a seven-membered diazepinyl ring. The latter ring adopts a boat conformation (with the methyl-triazolylacetate-bearing C atom as the prow and the fused-ring C atoms as the stern). The benzyl groups connected to the diazepinyl ring jprotrude from the sides; the methyl-triazolylacetate substituent occupies an axial position.
Langmia, Immaculate M; Apalasamy, Yamunah D; Omar, Siti Z; Mohamed, Zahurin
2016-11-01
Genetic factors influence susceptibility to preterm birth (PTB) and the immune pathway of PTB that involves the production of cytokines such as interleukins has been implicated in PTB disease. The aim of this study is to investigate the association of interleukin 1β (IL1B) gene polymorphisms and IL1B levels with spontaneous PTB. Peripheral maternal blood from 495 women was used for extraction of DNA and genotyping was carried out using the Sequenom MassARRAY platform. Maternal plasma was used to measure IL1B levels. There was no significant association between the allelic and genotype distribution of IL1B single nucleotide polymorphism (SNP) (rs1143634, rs1143627, rs16944) and the risk of PTB among Malaysian Malay women (rs1143634, P=0.722; rs1143627, P=0.543; rs16944, P=0.615). However, IL1B levels were significantly different between women who delivered preterm compared with those who delivered at term (P=0.030); high mean levels were observed among Malay women who delivered at preterm (mean=32.52) compared with term (mean=21.68). IL1B SNPs were not associated with IL1B plasma levels. This study indicates a significant association between IL1B levels and reduced risk of PTB among the Malaysian Malay women. This study shows the impact of IL1B levels on susceptibility to PTB disease; however, the high levels of IL1B observed among women in the preterm group are not associated with IL1B SNPs investigated in this study; IL1B high levels may be because of other factors not explored in this study and therefore warrant further investigation.
Fermilab Recycler Ring: Technical design report. Revision 1.1
International Nuclear Information System (INIS)
Jackson, G.
1996-07-01
This report describes the technical design of the Fermilab Recycler Ring. The purpose of the Recycler is to augment the luminosity increase anticipated from the implementation of the Fermi III upgrade project, which has as its main component the Fermilab Main Injector construction project. The Recycler is a fixed 8 GeV kinetic energy storage ring. It is located in the Main Injector tunnel directly above the Main Injector beamline, near the ceiling. The construction schedule calls for the installation of the Recycler ring before the installation shutdown of the Main Injector. This aggressive construction schedule is made possible by the exclusive use of permanent magnets in the ring lattice, removing the need for expensive conventional iron/copper magnet construction along with the related power supplies, cooling water system, and electrical safety systems. The location, operating energy, and mode of construction are chosen to minimize operational impacts on both Fermilab's ongoing High Energy Physics program and the Main Injector construction project
Institute of Scientific and Technical Information of China (English)
Na Chen; Wang-Bin Zhou; Ying-Xiang Wang; Ai-Wu Dong; Yu Yu
2014-01-01
Homologous recombination (HR) is a key process during meiosis in reproductive cells and the DNA damage repair process in somatic cells. Although chromatin structure is thought to be crucial for HR, only a smal number of chromatin modifiers have been studied in HR regulation so far. Here, we investigated the function of CURLY LEAF (CLF), a Polycomb-group (PcG) gene responsible for histone3 lysine 27 trimethy-lation (H3K27me3), in somatic and meiotic HR in Arabidopsis thaliana. Although fluorescent protein reporter assays in pol en and seeds showed that the frequency of meiotic cross-over in the loss-of-function mutant clf-29 was not significantly different from that in wild type, there was a lower frequency of HR in clf-29 than in wild type under normal conditions and under bleomycin treatment. The DNA damage levels were compara-ble between clf-29 and wild type, even though several DNA damage repair genes (e.g. ATM, BRCA2a, RAD50, RAD51, RAD54,and PARP2) were expressed at lower levels in clf-29. Under bleomycin treatment, the expression levels of DNA repair genes were similar in clf-29 and wild type, thus CLF may also regulate HR via other mechanisms. These findings expand the current knowledge of PcG function and contribute to general interests of epigenetic regulation in genome stability regulation.
A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma
Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D.; Schlecht, Nicolas F.; Einstein, Mark H.; Greally, John M.
2016-01-01
Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors. PMID:27557505
A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma.
Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D; Schlecht, Nicolas F; Einstein, Mark H; Greally, John M
2016-09-20
Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors.
Clinical investigation of proximate exposed group, 1
International Nuclear Information System (INIS)
Ito, Chikako; Hasegawa, Kazuyo; Kato, Masafumi; Kumasawa, Toshihiko
1984-01-01
In order to investigate effects of the A-bombing on prevalence of diabetes mellitus, follow-up studies were made on 5907 A-bomb survivors who received glucose tolerance test (GTT) during 20 years between 1963 and 1983. The A-bomb survivors were divided into the group A (1899 men and 1165 women exposed within 1.9 km from the hypocenter) and the group B (1725 men and 1118 women exposed 3.0 km or farther from it). Among non-obese survivors, 21.9% and 21.8% were being treated for diabetes mellitus or were evaluated as having diabetic type on GTT in the group A and the group B, respectively; while this was seen in 52.1% of obese survivors in the group A and 49.9% in the group B. There was no difference between the groups. In non-obese survivors, the annual development rate from the normal type to the diabetic type was 0.89% in the group A and 0.65% in the group B; the annual development rate from the borderline type to the diabetic type was 5.73% in the group A and 5.49% in the group B, showing no differences between the groups. The annual development rate from the normal or borderline type to the diabetic type was two times or higher in obese survivors than in non-obese survivors irrespective of exposure status. Regarding the number of diabetic survivors who became non-diabetic type in spite of having no treatment, and prevalence of diabetic complications, no difference was seen between the groups. These results suggest that the A-bombing has scarcely influenced the prevalence of diabetes mellitus and clinical course. (Namekawa, K.)
Rybp, a polycomb complex-associated protein, is required for mouse eye development
Directory of Open Access Journals (Sweden)
Schreiber-Agus Nicole
2007-04-01
Full Text Available Abstract Background Rybp (Ring1 and YY1 binding protein is a zinc finger protein which interacts with the members of the mammalian polycomb complexes. Previously we have shown that Rybp is critical for early embryogenesis and that haploinsufficiency of Rybp in a subset of embryos causes failure of neural tube closure. Here we investigated the requirement for Rybp in ocular development using four in vivo mouse models which resulted in either the ablation or overexpression of Rybp. Results Our results demonstrate that loss of a single Rybp allele in conventional knockout mice often resulted in retinal coloboma, an incomplete closure of the optic fissure, characterized by perturbed localization of Pax6 but not of Pax2. In addition, about one half of Rybp-/- Rybp+/+ chimeric embryos also developed retinal colobomas and malformed lenses. Tissue-specific transgenic overexpression of Rybp in the lens resulted in abnormal fiber cell differentiation and severe lens opacification with increased levels of AP-2α and Sox2, and reduced levels of βA4-crystallin gene expression. Ubiquitous transgenic overexpression of Rybp in the entire eye caused abnormal retinal folds, corneal neovascularization, and lens opacification. Additional changes included defects in anterior eye development. Conclusion These studies establish Rybp as a novel gene that has been associated with coloboma. Other genes linked to coloboma encode various classes of transcription factors such as BCOR, CBP, Chx10, Pax2, Pax6, Six3, Ski, Vax1 and Vax2. We propose that the multiple functions for Rybp in regulating mouse retinal and lens development are mediated by genetic, epigenetic and physical interactions between these genes and proteins.
Niu, Qingli; Bonsergent, Claire; Guan, Guiquan; Yin, Hong; Malandrin, Laurence
2013-11-15
Babesiosis is a frequent infection of animals worldwide by tick borne pathogen Babesia, and several species are responsible for ovine babesiosis. Recently, several Babesia motasi-like isolates were described in sheep in China. In this study, we sequenced the multigenic rap-1 gene locus of one of these isolates, Babesia sp. BQ1 Lintan. The RAP-1 proteins are involved in the process of red blood cells invasion and thus represent a potential target for vaccine development. A complex composition and organization of the rap-1 locus was discovered with: (1) the presence of 3 different types of rap-1 sequences (rap-1a, rap-1b and rap-1c); (2) the presence of multiple copies of rap-1a and rap-1b; (3) polymorphism among the rap-1a copies, with two classes (named rap-1a61 and rap-1a67) having a similarity of 95.7%, each class represented by two close variants; (4) polymorphism between rap-1a61-1 and rap-1a61-2 limited to three nucleotide positions; (5) a difference of eight nucleotides between rap-1a67-1 and rap-1a67-2 from position 1270 to the putative stop site of rap-1a67-1 which might produce two putative proteins of slightly different sizes; (6) the ratio of rap-1a copies corresponding to one rap-1a67, one rap-1a61-1 and one rap-1a61-2; (7) the presence of three different intergenic regions separating rap-1a, rap-1b and rap-1c; (8) interspacing of the rap-1a copies with rap-1b copies; and (9) the terminal position of rap-1c in the locus. A 31kb locus composed of 6 rap-1a sequences interspaced with 5 rap-1b sequences and with a terminal rap-1c copy was hypothesized. A strikingly similar sequence composition (rap-1a, rap-1b and rap-1c), as well as strong gene identities and similar locus organization with B. bigemina were found and highlight the conservation of synteny at this locus in this phylogenetic clade. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Erik Södersten
2014-09-01
Full Text Available Polycomb group (PcG proteins bind to and repress genes in embryonic stem cells through lineage commitment to the terminal differentiated state. PcG repressed genes are commonly characterized by the presence of the epigenetic histone mark H3K27me3, catalyzed by the Polycomb repressive complex 2. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation. The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP experiments showed that increased H3K27me3S28p was accompanied by reduced PcG binding to regulatory regions of genes. An analysis of the genome wide distribution of L-DOPA-induced H3K27me3S28 phosphorylation by ChIP sequencing (ChIP-seq in combination with expression analysis by RNA-sequencing (RNA-seq showed that the induction of H3K27me3S28p correlated with increased expression of a subset of PcG repressed genes. We found that induction of H3K27me3S28p persisted during chronic L-DOPA administration to parkisonian mice and correlated with aberrant gene expression. We propose that dopaminergic transmission can activate PcG repressed genes in the adult brain and thereby contribute to long-term maladaptive responses including the motor complications, or dyskinesia, caused by prolonged administration of L-DOPA in Parkinson's disease.
8-Bromo-3,4-dihydro-2H-1,3-thiazino[2,3:2′,1′]imidazo[5′,4′-b]pyridine
Directory of Open Access Journals (Sweden)
Hend Bel Ghacham
2010-05-01
Full Text Available The imidazopyridine ring system in the title compound, C9H8BrN3S, is almost planar [r.m.s. deviation of the C and N atoms = 0.007 (1 Å]. The S and methylene C atoms connected to the five-membered ring lie within this plane. The remaining two methylene groups of the thiazine ring are disordered over two sets of sites in a 0.817 (5:0.183 (5 ratio.
Organic semiconductors based on [1]benzothieno[3,2-b][1]benzothiophene substructure.
Takimiya, Kazuo; Osaka, Itaru; Mori, Takamichi; Nakano, Masahiro
2014-05-20
The design, synthesis, and characterization of organic semiconductors applicable to organic electronic devices, such as organic field-effect transistors (OFETs) and organic photovoltaics (OPVs), had been one of the most important topics in materials chemistry in the past decade. Among the vast number of materials developed, much expectation had been placed on thienoacenes, which are rigid and planar structures formed by fusing thiophenes and other aromatic rings, as a promising candidate for organic semiconductors for high-performance OFETs. However, the thienoacenes examined as an active material in OFETs in the 1990s afforded OFETs with only moderate hole mobilities (approximately 0.1 cm(2) V(-1) s(-1)). We speculated that this was due to the sulfur atoms in the thienoacenes, which hardly contributed to the intermolecular orbital overlap in the solid state. On the other hand, we have focused on other types of thienoacenes, such as [1]benzothieno[3,2-b][1]benzothiophene (BTBT), which seem to have appropriate HOMO spatial distribution for effective intermolecular orbital overlap. In fact, BTBT derivatives and their related materials, including dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene (DNTT), have turned out to be superior organic semiconductors, affording OFETs with very high mobilities. To illustrate some examples, we have developed 2,7-diphenyl BTBT (DPh-BTBT) that yields vapor-deposited OFETs having mobilities of up to 2.0 cm(2) V(-1) s(-1) under ambient conditions, highly soluble dialkyl-BTBTs (Cn-BTBTs) that afford solution-processed OFETs with mobilities higher than 1.0 cm(2) V(-1) s(-1), and DNTT and its derivatives that yield OFETs with even higher mobilities (>3.0 cm(2) V(-1) s(-1)) and stability under ambient conditions. Such high performances are rationalized by their solid-state electronic structures that are calculated based on their packing structures: the large intermolecular orbital overlap and the isotropic two-dimensional electronic
Directory of Open Access Journals (Sweden)
Luciane Mie Kawashima
2006-09-01
Full Text Available Levantamentos de ocorrência de micotoxinas em alimentos foram realizados nas últimas duas décadas nas regiões Sudeste e Sul do Brasil. Levantamentos em alimentos comercializados em outras regiões têm-se limitado a aflatoxinas em amendoim e castanhas do Brasil. O presente trabalho pesquisou a presença de fumonisina B1, aflatoxinas B1, B2, G1 e G2, ocratoxina A e zearalenona em 74 amostras de produtos a base de milho adquiridas no comércio da cidade de Recife, PE, durante o período de 1999 a 2001. Fumonisina B1 foi determinada por cromatografia líquida de alta eficiência com detecção por fluorescência e as demais toxinas foram determinadas por cromatografia em camada delgada. Fumonisina B1 foi encontrada em 94,6% das amostras em concentrações variando de 20 a 8600 µg/kg. Apenas 5 amostras continham aflatoxina B1 e o teor máximo encontrado foi 20 µg/kg. Duas amostras ultrapassaram o limite de 20 µg/kg para a somatória das aflatoxinas B1, B2, G1 e G2 (farinha de milho pré-cozida com 21,5 µg/kg e quirera (xerém com 23,3 µg/kg. As aflatoxinas G1 e G2, ocratoxina A e zearalenona não foram detectadas em nenhuma das amostras. Todas as amostras contaminadas com aflatoxinas também apresentaram fumonisina B1.Research concerning the presence of mycotoxin in food has been conducted in the Southwest and South regions of Brazil over the last two decades. Research in other regions has been limited to aflatoxin in peanuts and Brazil nuts. The aim of this work is to study the presence of fumonisin B1, aflatoxins B1, B2, G1, and G2, ochratoxin A and zearalenone in 74 samples of corn products acquired in shops and food markets in the city of Recife (PE from 1999 to 2001. Fumonisin B1 was determined by high performance liquid chromatography and fluorescence was detected. The other toxins were determined by thin layer chromatography. Fumonisin B1 was found in 94.6% of the samples in levels from 20 to 8600 µg/kg. Only 5 samples contained
26 CFR 1.367(b)-1 - Other transfers.
2010-04-01
... its successor in interest) that the shareholder is making the election described in § 1.367(b)-3(c)(3... paragraph (c)(2)— (i) A shareholder described in § 1.367(b)-3(b)(1) that realizes income in a transaction described in § 1.367(b)-3(a); (ii) A shareholder that makes the election described in § 1.367(b)-3(c)(3...
Large quantum rings in the ν > 1 quantum Hall regime
International Nuclear Information System (INIS)
Raesaenen, E; Aichinger, M
2009-01-01
We study computationally the ground-state properties of large quantum rings in the filling-factor ν>1 quantum Hall regime. We show that the arrangement of electrons into different Landau levels leads to clear signatures in the total energies as a function of the magnetic field. In this context, we discuss possible approximations for the filling factor ν in the system. We are able to characterize integer-ν states in quantum rings in an analogy with conventional quantum Hall droplets. We also find a partially spin-polarized state between ν = 2 and 3. Despite the specific topology of a quantum ring, this state is strikingly reminiscent of the recently found ν = 5/2 state in a quantum dot.
Large quantum rings in the ν > 1 quantum Hall regime.
Räsänen, E; Aichinger, M
2009-01-14
We study computationally the ground-state properties of large quantum rings in the filling-factor ν>1 quantum Hall regime. We show that the arrangement of electrons into different Landau levels leads to clear signatures in the total energies as a function of the magnetic field. In this context, we discuss possible approximations for the filling factor ν in the system. We are able to characterize integer-ν states in quantum rings in an analogy with conventional quantum Hall droplets. We also find a partially spin-polarized state between ν = 2 and 3. Despite the specific topology of a quantum ring, this state is strikingly reminiscent of the recently found ν = 5/2 state in a quantum dot.
(He 1) photoelectron spectra of vinyl- and (1-dimethylaminovinyl)pyridines
International Nuclear Information System (INIS)
Baidin, V.N.; Koikov, L.N.; Terent'ev, P.B.; Gloriozov, I.P.
1985-01-01
The (He 1) photoelectron spectra of α=, β-, γ-vinyl, α-, β-, and γ-(1-dimethylvinyl)-pyridines, 1-dimethyl- and 1-diethylaminostyrenes were obtained and interpreted within the framework of the molecular orbital perturbation theory. In both pyridine derivative series, there is a regular increase in the ionization energy of the 1α 2 , π/sub C=C/ and n/sub en/ orbitals and decrease in the ionization energy of the 2b 1 orbitals in the order α 2 and 2b 1 is found for γ-vinylpyridine). The splitting of the energy levels of the heterocycle in dimethylaminovinylpyridines is less than in the corresponding vinyl derivatives, which indicates a weakening of the interaction between the aromatic (or heteroaromatic) ring and the enamine fragment extruding from the ring plane. The ionization energy of the unshared electron pair of the nitrogen atom of the pyridine ring for all the compounds except for α- (1-dimethylaminovinyl)pyridine (which displays an ortho effect) is close to that for pyridine. The photoelectron spectral data are compared with the MO energies calculated by the MINDO/3 method
(4bS,8aS-1-Isopropyl-4b,8,8-trimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-2-yl acetate
Directory of Open Access Journals (Sweden)
Radouane Oubabi
2014-03-01
Full Text Available The hemisynthesis of the title compound, C22H32O2, was carried out through direct acetylation reaction of the naturally occurring diterpene totarol [systematic name: (4bS,8aS-4b,8,8-trimethyl-1-propan-2-yl-5,6,7,8a,9,10-hexahydrophenanthren-2-ol]. The molecule is built up from three fused six membered rings, one saturated and two unsaturated. The central unsaturated ring has a half-chair conformation, whereas the other unsaturated ring displays a chair conformation. The absolute configuration is deduced from the chemical pathway. The value of the Hooft parameter [−0.10 (6] allowed this absolute configuration to be confirmed.
Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction
Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar
2013-01-01
Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938
Errasti, A E; Rey-Ares, V; Daray, F M; Rogines-Velo, M P; Sardi, S P; Paz, C; Podestá, E J; Rothlin, R P
2001-08-01
In isolated human umbilical vein (HUV), the contractile response to des-Arg9-bradykinin (des-Arg9-BK), selective BK B1 receptor agonist, increases as a function of the incubation time. Here, we evaluated whether cyclooxygenase (COX) pathway is involved in BK B1-sensitized response obtained in 5-h incubated HUV rings. The effect of different concentrations of indomethacin, sodium salicylate, ibuprofen, meloxicam, lysine clonixinate or NS-398 administrated 30 min before concentration-response curves (CRC) was studied. All treatments produced a significant rightward shift of the CRC to des-Arg9-BK in a concentration-dependent manner, which provides pharmacological evidence that COX pathway is involved in the BK B1 responses. Moreover, in this tissue, the NS-398 pKb (5.2) observed suggests that COX-2 pathway is the most relevant. The strong correlation between published pIC50 for COX-2 and the NSAIDs' pKbs estimated further supports the hypothesis that COX-2 metabolites are involved in BK B1 receptor-mediated responses. In other rings, indomethacin (30, 100 micromol/l) or NS-398 (10, 30 micromol/l) produced a significant rightward shift of the CRC to BK, selective BK B2 agonist, and its pKbs were similar to the values to inhibit BK B1 receptor responses, suggesting that COX-2 pathway also is involved in BK B2 receptor responses. Western blot analysis shows that COX-1 and COX-2 isoenzymes are present before and after 5-h in vitro incubation and apparently COX-2 does not suffer additional induction.
2-[4-(2-Chloroacetylphenyl]-2-methyl-1-(pyrrolidin-1-ylpropan-1-one
Directory of Open Access Journals (Sweden)
Dong-mei Ren
2013-08-01
Full Text Available The asymmetric unit of the title compound, C16H20ClNO2, contains two molecules in which the dihedral angles between the benzene ring and the plane of the amide unit are 77.4 (1 and 81.1 (1°. In both molecules, the five-membered ring adopts an envelope conformation with one of the β-C atoms as the flap. In the crystal, molecules are connected via C—H...O hydrogen bonds, forming chains along the b-axis direction. These chains are further linked by C—H...π interactions, forming a three-dimensional network.
Crystal structure of (E-1-(4′-methoxy-[1,1′-biphenyl]-4-yl-3-(3-nitrophenylprop-2-en-1-one
Directory of Open Access Journals (Sweden)
T. Vidhyasagar
2015-01-01
Full Text Available The title compound, C22H17NO4, crystallizes with two independent molecules (A and B in the asymmetric unit. Each molecule exists as an E isomer with C—C=C—C torsion angles of −175.69 (17 and −178.41 (17° in A and B, respectively. In molecule A, the planes of the terminal benzene rings are twisted by an angle of 26.67 (10°, while the biphenyl unit is non-planar, the dihedral angle between the rings being 30.81 (10°. The dihedral angle between the nitrophenyl ring and the inner phenyl ring is 6.50 (9°. The corresponding values in molecule B are 60.61 (9, 31.07 (8 and 31.05 (9°. In the crystal, molecules are arranged in a head-to-head manner, with the 3-nitrophenyl groups nearly parallel to one another. The A and B molecules are linked to one another via C—H...O hydrogen bonds, forming chains lying parallel to (-320 and enclosing R22(10 and R22(12 ring motifs. The methoxy group in both molecules is positionally disordered with a refined occupancy ratio of 0.979 (4:0.021 (4 for molecule A and 0.55 (4:0.45 (4 for molecule B.
Frondelius, Kasper; Borg, Madelene; Ericson, Ulrika; Borné, Yan; Melander, Olle; Sonestedt, Emily
2017-02-28
Low serum apolipoprotein (Apo) A1 concentrations and high serum ApoB concentrations may be better markers of the risk of cardiovascular disease than high-density lipoprotein (HDL) and low-density lipoprotein (LDL). However, the associations between modifiable lifestyle factors and Apo concentrations have not been investigated in detail. Therefore, this study investigated the associations between Apo concentrations and education, lifestyle factors and dietary intake (macronutrients and 34 food groups). These cross-sectional associations were examined among 24,984 individuals in a Swedish population-based cohort. Baseline examinations of the cohort were conducted between 1991 and 1996. Dietary intake was assessed using a modified diet history method. The main determinants of high ApoA1 concentrations ( r between 0.05 and 0.25) were high alcohol consumption, high physical activity, non-smoking, and a low body mass index (BMI), and the main determinants of high ApoB concentrations were smoking and a high BMI. The intake of sucrose and food products containing added sugar (such as pastries, sweets, chocolate, jam/sugar and sugar-sweetened beverages) was negatively correlated with ApoA1 concentrations and positively correlated with ApoB concentrations and the ApoB/ApoA1 ratio, whereas the intake of fermented dairy products, such as fermented milk and cheese, was positively correlated with ApoA1 concentrations and negatively correlated with the ApoB/ApoA1 ratio. These results indicate that smoking, obesity, low physical activity, low alcohol consumption and a diet high in sugar and low in fermented dairy products are correlated with an unfavorable Apo profile.
(11-Methylpyrido[2,3-b][1,4]benzodiazepin-6-yl(phenylmethanone
Directory of Open Access Journals (Sweden)
Fuqiang Shi
2010-09-01
Full Text Available In the title compound, C20H15N3O, the diazepine ring adopts a boat conformation. The dihedral angle between pyridine and benzene rings is 55.2 (1°. The benzoyl phenyl ring forms dihedral angles of 49.4 (1 and 75.9 (1°, respectively, with the pyridine and benzene rings. In the crystal, molecules are linked into centrosymmetric dimers by pairs of C—H...N hydrogen bonds.
Neurodevelopmental problems and extremes in BMI
Directory of Open Access Journals (Sweden)
Nóra Kerekes
2015-07-01
Full Text Available Background. Over the last few decades, an increasing number of studies have suggested a connection between neurodevelopmental problems (NDPs and body mass index (BMI. Attention deficit/hyperactivity disorder (ADHD and autism spectrum disorders (ASD both seem to carry an increased risk for developing extreme BMI. However, the results are inconsistent, and there have been only a few studies of the general population of children.Aims. We had three aims with the present study: (1 to define the prevalence of extreme (low or high BMI in the group of children with ADHD and/or ASDs compared to the group of children without these NDPs; (2 to analyze whether extreme BMI is associated with the subdomains within the diagnostic categories of ADHD or ASD; and (3 to investigate the contribution of genetic and environmental factors to BMI in boys and girls at ages 9 and 12.Method. Parents of 9- or 12-year-old twins (n = 12,496 were interviewed using the Autism—Tics, ADHD and other Comorbidities (A-TAC inventory as part of the Child and Adolescent Twin Study in Sweden (CATSS. Univariate and multivariate generalized estimated equation models were used to analyze associations between extremes in BMI and NDPs.Results. ADHD screen-positive cases followed BMI distributions similar to those of children without ADHD or ASD. Significant association was found between ADHD and BMI only among 12-year-old girls, where the inattention subdomain of ADHD was significantly associated with the high extreme BMI. ASD scores were associated with both the low and the high extremes of BMI. Compared to children without ADHD or ASD, the prevalence of ASD screen-positive cases was three times greater in the high extreme BMI group and double as much in the low extreme BMI group. Stereotyped and repetitive behaviors were significantly associated with high extreme BMIs.Conclusion. Children with ASD, with or without coexisting ADHD, are more prone to have low or high extreme BMIs than
Polycomb repressive complex 2 (PRC2 restricts hematopoietic stem cell activity.
Directory of Open Access Journals (Sweden)
Ian J Majewski
2008-04-01
Full Text Available Polycomb group proteins are transcriptional repressors that play a central role in the establishment and maintenance of gene expression patterns during development. Using mice with an N-ethyl-N-nitrosourea (ENU-induced mutation in Suppressor of Zeste 12 (Suz12, a core component of Polycomb Repressive Complex 2 (PRC2, we show here that loss of Suz12 function enhances hematopoietic stem cell (HSC activity. In addition to these effects on a wild-type genetic background, mutations in Suz12 are sufficient to ameliorate the stem cell defect and thrombocytopenia present in mice that lack the thrombopoietin receptor (c-Mpl. To investigate the molecular targets of the PRC2 complex in the HSC compartment, we examined changes in global patterns of gene expression in cells deficient in Suz12. We identified a distinct set of genes that are regulated by Suz12 in hematopoietic cells, including eight genes that appear to be highly responsive to PRC2 function within this compartment. These data suggest that PRC2 is required to maintain a specific gene expression pattern in hematopoiesis that is indispensable to normal stem cell function.
One, Two, Three: Polycomb Proteins Hit All Dimensions of Gene Regulation
Directory of Open Access Journals (Sweden)
Stefania del Prete
2015-07-01
Full Text Available Polycomb group (PcG proteins contribute to the formation and maintenance of a specific repressive chromatin state that prevents the expression of genes in a particular space and time. Polycomb repressive complexes (PRCs consist of several PcG proteins with specific regulatory or catalytic properties. PRCs are recruited to thousands of target genes, and various recruitment factors, including DNA-binding proteins and non-coding RNAs, are involved in the targeting. PcG proteins contribute to a multitude of biological processes by altering chromatin features at different scales. PcG proteins mediate both biochemical modifications of histone tails and biophysical modifications (e.g., chromatin fiber compaction and three-dimensional (3D chromatin conformation. Here, we review the role of PcG proteins in nuclear architecture, describing their impact on the structure of the chromatin fiber, on chromatin interactions, and on the spatial organization of the genome in nuclei. Although little is known about the role of plant PcG proteins in nuclear organization, much is known in the animal field, and we highlight similarities and differences in the roles of PcG proteins in 3D gene regulation in plants and animals.
Niederer, Iris; Kriemler, Susi; Zahner, Lukas; Burgi, Flavia; Ebenegger, Vincent; Marques- Vidal, Pedro; Puder, Jardena J.
2012-01-01
In the Ballabeina study, we investigated age- and BMI-group-related differences in aerobic fitness (20 m shuttle run), agility (obstacle course), dynamic (balance beam) and static balance (balance platform), and physical activity (PA, accelerometers) in 613 children (M age = 5.1 years, SD = 0.6). Normal weight (NW) children performed better than…
Carini, Giovanni, Jr.; Carini, Giuseppe; D’Angelo, Giovanna; Federico, Mauro; Romano, Valentino
2018-05-01
Low and high frequency Raman scattering of B2O3 glasses, compacted under GPa pressures, has been performed to investigate structural changes due to increasing atomic packing. Compacted glasses, annealed at ambient temperature and pressure, experience a time-dependent decrease of the density to a smaller constant value over a period of few months, displaying a permanent plastic deformation. Increasing densification determines a parallel and progressive decrease of the intensity of the Boson peak and the main band at 808 cm‑1, both these modes arising from localized vibrations involving planar boroxol rings (B3O6), the glassy units formed from three basic BO3 triangles. The 808 cm‑1 mode preserves its frequency, while the BP evidences a well-defined frequency increase. The high-frequency multicomponent band between 1200 and 1600 cm‑1 also changes with increasing densification, disclosing a decreasing intensity of the 1260 cm‑1 mode due to oxygen vibrations of BO3 units bridging boroxol rings. This indicates the gradual vibrational collapse of groups formed from rings connected by more complex links than a single bridging oxygen. The observed behaviours suggest that glass compaction causes severe deformation of boroxol rings, determining a decrease of groups which preserve unaltered their vibrational activity. Growing glass densification stiffens the network and leads to a decrease of the excess heat capacity over the Debye prediction below 20 K, which is not accounted for by the hardening of the elastic continuum. By using the low-frequency Raman scattering to determine the temperature dependence of the heat capacity, it has been evaluated the density of low-frequency vibrational states which discloses a significant reduction of excess modes with increasing density.
Directory of Open Access Journals (Sweden)
Youhei Takeda
2015-01-01
Full Text Available A facile and moderately functional-group-tolerant synthetic method for the preparation of 7,8-diaza[5]helicenes has been developed. It comprises of an oxidative ring-closing process of 1,1’-binaphthalene-2,2’-diamine (BINAM derivatives with a chlorine-containing oxidant (t-BuOCl in the presence of a base (2,6-lutidine. In addition the basic physicochemical properties of newly synthesized compounds have been investigated.
Dipropyl 3,6-diphenyl-1,2-dihydro-1,2,4,5-tetrazine-1,2-dicarboxylate.
Rao, Guo-Wu; Hu, Wei-Xiao
2003-05-01
The title compound, C(22)H(24)N(4)O(4), was prepared from propyl chloroformate and 3,6-diphenyl-1,2-dihydro-s-tetrazine. This reaction yields the title compound rather than dipropyl 3,6-diphenyl-1,4-dihydro-s-tetrazine-1,4-dicarboxylate. The 2,3-diazabutadiene group in the central six-membered ring is not planar; the C=N double-bond length is 1.285 (2) A, and the average N-N single-bond length is 1.401 (3) A, indicating a lack of conjugation. The ring has a twist conformation, in which adjacent N atoms lie +/- 0.3268 (17) A from the plane of the ring. The molecule has twofold crystallographic symmetry.
Foxp1 controls mature B cell survival and the development of follicular and B-1 B cells
Patzelt, Thomas; Keppler, Selina J.; Gorka, Oliver; Thoene, Silvia; Wartewig, Tim; Reth, Michael; Förster, Irmgard; Lang, Roland; Buchner, Maike; Ruland, Jürgen
2018-01-01
The transcription factor Foxp1 is critical for early B cell development. Despite frequent deregulation of Foxp1 in B cell lymphoma, the physiological functions of Foxp1 in mature B cells remain unknown. Here, we used conditional gene targeting in the B cell lineage and report that Foxp1 disruption in developing and mature B cells results in reduced numbers and frequencies of follicular and B-1 B cells and in impaired antibody production upon T cell-independent immunization in vivo. Moreover, Foxp1-deficient B cells are impaired in survival even though they exhibit an increased capacity to proliferate. Transcriptional analysis identified defective expression of the prosurvival Bcl-2 family gene Bcl2l1 encoding Bcl-xl in Foxp1-deficient B cells, and we identified Foxp1 binding in the regulatory region of Bcl2l1. Transgenic overexpression of Bcl2 rescued the survival defect in Foxp1-deficient mature B cells in vivo and restored peripheral B cell numbers. Thus, our results identify Foxp1 as a physiological regulator of mature B cell survival mediated in part via the control of Bcl-xl expression and imply that this pathway might contribute to the pathogenic function of aberrant Foxp1 expression in lymphoma. PMID:29507226
Green chemistry: Efficient epoxides ring-opening with 1-butanol under microwave irradiation
International Nuclear Information System (INIS)
Garcia-Vidal, Jesus A.; Duran-Valle, Carlos J.; Ferrera-Escudero, Santiago
2006-01-01
Two activated carbons treated with mineral acids (HNO 3 and sulfonitric mixture) have been tested as acid catalysts in the epoxides (1,2-epoxyhexane and styrene oxide) ring-opening reaction with 1-butanol under microwave (MW) irradiation. The mayor obtained product is that resulting of the alcohol addition to the most substituted carbon in the epoxide ring. The most active catalyst is that treated with sulfonitric mixture. The use of a MW oven allows achieving to the complete conversion of styrene oxide in only 2 min
Green chemistry: Efficient epoxides ring-opening with 1-butanol under microwave irradiation
Energy Technology Data Exchange (ETDEWEB)
Garcia-Vidal, Jesus A. [Departamento de Quimica Inorganica, Facultad de Ciencias, Universidad de Extremadura, Campus Universitario, Avda. de Elvas, s/n, E-06071-Badajoz (Spain); Duran-Valle, Carlos J. [Departamento de Quimica Inorganica, Facultad de Ciencias, Universidad de Extremadura, Campus Universitario, Avda. de Elvas, s/n, E-06071-Badajoz (Spain)]. E-mail: carlosdv@unex.es; Ferrera-Escudero, Santiago [Departamento de Quimica Inorganica y Quimica Tecnica, Universidad Nacional de Educacion a Distancia, C/Senda del Rey, 9, E-28040 Madrid (Spain)
2006-06-30
Two activated carbons treated with mineral acids (HNO{sub 3} and sulfonitric mixture) have been tested as acid catalysts in the epoxides (1,2-epoxyhexane and styrene oxide) ring-opening reaction with 1-butanol under microwave (MW) irradiation. The mayor obtained product is that resulting of the alcohol addition to the most substituted carbon in the epoxide ring. The most active catalyst is that treated with sulfonitric mixture. The use of a MW oven allows achieving to the complete conversion of styrene oxide in only 2 min.
5-(4-Ethoxyphenyl-3-(pyridin-2-yl-4,5-dihydro-1H-pyrazole-1-carbothioamide
Directory of Open Access Journals (Sweden)
Hoong-Kun Fun
2012-03-01
Full Text Available In the title compound, C17H18N4OS, a pyrazoline derivative, the pyrazoline ring adopts an envelope conformation with the C atom bonded to the benzene ring as the flap atom. The dihedral angle between the pyridine and benzene rings is 80.50 (6°. The ethoxyphenyl group is approximately planar, with an r.m.s. deviation of 0.0238 (1 Å for the nine non-H atoms. In the crystal, molecules are linked by N—H...O and N—H...S hydrogen bonds into a tape along the b axis. Weak C—H...N and C—H...π interactions are also observed.
Crystal structure of [1,1′:3′,1′′-terphenyl]-2′,3,3′′-tricarboxylic acid
Directory of Open Access Journals (Sweden)
Daniel A. Decato
2015-09-01
Full Text Available The asymmetric unit of the title compound, C21H14O6, comprises two symmetrically independent molecules that form a locally centrosymmetric hydrogen-bonded dimer, with the planes of the corresponding carboxylic acid groups rotated by 15.8 (1 and 17.5 (1° relative to those of the adjacent benzene rings. The crystal as a whole, however, exhibits a noncentrosymmetric packing, described by the polar space group Pca21. The dimers form layers along the ab plane, being interconnected by hydrogen bonds involving the remaining carboxylic acid groups. The plane of the central carboxylic acid group forms dihedral angles of 62.5 (1 and 63.0 (1° with those of the adjacent benzene rings and functions as a hydrogen-bond donor and acceptor. As a donor, it interconnects adjacent layers, while as an acceptor it stabilizes the packing within the layers. The `distal' carboxylic acid groups are nearly coplanar with the planes of the adjacent benzene rings, forming dihedral angles of 1.8 (1 and 7.1 (1°. These groups also form intra- and inter-layer hydrogen bonds, but with `reversed' functionality, as compared with the central carboxylic acid groups.
Wolf, Jannic Sebastian; Babics, Maxime; Wang, Kai; Saleem, Qasim; Liang, Ru-Ze; Hansen, Michael Ryan; Beaujuge, Pierre
2016-01-01
We report on the synthesis, material properties and BHJ solar cell characteristics of a set of π-conjugated small-molecule (SM) donors composed of benzo[1,2-b:4,5-b′]dithiophene (BDT) and pyrido[3,4-b]pyrazine (PP) units – examining the perspectives of alkyl-substituted PP acceptor motifs in SM designs. In these systems (SM1-4), both the type of side chains derived from the PP motifs and the presence of ring-substituents on BDT critically impact (i) molecular packing, and (ii) thin-film morphologies and charge transport in BHJ solar cells. With the appropriate side-chain pattern, the ring-substituted analogue SM4 stands out: achieving efficiencies of ca. 6.5% with PC71BM, and fine-scale morphologies comparable to those obtained with some of the best-performing polymer donors in BHJ solar cells. 1H-1H DQ-SQ NMR analyses are used to examine the distinct self-assembly pattern of SM4, expected to factor into the development of the BHJ morphology.
Wolf, Jannic Sebastian
2016-01-22
We report on the synthesis, material properties and BHJ solar cell characteristics of a set of π-conjugated small-molecule (SM) donors composed of benzo[1,2-b:4,5-b′]dithiophene (BDT) and pyrido[3,4-b]pyrazine (PP) units – examining the perspectives of alkyl-substituted PP acceptor motifs in SM designs. In these systems (SM1-4), both the type of side chains derived from the PP motifs and the presence of ring-substituents on BDT critically impact (i) molecular packing, and (ii) thin-film morphologies and charge transport in BHJ solar cells. With the appropriate side-chain pattern, the ring-substituted analogue SM4 stands out: achieving efficiencies of ca. 6.5% with PC71BM, and fine-scale morphologies comparable to those obtained with some of the best-performing polymer donors in BHJ solar cells. 1H-1H DQ-SQ NMR analyses are used to examine the distinct self-assembly pattern of SM4, expected to factor into the development of the BHJ morphology.
... Prize Alfred Nobel's Life and Work Teachers' Questionnaire Vitamin B1 - About The Chicken Farm educational game and ... the game window. Reading: "Christian Eijkman, Beriberi and Vitamin B1" - Who was Eijkman and why did he ...
Mode-Locked 1.5 um Semiconductor Optical Fiber Ring
DEFF Research Database (Denmark)
Pedersen, Niels Vagn; Jakobsen, Kaj Bjarne; Vaa, Michael
1996-01-01
The dynamics of a mode-locked SOA fiber ring are investigated experimentally and numerically. Generation of near transform-limited (time-bandwidth product = 0.7) 1.5 um 54 ps FWHM pulses with a peak power of 2.8 mW at a repetition rate of 960 MHz is demonstrated experimentally. The experimental r...
Czech Academy of Sciences Publication Activity Database
Fujimura, Naoko; Kuželová, Andrea; Ebert, A.; Strnad, Hynek; Láchová, Jitka; Machoň, Ondřej; Busslinger, M.; Kozmik, Zbyněk
2018-01-01
Roč. 433, č. 1 (2018), s. 47-60 ISSN 0012-1606 R&D Projects: GA ČR GA15-23675S; GA MŠk(CZ) LQ1604; GA MŠk(CZ) LM2015040; GA MŠk ED2.1.00/19.0395 Institutional support: RVO:68378050 Keywords : Retina * Differentiation * Polycomb * Eed Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biology (theoretical, mathematical, thermal, cryobiology, biological rhythm), Evolutionary biology Impact factor: 2.944, year: 2016
Novel Platinum-Catalyzed Ring-Opening of 1,2-Cyclopropanated Sugars with Alcohols
DEFF Research Database (Denmark)
Beyer, Jürgen; Madsen, Robert
1998-01-01
Reaction of 1,2-cyclopropanated sugars with a catalytic amount ofZeise's dimer [Pt(C2H4)Cl2]2 and an alcohol gives 2-C-branched glycosides by a novel platinum catalyzed ring-opening. A wide variety of alcohols can participate in this ring-opening reaction giving 2-C-branched glycosides ranging from...
Crystal and macular structure of 1:1 complex of N-methylmorpholine betaine with salicylic acid
International Nuclear Information System (INIS)
Bartoszak-Adamska, E.; Dega-Szafran, Z.; Przedwojska, M.; Jaskolski, M.
2003-01-01
The structure of a 1:1 complexes of complex of N-methylmorpholine betaine (MMB) with salicylic acid (SAL) has been determined by a single crystal X-ray analysis. The crystals are orthorhombic, space group Pbca, with a 9.4702(6), b = 13.0559(7) and c = 45.226(2) A (at 140 K). The asymmetric unit is composed of two MMB + ·SAL - units (A and B) each formed by a short, nearly linear O-H...O hydrogen bond (2.542(2) and 2.474(2) A) between the carboxylic group of the betaine cation and carboxylate group of the anion. The salicylate anions form short intramolecular O-H...O hydrogen bonds of 2. 472(2) and 2.525(2) A (O-H...O angles 160(2) and 149(2) o ) for anion A and B, respectively, between the ortho hydroxyl donor and the COO - group, but the carboxylate acceptor O atom is in each case different. The morpholine rings are in a chair conformation with the -CH 2 COOH group in equatorial and the methyl group in axial positions. FTIR, and 1 H and 13 C NMR spectra of the complex are discussed. (author)
Directory of Open Access Journals (Sweden)
Zouaoui Setifi
2015-05-01
Full Text Available In 2,2′-bipyridin-1-ium 1,1,3,3-tetracyano-2-ethoxyprop-2-en-1-ide, C10H9N2+·C9H5N4O−, (I, the ethyl group in the anion is disordered over two sets of atomic sites with occupancies 0.634 (9 and 0.366 (9, and the dihedral angle between the ring planes in the cation is 2.11 (7°. The two independent C(CN2 groups in the anion make dihedral angles of 10.60 (6 and 12.44 (4° with the central propenide unit, and the bond distances in the anion provide evidence for extensive electronic delocalization. In bis(2,2′-bipyridin-1-ium 1,1,3,3-tetracyano-2-(dicyanomethylenepropane-1,3-diide [alternative name bis(2,2′-bipyridin-1-ium tris(dicyanomethylenemethanediide], 2C10H9N2+·C10N62− (II, the dihedral angles between the ring planes in the two independent cations are 7.7 (2 and 10.92 (17°. The anion exhibits approximate C3 symmetry, consistent with extensive electronic delocalization, and the three independent C(CN2 groups make dihedral angles of 23.8 (2, 27.0 (3 and 27.4 (2° with the central plane. The ions in (I are linked by an N—H...N hydrogen bond and the resulting ion pairs are linked by two independent C—H...N hydrogen bonds, forming a ribbon containing alternating R44(18 and R44(26 rings, where both ring types are centrosymmetric. The ions in (II are linked by two independent N—H...N hydrogen bonds and the resulting ion triplets are linked by a C—H...N hydrogen bond, forming a C21(7 chain containing anions and only one type of cation, with the other cation linked to the chain by a further C—H...N hydrogen bond.
Duda, David M.; Olszewski, Jennifer L.; Tron, Adriana E.; Hammel, Michal; Lambert, Lester J.; Waddell, M. Brett; Mittag, Tanja; DeCaprio, James A.; Schulman, Brenda A.
2012-01-01
Summary The ~300 human Cullin-RING ligases (CRLs) are multisubunit E3s in which a RING protein, either RBX1 or RBX2, recruits an E2 to catalyze ubiquitination. RBX1-containing CRLs also can bind Glomulin (GLMN), which binds RBX1’s RING domain, regulates the RBX1-CUL1-containing SCFFBW7 complex, and is disrupted in the disease Glomuvenous Malformation. Here we report the crystal structure of a complex between GLMN, RBX1, and a fragment of CUL1. Structural and biochemical analyses reveal that GLMN adopts a HEAT-like repeat fold that tightly binds the E2-interacting surface of RBX1, inhibiting CRL-mediated chain formation by the E2 CDC34. The structure explains the basis for GLMN’s selectivity toward RBX1 over RBX2, and how disease-associated mutations disrupt GLMN-RBX1 interactions. Our study reveals a mechanism for RING E3 ligase regulation whereby an inhibitor blocks E2 access, and raises the possibility that other E3s are likewise controlled by cellular proteins that mask E2-binding surfaces to mediate inhibition. PMID:22748924
Assembly of the MreB-associated cytoskeletal ring of Escherichia coli.
Vats, Purva; Shih, Yu-Ling; Rothfield, Lawrence
2009-04-01
The Escherichia coli actin homologue MreB is part of a helical cytoskeletal structure that winds around the cell between the two poles. It has been shown that MreB redistributes during the cell cycle to form circumferential ring structures that flank the cytokinetic FtsZ ring and appear to be associated with division and segregation of the helical cytoskeleton. We show here that the MreB cytoskeletal ring also contains the MreC, MreD, Pbp2 and RodA proteins. Assembly of MreB, MreC, MreD and Pbp2 into the ring structure required the FtsZ ring but no other known components of the cell division machinery, whereas assembly of RodA into the cytoskeletal ring required one or more additional septasomal components. Strikingly, MreB, MreC, MreD and RodA were each able to independently assemble into the cytoskeletal ring and coiled cytoskeletal structures in the absence of any of the other ring components. This excludes the possibility that one or more of these proteins acts as a scaffold for incorporation of the other proteins into these structures. In contrast, incorporation of Pbp2 required the presence of MreC, which may provide a docking site for Pbp2 entry.
Contribution of CYP1B1 mutations and founder effect to primary congenital glaucoma in Mexico.
Zenteno, Juan Carlos; Hernandez-Merino, Elena; Mejia-Lopez, Herlinda; Matías-Florentino, Margarita; Michel, Norma; Elizondo-Olascoaga, Celia; Korder-Ortega, Vincent; Casab-Rueda, Homero; Garcia-Ortiz, Jose Elias
2008-01-01
The frequency of primary congenital glaucoma (PCG)-causing CYP1B1 mutations varies importantly among distinct populations, ranging from 20% in Indonesians and Japanese to about 100% among the Saudi Arabians and Slovakian Gypsies. Thus, the molecular characterization of large groups of PCG from different ethnic backgrounds is important to establish the actual CYP1B1 contribution in specific populations. In this work, the molecular analysis of the CYP1B1 gene in a group of Mexican PCG patients is reported. Thirty unrelated Mexican patients fulfilling the clinical criteria for PCG were included. Two cases were familial and with proven consanguinity, originating from distinct regions of the country. Polymerase chain reaction amplification and direct automated sequencing of the CYP1B1 coding region was performed in each participating subject. An identical pathogenic CYP1B1 mutation was demonstrated in 2 unrelated PCG subjects. The mutation consisted of a homozygous G to A transition at nucleotide position 1505 in exon 3, which predicted a substitution of glutamic acid for lysine at residue 387 of the protein (E387K). In the remaining 28 PCG subjects, no deleterious mutations were identified. Both subjects with the E387K mutation shared a same haplotype for 5 CYP1B1 intragenic single nucleotide polymorphisms, indicating a common origin of the allele. Mexican patients with PCG are rarely (less than 10%) due to CYP1B1 mutations. Available data indicate that most of the non-Brazilian Latin American PCG patients investigated to date are not due to CYP1B1 defects. Populations with low incidence of CYP1B1 mutations are appropriate candidates for the identification of novel PCG-causing genes.
2-Methyl-1,10b-dihydro-5H-pyrazolo[1,5-c][1,3]benzoxazin-5-one
Directory of Open Access Journals (Sweden)
Jan Světlík
2009-05-01
Full Text Available In the title compound, C11H10N2O2, a potential inhibitor of the cyclooxygenase-2 isoenzyme, the pyrazoline ring exists in a flat-envelope conformation while the puckering of the central oxazine ring is more severe. As a result, the molecule as a whole is non-planar. The formal sp3 pyrazoline N atom is sp2 hybridized, with the lone-pair electrons delocalized through conjugation with the carbonyl group rather than the double bond of the pyrazoline ring.
Directory of Open Access Journals (Sweden)
Kasper Frondelius
2017-02-01
Full Text Available Low serum apolipoprotein (Apo A1 concentrations and high serum ApoB concentrations may be better markers of the risk of cardiovascular disease than high-density lipoprotein (HDL and low-density lipoprotein (LDL. However, the associations between modifiable lifestyle factors and Apo concentrations have not been investigated in detail. Therefore, this study investigated the associations between Apo concentrations and education, lifestyle factors and dietary intake (macronutrients and 34 food groups. These cross-sectional associations were examined among 24,984 individuals in a Swedish population-based cohort. Baseline examinations of the cohort were conducted between 1991 and 1996. Dietary intake was assessed using a modified diet history method. The main determinants of high ApoA1 concentrations (r between 0.05 and 0.25 were high alcohol consumption, high physical activity, non-smoking, and a low body mass index (BMI, and the main determinants of high ApoB concentrations were smoking and a high BMI. The intake of sucrose and food products containing added sugar (such as pastries, sweets, chocolate, jam/sugar and sugar-sweetened beverages was negatively correlated with ApoA1 concentrations and positively correlated with ApoB concentrations and the ApoB/ApoA1 ratio, whereas the intake of fermented dairy products, such as fermented milk and cheese, was positively correlated with ApoA1 concentrations and negatively correlated with the ApoB/ApoA1 ratio. These results indicate that smoking, obesity, low physical activity, low alcohol consumption and a diet high in sugar and low in fermented dairy products are correlated with an unfavorable Apo profile.
International Nuclear Information System (INIS)
Wang, J.; Kagoshima, Y.; Miyahara, T.; Ando, M.; Aoki, S.; Anderson, E.; Attwood, D.; Kern, D.
1995-01-01
A soft x-ray microscope has been developed at the beamline NE1B of the 6.5-GeV TRISTAN Accumulation Ring (AR). It makes use of undulator radiation as its source and a zone plate with the outermost zone width of 50 nm as its imaging element. It has two main features. First, the undulator radiation is monochromatized by a grazing incidence grating monochromator to match to the monochromaticity requirement of the zone plate. Second, a visible light prefocus unit consisting of two objectives has been designed and installed in the x-ray microscope. The x-ray optical system of the microscope can be adjusted easily, quickly, and precisely by using this unit. The microscope can resolve 55-nm lines and spaces in a zone plate test pattern
Cao, Xiangrong; Yang, Xueyuan; Wang, Peixia; Liang, Yue; Liu, Feng; Tuerhong, Muhetaer; Jin, Da-Qing; Xu, Jing; Lee, Dongho; Ohizumi, Yasushi; Guo, Yuanqiang
2017-12-01
Protein tyrosine phosphatase 1B (PTP1B) has been regarded asa target for the research and development of new drugs to treat type II diabetes and PTP1B inhibitors are potential lead compounds for this type of new drugs. A phytochemical investigation to obtain new PTP1B inhibitors resulted in the isolation of four new phloroglucinols, longistyliones A-D (1-4) from the aerial parts of Hypericum longistylum. The structures of 1-4 were elucidated on the basis of extensive 1D and 2D NMR spectroscopic data analysis, and the absolute configurations of these compounds were established by comparing their experimental electronic circular dichroism (ECD) spectra with those calculated by the time-dependent density functional theory method. Compounds 1-4 possess a rare polycyclic phloroglucinol skeleton. The following biological evaluation revealed that all of the compounds showed PTP1B inhibitory effects. The further molecular docking studies indicated the strong interactions between these bioactive compounds with the PTP1B protein, which revealed the possible mechanism of PTP1B inhibition of bioactive compounds. All of the results implied that these compounds are potentially useful for the treatment of type II diabetes. Copyright © 2017 Elsevier Inc. All rights reserved.
G345.45+1.50: an expanding ring-like structure with massive star formation
López-Calderón, Cristian; Bronfman, Leonardo; Nyman, Lars-Åke; Garay, Guido; de Gregorio-Monsalvo, Itziar; Bergman, Per
2016-11-01
Context. Ring-like structures in the interstellar medium (ISM) are commonly associated with high-mass stars. Kinematic studies of large structures in giant molecular clouds (GMCs) toward these ring-like structures may help us to understand how massive stars form. Aims: The origin and properties of the ring-like structure G345.45+1.50 is investigated through observations of the 13CO(3-2) line. The aim of the observations is to determine the kinematics in the region and to compare physical characteristics estimated from gas emission with those previously determined using dust continuum emission. This area in the sky is well suited for studies like this because the ring is located 1.5° above the Galactic plane at 1.8 kpc from the Sun, thus molecular structures are rarely superposed on our line of sight, which minimizes confusion effects that might hinder identifying of individual molecular condensations. Methods: The 13CO(3-2) line was mapped toward the whole ring using the Atacama Pathfinder Experiment (APEX) telescope. The observations cover 17' × 20' in the sky with a spatial resolution of 0.2 pc and an rms of 1 K at a spectral resolution of 0.1 km s-1. Results: The ring is found to be expanding with a velocity of 1.0 km s-1, containing a total mass of 6.9 × 103M⊙, which agrees well with that determined using 1.2 mm dust continuum emission. An expansion timescale of 3 × 106 yr and a total energy of 7 × 1046 erg are estimated. The origin of the ring might have been a supernova explosion, since a 35.5 cm source, J165920-400424, is located at the center of the ring without an infrared counterpart. The ring is fragmented, and 104 clumps were identified with diameters of between 0.3 and 1.6 pc, masses of between 2.3 and 7.5 × 102M⊙, and densities of between 102 and 104 cm-3. At least 18% of the clumps are forming stars, as is shown in infrared images. Assuming that the clumps can be modeled as Bonnor-Ebert spheres, 13 clumps are collapsing, and the rest of
Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila
DEFF Research Database (Denmark)
Bantignies, Frédéric; Roure, Virginie; Comet, Itys
2011-01-01
In Drosophila melanogaster, Hox genes are organized in an anterior and a posterior cluster, called Antennapedia complex and bithorax complex, located on the same chromosome arm and separated by 10 Mb of DNA. Both clusters are repressed by Polycomb group (PcG) proteins. Here, we show that genes...... of the two Hox complexes can interact within nuclear PcG bodies in tissues where they are corepressed. This colocalization increases during development and depends on PcG proteins. Hox gene contacts are conserved in the distantly related Drosophila virilis species and they are part of a large gene...
Directory of Open Access Journals (Sweden)
Sabra L. Katz-Wise
2014-01-01
Full Text Available Obesity is a key public health issue for US youth. Previous research with primarily white samples of youth has indicated that sexual minority females have higher body mass index (BMI and sexual minority males have lower BMI than their same-gender heterosexual counterparts, with sexual orientation differences in males increasing across adolescence. This research explored whether gender and sexual orientation differences in BMI exist in nonwhite racial/ethnic groups. Using data from Waves I–IV (1995–2009 of the US National Longitudinal Study of Adolescent Health (N = 13,306, ages 11–34 years, we examined associations between sexual orientation and BMI (kg/m2 over time, using longitudinal linear regression models, stratified by gender and race/ethnicity. Data were analyzed in 2013. Among males, heterosexual individuals showed greater one-year BMI gains than gay males across all race/ethnicity groups. Among females, white and Latina bisexual individuals had higher BMI than same-race/ethnicity heterosexual individuals regardless of age; there were no sexual orientation differences in black/African Americans. Sexual orientation disparities in BMI are a public health concern across race/ethnicity groups. Interventions addressing unhealthy weight gain in youth must be relevant for all sexual orientations and race/ethnicities.
Which finite simple groups are unit groups?
DEFF Research Database (Denmark)
Davis, Christopher James; Occhipinti, Tommy
2014-01-01
We prove that if G is a finite simple group which is the unit group of a ring, then G is isomorphic to either (a) a cyclic group of order 2; (b) a cyclic group of prime order 2^k −1 for some k; or (c) a projective special linear group PSLn(F2) for some n ≥ 3. Moreover, these groups do all occur a...
Polymers Containing 1, 3, 4-Oxadiazole Rings for Advanced Materials
Directory of Open Access Journals (Sweden)
Mariana-Dana Damaceanu
2011-10-01
Full Text Available This paper presents the synthesis, properties and potential applications of new polymers containing 1, 3, 4-oxadiazole rings, tacking into account the requirements of the modern technologies. Two classes of polymers containing oxadiazole rings were approached: polyamides and polyimides. All the polymers were characterized with respect to the identification of their chemical structure, solubility, molecular weights, film forming ability, thermal, dielectric and optical properties, and the behaviour of polyoxadiazole films upon irradiation with pulsed KrF laser. All the properties were discussed in correlation with their chemical structure and compared with those of related polymers.
High prevalence of hepatitis B virus genotype C/C1 in the Minangkabau ethnic group in Indonesia
Directory of Open Access Journals (Sweden)
Siburian Marlinang D
2013-01-01
Full Text Available Abstract Background The Minangkabau is one of the major ethnic groups in Indonesia. Previous studies with a limited number of samples have shown a different prevalence of HBV/C in the Minangkabau compared to the Indonesian population in general. The aim of this study was to assess the HBV genotype distribution pattern and the prevalence of pre-S, T1753V and A1762T/G1764A mutations among the Minangkabau HBV carriers. The samples were collected from Padang, West Sumatera and from western Java. Mixed primers for specific genotypes were used to determine the HBV genotype. Pre-S or S genes were amplified, sequenced and aligned with reference sequences from GenBank to derive a phylogenetic tree for subgenotyping. Pre-S genes were also analyzed for mutations. The basal core promoter (BCP region was amplified and directly sequenced to analyze T1753V and A1762T/G1764A mutations. Results The predominant HBV genotype among the Minangkabau HBV carriers (n=117 was C (72.6% followed by B (24.8% and co-infection with B and C (2.6%. The prevalence of pre-S mutations, including both the pre-S deletion and pre-S2 start codon mutation, was 41.0%, and the T1753V and A1762T/G1764A mutations were found in 51.9% and 71.2% respectively. HBV/C1 was the predominant HBV subgenotype in the Minangkabau HBV carriers, and was found in 66.2%, followed by B3, B7, C8, B2, B9, C2, and C10 (18.3%, 7.0%, 2.8%, 1.4%, 1.4%, 1.4%, and 1.4% respectively. From samples that were found to be co-infected with HBV B and C, two samples were successfully cloned and subgenotyped, including one with mixed subgenotypes of B3 and C1, and another one with mixed subgenotypes of B7, C1, putative intergenotypic of B/A, and C/A. Furthermore, three samples from donors of non-Minangkabau ethnicity from Padang were found to be infected with an intragenotypic recombination form, including a putative recombinant of B8/B3 and B9/B7. Conclusion HBV/C with subgenotype C1 was the predominant HBV genotype among
International Nuclear Information System (INIS)
Vormittag, Laurenz; Thurnher, Dietmar; Geleff, Silvana; Pammer, Johannes; Heiduschka, Gregor; Brunner, Markus; Grasl, Matthaeus Ch.; Erovic, Boban M.
2009-01-01
Purpose: This study was conducted to determine the expression of Bmi-1 and podoplanin in healthy oral mucosa and in untreated tumor tissues samples of patients with squamous cell carcinomas of the head and neck. All patients were treated by primary radio(chemo)therapy. Methods and Materials: The expression of Bmi-1 and podoplanin was immunohistochemically evaluated in 12 normal oral mucosa and 63 tumor specimens and correlated with patients' clinical data. Results: In healthy mucosa expression of Bmi-1 and podoplanin was restricted to the basal cell layer. Expression of both proteins was found in 79% and 86% of our tumor samples, respectively. In 17 and 8 samples, Bmi-1 and podoplanin were co-expressed at the invasive border or diffuse in the bulk of the tumor, respectively. Univariate analysis showed that the co-expression of Bmi-1 and podoplanin correlated to decreased overall survival (p = 0.044). Moreover, multivariate testing identified high expression of podoplanin (p = 0.044), co-expression of Bmi-1 and podoplanin (p = 0.007) and lack of response to therapy (p < 0.0001) as predictors of shortened overall survival in patients treated with primary radio(chemo)therapy. Conclusions: Bmi-1 and podoplanin are expressed at the invasive front of squamous cell carcinomas of the head and neck. Co-expression of Bmi-1 and podoplanin predicts significantly overall survival of patients treated with primary radio(chemo)therapy
Production and testing of HENDL-2.1/CG coarse-group cross-section library based on ENDF/B-VII.0
International Nuclear Information System (INIS)
Xu Dezheng; He Zhaozhong; Zou Jun; Zeng Qin
2010-01-01
A coarse-group coupled neutron and photon (27n + 21γ) cross-section library HENDL-2.1/CG, based on ENDF/B-VII.0 evaluate data source, has been produced by FDS Team in Institute of Plasma Physics, Chinese Academy of Sciences (ASIPP). HENDL-2.1/CG containing 350 nuclide cross-section files (from 1 H to 252 Cf) was generated in MATXS format with the NJOY processing system and then by compiling coarse-group problem-dependent format using the TRANSX code. In order to verify the availability and reliability of the HENDL-2.1/CG data library, requisite benchmark calculations were performed and compared with HENDL-2.0/MG fine-group coupled neutron and photon (175n + 42γ) cross-section library. In general, results using the coarse-group library showed similarly believable as fine-group library.
Aflatoxin B1: Mechanism of mutagenesis
Directory of Open Access Journals (Sweden)
Regina M. Santella
2007-02-01
Full Text Available
Aflatoxins are a group of toxic and carcinogenic fungal metabolites that frequently contaminate corn, peanuts and other products. Aflatoxin B1 (AFB1, the most potent of these, is metabolized by the cytochrome P450 system into a number of hydroxylated metabolites and glutathione conjugates in the process of conversion to more hydrophilic forms for urinary excretion. Unfortunately, one of these metabolites is the aflatoxin-8,9-epoxide that is produced in two forms, endo and exo. Glutathione S-transferases (GST are able to conjugate and detoxify this reactive intermediate. Species differences in susceptibility to the effects of AFB1 are partially related to differences in expression of specific GSTs that are able to conjugate the epoxide to glutathione. The exo epoxide is able to intercalate into DNA and this is followed by reaction of the C8 position of the epoxide with the N7 position of guanine.
NMR studies of oligonucleotide duplexes containing the adduct have demonstrated that the adduct exists with the aromatic portion intercalated on the 5' face of the guanine residue with Watson-Crick base pairing maintained.
However, this covalent adduct is chemically unstable due to the charge on the ribose ring. As a result, the guanine can be released from the DNA leaving an apurinic site. This released guanine adduct can be detected in the urine and serves as a biomarker of exposure to AFB1. Alternatively, the ribose ring opens forming a stable formamidopyrimidine (FAPY adduct. This adduct somewhat stabilizes the DNA duplex. Time course studies in animals have demonstrated that the N7 adduct is rapidly removed, probably because it causes more distortion in the helix, while the FAPY adduct is more
Crystal structure of 4-aminobenzoic acid–4-methylpyridine (1/1
Directory of Open Access Journals (Sweden)
M. Krishna Kumar
2015-02-01
Full Text Available In the title 1:1 adduct, C6H7N·C7H7NO2, the carboxylic acid group is twisted at an angle of 4.32 (18° with respect to the attached benzene ring. In the crystal, the carboxylic acid group is linked to the pyridine ring by an O—H...N hydrogen bond, forming a dimer. The dimers are linked by N—H...O hydrogen bonds, generating (010 sheets.
Polycomb-like proteins link the PRC2 complex to CpG islands
Energy Technology Data Exchange (ETDEWEB)
Li, Haojie; Liefke, Robert; Jiang, Junyi; Kurland, Jesse Vigoda; Tian, Wei; Deng, Pujuan; Zhang, Weidi; He, Qian; Patel, Dinshaw J.; Bulyk, Martha L.; Shi, Yang; Wang, Zhanxin
2017-09-06
The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood. Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.
(1S*,3R*,5S*,7S*-4,4,8,8-Tetrachloro-1-isopropyl-5-methyltricyclo[5.1.0.03,5]octane
Directory of Open Access Journals (Sweden)
Koblandy M. Turdybekov
2014-04-01
Full Text Available The title compound, C12H16Cl4, is a derivative of the natural product 1-isopropyl-4-methylcyclohexa-1,4-diene, and represents a diastereomer with two trans-fused cyclopropane rings. Both enantiomers are present in the non-centrosymmetric polar space group Pna21. The central cyclohexane ring is planar within 0.02 (1 Å. The C atoms of dichloromethylene groups deviate from this plane by 1.19 (1 and −1.26 (1 Å, whereas the isopropyl and methyl groups are oriented more equatorially, deviating by 0.71 (1 and −0.87 (1 Å, respectively.
Directory of Open Access Journals (Sweden)
Jin Liu
2018-03-01
Full Text Available Phidianidines A and B are two novel marine indole alkaloids bearing an uncommon 1,2,4-oxadiazole ring and exhibiting various biological activities. Our previous research showed that the synthesized phidianidine analogs had the potential to inhibit the activity of protein tyrosine phosphatase 1B (PTP1B, a validated target for Type II diabetes, which indicates that these analogs are worth further structural modification. Therefore, in this paper, a series of phidianidine derivatives were designed and rapidly synthesized with a function-oriented synthesis (FOS strategy. Their inhibitory effects on PTP1B and T-cell protein tyrosine phosphatase (TCPTP were evaluated, and several compounds displayed significant inhibitory potency and specific selectivity over PTP1B. The structure–activity relationship (SAR and molecular docking analyses are also described.
Liu, Jin; Chen, Yu; Li, Jing-Ya; Luo, Cheng; Li, Jia; Chen, Kai-Xian; Li, Xu-Wen; Guo, Yue-Wei
2018-03-20
Phidianidines A and B are two novel marine indole alkaloids bearing an uncommon 1,2,4-oxadiazole ring and exhibiting various biological activities. Our previous research showed that the synthesized phidianidine analogs had the potential to inhibit the activity of protein tyrosine phosphatase 1B (PTP1B), a validated target for Type II diabetes, which indicates that these analogs are worth further structural modification. Therefore, in this paper, a series of phidianidine derivatives were designed and rapidly synthesized with a function-oriented synthesis (FOS) strategy. Their inhibitory effects on PTP1B and T-cell protein tyrosine phosphatase (TCPTP) were evaluated, and several compounds displayed significant inhibitory potency and specific selectivity over PTP1B. The structure-activity relationship (SAR) and molecular docking analyses are also described.
Meah, Farah A; DiMeglio, Linda A; Greenbaum, Carla J; Blum, Janice S; Sosenko, Jay M; Pugliese, Alberto; Geyer, Susan; Xu, Ping; Evans-Molina, Carmella
2016-06-01
The incidence of type 1 diabetes is increasing at a rate of 3-5% per year. Genetics cannot fully account for this trend, suggesting an influence of environmental factors. The accelerator hypothesis proposes an effect of metabolic factors on type 1 diabetes risk. To test this in the TrialNet Pathway to Prevention (PTP) cohort, we analysed the influence of BMI, weight status and insulin resistance on progression from single to multiple islet autoantibodies (Aab) and progression from normoglycaemia to diabetes. HOMA1-IR was used to estimate insulin resistance in Aab-positive PTP participants. Cox proportional hazards models were used to evaluate the effects of BMI, BMI percentile (BMI%), weight status and HOMA1-IR on the progression of autoimmunity or the development of diabetes. Data from 1,310 single and 1,897 multiple Aab-positive PTP participants were included. We found no significant relationships between BMI, BMI%, weight status or HOMA1-IR and the progression from one to multiple Aabs. Similarly, among all Aab-positive participants, no significant relationships were found between BMI, weight status or HOMA1-IR and progression to diabetes. Diabetes risk was modestly increased with increasing BMI% among the entire cohort, in obese participants 13-20 years of age and with increasing HOMA1-IR in adult Aab-positive participants. Analysis of the accelerator hypothesis in the TrialNet PTP cohort does not suggest a broad influence of metabolic variables on diabetes risk. Efforts to identify other potentially modifiable environmental factors should continue.
TET1 and hydroxymethylcytosine in transcription and DNA methylation fidelity
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Pedersen, Marianne Terndrup
2011-01-01
a role in transcriptional repression. TET1 binds a significant proportion of Polycomb group target genes. Furthermore, TET1 associates and colocalizes with the SIN3A co-repressor complex. We propose that TET1 fine-tunes transcription, opposes aberrant DNA methylation at CpG-rich sequences and thereby...... throughout the genome of embryonic stem cells, with the majority of binding sites located at transcription start sites (TSSs) of CpG-rich promoters and within genes. The hmC modification is found in gene bodies and in contrast to mC is also enriched at CpG-rich TSSs. We provide evidence further that TET1 has...... contributes to the regulation of DNA methylation fidelity....
Wang, Rubing; Zhang, Xiaojie; Chen, Chengsheng; Chen, Guanglin; Sarabia, Cristian; Zhang, Qiang; Zheng, Shilong; Wang, Guangdi; Chen, Qiao-Hong
2017-06-16
To systematically investigate the structure-activity relationships of 1,7-diheteroarylhepta-1,4,6-trien-3-ones in three human prostate cancer cell models and one human prostate non-neoplastic epithelial cell model, thirty five 1,7-diarylhepta-1,4,6-trien-3-ones with different terminal heteroaromatic rings have been designed for evaluation of their anti-proliferative potency in vitro. These target compounds have been successfully synthesized through two sequential Horner-Wadsworth-Emmons reactions starting from the appropriate aldehydes and tetraethyl (2-oxopropane-1,3-diyl)bis(phosphonate). Their anti-proliferative potency against PC-3, DU-145 and LNCaP human prostate cancer cell lines can be significantly enhanced by the manipulation of the terminal heteroaromatic rings, further demonstrating the utility of 1,7-diarylhepta-1,4,6-trien-3-one as a potential scaffold for the development of anti-prostate cancer agents. The optimal analog 40 is 82-, 67-, and 39-fold more potent than curcumin toward the three prostate cancer cell lines, respectively. The experimental data also reveal that the trienones with two different terminal aromatic rings possess greater potency toward three prostate cancer cell lines, but also have greater capability of suppressing the proliferation of PWR-1E benign human prostate epithelial cells, as compared to the corresponding counterparts with two identical terminal rings and curcumin. The terminal aromatic rings also affect the cell apoptosis perturbation. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Jeong HU
2015-01-01
Full Text Available Hyeon-Uk Jeong,1 Mihwa Kwon,2 Yongnam Lee,3 Ji Seok Yoo,3 Dae Hee Shin,3 Im-Sook Song,2 Hye Suk Lee1 1College of Pharmacy, The Catholic University of Korea, Bucheon 420-743, Korea; 2College of Pharmacy and Research Institute of Pharmaceutical Sciences, Kyungpook National University, Daegu 702-701, Korea; 3Central R&D Institute, Yungjin Pharm Co., Ltd., Suwon 443-270, Korea Abstract: We investigated the in vitro transport characteristics of catalposide in HEK293 cells overexpressing organic anion transporter 1 (OAT1, OAT3, organic anion transporting polypeptide 1B1 (OATP1B1, OATP1B3, organic cation transporter 1 (OCT1, OCT2, P-glycoprotein (P-gp, and breast cancer resistance protein (BCRP. The transport mechanism of catalposide was investigated in HEK293 and LLC-PK1 cells overexpressing the relevant transporters. The uptake of catalposide was 319-, 13.6-, and 9.3-fold greater in HEK293 cells overexpressing OAT3, OATP1B1, and OATP1B3 transporters, respectively, than in HEK293 control cells. The increased uptake of catalposide via the OAT3, OATP1B1, and OATP1B3 transporters was decreased to basal levels in the presence of representative inhibitors such as probenecid, furosemide, and cimetidine (for OAT3 and cyclosporin A, gemfibrozil, and rifampin (for OATP1B1 and OATP1B3. The concentration-dependent OAT3-mediated uptake of catalposide revealed the following kinetic parameters: Michaelis constant (Km =41.5 µM, maximum uptake rate (Vmax =46.2 pmol/minute, and intrinsic clearance (CLint =1.11 µL/minute. OATP1B1- and OATP1B3-mediated catalposide uptake also showed concentration dependency, with low CLint values of 0.035 and 0.034 µL/minute, respectively. However, the OCT1, OCT2, OAT1, P-gp, and BCRP transporters were apparently not involved in the uptake of catalposide into cells. In addition, catalposide inhibited the transport activities of OAT3, OATP1B1, and OATP1B3 with half-maximal inhibitory concentration values of 83, 200, and 235 µ
Liang, Hui; Cao, Qing; Liu, Huan; Guan, Wei; Wong, Claudia; Tong, Daniel
2018-01-15
Roux-en-Y gastric bypass has been proven to be beneficial for patients with obesity and type 2 diabetes mellitus (T2DM). In less-obese patient (BMI 30-35 kg/m 2 ), surgical treatment is indicated when medication fails to control the T2DM. Asian develops diabetes at a lower BMI. For lower-BMI patients, the rate of diabetes amelioration varies significantly with patients of higher BMI after surgical treatment. The factors that contribute to the post-operative diabetes response rate in lower-BMI patients have not been elucidated. Between 2010 and 2014, a total of 144 patients who underwent gastric bypass for the treatment of T2DM were included for study. Patients were divided into two groups for subgroup analysis, namely BMI > 30 kg/m 2 and BMI BMI group (BMI > 30 kg/m 2 ) was 80% (n = 90) whereas for the lower BMI (BMI BMI group, low HbA1c and high fasting C-peptide are predictive factors whereas for lower-BMI group, along with elevated C-peptide level, disease duration is the positive predictive factor for DM remission. Patients with BMI > 30 kg/m 2 and those with BMI BMI patients while duration of diabetes is for high-low-BMI patients. C-peptide is a predictor of remission in both groups. Further large-scale studies are required to define the predictors of diabetes remission after gastric bypass in low- and high-BMI patients.
The efficacy of laparoscopic examination of the internal inguinal ring in children.
Grossmann, P A; Wolf, S A; Hopkins, J W; Paradise, N F
1995-02-01
The ability of physicians to identify a patent processus vaginalis by laparoscopic examination of the internal ring is now well established, but the efficacy on patient outcome is not. The authors reviewed their experience to determine the effect of diagnostic laparoscopy of the internal ring on the management of children with inguinal hernias. The records of 150 children who underwent inguinal surgery were reviewed--75 before (group 1) and 75 after (group 2) pediatric laparoscopy was introduced into the authors' practice. The children in group 1 were selected for unilateral or bilateral surgery based on history, age, sex, side of presentation, and parental preference. For group 2, laparoscopy was an additional option offered to appropriate patients. Laparoscopy was performed in 43 group 2 patients, using an infraumbilical site. The minimum follow-up period was 2 years for group 1 and 1 year for group 2. The mean ages for groups 1 and 2 were 41.2 and 39.7 months, respectively. There were 61 boys and 14 girls in each group. The percentages of right (R), left (L), and bilateral (B) findings, based on clinical observation, were 56.0 (R), 29.3 (L), and 14.7 (B) for group 1, and 58.7 (R), 26.6 (L), and 14.7 (B) for group 2. The incidence of bilateral surgical exploration was similar for the two groups (group 1, 58.6%; group 2, 61.3%). The addition of laparoscopy significantly lowered the incidence of negative explorations (group 1, 16.0%; group 2, 2.6%; P < .01).(ABSTRACT TRUNCATED AT 250 WORDS)
Directory of Open Access Journals (Sweden)
Alberto Mimenza Alvarado
2016-01-01
Full Text Available Introduction. Painful diabetic neuropathy (PDN is a prevalent and impairing disorder. The objective of this study was to show the efficacy and safety of gabapentin (GBP plus complex B vitamins: thiamine (B1 and cyanocobalamine (B12 compared to pregabalin in patients with moderate to severe intensity PDN. Method. Multicenter, randomized, blind study. Two hundred and seventy patients were evaluated, 147 with GBP/B1/B12 and 123 with PGB, with a 7/10 pain intensity on the Visual Analog Scale (VAS. Five visits (12 weeks were scheduled. The GBP/B1 (100 mg/B12 (20 mg group started with 300 mg at visit 1 to 3600 mg at visit 5. The PGB group started with 75 mg/d at visit 1 to 600 mg/d at visit 5. Different safety and efficacy scales were applied, as well as adverse event assessment. Results. Both drugs showed reduction of pain intensity, without significant statistical difference (P=0.900. In the GBP/B1/B12 group, an improvement of at least 30% on VAS correlated to a 900 mg/d dose, compared with PGB 300 mg/d. Likewise, occurrence of vertigo was lower in the GBP/B1-B12 group, with a significant statistical difference, P=0.014. Conclusions. Our study shows that GPB/B1-B12 combination is as effective as PGB. Nonetheless, pain intensity reduction is achieved with 50% of the minimum required gabapentin dose alone (800 to 1600 mg/d in classic NDD trials. Less vertigo and dizziness occurrence was also observed in the GBP/B1/B12 group. This trial is registered with ClinicalTrials.gov NCT01364298.
Gregoretti, Francesco; Cesarini, Elisa; Lanzuolo, Chiara; Oliva, Gennaro; Antonelli, Laura
2016-01-01
The large amount of data generated in biological experiments that rely on advanced microscopy can be handled only with automated image analysis. Most analyses require a reliable cell image segmentation eventually capable of detecting subcellular structures.We present an automatic segmentation method to detect Polycomb group (PcG) proteins areas isolated from nuclei regions in high-resolution fluorescent cell image stacks. It combines two segmentation algorithms that use an active contour model and a classification technique serving as a tool to better understand the subcellular three-dimensional distribution of PcG proteins in live cell image sequences. We obtained accurate results throughout several cell image datasets, coming from different cell types and corresponding to different fluorescent labels, without requiring elaborate adjustments to each dataset.
Commutativity theorems for rings and groups with constraints on commutators
Directory of Open Access Journals (Sweden)
Evagelos Psomopoulos
1984-01-01
Full Text Available Let n>1, m, t, s be any positive integers, and let R be an associative ring with identity. Suppose xt[xn,y]=[x,ym]ys for all x, y in R. If, further, R is n-torsion free, then R is commutativite. If n-torsion freeness of R is replaced by m, n are relatively prime, then R is still commutative. Moreover, example is given to show that the group theoretic analogue of this theorem is not true in general. However, it is true when t=s=0 and m=n+1.
Jiang, Zhaoyan; Li, Huan; Wang, Zhen; Zhang, Jianqi; Zhang, Yajie; Lu, Kun; Wei, Zhixiang
2018-03-23
Three novel copolymers based on zigzag naphthodithiophene (zNDT) with different aromatic rings as π bridges and different core side substitutions are designed and synthesized (PzNDT-T-1,3-bis(4-(2-ethylhexyl)-thiophen-2-yl)-5,7-bis(2-ethylhexyl)benzo[1,2-c:4,5-c']-dithiophene-4,8-dione (BDD), PzNDT-TT-BDD, and PzNDTP-T-BDD, respectively). The 2D conjugation structure and molecular planarity of the polymers can be effectively altered through the modification of conjugated side chains and π-bridges. These alterations contribute to the variation in energy levels, light absorption capacity, and morphology compatibility of the polymers. When blended with the nonfullerene acceptor (2,2'-[(4,4,9,9-tetrahexyl-4,9-dihydro-sindaceno[1,2-b:5,6-b']dithiophene-2,7-diyl)bis[methylidyne(3-oxo-1H-indene-2,1(3H)-diylidene)
RP-HPLC Determination of vitamins B1, B3, B6, folic acid and B12 in multivitamin tablets
Directory of Open Access Journals (Sweden)
SOTE VLADIMIROV
2005-10-01
Full Text Available Abstract:Asimple and sensitive reversed-phase, ion-pair HPLC method was developed and validated for the simultaneous determination of B-group vitamins, thiamine chloride hydrochloride (B1, nicotinamide (B3, pyridoxine hydrochloride (B6 and folic acid in Pentovit® coated tablets. The cyanocobalamine (B12 was determined separately, because of its low concentration in the investigated multivitamin preparation. RP-HPLC analysis was performed with a LKB 2150 HPLC system, equipped with a UV/VIS Waters M484 detector. The procedures for the determination of B1, B2, B6 and folic acid were carried out on a Supelcosil ABZ+ (15 cm 4.6 mm; 5 µm column with methanol-5mM heptanesulphonic acid sodium salt 0.1%triethylamine TEA(25:75 V/V; pH 2.8 as themobile phase. For the determination of B12 a Suplex pKb-100 (15 cm 4.6 mm; 5 µm column andmethanolâwater (22:78 V/V as themobile phase were used. The column effluentsweremonitored at 290 nm for B 1, B3, B6 and folic acid, and at 550 nm for B12. The obtained results and statistical parameters for all the investigated vitamins of the B-group in Pentovit® coated tablets were satisfactory and ranged from 90.4 % to 108.5 % (RSD. from 0.5% to 4.1 %. The parameters for the validation of the methods are given.
1,3-Di-4-pyridylpropane–4,4′-oxydibenzoic acid (1/1
Directory of Open Access Journals (Sweden)
Hirofumi Hinode
2008-12-01
Full Text Available The hydrothermal reaction of Cd(NO32·4H2O, 1,3-di-4-pyridylpropane (BPP and 4,4′-oxydibenzoic acid (OBA led to the formation of the title compound, C13H14N2·C14H10O5. The asymmetric unit consists of one molecule of OBA and one of BPP. In the OBA molecule, one COOH group is nearly planar with its attached benzene ring [dihedral angle = 0.9 (1°], while the other COOH group is slightly twisted with a dihedral angle of 10.8 (3°. The carboxyl groups form strong intermolecular O—H...N hydrogen bonds with N atoms of the pyridine rings in BPP, linking the molecules into zigzag chains.
26 CFR 1.280B-1 - Demolition of structures.
2010-04-01
... 26 Internal Revenue 3 2010-04-01 2010-04-01 false Demolition of structures. 1.280B-1 Section 1... (CONTINUED) INCOME TAXES Items Not Deductible § 1.280B-1 Demolition of structures. (a) In general. Section 280B provides that, in the case of the demolition of any structure, no deduction otherwise allowable...
Variations in Ring Particle Cooling across Saturn's Rings with Cassini CIRS
Brooks, S. M.; Spilker, L. J.; Pilorz, S.; Edgington, S. G.; Déau, E.; Altobelli, N.
2010-12-01
Cassini's Composite Infrared Spectrometer has recorded over two million of spectra of Saturn's rings in the far infrared since arriving at Saturn in 2004. CIRS records far infrared radiation between 10 and 600 cm-1 ( 16.7 and 1000 μ {m} ) at focal plane 1 (FP1), which has a field of view of 3.9 mrad. Thermal emission from Saturn’s rings peaks in this wavelength range. Ring temperatures can be inferred from FP1 data. By tracking how ring temperatures vary, we can determine the thermal inertia of the rings. Previous studies have shown that the rings' thermal inertia, a measure of their response to changes in the thermal environment, varies from ring to ring. Thermal inertia can provide insight into the physical structure of Saturn's ring particles and their regoliths. Low thermal inertia and rapidly changing temperatures are suggestive of ring particles that have more porous or fluffy regoliths or that are riddled with cracks. Solid particles can be expected to have higher thermal inertias. Ferrari et al. (2005) fit thermal inertia values of 5218 {Jm)-2 {K}-1 {s}-1/2 to their B ring data and 6412 {Jm)-2 {K}-1 {s}-1/2 to their C ring data. In this work we focus on CIRS observations of the shadowed portion of Saturn's rings. The rings’ thermal budget is dominated by its absorption of solar radiation. As a result, ring particles abruptly cool as they traverse Saturn's shadow. From these shadow observations we can create cooling curves at specific locations across the rings. We will show that the rings' cooling curves and thus their thermal inertia vary not only from ring to ring, but by location within the individual rings. This research was carried out at the Jet Propulsion Laboratory, California Institute of Technology, under contract with NASA. Copyright 2010 California Institute of Technology. Government sponsorship acknowledged.
Directory of Open Access Journals (Sweden)
Patrick Claude
2011-12-01
Full Text Available Phenyl 3,4,6-tri-O-benzyl-2-O-(3-carboxypropionyl-1-thio-β-D-galactopyranoside (1 was condensed via its pentafluorophenyl ester 2 with 5-aminopentyl (4a, 4-aminobutyl (4b, 3-aminopropyl (4c and 2-aminoethyl 4,6-O-benzylidene-β-D-glucopyranoside (4d, prepared from the corresponding N-Cbz protected glucosides 3a–d, to give the corresponding 2-[3-(alkylcarbamoylpropionyl] tethered saccharides 5a–d. Intramolecular, ring closing glycosylation of the saccharides with NIS and TMSOTf afforded the tethered β(1→3 linked disaccharides 6a–c, the α(1→3 linked disaccharides 7a–d and the α(1→2 linked disaccharide 8d in ratios depending upon the ring size formed during glycosylation. No β(1→2 linked disaccharides were formed. Molecular modeling of saccharides 6–8 revealed that a strong aromatic stacking interaction between the aromatic parts of the benzyl and benzylidene protecting groups in the galactosyl and glucosyl moieties was mainly responsible for the observed regioselectivity and anomeric selectivity of the ring-closing glycosylation step.
Report of the eRHIC Ring-Ring Working Group
Energy Technology Data Exchange (ETDEWEB)
Aschenauer, E. C. [Brookhaven National Lab. (BNL), Upton, NY (United States); Berg, S. [Brookhaven National Lab. (BNL), Upton, NY (United States); Blaskiewicz, M. [Brookhaven National Lab. (BNL), Upton, NY (United States); Brennan, M. [Brookhaven National Lab. (BNL), Upton, NY (United States); Fedotov, A. [Brookhaven National Lab. (BNL), Upton, NY (United States); Fischer, W. [Brookhaven National Lab. (BNL), Upton, NY (United States); Litvinenko, V. [Brookhaven National Lab. (BNL), Upton, NY (United States); Montag, C. [Brookhaven National Lab. (BNL), Upton, NY (United States); Palmer, R. [Brookhaven National Lab. (BNL), Upton, NY (United States); Parker, B. [Brookhaven National Lab. (BNL), Upton, NY (United States); Peggs, S. [Brookhaven National Lab. (BNL), Upton, NY (United States); Ptitsyn, V. [Brookhaven National Lab. (BNL), Upton, NY (United States); Ranjbar, V. [Brookhaven National Lab. (BNL), Upton, NY (United States); Tepikian, S. [Brookhaven National Lab. (BNL), Upton, NY (United States); Trbojevic, D. [Brookhaven National Lab. (BNL), Upton, NY (United States); Willeke, F. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2015-10-13
This report evaluates the ring-ring option for eRHIC as a lower risk alternative to the linac-ring option. The reduced risk goes along with a reduced initial luminosity performance. However, a luminosity upgrade path is kept open. This upgrade path consists of two branches, with the ultimate upgrade being either a ring-ring or a linac-ring scheme. The linac-ring upgrade could be almost identical to the proposed linac-ring scheme, which is based on an ERL in the RHIC tunnel. This linac-ring version has been studied in great detail over the past ten years, and its significant risks are known. On the other hand, no detailed work on an ultimate performance ring-ring scenario has been performed yet, other than the development of a consistent parameter set. Pursuing the ring-ring upgrade path introduces high risks and requires significant design work that is beyond the scope of this report.
Directory of Open Access Journals (Sweden)
Hong-Mei Sun
2009-09-01
Full Text Available In the title compound, [Ag2(C14H14N42](C7H4O6S·CH3OH·3H2O, the complex dication has a binuclear structure in which each AgI ion is two-coordinated in a slightly distorted linear coordination geometry. The two AgI atoms are bridged by two 1,2-bis[(1H-imidazol-1-ylmethyl]benzene (IBI ligands, forming a 22-membered ring. In the dication, π–π interactions are observed between the imidazole rings with centroid–centroid distances of 3.472 (3 and 3.636 (3 Å. In the crystal, the uncoordinated water molecules, anions and methanol solvent molecules are linked into chains along the b axis by O—H...O hydrogen bonds. In addition, π–π interactions are observed between the benzene rings of the IBI ligands, with a centroid–centroid distance of 3.776 (2 Å. The sulfonate group is disordered over two orientations with occupancies of 0.676 (12 and 0.324 (12.
Eating tasty food to cope. Longitudinal association with BMI.
Boggiano, M M; Wenger, L E; Turan, B; Tatum, M M; Morgan, P R; Sylvester, M D
2015-04-01
The goals of this study were to determine if a change in certain motives to eat highly palatable food, as measured by the Palatable Eating Motives Scale (PEMS), could predict a change in body mass index (BMI) over time, to assess the temporal stability of these motive scores, and to test the reliability of previously reported associations between eating tasty foods to cope and BMI. BMI, demographics, and scores on the PEMS and the Binge Eating Scale were obtained from 192 college students. Test-retest analysis was performed on the PEMS motives in groups varying in three gap times between tests. Regression analyses determined what PEMS motives predicted a change in BMI over two years. The results replicated previous findings that eating palatable food for Coping motives (e.g., to forget about problems, reduce negative feelings) is associated with BMI. Test-retest correlations revealed that motive scores, while somewhat stable, can change over time. Importantly, among overweight participants, a change in Coping scores predicted a change in BMI over 2 years, such that a 1-point change in Coping predicted a 1.76 change in BMI (equivalent to a 10.5 lb. change in body weight) independent of age, sex, ethnicity, and initial binge-eating status (Cohen's f(2) effect size = 1.44). The large range in change of Coping scores suggests it is possible to decrease frequency of eating to cope by more than 1 scale point to achieve weight losses greater than 10 lbs. in young overweight adults, a group already at risk for rapid weight gain. Hence, treatments aimed specifically at reducing palatable food intake for coping reasons vs. for social, reward, or conformity reasons, should help achieve a healthier body weight and prevent obesity if this motive-type is identified prior to significant weight gain. Copyright © 2015 Elsevier Ltd. All rights reserved.
Adiabatic compression of ion rings
International Nuclear Information System (INIS)
Larrabee, D.A.; Lovelace, R.V.
1982-01-01
A study has been made of the compression of collisionless ion rings in an increasing external magnetic field, B/sub e/ = zB/sub e/(t), by numerically implementing a previously developed kinetic theory of ring compression. The theory is general in that there is no limitation on the ring geometry or the compression ratio, lambdaequivalentB/sub e/ (final)/B/sub e/ (initial)> or =1. However, the motion of a single particle in an equilibrium is assumed to be completely characterized by its energy H and canonical angular momentum P/sub theta/ with the absence of a third constant of the motion. The present computational work assumes that plasma currents are negligible, as is appropriate for a low-temperature collisional plasma. For a variety of initial ring geometries and initial distribution functions (having a single value of P/sub theta/), it is found that the parameters for ''fat'', small aspect ratio rings follow general scaling laws over a large range of compression ratios, 1 3 : The ring radius varies as lambda/sup -1/2/; the average single particle energy as lambda/sup 0.72/; the root mean square energy spread as lambda/sup 1.1/; and the total current as lambda/sup 0.79/. The field reversal parameter is found to saturate at values typically between 2 and 3. For large compression ratios the current density is found to ''hollow out''. This hollowing tends to improve the interchange stability of an embedded low β plasma. The implications of these scaling laws for fusion reactor systems are discussed
Ducklow, Hugh
1986-11-01
The distribution of bacterioplankton biomass and productivity in warm-core Gulf Stream ring 82-B generally corresponded to the physical and dynamical structure of the ring. Mean cell volumes were uniform for 4 months, but were larger by a factor of 2-3 in the high velocity (frontal) region (HVR) near the ring edge. As a result of this gradient and higher abundances, water column biomass and production were highest in the front, which appeared to be a local maximum in those properties. In this regard bacterioplankton contrasted strongly to phytoplankton, which exhibited strong local maxima at the center of the ring in June. In April when the water column inside the ring was isothermal to 450 m, bacterial biomass and production were low and uniform to 250 and 50 m, respectively. Bacterioplankton responded dramatically to the vernal restratification of the ring. In June when the surface layer was characterized by a strong pycnocline at 10-40 m, bacterial biomass and production often had strong subsurface maxima, and were 3 and 5 times greater than in April, respectively. Abundance exceeded 1.5 × 10 9 cells l -1 at ring center and exceeded 3 × 10 9 l -1 in the HVR. Turnover rates for the euphotic zone bacterioplankton as a whole were 0.24 d -1 in April, 0.56 d -1 in June, and 0.27 d -1 in August at ring center. Bacterial production averaged 12% of hourly primary production (range 1-32%), suggesting that bacteria control a significant and sometimes large portion of the carbon cycling in the euphotic zone. These data suggest that warm-core rings are sites of enhanced variability of bacterioplankton properties in the open sea. Furthermore, the data strongly support recent work showing that frontal zones are sites of locally enhanced bacterial biomass and production. In the ring system as a whole, the euphotic zone bacterioplankton biomass and production were comparable to and occasionally greater than the biomass and production of the >64 μm zooplankton, especially in
The nuclear receptor NR2E1/TLX controls senescence
Krusche, Benjamin; Pemberton, Helen; Alonso, Marta M.; Chandler, Hollie; Brookes, Sharon; Parrinello, Simona; Peters, Gordon; Gil, Jesús
2014-01-01
The nuclear receptor NR2E1 (also known as TLX or tailless) controls the self-renewal of neural stem cells (NSCs) and has been implied as an oncogene which initiates brain tumours including glioblastomas. Despite NR2E1 regulating targets like p21CIP1 or PTEN we still lack a full explanation for its role in NSC self-renewal and tumorigenesis. We know that Polycomb repressive complexes (PRC) also control stem cell self-renewal and tumorigenesis, but so far, no formal connection has been established between NR2E1 and PRCs. In a screen for transcription factors regulating the expression of the Polycomb protein CBX7, we identified NR2E1 as one of its more prominent regulators. NR2E1 binds at the CBX7 promoter, inducing its expression. Notably CBX7 represses NR2E1 as part of a regulatory loop. Ectopic NR2E1 expression inhibits cellular senescence, extending cellular lifespan in fibroblasts via CBX7-mediated regulation of p16INK4a and direct repression of p21CIP1. In addition NR2E1 expression also counteracts oncogene-induced senescence (OIS). The importance of NR2E1 to restrain senescence is highlighted through the process of knocking down its expression, which causes premature senescence in human fibroblasts and epithelial cells. We also confirmed that NR2E1 regulates CBX7 and restrains senescence in NSCs. Finally, we observed that the expression of NR2E1 directly correlates with that of CBX7 in human glioblastoma multiforme. Overall we identified control of senescence and regulation of Polycomb action as two possible mechanisms that can join those so far invoked to explain the role of NR2E1 in control of NSC self-renewal and cancer. PMID:25328137
The nuclear receptor NR2E1/TLX controls senescence.
O'Loghlen, Ana; Martin, Nadine; Krusche, Benjamin; Pemberton, Helen; Alonso, Marta M; Chandler, Hollie; Brookes, Sharon; Parrinello, Simona; Peters, Gordon; Gil, Jesús
2015-07-30
The nuclear receptor NR2E1 (also known as TLX or tailless) controls the self-renewal of neural stem cells (NSCs) and has been implied as an oncogene which initiates brain tumors including glioblastomas. Despite NR2E1 regulating targets like p21(CIP1) or PTEN we still lack a full explanation for its role in NSC self-renewal and tumorigenesis. We know that polycomb repressive complexes also control stem cell self-renewal and tumorigenesis, but so far, no formal connection has been established between NR2E1 and PRCs. In a screen for transcription factors regulating the expression of the polycomb protein CBX7, we identified NR2E1 as one of its more prominent regulators. NR2E1 binds at the CBX7 promoter, inducing its expression. Notably CBX7 represses NR2E1 as part of a regulatory loop. Ectopic NR2E1 expression inhibits cellular senescence, extending cellular lifespan in fibroblasts via CBX7-mediated regulation of p16(INK4a) and direct repression of p21(CIP1). In addition NR2E1 expression also counteracts oncogene-induced senescence. The importance of NR2E1 to restrain senescence is highlighted through the process of knocking down its expression, which causes premature senescence in human fibroblasts and epithelial cells. We also confirmed that NR2E1 regulates CBX7 and restrains senescence in NSCs. Finally, we observed that the expression of NR2E1 directly correlates with that of CBX7 in human glioblastoma multiforme. Overall we identified control of senescence and regulation of polycomb action as two possible mechanisms that can join those so far invoked to explain the role of NR2E1 in control of NSC self-renewal and cancer.
Yokoyama, Akira; Yokoyama, Tetsuji; Matsui, Toshifumi; Mizukami, Takeshi; Matsushita, Sachio; Higuchi, Susumu; Maruyama, Katsuya
2013-07-01
The calories in alcoholic beverages consumed by alcoholics are a major energy source and a strong modifier of their body weight. Genetic polymorphisms of alcohol dehydrogenase-1B (ADH1B) and aldehyde dehydrogenase-2 (ALDH2) affect susceptibility to alcoholism and may affect body weight via gene-associated differences in fuel utilization in alcoholics. We evaluated associations between ADH1B/ALDH2 genotypes and the body weight and body mass index (BMI) of 1,301 Japanese alcoholic men at the time of their first visit to an addiction center. Median (25th to 75th) caloric intake in the form of alcoholic beverages was 864 (588 to 1,176) kcal/d. Age-adjusted caloric intake did not differ according to ADH1B/ALDH2 genotypes. The body weight and BMI values showed that the ADH1B*2/*2 and *1/*2 carriers (n = 939) were significantly leaner than the ADH1B*1/*1 carriers (n = 362) irrespective of age, drinking, smoking, and dietary habits. The age-adjusted body weight values of the ADH1B*2/*2, ADH1B*1/*2, and ADH1B*1/*1 carriers were 58.4 ± 0.4, 58.7 ± 0.5, and 63.6 ± 0.5 kg, respectively (ADH1B*2 vs. ADH1B*1/*1 carriers, p strong determinant of body weight in the alcoholics. The more rapid EtOH elimination associated with the ADH1B*2 allele may result in less efficient utilization of EtOH as an energy source in alcoholics. Copyright © 2013 by the Research Society on Alcoholism.
(2E-1-(3-Chlorophenyl-3-(4-chlorophenylprop-2-en-1-one
Directory of Open Access Journals (Sweden)
Jerry P. Jasinski
2009-11-01
Full Text Available The title compound, C15H10Cl2O, is a chalcone with 3-chlorophenyl and 4-chlorophenyl substituents bonded at the opposite ends of a propenone group, the biologically active region. The dihedral angle between mean planes of these two chloro-substituted benzene rings is 46.7 (7° compared to 46.0 (1 and 32.4 (1° in similar published sructures. The angles between the mean plane of the prop-2-en-1-one group and the mean planes of the 3-chlorophenyl and 4-chlorophenyl rings are 24.1 (2 and 29.63°, respectively. While no classical hydrogen bonds are present, weak intermolecular C—H...π-ring interactions are observed, which contribute to the stability of crystal packing.
Mel-18 interacts with RanGAP1 and inhibits its sumoylation.
Zhang, Jie; Sarge, Kevin D
2008-10-17
Our previous results showed that the polycomb protein mel-18 binds to a protein called HSF2 and inhibits HSF2 sumoylation, thereby functioning as an anti-SUMO E3 factor. This study also suggested that mel-18 regulates the sumoylation of other cellular proteins, but the identities of these other proteins were unknown. Here we show that mel-18 interacts with the RanGAP1 protein and inhibits its sumoylation, and that these activities do not require the RING domain of mel-18. The results also show that RanGAP1 sumoylation is decreased during mitosis, and that this is associated with increased interaction between RanGAP1 and mel-18 during this stage of the cell cycle. Intriguingly, this regulatory relationship is the opposite of that found for mel-18 and HSF2, in which the interaction between these two proteins decreases during mitosis, resulting in elevated HSF2 sumoylation. The results of this study strengthen the conclusion that mel-18 functions as an anti-SUMO E3 factor, and extend its targets to include regulation of the sumoylation of the important cellular protein RanGAP1.
Directory of Open Access Journals (Sweden)
Kasi Viswanatharaju Ruddraraju
2015-07-01
Full Text Available The asymmetric unit of the title compound, C14H24N2O5S, contains two independent molecules (A and B. In each molecule, the isothiazolidin-3-one ring adopts an envelope conformation with the methylene C atom as the flap. In the crystal, the A molecules are linked to one another by N—H...O hydrogen bonds, forming columns along [010]. The B molecules are also linked to one another by N—H...O hydrogen bonds, forming columns along the same direction, i.e. [010]. Within the individual columns, there are also C—H...S and C—H...O hydrogen bonds present. The columns of A and B molecules are linked by C—H...O hydrogen bonds, forming sheets parallel to (10-1. The absolute structure was determined by resonant scattering [Flack parameter = 0.00 (3].
Report of the New Rings Study Group
Energy Technology Data Exchange (ETDEWEB)
Holmes, S.D.; Dugan, G.; Marriner, J.
1987-10-19
We have taken the approach here of trying to understand both the feasibility and practicality of varied options for new rings at Fermilab, rather than trying to produce a single detailed design. In other words, this document is not a design report and should not be construed as such. Our perception of the potential needs for new rings (in order of priority) is as follows: Antiproton Storage and/or Recovery: A facility for storing up to 4 x 10/sup 12/ antiprotons is needed. Recovery of antiprotons from the collider becomes a viable option if the luminosity is indeed dominated by emittance dilution rather than beam loss. New or Post-Booster: The goal here would be to inject into the existing Main Ring above transition. Improved performance of the Main Ring would be anticipated. New Main Ring: Advantages would include better emittance preservation, a faster cycle time for antiproton production, and the removal of interference/backgrounds at the B0 and D0 detectors. We discuss in this paper various scenarios based on one or more combinations of the above possibilities. 14 figs., 10 tabs.
Report of the New Rings Study Group
International Nuclear Information System (INIS)
Holmes, S.D.; Dugan, G.; Marriner, J.
1987-01-01
We have taken the approach here of trying to understand both the feasibility and practicality of varied options for new rings at Fermilab, rather than trying to produce a single detailed design. In other words, this document is not a design report and should not be construed as such. Our perception of the potential needs for new rings (in order of priority) is as follows: Antiproton Storage and/or Recovery: A facility for storing up to 4 x 10 12 antiprotons is needed. Recovery of antiprotons from the collider becomes a viable option if the luminosity is indeed dominated by emittance dilution rather than beam loss. New or Post-Booster: The goal here would be to inject into the existing Main Ring above transition. Improved performance of the Main Ring would be anticipated. New Main Ring: Advantages would include better emittance preservation, a faster cycle time for antiproton production, and the removal of interference/backgrounds at the B0 and D0 detectors. We discuss in this paper various scenarios based on one or more combinations of the above possibilities. 14 figs., 10 tabs
Energy Technology Data Exchange (ETDEWEB)
Sharma, P. [University of Jammu, X-ray Crystallography Laboratory, Department of Physics (India); Subbulakshmi, K. N.; Narayana, B. [Mangalore University, Department of Chemistry (India); Sarojini, B. K. [Mangalore University, Industrial Chemistry Division, Department of Studies in Chemistry (India); Kant, R., E-mail: rkant.ju@gmail.com [University of Jammu, X-ray Crystallography Laboratory, Department of Physics (India)
2016-03-15
The title compound, 2-(thiophen-2-yl)-1-(5-thioxo-4,5-dihydro-1,3,4-oxadiazol-2-yl)ethenyl] benzamide:N,N-dimethylformamide (1: 1), (C{sub 15}H{sub 11}N{sub 3}O{sub 2}S{sub 2} · C{sub 3}H{sub 7}NO), was synthesized, and its structure was established by spectral analysis and X-ray diffraction studies. The compound crystallizes in the monoclinic space group P2{sub 1}/n with a = 10.8714(7), b = 9.0497(5), c = 19.8347(13) Å, β = 91.093(5)°, Z = 4. The crystal structure is stabilized by N–H···S, C–H···O and N–H···O hydrogen bonds. The π···π interactions are also observed between the rings.
Kanemasa, Yusuke; Shimoyama, Tatsu; Sasaki, Yuki; Tamura, Miho; Sawada, Takeshi; Omuro, Yasushi; Hishima, Tsunekazu; Maeda, Yoshiharu
2018-02-01
Studies that have evaluated the prognostic value of body mass index (BMI) in patients with diffuse large B-cell lymphoma have recently been reported. However, the impact of BMI on survival outcomes remains controversial. We retrospectively analyzed the data of 406 diffuse large B-cell lymphoma patients treated with R-CHOP or R-CHOP-like regimens. The number (%) of patients that were categorized into 1 of 4 groups according to BMI were underweight (BMI (BMI (≥25 kg/m 2 ) (5-y OS, 61.5% vs 85.7%; P = .039). In contrast, in young female patients (BMI had significantly better OS than those with a high BMI (5-y OS, 88.6% vs 46.4%; P BMI on OS between young and elderly patients. In this study, we demonstrated that being underweight and obese were independent prognostic factors compared with being normal weight. In female patients, BMI had a different impact on the prognosis of young and elderly patients, whereas in male patients, there was no difference in the effect of BMI on prognosis according to age. Copyright © 2017 John Wiley & Sons, Ltd.
Delacrétaz, Aurélie; Zdralovic, Adna; Vandenberghe, Frederik; Saigi-Morgui, Nuria; Glatard, Anaïs; Quteineh, Lina; Gholam-Rezaee, Mehdi; Raffoul, Wassim; Applegate, Lee Ann; Jafari, Paris; Gamma, Franziska; von Gunten, Armin; Conus, Philippe; Eap, Chin B
2017-09-10
Genetic factors associated with Body Mass Index (BMI) have been widely studied over the last decade. We examined whether genetic variants previously associated with BMI in the general population are associated with cardiometabolic parameter worsening in the psychiatric population receiving psychotropic drugs, a high-risk group for metabolic disturbances. Classification And Regression Trees (CARTs) were used as a tool capable of describing hierarchical associations, to pinpoint genetic variants best predicting worsening of cardiometabolic parameters (i.e total, HDL and LDL-cholesterol, triglycerides, body mass index, waist circumference, fasting glucose, and blood pressure) following prescription of psychotropic drugs inducing weight gain in a discovery sample of 357 Caucasian patients. Significant findings were tested for replication in a second Caucasian psychiatric sample (n=140). SH2B1 rs3888190C>A was significantly associated with LDL levels in the discovery and in the replication sample, with A-allele carriers having 0.2mmol/l (p=0.005) and 0.36mmol/l (p=0.007) higher LDL levels compared to others, respectively. G-allele carriers of RABEP1 rs1000940A>G had lower fasting glucose levels compared to others in both samples (-0.16mmol/l; p<0.001 and -0.77mmol/l; p=0.03 respectively). The present study is the first to observe such associations in human subjects, which may in part be explained by a high risk towards dyslipidemia and diabetes in psychiatric patients receiving psychotropic treatments compared to population-based individuals. These results may therefore give new insight into the etiology of LDL-cholesterol and glucose regulation in psychiatric patients under psychotropic drug therapy. Copyright © 2017 Elsevier B.V. All rights reserved.
... between the BMI and body fatness is fairly strong 1,2,3,7 , but even if 2 people have the same BMI, their level of body fatness may differ 12 . In general, At the same BMI, women tend to have more body fat than men. At the same BMI, Blacks have less body ...
Laddha, Naresh C.; Dwivedi, Mitesh; Mansuri, Mohmmad Shoab; Singh, Mala; Patel, Hetanshi H.; Agarwal, Nishtha; Shah, Anish M.; Begum, Rasheedunnisa
2014-01-01
Background Vitiligo is a depigmenting disorder resulting from loss of functional melanocytes in the skin. NPY plays an important role in induction of immune response by acting on a variety of immune cells. NPY synthesis and release is governed by IL1B. Moreover, genetic variability in IL1B is reported to be associated with elevated NPY levels. Objectives Aim of the present study was to explore NPY promoter −399T/C (rs16147) and exon2 +1128T/C (rs16139) polymorphisms as well as IL1B promoter −511C/T (rs16944) polymorphism and to correlate IL1B transcript levels with vitiligo. Methods PCR-RFLP method was used to genotype NPY -399T/C SNP in 454 patients and 1226 controls; +1128T/C SNP in 575 patients and 1279 controls and IL1B −511C/T SNP in 448 patients and 785 controls from Gujarat. IL1B transcript levels in blood were also assessed in 105 controls and 95 patients using real-time PCR. Results Genotype and allele frequencies for NPY −399T/C, +1128T/C and IL1B −511C/T SNPs differed significantly (pvitiligo by 2.3 fold (pvitiligo (p = 0.015), also in female patients than male patients (p = 0.026). Genotype-phenotype correlation showed moderate association of IL1B -511C/T polymorphism with higher IL1B transcript levels. Trend analysis revealed significant difference between patients and controls for IL1B transcript levels with respect to different genotypes. Conclusion Our results suggest that NPY −399T/C, +1128T/C and IL1B −511C/T polymorphisms are associated with vitiligo and IL1B −511C/T SNP influences its transcript levels leading to increased risk for vitiligo in Gujarat population. Up-regulation of IL1B transcript in patients advocates its possible role in autoimmune pathogenesis of vitiligo. PMID:25221996
Directory of Open Access Journals (Sweden)
Jihee Kim
2017-12-01
Full Text Available Emerging studies have revealed the involvement of high-mobility group box 1 (HMGB1 in systemic fibrotic diseases, yet its role in the cutaneous scarring process has not yet been investigated. We hypothesized that HMGB1 may promote fibroblast activity to cause abnormal cutaneous scarring. In vitro wound healing assay with normal and keloid fibroblasts demonstrated that HMGB1 administration promoted the migration of both fibroblasts with increased speed and a greater traveling distance. Treatment of the HMGB1 inhibitor glycyrrhizic acid (GA showed an opposing effect on both activities. To analyze the downstream mechanism, the protein levels of extracellular signal-regulated kinase (ERK 1/2, protein kinase B (AKT, and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB were measured by western blot analysis. HMGB1 increased the expression levels of ERK1/2, AKT, and NF-κB compared to the control, which was suppressed by GA. HMGB1 promoted both normal and keloid fibroblasts migration to a degree equivalent to that achieved with TGF-β. We concluded that HMGB1 activates fibroblasts via the receptor for advanced glycation end product (RAGE—mitogen-activated protein kinases (MAPK and NF-κB interaction signaling pathways. Further knowledge of the relationship of HMGB1 with skin fibrosis may lead to a promising clinical approach to manage abnormal scarring.
Kim, Jihee; Park, Jong-Chul; Lee, Mi Hee; Yang, Chae Eun; Lee, Ju Hee; Lee, Won Jai
2017-12-28
Emerging studies have revealed the involvement of high-mobility group box 1 (HMGB1) in systemic fibrotic diseases, yet its role in the cutaneous scarring process has not yet been investigated. We hypothesized that HMGB1 may promote fibroblast activity to cause abnormal cutaneous scarring. In vitro wound healing assay with normal and keloid fibroblasts demonstrated that HMGB1 administration promoted the migration of both fibroblasts with increased speed and a greater traveling distance. Treatment of the HMGB1 inhibitor glycyrrhizic acid (GA) showed an opposing effect on both activities. To analyze the downstream mechanism, the protein levels of extracellular signal-regulated kinase (ERK) 1/2, protein kinase B (AKT), and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) were measured by western blot analysis. HMGB1 increased the expression levels of ERK1/2, AKT, and NF-κB compared to the control, which was suppressed by GA. HMGB1 promoted both normal and keloid fibroblasts migration to a degree equivalent to that achieved with TGF-β. We concluded that HMGB1 activates fibroblasts via the receptor for advanced glycation end product (RAGE)-mitogen-activated protein kinases (MAPK) and NF-κB interaction signaling pathways. Further knowledge of the relationship of HMGB1 with skin fibrosis may lead to a promising clinical approach to manage abnormal scarring.
The effect of standardized food intake on the association between BMI and 1H-NMR metabolites
Schutte, A.M.; Akker, van den Erik B.; Deelen, Joris; Rest, van de O.; Heemst, van D.; Feskens, E.J.M.; Beekman, M.; Slagboom, P.E.
2016-01-01
Multiple studies have shown that levels of 1H-NMR metabolites are associated with disease and risk factors of disease such as BMI. While most previous investigations have been performed in fasting samples, meta-analysis often includes both cohorts with fasting and non-fasting blood samples. In the
(E-1-(2-Bromophenyl-3-(2,5-dimethoxyphenylprop-2-en-1-one
Directory of Open Access Journals (Sweden)
Jerry P. Jasinski
2010-08-01
Full Text Available The title compound, C17H15BrO3, is a chalcone with the 2-bromophenyl and 2,5-dimethoxyphenyl rings bonded at opposite ends of a propene group. The dihedral angle between the mean planes of the ortho-bromo and ortho,meta-dimethoxy-substituted benzene rings is 77.3 (1°. The dihedral angles between the mean plane of the prop-2-ene-1-one group and the mean planes of the 2-bromophenyl and 2,5-dimethoxyphenyl rings are 58.6 (1 and 30.7 (4°, respectively. Weak C—H...O, C—H...Br and π–π stacking intermolecular interactions [centroid–centroid distance = 3.650 (2 Å] are present in the structure.
Cloning and tissue expression of cytochrome P450 1B1 and 1C1 ...
African Journals Online (AJOL)
Cytochrome P450 1 (CYP1) is widely used as an indicator of exposure to environmental contaminants. In the study, two full-length complementary DNAs encode for CYP1B1 and CYP1C1 were cloned from medaka liver exposed to 500 ppb β-naphthoflavone for 24 h. CYP1B1, having 1984 bp, contains an open reading ...
Plasma position from ring current measurements in Extrap T1
International Nuclear Information System (INIS)
Brunsell, P.; Jin Li.
1989-11-01
The inductive coupling between the plasma and the four octupole field coils in the Extrap T1 device is utilized as a means of estimating the plasma position. The current in each octupole ring as well as the plasma current is measured by a Rogowski coil and the ring - plasma mutual inductance is then computed assuming axisymmetric plasma displacements. The obtained position is in agreement with internal magnetic probe measurements. The time - evolution of the plasma position for different external vertical and toroidal field strengths is studied. For the present discharge parameter a vertical field of about .008 T is found to give an almost radially stationary plasma. The results are compared with a simple equilibrium model
Role of ring oxidation in the metabolic activation of 1-nitropyrene.
Beland, F A
1991-12-01
Nitrated polycyclic aromatic hydrocarbons are wide-spread environmental pollutants that have been detected in photocopier toners, airborne particulates, coal fly ash, and diesel engine exhaust emissions. 1-Nitropyrene, a representative nitropolycyclic aromatic hydrocarbon present in diesel particulates, is a mutagen in Salmonella typhimurium and a tumorigen in laboratory animals. The activation of 1-nitropyrene to a bacterial mutagen has been attributed to nitroreduction; however, the metabolic pathways involved in its metabolism to a tumorigen are not known, but may involve nitroreduction, ring oxidation, or a combination of the two. In these experiments, we examined the importance of ring oxidation in the activation of 1-nitropyrene (99.85 to 99.98 percent 1-nitropyrene, 0.15 to 0.02 percent 1,3-, 1,6-, and 1,8-dinitropyrene by mass spectral analyses) to a mammalian-cell mutagen and carcinogen. Chinese hamster ovary cells were used to assess the mutagenicity of ring-oxidized 1-nitropyrene metabolites. In the absence of a rat liver 9,000 x g supernatant, 6-hydroxy-1-nitropyrene, 1-nitropyrene-9,10-oxide, and pyrene-4,5-oxide were the most mutagenic compounds tested. 3-Hydroxy-1-nitropyrene, 8-hydroxy-1-nitropyrene, and 1-nitropyrene-4,5-oxide were weaker mutagens, whereas pyrene and 1-nitropyrene were essentially nonmutagenic. The order of mutagenic potency with S9 was: 1-nitropyrene-4,5-oxide greater than 6-hydroxy-1-nitropyrene approximately 1-nitropyrene-9,10-oxide greater than 1-nitropyrene approximately 3-hydroxy-1-nitropyrene approximately 8-hydroxy-1-nitropyrene greater than pyrene approximately pyrene-4,5-oxide, with the last two compounds being nearly nonmutagenic. The epoxide hydrase inhibitor 1,2-epoxy-3,3,3-trichloropropane increased the mutation frequency fivefold. In addition, guinea pig liver microsomes and Aroclor-induced rat liver microsomes, which increased the formation of 1-nitropyrene-4,5-oxide and 1-nitropyrene-9,10-oxide, increased the
Minimal generating sets of groups, rings, and fields | Halbeisen ...
African Journals Online (AJOL)
A subset X of a group (or a ring, or a field) is called generating, if the smallest subgroup (or subring, or subfield) containing X is the group (ring, field) itself. A generating set X is called minimal generating, if X does not properly contain any generating set. The existence and cardinalities of minimal generating sets of various ...
(E-1-Phenylethanone semicarbazone
Directory of Open Access Journals (Sweden)
Hoong-Kun Fun
2009-08-01
Full Text Available In the title compound, C9H11N3O, the benzene ring is disordered over two positions with refined occupancies of 0.922 (5 and 0.078 (5. The program PLATON [Spek (2009. Acta Cryst. D65, 148–155] recommends the solution in the space group C2/m with a = 7.3050 (3, b = 6.6745 (2, c = 18.3853 (6 Å and β = 96.986 (2°. However, the large number of non-extinct reflections needed to be ignored if C2/m is chosen suggested that the space group is incorrect, even though the R values are lower than that for P21/c. The semicarbazone group is essentially planar, with a maximum deviation of 0.046 (1 Å for one of the N atoms. The mean plane of the semicarbazone group forms dihedral angles of 33.61 (8 and 39.1 (9° with the benzene ring of the major and minor components, respectively. In the crystal structure, molecules are linked by intermolecular N—H...O hydrogen bonds into extended chains along the c axis. The crystal structure is further stabilized by weak intermolucular C—H...π interactions.
Directory of Open Access Journals (Sweden)
Chia-I Ko
2014-01-01
Full Text Available The aryl hydrocarbon receptor (AHR is a transcription factor and environmental sensor that regulates expression of genes involved in drug-metabolism and cell cycle regulation. Chromatin immunoprecipitation analyses, Ahr ablation in mice and studies with orthologous genes in invertebrates suggest that AHR may also play a significant role in embryonic development. To address this hypothesis, we studied the regulation of Ahr expression in mouse embryonic stem cells and their differentiated progeny. In ES cells, interactions between OCT3/4, NANOG, SOX2 and Polycomb Group proteins at the Ahr promoter repress AHR expression, which can also be repressed by ectopic expression of reprogramming factors in hepatoma cells. In ES cells, unproductive RNA polymerase II binds at the Ahr transcription start site and drives the synthesis of short abortive transcripts. Activation of Ahr expression during differentiation follows from reversal of repressive marks in Ahr promoter chromatin, release of pluripotency factors and PcG proteins, binding of Sp factors, establishment of histone marks of open chromatin, and engagement of active RNAPII to drive full-length RNA transcript elongation. Our results suggest that reversible Ahr repression in ES cells holds the gene poised for expression and allows for a quick switch to activation during embryonic development.
Association of IL1A and IL1B loci with primary open angle glaucoma
Directory of Open Access Journals (Sweden)
Mukhopadhyay Indranil
2010-06-01
Full Text Available Abstract Background Recent studies suggest that glaucoma is a neurodegenerative disease in which secondary degenerative losses occur after primary insult by raised Intraocular pressure (IOP or by other associated factors. It has been reported that polymorphisms in the IL1A and IL1B genes are associated with Primary Open Angle Glaucoma (POAG. The purpose of our study was to investigate the role of these polymorphisms in eastern Indian POAG patients. Methods The study involved 315 unrelated POAG patients, consisting of 116 High Tension Glaucoma (HTG patients with intra ocular pressure (IOP > 21 mmHg and 199 non-HTG patients (presenting IOP IL1A (-889C/T; rs1800587, IL1B (-511C/T; rs16944 and IL1B (3953C/T; rs1143634. Haplotype frequency was determined by Haploview 4.1 software. The association of individual SNPs and major haplotypes was evaluated using chi-square statistics. The p-value was corrected for multiple tests by Bonferroni method. Results No significant difference was observed in the allele and genotype frequencies for IL1A and IL1B SNPs between total pool of POAG patients and controls. However, on segregating the patient pool to HTG and non-HTG groups, weak association was observed for IL1A polymorphism (-889C/T where -889C allele was found to portray risk (OR = 1.380; 95% CI = 1.041-1.830; p = 0.025 for non-HTG patients. Similarly, 3953T allele of IL1B polymorphism (+3953C/T was observed to confer risk to HTG group (OR = 1.561; 95% CI = 1.022-2.385; p = 0.039. On haplotype analysis it was observed that TTC was significantly underrepresented in non-HTG patients (OR = 0.538; 95% CI = 0.356- 0.815; p = 0.003 while TCT haplotype was overrepresented in HTG patients (OR = 1.784; 95% CI = 1.084- 2.937; p = 0.022 compared to control pool. However, after correction for multiple tests by Bonferroni method, an association of only TTC haplotype with non-HTG cases sustained (pcorrected = 0.015 and expected to confer protection. Conclusion The study
Directory of Open Access Journals (Sweden)
Nisar Ullah
2014-02-01
Full Text Available In the asymmetric unit of the title compound, C27H27FN2O·0.25CHCl3, there are two independent molecules (A and B together with a partially disordered chloroform molecule situated about an inversion center. The conformation of the two molecules is very similar. The bridging piperidine rings each have a chair conformation while the piperidin-2-one rings of the quinoline moiety have screw-boat conformations. The benzene rings of the biphenyl moiety are inclined to one another by 26.37 (4 and 23.75 (15° in molecules A and B, respectively. The mean plane of the central piperidine ring [r.m.s. deviation = 0.241 (2 Å in both molecules A and B] is inclined to the benzene ring of the quinoline moiety by 80.06 (4 in A and 83.75 (15° in B, while it is inclined to the adjacent benzene ring of the biphenyl group by 73.623 (15 in A and 75.65 (14° in B. In the crystal, individual molecules are linked by pairs of N—H...O hydrogen bonds, forming A–A and B–B inversion dimers with R22(8 ring motifs. The dimers are stabilized by C—H...O hydrogen bonds and linked via C—H...F and C—H...N hydrogen bonds into a three-dimensional network. Several C—H...π interactions are also present.
International Nuclear Information System (INIS)
Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan
2016-01-01
Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.
Energy Technology Data Exchange (ETDEWEB)
Lu, Lu; Xu, Hui; Luo, Fei; Liu, Xinlu; Lu, Xiaolin; Yang, Qianlei; Xue, Junchao; Chen, Chao; Shi, Le; Liu, Qizhan, E-mail: drqzliu@hotmail.com
2016-08-01
Cigarette smoking is the strongest risk factor for the development of lung cancer, the leading cause of cancer-related deaths. However, the molecular mechanisms leading to lung cancer are largely unknown. A long-noncoding RNA (lncRNA), CCAT1, regarded as cancer-associated, has been investigated extensively. Moreover, the molecular mechanisms of lncRNAs in regulation of microRNAs (miRNAs) induced by cigarette smoke remain unclear. In the present investigation, cigarette smoke extract (CSE) caused an altered cell cycle and increased CCAT1 levels and decreased miR-218 levels in human bronchial epithelial (HBE) cells. Depletion of CCAT1 attenuated the CSE-induced decreases of miR-218 levels, suggesting that miR-218 is negatively regulated by CCAT1 in HBE cells exposed to CSE. The CSE-induced increases of BMI1 levels and blocked by CCAT1 siRNA were attenuated by an miR-218 inhibitor. Moreover, in CSE-transformed HBE cells, the CSE-induced cell cycle changes and elevated neoplastic capacity were reversed by CCAT1 siRNA or BMI1 siRNA. This epigenetic silencing of miR-218 by CCAT1 induces an altered cell cycle transition through BMI1 and provides a new mechanism for CSE-induced lung carcinogenesis. - Highlights: • CSE exposure induces increases of CCAT1 levels and decreases of miR-218 levels. • CCAT1 negatively regulates miR-218 expression. • CCAT1, regulated by miR-218, via BMI1, is involved in the CSE-induced altered cell cycle transition.
Directory of Open Access Journals (Sweden)
Naresh C Laddha
Full Text Available BACKGROUND: Vitiligo is a depigmenting disorder resulting from loss of functional melanocytes in the skin. NPY plays an important role in induction of immune response by acting on a variety of immune cells. NPY synthesis and release is governed by IL1B. Moreover, genetic variability in IL1B is reported to be associated with elevated NPY levels. OBJECTIVES: Aim of the present study was to explore NPY promoter -399T/C (rs16147 and exon2 +1128T/C (rs16139 polymorphisms as well as IL1B promoter -511C/T (rs16944 polymorphism and to correlate IL1B transcript levels with vitiligo. METHODS: PCR-RFLP method was used to genotype NPY -399T/C SNP in 454 patients and 1226 controls; +1128T/C SNP in 575 patients and 1279 controls and IL1B -511C/T SNP in 448 patients and 785 controls from Gujarat. IL1B transcript levels in blood were also assessed in 105 controls and 95 patients using real-time PCR. RESULTS: Genotype and allele frequencies for NPY -399T/C, +1128T/C and IL1B -511C/T SNPs differed significantly (p<0.0001, p<0.0001; p = 0.0161, p = 0.0035 and p<0.0001, p<0.0001 between patients and controls. 'TC' haplotype containing minor alleles of NPY polymorphisms was significantly higher in patients and increased the risk of vitiligo by 2.3 fold (p<0.0001. Transcript levels of IL1B were significantly higher, in patients compared to controls (p = 0.0029, in patients with active than stable vitiligo (p = 0.015, also in female patients than male patients (p = 0.026. Genotype-phenotype correlation showed moderate association of IL1B -511C/T polymorphism with higher IL1B transcript levels. Trend analysis revealed significant difference between patients and controls for IL1B transcript levels with respect to different genotypes. CONCLUSION: Our results suggest that NPY -399T/C, +1128T/C and IL1B -511C/T polymorphisms are associated with vitiligo and IL1B -511C/T SNP influences its transcript levels leading to increased risk for vitiligo in
Impact of Body Mass Index on Immunogenicity of Pandemic H1N1 Vaccine in Children and Adults
Callahan, S. Todd; Wolff, Mark; Hill, Heather R.; Edwards, Kathryn M.; Keitel, Wendy; Atmar, Robert; Patel, Shital; Sahly, Hana El; Munoz, Flor; Paul Glezen, W.; Brady, Rebecca; Frenck, Robert; Bernstein, David; Harrison, Christopher; Jackson, Mary Anne; Swanson, Douglas; Newland, Jason; Myers, Angela; Livingston, Robyn A; Walter, Emmanuel; Dolor, Rowena; Schmader, Kenneth; Mulligan, Mark J.; Edupuganti, Srilatha; Rouphael, Nadine; Whitaker, Jennifer; Spearman, Paul; Keyserling, Harry; Shane, Andi; Eckard, Allison Ross; Jackson, Lisa A.; Frey, Sharon E.; Belshe, Robert B.; Graham, Irene; Anderson, Edwin; Englund, Janet A.; Healy, Sara; Winokur, Patricia; Stapleton, Jack; Meier, Jeffrey; Kotloff, Karen; Chen, Wilbur; Hutter, Julia; Stephens, Ina; Wooten, Susan; Wald, Anna; Johnston, Christine; Edwards, Kathryn M.; Buddy Creech, C.; Todd Callahan, S.
2014-01-01
Obesity emerged as a risk factor for morbidity and mortality related to 2009 pandemic influenza A (H1N1) infection. However, few studies examine the immune responses to H1N1 vaccine among children and adults of various body mass indices (BMI). Pooling data from 3 trials of unadjuvanted split-virus H1N1 A/California/07/2009 influenza vaccines, we analyzed serologic responses of participants stratified by BMI grouping. A single vaccine dose produced higher hemagglutination inhibition antibody titers at day 21 in obese compared to nonobese adults, but there were no significant differences in responses to H1N1 vaccine among children or adults of various BMI following 2 doses. PMID:24795475
Benzene-1,2-dicarboxylic acid–pyridinium-2-olate (1/1
Directory of Open Access Journals (Sweden)
Chua-Hua Yu
2012-07-01
Full Text Available The asymmetric unit of the title compound, C5H5NO·C8H6O4, contains one o-phthalate acid molecule and one pyridin-2-ol molecule, which exists in a zwitterionic form. In the o-phthalate acid molecule, the carboxylate groups are twisted from the benzene ring by dihedral angles of 13.6 (1° and 73.1 (1°; the hydroxy H atom in the latter group is disordered over two positons in a 1:1 ratio. In the crystal, O—H...O and N—H...O hydrogen bonds link the molecules into zigzag chains in [-101].
Directory of Open Access Journals (Sweden)
Sha Si
Full Text Available Polycomb-group RING finger proteins (Pcgf1-Pcgf6 are components of Polycomb repressive complex 1 (PRC1-related complexes that catalyze monoubiquitination of histone H2A at lysine 119 (H2AK119ub1, an epigenetic mark associated with repression of genes. Pcgf5 has been characterized as a component of PRC1.5, one of the non-canonical PRC1, consisting of Ring1a/b, Rybp/Yaf2 and Auts2. However, the biological functions of Pcgf5 have not yet been identified. Here we analyzed the impact of the deletion of Pcgf5 specifically in hematopoietic stem and progenitor cells (HSPCs. Pcgf5 is expressed preferentially in hematopoietic stem cells (HSCs and multipotent progenitors (MPPs compared with committed myeloid progenitors and differentiated cells. We transplanted bone marrow (BM cells from Rosa::Cre-ERT control and Cre-ERT;Pcgf5fl/fl mice into lethally irradiated recipient mice. At 4 weeks post-transplantation, we deleted Pcgf5 by injecting tamoxifen, however, no obvious changes in hematopoiesis were detected including the number of HSPCs during a long-term observation period following the deletion. Competitive BM repopulating assays revealed normal repopulating capacity of Pcgf5-deficient HSCs. Nevertheless, Pcgf5-deficient HSPCs showed a significant reduction in H2AK119ub1 levels compared with the control. ChIP-sequence analysis confirmed the reduction in H2AK119ub1 levels, but revealed no significant association of changes in H2AK119ub1 levels with gene expression levels. Our findings demonstrate that Pcgf5-containing PRC1 functions as a histone modifier in vivo, but its role in HSPCs is limited and can be compensated by other PRC1-related complexes in HSPCs.
Aflatoxin B1 and M1: Biological Properties and Their Involvement in Cancer Development
Directory of Open Access Journals (Sweden)
Silvia Marchese
2018-05-01
Full Text Available Aflatoxins are fungal metabolites found in feeds and foods. When the ruminants eat feedstuffs containing Aflatoxin B1 (AFB1, this toxin is metabolized and Aflatoxin M1 (AFM1 is excreted in milk. International Agency for Research on Cancer (IARC classified AFB1 and AFM1 as human carcinogens belonging to Group 1 and Group 2B, respectively, with the formation of DNA adducts. In the last years, some epidemiological studies were conducted on cancer patients aimed to evaluate the effects of AFB1 and AFM1 exposure on cancer cells in order to verify the correlation between toxin exposure and cancer cell proliferation and invasion. In this review, we summarize the activation pathways of AFB1 and AFM1 and the data already reported in literature about their correlation with cancer development and progression. Moreover, considering that few data are still reported about what genes/proteins/miRNAs can be used as damage markers due to AFB1 and AFM1 exposure, we performed a bioinformatic analysis based on interaction network and miRNA predictions to identify a panel of genes/proteins/miRNAs that can be used as targets in further studies for evaluating the effects of the damages induced by AFB1 and AFM1 and their capacity to induce cancer initiation.
Directory of Open Access Journals (Sweden)
Hanan Salah
2017-05-01
Full Text Available Condensation of 4-phenyl-1H-[1,5]benzodiazepin-2(3H-one (1 with 3-formylchromone (2 afforded a mixture of 3-(chromenylmethylene[1,5]benzodiazepinone 3 and 14-chromenylbenzodiazepino[2,3:6,5]pyrano[2,3-b]benzodiazepine 4. Ring rearrangements of compound 3 with different nucleophilic reagents, such as potassium hydroxide and/or ammonium acetate led to rearrangement into pyranobenzodiazepine 5 and pyridobenzodiazepine 6, respectively. Treatment of compound 3 with hydrazine hydrate, hydroxylamine hydrochloride, malononitrile, cyanothioacetamide, 2-cyano-3,3-disufanylacrylonitrile, and/or 2-cyano-3-phenylamino-3-sufanylacrylonitrile, has been carried out at different conditions, leading to versatile heterocyclic substituted benzodiazepines at position 3, viz. pyrazole 8, isoxazole 9, pyridines 10 and 11, 1,3-dithiine 12, and 1,3-thiazine 13 derivatives.
Aaij, Roel; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreassen, Rolf; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Belogurov, Sergey; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Bird, Thomas; Bizzeti, Andrea; Bjørnstad, Pål Marius; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borgia, Alessandra; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Brambach, Tobias; van den Brand, Johannes; Bressieux, Joël; Brett, David; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Brown, Henry; Bursche, Albert; Busetto, Giovanni; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Ciba, Krzystof; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cojocariu, Lucian; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Counts, Ian; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dalseno, Jeremy; David, Pascal; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Silva, Weeraddana; De Simone, Patrizia; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Di Canto, Angelo; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garofoli, Justin; Garra Tico, Jordi; Garrido, Lluis; Gaspar, Clara; Gauld, Rhorry; Gavardi, Laura; Gavrilov, Gennadii; Geraci, Angelo; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Gianì, Sebastiana; Gibson, Valerie; Giubega, Lavinia-Helena; Gligorov, V.V.; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graziani, Giacomo; Grecu, Alexandru; Greening, Edward; Gregson, Sam; Griffith, Peter; Grillo, Lucia; Grünberg, Oliver; Gui, Bin; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Hampson, Thomas; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; He, Jibo; Head, Timothy; Heijne, Veerle; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hoballah, Mostafa; Hombach, Christoph; Hulsbergen, Wouter; Hunt, Philip; Hussain, Nazim; Hutchcroft, David; Hynds, Daniel; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jaton, Pierre; Jawahery, Abolhassan; Jing, Fanfan; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Karbach, Moritz; Karodia, Sarah; Kelsey, Matthew; Kenyon, Ian; Ketel, Tjeerd; Khanji, Basem; Khurewathanakul, Chitsanu; Klaver, Suzanne; Klimaszewski, Konrad; Kochebina, Olga; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Korolev, Mikhail; Kozlinskiy, Alexandr; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krocker, Georg; Krokovny, Pavel; Kruse, Florian; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kurek, Krzysztof; Kvaratskheliya, Tengiz; La Thi, Viet Nga; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lambert, Robert W; Lanfranchi, Gaia; Langenbruch, Christoph; Langhans, Benedikt; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Lefèvre, Regis; Leflat, Alexander; Lefrançois, Jacques; Leo, Sabato; Leroy, Olivier; Lesiak, Tadeusz; Lespinasse, Mickael; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Liles, Myfanwy; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Lohn, Stefan; Longstaff, Iain; Lopes, Jose; Lopez-March, Neus; Lowdon, Peter; Lu, Haiting; Lucchesi, Donatella; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Machefert, Frederic; Machikhiliyan, Irina V; Maciuc, Florin; Maev, Oleg; Malde, Sneha; Malinin, Alexander; Manca, Giulia; Mancinelli, Giampiero; Mapelli, Alessandro; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Märki, Raphael; Marks, Jörg; Martellotti, Giuseppe; Martens, Aurelien; Martín Sánchez, Alexandra; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massafferri, André; Matev, Rosen; Mathe, Zoltan; Matteuzzi, Clara; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; McSkelly, Ben; Meadows, Brian; Meier, Frank; Meissner, Marco; Merk, Marcel; Milanes, Diego Alejandro; Minard, Marie-Noelle; Moggi, Niccolò; Molina Rodriguez, Josue; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Müller, Katharina; Mussini, Manuel; Muster, Bastien; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi-Dung; Nguyen-Mau, Chung; Nicol, Michelle; Niess, Valentin; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Oggero, Serena; Ogilvy, Stephen; Okhrimenko, Oleksandr; Oldeman, Rudolf; Onderwater, Gerco; Orlandea, Marius; Otalora Goicochea, Juan Martin; Owen, Patrick; Oyanguren, Maria Arantza; Pal, Bilas Kanti; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parkes, Christopher; Parkinson, Christopher John; Passaleva, Giovanni; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Perrin-Terrin, Mathieu; Pescatore, Luca; Pesen, Erhan; Petridis, Konstantin; Petrolini, Alessandro; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pilař, Tomas; Pinci, Davide; Pistone, Alessandro; Playfer, Stephen; Plo Casasus, Maximo; Polci, Francesco; Poluektov, Anton; Polycarpo, Erica; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Potterat, Cédric; Price, Eugenia; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Rachwal, Bartolomiej; Rademacker, Jonas; Rakotomiaramanana, Barinjaka; Rama, Matteo; Rangel, Murilo; Raniuk, Iurii; Rauschmayr, Nathalie; Raven, Gerhard; Reichert, Stefanie; Reid, Matthew; dos Reis, Alberto; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vincente; Roa Romero, Diego; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Perez, Pablo; Roiser, Stefan; Romanovsky, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rouvinet, Julien; Ruf, Thomas; Ruiz, Hugo; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sagidova, Naylya; Sail, Paul; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sepp, Indrek; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Silva Coutinho, Rafael; Simi, Gabriele; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Anthony; Smith, Edmund; Smith, Eluned; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Soomro, Fatima; Souza, Daniel; Souza De Paula, Bruno; Spaan, Bernhard; Sparkes, Ailsa; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Steinkamp, Olaf; Stenyakin, Oleg; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Stroili, Roberto; Subbiah, Vijay Kartik; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Swientek, Stefan; Syropoulos, Vasileios; Szczekowski, Marek; Szczypka, Paul; Szumlak, Tomasz; T'Jampens, Stephane; Teklishyn, Maksym; Tellarini, Giulia; Teubert, Frederic; Thomas, Christopher; Thomas, Eric; van Tilburg, Jeroen; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Torr, Nicholas; Tournefier, Edwige; Tourneur, Stephane; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tuning, Niels; Ubeda Garcia, Mario; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vagnoni, Vincenzo; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vázquez Sierra, Carlos; Vecchi, Stefania; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Vollhardt, Achim; Volyanskyy, Dmytro; Voong, David; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wandernoth, Sebastian; Wang, Jianchun; Ward, David; Watson, Nigel; Websdale, David; Whitehead, Mark; Wicht, Jean; Wiedner, Dirk; Wilkinson, Guy; Williams, Matthew; Williams, Mike; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wright, Simon; Wu, Suzhi; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yuan, Xuhao; Yushchenko, Oleg; Zangoli, Maria; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Wen Chao; Zhang, Yanxi; Zhelezov, Alexey; Zhokhov, Anatoly; Zhong, Liang; Zvyagin, Alexander
2014-10-14
The production of $\\chi_b$ mesons in proton-proton collisions is studied using a data sample collected by the LHCb detector, at centre-of-mass energies of $\\sqrt{s}=7$ and $8$ TeV and corresponding to an integrated luminosity of 3.0 fb$^{-1}$. The $\\chi_b$ mesons are identified through their decays to $\\Upsilon(1S)\\gamma$ and $\\Upsilon(2S)\\gamma$ using photons that converted to $e^+e^-$ pairs in the detector. The $\\chi_b(3P)$ meson mass, and the relative prompt production rate of $\\chi_{b1}(1P)$ and $\\chi_{b2}(1P)$ mesons as a function of the $\\Upsilon(1S)$ transverse momentum in the $\\chi_b$ rapidity range 2.0< $y$<4.5, are measured. Assuming a mass splitting between the $\\chi_{b1}(3P)$ and the $\\chi_{b2}(3P)$ states of 10.5 MeV/$c^2$, the mass of the $\\chi_{b1}(3P)$ meson is \\begin{equation*} m(\\chi_{b1}(3P))= 10515.7^{+2.2}_{-3.9}(stat) ^{+1.5}_{-2.1}(syst) MeV/c^2. \\end{equation*}
1-Cyclohexyl-6,7-dimethoxy-1,4-dihydronaphthalene
Directory of Open Access Journals (Sweden)
Shao-Yuan Chen
2014-06-01
Full Text Available The title compound, C18H24O2, was isolated from the leaves extract of Ficus carica L. The cyclohexane ring displays a chair conformation whereas the cyclohexa-1,4-diene ring adopts a flattened boat conformation with methyl C atoms at the prow and stern. In the crystal, molecules are linked by weak C—H...O hydrogen bonds into supramolecular chains propagated along the b-axis direction.
3-Benzyl-4-ethyl-1H-1,2,4-triazole-5(4H)-thione.
Karczmarzyk, Zbigniew; Pitucha, Monika; Wysocki, Waldemar; Pachuta-Stec, Anna; Stańczuk, Andrzej
2013-02-01
The title compound, C(11)H(13)N(3)S, exists in the 5-thioxo tautomeric form. The benzene ring exhibits disorder with a refined ratio of 0.77 (2):0.23 (2) for components A and B with a common bridgehead C atom. The 1,2,4-triazole ring is essentially planar, with a maximum deviation of 0.002 (3) Å for the benzyl-substituted C atom, and forms dihedral angles of 88.94 (18) and 86.56 (49)° with the benzene rings of components A and B, respectively. The angle between the plane of the ethyl chain and the mean plane of 1,2,4-triazole ring is 88.55 (15)° and this conformation is stabilized by an intra-molecular C-H⋯S contact. In the crystal, pairs of N-H⋯S hydrogen bonds link mol-ecules into inversion dimers. π-π inter-actions are observed between the triazole and benzene rings, with centroid-centroid separations of 3.547 (4) and 3.544 (12) Å for components A and B, and slippages of 0.49 (6) and 0.58 (15) Å, respectively.
Directory of Open Access Journals (Sweden)
Vincent van den Boom
2016-01-01
Full Text Available Polycomb proteins are classical regulators of stem cell self-renewal and cell lineage commitment and are frequently deregulated in cancer. Here, we find that the non-canonical PRC1.1 complex, as identified by mass-spectrometry-based proteomics, is critically important for human leukemic stem cells. Downmodulation of PRC1.1 complex members, like the DNA-binding subunit KDM2B, strongly reduces cell proliferation in vitro and delays or even abrogates leukemogenesis in vivo in humanized xenograft models. PRC1.1 components are significantly overexpressed in primary AML CD34+ cells. Besides a set of genes that is targeted by PRC1 and PRC2, ChIP-seq studies show that PRC1.1 also binds a distinct set of genes that are devoid of H3K27me3, suggesting a gene-regulatory role independent of PRC2. This set encompasses genes involved in metabolism, which have transcriptionally active chromatin profiles. These data indicate that PRC1.1 controls specific genes involved in unique cell biological processes required for leukemic cell viability.
RSCAT_LEVEL_2B_OWV_COMP_12_V1.1:1
National Aeronautics and Space Administration — This dataset contains the RapidScat Level 2B 12.5km Version 1.1 science-quality ocean surface wind vectors. The Level 2B wind vectors are binned on a 12.5 km Wind...
Directory of Open Access Journals (Sweden)
Hoggard N
2012-05-01
Full Text Available Nigel Hoggard1, Abdelali Agouni2, Nimesh Mody2, Mirela Delibegovic21Rowett Institute of Nutrition and Health, 2Integrative Physiology, University of Aberdeen, Aberdeen, UKBackground: Retinol-binding protein 4 (RBP4 is an adipokine identified as a marker of insulin resistance in mice and humans. Protein tyrosine phosphatase 1B (PTP1B expression levels as well as other genes involved in the endoplasmic reticulum (ER stress response are increased in adipose tissue of obese, high-fat-diet-fed mice. In this study we investigated if serum and/or adipose tissue RBP4 protein levels and expression levels of PTP1B and other ER stress-response genes are altered in obese and obese/diabetic men resident in northeast Scotland.Methods: We studied three groups of male volunteers: (1 normal/overweight (body mass index [BMI] < 30, (2 obese (BMI > 30, and (3 obese/diabetic (BMI > 30 controlling their diabetes either by diet or the antidiabetic drug metformin. We analyzed their serum and adipose tissue RBP4 protein levels as well as adipose tissue mRNA expression of PTP1B, binding immunoglobulin protein (BIP, activated transcription factor 4 (ATF4, and glucose-regulated protein 94 (GRP94 alongside other markers of adiposity (percentage body fat, leptin, cholesterol, triglycerides and insulin resistance (oral glucose tolerance tests, insulin, homeostatic model assessment–insulin resistance, C-reactive protein, and adiponectin.Results: We found that obese Scottish subjects had significantly higher serum RBP4 protein levels in comparison to the normal/overweight subjects (P < 0.01. Serum RBP4 levels were normalized in obese/diabetic subjects treated with diet or metformin (P < 0.05. Adipose tissue RBP4 protein levels were comparable between all three groups of subjects as were serum and adipose transthyretin levels. Adipose tissue PTP1B mRNA levels were increased in obese subjects in comparison to normal/overweight subjects (P < 0.05; however diet and/or metformin
International Nuclear Information System (INIS)
Wierzbicka-Wieczorek, Maria; Goeckeritz, Martin; Kolitsch, Uwe; Lenz, Christoph; Giester, Gerald
2015-01-01
The silicate Cs 1.86 K 1.14 DySi 6 O 15 represents a mixed tetrahedral-octahedral framework structure type based on roughly circular Si 6 O 15 rings and isolated DyO 6 octahedra. The silicate Cs 1.6 K 1.4 SmSi 6 O 15 has a layered atomic arrangement built from corrugated Si 6 O 15 layers containing four-, six- and eight-membered rings. The layers are connected by isolated SmO 6 octahedra to form a mixed tetrahedral-octahedral framework. This structure shows a close structural relationship to β-K 3 NdSi 6 O 15 and a less close one to dehydrated elpidite (Na 2 ZrSi 6 O 15 ). In both structures, Cs/K atoms occupy large voids. The silicates were obtained through high-temperature flux syntheses. Their crystal structures have been determined from single-crystal X-ray diffraction data. Cs 1.86 K 1.14 DySi 6 O 15 crystallises in R32 (no. 155) with a = 13.896(2), c = 35.623(7) Aa and V = 5957.2(17) Aa 3 , whereas Cs 1.6 K 1.4 SmSi 6 O 15 crystallises in Cmca (no. 64) with a = 14.474(3), b = 14.718(3), c = 15.231(3) Aa and V = 3244.7(11) Aa 3 . The Dy 3+ and Sm 3+ cations present in the silicates cause PL emission bands in the visible yellow-to-orange spectral range. (Copyright copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Dopamine genes (DRD2/ANKK1-TaqA1 and DRD4-7R and executive function: their interaction with obesity.
Directory of Open Access Journals (Sweden)
Mar Ariza
Full Text Available Obesity is a multifactorial disease caused by the interaction between genotype and environment, and it is considered to be a type of addictive alteration. The A1 allele of the DRD2/ANKK1-TaqIA gene has been associated with addictive disorders, with obesity and with the performance in executive functions. The 7 repeat allele of the DRD4 gene has likewise been associated with the performance in executive functions, as well as with addictive behaviors and impulsivity. Participants were included in the obesity group (N = 42 if their body mass index (BMI was equal to or above 30, and in the lean group (N = 42 if their BMI was below 25. The DRD2/ANKK1-TaqIA and DRD4 VNTR polymorphisms were obtained. All subjects underwent neuropsychological assessment. Eating behavior traits were evaluated. The 'DRD2/ANKK1-TaqIA A1-allele status' had a significant effect on almost all the executive variables, but no significant 'DRD4 7R-allele status' effects were observed for any of the executive variables analyzed. There was a significant 'group' x 'DRD2/ANKK1-TaqIA A1-allele status' interaction effect on LN and 'group' x 'DRD4 7R-allele status' interaction effect on TMT B-A score. Being obese and a carrier of the A1 allele of DRD2/ANKK1-TaqIA or the 7R allele of DRD4 VNTR polymorphisms could confer a weakness as regards the performance of executive functions.
26 CFR 1.1402(b)-1 - Self-employment income.
2010-04-01
... 26 Internal Revenue 12 2010-04-01 2010-04-01 false Self-employment income. 1.1402(b)-1 Section 1... (CONTINUED) INCOME TAXES Tax on Self-Employment Income § 1.1402(b)-1 Self-employment income. (a) In general... this section, the term “self-employment income” means the net earnings from self-employment derived by...
Bis[(1-methyl-1H-tetrazol-5-ylsulfanyl]methane
Directory of Open Access Journals (Sweden)
Wei Wei
2011-04-01
Full Text Available The molecule of the title compound, C5H8N8S2, lies on a twofold rotation axis that relates on 1-methyltetrazolyl group to the other; the five-membered rings are twisted by 53.1 (1°.
Ruddraraju, Kasi Viswanatharaju; Hillebrand, Roman; Barnes, Charles L; Gates, Kent S
2015-04-01
The title compound, C24H32N4O8S, (I), crystallizes as a zwitterion. The terminal amine N atom of the [(2-{2-[2-(2-ammonio-eth-oxy)eth-oxy]eth-oxy}eth-yl)carbamo-yl] side chain is protonated, while the 1,2,5-thia-diazo-lidin-3-one 1,1-dioxide N atom is deprotonated. The side chain is turned over on itself with an intra-molecular N-H⋯O hydrogen bond. The 1,2,5-thia-diazo-lidin-3-one 1,1-dioxide ring has an envelope conformation with the aryl-substituted N atom as the flap. Its mean plane is inclined by 62.87 (8)° to the aryl ring to which it is attached, while the aryl rings of the biphenyl unit are inclined to one another by 20.81 (8)°. In the crystal, mol-ecules are linked by N-H⋯O and N-H⋯N hydrogen bonds, forming slabs lying parallel to (010). Within the slabs there are C-H⋯O and C-H⋯N hydrogen bonds and C-H⋯π inter-actions present.
Low 5-HT1B receptor binding in the migraine brain
DEFF Research Database (Denmark)
Deen, Marie; Hansen, Hanne D; Hougaard, Anders
2018-01-01
Background The pathophysiology of migraine may involve dysfunction of serotonergic signaling. In particular, the 5-HT1B receptor is considered a key player due to the efficacy of 5-HT1B receptor agonists for treatment of migraine attacks. Aim To examine the cerebral 5-HT1B receptor binding....... Patients who reported migraine brain regions involved in pain modulation as regions of interest and applied a latent variable model (LVM) to assess the group effect on binding across these regions. Results Our data...... support a model wherein group status predicts the latent variable ( p = 0.038), with migraine patients having lower 5-HT1B receptor binding across regions compared to controls. Further, in a whole-brain voxel-based analysis, time since last migraine attack correlated positively with 5-HT1B receptor...
Keskin, Mehmet Zeynel; Budak, Salih; Aksoy, Evrim Emre; Yücel, Cem; Karamazak, Serkan; Ilbey, Yusuf Ozlem; Kozacıoğlu, Zafer
2017-10-03
To evaluate the effects of body mass index (BMI) ratio on semen parameters and serum reproductive hormones. The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC), normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165), Group 2 (n = 222) and Group 3 (n = 56). There was no statistically significant difference in terms of all variables between the groups. We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.
Kalliokoski, A; Backman, J T; Kurkinen, K J; Neuvonen, P J; Niemi, M
2008-10-01
In a randomized crossover study, 24 SLCO181-genotyped healthy volunteers were given daily doses of 1,200 mg gemfibrozil, 40 mg atorvastatin, or placebo, followed by 0.25 mg of repaglinide on day 3. The mean increase in the repaglinide area under the plasma concentration-time curve from 0 h to infinity (AUC(0-infinity)) produced by gemfibrozil was larger in individuals with the SLCO1B1 c.521CC genotype (n = 6) than in those with the c.521TC (n = 6) and c.521TT (n = 12) genotypes, by factors of 1.56 (P = 0.004) and 1.54 (P = 0.002), respectively. Gemfibrozil prolonged the repaglinide elimination half-life 1.43 times more in the c.521 CC group than in the c.521TT group (P = 0.047), but no differences were seen in the effects on peak plasma concentration (C(max)). While on gemfibrozil, the minimum blood glucose concentration after repaglinide intake was 19% lower in the c.521CC participants than in the c.521TT participants (P = 0.009). In the c.521TT group, atorvastatin intake had the effect of increasing repaglinide Cmax and AUC(0-infinity) by41% (P = 0.001) and 18% (P = 0.033), respectively. In conclusion, the extent of gemfibrozil-repaglinide interaction depends on SLCO1B1 genotype. Atorvastatin raises plasma repaglinide concentrations, probably by inhibiting organic anion transporting polypeptide 1B1 (OATP1B1).
CLONING AND CHARACTERIZATION OF THE PHTHALATE CATABOLISM REGION OF PRE1 OF ARTHROBACTER KEYSERI 12B
o-Phthalate (benzene-1,2-dicarboxylate) is a central intermediate in the bacterial degradation of phthalate ester plasticizers as well as of a number of fused-ring polycyclic aromatic hydrocarbons found in fossil fuels. In Arthrobacter keyseri 12B, the genes encoding catabolism o...
Jumonji/Arid1b (Jarid1b) protein modulates human esophageal cancer cell growth
KANO, YOSHIHIRO; KONNO, MASAMITSU; OHTA, KATSUYA; HARAGUCHI, NAOTSUGU; NISHIKAWA, SHIMPEI; KAGAWA, YOSHINORI; HAMABE, ATSUSHI; HASEGAWA, SHINICHIRO; OGAWA, HISATAKA; FUKUSUMI, TAKAHITO; NOGUCHI, YUKO; OZAKI, MIYUKI; KUDO, TOSHIHIRO; SAKAI, DAISUKE; SATOH, TAROH; ISHII, MASARU; MIZOHATA, EIICHI; INOUE, TAKESHI; MORI, MASAKI; DOKI, YUICHIRO; ISHII, HIDESHI
2013-01-01
Although esophageal cancer is highly heterogeneous and the involvement of epigenetic regulation of cancer stem cells is highly suspected, the biological significance of epigenetically modified molecules that regulate different subpopulations remains to be firmly established. Using esophageal cancer cells, we investigated the functional roles of the H3K4 demethylase Jumonji/Arid1b (Jarid1b) (Kdm5b/Plu-1/Rbp2-h1), an epigenetic factor that is required for continuous cell growth in melanoma. JARID1B knockdown resulted in the suppression of esophageal cancer cell growth, sphere formation and invasion ability and was associated with loss of epithelial marker expression. However, these inhibitory effects observed on tumor formation were reverted subsequent to subcutaneous inoculation of these cells into immune-deficient mice. These results indicated that JARID1B plays a role in maintaining cancer stem cells in the esophagus and justifies the rationale for studying the effects of continuous inhibition of this epigenetic factor in esophageal cancer. PMID:24649241
Wu, Jian-Guo; Wei, Rui-Hua; Liu, Ai-Hua; Zhou, Xiao-Xu; Sun, Guo-Ling; Li, Xiao-Rong
2011-01-01
The purpose of this prospective, interventional, comparative case series was to evaluate the efficiency and feasibility of a disposable sutureless silicone lens ring for corneal contact lens stabilization during combined 23-gauge vitrectomy and cataract surgery. We developed a ring consisting of a single silicone component with three footplates along the ring margin to fit cannulae for holding conventional contact lenses. Thirty eyes from 30 patients with cataract and vitreoretinal disease were included, and divided into two matched groups according to disease type and ring used. In Group A, we used a 23-gauge transconjunctival vitrectomy system and a disposable sutureless silicone lens ring (n = 15). In Group B, we used a 23-gauge transconjunctival vitrectomy system and a conventional metal lens ring (n = 15). The main outcome measures were: time required for vitrectomy preparation, rate of intraoperative corneal limbus bleeding, and limbus scar rate at the final follow-up visit. Thirty cases were successfully completed. The average vitrectomy preparation time was less in Group A than in Group B (P < 0.01), and the average preparation time saved was 3.94 minutes. None of the Group A patients had intraoperative bleeding or postoperative scarring, whereas all 15 Group B cases had bleeding and five had scarring. There was a statistically significant difference between Group A and Group B for these complications (P ≤ 0.05). This report demonstrates the advantages of using a sutureless silicone ring during combined 23-gauge vitrectomy and cataract surgery. Using this method could allow extra time for the surgeon to pay more attention to complex vitreoretinal procedures.
CYP1B1 and MYOC Mutations in Vietnamese Primary Congenital Glaucoma Patients.
Do, Tan; Shei, William; Chau, Pham Thi Minh; Trang, Doan Le; Yong, Victor H K; Ng, Xiao Yu; Chen, Yue Ming; Aung, Tin; Vithana, Eranga N
2016-05-01
Primary congenital glaucoma (PCG, OMIM 231300), the most common glaucoma in infancy, is caused by developmental defects in the anterior chamber angle. The 3 implicated genes are cytochrome P450 family I subfamily B polypeptide 1 (CYP1B1), latent transforming growth factor β-binding protein 2 (LTBP2), and myocilin (MYOC). In this study, we sought to determine CYP1B1 and MYOC sequence variations in a Vietnamese cohort of index cases with PCG and their families. Thirty Vietnamese subjects with PCG and 120 normal Vietnamese subjects were recruited. PCG was defined by the presence of at least 2 of the following clinical manifestations: increased corneal diameter (>10 mm at birth), corneal edema, Haab's striae, optic disc changes, and absence of other ocular or systemic diseases associated with childhood glaucoma. The coding exons, intron and exon boundaries, and untranslated regions of CYP1B1 and MYOC genes were PCR amplified and subjected to bidirectional sequencing in all subjects. We identified 2 homozygous and 3 heterozygous CYP1B1 sequence alterations in our study subjects. Among the 5 mutations identified, 2 (p.H279L and p.L283F) were novel mutations, whereas 3 (p.A121_S122insDRPAFA, p.L107V, and p.V320L) had been previously reported in PCG cases. None of these mutations was observed in any of the 120 controls. Haplotypes generated with 6 non-disease-causing intragenic single nucleotide polymorphisms detected in CYP1B1 indicated that the most common haplotype in Vietnamese population is similar to that found in Chinese and Japanese. The genotype-phenotype correlation showed no significant difference between mutation and no-mutation groups for quantitative clinical features (presenting intraocular pressure, corneal diameter, number of surgeries performed, the cup-to-disc ratio) as well as for qualitative factors (bilateral cases, phenotype severity, and the prognosis) (P>0.05). Five out of 30 families with PCG (16.7%) had disease attributable to CYP1B1 alterations
6-(4-Bromophenyl-2-(4-fluorobenzylimidazo[2,1-b][1,3,4]thiadiazole
Directory of Open Access Journals (Sweden)
Afshan Banu
2011-04-01
Full Text Available In the title compound, C17H11BrFN3S, the imidazothiadiazole and bromophenyl rings are individually almost planar, with maximum deviations of 0.0215 (4 and 0.0044 (4 Å, respectively, and are inclined at an angle of 27.34 (3° with respect to each other. The dihedral angle between the mean planes of the fluorobenzyl and imidazothiadiazole rings is 79.54 (3°. The crystal structure is stabilized by intermolecular C—H...N interactions resulting in chains of molecules along the b axis.
Deciphering Intrinsic Inter-subunit Couplings that Lead to Sequential Hydrolysis of F 1 -ATPase Ring
Dai, Liqiang; Flechsig, Holger; Yu, Jin
2017-10-01
The rotary sequential hydrolysis of metabolic machine F1-ATPase is a prominent feature to reveal high coordination among multiple chemical sites on the stator F1 ring, which also contributes to tight coupling between the chemical reaction and central {\\gamma}-shaft rotation. High-speed AFM experiments discovered that the sequential hydrolysis was maintained on the F1 ring even in the absence of the {\\gamma} rotor. To explore how the intrinsic sequential performance arises, we computationally investigated essential inter-subunit couplings on the hexameric ring of mitochondrial and bacterial F1. We first reproduced the sequential hydrolysis schemes as experimentally detected, by simulating tri-site ATP hydrolysis cycles on the F1 ring upon kinetically imposing inter-subunit couplings to substantially promote the hydrolysis products release. We found that it is key for certain ATP binding and hydrolysis events to facilitate the neighbor-site ADP and Pi release to support the sequential hydrolysis. The kinetically feasible couplings were then scrutinized through atomistic molecular dynamics simulations as well as coarse-grained simulations, in which we enforced targeted conformational changes for the ATP binding or hydrolysis. Notably, we detected the asymmetrical neighbor-site opening that would facilitate the ADP release upon the enforced ATP binding, and computationally captured the complete Pi release through charge hopping upon the enforced neighbor-site ATP hydrolysis. The ATP-hydrolysis triggered Pi release revealed in current TMD simulation confirms a recent prediction made from statistical analyses of single molecule experimental data in regard to the role ATP hydrolysis plays. Our studies, therefore, elucidate both the concerted chemical kinetics and underlying structural dynamics of the inter-subunit couplings that lead to the rotary sequential hydrolysis of the F1 ring.
Patel, Roma; Dwivedi, Mitesh; Mansuri, Mohmmad Shoab; Ansarullah; Laddha, Naresh C; Thakker, Ami; Ramachandran, A V; Begum, Rasheedunnisa
2016-01-01
Neuropeptide Y (NPY) is known to play a role in the regulation of satiety, energy balance, body weight, and insulin release. Interleukin-1beta (IL1B) has been associated with loss of beta-cell mass in type-II diabetes (TIID). The present study attempts to investigate the association of NPY exon2 +1128 T/C (Leu7Pro; rs16139), NPY promoter -399 T/C (rs16147) and IL1B -511 C/T (rs16944) polymorphisms with TIID and their correlation with plasma lipid levels, BMI, and IL1B transcript levels. PCR-RFLP was used for genotyping these polymorphisms in a case-control study involving 558 TIID patients and 1085 healthy age-matched controls from Gujarat. Linkage disequilibrium and haplotype analysis of the NPY polymorphic sites were performed to assess their association with TIID. IL1B transcript levels in PBMCs were also assessed in 108 controls and 101 patients using real-time PCR. Our results show significant association of both structural and promoter polymorphisms of NPY (p<0.0001 and p<0.0001 respectively) in patients with TIID. However, the IL1B C/T polymorphism did not show any association (p = 0.3797) with TIID patients. Haplotype analysis revealed more frequent association of CC and CT haplotypes (p = 3.34 x 10-5, p = 6.04 x 10-9) in diabetics compared to controls and increased the risk of diabetes by 3.02 and 2.088 respectively. Transcript levels of IL1B were significantly higher (p<0.0001) in patients as compared to controls. Genotype-phenotype correlation of IL1B polymorphism did not show any association with its higher transcript levels. In addition, NPY +1128 T/C polymorphism was found to be associated with increased plasma LDL levels (p = 0.01). The present study provides an evidence for a strong correlation between structural and promoter polymorphisms of NPY gene and upregulation of IL1B transcript levels with susceptibility to TIID and altering the lipid metabolism in Gujarat population.
Moura Neto, Arnaldo; Parisi, Maria Candida Ribeiro; Alegre, Sarah Monte; Pavin, Elizabeth Joao; Tambascia, Marcos Antonio; Zantut-Wittmann, Denise Engelbrecht
2016-01-01
Thyroid hormone (TH) abnormalities are common in patients with diabetes mellitus (DM). These thyroid hormone abnormalities have been associated with inflammatory activity in several conditions but this link remains unclear in DM. We assessed the influence of subclinical inflammation in TH metabolism in euthyroid diabetic patients. Cross-sectional study involving 258 subjects divided in 4 groups: 70 patients with T2DM and 55 patients with T1DM and two control groups of 70 and 63 non-diabetic individuals, respectively. Groups were paired by age, sex, and body mass index (BMI). We evaluated the association between clinical and hormonal variables [thyrotropin, reverse T3 (rT3), total and free thyroxine (T4), and triiodothyronine (T3)] with the inflammation markers C-reactive protein (hs-CRP), serum amyloid A (SAA), and interleukin-6 (IL-6). Serum T3 and free T3 were lower in patients with diabetes (all P 1) compared to the control groups. Interleukin-6 showed positive correlations with rT3 in both groups (P 193; 95% CI -0.31; -0.076; P = 0.002) and FT4/rT3 (B = -0.107; 95% CI -0.207; -0.006; P = 0.039) in the T1DM group. In the T2DM group, SAA (B = 0.18; 95% CI 0.089; 0.271; P 1) and hs-CRP (B = -0.069; 95% CI -0.132; -0.007; P = 0.03) predicted FT3 levels. SAA (B = -0.16; 95% CI -0.26; -0.061; P = 0.002) and IL6 (B = 0.123; 95% CI 0.005; 0.241; P = 0.041) were related to FT4/FT3. In DM, differences in TH levels compared to non-diabetic individuals were related to increased subclinical inflammatory activity and BMI. Altered deiodinase activity was probably involved. These findings were independent of sex, age, BMI, and HbA1c levels.
Kiss, Tibor; Balla, Krisztina; Veisz, Ottó; Láng, László; Bedő, Zoltán; Griffiths, Simon; Isaac, Peter; Karsai, Ildikó
2014-01-01
Heading of cereals is determined by complex genetic and environmental factors in which genes responsible for vernalization and photoperiod sensitivity play a decisive role. Our aim was to use diagnostic molecular markers to determine the main allele types in VRN - A1 , VRN - B1 , VRN - D1 , PPD - B1 and PPD - D1 in a worldwide wheat collection of 683 genotypes and to investigate the effect of these alleles on heading in the field. The dominant VRN - A1 , VRN - B1 and VRN - D1 alleles were present at a low frequency. The PPD - D1a photoperiod-insensitive allele was carried by 57 % of the cultivars and was most frequent in Asian and European cultivars. The PPD - B1 photoperiod-insensitive allele was carried by 22 % of the genotypes from Asia, America and Europe. Nine versions of the PPD - B1 -insensitive allele were identified based on gene copy number and intercopy structure. The allele compositions in PPD - D1 , PPD - B1 and VRN - D1 significantly influenced heading and together explained 37.5 % of the phenotypic variance. The role of gene model increased to 39.1 % when PPD - B1 intercopy structure was taken into account instead of overall PPD - B1 type (sensitive vs. insensitive). As a single component, PPD - D1 had the most important role (28.0 % of the phenotypic variance), followed by PPD - B1 (12.3 % for PPD - B1 _overall, and 15.1 % for PPD - B1 _intercopy) and VRN - D1 (2.2 %). Significant gene interactions were identified between the marker alleles within PPD - B1 and between VRN - D1 and the two PPD1 genes. The earliest heading genotypes were those with the photoperiod-insensitive allele in PPD - D1 and PPD - B1 , and with the spring allele for VRN - D1 and the winter alleles for VRN - A1 and VRN - B1 . This combination could only be detected in genotypes from Southern Europe and Asia. Late-heading genotypes had the sensitivity alleles for both PPD1 genes, regardless of the allelic composition of the VRN1 genes. There was a 10-day difference in
Directory of Open Access Journals (Sweden)
I. I. Arief
2013-08-01
Full Text Available Bacteriocins produced by Indonesian lactic acid bacteria Lactobacillus plantarum IIA-1A5, IIA-1B1, IIA-2B2 were purified and characterized. Plantaricin W gene had been successfully amplified from all strains. This amplicon showed the expected 200 bp size of plantaricin W gene. This bacteriocins purified from L. plantarum IIA-1A5, IIA-1B1, and IIA-2B2 were named plantaricin IIA-1A5, IIA-1B1, and IIA-2B2. Purification by cation exchange chromatography increased the purity (fold and activity of plantaricins. Purity of plantaricin IIA-1A5 was increased by 3.13 fold with specific activity 13.40 AU/mg. Plantaricin IIA-1B1 had 2.98 fold purity with specific activity 5.12 AU/mg, while purity of plantaricin IIA-2B2 was 1.37 fold with specific activity 7.70 AU/mg. All plantaricins could inhibit the growth of pathogenic bacteria, such as Escherichia coli, Salmonella typhimurium, Bacillus cereus, and Staphylococcus aureus. Plantaricins could be digested by trypsin. Stability of plantaricins at 80 oC for 30 min and at 121 oC for 15 min were affected by type of plantaricin and species of pathogenic bacteria. Generally, plantaricin IIA-1A5 was better as antimicrobial agent than plantaricin IIA-1B1 and plantaricin IIA-2B2.
Directory of Open Access Journals (Sweden)
Mini Joseph
2017-10-01
Full Text Available Introduction: There is paucity of data on the nutritional intake in low Body Mass Index (BMI Asian Indians with diabetes. Aim: To study the difference in the nutrient intake pattern in low-BMI Type 1 Diabetes Mellitus (T1DM and Fibrocalcific Pancreatic Diabetes (FCPD patients. Materials and Methods: This cross-sectional study consisted of T1DM (n=40 and FCPD (n=20 male patients with similar BMI. Nutritional data was collected using the 24 hour recall method and food diaries. Fasting blood samples were analysed for lipid profile, serum creatinine, glycosylated haemoglobin, albumin, calcium and vitamin D. Stool samples were analysed for pancreatic elastase. Percentage analysis, Independent sample t-test and Pearson coefficient correlation were used to analyse the data. A p-value<0.05 was considered as statistically significant. Results: The FCPD patients, on biochemical analysis, had significantly lower vitamin D levels compared to the T1DM group (p=0.035. However, haemoglobin, triglycerides, low density lipoproteins, creatinine, albumin and calcium were similar between the groups. In the nutrient data, FCPD patients had a significant higher intake of fat (p=0.039, fibre (p<0.001, calcium (p=0.047, phosphorous (p=0.035, and niacin (p=0.001 and calories from fat (p=0.047. The T1DM group had a significantly higher intake of thiamine (p=0.047 and carbohydrates (p=0.014. Conclusion: T1DM and FCPD groups have similar dietary pattern deficit in fibre, calories, macronutrients and micronutrients. Malabsorption and poor glycaemic control in FCPD patients can be attributed to a higher dietary fat intake. A balanced diet can ensure better glycaemic control.
Hydroxyl group induced adsorption of four-nitro benzoic acid on Si(100) 2x1 surface
International Nuclear Information System (INIS)
Ihm, K.; Kang, T.-H.; Hwang, C.C.; Kim, K.-J.; Hwang, H.-N.; Kim, H.-D.; Han, J.H.; Moon, S.; Kim, B.; POSTECH
2004-01-01
Full text: A number of studies have been conducted on self-assembled monolayers (SAMs) in order to study the adhesion of polymer films on various substrates. Recently, the studies on SAMs on the semiconductor substrate are more motivated because of their possible application to nanoscale devices. For the electronic and chemical properties suitable for various applications, the aromatic ring has been used as a building block of various molecules forming SAMs. Here, we used four-nitro benzoic acid (4-NBA) as a model planar aromatic compound, in which the phenyl ring, the carboxylic functional group, and NO2 are on the same plane. The adsorption mechanism of 4-NBA on the in-situ prepared OH/Si(100) 2x1 surface was investigated using x-ray photoelectron spectroscopy and near-edge x-ray absorption e structure. The results revealed that the 4-NBA molecule reacts with the hydroxyl group on the Si(100) 2x1 surface through deprotonation of the carboxyl group. The saturation coverage of 4-NBA estimated by the O 1s ratio is 1/2 ML. Additionally, we could observe the desorption of the oxygen atom from the NO2 moiety of the 4-NBA upon irradiating the surface by photons of 500 eV
Nagaoka, Shin-Ichi; Bandoh, Yuki; Nagashima, Umpei; Ohara, Keishi
2017-10-26
Singlet-oxygen ( 1 O 2 ) quenching, free-radical scavenging, and excited-state intramolecular proton-transfer (ESIPT) activities of hydroxyflavones, anthocyanidins, and 1-hydroxyanthraquinones were studied by means of laser, stopped-flow, and steady-state spectroscopies. In hydroxyflavones and anthocyanidins, the 1 O 2 quenching activity positively correlates to the free-radical scavenging activity. The reason for this correlation can be understood by considering that an early step of each reaction involves electron transfer from the unfused phenyl ring (B-ring), which is singly bonded to the bicyclic chromen or chromenylium moiety (A- and C-rings). Substitution of an electron-donating OH group at B-ring enhances the electron transfer leading to activation of the 1 O 2 quenching and free-radical scavenging. In 3-hydroxyflavones, the OH substitution at B-ring reduces the activity of ESIPT within C-ring, which can be explained in terms of the nodal-plane model. As a result, the 1 O 2 quenching and free-radical scavenging activities negatively correlate to the ESIPT activity. A catechol structure at B-ring is another factor that enhances the free-radical scavenging in hydroxyflavones. In contrast to these hydroxyflavones, 1-hydroxyanthraquinones having an electron-donating OH substituent adjacent to the O-H---O═C moiety susceptible to ESIPT do not show a simple correlation between their 1 O 2 quenching and ESIPT activities, because the OH substitution modulates these reactions.
On Semiprime Noetherian PI-Rings
Chiba, Katsuo
2000-01-01
Let R be a semiprime Noetherian PI-ring and Q(R) the semisimple Artinian ring of fractions of R. We shall prove the following conditions are equivalent: (1) the Krull dimention of R is at most one, (2) Any ring between R and Q(R) is again right Noetherian, (3) Let a, b be central regular elements of Q(R). Then the subring R + aR[b] of Q(R) is right Noetherian.
Preparation and Biological Properties of Ring-Substituted Naphthalene-1-Carboxanilides
Directory of Open Access Journals (Sweden)
Tomas Gonec
2014-07-01
Full Text Available In this study, a series of twenty-two ring-substituted naphthalene-1-carboxanilides were prepared and characterized. Primary in vitro screening of the synthesized carboxanilides was performed against Mycobacterium avium subsp. paratuberculosis. N-(2-Methoxyphenylnaphthalene-1-carboxamide, N-(3-methoxy-phenylnaphthalene-1-carboxamide, N-(3-methylphenylnaphthalene-1-carboxamide, N-(4-methylphenylnaphthalene-1-carboxamide and N-(3-fluorophenylnaphthalene-1-carboxamide showed against M. avium subsp. paratuberculosis two-fold higher activity than rifampicin and three-fold higher activity than ciprofloxacin. The most effective antimycobacterial compounds demonstrated insignificant toxicity against the human monocytic leukemia THP-1 cell line. The testing of biological activity of the compounds was completed with the study of photosynthetic electron transport (PET inhibition in isolated spinach (Spinacia oleracea L. chloroplasts. The PET-inhibiting activity expressed by IC50 value of the most active compound N-[4-(trifluoromethylphenyl]naphthalene-1-carboxamide was 59 μmol/L. The structure-activity relationships are discussed.
Directory of Open Access Journals (Sweden)
Pi-Hui Hsu
2018-04-01
Full Text Available Background: Due to studies on calorie requirement in mechanically ventilated critically ill elderly patients are few, and indirect calorimetry (IC is not available in every intensive care unit (ICU. The aim of this study was to compare IC and Harris–Benedict (HB predictive equation in different BMI groups. Methods: A total of 177 mechanically ventilated critically ill elderly patients (≧65 years old underwent IC for measured resting energy expenditure (MREE. Estimated calorie requirement was calculated by the HB equation, using actual body weight (ABW and ideal body weight (IBW separately. Patients were divided into four BMI groups. One-way ANOVA and Pearson's correlation coefficient were used for statistical analyses. Results: The mean MREE was 1443.6 ± 318.2 kcal/day, HB(ABW was 1110.9 ± 177.0 kcal/day and HB(IBW was 1101.5 ± 113.1 kcal/day. The stress factor (SFA = MREE ÷ HB(ABW was 1.43 ± 0.26 for the underweight, 1.30 ± 0.27 for the normal weight, 1.20 ± 0.19 for the overweight, and 1.20 ± 0.31 for the obese. The SFI (SFI = MREE ÷ HB(IBW was 1.24 ± 0.24 for the underweight, 1.31 ± 0.26 for the normal weight, 1.36 ± 0.21 for the overweight, and 1.52 ± 0.39 for the obese. MREE had significant correlation both with REE(ABW = HB(ABW × SFA (r = 0.46; P < 0.0001 and REE(IBW = HB(IBW × SFI (r = 0.43; P < 0.0001. Conclusion: IC is the best accurate method for assessing calorie requirement of mechanically ventilated critically ill elderly patients. When IC is not available, using the predictive HB equation is an alternative choice. Calorie requirement can be predicted by HB(ABW × 1.20–1.43 for critically ill elderly patients according to different BMI groups, or using HB(IBW × 1.24–1.52 for patients with edema, ascites or no available body weight data. Keywords: Body Mass Index, Elderly critical care, Harris–Benedict equation, Indirect calorimetry
Krause, Jens C; Ghandil, Pegah; Chrabieh, Maya; Casanova, Jean-Laurent; Picard, Capucine; Puel, Anne; Creech, C Buddy
2009-11-01
We describe a child with very late-onset group B Streptococcus sepsis and meningitis, systemic shigellosis, and chronic osteomyelitis. Peripheral blood cells obtained from the patient and her brother did not respond to stimulation with either interleukin-1beta or lipopolysaccharide. Sequencing of the interleukin-1 receptor-associated kinase-4 gene revealed 2 novel mutations.
Directory of Open Access Journals (Sweden)
Li X-R
2011-06-01
Full Text Available Jian-Guo Wu, Rui-Hua Wei, Ai-Hua Liu, Xiao-Xu Zhou, Guo-Ling Sun, Xiao-Rong LiTianjin Medical University Eye Center, Tianjin, ChinaBackground: The purpose of this prospective, interventional, comparative case series was to evaluate the efficiency and feasibility of a disposable sutureless silicone lens ring for corneal contact lens stabilization during combined 23-gauge vitrectomy and cataract surgery.Methods: We developed a ring consisting of a single silicone component with three footplates along the ring margin to fit cannulae for holding conventional contact lenses. Thirty eyes from 30 patients with cataract and vitreoretinal disease were included, and divided into two matched groups according to disease type and ring used. In Group A, we used a 23-gauge transconjunctival vitrectomy system and a disposable sutureless silicone lens ring (n = 15. In Group B, we used a 23-gauge transconjunctival vitrectomy system and a conventional metal lens ring (n = 15. The main outcome measures were: time required for vitrectomy preparation, rate of intraoperative corneal limbus bleeding, and limbus scar rate at the final follow-up visit.Results: Thirty cases were successfully completed. The average vitrectomy preparation time was less in Group A than in Group B (P < 0.01, and the average preparation time saved was 3.94 minutes. None of the Group A patients had intraoperative bleeding or postoperative scarring, whereas all 15 Group B cases had bleeding and five had scarring. There was a statistically significant difference between Group A and Group B for these complications (P ≤ 0.05.Conclusion: This report demonstrates the advantages of using a sutureless silicone ring during combined 23-gauge vitrectomy and cataract surgery. Using this method could allow extra time for the surgeon to pay more attention to complex vitreoretinal procedures.Keywords: pars plana vitrectomy, contact lens, silicone ring, cataract surgery
Crystal structure of 1-methoxy-5-methyl-N-phenyl-1,2,3-triazole-4-carboxamide
Directory of Open Access Journals (Sweden)
Inna S. Khazhieva
2015-10-01
Full Text Available The title compound, C11H12N4O2,was prepared via the transformation of sodium 4-acetyl-1-phenyl-1H-[1.2.3]triazolate under the action of methoxyamine hydrochloride. The dihedral angle between the triazole and phenyl rings is 25.12 (16° and the C atom of the methoxy group deviates from the triazole plane by 0.894 (4Å. The conformation of the CONHR-group is consolodated by an intramolecular N—H...N hydrogen bond to an N-atom of the triazole ring, which closes an S(5 ring. In the crystal, weak N—H...N hydrogen bonds link the molecules into C(6 [010] chains.
The c-Ring of the F1FO-ATP Synthase: Facts and Perspectives.
Nesci, Salvatore; Trombetti, Fabiana; Ventrella, Vittoria; Pagliarani, Alessandra
2016-04-01
The F1FO-ATP synthase is the only enzyme in nature endowed with bi-functional catalytic mechanism of synthesis and hydrolysis of ATP. The enzyme functions, not only confined to energy transduction, are tied to three intrinsic features of the annular arrangement of c subunits which constitutes the so-called c-ring, the core of the membrane-embedded FO domain: (i) the c-ring constitution is linked to the number of ions (H(+) or Na(+)) channeled across the membrane during the dissipation of the transmembrane electrochemical gradient, which in turn determines the species-specific bioenergetic cost of ATP, the "molecular currency unit" of energy transfer in all living beings; (ii) the c-ring is increasingly involved in the mitochondrial permeability transition, an event linked to cell death and to most mitochondrial dysfunctions; (iii) the c subunit species-specific amino acid sequence and susceptibility to post-translational modifications can address antibacterial drug design according to the model of enzyme inhibitors which target the c subunits. Therefore, the simple c-ring structure not only allows the F1FO-ATP synthase to perform the two opposite tasks of molecular machine of cell life and death, but it also amplifies the enzyme's potential role as a drug target.
Energy Technology Data Exchange (ETDEWEB)
Dombrovski, Luidmila; Dong, Aiping; Bochkarev, Alexey; Plotnikov, Alexander N. (Toronto)
2008-09-17
Cytosolic sulfotransferases (SULTs), often referred as Phase II enzymes of chemical defense, are a superfamily of enzymes that catalyze the transfer of a sulfonate group from 3{prime}-phosphoadenosine 5{prime}-phosphosulfate (PAPS) to an acceptor group of substrates. This reaction modulates the activities of a large array of small endogenous and foreign chemicals including drugs, toxic compounds, steroid hormones, and neurotransmitters. In some cases, however, SULTs activate certain food and environmental compounds to mutagenenic and carcinogenic metabolites. Twelve human SULTs have been identified, which are partitioned into three families: SULT1, SULT2 and SULT4. The SULT1 family is further divided in four subfamilies, A, B, C, and E, and comprises eight members (1A1, 1A2, 1A3, 1B1, 1C1, 1C2, 1C3, and 1E1). Despite sequence and structural similarity among the SULTs, the family and subfamily members appear to have different biological function. SULT1 family shows substrate-binding specificity for simple phenols, estradiol, and thyroid hormones, as well as environmental xenobiotics and drugs. Human SULT1B1 is expressed in liver, colon, small intestine, and blood leukocytes, and shows substrate-binding specificity to thyroid hormones and benzylic alcohols. Human SULT1C1 is expressed in the adult stomach, kidney, and thyroid, as well as in fetal kidney and liver. SULT1C1 catalyzes the sulfonation of p-nitrophenol and N-hydroxy-2-acetylaminofluorene in vitro. However, the in vivo function of the enzyme remains unknown. We intend to solve the structures for all of the SULTs for which structural information is not yet available, and compare the structural and functional features of the entire SULT superfamily. Here we report the structures of two members of SULT1 family, SULT1B1 and SULT1C1, both in complex with the product of the PAPS cofactor, adenosine-3{prime}-5{prime}-diphosphate (PAP).
3-Benzyl-4-ethyl-1H-1,2,4-triazole-5(4H-thione
Directory of Open Access Journals (Sweden)
Zbigniew Karczmarzyk
2013-02-01
Full Text Available The title compound, C11H13N3S, exists in the 5-thioxo tautomeric form. The benzene ring exhibits disorder with a refined ratio of 0.77 (2:0.23 (2 for components A and B with a common bridgehead C atom. The 1,2,4-triazole ring is essentially planar, with a maximum deviation of 0.002 (3 Å for the benzyl-substituted C atom, and forms dihedral angles of 88.94 (18 and 86.56 (49° with the benzene rings of components A and B, respectively. The angle between the plane of the ethyl chain and the mean plane of 1,2,4-triazole ring is 88.55 (15° and this conformation is stabilized by an intramolecular C—H...S contact. In the crystal, pairs of N—H...S hydrogen bonds link molecules into inversion dimers. π–π interactions are observed between the triazole and benzene rings, with centroid–centroid separations of 3.547 (4 and 3.544 (12 Å for components A and B, and slippages of 0.49 (6 and 0.58 (15 Å, respectively.
The PD-1/B7-H1 pathway modulates the natural killer cells versus mouse glioma stem cells.
Directory of Open Access Journals (Sweden)
Bo Yuan Huang
Full Text Available Glioblastoma multiforme (GBM is the most malignant primary type of brain tumor in adults. There has been increased focus on the immunotherapies to treat GBM patients, the therapeutic value of natural killer (NK cells is still unknown. Programmed death-1 (PD-1 is a major immunological checkpoint that can negatively regulate the T-cell-mediated immune response. We tested the combination of the inhibiting the PD-1/B7H1 pathway with a NK-cell mediated immune response in an orthotopic mouse model of GBM.Mouse glioma stem cells (GL261GSCs and mouse NK cells were isolated and identified. A lactate dehydrogenase (LDH assay was perfomed to detect the cytotoxicity of NK cells against GL261GSCs. GL261GSCs were intracranially implanted into mice, and the mice were stratified into 3 treatment groups: 1 control, 2 NK cells treatment, and 3 PD-1 inhibited NK cells treatment group. Overall survival was quantified, and animal magnetic resonance imaging (MRI was performed to determine tumor growth. The brains were harvested after the mice were euthanized, and immunohistochemistry against CD45 and PCNA was performed.The mouse NK cells were identified as 90% CD3- NK1.1+CD335+ by flow cytometric analysis. In the LDH assay, the ratios of the damaged GL261GSCs, with the E:T ratios of 2.5:1, 5:1, and 10:1, were as follows: 1 non-inhibited group: 7.42%, 11.31%, and 15.1%, 2 B7H1 inhibited group: 14.75%, 18.25% and 29.1%, 3 PD-1 inhibited group: 15.53%, 19.21% and 29.93%, 4 double inhibited group: 33.24%, 42.86% and 54.91%. In the in vivo experiments, the mice in the PD-1 inhibited NK cells treatment group and IL-2-stimulated-NK cells treatment group displayed a slowest tumor growth (F = 308.5, P<0.01 and a slower tumor growth compared with control group (F = 118.9, P<0.01, respectively. The median survival of the mice in the three groups were as follows: 1 conrol group: 29 days, 2 NK cells treatment group: 35 days (P = 0.0012, 3 PD-1 inhibited NK cells treatment group
Directory of Open Access Journals (Sweden)
Mehmet Zeynel Keskin
2017-10-01
Full Text Available Aim: To evaluate the effects of body mass index (BMI ratio on semen parameters and serum reproductive hormones. Materials and methods: The data of 454 patients who prsented to male infertility clinics in our hospital between 2014 and 2015 were analyzed retrospectively. Weight, height, serum hormone levels and semen analysis results of the patients were obtained. BMI values were calculated by using the weight and height values of the patients and they were classified as group 1 for BMI values ≤ 25 kg/m2, as group 2 for BMI values 25-30 kg/m2 and as group 3 for BMI values ≥ 30 kg/m2. Results: The mean values of BMI, semen volume, concentration, total motility, progressive motility, total progressive motile sperm count (TPMSC, normal morphology according to Kruger, head abnormality, neck abnormality, tail abnormality, FSH, LH, prolactin, T/E2, total testosterone and estradiol parameters of the patients were considered. Patients were divided according to BMI values in Group 1 (n = 165, Group 2 (n = 222 and Group 3 (n = 56. There was no statistically significant difference in terms of all variables between the groups. Conclusions: We analyzed the relationship between BMI level and semen parameters and reproductive hormones, demonstrating no relationship between BMI and semen parameters. In our study, BMI does not affect semen parameters although it shows negative correlation with prolactin and testosterone levels.
(2E-3-(4-Chlorophenyl-1-(4-hydroxyphenylprop-2-en-1-one
Directory of Open Access Journals (Sweden)
Jerry P. Jasinski
2011-04-01
Full Text Available In the title compound, C15H11ClO2, the dihedral angle between the mean planes of the chlorobenzene and hydroxybenzene rings is 6.5 (6°. The mean plane of the prop-2-en-1-one group makes an angle of 18.0 (1° with the hydroxyphenyl ring and 11.5 (1° with the chlorophenyl ring. The crystal packing is stabilized by intermolecular O—H...O hydrogen bonds, weak C—H...O, C—H...π and π–π stacking interactions [centroid–centroid distances = 3.7771 (7 and 3.6917 (7 Å].
DEFF Research Database (Denmark)
Janiga, A.; Bednarska, D.; Thorsted, B.
2014-01-01
elucidated by comparison with simpler tetraaryl-analogues. The strong charge-transfer characteristic of these functional dyes can be illustrated by large Stokes shifts (4100-7100 cm(-1)) for A-D-A architectures. The replacement of phenyl rings at positions 2 and 5 with the arylethynylaryl substituents......The synthesis and optical characterization of six novel heteroaromatic-based chromophores is described. The new dyes present mostly an A-D-A general framework, where A is an electron-deficient aromatic ring and D is an electron-rich pyrrolo[3,2-b] pyrrole moiety, linked via triple bonds...
ANALISIS SUDUT PANDANG KAMERA (Studi kasus: Film Jelangkung dan Film The Ring 1
Directory of Open Access Journals (Sweden)
Listia Natadjaja
2005-01-01
Full Text Available Horror movie is one of the strengths of Indonesian film industry; however it is not so popular in the International market. Thus%2C an analysis is needed to determine what the strengths are of another horror movie that has achieved global recognition. This analysis trie s to examine film angles that could be one of the important factors in audio visual in creating horror movies. The Ring 1 is chosen as a comparison to Indonesian horror movie. The Ring 1 has the most world recognition%2C and it has been re-made by Korean and American horror movie makers. Jelangkung is chosen because it is the pioneer of horror movies in Indonesia and has inspired other movies in the same genre. Both films are analyzed from the camera angle aspect which gives the horror effect. Abstract in Bahasa Indonesia : Film horor merupakan salah satu kekuatan perfilman layar lebar di Indonesia.%2C akan tetapi film horor Indonesia kurang dapat menyebar di pasaran Internasional. Oleh karena itu%2C suatu analisis diperlukan untuk mengetahui apakah kekuatan-kekuatan yang dimiliki oleh film horor negara-negara lain yang banyak digemari masyarakat global terutama dari sudut pandang kamera yang merupakan salah satu faktor penting dalam menciptakan kesan horor pada suatu film. Film The Ring 1 dipilih sebagai pedoman perbandingan film horor Indonesia%2C karena film The Ring 1 adalah film horor yang sangat banyak diminati oleh masyarakat di seluruh dunia%2C bahkan telah diremake oleh Korea dan USA. Film Horor Indonesia yang dipilih adalah film Jelangkung yang pertama kali muncul pada film layar lebar dan menjadi cikal bakal munculnya banyak film layar lebar di Indonesia dengan genre yang sama. Analisa kedua film ini ditinjau dari sudut pandang kamera yang dapat menampilkan kesan horor. horror movie%2C camera angle%2C Indonesia%2C Japan.
Directory of Open Access Journals (Sweden)
Junchen Chen
Full Text Available Melanoma accounts for nearly 80% of all deaths associated with skin cancer.CD147 plays a very important role in melanoma progression and the expression level may correlate with tumor malignancy. RING1 can bind DNA and act as a transcriptional repressor, play an important role in the aggressive phenotype in melanoma. The interactions between CD147 and RING1 were identified with a yeast two-hybrid and RING1 interacted with CD147 through the transmembrane domain. RING1 inhibits CD147's capability promoting melanoma cell migration. In conclusion, the study identified novel interactions between CD147 and RING1, recovered CD147 nuclear envelope distribution in melanoma cells, and suggested a new mechanism underlying how cytoplasmic CD147 promotes melanoma development.
Chen, Junchen; Peng, Cong; Lei, Li; Zhang, Jianglin; Zeng, Weiqi; Chen, Xiang
2017-01-01
Melanoma accounts for nearly 80% of all deaths associated with skin cancer.CD147 plays a very important role in melanoma progression and the expression level may correlate with tumor malignancy. RING1 can bind DNA and act as a transcriptional repressor, play an important role in the aggressive phenotype in melanoma. The interactions between CD147 and RING1 were identified with a yeast two-hybrid and RING1 interacted with CD147 through the transmembrane domain. RING1 inhibits CD147's capability promoting melanoma cell migration. In conclusion, the study identified novel interactions between CD147 and RING1, recovered CD147 nuclear envelope distribution in melanoma cells, and suggested a new mechanism underlying how cytoplasmic CD147 promotes melanoma development.
Cui, J G; Zhao, Y; Sethi, P; Li, Y Y; Mahta, A; Culicchia, F; Lukiw, W J
2010-07-01
High density micro-RNA (miRNA) arrays, fluorescent-reporter miRNA assay and Northern miRNA dot-blot analysis show that a brain-enriched miRNA-128 is significantly down-regulated in glioblastoma multiforme (GBM) and in GBM cell lines when compared to age-matched controls. The down-regulation of miRNA-128 was found to inversely correlate with WHO tumor grade. Three bioinformatics-verified miRNA-128 targets, angiopoietin-related growth factor protein 5 (ARP5; ANGPTL6), a transcription suppressor that promotes stem cell renewal and inhibits the expression of known tumor suppressor genes involved in senescence and differentiation, Bmi-1, and a transcription factor critical for the control of cell-cycle progression, E2F-3a, were found to be up-regulated. Addition of exogenous miRNA-128 to CRL-1690 and CRL-2610 GBM cell lines (a) restored 'homeostatic' ARP5 (ANGPTL6), Bmi-1 and E2F-3a expression, and (b) significantly decreased the proliferation of CRL-1690 and CRL-2610 cell lines. Our data suggests that down-regulation of miRNA-128 may contribute to glioma and GBM, in part, by coordinately up-regulating ARP5 (ANGPTL6), Bmi-1 and E2F-3a, resulting in the proliferation of undifferentiated GBM cells.
A Stereoselective [3+1] Ring Expansion for the Synthesis of Highly Substituted Methylene Azetidines.
Schmid, Steven C; Guzei, Ilia A; Schomaker, Jennifer M
2017-09-25
The reaction of rhodium-bound carbenes with strained bicyclic methylene aziridines results in a formal [3+1] ring expansion to yield highly substituted methylene azetidines with excellent regio- and stereoselectivity. The reaction appears to proceed through an ylide-type mechanism, where the unique strain and structure of the methylene aziridine promotes a ring-opening/ring-closing cascade that efficiently transfers chirality from substrate to product. The resultant products can be elaborated into new azetidine scaffolds containing vicinal tertiary-quaternary and even quaternary-quaternary stereocenters. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nishi, Hiroyuki; Toda, Koichi; Miyagawa, Shigeru; Yoshikawa, Yasushi; Fukushima, Satsuki; Kawamura, Masashi; Yoshioka, Daisuke; Saito, Tetsuya; Ueno, Takayoshi; Kuratani, Toru; Sawa, Yoshiki
2016-09-01
We assessed the effects of different types of prosthetic rings on mitral annular dynamics using real-time three-dimensional echocardiography (RT3DE). RT3DE was performed in 44 patients, including patients undergoing mitral annuloplasty using the Cosgrove-Edwards flexible band (Group A, n = 10), the semi-rigid Sorin Memo 3D ring (Group B, n = 17), the semi-rigid Edwards Physio II ring (Group C, n = 7) and ten control subjects. Various annular diameters were measured throughout the cardiac cycle. We observed flexible anterior annulus motion in all of the groups except Group C. A flexible posterior annulus was only observed in Group B and the Control group. The mitral annular area changed during the cardiac cycle by 8.4 ± 3.2, 6.3 ± 2.0, 3.2 ± 1.3, and 11.6 ± 5.0 % in Group A, Group B, Group C, and the Control group, respectively. The dynamic diastolic to systolic change in mitral annular diameters was lost in Group C, while it was maintained in Group A, and to a good degree in Group B. In comparison to the Control group, the mitral annulus shape was more ellipsoid in Group B and Group C, and more circular in Group A. Although mitral regurgitation was well controlled by all of the types of rings that were utilized in the present study, we demonstrated that the annulus motion and annulus shape differed according to the type of prosthetic ring that was used, which might provide important information for the selection of an appropriate prosthetic ring.
The B(E2;4^+1->2^+1) / B(E2;2^+1->0^+1) Ratio in Even-Even Nuclei
Loelius, C.; Sharon, Y. Y.; Zamick, L.; G"Urdal, G.
2009-10-01
We considered 207 even-even nuclei throughout the chart of nuclides for which the NNDC Tables had data on the energies and lifetimes of the 2^+1 and 4^+1 states. Using these data we calculated for each nucleus the electric quadrupole transition strengths B(E2;4^+1->2^+1) and B(E2;2^+1->0^+1), as well as their ratio. The internal conversion coefficients were obtained by using the NNDC HSICC calculator. For each nucleus we plotted the B(E2) ratio against A, N, and Z. We found that for close to 90% of the nuclei considered the ratio had values between 0.5 and 2.5. Most of the outliers had magic numbers of protons or neutrons. Our ratio results were compared with the theoretical predictions for this ratio by different models--10/7 in the rotational model and 2 in the simplest vibrational model. In the rotational regions (for 150 220) the ratios were indeed close to 10/7. For the few nuclei thought to be vibrational the ratios were usually less than 2. Otherwise, we got a wide scatter of ratio values. Hence other models, including the NpNn scheme, must be considered in interpreting these results.
Wind tunel tests of Risoe-B1-18 and Risoe-B1-24
Energy Technology Data Exchange (ETDEWEB)
Fuglsang, P.; Bak, C.; Gaunaa, M.; Antoniou, I.
2003-01-01
This report contains 2D measurements of the Risoe-B1-18 and Risoe-B1-24 airfoils. The aerodynamic properties were derived from pressure measurements on the airfoil surface and in the wake. The measurements were conducted in the VELUX open jet wind tunnel, which has a background turbulence intensity of 1%, and an inlet flow velocity of 42 m/s. The airfoil sections had a chord of 0.600 m giving a Reynolds number of 1.6Oe106. The span was 1.9 m and end plates were used to minimize 3D flow effects. The measurements comprised both static and dynamic inflow. Static inflow covered angles of attack from 5o to 30 deg. Dynamic inflow was obtained by pitching the airfoil in a harmonic motion around various mean angles of attack. The test matrix involved smooth flow, various kinds of leading edge roughness, stall strips, vortex generators and Gurney flaps in different combinations. The quality of the measurements was good and the agreement between measurements and numerical CFD predictions with EllipSys2D was good. For both airfoils predictions with turbulent flow captured very well the shapes of lift and drag curves as well as the magnitude of maximum lift. Measurements of Risoe-B1-18 showed that the maximum lift coefficient was 1.64 at an angle of attack of approximately 13 deg. The airfoil was not very sensitive to leading edge roughness despite its high maximum lift. Measurements with stall strips showed that stall strips could control the level of maximum lift. The Risoe-B1-24 measurements showed that the maximum lift coefficient was 1.62 at an angle of attack of approximately 14 deg. The airfoil was only little sensitive to leading edge roughness despite its high relative thickness and high maximum lift. Measurements with delta wing shaped vortex generators increased the maximum lift coefficient to 2.02 and measurements with Gurney flaps increased the maximum lift coefficient to 1.85. Measurements with combination of vortex generators and Gurney flaps showed a maximum
International Nuclear Information System (INIS)
Fleischmann, H.H.
1986-10-01
During the present, second period of our contract, the effort of our RECE-group was focussed mainly in four areas: (1) the design and construction of our new main experimental device, the megavolt ion coil experiment (MICE, aimed at generating 1-MeV ion rings) was continued. The device construction was completed and injection experiments recently have started using a half-cusp arrangement. (2) Using our smaller MERGE device (500 keV electrons, cusp injection), we investigated as expected the precessional stabilization of strong electron rings by a resistive wall. As expected, the experiments are completed. The results show excellent agreement with the basic theoretical expectations of our earlier analytic calculations and also with a more detailed computer code recently compiled. (3) Also, our MERGE device was completed as expected; experiments showed successful generation of electron and plasma rings; first experiments on the merging of these rings show a rapid attraction between the rings, which is to be properly slowed down by the introduction of a resistive wall. (4) Our pilot model calculations on mixed-CT configurations were nearly completed; including a survey of relevant plasma ring equilibria with a strong large-orbit particle components. Rough stability limits were obtained by studying the magnetic interaction between the two components
{2-[(4-Nitrobenzylideneamino]-4,5,6,7-tetrahydro-1-benzothiophen-3-yl}(phenylmethanone
Directory of Open Access Journals (Sweden)
Manpreet Kaur
2014-06-01
Full Text Available In the title compound, C22H18N2O3S, disorder is found in the benzoyl group (A and B, as well as for four C atoms of the cyclohexene ring. Two orientations were modeled in a 0.583 (5:0.417 (5 ratio. The cyclohexene ring is in a distorted chair conformation. The dihedral angles between the mean plane of the thiophene ring and the 4-nitrobenzene and phenyl rings are 30.9 (8 and 64.8 (3 (A and 62.4 (7° (B. The mean planes of the 4-nitrobenzene and the phenyl rings are almost perpendicular to each other, with dihedral angles of 85.4 (1 (A and 83.9 (8° (B. An extensive array of weak C—H...O interactions consolidate molecules into a three-dimensional architecture, forming chains along [001] and [010] and layers parallel to (011.
26 CFR 1.167(b)-1 - Straight line method.
2010-04-01
... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Straight line method. 1.167(b)-1 Section 1.167(b... Straight line method. (a) In general. Under the straight line method the cost or other basis of the... may be reduced to a percentage or fraction. The straight line method may be used in determining a...
Peck, Travis; Scharf, Rebecca J; Conaway, Mark R; DeBoer, Mark D
2015-08-01
Evaluate associations between TV viewing and weight status in children from kindergarten to first grade. Linear and logistic regression was used to evaluate associations of TV-viewing time on BMI-z-score cross-sectionally at kindergarten and first grade and longitudinally in between, among a nationally representative sample of 14,645 children from the Early Childhood Longitudinal Study-Kindergarten Cohort 2011. All analyses were adjusted for sex, race/ethnicity, parental education, and household income. Weekday TV-viewing time was correlated with BMI-z-score (P TV daily, children watching ≥1 h in kindergarten and first grade had a greater odds of overweight (1.50-1.60) and obesity (1.58-1.73). Children watching 1-TV had a greater odds of becoming overweight (1.39) and obese (1.86) between evaluations. Children watching as little as 1-TV daily were more likely to become overweight and obese over time. Physicians should encourage families to restrict TV-viewing time to reduce weight gain. © 2015 The Obesity Society.
26 CFR 1.802(b)-1 - Tax on life insurance companies.
2010-04-01
.... For the definition of the term “1954 life insurance company taxable income”, see § 1.805-1. (b) The... 26 Internal Revenue 8 2010-04-01 2010-04-01 false Tax on life insurance companies. 1.802(b)-1...) INCOME TAX (CONTINUED) INCOME TAXES Life Insurance Companies § 1.802(b)-1 Tax on life insurance companies...
The design strategy of selective PTP1B inhibitors over TCPTP.
Li, XiangQian; Wang, LiJun; Shi, DaYong
2016-08-15
Protein tyrosine phosphatase 1B (PTP1B) has already been well studied as a highly validated therapeutic target for diabetes and obesity. However, the lack of selectivity limited further studies and clinical applications of PTP1B inhibitors, especially over T-cell protein tyrosine phosphatase (TCPTP). In this review, we enumerate the published specific inhibitors of PTP1B, discuss the structure-activity relationships by analysis of their X-ray structures or docking results, and summarize the characteristic of selectivity related residues and groups. Furthermore, the design strategy of selective PTP1B inhibitors over TCPTP is also proposed. We hope our work could provide an effective way to gain specific PTP1B inhibitors. Copyright © 2016 Elsevier Ltd. All rights reserved.
Creekmore, Amy L; Ziegler, Yvonne S; Bonéy, Jamie L; Nardulli, Ann M
2007-03-15
We have used a chromatin immunoprecipitation (ChIP)-based cloning strategy to isolate and identify genes associated with estrogen receptor alpha (ERalpha) in MCF-7 human breast cancer cells. One of the gene regions isolated was a 288bp fragment from the ninth intron of the breast cancer 1 associated ring domain (BARD1) gene. We demonstrated that ERalpha associated with this region of the endogenous BARD 1 gene in MCF-7 cells, that ERalpha bound to three of five ERE half sites located in the 288bp BARD1 region, and that this 288bp BARD1 region conferred estrogen responsiveness to a heterologous promoter. Importantly, treatment of MCF-7 cells with estrogen increased BARD1 mRNA and protein levels. These findings demonstrate that ChIP cloning strategies can be utilized to successfully isolate regulatory regions that are far removed from the transcription start site and assist in identifying cis elements involved in conferring estrogen responsiveness.
Kim, Eun-Sang; Lee, You-Jin; Kim, Jeong-Rang; Kim, Joo-Wan; Kim, Tae-Wan; Chae, Ho-Jeong; Kim, Chul-Ung; Lee, Chang-Ha; Jeong, Soon-Yong
2016-02-01
Nanoporous Beta zeolite was dealuminated by weak acid treatment for reducing the acidity. Bi-functional catalysts were prepared using commercial Beta zeolites and the dealuminated zeolites for acidic function, NiW for metallic function. 1-Methylnaphthalene was selected as a model compound for multi-ring aromatics in heavy oil, and its selective ring opening reaction has been investigated using the prepared bi-functional catalysts with different acidity in fixed bed reaction system. The dealuminated Beta zeolites, which crystal structure and nanoporosity were maintained, showed the higher SiO2/Al2O3 ratio and smaller acidity than their original zeolite. NiW-supported catalyst using the dealuminated Beta zeolite with SiO2/Al203 mole ratio of 55 showed the highest performance for the selective ring opening. The acidity of catalyst seemed to play an important role as active sites for the selective ring opening of 1-methylnaphthalene but there should be some optimum catalyst acidity for the reaction. The acidity of Beta zeolite could be controlled by the acid treatment and the catalyst with the optimum acidity for the selective ring opening could be prepared.
Data of evolutionary structure change: 1BT8B-1EN5B [Confc[Archive
Lifescience Database Archive (English)
Full Text Available e>KGLKK----GTTLQ >H ---- > ATOM ...bChain>B 1BT8B KNMAPKGSAPERPT cture>H ...DChain> LVLKG--DKLAV >EEEE -- EEEE...ence>LVWDPLGKRINT >EEEE EEEEe> AT...re> ATOM 2237 CA LYS B 80 12.251 15.102 18.409 1.00 11.94 C
Reduced frequency of blood group Lewis a-b- in female Type 1 diabetes patients
DEFF Research Database (Denmark)
Kharagjitsingh, A.V.; Prinsen, K.; Lemkes, H.H.
2008-01-01
AIMS: To examine a disputed association between the Lewis(a(-)b(-)) phenotype and Type 1 diabetes (T1D). METHODS: Lewis red blood cell phenotyping was performed for 97 T1D White patients and 100 control subjects using monoclonal antibodies. Two historical cohorts were also included as a control...
Malara, M; Hübner-Wozniak, E; Lewandowska, I
2013-06-01
The purpose of the present study was to examine the nutritional status of vitamin B1, B2, and B6 in respect to dietary intake of these vitamins and activity coefficients of the erythrocyte enzymes transketolase, glutathione reductase, and aspartic aminotransferase in young men and women with different physical activity levels. The participants of this study were 20 women and 20 men with high physical activity (groups HAW and HAM, respectively), and 20 women and 20 men with low physical activity (groups LAW and LAM, respectively). The intake of vitamins B1, B2, B6, proteins, and calorie content of the diet was based on the average of the 4-day dietary recalls. To assess nutritional status of vitamin B1, B2, and B6, the activity coefficients (α) of erythrocyte transketolase (ETK), erythrocyte glutathione reductase (EGR), and erythrocyte aspartic aminotransferase (EAST) were estimated in blood hemolysates. The intake of the studied vitamins in the diet was statistically significantly lower in the female groups compared with the respective male groups. Deficiency of vitamin B6 in the diet was present more often in women than in men (in terms of the recommended dietary allowances [RDA]). Values of the activity coefficient αETK indicated that none of the groups in this study suffered the risk of vitamin B1 deficiency. The value of the activity coefficient αEGR indicated that the groups of women and men with low physical activity were more prone to vitamin B2 deficiency compared with the high physical activity groups. The risk of vitamin B6 deficiency (αEAST) in both male groups was higher than in both female groups. The obtained results do not allow for unequivocal determination of the impact of sex and the level of physical activity on intake and nutritional status of vitamin B1, B2, and B6. Independently of sex and the level of physical activity, the women and men consumed insufficient quantities of vitamins B1 and B6, although this was not always related to
Palanee-Phillips, Thesla; Schwartz, Katie; Brown, Elizabeth R; Govender, Vaneshree; Mgodi, Nyaradzo; Kiweewa, Flavia Matovu; Nair, Gonasagrie; Mhlanga, Felix; Siva, Samantha; Bekker, Linda-Gail; Jeenarain, Nitesha; Gaffoor, Zakir; Martinson, Francis; Makanani, Bonus; Naidoo, Sarita; Pather, Arendevi; Phillip, Jessica; Husnik, Marla J; van der Straten, Ariane; Soto-Torres, Lydia; Baeten, Jared
2015-01-01
Women in sub-Saharan Africa are a priority population for evaluation of new biomedical HIV-1 prevention strategies. Antiretroviral pre-exposure prophylaxis is a promising prevention approach; however, clinical trials among young women using daily or coitally-dependent products have found low adherence. Antiretroviral-containing vaginal microbicide rings, which release medication over a month or longer, may reduce these adherence challenges. ASPIRE (A Study to Prevent Infection with a Ring for Extended Use) is a phase III, randomized, double-blind, placebo-controlled trial testing the safety and effectiveness of a vaginal ring containing the non-nucleoside reverse transcriptase inhibitor dapivirine for prevention of HIV-1 infection. We describe the baseline characteristics of African women enrolled in the ASPIRE trial. Between August 2012 and June 2014, 5516 women were screened and 2629 HIV-1 seronegative women between 18-45 years of age were enrolled from 15 research sites in Malawi, South Africa, Uganda, and Zimbabwe. The median age was 26 years (IQR 22-31) and the majority (59%) were unmarried. Nearly 100% of participants reported having a primary sex partner in the prior three months but 43% did not know the HIV-1 status of their primary partner; 17% reported additional concurrent partners. Nearly two-thirds (64%) reported having disclosed to primary partners about planned vaginal ring use in the trial. Sexually transmitted infections were prevalent: 12% had Chlamydia trachomatis, 7% Trichomonas vaginalis, 4% Neisseria gonorrhoeae, and 1% syphilis. African HIV-1 seronegative women at risk of HIV -1 infection were successfully enrolled into a phase III trial of dapivirine vaginal ring for HIV-1 prevention.
Directory of Open Access Journals (Sweden)
Thesla Palanee-Phillips
Full Text Available Women in sub-Saharan Africa are a priority population for evaluation of new biomedical HIV-1 prevention strategies. Antiretroviral pre-exposure prophylaxis is a promising prevention approach; however, clinical trials among young women using daily or coitally-dependent products have found low adherence. Antiretroviral-containing vaginal microbicide rings, which release medication over a month or longer, may reduce these adherence challenges.ASPIRE (A Study to Prevent Infection with a Ring for Extended Use is a phase III, randomized, double-blind, placebo-controlled trial testing the safety and effectiveness of a vaginal ring containing the non-nucleoside reverse transcriptase inhibitor dapivirine for prevention of HIV-1 infection. We describe the baseline characteristics of African women enrolled in the ASPIRE trial.Between August 2012 and June 2014, 5516 women were screened and 2629 HIV-1 seronegative women between 18-45 years of age were enrolled from 15 research sites in Malawi, South Africa, Uganda, and Zimbabwe. The median age was 26 years (IQR 22-31 and the majority (59% were unmarried. Nearly 100% of participants reported having a primary sex partner in the prior three months but 43% did not know the HIV-1 status of their primary partner; 17% reported additional concurrent partners. Nearly two-thirds (64% reported having disclosed to primary partners about planned vaginal ring use in the trial. Sexually transmitted infections were prevalent: 12% had Chlamydia trachomatis, 7% Trichomonas vaginalis, 4% Neisseria gonorrhoeae, and 1% syphilis.African HIV-1 seronegative women at risk of HIV -1 infection were successfully enrolled into a phase III trial of dapivirine vaginal ring for HIV-1 prevention.
Palanee-Phillips, Thesla; Schwartz, Katie; Brown, Elizabeth R.; Govender, Vaneshree; Mgodi, Nyaradzo; Kiweewa, Flavia Matovu; Nair, Gonasagrie; Mhlanga, Felix; Siva, Samantha; Bekker, Linda-Gail; Jeenarain, Nitesha; Gaffoor, Zakir; Martinson, Francis; Makanani, Bonus; Naidoo, Sarita; Pather, Arendevi; Phillip, Jessica; Husnik, Marla J.; van der Straten, Ariane; Soto-Torres, Lydia; Baeten, Jared
2015-01-01
Introduction Women in sub-Saharan Africa are a priority population for evaluation of new biomedical HIV-1 prevention strategies. Antiretroviral pre-exposure prophylaxis is a promising prevention approach; however, clinical trials among young women using daily or coitally-dependent products have found low adherence. Antiretroviral-containing vaginal microbicide rings, which release medication over a month or longer, may reduce these adherence challenges. Methods ASPIRE (A Study to Prevent Infection with a Ring for Extended Use) is a phase III, randomized, double-blind, placebo-controlled trial testing the safety and effectiveness of a vaginal ring containing the non-nucleoside reverse transcriptase inhibitor dapivirine for prevention of HIV-1 infection. We describe the baseline characteristics of African women enrolled in the ASPIRE trial. Results Between August 2012 and June 2014, 5516 women were screened and 2629 HIV-1 seronegative women between 18–45 years of age were enrolled from 15 research sites in Malawi, South Africa, Uganda, and Zimbabwe. The median age was 26 years (IQR 22–31) and the majority (59%) were unmarried. Nearly 100% of participants reported having a primary sex partner in the prior three months but 43% did not know the HIV-1 status of their primary partner; 17% reported additional concurrent partners. Nearly two-thirds (64%) reported having disclosed to primary partners about planned vaginal ring use in the trial. Sexually transmitted infections were prevalent: 12% had Chlamydia trachomatis, 7% Trichomonas vaginalis, 4% Neisseria gonorrhoeae, and 1% syphilis. Conclusions African HIV-1 seronegative women at risk of HIV -1 infection were successfully enrolled into a phase III trial of dapivirine vaginal ring for HIV-1 prevention. PMID:26061040
Verification and validation of multi-group library MUSE1.0 created from ENDF/B-VII.0
International Nuclear Information System (INIS)
Chen Yixue; Wu Jun; Yang Shouhai; Zhang Bin; Lu Daogang; Chen Chaobin
2010-01-01
A multi-group library set named MUSE1.0 with 172-neutron group and 42-photon group is produced based on ENDF/B-VII.0 using NJOY code. Weight function of the multi-group library set is taken from the Vitanim-e library and the max legendre order of scattering matrix is six. All the nuclides have thermal scattering data created using free-gas scattering law and 10 Bondarenko background cross sections se lected to generate the self-shielded multi-group cross sections. The final libraries have GENDF-format, MATXS-format and ACE-multi-group sub-libraries and each sub-library generated under 4 temperatures(293 K,600 K,800 K and 900 K). This paper provides a summary of the procedure to produce the library set and a detail description of the validation of the multi-group library set by several critical benchmark devices and shielding benchmark devices using MCNP code. The ability to handle the thermal neutron transport and resonance self-shielding problems are investigated specially. In the end, we draw the conclusion that the multi-group libraries produced is credible and can be used in the R and D process of Supercritical Water Reactor Design. (authors)
Synthesis of a new class of fused cyclotetraphosphazene ring systems.
Beşli, Serap; Mutlu, Ceylan; İbişoğlu, Hanife; Yuksel, Fatma; Allen, Christopher W
2015-01-05
Octachlorocyclotetraphosphazene (1) was reacted with butylamines [n-butyl, i-butyl, sec-butyl, and t-butyl] in a 1:0.8 mol ratio in THF to obtain cyclotetraphosphazenes bearing a P-NH group, N4P4Cl7(NHR) [R = n-butyl (2a), i-butyl (2b), sec-butyl (2c), t-butyl (2d)](2a-d). The cyclotetraphosphazene derivatives 2a, 2b, and 2c were treated with sodium hydride giving rise to a new type of cyclophosphazene compounds (P8N8 ring) consisting of three fused tetramer rings (3a-c). Whereas reaction of sodium hydride with the t-butylaminocyclophosphazene derivative (2d) gave a P-O-P bridged compound (4) presumably as a result of hydrolysis reaction associated with moisture in the solvent. It is likely that the 16-membered cyclooctaphosphazene derivatives (3a-c) are formed by a proton abstraction/chloride ion elimination, intramolecular nucleophilic attack, ring opening and intermolecular condensation processes, respectively.
CYP1B1 expression, a potential risk factor for breast cancer
Energy Technology Data Exchange (ETDEWEB)
Goth-Goldstein, Regine; Erdmann, Christine A.; Russell, Marion
2001-05-31
CYP1B1 expression in non-tumor breast tissue from breast cancer patients and cancer-free individuals was determined to test the hypothesis that high CYP1B1 expression is a risk factor for breast cancer. Large interindividual variations in CYP1B1 expression were found with CYP1B1 levels notably higher in breast cancer patients than cancer-free individuals. The results indicate that CYP1B1 might play a role in breast cancer either through increased PAH activation or through metabolism of endogenous estrogen to a carcinogenic derivative.
DHU1 negatively regulates UV-B signaling via its direct interaction with COP1 and RUP1.
Kim, Sang-Hoon; Kim, Hani; Chung, Sunglan; Lee, Jae-Hoon
2017-09-16
Although DWD HYPERSENSITIVE TO UV-B 1 (DHU1) is reported to be a negative regulator in UV-B mediated cellular responses, its detailed role in UV-B signaling is still elusive. To further understand the action mechanism of DHU1 in UV-B response, physical and genetic interactions of DHU1 with various UV-B signaling components were investigated. Yeast two hybrid assay results suggested that DHU1 directly interacts with COP1 and RUP1, implying a functional connection with both COP1 and RUP1. In spite of the physical association between DHU1 and COP1, loss of DHU1 did not affect protein stability of COP1. Epistatic analysis showed that the functional loss of both DHU1 and UVR8 leads to alleviation of UV-B hypersensitivity displayed in dhu1-1. Moreover, phenotypic studies with dhu1-1 cop1-6 and dhu1-1 hy5-215 revealed that COP1 and HY5 are epistatic to DHU1, indicating that UV-B hypersensitivity of dhu1-1 requires both COP1 and HY5. In the case of dhu1-1 rup1-1, UV-B responsiveness was similar to that of both dhu1-1 and rup1-1, implying that DHU1 and RUP1 are required for each other's function. Collectively, these results show that the role of DHU1 as a negative regulator in UV-B response may be derived from its direct interaction with COP1 by sequestering COP1 from the active UVR8-COP1 complex, resulting in a decrease in the COP1 population that positively participates in UV-B signaling together with UVR8. Furthermore, this inhibitory role of DHU1 in UV-B signaling is likely to be functionally connected to RUP1. This study will serve as a platform to further understand more detailed action mechanism of DHU1 in UV-B response and DHU1-mediated core UV-B signaling in Arabidopsis. Copyright © 2017 Elsevier Inc. All rights reserved.
Postoperative Complications of Total Joint Arthroplasty in Obese Patients Stratified by BMI.
Zusmanovich, Mikhail; Kester, Benjamin S; Schwarzkopf, Ran
2018-03-01
High body mass index (BMI) is associated with significant complications in patients undergoing total joint arthroplasty. Many studies have evaluated this trend, but few have looked at the rates of complications based on BMI as a continuous variable. The purpose of this study was to stratify obese patients into 3 BMI categories and evaluate their rates of complications and gauge whether transitioning from higher to lower BMI category lowers complication. Patients undergoing primary total joint arthroplasty were selected from the National Surgical Quality Improvement Program database from 2008-2015 and arranged into 3 groups based on BMI: O1 (BMI 30-34.9 kg/m 2 ), O2 (BMI 35-39.9 kg/m 2 ), and O3 (BMI >40 kg/m 2 ). Thirty-day complications were recorded and evaluated utilizing univariate and multivariate analyses stratified by BMI. A total of 268,663 patients were identified. Patients with a BMI >30 kg/m 2 had more infectious and medical complications compared with nonobese patients. Furthermore, there were increased complications as the BMI categories increased. Patients with a BMI >40 kg/m 2 (O3) had longer operating times, length of stay, higher rates of readmissions, reoperations, deep venous thrombosis, renal insufficiency, superficial infections, deep infections, and wound dehiscence. These trends were present when comparing the O2 with O1 category as well. We have demonstrated increased rates of medical and surgical complications in obese patients. Furthermore, we demonstrated a stepwise increase in complication rates when transitioning to higher BMI groups. Based on our data, we believe that preoperative counseling and interventions to decrease BMI should be explored before offering elective surgery to obese patients. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Asunción Burguete
2008-12-01
Full Text Available A series of ring substituted 3-phenyl-1-(1,4-di-N-oxide quinoxalin-2-yl-2-propen-1-one derivatives were synthesized and tested for in vitro leishmanicidal activity against amastigotes of Leishmania amazonensis in axenical cultures and murine infected macrophages. Structure-activity relationships demonstrated the importance of a radical methoxy at position R3', R4' and R5'. (2E-3-(3,4,5-trimethoxy-phenyl-1-(3,6,7-trimethyl-1,4-dioxy-quinoxalin-2-yl-propenone was the most active. Cytotoxicity on macrophages revealed that this product was almost six times more active than toxic.
Abdulahad, D.A.; Westra, J.; Reefman, E.; Zuidersma, E.; Bijzet, J.; Limburg, P.C.; Kallenberg, C.G.M.; Bijl, M.
2013-01-01
Photosensitivity is characteristic of systemic lupus erythematosus (SLE). Upon ultraviolet B (UVB) exposure, patients develop inflammatory skin lesions in the vicinity of sunburn cells (SBCs). High mobility group box 1 (HMGB1) is released from apoptotic and activated cells and exerts inflammatory
Leak Rate Performance of Silicone Elastomer O-Rings Contaminated with JSC-1A Lunar Regolith Simulant
Oravec, Heather Ann; Daniels, Christopher C.
2014-01-01
Contamination of spacecraft components with planetary and foreign object debris is a growing concern. Face seals separating the spacecraft cabin from the debris filled environment are particularly susceptible; if the seal becomes contaminated there is potential for decreased performance, mission failure, or catastrophe. In this study, silicone elastomer O-rings were contaminated with JSC- 1A lunar regolith and their leak rate performance was evaluated. The leak rate values of contaminated O-rings at four levels of seal compression were compared to those of as-received, uncontaminated, O-rings. The results showed a drastic increase in leak rate after contamination. JSC-1A contaminated O-rings lead to immeasurably high leak rate values for all levels of compression except complete closure. Additionally, a mechanical method of simulant removal was examined. In general, this method returned the leak rate to as-received values.
Molnár, Ágnes; Kövesdi, Annamária; Szücs, Nikolette; Tóth, Miklós; Igaz, Péter; Rácz, Károly; Patócs, Attila
2016-08-01
Glucocorticoid substitution is essential in patients with chronic primary adrenocortical insufficiency (Addison's disease) and both over-treatment and inadequate dosage have deleterious effects. Individual sensitivity to glucocorticoids is partly genetically determined. To test the hypothesis whether the well-characterized SNPs of the GR and HSD11B1 genes may modulate the individual sensitivity to exogenous glucocorticoids and may influence clinical and/or laboratory parameters and the glucocorticoid substitution dosage in patients with Addison's disease. 68 patients with primary adrenocortical insufficiency were involved. Clinical and laboratory data, as well as the dosage of the hormone replacement therapy were collected. Peripheral blood DNA was isolated, and the GR and HSD11B1 SNPs were examined using allele-specific PCR or Taqman assay on Real Time PCR. The allele frequency of the GR N363S polymorphism was higher in patients compared to the control group and the disease appeared significantly earlier in patients harbouring the GR A3669G compared to noncarriers. These patients had higher ACTH level measured at the time of diagnosis. Homozygous BclI carriers had higher body mass index (BMI) and lower total hydrocortisone equivalent supplementation dose needed than heterozygous or noncarriers. The BMI and weight gain during hormone replacement therapy were also higher in carriers of the HSD11B1 rs4844880 treated with glucocorticoids other than dexamethasone. The BclI polymorphism of the GR gene and the rs4844880 of the HSD11B1 gene may contribute to weight gain and may affect the individual need of glucocorticoid substitution dose in these patients. © 2016 John Wiley & Sons Ltd.
Makhuri, Farahnaz Rezaei; Ghasemi, Jahan B
2015-10-12
In this study as the first attempt; comparative molecular field analysis (CoMFA), comparative molecular similarity indices analysis (CoMSIA) and AutoGPA-based 3D-QSAR methods were applied on a set of 47 recently reported Ck1d inhibitors, in order to gain an insight into the structural requirements which providing guidelines for the design of next generation compounds with enhanced bioactivity. The results of 3D-QSAR analyses indicated that hydrophobic and negatively charged groups at 6th position of benzothiazole ring and positively charged and bulky groups at ortho position of phenyl ring are favorable for high activity. Moreover, molecular docking studies with GOLD protocol revealed that this chemical series has two different orientations in CK1d active site: orientation 1, in which the benzothiazole ring of the compounds is the closet to the hydrophobic area created by Ile23 and 37, Ala36 Lys 38, Met80, 82 and Val81, and orientation 2, in which the benzene ring of the compounds is directed toward the hydrophobic center. Molecular docking result of the riluzole, the only drug approved by FDA for amyotrophic lateral sclerosis (ALS), indicated that the orientation 2 is preferred due to the presence of OCF3 group in R(1) situation at 6th position of benzothiazole ring, while with replacement of OCF3 group by CF3, the orientation 1 is observed. At the end, to find similar analogs by virtual screening, a two-stage approach: pharmacophore-based screening using generated AutoGPA-based 3D-QSAR model followed by structure-based virtual screening using molecular docking was employed. Visual inspection of the docking results of virtually obtained hits revealed two different binding orientations, in which compounds with high GOLD fitness scores produced binding modes, which were the same as the one observed in compounds with orientation 1, whereas the binding modes of the structures with low GOLD fitness scores were in agreement with orientation 2. Further, the drug
Nel, Annaléne; Martins, Janine; Bekker, Linda-Gail; Ramjee, Gita; Masenga, Gileard; Rees, Helen; van Niekerk, Neliëtte
2018-01-01
Women in sub-Saharan Africa are in urgent need of female-initiated human immunodeficiency virus (HIV) preventative methods. Vaginal rings are one dosage form in development for delivery of HIV microbicides. However, African women have limited experience with vaginal rings. This Phase I, randomized, crossover trial assessed and compared the safety, acceptability and adherence of a silicone elastomer placebo vaginal ring, intended as a microbicide delivery method, inserted for a 12-week period in healthy, HIV-negative, sexually active women in South Africa and Tanzania. 170 women, aged 18 to 35 years were enrolled with 88 women randomized to Group A, using a placebo vaginal ring for 12 weeks followed by a 12-week safety observation period. 82 women were randomized to Group B and observed for safety first, followed by a placebo vaginal ring for 12 weeks. Safety was assessed by clinical laboratory assessments, pelvic/colposcopy examinations and adverse events. Possible carry-over effect was addressed by ensuring no signs or symptoms of genital irritation at crossover. No safety concerns were identified for any safety variables assessed during the trial. No serious adverse events were reported considered related to the placebo vaginal ring. Vaginal candidiasis was the most common adverse event occurring in 11% of participants during each trial period. Vaginal discharge (2%), vaginal odour (2%), and bacterial vaginitis (2%) were assessed as possibly or probably related to the vaginal ring. Thirty-four percent of participants had sexually transmitted infections (STIs) at screening, compared to 12% of participants who tested positive for STIs at crossover and the final trial visit. Three participants (2%) tested HIV positive during the trial. The silicone elastomer vaginal ring had no safety concerns, demonstrating a profile favorable for further development for topical release of antiretroviral-based microbicides.
Directory of Open Access Journals (Sweden)
Jin Mao
2016-11-01
Full Text Available Aflatoxins, a group of extremely hazardous compounds because of their genotoxicity and carcinogenicity to human and animals, are commonly found in many tropical and subtropical regions. Ultraviolet (UV irradiation is proven to be an effective method to reduce or detoxify aflatoxins. However, the degradation products of aflatoxins under UV irradiation and their safety or toxicity have not been clear in practical production such as edible oil industry. In this study, the degradation products of aflatoxin B1 (AFB1 in peanut oil were analyzed by Ultra Performance Liquid Chromatograph-Thermo Quadrupole Exactive Focus mass spectrometry/mass spectrometry (UPLC-TQEF-MS/MS. The high-resolution mass spectra reflected that two main products were formed after the modification of a double bond in the terminal furan ring and the fracture of the lactone ring, while the small molecules especially nitrogen-containing compound may have participated in the photochemical reaction. According to the above results, the possible photodegradation pathway of AFB1 in peanut oil is proposed. Moreover, the human embryo hepatocytes viability assay indicated that the cell toxicity of degradation products after UV irradiation was much lower than that of AFB1, which could be attributed to the breakage of toxicological sites. These findings can provide new information for metabolic pathways and the hazard assessment of AFB1 using UV detoxification.
Mao, Jin; He, Bing; Zhang, Liangxiao; Li, Peiwu; Zhang, Qi; Ding, Xiaoxia; Zhang, Wen
2016-01-01
Aflatoxins, a group of extremely hazardous compounds because of their genotoxicity and carcinogenicity to human and animals, are commonly found in many tropical and subtropical regions. Ultraviolet (UV) irradiation is proven to be an effective method to reduce or detoxify aflatoxins. However, the degradation products of aflatoxins under UV irradiation and their safety or toxicity have not been clear in practical production such as edible oil industry. In this study, the degradation products of aflatoxin B1 (AFB1) in peanut oil were analyzed by Ultra Performance Liquid Chromatograph-Thermo Quadrupole Exactive Focus mass spectrometry/mass spectrometry (UPLC-TQEF-MS/MS). The high-resolution mass spectra reflected that two main products were formed after the modification of a double bond in the terminal furan ring and the fracture of the lactone ring, while the small molecules especially nitrogen-containing compound may have participated in the photochemical reaction. According to the above results, the possible photodegradation pathway of AFB1 in peanut oil is proposed. Moreover, the human embryo hepatocytes viability assay indicated that the cell toxicity of degradation products after UV irradiation was much lower than that of AFB1, which could be attributed to the breakage of toxicological sites. These findings can provide new information for metabolic pathways and the hazard assessment of AFB1 using UV detoxification. PMID:27845743
5-GHz passively mode-locked quantum dot ring laser diode at 1.5 μm
Heck, M.J.R.; Renault, A.; Bente, E.A.J.M.; Oei, Y.S.; Smit, M.K.; Eikema, K.S.E.; Ubachs, W.; Anantathanasarn, S.; Nötzel, R.
2008-01-01
In this paper we present the first observation of passive mode-locking in a quantum dot (QD) ring laser operating at wavelengths around 1.5 µm. The device consists of an 18-mm long (electrically pumped) ring cavity, corresponding to a 5-GHz roundtrip frequency. The waveguide width is 2 µm. A
4-[(5R*,10bR*-2-Methyl-1,10b-dihydropyrazolo[1,5-c][1,3]benzoxazin-5-yl]benzoic acid
Directory of Open Access Journals (Sweden)
Jan Světlík
2008-03-01
Full Text Available In the title compound, C18H16N2O3, a potential inhibitor of the cyclooxygenase-2 isoenzyme, the pyrazoline ring exists in a flattened envelope conformation with one C atom deviating by 0.463 Å from the mean plane of the remaining four atoms. The puckering of the central oxazine ring is more severe, with one N atom and one C atom displaced by 0.235 (6 and 0.370 (2 Å, respectively, on opposite sides of the mean plane defined by the other four atoms; the conformation is that of a half-chair. As a result, the molecule as a whole is not planar. The carboxyl group is involved in an intermolecular O—H...N hydrogen bond, which links the molecules into centrosymmetric dimers.
The PD-1/B7-H1 pathway modulates the natural killer cells versus mouse glioma stem cells.
Huang, Bo Yuan; Zhan, Yi Ping; Zong, Wen Jing; Yu, Chun Jiang; Li, Jun Fa; Qu, Yan Ming; Han, Song
2015-01-01
Glioblastoma multiforme (GBM) is the most malignant primary type of brain tumor in adults. There has been increased focus on the immunotherapies to treat GBM patients, the therapeutic value of natural killer (NK) cells is still unknown. Programmed death-1 (PD-1) is a major immunological checkpoint that can negatively regulate the T-cell-mediated immune response. We tested the combination of the inhibiting the PD-1/B7H1 pathway with a NK-cell mediated immune response in an orthotopic mouse model of GBM. Mouse glioma stem cells (GL261GSCs) and mouse NK cells were isolated and identified. A lactate dehydrogenase (LDH) assay was perfomed to detect the cytotoxicity of NK cells against GL261GSCs. GL261GSCs were intracranially implanted into mice, and the mice were stratified into 3 treatment groups: 1) control, 2) NK cells treatment, and 3) PD-1 inhibited NK cells treatment group. Overall survival was quantified, and animal magnetic resonance imaging (MRI) was performed to determine tumor growth. The brains were harvested after the mice were euthanized, and immunohistochemistry against CD45 and PCNA was performed. The mouse NK cells were identified as 90% CD3- NK1.1+CD335+ by flow cytometric analysis. In the LDH assay, the ratios of the damaged GL261GSCs, with the E:T ratios of 2.5:1, 5:1, and 10:1, were as follows: 1) non-inhibited group: 7.42%, 11.31%, and 15.1%, 2) B7H1 inhibited group: 14.75%, 18.25% and 29.1%, 3) PD-1 inhibited group: 15.53%, 19.21% and 29.93%, 4) double inhibited group: 33.24%, 42.86% and 54.91%. In the in vivo experiments, the mice in the PD-1 inhibited NK cells treatment group and IL-2-stimulated-NK cells treatment group displayed a slowest tumor growth (F = 308.5, Pmouse NK cells to kill the GL261GSCs, and the PD-1-inhibited NK cells could be a feasible immune therapeutic approach against GBM.
International Nuclear Information System (INIS)
Pannucci, N L; Li, D; Sahay, S; Thomas, E K; Chen, R; Tala, I; Hu, T; Ciccarelli, B T; Megjugorac, N J; Adams III, H C; Rodriguez, P L; Fitzpatrick, E R; Lagunoff, D; Williams, D A; Whitehead, I P
2013-01-01
Previous studies have demonstrated that p210 BCR/ABL1 interacts directly with the xeroderma pigmentosum group B (XPB) protein, and that XPB is phosphorylated on tyrosine in cells that express p210 BCR/ABL1. In the current study, we have constructed a p210 BCR/ABL1 mutant that can no longer bind to XPB. The mutant has normal kinase activity and interacts with GRB2, but can no longer phosphorylate XPB. Loss of XPB binding is associated with reduced expression of c-MYC and reduced transforming potential in ex-vivo clonogenicity assays, but does not affect nucleotide excision repair in lymphoid or myeloid cells. When examined in a bone marrow transplantation (BMT) model for chronic myelogenous leukemia, mice that express the mutant exhibit attenuated myeloproliferation and lymphoproliferation when compared with mice that express unmodified p210 BCR/ABL1. Thus, the mutant-transplanted mice show predominantly neutrophilic expansion and altered progenitor expansion, and have significantly extended lifespans. This was confirmed in a BMT model for B-cell acute lymphoblastic leukemia, wherein the majority of the mutant-transplanted mice remain disease free. These results suggest that the interaction between p210 BCR/ABL1 and XPB can contribute to disease progression by influencing the lineage commitment of lymphoid and myeloid progenitors
2010-01-01
... FEDERAL FINANCIAL ASSISTANCE General Provisions § 15b.1 Purpose. The purpose of this part is to implement... 7 Agriculture 1 2010-01-01 2010-01-01 false Purpose. 15b.1 Section 15b.1 Agriculture Office of the... receiving Federal financial assistance. ...
Carlsson, A; Kockum, I; Lindblad, B; Engleson, L; Nilsson, A; Forsander, G; Karlsson, A-K; Kernell, A; Ludvigsson, J; Marcus, C; Zachrisson, I; Ivarsson, S-A; Lernmark, A
2012-05-01
Type 1 diabetes and obesity has increased in childhood. We therefore tested the hypothesis that type 1 diabetes human leukocyte antigen DQ (HLA-DQ) risk genotypes may be associated with increased body mass index (BMI). The type 1 diabetes high-risk HLA-DQ A1*05:01-B1*02:01/A1*03:01-B1*03:02 genotype along with lower risk DQ genotypes were determined at the time of clinical onset by PCR and hybridization with allele-specific probes. BMI was determined after diabetes was stabilized. A total of 2403 incident type 1 diabetes children below 18 years of age were ascertained in the Swedish national Better Diabetes Diagnosis (BDD) study between May 2005 to September 2009. All children classified with type 1 diabetes, including positivity for at least one islet autoantibody, were investigated. Overall, type 1 diabetes HLA-DQ risk was negatively associated with BMI (P1-B1*02:01/A1*03:01-B1)03:02 genotype decreased with increasing BMI (Ptype 1 diabetes DQ genotypes were associated with an increased proportion of patients who were overweight or obese (P1). Indeed, the proportion of patients with the low-risk A1*05:01-B1*02:01/A1*05:01-B1*02:01 genotype increased with increasing BMI (P1-B1*02:01/A1*05:01-B1*02:01 genotype and increased BMI was significant (Pobese was 1.80 (95% confidence interval 1.21-2.61; Ptype 1 diabetes children with the A1*05:01-B1*02:01 haplotype was most pronounced in children diagnosed between 5 and 9 years of age. Susceptibility for childhood type 1 diabetes was unexpectedly found to be associated with the A1*05:01-B1*02:01/A1*05:01-B1*02:01 genotype and an increased BMI. These results support the hypothesis that overweight may contribute to the risk of type 1 diabetes in children positive for HLA-DQ A1*05:01-B1*02:01.
Directory of Open Access Journals (Sweden)
Krystal R. Fontenot
2013-09-01
Full Text Available The title compound, C26H22N5O4P3·C3H6O, has been achieved in a two-step synthesis that does not require chromatography. This molecule contains a seven-membered spirocyclic ring at two P-atom positions and a five-membered ring containing new P—N bonds at the other P-atom position. Endocyclic torsion angles about the central biphenyl C—C bonds are −41.5 (3 and −44.4 (3°, and P—N bonds of the central P3N3 ring are within the range 1.5665 (17–1.6171 (17 Å, while the P—O distances are in the range 1.5940 (14–1.6041 (14 Å. One N—H group makes an intermolecular N—H...N hydrogen bond, forming centrosymmetric dimers, while the other N—H group makes an N—H...O hydrogen bond to the acetone solvent molecule. The crystal was a two-component non-merohedral twin with ratio 0.811/0.189.
Long-term BMI and growth profiles in offspring of women with gestational diabetes.
Hammoud, Nurah M; Visser, Gerard H A; van Rossem, Lenie; Biesma, Douwe H; Wit, Jan M; de Valk, Harold W
2018-05-01
Gestational diabetes mellitus (GDM) is reported to be associated with childhood obesity, however the magnitude of this association and relation to intrauterine growth is uncertain. We, therefore, aimed to assess whether the growth trajectories of large for gestational age (LGA) and non-LGA offspring of mothers with GDM (OGDM) are different until early adolescence. We also aimed to explore whether growth trajectories of OGDM differ from those of offspring of mothers with type 1 or 2 diabetes (ODM1, ODM2). We studied height and BMI standard deviation score (SDS) of the OGDM group, up to the age of 14 years, with subgroup analysis comparing LGA with non-LGA at birth as a reflection of the intrauterine environment. All mothers with GDM who delivered at the University Medical Center Utrecht between 1990 and 2006 were contacted to participate; informed consent was received for 104 OGDM of 93 mothers. Offspring data were collected through Dutch infant welfare centres. Recorded height and weight were converted to BMI and age- and sex-specific SDS values for Dutch children. Additionally, we compared the OGDM group with ODM1 and ODM2 groups in order to identify those offspring with the highest risk of becoming overweight. Growth trajectories were compared between non-LGA and LGA OGDM and between OGDM, ODM1 and ODM2, using a random-effects model. In the longitudinal follow-up a mean of 7.4 ± 2 measurements per infant were available. Mothers had a prepregnancy BMI of 25.8 kg/m 2 and 24% of their infants were LGA at birth. Heights of OGDM were no different from those of the Dutch Growth Study. Non-LGA OGDM showed a BMI SDS comparable with that of the reference population, with a slight increase in early adolescence. LGA OGDM had a higher BMI SDS trajectory than non-LGA OGDM and the reference population, which plateaued at around 10 years of age. Comparison of growth trajectories of OGDM, ODM1 and ODM2 showed ODM2 to have the highest trajectory followed by ODM1 and OGDM
Radar imaging of Saturn's rings
Nicholson, Philip D.; French, Richard G.; Campbell, Donald B.; Margot, Jean-Luc; Nolan, Michael C.; Black, Gregory J.; Salo, Heikki J.
2005-09-01
We present delay-Doppler images of Saturn's rings based on radar observations made at Arecibo Observatory between 1999 and 2003, at a wavelength of 12.6 cm and at ring opening angles of 20.1°⩽|B|⩽26.7°. The average radar cross-section of the A ring is ˜77% relative to that of the B ring, while a stringent upper limit of 3% is placed on the cross-section of the C ring and 9% on that of the Cassini Division. These results are consistent with those obtained by Ostro et al. [1982, Icarus 49, 367-381] from radar observations at |B|=21.4°, but provide higher resolution maps of the rings' reflectivity profile. The average cross-section of the A and B rings, normalized by their projected unblocked area, is found to have decreased from 1.25±0.31 to 0.74±0.19 as the rings have opened up, while the circular polarization ratio has increased from 0.64±0.06 to 0.77±0.06. The steep decrease in cross-section is at variance with previous radar measurements [Ostro et al., 1980, Icarus 41, 381-388], and neither this nor the polarization variations are easily understood within the framework of either classical, many-particle-thick or monolayer ring models. One possible explanation involves vertical size segregation in the rings, whereby observations at larger elevation angles which see deeper into the rings preferentially see the larger particles concentrated near the rings' mid-plane. These larger particles may be less reflective and/or rougher and thus more depolarizing than the smaller ones. Images from all four years show a strong m=2 azimuthal asymmetry in the reflectivity of the A ring, with an amplitude of ±20% and minima at longitudes of 67±4° and 247±4° from the sub-Earth point. We attribute the asymmetry to the presence of gravitational wakes in the A ring as invoked by Colombo et al. [1976, Nature 264, 344-345] to explain the similar asymmetry long seen at optical wavelengths. A simple radiative transfer model suggests that the enhancement of the azimuthal
Extending the Impact of RAC1b Overexpression to Follicular Thyroid Carcinomas
Directory of Open Access Journals (Sweden)
Márcia Faria
2016-01-01
Full Text Available RAC1b is a hyperactive variant of the small GTPase RAC1 known to be a relevant molecular player in different cancers. Previous studies from our group lead to the evidence that its overexpression in papillary thyroid carcinoma (PTC is associated with an unfavorable prognosis. In the present study, we intended to extend the analysis of RAC1b expression to thyroid follicular neoplasms and to seek for clinical correlations. RAC1b expression levels were determined by RT-qPCR in thyroid follicular tumor samples comprising 23 follicular thyroid carcinomas (FTCs and 33 follicular thyroid adenomas (FTAs. RAC1b was found to be overexpressed in 33% of carcinomas while no RAC1b overexpression was documented among follicular adenomas. Patients with a diagnosis of FTC were divided into two groups based on longitudinal evolution and final outcome. RAC1b overexpression was significantly associated with both the presence of distant metastases (P = 0.01 and poorer clinical outcome (P = 0.01 suggesting that, similarly to that previously found in PTCs, RAC1b overexpression in FTCs is also associated with worse outcomes. Furthermore, the absence of RAC1b overexpression in follicular adenomas hints its potential as a molecular marker likely to contribute, in conjunction with other putative markers, to the preoperative differential diagnosis of thyroid follicular lesions.
Extending the Impact of RAC1b Overexpression to Follicular Thyroid Carcinomas
Faria, Márcia; Capinha, Liliana; Simões-Pereira, Joana; Bugalho, Maria João; Silva, Ana Luísa
2016-01-01
RAC1b is a hyperactive variant of the small GTPase RAC1 known to be a relevant molecular player in different cancers. Previous studies from our group lead to the evidence that its overexpression in papillary thyroid carcinoma (PTC) is associated with an unfavorable prognosis. In the present study, we intended to extend the analysis of RAC1b expression to thyroid follicular neoplasms and to seek for clinical correlations. RAC1b expression levels were determined by RT-qPCR in thyroid follicular tumor samples comprising 23 follicular thyroid carcinomas (FTCs) and 33 follicular thyroid adenomas (FTAs). RAC1b was found to be overexpressed in 33% of carcinomas while no RAC1b overexpression was documented among follicular adenomas. Patients with a diagnosis of FTC were divided into two groups based on longitudinal evolution and final outcome. RAC1b overexpression was significantly associated with both the presence of distant metastases (P = 0.01) and poorer clinical outcome (P = 0.01) suggesting that, similarly to that previously found in PTCs, RAC1b overexpression in FTCs is also associated with worse outcomes. Furthermore, the absence of RAC1b overexpression in follicular adenomas hints its potential as a molecular marker likely to contribute, in conjunction with other putative markers, to the preoperative differential diagnosis of thyroid follicular lesions. PMID:27127508
A bulk-controlled ring-VCO with 1/f-noise reduction for frequency ΔΣ modulator
DEFF Research Database (Denmark)
Tuan Vu, CAO; Wisland, Dag T.; Lande, Tor Sverre
The paper introduces a bulk-controlled ring-VCO with a tail transistor utilizing flicker-noise (1/f-noise) reduction techniques for a frequency-based DeltaSigma modulator (FDSM). This VCO converts an analog input voltage to phase information under various bias conditions ranging from sub-threshol......The paper introduces a bulk-controlled ring-VCO with a tail transistor utilizing flicker-noise (1/f-noise) reduction techniques for a frequency-based DeltaSigma modulator (FDSM). This VCO converts an analog input voltage to phase information under various bias conditions ranging from sub...
Ho, Yik-Khuan; Zhi, Huijun; Bowlin, Tara; Dorjbal, Batsukh; Philip, Subha; Zahoor, Muhammad Atif; Shih, Hsiu-Ming; Semmes, Oliver John; Schaefer, Brian; Glover, J N Mark; Giam, Chou-Zen
2015-08-01
Human T lymphotropic virus type 1 (HTLV-1) trans-activator/oncoprotein, Tax, impacts a multitude of cellular processes, including I-κB kinase (IKK)/NF-κB signaling, DNA damage repair, and mitosis. These activities of Tax have been implicated in the development of adult T-cell leukemia (ATL) in HTLV-1-infected individuals, but the underlying mechanisms remain obscure. IKK and its upstream kinase, TGFβ-activated kinase 1 (TAK1), contain ubiquitin-binding subunits, NEMO and TAB2/3 respectively, which interact with K63-linked polyubiquitin (K63-pUb) chains. Recruitment to K63-pUb allows cross auto-phosphorylation and activation of TAK1 to occur, followed by TAK1-catalyzed IKK phosphorylation and activation. Using cytosolic extracts of HeLa and Jurkat T cells supplemented with purified proteins we have identified ubiquitin E3 ligase, ring finger protein 8 (RNF8), and E2 conjugating enzymes, Ubc13:Uev1A and Ubc13:Uev2, to be the cellular factors utilized by Tax for TAK1 and IKK activation. In vitro, the combination of Tax and RNF8 greatly stimulated TAK1, IKK, IκBα and JNK phosphorylation. In vivo, RNF8 over-expression augmented while RNF8 ablation drastically reduced canonical NF-κB activation by Tax. Activation of the non-canonical NF-κB pathway by Tax, however, is unaffected by the loss of RNF8. Using purified components, we further demonstrated biochemically that Tax greatly stimulated RNF8 and Ubc13:Uev1A/Uev2 to assemble long K63-pUb chains. Finally, co-transfection of Tax with increasing amounts of RNF8 greatly induced K63-pUb assembly in a dose-dependent manner. Thus, Tax targets RNF8 and Ubc13:Uev1A/Uev2 to promote the assembly of K63-pUb chains, which signal the activation of TAK1 and multiple downstream kinases including IKK and JNK. Because of the roles RNF8 and K63-pUb chains play in DNA damage repair and cytokinesis, this mechanism may also explain the genomic instability of HTLV-1-transformed T cells and ATL cells.
2010-07-01
... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Procedures and Methods for Estimating Costs of Nitrogen Oxides Controls Applied to Group 1, Boilers B Appendix B to Part 76 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) ACID RAIN NITROGEN OXIDES...
Electronic structures of GaAs/AlxGa1-xAs quantum double rings
Directory of Open Access Journals (Sweden)
Li Shu-Shen
2006-01-01
Full Text Available AbstractIn the framework of effective mass envelope function theory, the electronic structures of GaAs/AlxGa1-xAs quantum double rings (QDRs are studied. Our model can be used to calculate the electronic structures of quantum wells, wires, dots, and the single ring. In calculations, the effects due to the different effective masses of electrons and holes in GaAs and AlxGa1-xAs and the valence band mixing are considered. The energy levels of electrons and holes are calculated for different shapes of QDRs. The calculated results are useful in designing and fabricating the interrelated photoelectric devices. The single electron states presented here are useful for the study of the electron correlations and the effects of magnetic fields in QDRs.
Gender expression associated with BMI in a prospective cohort study of US adolescents.
Bryn Austin, S; Ziyadeh, Najat J; Calzo, Jerel P; Sonneville, Kendrin R; Kennedy, Grace A; Roberts, Andrea L; Haines, Jess; Scherer, Emily A
2016-02-01
To examine the relationship between gender expression (GE) and BMI in adolescence. Repeated measures of weight-related behaviors and BMI were collected from 1996 to 2011 via annual/biennial self-report surveys from youth aged 10 to 23 years (6,693 females, 2,978 males) in the longitudinal Growing Up Today Study. GE (very conforming [referent], mostly conforming, nonconforming) was assessed in 2010/11. Sex-stratified, multivariable linear models estimated GE group differences in BMI and the contribution of sexual orientation and weight-related exposures to group differences. Models for males included interaction terms for GE with age. In females, mostly conforming youth had 0.53 kg m(-2) and nonconforming had 1.23 kg m(-2) higher BMI; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 8% and remained statistically significant. In males, mostly conforming youth had -0.67 kg m(-2) and nonconforming had -1.99 kg m(-2) lower BMI (age [in years]) interactions were between -0.09 and -0.14 kg m(-2) ; when adding adjustment for sexual orientation and weight-related exposures, GE group estimates were attenuated up to 11% and remained statistically significant. GE is a strong independent predictor of BMI in adolescence. Obesity prevention and treatment interventions with youth must address ways that gender norms may reinforce or undermine healthful behaviors. © 2016 The Obesity Society.
Cdt1 stabilizes an open MCM ring for helicase loading.
Frigola, Jordi; He, Jun; Kinkelin, Kerstin; Pye, Valerie E; Renault, Ludovic; Douglas, Max E; Remus, Dirk; Cherepanov, Peter; Costa, Alessandro; Diffley, John F X
2017-06-23
ORC, Cdc6 and Cdt1 act together to load hexameric MCM, the motor of the eukaryotic replicative helicase, into double hexamers at replication origins. Here we show that Cdt1 interacts with MCM subunits Mcm2, 4 and 6, which both destabilizes the Mcm2-5 interface and inhibits MCM ATPase activity. Using X-ray crystallography, we show that Cdt1 contains two winged-helix domains in the C-terminal half of the protein and a catalytically inactive dioxygenase-related N-terminal domain, which is important for MCM loading, but not for subsequent replication. We used these structures together with single-particle electron microscopy to generate three-dimensional models of MCM complexes. These show that Cdt1 stabilizes MCM in a left-handed spiral open at the Mcm2-5 gate. We propose that Cdt1 acts as a brace, holding MCM open for DNA entry and bound to ATP until ORC-Cdc6 triggers ATP hydrolysis by MCM, promoting both Cdt1 ejection and MCM ring closure.
(E-Methyl 3-(3,4-dimethoxyphenyl-2-[(1,3-dioxoisoindolin-2-ylmethyl]acrylate
Directory of Open Access Journals (Sweden)
D. Kannan
2012-04-01
Full Text Available In the title compound, C21H19NO6, the isoindole ring system is essentially planar [maximum deviation = 0.019 (2 Å for the N atom] and is oriented at a dihedral angle of 51.3 (1° with respect to the benzene ring. The two methoxy groups are almost coplanar with the attached benzene ring [C—O—C—C = 3.7 (4 and 4.3 (4°]. The molecular conformation is stabilized by an intramolecular C—H...O hydrogen bond, which generates an S(9 ring motif. In the crystal, molecules are linked through bifurcated C—H...(O,O hydrogen bonds having R12(5 ring motifs, forming chains along the b-axis direction. The crystal packing is further stabilzed by π–π interactions [centriod–centroid distance = 3.463 (1 Å].
Directory of Open Access Journals (Sweden)
Antunes Edson
2008-05-01
Full Text Available Abstract Background Obesity has been associated with a variety of disease such as type II diabetes mellitus, arterial hypertension and atherosclerosis. Evidences have shown that exercise training promotes beneficial effects on these disorders, but the underlying mechanisms are not fully understood. The aim of this study was to investigate whether physical preconditioning prevents the deleterious effect of high caloric diet in vascular reactivity of rat aortic and mesenteric rings. Methods Male Wistar rats were divided into sedentary (SD; trained (TR; sedentary diet (SDD and trained diet (TRD groups. Run training (RT was performed in sessions of 60 min, 5 days/week for 12 weeks (70–80% VO2max. Triglycerides, glucose, insulin and nitrite/nitrate concentrations (NOx- were measured. Concentration-response curves to acetylcholine (ACh and sodium nitroprusside (SNP were obtained. Expression of Cu/Zn superoxide dismutase (SOD-1 was assessed by Western blotting. Results High caloric diet increased triglycerides concentration (SDD: 216 ± 25 mg/dl and exercise training restored to the baseline value (TRD: 89 ± 9 mg/dl. Physical preconditioning significantly reduced insulin levels in both groups (TR: 0.54 ± 0.1 and TRD: 1.24 ± 0.3 ng/ml as compared to sedentary animals (SD: 0.87 ± 0.1 and SDD: 2.57 ± 0.3 ng/ml. On the other hand, glucose concentration was slightly increased by high caloric diet, and RT did not modify this parameter (SD: 126 ± 6; TR: 140 ± 8; SDD: 156 ± 8 and TRD 153 ± 9 mg/dl. Neither high caloric diet nor RT modified NOx- levels (SD: 27 ± 4; TR: 28 ± 6; SDD: 27 ± 3 and TRD: 30 ± 2 μM. Functional assays showed that high caloric diet impaired the relaxing response to ACh in mesenteric (about 13%, but not in aortic rings. RT improved the relaxing responses to ACh either in aortic (28%, for TR and 16%, to TRD groups or mesenteric rings (10%, for TR and 17%, to TRD groups that was accompanied by up-regulation of SOD-1
Kowalczyk, Agata; Kołodziejczyk, Michał; Gorąca, Anna
2015-12-31
The aim of the study was to evaluate the effect of BAY 11-7082, an NF-κB inhibitor, on basal and ET-1-induced production of reactive oxygen species (ROS), TNF-α and p65 protein in rat kidney. The experimental animals were divided into five groups (n=7) receiving: 1) saline (control); 2 and 3) ET-1 in a dose of 3 μg/kg body weight (b.w.) or 12.5 μg/kg b.w.; 4) BAY 11-7082 (10 mg/kg b.w.); 5) BAY 11-7082 (10 mg/kg b.w.) and ET-1 (12.5 μg/kg b.w.), respectively. In kidney homogenates the concentration of thiobarbituric acid reactive substances (TBARS), H2O2, TNF-α, p65 protein and GSH/GSSG ratio were determined. ET-1 resulted in a dose-dependent increase in TBARS and hydrogen peroxide (H2O2) levels, and a decrease in GSH/GSSG ratio when compared to the controls. BAY 11-7082 administered 1 h before ET-1 administration at a dose of 12.5 μg/kg resulted in a decrease (PET-1 groups. The level of TNF-α was increased (PET-1, while BAY 11-7082 reduced the TNF-α level (PET-1 induced oxidative stress in kidney tissue. These actions of BAY 11-7082 may result from reduced activity of NF-κB signaling pathways. Inhibition of the NF-κB pathway may be a promising strategy for preventing the progression of kidney damage.