WorldWideScience

Sample records for bmi-1-ring1b polycomb group

  1. Transcriptional regulation by Polycomb group proteins

    DEFF Research Database (Denmark)

    Di Croce, Luciano; Helin, Kristian

    2013-01-01

    Polycomb group (PcG) proteins are epigenetic regulators of transcription that have key roles in stem-cell identity, differentiation and disease. Mechanistically, they function within multiprotein complexes, called Polycomb repressive complexes (PRCs), which modify histones (and other proteins......) and silence target genes. The dynamics of PRC1 and PRC2 components has been the focus of recent research. Here we discuss our current knowledge of the PRC complexes, how they are targeted to chromatin and how the high diversity of the PcG proteins allows these complexes to influence cell identity....

  2. Polycomb group protein-mediated repression of transcription

    DEFF Research Database (Denmark)

    Morey, Lluís; Helin, Kristian

    2010-01-01

    The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work as transcri......The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work...... as transcriptional repressors is incompletely understood, but involves post-translational modifications of histones by two major PcG protein complexes: polycomb repressive complex 1 and polycomb repressive complex 2....

  3. Polycomb group protein bodybuilding: working out the routines.

    Science.gov (United States)

    Sievers, Cem; Paro, Renato

    2013-09-30

    Polycomb group (PcG) proteins regulate gene expression by modifying chemical and structural properties of chromatin. Isono et al. (2013) now report in Developmental Cell a polymerization-dependent mechanism used by PcG proteins to form higher-order chromatin structures, referred to as Polycomb bodies, and demonstrate its necessity for gene silencing. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Interactions of Polyhomeotic with Polycomb Group Genes of Drosophila Melanogaster

    OpenAIRE

    Cheng, N. N.; Sinclair, DAR.; Campbell, R. B.; Brock, H. W.

    1994-01-01

    The Polycomb (Pc) group genes of Drosophila are negative regulators of homeotic genes, but individual loci have pleiotropic phenotypes. It has been suggested that Pc group genes might form a regulatory hierarchy, or might be members of a multimeric complex that obeys the law of mass action. Recently, it was shown that polyhomeotic (ph) immunoprecipitates in a multimeric complex that includes Pc. Here, we show that duplications of ph suppress homeotic transformations of Pc and Pcl, supporting ...

  5. Polycomb-group genes sustaining the stem cell activity

    International Nuclear Information System (INIS)

    Takihara, Yoshihiro

    2006-01-01

    Polycomb-group genes (PcG) have a role in constituting the cellular memory mechanisms through which the once expressed phenotypes during development are transmitted thereafter and this review describes, together with authors' findings of sustaining hematopoietic stem cell activity by the PcG products, what molecular bases, involving the control of histone code, are concerned in the memory. Recent investigations have gradually elucidated the outline of epigenetic control mechanisms of the memory: messages are set up as a histone code in the chromatin and the PcG complex recruited by recognition of the code regulates the chromatin structure leading to DNA transcription and maintenance of the phenotype. Proliferation of hematopoietic stem cells ex vivo will be possible if exact and detailed mechanisms for PcG are made clear in future. Such ex vivo techniques are especially awaited for marrow remodeling treatment of hematopoietic failure induced by radiation exposure. (T.I.)

  6. Altered expression of polycomb group genes in glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Gang Li

    Full Text Available The Polycomb group (PcG proteins play a critical role in histone mediated epigenetics which has been implicated in the malignant evolution of glioblastoma multiforme (GBM. By systematically interrogating The Cancer Genome Atlas (TCGA, we discovered widespread aberrant expression of the PcG members in GBM samples compared to normal brain. The most striking differences were upregulation of EZH2, PHF19, CBX8 and PHC2 and downregulation of CBX7, CBX6, EZH1 and RYBP. Interestingly, changes in EZH2, PHF19, CBX7, CBX6 and EZH1 occurred progressively as astrocytoma grade increased. We validated the aberrant expression of CBX6, CBX7, CBX8 and EZH2 in GBM cell lines by Western blotting and qRT-PCR, and further the aberrant expression of CBX6 in GBM tissue samples by immunohistochemical staining. To determine if there was functional significance to the diminished CBX6 levels in GBM, CBX6 was overexpressed in GBM cells resulting in decreased proliferative capacity. In conclusion, aberrant expression of PcG proteins in GBMs may play a role in the development or maintenance of the malignancy.

  7. Polycomb group proteins in cell cycle progression and cancer

    DEFF Research Database (Denmark)

    Pasini, Diego; Bracken, Adrian P; Helin, Kristian

    2004-01-01

    Epigenetic deregulation of gene expression is emerging as key mechanism in tumorigenesis. Deregulated activity of the chromatin remodeling Polycomb Repressive Complex 2 (PRC2) has recently been shown to be a frequent event in human tumors. Here we discuss these findings and speculate on the role ...

  8. Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*

    Science.gov (United States)

    Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long

    2013-01-01

    Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668

  9. Lineage specific expression of Polycomb Group Proteins in human embryonic stem cells in vitro.

    Science.gov (United States)

    Pethe, Prasad; Pursani, Varsha; Bhartiya, Deepa

    2015-05-01

    Human embryonic (hES) stem cells are an excellent model to study lineage specification and differentiation into various cell types. Differentiation necessitates repression of specific genes not required for a particular lineage. Polycomb Group (PcG) proteins are key histone modifiers, whose primary function is gene repression. PcG proteins form complexes called Polycomb Repressive Complexes (PRCs), which catalyze histone modifications such as H2AK119ub1, H3K27me3, and H3K9me3. PcG proteins play a crucial role during differentiation of stem cells. The expression of PcG transcripts during differentiation of hES cells into endoderm, mesoderm, and ectoderm lineage is yet to be shown. In-house derived hES cell line KIND1 was differentiated into endoderm, mesoderm, and ectoderm lineages; followed by characterization using RT-PCR for HNF4A, CDX2, MEF2C, TBX5, SOX1, and MAP2. qRT-PCR and western blotting was performed to compare expression of PcG transcripts and proteins across all the three lineages. We observed that cells differentiated into endoderm showed upregulation of RING1B, BMI1, EZH2, and EED transcripts. Mesoderm differentiation was characterized by significant downregulation of all PcG transcripts during later stages. BMI1 and RING1B were upregulated while EZH2, SUZ12, and EED remained low during ectoderm differentiation. Western blotting also showed distinct expression of BMI1 and EZH2 during differentiation into three germ layers. Our study shows that hES cells differentiating into endoderm, mesoderm, and ectoderm lineages show distinct PcG expression profile at transcript and protein level. © 2015 International Federation for Cell Biology.

  10. A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell

    OpenAIRE

    Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira

    2008-01-01

    DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embry...

  11. Pluripotency factors and Polycomb Group proteins repress aryl hydrocarbon receptor expression in murine embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Chia-I Ko

    2014-01-01

    Full Text Available The aryl hydrocarbon receptor (AHR is a transcription factor and environmental sensor that regulates expression of genes involved in drug-metabolism and cell cycle regulation. Chromatin immunoprecipitation analyses, Ahr ablation in mice and studies with orthologous genes in invertebrates suggest that AHR may also play a significant role in embryonic development. To address this hypothesis, we studied the regulation of Ahr expression in mouse embryonic stem cells and their differentiated progeny. In ES cells, interactions between OCT3/4, NANOG, SOX2 and Polycomb Group proteins at the Ahr promoter repress AHR expression, which can also be repressed by ectopic expression of reprogramming factors in hepatoma cells. In ES cells, unproductive RNA polymerase II binds at the Ahr transcription start site and drives the synthesis of short abortive transcripts. Activation of Ahr expression during differentiation follows from reversal of repressive marks in Ahr promoter chromatin, release of pluripotency factors and PcG proteins, binding of Sp factors, establishment of histone marks of open chromatin, and engagement of active RNAPII to drive full-length RNA transcript elongation. Our results suggest that reversible Ahr repression in ES cells holds the gene poised for expression and allows for a quick switch to activation during embryonic development.

  12. Polycomb-group histone methyltransferase CLF is required for proper somatic recombination in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Na Chen; Wang-Bin Zhou; Ying-Xiang Wang; Ai-Wu Dong; Yu Yu

    2014-01-01

    Homologous recombination (HR) is a key process during meiosis in reproductive cells and the DNA damage repair process in somatic cells. Although chromatin structure is thought to be crucial for HR, only a smal number of chromatin modifiers have been studied in HR regulation so far. Here, we investigated the function of CURLY LEAF (CLF), a Polycomb-group (PcG) gene responsible for histone3 lysine 27 trimethy-lation (H3K27me3), in somatic and meiotic HR in Arabidopsis thaliana. Although fluorescent protein reporter assays in pol en and seeds showed that the frequency of meiotic cross-over in the loss-of-function mutant clf-29 was not significantly different from that in wild type, there was a lower frequency of HR in clf-29 than in wild type under normal conditions and under bleomycin treatment. The DNA damage levels were compara-ble between clf-29 and wild type, even though several DNA damage repair genes (e.g. ATM, BRCA2a, RAD50, RAD51, RAD54,and PARP2) were expressed at lower levels in clf-29. Under bleomycin treatment, the expression levels of DNA repair genes were similar in clf-29 and wild type, thus CLF may also regulate HR via other mechanisms. These findings expand the current knowledge of PcG function and contribute to general interests of epigenetic regulation in genome stability regulation.

  13. Epigenetic regulation of HIV-1 latency: focus on polycomb group (PcG) proteins.

    Science.gov (United States)

    Khan, Sheraz; Iqbal, Mazhar; Tariq, Muhammad; Baig, Shahid M; Abbas, Wasim

    2018-01-01

    HIV-1 latency allows the virus to persist until reactivation, in a transcriptionally silent form in its cellular reservoirs despite the presence of effective cART. Such viral persistence represents a major barrier to HIV eradication since treatment interruption leads to rebound plasma viremia. Polycomb group (PcG) proteins have recently got a considerable attention in regulating HIV-1 post-integration latency as they are involved in the repression of proviral gene expression through the methylation of histones. This epigenetic regulation plays an important role in the establishment and maintenance of HIV-1 latency. In fact, PcG proteins act in complexes and modulate the epigenetic signatures of integrated HIV-1 promoter. Key role played by PcG proteins in the molecular control of HIV-1 latency has led to hypothesize that PcG proteins may represent a valuable target for future HIV-1 therapy in purging HIV-1 reservoirs. In this regard, various small molecules have been synthesized or explored to specifically block the epigenetic activity of PcG. In this review, we will highlight the possible therapeutic approaches to achieve either a functional or sterilizing cure of HIV-1 infection with special focus on histone methylation by PcG proteins together with current and novel pharmacological approaches to reactivate HIV-1 from latency that could ultimately lead towards a better clearance of viral latent reservoirs.

  14. Polycomb Group Protein YY1 Is an Essential Regulator of Hematopoietic Stem Cell Quiescence

    Directory of Open Access Journals (Sweden)

    Zhanping Lu

    2018-02-01

    Full Text Available Yin yang 1 (YY1 is a ubiquitous transcription factor and mammalian polycomb group protein (PcG with important functions to regulate embryonic development, lineage differentiation, and cell proliferation. YY1 mediates stable PcG-dependent transcriptional repression via recruitment of PcG proteins that catalyze histone modifications. Many questions remain unanswered regarding how cell- and tissue-specificity is achieved by PcG proteins. Here, we demonstrate that a conditional knockout of Yy1 in hematopoietic stem cells (HSCs decreases long-term repopulating activity and ectopic YY1 expression expands HSCs. Although the YY1 PcG domain is required for Igκ chain rearrangement in B cells, the YY1 mutant lacking the PcG domain retained the capacity to stimulate HSC self-renewal. YY1 deficiency deregulated the genetic network governing HSC cell proliferation and impaired stem cell factor/c-Kit signaling, disrupting mechanisms conferring HSC quiescence. These results reveal a mechanism for how a ubiquitously expressed transcriptional repressor mediates lineage-specific functions to control adult hematopoiesis.

  15. Participation of Polycomb group gene extra sex combs in hedgehog signaling pathway

    International Nuclear Information System (INIS)

    Shindo, Norihisa; Sakai, Atsushi; Yamada, Kouji; Higashinakagawa, Toru

    2004-01-01

    Polycomb group (PcG) genes are required for stable inheritance of epigenetic states across cell divisions, a phenomenon termed cellular memory. PcG proteins form multimeric nuclear complex which modifies the chromatin structure of target site. Drosophila PcG gene extra sex combs (esc) and its vertebrate orthologs constitute a member of ESC-E(Z) complex, which possesses histone methyltransferase activity. Here we report isolation and characterization of medaka esc homolog, termed oleed. Hypomorphic knock-down of oleed using morpholino antisense oligonucleotides resulted in the fusion of eyes, termed cyclopia. Prechordal plate formation was not substantially impaired, but expression of hedgehog target genes was dependent on oleed, suggesting some link with hedgehog signaling. In support of this implication, histone methylation, which requires the activity of esc gene product, is increased in hedgehog stimulated mouse NIH-3T3 cells. Our data argue for the novel role of esc in hedgehog signaling and provide fundamental insight into the epigenetic mechanisms in general

  16. Small Ubiquitin-like Modifier (SUMO) Conjugation Impedes Transcriptional Silencing by the Polycomb Group Repressor Sex Comb on Midleg*

    OpenAIRE

    Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.

    2011-01-01

    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-te...

  17. Human Polycomb group EED protein negatively affects HIV-1 assembly and release

    Directory of Open Access Journals (Sweden)

    Darlix Jean-Luc

    2007-06-01

    Full Text Available Abstract Background The human EED protein, a member of the superfamily of Polycomb group (PcG proteins with WD-40 repeats, has been found to interact with three HIV-1 components, namely the structural Gag matrix protein (MA, the integrase enzyme (IN and the Nef protein. The aim of the present study was to analyze the possible biological role of EED in HIV-1 replication, using the HIV-1-based vector HIV-Luc and EED protein expressed by DNA transfection of 293T cells. Results During the early phase of HIV-1 infection, a slight negative effect on virus infectivity occurred in EED-expressing cells, which appeared to be dependent on EED-MA interaction. At late times post infection, EED caused an important reduction of virus production, from 20- to 25-fold as determined by CAp24 immunoassay, to 10- to 80-fold based on genomic RNA levels, and this decrease was not due to a reduction of Gag protein synthesis. Coexpression of WTNef, or the non-N-myristoylated mutant NefG2A, restored virus yields to levels obtained in the absence of exogenous EED protein. This effect was not observed with mutant NefΔ57 mimicking the Nef core, or with the lipid raft-retargeted fusion protein LAT-Nef. LATAA-Nef, a mutant defective in the lipid raft addressing function, had the same anti-EED effect as WTNef. Cell fractionation and confocal imaging showed that, in the absence of Nef, EED mainly localized in membrane domains different from the lipid rafts. Upon co-expression with WTNef, NefG2A or LATAA-Nef, but not with NefΔ57 or LAT-Nef, EED was found to relocate into an insoluble fraction along with Nef protein. Electron microscopy of HIV-Luc producer cells overexpressing EED showed significant less virus budding at the cell surface compared to control cells, and ectopic assembly and clustering of nuclear pore complexes within the cytoplasm. Conclusion Our data suggested that EED exerted an antiviral activity at the late stage of HIV-1 replication, which included genomic

  18. Transcriptional response of polycomb group genes to status epilepticus in mice is modified by prior exposure to epileptic preconditioning

    Directory of Open Access Journals (Sweden)

    James eReynolds

    2015-03-01

    Full Text Available Exposure of the brain to brief, non-harmful seizures can activate protective mechanisms that temporarily generate a damage-refractory state. This process, termed epileptic tolerance, is associated with large-scale down-regulation of gene expression. Polycomb group proteins are master controllers of gene silencing during development that are re-activated by injury to the brain. Here we explored the transcriptional response of genes associated with polycomb repressor complex (PRC 1 (Ring1A and Ring1B and Bmi1 and PRC2 (Ezh1, Ezh2 and Suz12, as well as additional transcriptional regulators Sirt1, Yy1 and Yy2, in a mouse model of status epilepticus. Findings were contrasted to changes after status epilepticus in mice previously given brief seizures to evoke tolerance. Real-time quantitative PCR showed status epilepticus prompted an early (1 h increase in expression of several genes in PRC1 and PRC2 in the hippocampus, followed by down-regulation of many of the same genes at later times points (4 , 8 and 24 h. Spatio-temporal differences were found among PRC2 genes in epileptic tolerance, including increased expression of Ezh2, Suz12 and Yy2 relative to the normal injury response to status epilepticus. In contrast, PRC1 complex genes including Ring 1B and Bmi1 displayed differential down-regulation in epileptic tolerance. The present study characterizes polycomb group gene expression following status epilepticus and shows prior seizure exposure produces select changes to PRC1 and PRC2 composition that may influence differential gene expression in epileptic tolerance.

  19. Polycomb group (PcG) proteins and Pax6 cooperate to inhibit in vivo reprogramming of the developing Drosophila eye.

    Science.gov (United States)

    Zhu, Jinjin; Ordway, Alison J; Weber, Lena; Buddika, Kasun; Kumar, Justin P

    2018-04-04

    How different cells and tissues commit to and determine their fates has been a central question in developmental biology since the seminal embryological experiments conducted by Wilhelm Roux and Hans Driesch in sea urchins and frogs. Here, we demonstrate that Polycomb group (PcG) proteins maintain Drosophila eye specification by suppressing the activation of alternative fate choices. The loss of PcG in the developing eye results in a cellular reprogramming event in which the eye is redirected to a wing fate. This fate transformation occurs with either the individual loss of Polycomb proteins or the simultaneous reduction of the Pleiohomeotic repressive complex and Pax6. Interestingly, the requirement for retinal selector genes is limited to Pax6, as the removal of more downstream members does not lead to the eye-wing transformation. We also show that distinct PcG complexes are required during different developmental windows throughout eye formation. These findings build on earlier observations that the eye can be reprogrammed to initiate head epidermis, antennal and leg development. © 2018. Published by The Company of Biologists Ltd.

  20. A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell

    Science.gov (United States)

    Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira

    2008-01-01

    DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embryonic and adult stem cells. By screening proteins responding to DNA damage using laser micro-irradiation, we found that PHF1, a human homolog of Drosophila polycomb-like, Pcl, protein, was recruited to DSBs immediately after irradiation and dissociated within 10 min. The accumulation at DSBs is Ku70/Ku80-dependent, and knockdown of PHF1 leads to X-ray sensitivity and increases the frequency of homologous recombination in HeLa cell. We found that PHF1 interacts physically with Ku70/Ku80, suggesting that PHF1 promotes nonhomologous end-joining processes. Furthermore, we found that PHF1 interacts with a number of proteins involved in DNA damage responses, RAD50, SMC1, DHX9 and p53, further suggesting that PHF1, besides the function in PcG, is involved in genome maintenance processes. PMID:18385154

  1. The immediate early gene product EGR1 and polycomb group proteins interact in epigenetic programming during chondrogenesis.

    Directory of Open Access Journals (Sweden)

    Frank Spaapen

    Full Text Available Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3 blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis.

  2. Small ubiquitin-like modifier (SUMO) conjugation impedes transcriptional silencing by the polycomb group repressor Sex Comb on Midleg.

    Science.gov (United States)

    Smith, Matthew; Mallin, Daniel R; Simon, Jeffrey A; Courey, Albert J

    2011-04-01

    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE.

  3. Small Ubiquitin-like Modifier (SUMO) Conjugation Impedes Transcriptional Silencing by the Polycomb Group Repressor Sex Comb on Midleg*

    Science.gov (United States)

    Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.

    2011-01-01

    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE. PMID:21278366

  4. Comparative Analysis of Chromatin Binding by Sex Comb on Midleg (SCM) and Other Polycomb Group Repressors at a Drosophila Hox Gene▿

    OpenAIRE

    Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.

    2010-01-01

    Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and othe...

  5. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  6. Structural Basis of Polycomb Bodies

    Czech Academy of Sciences Publication Activity Database

    Šmigová, J.; Juda, P.; Krejčí, Jana; Raška, I.

    2014-01-01

    Roč. 60, č. 1 (2014), s. 13-20 ISSN 0015-5500 R&D Projects: GA ČR(CZ) GBP302/12/G157; GA MŠk(CZ) EE2.3.30.0030 Institutional support: RVO:68081707 Keywords : Polycomb group proteins * Polycomb body * post-translational chromatin modifications Subject RIV: BO - Biophysics Impact factor: 1.000, year: 2014

  7. batman Interacts with polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor.

    Science.gov (United States)

    Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L

    2003-02-01

    Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.

  8. SSX2 is a novel DNA-binding protein that antagonizes polycomb group body formation and gene repression

    DEFF Research Database (Denmark)

    Gjerstorff, Morten Frier; Relster, Mette Marie; Greve, Katrine Buch Viden

    2014-01-01

    Polycomb group (PcG) complexes regulate cellular identity through epigenetic programming of chromatin. Here, we show that SSX2, a germline-specific protein ectopically expressed in melanoma and other types of human cancers, is a chromatin-associated protein that antagonizes BMI1 and EZH2 PcG body...... formation and derepresses PcG target genes. SSX2 further negatively regulates the level of the PcG-associated histone mark H3K27me3 in melanoma cells, and there is a clear inverse correlation between SSX2/3 expression and H3K27me3 in spermatogenesis. However, SSX2 does not affect the overall composition...

  9. Cooperativity, Specificity, and Evolutionary Stability of Polycomb Targeting in Drosophila

    Directory of Open Access Journals (Sweden)

    Bernd Schuettengruber

    2014-10-01

    Full Text Available Summary: Metazoan genomes are partitioned into modular chromosomal domains containing active or repressive chromatin. In flies, Polycomb group (PcG response elements (PREs recruit PHO and other DNA-binding factors and act as nucleation sites for the formation of Polycomb repressive domains. The sequence specificity of PREs is not well understood. Here, we use comparative epigenomics and transgenic assays to show that Drosophila domain organization and PRE specification are evolutionarily conserved despite significant cis-element divergence within Polycomb domains, whereas cis-element evolution is strongly correlated with transcription factor binding divergence outside of Polycomb domains. Cooperative interactions of PcG complexes and their recruiting factor PHO stabilize PHO recruitment to low-specificity sequences. Consistently, PHO recruitment to sites within Polycomb domains is stabilized by PRC1. These data suggest that cooperative rather than hierarchical interactions among low-affinity sequences, DNA-binding factors, and the Polycomb machinery are giving rise to specific and strongly conserved 3D structures in Drosophila. : Schuettengruber et al. present an extensive comparative epigenomics data set, providing new insights into cis-driven versus buffered evolution of Polycomb recruitment and Polycomb domain specificity. Using chromatin immunoprecipitation sequencing and transgenic assays, they demonstrate an extremely high conservation of Polycomb repressive domains in five Drosophila species. Using Hi-C and knockout experiments, they challenge the standard hierarchical Polycomb recruitment model and demonstrate that cooperative rather than hierarchical interactions among DNA motifs, transcription factors, and Polycomb group complexes define Polycomb domains.

  10. Characterization of an antagonistic switch between histone H3 lysine 27 methylation and acetylation in the transcriptional regulation of Polycomb group target genes

    DEFF Research Database (Denmark)

    Pasini, Diego; Malatesta, Martina; Jung, Hye Ryung

    2010-01-01

    Polycomb group (PcG) proteins are transcriptional repressors, which regulate proliferation and cell fate decisions during development, and their deregulated expression is a frequent event in human tumours. The Polycomb repressive complex 2 (PRC2) catalyzes trimethylation (me3) of histone H3 lysine...... are poorly understood. To gain insight into these mechanisms, we have determined the global changes in histone modifications in embryonic stem (ES) cells lacking the PcG protein Suz12 that is essential for PRC2 activity. We show that loss of PRC2 activity results in a global increase in H3K27 acetylation....... The methylation to acetylation switch correlates with the transcriptional activation of PcG target genes, both during ES cell differentiation and in MLL-AF9-transduced hematopoietic stem cells. Moreover, we provide evidence that the acetylation of H3K27 is catalyzed by the acetyltransferases p300 and CBP. Based...

  11. Polycomb Group Proteins RING1A and RING1B Regulate the Vegetative Phase Transition in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Jian Li

    2017-05-01

    Full Text Available Polycomb group (PcG protein-mediated gene silencing is a major regulatory mechanism in higher eukaryotes that affects gene expression at the transcriptional level. Here, we report that two conserved homologous PcG proteins, RING1A and RING1B (RING1A/B, are required for global H2A monoubiquitination (H2Aub in Arabidopsis. The mutation of RING1A/B increased the expression of members of the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL gene family and caused an early vegetative phase transition. The early vegetative phase transition observed in ring1a ring1b double mutant plants was dependent on an SPL family gene, and the H2Aub status of the chromatin at SPL locus was dependent on RING1A/B. Moreover, mutation in RING1A/B affected the miRNA156a-mediated vegetative phase transition, and RING1A/B and the AGO7-miR390-TAS3 pathway were found to additively regulate this transition in Arabidopsis. Together, our results demonstrate that RING1A/B regulates the vegetative phase transition in Arabidopsis through the repression of SPL family genes.

  12. Insulators target active genes to transcription factories and polycomb-repressed genes to polycomb bodies.

    Directory of Open Access Journals (Sweden)

    Hua-Bing Li

    2013-04-01

    Full Text Available Polycomb bodies are foci of Polycomb proteins in which different Polycomb target genes are thought to co-localize in the nucleus, looping out from their chromosomal context. We have shown previously that insulators, not Polycomb response elements (PREs, mediate associations among Polycomb Group (PcG targets to form Polycomb bodies. Here we use live imaging and 3C interactions to show that transgenes containing PREs and endogenous PcG-regulated genes are targeted by insulator proteins to different nuclear structures depending on their state of activity. When two genes are repressed, they co-localize in Polycomb bodies. When both are active, they are targeted to transcription factories in a fashion dependent on Trithorax and enhancer specificity as well as the insulator protein CTCF. In the absence of CTCF, assembly of Polycomb bodies is essentially reduced to those representing genomic clusters of Polycomb target genes. The critical role of Trithorax suggests that stable association with a specialized transcription factory underlies the cellular memory of the active state.

  13. Comparative analysis of chromatin binding by Sex Comb on Midleg (SCM) and other polycomb group repressors at a Drosophila Hox gene.

    Science.gov (United States)

    Wang, Liangjun; Jahren, Neal; Miller, Ellen L; Ketel, Carrie S; Mallin, Daniel R; Simon, Jeffrey A

    2010-06-01

    Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets.

  14. Comparative Analysis of Chromatin Binding by Sex Comb on Midleg (SCM) and Other Polycomb Group Repressors at a Drosophila Hox Gene▿

    Science.gov (United States)

    Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.

    2010-01-01

    Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets. PMID:20351181

  15. Polycomb Group Protein Displacement and Gene Activation through MSK-Dependent H3K27me3S28 Phosphorylation

    DEFF Research Database (Denmark)

    Gehani, Simmi Suman; Agrawal-Singh, Shuchi; Dietrich, Nikolaj

    2010-01-01

    Epigenetic regulation of chromatin structure is essential for the expression of genes determining cellular specification and function. The Polycomb repressive complex 2 (PRC2) di- and trimethylates histone H3 on lysine 27 (H3K27me2/me3) to establish repression of specific genes in embryonic stem ...

  16. Additional sex combs-like 1 belongs to the enhancer of trithorax and Polycomb Group and genetically interacts with Cbx2 in mice

    Science.gov (United States)

    Fisher, C.L.; Lee, I.; Bloyer, S.; Bozza, S.; Chevalier, J.; Dahl, A; Bodner, C.; Helgason, C. D.; Hess, J.L.; Humphries, R.K.; Brock, H.W.

    2009-01-01

    The Additional sex combs (Asx) gene of Drosophila behaves genetically as an enhancer of trithorax and Polycomb (ETP) in displaying bidirectional homeotic phenotypes, suggesting that is required for maintenance of both activation and silencing of Hox genes. There are 3 murine homologs of Asx called Additional sex combs-like1, 2, and-3. Asxl1 is required for normal adult hematopoiesis; however its embryonic function is unknown. We used a targeted mouse mutant line Asxl1tm1Bc to determine if Asxl1 is required to silence and activate Hox genes in mice during axial patterning. The mutant embryos exhibit simultaneous anterior and posterior transformations of the axial skeleton, consistent with a role for Asxl1 in activation and silencing of Hox genes. Transformations of the axial skeleton are enhanced in compound mutant embryos for the Polycomb group gene M33/Cbx2. Hox a4, a7, and c8 are derepressed in Asxl1tm1Bc mutants in the antero-posterior axis, but Hox c8 expression is reduced in the brain of mutants, consistent with Asxl1 being required both for activation and repression of Hox genes. We discuss the genetic and molecular definition of ETPs, and suggest that the function of Asxl1 depends on its cellular context. PMID:19833123

  17. The Polycomb group proteins bind throughout the INK4A-ARF locus and are disassociated in senescent cells

    DEFF Research Database (Denmark)

    Bracken, Adrian P; Kleine-Kohlbrecher, Daniela; Dietrich, Nikolaj

    2007-01-01

    The p16INK4A and p14ARF proteins, encoded by the INK4A-ARF locus, are key regulators of cellular senescence, yet the mechanisms triggering their up-regulation are not well understood. Here, we show that the ability of the oncogene BMI1 to repress the INK4A-ARF locus requires its direct association...... and is dependent on the continued presence of the EZH2-containing Polycomb-Repressive Complex 2 (PRC2) complex. Significantly, EZH2 is down-regulated in stressed and senescing populations of cells, coinciding with decreased levels of associated H3K27me3, displacement of BMI1, and activation of transcription...

  18. An Automatic Segmentation Method Combining an Active Contour Model and a Classification Technique for Detecting Polycomb-group Proteinsin High-Throughput Microscopy Images.

    Science.gov (United States)

    Gregoretti, Francesco; Cesarini, Elisa; Lanzuolo, Chiara; Oliva, Gennaro; Antonelli, Laura

    2016-01-01

    The large amount of data generated in biological experiments that rely on advanced microscopy can be handled only with automated image analysis. Most analyses require a reliable cell image segmentation eventually capable of detecting subcellular structures.We present an automatic segmentation method to detect Polycomb group (PcG) proteins areas isolated from nuclei regions in high-resolution fluorescent cell image stacks. It combines two segmentation algorithms that use an active contour model and a classification technique serving as a tool to better understand the subcellular three-dimensional distribution of PcG proteins in live cell image sequences. We obtained accurate results throughout several cell image datasets, coming from different cell types and corresponding to different fluorescent labels, without requiring elaborate adjustments to each dataset.

  19. Genome-Wide Identification of Polycomb Target Genes Reveals a Functional Association of Pho with Scm in Bombyx mori

    OpenAIRE

    Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

    2012-01-01

    Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent ...

  20. SSX and the synovial-sarcoma-specific chimaeric protein SYT-SSX co-localize with the human Polycomb group complex.

    Science.gov (United States)

    Soulez, M; Saurin, A J; Freemont, P S; Knight, J C

    1999-04-29

    Chromosome translocation t(X;18)(p11.2;q11.2) is unique to synovial sarcomas and results in an 'in frame' fusion of the SYT gene with the SSX1 or closely-related SSX2 gene. Wild-type SYT and SSX proteins, and the SYT-SSX chimaeric proteins, can modulate transcription in gene reporter assays. To help elucidate the role of these proteins in cell function and neoplasia we have performed immunolabelling experiments to determine their subcellular localization in three cell types. Transient expression of epitope-tagged proteins produced distinctive nuclear staining patterns. The punctate staining of SYT and SYT-SSX proteins showed some similarities. We immunolabelled a series of endogenous nuclear antigens and excluded the SYT and SYT-SSX focal staining from association with these domains (e.g. sites of active transcription, snRNPs). In further experiments we immunolabelled the Polycomb group (PcG) proteins RING1 or BMI-1 and showed that SSX and SYT-SSX proteins, but not SYT, co-localized with these markers. Consistent with this we show that SSX and SYT-SSX associate with chromatin, and also associate with condensed chromatin at metaphase. Noteably, SSX produced a dense signal over the surface of metaphase chromosomes whereas SYT-SSX produced discrete focal staining. Our data indicate that SSX and SYT-SSX proteins are recruited to nuclear domains occupied by PcG complexes, and this provides us with a new insight into the possible function of wild-type SSX and the mechanism by which the aberrant SYT-SSX protein might disrupt fundamental mechanisms controlling cell division and cell fate.

  1. Epigenetic chromatin modifiers in barley: IV. The study of barley Polycomb group (PcG genes during seed development and in response to external ABA

    Directory of Open Access Journals (Sweden)

    Stanca Michele A

    2010-04-01

    Full Text Available Abstract Background Epigenetic phenomena have been associated with the regulation of active and silent chromatin states achieved by modifications of chromatin structure through DNA methylation, and histone post-translational modifications. The latter is accomplished, in part, through the action of PcG (Polycomb group protein complexes which methylate nucleosomal histone tails at specific sites, ultimately leading to chromatin compaction and gene silencing. Different PcG complex variants operating during different developmental stages have been described in plants. In particular, the so-called FIE/MEA/FIS2 complex governs the expression of genes important in embryo and endosperm development in Arabidopsis. In our effort to understand the epigenetic mechanisms regulating seed development in barley (Hordeum vulgare, an agronomically important monocot plant cultivated for its endosperm, we set out to characterize the genes encoding barley PcG proteins. Results Four barley PcG gene homologues, named HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were identified and structurally and phylogenetically characterized. The corresponding genes HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were mapped onto barley chromosomes 7H, 4H, 2H and 5H, respectively. Expression analysis of the PcG genes revealed significant differences in gene expression among tissues and seed developmental stages and between barley cultivars with varying seed size. Furthermore, HvFIE and HvE(Z gene expression was responsive to the abiotic stress-related hormone abscisic acid (ABA known to be involved in seed maturation, dormancy and germination. Conclusion This study reports the first characterization of the PcG homologues, HvFIE, HvE(Z, HvSu(z12a and HvSu(z12b in barley. All genes co-localized with known chromosomal regions responsible for malting quality related traits, suggesting that they might be used for developing molecular markers to be applied in marker assisted selection. The Pc

  2. KDM2B recruitment of the Polycomb group complex, PRC1.1, requires cooperation between PCGF1 and BCORL1

    OpenAIRE

    Wong, Sarah J.; Gearhart, Micah D.; Taylor, Alexander B.; Nanyes, David R.; Ha, Daniel J.; Robinson, Angela K.; Artigas, Jason A.; Lee, Oliver J.; Demeler, Borries; Hart, P. John; Bardwell, Vivian J.; Kim, Chongwoo A.

    2016-01-01

    KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and the ...

  3. The Polycomb Group Protein L3MBTL1 Represses a SMAD5-Mediated Hematopoietic Transcriptional Program in Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Fabiana Perna

    2015-04-01

    Full Text Available Epigenetic regulation of key transcriptional programs is a critical mechanism that controls hematopoietic development, and, thus, aberrant expression patterns or mutations in epigenetic regulators occur frequently in hematologic malignancies. We demonstrate that the Polycomb protein L3MBTL1, which is monoallelically deleted in 20q- myeloid malignancies, represses the ability of stem cells to drive hematopoietic-specific transcriptional programs by regulating the expression of SMAD5 and impairing its recruitment to target regulatory regions. Indeed, knockdown of L3MBTL1 promotes the development of hematopoiesis and impairs neural cell fate in human pluripotent stem cells. We also found a role for L3MBTL1 in regulating SMAD5 target gene expression in mature hematopoietic cell populations, thereby affecting erythroid differentiation. Taken together, we have identified epigenetic priming of hematopoietic-specific transcriptional networks, which may assist in the development of therapeutic approaches for patients with anemia.

  4. A repetitive elements perspective in Polycomb epigenetics.

    Directory of Open Access Journals (Sweden)

    Valentina eCasa

    2012-10-01

    Full Text Available Repetitive elements comprise over two-thirds of the human genome. For a long time, these elements have received little attention since they were considered non functional. On the contrary, recent evidence indicates that they play central roles in genome integrity, gene expression and disease. Indeed, repeats display meiotic instability associated with disease and are located within common fragile sites, which are hotspots of chromosome rearrangements in tumors. Moreover, a variety of diseases have been associated with aberrant transcription of repetitive elements. Overall this indicates that appropriate regulation of repetitive elements’ activity is fundamental.Polycomb group (PcG proteins are epigenetic regulators that are essential for the normal development of multicellular organisms. Mammalian PcG proteins are involved in fundamental processes, such as cellular memory, cell proliferation, genomic imprinting, X-inactivation, and cancer development. PcG proteins can convey their activity through long-distance interactions also on different chromosomes. This indicates that the 3D organization of PcG proteins contributes significantly to their function. However, it is still unclear how these complex mechanisms are orchestrated and which role PcG proteins play in the multi-level organization of gene regulation. Intriguingly, the greatest proportion of Polycomb-mediated chromatin modifications is located in genomic repeats and it has been suggested that they could provide a binding platform for Polycomb proteins.Here, these lines of evidence are woven together to discuss how repetitive elements could contribute to chromatin organization in the 3D nuclear space.

  5. KDM2B Recruitment of the Polycomb Group Complex, PRC1.1, Requires Cooperation between PCGF1 and BCORL1.

    Science.gov (United States)

    Wong, Sarah J; Gearhart, Micah D; Taylor, Alexander B; Nanyes, David R; Ha, Daniel J; Robinson, Angela K; Artigas, Jason A; Lee, Oliver J; Demeler, Borries; Hart, P John; Bardwell, Vivian J; Kim, Chongwoo A

    2016-10-04

    KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes, and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA-binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and PCGF1, a core component of PRC1.1. The crystal structure of the KDM2B/SKP1/BCORL1/PCGF1 complex illustrates the crucial role played by the PCGF1/BCORL1 heterodimer. The BCORL1 PUFD domain positions residues preceding the RAWUL domain of PCGF1 to create an extended interface for interaction with KDM2B, which is unique to the PCGF1-containing PRC1.1 complex. The structure also suggests how KDM2B might simultaneously function in PRC1.1 and an SCF ubiquitin ligase complex and the possible molecular consequences of BCOR PUFD internal tandem duplications found in pediatric kidney and brain tumors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Genome-wide analysis of Polycomb targets in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, Yuri B.; Kahn, Tatyana G.; Nix, David A.; Li,Xiao-Yong; Bourgon, Richard; Biggin, Mark; Pirrotta, Vincenzo

    2006-04-01

    Polycomb Group (PcG) complexes are multiprotein assemblages that bind to chromatin and establish chromatin states leading to epigenetic silencing. PcG proteins regulate homeotic genes in flies and vertebrates but little is known about other PcG targets and the role of the PcG in development, differentiation and disease. We have determined the distribution of the PcG proteins PC, E(Z) and PSC and of histone H3K27 trimethylation in the Drosophila genome. At more than 200 PcG target genes, binding sites for the three PcG proteins colocalize to presumptive Polycomb Response Elements (PREs). In contrast, H3 me3K27 forms broad domains including the entire transcription unit and regulatory regions. PcG targets are highly enriched in genes encoding transcription factors but receptors, signaling proteins, morphogens and regulators representing all major developmental pathways are also included.

  7. Drosophila DNA-Binding Proteins in Polycomb Repression

    Directory of Open Access Journals (Sweden)

    Maksim Erokhin

    2018-01-01

    Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.

  8. Polycomb protein SCML2 associates with USP7 and counteracts histone H2A ubiquitination in the XY chromatin during male meiosis

    NARCIS (Netherlands)

    Luo, Mengcheng; Zhou, Jian; Leu, N. Adrian; Abreu, Carla M.; Wang, Jianle; Anguera, Montserrat C.; de Rooij, Dirk G.; Jasin, Maria; Wang, P. Jeremy

    2015-01-01

    Polycomb group proteins mediate transcriptional silencing in diverse developmental processes. Sex chromosomes undergo chromosome-wide transcription silencing during male meiosis. Here we report that mouse SCML2 (Sex comb on midleg-like 2), an X chromosome-encoded polycomb protein, is specifically

  9. Interaction proteomics analysis of polycomb proteins defines distinct PRC1 complexes in mammalian cells

    DEFF Research Database (Denmark)

    Vandamme, Julien; Völkel, Pamela; Rosnoblet, Claire

    2011-01-01

    Polycomb group (PcG) proteins maintain transcriptional repression of hundreds of genes involved in development, signaling or cancer using chromatin-based epigenetic mechanisms. Biochemical studies in Drosophila have revealed that PcG proteins associate in at least two classes of protein complexes...... known as Polycomb repressive complexes 1 and 2 (PRC1 and PRC2). Drosophila core PRC1 is composed of four subunits, Polycomb (Pc), Sex combs extra (Sce), Polyhomeotic (Ph), and Posterior sex combs (Psc). Each of these proteins has multiple orthologs in vertebrates classified respectively as the CBX, RING...... in order to identify interacting partners of CBX family proteins under the same experimental conditions. Our analysis identified with high confidence about 20 proteins co-eluted with CBX2 and CBX7 tagged proteins, about 40 with CBX4, and around 60 with CBX6 and CBX8. We provide evidences that the CBX...

  10. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Genome-wide identification of polycomb target genes reveals a functional association of Pho with Scm in Bombyx mori.

    Science.gov (United States)

    Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

    2012-01-01

    Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524) and BmScm (331 out of 532), and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.

  12. Genome-wide identification of polycomb target genes reveals a functional association of Pho with Scm in Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Zhiqing Li

    Full Text Available Polycomb group (PcG proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1, Polycomb repressive complex 2 (PRC2, and Pleiohomeotic repressive complex (PhoRC, to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524 and BmScm (331 out of 532, and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.

  13. Polycomb complexes act redundantly to repress genomic repeats and genes

    DEFF Research Database (Denmark)

    Leeb, Martin; Pasini, Diego; Novatchkova, Maria

    2010-01-01

    Polycomb complexes establish chromatin modifications for maintaining gene repression and are essential for embryonic development in mice. Here we use pluripotent embryonic stem (ES) cells to demonstrate an unexpected redundancy between Polycomb-repressive complex 1 (PRC1) and PRC2 during...... the formation of differentiated cells. ES cells lacking the function of either PRC1 or PRC2 can differentiate into cells of the three germ layers, whereas simultaneous loss of PRC1 and PRC2 abrogates differentiation. On the molecular level, the differentiation defect is caused by the derepression of a set...

  14. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  15. Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila

    DEFF Research Database (Denmark)

    Bantignies, Frédéric; Roure, Virginie; Comet, Itys

    2011-01-01

    In Drosophila melanogaster, Hox genes are organized in an anterior and a posterior cluster, called Antennapedia complex and bithorax complex, located on the same chromosome arm and separated by 10 Mb of DNA. Both clusters are repressed by Polycomb group (PcG) proteins. Here, we show that genes...... of the two Hox complexes can interact within nuclear PcG bodies in tissues where they are corepressed. This colocalization increases during development and depends on PcG proteins. Hox gene contacts are conserved in the distantly related Drosophila virilis species and they are part of a large gene...

  16. Polycomb repressive complex 2 (PRC2 restricts hematopoietic stem cell activity.

    Directory of Open Access Journals (Sweden)

    Ian J Majewski

    2008-04-01

    Full Text Available Polycomb group proteins are transcriptional repressors that play a central role in the establishment and maintenance of gene expression patterns during development. Using mice with an N-ethyl-N-nitrosourea (ENU-induced mutation in Suppressor of Zeste 12 (Suz12, a core component of Polycomb Repressive Complex 2 (PRC2, we show here that loss of Suz12 function enhances hematopoietic stem cell (HSC activity. In addition to these effects on a wild-type genetic background, mutations in Suz12 are sufficient to ameliorate the stem cell defect and thrombocytopenia present in mice that lack the thrombopoietin receptor (c-Mpl. To investigate the molecular targets of the PRC2 complex in the HSC compartment, we examined changes in global patterns of gene expression in cells deficient in Suz12. We identified a distinct set of genes that are regulated by Suz12 in hematopoietic cells, including eight genes that appear to be highly responsive to PRC2 function within this compartment. These data suggest that PRC2 is required to maintain a specific gene expression pattern in hematopoiesis that is indispensable to normal stem cell function.

  17. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  18. One, Two, Three: Polycomb Proteins Hit All Dimensions of Gene Regulation

    Directory of Open Access Journals (Sweden)

    Stefania del Prete

    2015-07-01

    Full Text Available Polycomb group (PcG proteins contribute to the formation and maintenance of a specific repressive chromatin state that prevents the expression of genes in a particular space and time. Polycomb repressive complexes (PRCs consist of several PcG proteins with specific regulatory or catalytic properties. PRCs are recruited to thousands of target genes, and various recruitment factors, including DNA-binding proteins and non-coding RNAs, are involved in the targeting. PcG proteins contribute to a multitude of biological processes by altering chromatin features at different scales. PcG proteins mediate both biochemical modifications of histone tails and biophysical modifications (e.g., chromatin fiber compaction and three-dimensional (3D chromatin conformation. Here, we review the role of PcG proteins in nuclear architecture, describing their impact on the structure of the chromatin fiber, on chromatin interactions, and on the spatial organization of the genome in nuclei. Although little is known about the role of plant PcG proteins in nuclear organization, much is known in the animal field, and we highlight similarities and differences in the roles of PcG proteins in 3D gene regulation in plants and animals.

  19. Polycomb enables primitive endoderm lineage priming in embryonic stem cells

    DEFF Research Database (Denmark)

    Illingworth, Robert S; Hölzenspies, Jurriaan J; Roske, Fabian V

    2016-01-01

    Mouse embryonic stem cells (ESCs), like the blastocyst from which they are derived, contain precursors of the epiblast (Epi) and primitive endoderm (PrEn) lineages. While transient in vivo, these precursor populations readily interconvert in vitro. We show that altered transcription is the driver...... polycomb with dynamic changes in transcription and stalled lineage commitment, allowing cells to explore alternative choices prior to a definitive decision....

  20. Polycomb group proteins in hematopoietic stem cell aging and malignancies

    NARCIS (Netherlands)

    Klauke, Karin; de Haan, Gerald

    Protection of the transcriptional "stemness" network is important to maintain a healthy hematopoietic stem cells (HSCs) compartment during the lifetime of the organism. Recent evidence shows that fundamental changes in the epigenetic status of HSCs might be one of the driving forces behind many

  1. Trithorax monomethylates histone H3K4 and interacts directly with CBP to promote H3K27 acetylation and antagonize Polycomb silencing

    Science.gov (United States)

    Tie, Feng; Banerjee, Rakhee; Saiakhova, Alina R.; Howard, Benny; Monteith, Kelsey E.; Scacheri, Peter C.; Cosgrove, Michael S.; Harte, Peter J.

    2014-01-01

    Trithorax (TRX) antagonizes epigenetic silencing by Polycomb group (PcG) proteins, stimulates enhancer-dependent transcription, and establishes a ‘cellular memory’ of active transcription of PcG-regulated genes. The mechanisms underlying these TRX functions remain largely unknown, but are presumed to involve its histone H3K4 methyltransferase activity. We report that the SET domains of TRX and TRX-related (TRR) have robust histone H3K4 monomethyltransferase activity in vitro and that Tyr3701 of TRX and Tyr2404 of TRR prevent them from being trimethyltransferases. The trxZ11 missense mutation (G3601S), which abolishes H3K4 methyltransferase activity in vitro, reduces the H3K4me1 but not the H3K4me3 level in vivo. trxZ11 also suppresses the impaired silencing phenotypes of the Pc3 mutant, suggesting that H3K4me1 is involved in antagonizing Polycomb silencing. Polycomb silencing is also antagonized by TRX-dependent H3K27 acetylation by CREB-binding protein (CBP). We show that perturbation of Polycomb silencing by TRX overexpression requires CBP. We also show that TRX and TRR are each physically associated with CBP in vivo, that TRX binds directly to the CBP KIX domain, and that the chromatin binding patterns of TRX and TRR are highly correlated with CBP and H3K4me1 genome-wide. In vitro acetylation of H3K27 by CBP is enhanced on K4me1-containing H3 substrates, and independently altering the H3K4me1 level in vivo, via the H3K4 demethylase LSD1, produces concordant changes in H3K27ac. These data indicate that the catalytic activities of TRX and CBP are physically coupled and suggest that both activities play roles in antagonizing Polycomb silencing, stimulating enhancer activity and cellular memory. PMID:24550119

  2. Mel-18, a mammalian Polycomb gene, regulates angiogenic gene expression of endothelial cells.

    Science.gov (United States)

    Jung, Ji-Hye; Choi, Hyun-Jung; Maeng, Yong-Sun; Choi, Jung-Yeon; Kim, Minhyung; Kwon, Ja-Young; Park, Yong-Won; Kim, Young-Myeong; Hwang, Daehee; Kwon, Young-Guen

    2010-10-01

    Mel-18 is a mammalian homolog of Polycomb group (PcG) genes. Microarray analysis revealed that Mel-18 expression was induced during endothelial progenitor cell (EPC) differentiation and correlates with the expression of EC-specific protein markers. Overexpression of Mel-18 promoted EPC differentiation and angiogenic activity of ECs. Accordingly, silencing Mel-18 inhibited EC migration and tube formation in vitro. Gene expression profiling showed that Mel-18 regulates angiogenic genes including kinase insert domain receptor (KDR), claudin 5, and angiopoietin-like 2. Our findings demonstrate, for the first time, that Mel-18 plays a significant role in the angiogenic function of ECs by regulating endothelial gene expression. Copyright © 2010 Elsevier Inc. All rights reserved.

  3. Clarifying the impact of polycomb complex component disruption in human cancers.

    Science.gov (United States)

    Yamamoto, Yukiya; Abe, Akihiro; Emi, Nobuhiko

    2014-04-01

    The dysregulation of proper transcriptional control is a major cause of developmental diseases and cancers. Polycomb proteins form chromatin-modifying complexes that transcriptionally silence genome regions in higher eukaryotes. The BCL6 corepressor (BCOR) complex comprises ring finger protein 1B (RNF2/RING1B), polycomb group ring finger 1 (PCGF1), and lysine-specific demethylase 2B (KDM2B) and is uniquely recruited to nonmethylated CpG islands, where it removes histone H3K36me2 and induces repressive histone H2A monoubiquitylation. Germline BCOR mutations have been detected in patients with oculofaciocardiodental and Lenz microphthalmia syndromes, which are inherited conditions. Recently, several variants of BCOR and BCOR-like 1 (BCORL1) chimeric fusion transcripts were reported in human cancers, including acute promyelocytic leukemia, bone sarcoma, and hepatocellular carcinoma. In addition, massively parallel sequencing has identified inactivating somatic BCOR and BCORL1 mutations in patients with acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia, medulloblastoma, and retinoblastoma. More importantly, patients with AML and MDS with BCOR mutations exhibit poor prognosis. This perspective highlights the detection of BCOR mutations and fusion transcripts of BCOR and BCORL1 and discusses their importance for diagnosing cancer subtypes and estimating the treatment responses of patients. Furthermore, this perspective proposes the need for additional functional studies to clarify the oncogenic mechanism by which BCOR and BCORL1 are disrupted in cancers, and how this may lead to the development of novel therapeutics. Mol Cancer Res; 12(4); 479-84. ©2014 AACR.

  4. Dopamine signaling leads to loss of Polycomb repression and aberrant gene activation in experimental parkinsonism.

    Directory of Open Access Journals (Sweden)

    Erik Södersten

    2014-09-01

    Full Text Available Polycomb group (PcG proteins bind to and repress genes in embryonic stem cells through lineage commitment to the terminal differentiated state. PcG repressed genes are commonly characterized by the presence of the epigenetic histone mark H3K27me3, catalyzed by the Polycomb repressive complex 2. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation. The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP experiments showed that increased H3K27me3S28p was accompanied by reduced PcG binding to regulatory regions of genes. An analysis of the genome wide distribution of L-DOPA-induced H3K27me3S28 phosphorylation by ChIP sequencing (ChIP-seq in combination with expression analysis by RNA-sequencing (RNA-seq showed that the induction of H3K27me3S28p correlated with increased expression of a subset of PcG repressed genes. We found that induction of H3K27me3S28p persisted during chronic L-DOPA administration to parkisonian mice and correlated with aberrant gene expression. We propose that dopaminergic transmission can activate PcG repressed genes in the adult brain and thereby contribute to long-term maladaptive responses including the motor complications, or dyskinesia, caused by prolonged administration of L-DOPA in Parkinson's disease.

  5. Ruled by Ubiquitylation: A New Order for Polycomb Recruitment

    Directory of Open Access Journals (Sweden)

    Yuri B. Schwartz

    2014-07-01

    Full Text Available Polycomb complexes are found in most cells, but they must be targeted to specific genes in specific cell types in order to regulate pluripotency and differentiation. The recruitment of Polycomb complexes to specific targets has been widely thought to occur in two steps: first, one complex, PRC2, produces histone H3 lysine 27 (H3K27 trimethylation at a specific gene, and then the PRC1 complex is recruited by its ability to bind to H3K27me3. Now, three new articles turn this model upside-down by showing that binding of a variant PRC1 complex and subsequent H2A ubiquitylation of surrounding chromatin is sufficient to trigger the recruitment of PRC2 and H3K27 trimethylation. These studies also show that ubiquitylated H2A is directly sensed by PRC2 and that ablation of PRC1-mediated H2A ubiquitylation impairs genome-wide PRC2 binding and disrupts mouse development.

  6. Alternative epigenetic chromatin states of polycomb target genes.

    Directory of Open Access Journals (Sweden)

    Yuri B Schwartz

    2010-01-01

    Full Text Available Polycomb (PcG regulation has been thought to produce stable long-term gene silencing. Genomic analyses in Drosophila and mammals, however, have shown that it targets many genes, which can switch state during development. Genetic evidence indicates that critical for the active state of PcG target genes are the histone methyltransferases Trithorax (TRX and ASH1. Here we analyze the repertoire of alternative states in which PcG target genes are found in different Drosophila cell lines and the role of PcG proteins TRX and ASH1 in controlling these states. Using extensive genome-wide chromatin immunoprecipitation analysis, RNAi knockdowns, and quantitative RT-PCR, we show that, in addition to the known repressed state, PcG targets can reside in a transcriptionally active state characterized by formation of an extended domain enriched in ASH1, the N-terminal, but not C-terminal moiety of TRX and H3K27ac. ASH1/TRX N-ter domains and transcription are not incompatible with repressive marks, sometimes resulting in a "balanced" state modulated by both repressors and activators. Often however, loss of PcG repression results instead in a "void" state, lacking transcription, H3K27ac, or binding of TRX or ASH1. We conclude that PcG repression is dynamic, not static, and that the propensity of a target gene to switch states depends on relative levels of PcG, TRX, and activators. N-ter TRX plays a remarkable role that antagonizes PcG repression and preempts H3K27 methylation by acetylation. This role is distinct from that usually attributed to TRX/MLL proteins at the promoter. These results have important implications for Polycomb gene regulation, the "bivalent" chromatin state of embryonic stem cells, and gene expression in development.

  7. Switch-Like Roles for Polycomb Proteins from Neurodevelopment to Neurodegeneration

    Directory of Open Access Journals (Sweden)

    Anke Hoffmann

    2017-12-01

    Full Text Available Polycomb Group (PcG proteins are best-known for maintaining repressive or active chromatin states that are passed on across multiple cell divisions, and thus sustain long-term memory of gene expression. PcG proteins engage different, partly gene- and/or stage-specific, mechanisms to mediate spatiotemporal gene expression during central nervous system development. In the course of this, PcG proteins bind to various cis-regulatory sequences (e.g., promoters, enhancers or silencers and coordinate, as well the interactions between distantly separated genomic regions to control chromatin function at different scales ranging from compaction of the linear chromatin to the formation of topological hubs. Recent findings show that PcG proteins are involved in switch-like changes in gene expression states of selected neural genes during the transition from multipotent to differentiating cells, and then to mature neurons. Beyond neurodevelopment, PcG proteins sustain mature neuronal function and viability, and prevent progressive neurodegeneration in mice. In support of this view, neuropathological findings from human neurodegenerative diseases point to altered PcG functions. Overall, improved insight into the multiplicity of PcG functions may advance our understanding of human neurodegenerative diseases and ultimately pave the way to new therapies.

  8. A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma.

    Science.gov (United States)

    Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D; Schlecht, Nicolas F; Einstein, Mark H; Greally, John M

    2016-09-20

    Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors.

  9. Polycomb proteins control proliferation and transformation independently of cell cycle checkpoints by regulating DNA replication

    DEFF Research Database (Denmark)

    Piunti, Andrea; Rossi, Alessandra; Cerutti, Aurora

    2014-01-01

    The ability of PRC1 and PRC2 to promote proliferation is a main feature that links polycomb (PcG) activity to cancer. PcGs silence the expression of the tumour suppressor locus Ink4a/Arf, whose products positively regulate pRb and p53 functions. Enhanced PcG activity is a frequent feature of human...

  10. The Arabidopsis GAGA-Binding Factor BASIC PENTACYSTEINE6 Recruits the POLYCOMB-REPRESSIVE COMPLEX1 Component LIKE HETEROCHROMATIN PROTEIN1 to GAGA DNA Motifs.

    Science.gov (United States)

    Hecker, Andreas; Brand, Luise H; Peter, Sébastien; Simoncello, Nathalie; Kilian, Joachim; Harter, Klaus; Gaudin, Valérie; Wanke, Dierk

    2015-07-01

    Polycomb-repressive complexes (PRCs) play key roles in development by repressing a large number of genes involved in various functions. Much, however, remains to be discovered about PRC-silencing mechanisms as well as their targeting to specific genomic regions. Besides other mechanisms, GAGA-binding factors in animals can guide PRC members in a sequence-specific manner to Polycomb-responsive DNA elements. Here, we show that the Arabidopsis (Arabidopsis thaliana) GAGA-motif binding factor protein basic pentacysteine6 (BPC6) interacts with like heterochromatin protein1 (LHP1), a PRC1 component, and associates with vernalization2 (VRN2), a PRC2 component, in vivo. By using a modified DNA-protein interaction enzyme-linked immunosorbant assay, we could show that BPC6 was required and sufficient to recruit LHP1 to GAGA motif-containing DNA probes in vitro. We also found that LHP1 interacts with VRN2 and, therefore, can function as a possible scaffold between BPC6 and VRN2. The lhp1-4 bpc4 bpc6 triple mutant displayed a pleiotropic phenotype, extreme dwarfism and early flowering, which disclosed synergistic functions of LHP1 and group II plant BPC members. Transcriptome analyses supported this synergy and suggested a possible function in the concerted repression of homeotic genes, probably through histone H3 lysine-27 trimethylation. Hence, our findings suggest striking similarities between animal and plant GAGA-binding factors in the recruitment of PRC1 and PRC2 components to Polycomb-responsive DNA element-like GAGA motifs, which must have evolved through convergent evolution. © 2015 American Society of Plant Biologists. All Rights Reserved.

  11. Polycomb Protein OsFIE2 Affects Plant Height and Grain Yield in Rice.

    Directory of Open Access Journals (Sweden)

    Xianbo Liu

    Full Text Available Polycomb group (PcG proteins have been shown to affect growth and development in plants. To further elucidate their role in these processes in rice, we isolated and characterized a rice mutant which exhibits dwarfism, reduced seed setting rate, defective floral organ, and small grains. Map-based cloning revealed that abnormal phenotypes were attributed to a mutation of the Fertilization Independent Endosperm 2 (OsFIE2 protein, which belongs to the PcG protein family. So we named the mutant as osfie2-1. Histological analysis revealed that the number of longitudinal cells in the internodes decreased in osfie2-1, and that lateral cell layer of the internodes was markedly thinner than wild-type. In addition, compared to wild-type, the number of large and small vascular bundles decreased in osfie2-1, as well as cell number and cell size in spikelet hulls. OsFIE2 is expressed in most tissues and the coded protein localizes in both nucleus and cytoplasm. Yeast two-hybrid and bimolecular fluorescence complementation assays demonstrated that OsFIE2 interacts with OsiEZ1 which encodes an enhancer of zeste protein previously identified as a histone methylation enzyme. RNA sequencing-based transcriptome profiling and qRT-PCR analysis revealed that some homeotic genes and genes involved in endosperm starch synthesis, cell division/expansion and hormone synthesis and signaling are differentially expressed between osfie2-1 and wild-type. In addition, the contents of IAA, GA3, ABA, JA and SA in osfie2-1 are significantly different from those in wild-type. Taken together, these results indicate that OsFIE2 plays an important role in the regulation of plant height and grain yield in rice.

  12. Polycomb Cbx family members mediate the balance between haematopoietic stem cell self-renewal and differentiation

    DEFF Research Database (Denmark)

    Klauke, Karin; Radulović, Višnja; Broekhuis, Mathilde

    2013-01-01

    The balance between self-renewal and differentiation of adult stem cells is essential for tissue homeostasis. Here we show that in the haematopoietic system this process is governed by polycomb chromobox (Cbx) proteins. Cbx7 is specifically expressed in haematopoietic stem cells (HSCs), and its...... overexpression enhances self-renewal and induces leukaemia. This effect is dependent on integration into polycomb repressive complex-1 (PRC1) and requires H3K27me3 binding. In contrast, overexpression of Cbx2, Cbx4 or Cbx8 results in differentiation and exhaustion of HSCs. ChIP-sequencing analysis shows that Cbx......7 and Cbx8 share most of their targets; we identified approximately 200 differential targets. Whereas genes targeted by Cbx8 are highly expressed in HSCs and become repressed in progenitors, Cbx7 targets show the opposite expression pattern. Thus, Cbx7 preserves HSC self-renewal by repressing...

  13. A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

    KAUST Repository

    Lengsfeld, Bettina M.; Berry, Kayla N.; Ghosh, Sharmistha; Takahashi, Masateru; Francis, Nicole J.

    2012-01-01

    Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

  14. A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma

    Science.gov (United States)

    Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D.; Schlecht, Nicolas F.; Einstein, Mark H.; Greally, John M.

    2016-01-01

    Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors. PMID:27557505

  15. A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

    KAUST Repository

    Lengsfeld, Bettina M.

    2012-09-17

    Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

  16. REST-mediated recruitment of polycomb repressor complexes in mammalian cells

    DEFF Research Database (Denmark)

    Dietrich, Nikolaj; Lerdrup, Mads; Landt, Eskild

    2012-01-01

    Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1......, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest¿/¿ and Eed¿/¿ mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently...... of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest¿/¿ mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context...

  17. A Cbx8-containing polycomb complex facilitates the transition to gene activation during ES cell differentiation.

    Directory of Open Access Journals (Sweden)

    Catherine Creppe

    2014-12-01

    Full Text Available Polycomb proteins play an essential role in maintaining the repression of developmental genes in self-renewing embryonic stem cells. The exact mechanism allowing the derepression of polycomb target genes during cell differentiation remains unclear. Our project aimed to identify Cbx8 binding sites in differentiating mouse embryonic stem cells. Therefore, we used a genome-wide chromatin immunoprecipitation of endogenous Cbx8 coupled to direct massive parallel sequencing (ChIP-Seq. Our analysis identified 171 high confidence peaks. By crossing our data with previously published microarray analysis, we show that several differentiation genes transiently recruit Cbx8 during their early activation. Depletion of Cbx8 partially impairs the transcriptional activation of these genes. Both interaction analysis, as well as chromatin immunoprecipitation experiments support the idea that activating Cbx8 acts in the context of an intact PRC1 complex. Prolonged gene activation results in eviction of PRC1 despite persisting H3K27me3 and H2A ubiquitination. The composition of PRC1 is highly modular and changes when embryonic stem cells commit to differentiation. We further demonstrate that the exchange of Cbx7 for Cbx8 is required for the effective activation of differentiation genes. Taken together, our results establish a function for a Cbx8-containing complex in facilitating the transition from a Polycomb-repressed chromatin state to an active state. As this affects several key regulatory differentiation genes this mechanism is likely to contribute to the robust execution of differentiation programs.

  18. Polycomb domain formation depends on short and long distance regulatory cues.

    Directory of Open Access Journals (Sweden)

    Bernd Schuettengruber

    Full Text Available BACKGROUND: Polycomb group (PcG proteins dynamically define cellular identities through the epigenetic repression of key developmental genes. In Drosophila, cis-regulatory regions termed PcG response elements (PREs act as nucleation sites for PcG proteins to create large repressive PcG domains that are marked by trimethylation of lysine 27 on histone H3 (H3K27me3. In addition to an action in cis, PREs can interact over long distances, thereby enhancing PcG dependent silencing. How PcG domains are established, which factors limit their propagation in cis, and how long range interactions of PREs in trans affect the chromatin structure is largely unknown. PRINCIPAL FINDINGS: We demonstrate that the insertion of a PRE-containing transgene in the Drosophila genome generates an artificial PcG domain and we analyze its organization by quantitative ChIP and ChIP-on-chip experiments. Intriguingly, a boundary element and known insulator proteins do not necessarily interfere with spreading of H3K27me3. Instead, domain borders correlate with the presence of promoter regions bound by RNA Polymerase II and active chromatin marks. In contrast, genes that are silent during early fly development get included within the PcG domain and this incorporation interferes with gene activation at later developmental stages. Moreover, trans-interaction of the transgenic PRE with its homologous endogenous PRE results in increased PcG binding, correlating with reinforced silencing of genes within the domain borders. CONCLUSIONS: Our results suggest that higher-order organization of PcG-bound chromatin can stabilize gene silencing within PcG domains. Further we propose that multi-protein complexes associated with active promoters are able to define the limits of PcG domains. Future work aimed to pinpoint the factors providing this barrier function will be required to understand the precise molecular mechanism by which active promoter regions can act as boundaries to stop

  19. Origin of the polycomb repressive complex 2 and gene silencing by an E(z) homolog in the unicellular alga Chlamydomonas.

    Science.gov (United States)

    Shaver, Scott; Casas-Mollano, J Armando; Cerny, Ronald L; Cerutti, Heriberto

    2010-05-16

    Polycomb group proteins play an essential role in the maintenance of cell identity and the regulation of development in both animals and plants. The Polycomb Repressive Complex 2 (PRC2) is involved in the establishment of transcriptionally silent chromatin states, in part through its ability to methylate lysine 27 of histone H3 by the Enhancer of zeste [E(z)] subunit. The absence of PRC2 in unicellular model fungi and its function in the repression of genes vital for the development of higher eukaryotes led to the proposal that this complex may have evolved together with the emergence of multicellularity. However, we report here on the widespread presence of PRC2 core subunits in unicellular eukaryotes from the Opisthokonta, Chromalveolata and Archaeplastida supergroups. To gain insight on the role of PRC2 in single celled organisms, we characterized an E(z) homolog, EZH, in the green alga Chlamydomonas reinhardtii. RNAi-mediated suppression of EZH led to defects in the silencing of transgenes and retrotransposons as well as to a global increase in histone post-translational modifications associated with transcriptional activity, such as trimethylation of histone H3 lysine 4 and acetylation of histone H4. On the basis of the parsimony principle, our findings suggest that PRC2 appeared early in eukaryotic evolution, even perhaps in the last unicellular common ancestor of eukaryotes. One of the ancestral roles of PCR2 may have been in defense responses against intragenomic parasites such as transposable elements, prior to being co-opted for lineage specific functions like developmental regulation in multicellular eukaryotes.

  20. Histone H3 Serine 28 Is Essential for Efficient Polycomb-Mediated Gene Repression in Drosophila

    Directory of Open Access Journals (Sweden)

    Philip Yuk Kwong Yung

    2015-06-01

    Full Text Available Trimethylation at histone H3K27 is central to the polycomb repression system. Juxtaposed to H3K27 is a widely conserved phosphorylatable serine residue (H3S28 whose function is unclear. To assess the importance of H3S28, we generated a Drosophila H3 histone mutant with a serine-to-alanine mutation at position 28. H3S28A mutant cells lack H3S28ph on mitotic chromosomes but support normal mitosis. Strikingly, all methylation states of H3K27 drop in H3S28A cells, leading to Hox gene derepression and to homeotic transformations in adult tissues. These defects are not caused by active H3K27 demethylation nor by the loss of H3S28ph. Biochemical assays show that H3S28A nucleosomes are a suboptimal substrate for PRC2, suggesting that the unphosphorylated state of serine 28 is important for assisting in the function of polycomb complexes. Collectively, our data indicate that the conserved H3S28 residue in metazoans has a role in supporting PRC2 catalysis.

  1. The polycomb group protein Suz12 is required for embryonic stem cell differentiation

    DEFF Research Database (Denmark)

    Pasini, Diego; Bracken, Adrian P; Hansen, Jacob Bo Højberg

    2007-01-01

    results in early lethality of mouse embryos. Here, we demonstrate that Suz12(-/-) mouse embryonic stem (ES) cells can be established and expanded in tissue culture. The Suz12(-/-) ES cells are characterized by global loss of H3K27 trimethylation (H3K27me3) and higher expression levels of differentiation......-specific genes. Moreover, Suz12(-/-) ES cells are impaired in proper differentiation, resulting in a lack of repression of ES cell markers as well as activation of differentiation-specific genes. Finally, we demonstrate that the PcGs are actively recruited to several genes during ES cell differentiation, which...... despite an increase in H3K27me3 levels is not always sufficient to prevent transcriptional activation. In summary, we demonstrate that Suz12 is required for the establishment of specific expression programs required for ES cell differentiation. Furthermore, we provide evidence that PcGs have different...

  2. The Role of Polycomb Group Gene BMI-1 in the Development of Prostate Cancer

    Science.gov (United States)

    2013-07-01

    J Clin Invest. 2005; 115:1503-21. 13. Siddique HR, Liao DJ, Mishra SK, Schuster T, Wang L, Matter B et al. Epicatechin-rich cocoa polyphenol...growth factors may result in an upregulation of diverse gene products in CSCs and their differentiated progenies dur- ing the EMT process [32, 33

  3. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  4. Adhesive pad differentiation in Drosophila melanogaster depends on the Polycomb group gene Su(z)2.

    Science.gov (United States)

    Hüsken, Mirko; Hufnagel, Kim; Mende, Katharina; Appel, Esther; Meyer, Heiko; Peisker, Henrik; Tögel, Markus; Wang, Shuoshuo; Wolff, Jonas; Gorb, Stanislav N; Paululat, Achim

    2015-04-15

    The ability of many insects to walk on vertical smooth surfaces such as glass or even on the ceiling has fascinated biologists for a long time, and has led to the discovery of highly specialized adhesive organs located at the distal end of the animals' legs. So far, research has primarily focused on structural and ultrastructural investigations leading to a deeper understanding of adhesive organ functionality and to the development of new bioinspired materials. Genetic approaches, e.g. the analysis of mutants, to achieve a better understanding of adhesive organ differentiation have not been used so far. Here, we describe the first Drosophila melanogaster mutant that develops malformed adhesive organs, resulting in a complete loss of climbing ability on vertical smooth surfaces. Interestingly, these mutants fail to make close contact between the setal tips and the smooth surface, a crucial condition for wet adhesion mediated by capillary forces. Instead, these flies walk solely on their claws. Moreover, we were able to show that the mutation is caused by a P-element insertion into the Su(z)2 gene locus. Remobilization of the P-element restores climbing ability. Furthermore, we provide evidence that the P-element insertion results in an artificial Su(z)2 transcript, which most likely causes a gain-of-function mutation. We presume that this transcript causes deregulation of yet unknown target genes involved in pulvilli differentiation. Our results nicely demonstrate that the genetically treatable model organism Drosophila is highly suitable for future investigations on adhesive organ differentiation. © 2015. Published by The Company of Biologists Ltd.

  5. The Role of Polycomb Group Gene Bmi-1 in the Development of Prostate Cancer

    Science.gov (United States)

    2011-09-01

    new tricks. Cell Div. 2006 Jul 24;1:15. 17. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions... Pestell RG. Signal transduction mediated by cyclin D1: from mitogens to cell proliferation: a molecular target with therapeutic potential. Cancer...Datar 22 R, Cote R, Pestell R, Albanese C. ErbB-2 induces the cyclin D1 gene in prostate epithelial cells in vitro and in vivo. Cancer Res. 2007

  6. How Polycomb-Mediated Cell Memory Deals With a Changing Environment

    KAUST Repository

    Marasca, Federica; Bodega, Beatrice; Orlando, Valerio

    2018-01-01

    Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment.

  7. How Polycomb-Mediated Cell Memory Deals With a Changing Environment

    KAUST Repository

    Marasca, Federica

    2018-03-09

    Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment.

  8. Polycomb-like proteins link the PRC2 complex to CpG islands

    Energy Technology Data Exchange (ETDEWEB)

    Li, Haojie; Liefke, Robert; Jiang, Junyi; Kurland, Jesse Vigoda; Tian, Wei; Deng, Pujuan; Zhang, Weidi; He, Qian; Patel, Dinshaw J.; Bulyk, Martha L.; Shi, Yang; Wang, Zhanxin

    2017-09-06

    The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood. Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.

  9. Chromatin-bound IκBα regulates a subset of polycomb target genes in differentiation and cancer.

    Science.gov (United States)

    Mulero, María Carmen; Ferres-Marco, Dolors; Islam, Abul; Margalef, Pol; Pecoraro, Matteo; Toll, Agustí; Drechsel, Nils; Charneco, Cristina; Davis, Shelly; Bellora, Nicolás; Gallardo, Fernando; López-Arribillaga, Erika; Asensio-Juan, Elena; Rodilla, Verónica; González, Jessica; Iglesias, Mar; Shih, Vincent; Mar Albà, M; Di Croce, Luciano; Hoffmann, Alexander; Miyamoto, Shigeki; Villà-Freixa, Jordi; López-Bigas, Nuria; Keyes, William M; Domínguez, María; Bigas, Anna; Espinosa, Lluís

    2013-08-12

    IκB proteins are the primary inhibitors of NF-κB. Here, we demonstrate that sumoylated and phosphorylated IκBα accumulates in the nucleus of keratinocytes and interacts with histones H2A and H4 at the regulatory region of HOX and IRX genes. Chromatin-bound IκBα modulates Polycomb recruitment and imparts their competence to be activated by TNFα. Mutations in the Drosophila IκBα gene cactus enhance the homeotic phenotype of Polycomb mutants, which is not counteracted by mutations in dorsal/NF-κB. Oncogenic transformation of keratinocytes results in cytoplasmic IκBα translocation associated with a massive activation of Hox. Accumulation of cytoplasmic IκBα was found in squamous cell carcinoma (SCC) associated with IKK activation and HOX upregulation. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Targeting MUC1-C suppresses polycomb repressive complex 1 in multiple myeloma.

    Science.gov (United States)

    Tagde, Ashujit; Markert, Tahireh; Rajabi, Hasan; Hiraki, Masayuki; Alam, Maroof; Bouillez, Audrey; Avigan, David; Anderson, Kenneth; Kufe, Donald

    2017-09-19

    The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM cell survival. The present studies show that targeting MUC1-C with (i) stable and inducible silencing and CRISPR/Cas9 editing and (ii) the pharmacologic inhibitor GO-203, which blocks MUC1-C function, downregulates BMI1, RING1 and RING2 expression. The results demonstrate that MUC1-C drives BMI1 transcription by a MYC-dependent mechanism. MUC1-C thus promotes MYC occupancy on the BMI1 promoter and thereby activates BMI1 expression. We also show that the MUC1-C→MYC pathway induces RING2 expression. Moreover, in contrast to BMI1 and RING2, we found that MUC1-C drives RING1 by an NF-κB p65-dependent mechanism. Targeting MUC1-C and thereby the suppression of these key PRC1 proteins was associated with downregulation of the PRC1 E3 ligase activity as evidenced by decreases in ubiquitylation of histone H2A. Targeting MUC1-C also resulted in activation of the PRC1-repressed tumor suppressor genes, PTEN, CDNK2A and BIM . These findings identify a heretofore unrecognized role for MUC1-C in the epigenetic regulation of MM cells.

  11. RYBP and Cbx7 Define Specific Biological Functions of Polycomb Complexes in Mouse Embryonic Stem Cells

    Directory of Open Access Journals (Sweden)

    Lluis Morey

    2013-01-01

    Full Text Available The Polycomb repressive complex 1 (PRC1 is required for decisions of stem cell fate. In mouse embryonic stem cells (ESCs, two major variations of PRC1 complex, defined by the mutually exclusive presence of Cbx7 or RYBP, have been identified. Here, we show that although the genomic localization of the Cbx7- and RYBP-containing PRC1 complexes overlaps in certain genes, it can also be mutually exclusive. At the molecular level, Cbx7 is necessary for recruitment of Ring1B to chromatin, whereas RYBP enhances the PRC1 enzymatic activity. Genes occupied by RYBP show lower levels of Ring1B and H2AK119ub and are consequently more highly transcribed than those bound by Cbx7. At the functional level, we show that genes occupied by RYBP are primarily involved in the regulation of metabolism and cell-cycle progression, whereas those bound by Cbx7 predominantly control early-lineage commitment of ESCs. Altogether, our results indicate that different PRC1 subtypes establish a complex pattern of gene regulation that regulates common and nonoverlapping aspects of ESC pluripotency and differentiation.

  12. Cell Cycle-Dependent Recruitment of Polycomb Proteins to the ASNS Promoter Counteracts C/ebp-Mediated Transcriptional Activation in Bombyx mori

    Science.gov (United States)

    Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Zhu, Li; Xu, Jian; Tatsuke, Tsuneyuki; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

    2013-01-01

    Epigenetic modifiers and transcription factors contribute to developmentally programmed gene expression. Here, we establish a functional link between epigenetic regulation by Polycomb group (PcG) proteins and transcriptional regulation by C/ebp that orchestrates the correct expression of Bombyx mori asparagine synthetase (BmASNS), a gene involved in the biosynthesis of asparagine. We show that the cis-regulatory elements of YY1-binding motifs and the CpG island present on the BmASNS promoter are required for the recruitment of PcG proteins and the subsequent deposition of the epigenetic repression mark H3K27me3. RNAi-mediated knockdown of PcG genes leads to derepression of the BmASNS gene via the recruitment of activators, including BmC/ebp, to the promoter. Intriguingly, we find that PcG proteins and BmC/ebp can dynamically modulate the transcriptional output of the BmASNS target in a cell cycle-dependent manner. It will be essential to suppress BmASNS expression by PcG proteins at the G2/M phase of the cell cycle in the presence of BmC/ebp activator. Thus, our results provide a novel insight into the molecular mechanism underlying the recruitment and regulation of the PcG system at a discrete gene locus in Bombyx mori. PMID:23382816

  13. Polycomb repression complex 2 is required for the maintenance of retinal progenitor cells and balanced retinal differentiation

    Czech Academy of Sciences Publication Activity Database

    Fujimura, Naoko; Kuželová, Andrea; Ebert, A.; Strnad, Hynek; Láchová, Jitka; Machoň, Ondřej; Busslinger, M.; Kozmik, Zbyněk

    2018-01-01

    Roč. 433, č. 1 (2018), s. 47-60 ISSN 0012-1606 R&D Projects: GA ČR GA15-23675S; GA MŠk(CZ) LQ1604; GA MŠk(CZ) LM2015040; GA MŠk ED2.1.00/19.0395 Institutional support: RVO:68378050 Keywords : Retina * Differentiation * Polycomb * Eed Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biology (theoretical, mathematical, thermal, cryobiology, biological rhythm), Evolutionary biology Impact factor: 2.944, year: 2016

  14. Rybp, a polycomb complex-associated protein, is required for mouse eye development

    Directory of Open Access Journals (Sweden)

    Schreiber-Agus Nicole

    2007-04-01

    Full Text Available Abstract Background Rybp (Ring1 and YY1 binding protein is a zinc finger protein which interacts with the members of the mammalian polycomb complexes. Previously we have shown that Rybp is critical for early embryogenesis and that haploinsufficiency of Rybp in a subset of embryos causes failure of neural tube closure. Here we investigated the requirement for Rybp in ocular development using four in vivo mouse models which resulted in either the ablation or overexpression of Rybp. Results Our results demonstrate that loss of a single Rybp allele in conventional knockout mice often resulted in retinal coloboma, an incomplete closure of the optic fissure, characterized by perturbed localization of Pax6 but not of Pax2. In addition, about one half of Rybp-/- Rybp+/+ chimeric embryos also developed retinal colobomas and malformed lenses. Tissue-specific transgenic overexpression of Rybp in the lens resulted in abnormal fiber cell differentiation and severe lens opacification with increased levels of AP-2α and Sox2, and reduced levels of βA4-crystallin gene expression. Ubiquitous transgenic overexpression of Rybp in the entire eye caused abnormal retinal folds, corneal neovascularization, and lens opacification. Additional changes included defects in anterior eye development. Conclusion These studies establish Rybp as a novel gene that has been associated with coloboma. Other genes linked to coloboma encode various classes of transcription factors such as BCOR, CBP, Chx10, Pax2, Pax6, Six3, Ski, Vax1 and Vax2. We propose that the multiple functions for Rybp in regulating mouse retinal and lens development are mediated by genetic, epigenetic and physical interactions between these genes and proteins.

  15. MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53.

    Science.gov (United States)

    Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias

    2016-01-07

    The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Stable X chromosome inactivation involves the PRC1 Polycomb complex and requires histone MACROH2A1 and the CULLIN3/SPOP ubiquitin E3 ligase

    DEFF Research Database (Denmark)

    Hernández-Muñoz, Inmaculada; Lund, Anders H; van der Stoop, Petra

    2005-01-01

    X inactivation involves the stable silencing of one of the two X chromosomes in XX female mammals. Initiation of this process occurs during early development and involves Xist (X-inactive-specific transcript) RNA coating and the recruitment of Polycomb repressive complex (PRC) 2 and PRC1 proteins...

  17. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  18. miR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)

    2015-01-02

    Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.

  19. High expression of Polycomb group protein EZH2 predicts poor survival in salivary gland adenoid cystic carcinoma

    NARCIS (Netherlands)

    Vékony, H.; Raaphorst, F.M.; Otte, A.P.; van Lohuizen, M.; Leemans, C.R.; van der Waal, I.; Bloemena, E.

    2008-01-01

    Background: The prognosis of adenoid cystic carcinoma (ACC), a malignant salivary gland tumour, depends on clinicopathological parameters. To decipher the biological behaviour of ACC, and to identify patients at risk of developing metastases, additional markers are needed. Methods: Expression of the

  20. dKDM2 couples histone H2A ubiquitylation to histone H3 demethylation during Polycomb group silencing

    NARCIS (Netherlands)

    A. Lagarou (Anna); A.B. Mohd Sarip; Y.M. Moshkin (Yuri); G.E. Chalkley (Gillian); K. Bezstarosti (Karel); J.A.A. Demmers (Jeroen); C.P. Verrijzer (Peter)

    2008-01-01

    textabstractTranscription regulation involves enzyme-mediated changes in chromatin structure. Here, we describe a novel mode of histone crosstalk during gene silencing, in which histone H2A monoubiquitylation is coupled to the removal of histone H3 Lys 36 dimethylation (H3K36me2). This pathway was

  1. Jarid2 binds mono-ubiquitylated H2A lysine 119 to mediate crosstalk between Polycomb complexes PRC1 and PRC2

    DEFF Research Database (Denmark)

    Cooper, Sarah; Grijzenhout, Anne; Underwood, Elizabeth

    2016-01-01

    crosstalk between these modifications is critical for the formation of stable Polycomb domains at target gene loci. While the molecular mechanism for recognition of H3K27me3 by PRC1 is well defined, the interaction of PRC2 with H2AK119u1 is poorly understood. Here we demonstrate a critical role for the PRC2...... cofactor Jarid2 in mediating the interaction of PRC2 with H2AK119u1. We identify a ubiquitin interaction motif at the amino-terminus of Jarid2, and demonstrate that this domain facilitates PRC2 localization to H2AK119u1 both in vivo and in vitro. Our findings ascribe a critical function to Jarid2...... and define a key mechanism that links PRC1 and PRC2 in the establishment of Polycomb domains....

  2. A human Polycomb isoform lacking the Pc box does not participate to PRC1 complexes but forms protein assemblies and represses transcription.

    Science.gov (United States)

    Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien; Pira, Dorcas; Angrand, Pierre-Olivier

    2012-05-01

    Polycomb repression controls the expression of hundreds of genes involved in development and is mediated by essentially two classes of chromatin-associated protein complexes. The Polycomb repressive complex 2 (PRC2) trimethylates histone H3 at lysine 27, an epigenetic mark that serves as a docking site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain. Using biochemical approaches and a novel in vivo imaging assay, we show that the short CBX2-2 isoform lacking the Pc box, does not participate in PRC1 protein complexes, but self-associates in vivo and forms complexes of high molecular weight. Furthermore, the CBX2 short isoform is still able to repress transcription, suggesting that Polycomb repression might occur in the absence of PRC1 formation.

  3. Control of flowering and cell fate by LIF2, an RNA binding partner of the polycomb complex component LHP1.

    Directory of Open Access Journals (Sweden)

    David Latrasse

    Full Text Available Polycomb Repressive Complexes (PRC modulate the epigenetic status of key cell fate and developmental regulators in eukaryotes. The chromo domain protein like heterochromatin protein1 (LHP1 is a subunit of a plant PRC1-like complex in Arabidopsis thaliana and recognizes histone H3 lysine 27 trimethylation, a silencing epigenetic mark deposited by the PRC2 complex. We have identified and studied an LHP1-Interacting Factor2 (LIF2. LIF2 protein has RNA recognition motifs and belongs to the large hnRNP protein family, which is involved in RNA processing. LIF2 interacts in vivo, in the cell nucleus, with the LHP1 chromo shadow domain. Expression of LIF2 was detected predominantly in vascular and meristematic tissues. Loss-of-function of LIF2 modifies flowering time, floral developmental homeostasis and gynoecium growth determination. lif2 ovaries have indeterminate growth and produce ectopic inflorescences with severely affected flowers showing proliferation of ectopic stigmatic papillae and ovules in short-day conditions. To look at how LIF2 acts relative to LHP1, we conducted transcriptome analyses in lif2 and lhp1 and identified a common set of deregulated genes, which showed significant enrichment in stress-response genes. By comparing expression of LHP1 targets in lif2, lhp1 and lif2 lhp1 mutants we showed that LIF2 can either antagonize or act with LHP1. Interestingly, repression of the FLC floral transcriptional regulator in lif2 mutant is accompanied by an increase in H3K27 trimethylation at the locus, without any change in LHP1 binding, suggesting that LHP1 is targeted independently from LIF2 and that LHP1 binding does not strictly correlate with gene expression. LIF2, involved in cell identity and cell fate decision, may modulate the activity of LHP1 at specific loci, during specific developmental windows or in response to environmental cues that control cell fate determination. These results highlight a novel link between plant RNA

  4. MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53

    DEFF Research Database (Denmark)

    Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice

    2016-01-01

    The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...

  5. Polycomb repressive complex 2 regulates MiR-200b in retinal endothelial cells: potential relevance in diabetic retinopathy.

    Directory of Open Access Journals (Sweden)

    Michael Anthony Ruiz

    Full Text Available Glucose-induced augmented vascular endothelial growth factor (VEGF production is a key event in diabetic retinopathy. We have previously demonstrated that downregulation of miR-200b increases VEGF, mediating structural and functional changes in the retina in diabetes. However, mechanisms regulating miR-200b in diabetes are not known. Histone methyltransferase complex, Polycomb Repressive Complex 2 (PRC2, has been shown to repress miRNAs in neoplastic process. We hypothesized that, in diabetes, PRC2 represses miR-200b through its histone H3 lysine-27 trimethylation mark. We show that human retinal microvascular endothelial cells exposed to high levels of glucose regulate miR-200b repression through histone methylation and that inhibition of PRC2 increases miR-200b while reducing VEGF. Furthermore, retinal tissue from animal models of diabetes showed increased expression of major PRC2 components, demonstrating in vivo relevance. This research established a repressive relationship between PRC2 and miR-200b, providing evidence of a novel mechanism of miRNA regulation through histone methylation.

  6. Mediator complex cooperatively regulates transcription of retinoic acid target genes with Polycomb Repressive Complex 2 during neuronal differentiation.

    Science.gov (United States)

    Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki

    2015-11-01

    The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  7. A novel zinc finger protein Zfp277 mediates transcriptional repression of the Ink4a/arf locus through polycomb repressive complex 1

    DEFF Research Database (Denmark)

    Negishi, Masamitsu; Saraya, Atsunori; Mochizuki, Shinobu

    2010-01-01

    . METHODOLOGY/PRINCIPAL FINDINGS: We examined the function of Zinc finger domain-containing protein 277 (Zfp277), a novel zinc finger protein that interacts with the PcG protein Bmi1. Zfp277 binds to the Ink4a/Arf locus in a Bmi1-independent manner and interacts with polycomb repressor complex (PRC) 1 through...... is essential for the recruitment of PRC1 to the Ink4a/Arf locus. Our findings also highlight dynamic regulation of both Zfp277 and PcG proteins by the oxidative stress pathways....

  8. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  9. Discovery and Molecular Basis of a Diverse Set of Polycomb Repressive Complex 2 Inhibitors Recognition by EED.

    Directory of Open Access Journals (Sweden)

    Ling Li

    Full Text Available Polycomb repressive complex 2 (PRC2, a histone H3 lysine 27 methyltransferase, plays a key role in gene regulation and is a known epigenetics drug target for cancer therapy. The WD40 domain-containing protein EED is the regulatory subunit of PRC2. It binds to the tri-methylated lysine 27 of the histone H3 (H3K27me3, and through which stimulates the activity of PRC2 allosterically. Recently, we disclosed a novel PRC2 inhibitor EED226 which binds to the K27me3-pocket on EED and showed strong antitumor activity in xenograft mice model. Here, we further report the identification and validation of four other EED binders along with EED162, the parental compound of EED226. The crystal structures for all these five compounds in complex with EED revealed a common deep pocket induced by the binding of this diverse set of compounds. This pocket was created after significant conformational rearrangement of the aromatic cage residues (Y365, Y148 and F97 in the H3K27me3 binding pocket of EED, the width of which was delineated by the side chains of these rearranged residues. In addition, all five compounds interact with the Arg367 at the bottom of the pocket. Each compound also displays unique features in its interaction with EED, suggesting the dynamics of the H3K27me3 pocket in accommodating the binding of different compounds. Our results provide structural insights for rational design of novel EED binder for the inhibition of PRC2 complex activity.

  10. Polycomb-Mediated Repression and Sonic Hedgehog Signaling Interact to Regulate Merkel Cell Specification during Skin Development.

    Directory of Open Access Journals (Sweden)

    Carolina N Perdigoto

    2016-07-01

    Full Text Available An increasing amount of evidence indicates that developmental programs are tightly regulated by the complex interplay between signaling pathways, as well as transcriptional and epigenetic processes. Here, we have uncovered coordination between transcriptional and morphogen cues to specify Merkel cells, poorly understood skin cells that mediate light touch sensations. In murine dorsal skin, Merkel cells are part of touch domes, which are skin structures consisting of specialized keratinocytes, Merkel cells, and afferent neurons, and are located exclusively around primary hair follicles. We show that the developing primary hair follicle functions as a niche required for Merkel cell specification. We find that intraepidermal Sonic hedgehog (Shh signaling, initiated by the production of Shh ligand in the developing hair follicles, is required for Merkel cell specification. The importance of Shh for Merkel cell formation is further reinforced by the fact that Shh overexpression in embryonic epidermal progenitors leads to ectopic Merkel cells. Interestingly, Shh signaling is common to primary, secondary, and tertiary hair follicles, raising the possibility that there are restrictive mechanisms that regulate Merkel cell specification exclusively around primary hair follicles. Indeed, we find that loss of Polycomb repressive complex 2 (PRC2 in the epidermis results in the formation of ectopic Merkel cells that are associated with all hair types. We show that PRC2 loss expands the field of epidermal cells competent to differentiate into Merkel cells through the upregulation of key Merkel-differentiation genes, which are known PRC2 targets. Importantly, PRC2-mediated repression of the Merkel cell differentiation program requires inductive Shh signaling to form mature Merkel cells. Our study exemplifies how the interplay between epigenetic and morphogen cues regulates the complex patterning and formation of the mammalian skin structures.

  11. Polycomb-Mediated Repression and Sonic Hedgehog Signaling Interact to Regulate Merkel Cell Specification during Skin Development.

    Science.gov (United States)

    Perdigoto, Carolina N; Dauber, Katherine L; Bar, Carmit; Tsai, Pai-Chi; Valdes, Victor J; Cohen, Idan; Santoriello, Francis J; Zhao, Dejian; Zheng, Deyou; Hsu, Ya-Chieh; Ezhkova, Elena

    2016-07-01

    An increasing amount of evidence indicates that developmental programs are tightly regulated by the complex interplay between signaling pathways, as well as transcriptional and epigenetic processes. Here, we have uncovered coordination between transcriptional and morphogen cues to specify Merkel cells, poorly understood skin cells that mediate light touch sensations. In murine dorsal skin, Merkel cells are part of touch domes, which are skin structures consisting of specialized keratinocytes, Merkel cells, and afferent neurons, and are located exclusively around primary hair follicles. We show that the developing primary hair follicle functions as a niche required for Merkel cell specification. We find that intraepidermal Sonic hedgehog (Shh) signaling, initiated by the production of Shh ligand in the developing hair follicles, is required for Merkel cell specification. The importance of Shh for Merkel cell formation is further reinforced by the fact that Shh overexpression in embryonic epidermal progenitors leads to ectopic Merkel cells. Interestingly, Shh signaling is common to primary, secondary, and tertiary hair follicles, raising the possibility that there are restrictive mechanisms that regulate Merkel cell specification exclusively around primary hair follicles. Indeed, we find that loss of Polycomb repressive complex 2 (PRC2) in the epidermis results in the formation of ectopic Merkel cells that are associated with all hair types. We show that PRC2 loss expands the field of epidermal cells competent to differentiate into Merkel cells through the upregulation of key Merkel-differentiation genes, which are known PRC2 targets. Importantly, PRC2-mediated repression of the Merkel cell differentiation program requires inductive Shh signaling to form mature Merkel cells. Our study exemplifies how the interplay between epigenetic and morphogen cues regulates the complex patterning and formation of the mammalian skin structures.

  12. An H3K9/S10 methyl-phospho switch modulates Polycomb and Pol II binding at repressed genes during differentiation.

    Science.gov (United States)

    Sabbattini, Pierangela; Sjoberg, Marcela; Nikic, Svetlana; Frangini, Alberto; Holmqvist, Per-Henrik; Kunowska, Natalia; Carroll, Tom; Brookes, Emily; Arthur, Simon J; Pombo, Ana; Dillon, Niall

    2014-03-01

    Methylated histones H3K9 and H3K27 are canonical epigenetic silencing modifications in metazoan organisms, but the relationship between the two modifications has not been well characterized. H3K9me3 coexists with H3K27me3 in pluripotent and differentiated cells. However, we find that the functioning of H3K9me3 is altered by H3S10 phosphorylation in differentiated postmitotic osteoblasts and cycling B cells. Deposition of H3K9me3/S10ph at silent genes is partially mediated by the mitogen- and stress-activated kinases (MSK1/2) and the Aurora B kinase. Acquisition of H3K9me3/S10ph during differentiation correlates with loss of paused S5 phosphorylated RNA polymerase II, which is present on Polycomb-regulated genes in embryonic stem cells. Reduction of the levels of H3K9me3/S10ph by kinase inhibition results in increased binding of RNAPIIS5ph and the H3K27 methyltransferase Ezh1 at silent promoters. Our results provide evidence of a novel developmentally regulated methyl-phospho switch that modulates Polycomb regulation in differentiated cells and stabilizes repressed states.

  13. [PRODUCT OF THE BMI1--A KEY COMPONENT OF POLYCOMB--POSITIVELY REGULATES ADIPOCYTE DIFFERENTIATION OF MOUSE MESENCHYMAL STEM CELLS].

    Science.gov (United States)

    Petrov, N S; Vereschagina, N A; Sushilova, E N; Kropotov, A V; Miheeva, N F; Popov, B V

    2016-01-01

    Bmil is a key component of Polycomb (PcG), which in mammals controls the basic functions of mammalian somatic stem cells (SSC) such as self-renewal and differentiation. Bmi1 supports SSC via transcriptional suppression of genes associated with cell cycle and differentiation. The most studied target genes of Bmi1 are the genes of Ink4 locus, CdkI p16(Ink4a) and p1(Arf), suppression of which due to activating mutations of the BMI1 results in formation of cancer stem cells (CSC) and carcinomas in various tissues. In contrast, inactivation of BMI1 results in cell cycle arrest and cell senescence. Although clinical phenomena of hypo- and hyperactivation of BMI1 are well known, its targets and mechanisms of regulation of tissue specific SSC are still obscure. The goal of this study was to evaluate the regulatory role of BMI1 in adipocyte differentiation (AD) of mouse mesenchymal stem cells (MSC). Induction of AD in mouse MSC of the C3H10T1/2 cell line was associated with an increase in the expression levels of BMI1, the genes of pRb family (RB, p130) and demethylase UTX, but not methyltransferase EZH2, whose products regulate the methylation levels of H3K27. It was observed earlier that H3K27me3 may play the role of the epigenetic switch by promoting AD of human MSC via activating expression of the PPARγ2, the master gene of AD (Hemming et al., 2014). Here we show that inactivation of BMI1 using specific siRNA slows and decreases the levels of AD, but does not abolish it. This is associated with a complete inhibition of the expression of adipogenic marker genes--PPARγ2, ADIPOQ and a decrease in the expression of RB, p130, but not UTX. The results obtained give evidence that the epigenetic mechanism regulating AD differentiation in mouse and human MSC is different.

  14. A human Polycomb isoform lacking the Pc box does not participate to PRC1 complexes but forms protein assemblies and represses transcription

    DEFF Research Database (Denmark)

    Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien

    2012-01-01

    site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial...... diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites...... and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain...

  15. LA VÍA RB/E2F Y LA FAMILIA DE PROTEÍNAS REPRESORAS POLYCOMB EN EL DESARROLLO DE CÁNCER

    Directory of Open Access Journals (Sweden)

    MERCEDES IMELDA DÁVALOS-SALAS

    2011-01-01

    Full Text Available El control adecuado del ciclo celular mediante la acción coordinada de la familia de factores de transcripción E2F resulta ser clave para la homeostasis celular. El entender su modo de acción desde una perspectiva epigenética resulta ser un tema de gran actualidad y cambia la visión de cómo es regulado el ciclo celular. Uno de los principales reguladores epigenéticos está conformado por el grupo de proteínas Polycomb (PcG, relacionadas con procesos patológicos como el cáncer, a través de la desregulación a nivel epigenético de genes supresores de tumores como BRCA1, p16 y p53, entre otros. Con relación a lo anterior, la regulación del gen supresor Retinoblastoma (Rb ha sido ampliamente estudiado dada su importante participación como regulador negativo del ciclo celular, pero más reciente se ha demostrado que su modo de acción está relacionado con el grupo de proteínas PcG. Cada uno de los procesos que involucran a componentes de la familia de factores E2F, los miembros de Polycomb y la familia de proteína Rb, parecen ser en cierta medida independientes y, por ende, poco relacionados. Sin embargo, existen evidencias de una convergencia a nivel epigenético en la acción de estos conjuntos de moléculas reguladoras de la progresión del ciclo celular y su desregulación nos puede llevar a entender mejor su contribución al desarrollo de procesos patológicos como el cáncer.

  16. Bypass of senescence by the polycomb group protein CBX8 through direct binding to the INK4A-ARF locus

    DEFF Research Database (Denmark)

    Dietrich, Nikolaj; Bracken, Adrian P; Trinh, Emmanuelle

    2007-01-01

    -ARF, and that ectopic expression of CBX8 leads to repression of the Ink4a-Arf locus and bypass of senescence, leading to cellular immortalization. Gene expression and location analysis demonstrate that besides the INK4A-ARF locus, CBX8 also regulates a number of other genes important for cell growth and survival...

  17. Identification of new members of Fertilisation Independent Seed Polycomb Group pathway involved in the control of seed development in Arabidopsis thaliana.

    Science.gov (United States)

    Guitton, Anne-Elisabeth; Page, Damian R; Chambrier, Pierre; Lionnet, Claire; Faure, Jean-Emmanuel; Grossniklaus, Ueli; Berger, Frédéric

    2004-06-01

    In higher plants, double fertilisation initiates seed development. One sperm cell fuses with the egg cell and gives rise to the embryo, the second sperm cell fuses with the central cell and gives rise to the endosperm. The endosperm develops as a syncytium with the gradual organisation of domains along an anteroposterior axis defined by the position of the embryo at the anterior pole and by the attachment to the placenta at the posterior pole. We report that ontogenesis of the posterior pole in Arabidopsis thaliana involves oriented migration of nuclei in the syncytium. We show that this migration is impaired in mutants of the three founding members of the FERTILIZATION INDEPENDENT SEED (FIS) class, MEDEA (MEA), FIS2 and FERTILIZATION INDEPENDENT ENDOSPERM (FIE). A screen based on a green fluorescent protein (GFP) reporter line allowed us to identify two new loci in the FIS pathway, medicis and borgia. We have cloned the MEDICIS gene and show that it encodes the Arabidopsis homologue of the yeast WD40 domain protein MULTICOPY SUPRESSOR OF IRA (MSI1). The mutations at the new fis loci cause the same cellular defects in endosperm development as other fis mutations, including parthenogenetic development, absence of cellularisation, ectopic development of posterior structures and overexpression of the GFP marker.

  18. Polycomb Repressive Complex 2 Enacts Wnt Signaling in Intestinal Homeostasis and Contributes to the Instigation of Stemness in Diseases Entailing Epithelial Hyperplasia or Neoplasia.

    Science.gov (United States)

    Oittinen, Mikko; Popp, Alina; Kurppa, Kalle; Lindfors, Katri; Mäki, Markku; Kaikkonen, Minna U; Viiri, Keijo

    2017-02-01

    Canonical Wnt/β-catenin signaling regulates the homeostasis of intestinal epithelium by controlling the balance between intestinal stem cell self-renewal and differentiation but epigenetic mechanisms enacting the process are not known. We hypothesized that epigenetic regulator, Polycomb Repressive Complex-2 (PRC2), is involved in Wnt-mediated epithelial homeostasis on the crypt-villus axis and aberrancies therein are implicated both in celiac disease and in intestinal malignancies. We found that PRC2 establishes repressive crypt and villus specific trimethylation of histone H3 lysine 27 (H3K27me3) signature on genes responsible for, for example, nutrient transport and cell killing in crypts and, for example, proliferation and differentiation in mature villi, suggesting that PRC2 facilitates the Wnt-governed intestinal homeostasis. When celiac patients are on gluten-containing diet PRC2 is out-of-bounds active and consequently its target genes were found affected in intestinal epithelium. Significant set of effective intestinal PRC2 targets are also differentially expressed in colorectal adenoma and carcinomas. Our results suggest that PRC2 gives rise and maintains polar crypt and villus specific H3K27me3 signatures. As H3K27me3 is a mark enriched in developmentally important genes, identified intestinal PRC2 targets are possibly imperative drivers for enterocyte differentiation and intestinal stem cell maintenance downstream to Wnt-signaling. Our work also elucidates the mechanism sustaining the crypt hyperplasia in celiac disease and suggest that PRC2-dependent fostering of epithelial stemness is a common attribute in intestinal diseases in which epithelial hyperplasia or neoplasia prevails. Finally, this work demonstrates that in intestine PRC2 represses genes having both pro-stemness and pro-differentiation functions, fact need to be considered when designing epigenetic therapies including PRC2 as a drug target. Stem Cells 2017;35:445-457. © 2016 Alpha

  19. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements.

    Directory of Open Access Journals (Sweden)

    Amanda Swain

    2016-09-01

    Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.

  20. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

    Science.gov (United States)

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

    2012-01-01

    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  1. MEL-18 loss mediates estrogen receptor-α downregulation and hormone independence.

    Science.gov (United States)

    Lee, Jeong-Yeon; Won, Hee-Young; Park, Ji-Hye; Kim, Hye-Yeon; Choi, Hee-Joo; Shin, Dong-Hui; Kang, Ju-Hee; Woo, Jong-Kyu; Oh, Seung-Hyun; Son, Taekwon; Choi, Jin-Woo; Kim, Sehwan; Kim, Hyung-Yong; Yi, Kijong; Jang, Ki-Seok; Oh, Young-Ha; Kong, Gu

    2015-05-01

    The polycomb protein MEL-18 has been proposed as a tumor suppressor in breast cancer; however, its functional relevance to the hormonal regulation of breast cancer remains unknown. Here, we demonstrated that MEL-18 loss contributes to the hormone-independent phenotype of breast cancer by modulating hormone receptor expression. In multiple breast cancer cohorts, MEL-18 was markedly downregulated in triple-negative breast cancer (TNBC). MEL-18 expression positively correlated with the expression of luminal markers, including estrogen receptor-α (ER-α, encoded by ESR1). MEL-18 loss was also associated with poor response to antihormonal therapy in ER-α-positive breast cancer. Furthermore, whereas MEL-18 loss in luminal breast cancer cells resulted in the downregulation of expression and activity of ER-α and the progesterone receptor (PR), MEL-18 overexpression restored ER-α expression in TNBC. Consistently, in vivo xenograft experiments demonstrated that MEL-18 loss induces estrogen-independent growth and tamoxifen resistance in luminal breast cancer, and that MEL-18 overexpression confers tamoxifen sensitivity in TNBC. MEL-18 suppressed SUMOylation of the ESR1 transactivators p53 and SP1, thereby driving ESR1 transcription. MEL-18 facilitated the deSUMOylation process by inhibiting BMI-1/RING1B-mediated ubiquitin-proteasomal degradation of SUMO1/sentrin-specific protease 1 (SENP1). These findings demonstrate that MEL-18 is a SUMO-dependent regulator of hormone receptors and suggest MEL-18 expression as a marker for determining the antihormonal therapy response in patients with breast cancer.

  2. MEL-18 loss mediates estrogen receptor–α downregulation and hormone independence

    Science.gov (United States)

    Lee, Jeong-Yeon; Won, Hee-Young; Park, Ji-Hye; Kim, Hye-Yeon; Choi, Hee-Joo; Shin, Dong-Hui; Kang, Ju-Hee; Woo, Jong-Kyu; Oh, Seung-Hyun; Son, Taekwon; Choi, Jin-Woo; Kim, Sehwan; Kim, Hyung-Yong; Yi, Kijong; Jang, Ki-Seok; Oh, Young-Ha; Kong, Gu

    2015-01-01

    The polycomb protein MEL-18 has been proposed as a tumor suppressor in breast cancer; however, its functional relevance to the hormonal regulation of breast cancer remains unknown. Here, we demonstrated that MEL-18 loss contributes to the hormone-independent phenotype of breast cancer by modulating hormone receptor expression. In multiple breast cancer cohorts, MEL-18 was markedly downregulated in triple-negative breast cancer (TNBC). MEL-18 expression positively correlated with the expression of luminal markers, including estrogen receptor–α (ER-α, encoded by ESR1). MEL-18 loss was also associated with poor response to antihormonal therapy in ER-α–positive breast cancer. Furthermore, whereas MEL-18 loss in luminal breast cancer cells resulted in the downregulation of expression and activity of ER-α and the progesterone receptor (PR), MEL-18 overexpression restored ER-α expression in TNBC. Consistently, in vivo xenograft experiments demonstrated that MEL-18 loss induces estrogen-independent growth and tamoxifen resistance in luminal breast cancer, and that MEL-18 overexpression confers tamoxifen sensitivity in TNBC. MEL-18 suppressed SUMOylation of the ESR1 transactivators p53 and SP1, thereby driving ESR1 transcription. MEL-18 facilitated the deSUMOylation process by inhibiting BMI-1/RING1B-mediated ubiquitin-proteasomal degradation of SUMO1/sentrin-specific protease 1 (SENP1). These findings demonstrate that MEL-18 is a SUMO-dependent regulator of hormone receptors and suggest MEL-18 expression as a marker for determining the antihormonal therapy response in patients with breast cancer. PMID:25822021

  3. How Polycomb-Mediated Cell Memory Deals With a Changing Environment: Variations in PcG complexes and proteins assortment convey plasticity to epigenetic regulation as a response to environment.

    Science.gov (United States)

    Marasca, Federica; Bodega, Beatrice; Orlando, Valerio

    2018-04-01

    Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment. © 2018 The Authors. BioEssays Published by WILEY Periodicals, Inc.

  4. Epigenetic modification of histone 3 lysine 27: mediator subunit MED25 is required for the dissociation of polycomb repressive complex 2 from the promoter of cytochrome P450 2C9.

    Science.gov (United States)

    Englert, Neal A; Luo, George; Goldstein, Joyce A; Surapureddi, Sailesh

    2015-01-23

    The Mediator complex is vital for the transcriptional regulation of eukaryotic genes. Mediator binds to nuclear receptors at target response elements and recruits chromatin-modifying enzymes and RNA polymerase II. Here, we examine the involvement of Mediator subunit MED25 in the epigenetic regulation of human cytochrome P450 2C9 (CYP2C9). MED25 is recruited to the CYP2C9 promoter through association with liver-enriched HNF4α, and we show that MED25 influences the H3K27 status of the HNF4α binding region. This region was enriched for the activating marker H3K27ac and histone acetyltransferase CREBBP after MED25 overexpression but was trimethylated when MED25 expression was silenced. The epigenetic regulator Polycomb repressive complex (PRC2), which represses expression by methylating H3K27, plays an important role in target gene regulation. Silencing MED25 correlated with increased association of PRC2 not only with the promoter region chromatin but with HNF4α itself. We confirmed the involvement of MED25 for fully functional preinitiation complex recruitment and transcriptional output in vitro. Formaldehyde-assisted isolation of regulatory elements (FAIRE) revealed chromatin conformation changes that were reliant on MED25, indicating that MED25 induced a permissive chromatin state that reflected increases in CYP2C9 mRNA. For the first time, we showed evidence that a functionally relevant human gene is transcriptionally regulated by HNF4α via MED25 and PRC2. CYP2C9 is important for the metabolism of many exogenous chemicals including pharmaceutical drugs as well as endogenous substrates. Thus, MED25 is important for regulating the epigenetic landscape resulting in transcriptional activation of a highly inducible gene, CYP2C9. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Group X

    Energy Technology Data Exchange (ETDEWEB)

    Fields, Susannah

    2007-08-16

    This project is currently under contract for research through the Department of Homeland Security until 2011. The group I was responsible for studying has to remain confidential so as not to affect the current project. All dates, reference links and authors, and other distinguishing characteristics of the original group have been removed from this report. All references to the name of this group or the individual splinter groups has been changed to 'Group X'. I have been collecting texts from a variety of sources intended for the use of recruiting and radicalizing members for Group X splinter groups for the purpose of researching the motivation and intent of leaders of those groups and their influence over the likelihood of group radicalization. This work included visiting many Group X websites to find information on splinter group leaders and finding their statements to new and old members. This proved difficult because the splinter groups of Group X are united in beliefs, but differ in public opinion. They are eager to tear each other down, prove their superiority, and yet remain anonymous. After a few weeks of intense searching, a list of eight recruiting texts and eight radicalizing texts from a variety of Group X leaders were compiled.

  6. Group Flow and Group Genius

    Science.gov (United States)

    Sawyer, Keith

    2015-01-01

    Keith Sawyer views the spontaneous collaboration of group creativity and improvisation actions as "group flow," which organizations can use to function at optimum levels. Sawyer establishes ideal conditions for group flow: group goals, close listening, complete concentration, being in control, blending egos, equal participation, knowing…

  7. Permutation groups

    CERN Document Server

    Passman, Donald S

    2012-01-01

    This volume by a prominent authority on permutation groups consists of lecture notes that provide a self-contained account of distinct classification theorems. A ready source of frequently quoted but usually inaccessible theorems, it is ideally suited for professional group theorists as well as students with a solid background in modern algebra.The three-part treatment begins with an introductory chapter and advances to an economical development of the tools of basic group theory, including group extensions, transfer theorems, and group representations and characters. The final chapter feature

  8. Group devaluation and group identification

    NARCIS (Netherlands)

    Leach, C.W.; Rodriguez Mosquera, P.M.; Vliek, M.L.W.; Hirt, E.

    2010-01-01

    In three studies, we showed that increased in-group identification after (perceived or actual) group devaluation is an assertion of a (preexisting) positive social identity that counters the negative social identity implied in societal devaluation. Two studies with real-world groups used order

  9. Lie groups and algebraic groups

    Indian Academy of Sciences (India)

    We give an exposition of certain topics in Lie groups and algebraic groups. This is not a complete ... of a polynomial equation is equivalent to the solva- bility of the equation ..... to a subgroup of the group of roots of unity in k (in particular, it is a ...

  10. Group Work

    Science.gov (United States)

    Wilson, Kristy J.; Brickman, Peggy; Brame, Cynthia J.

    2018-01-01

    Science, technology, engineering, and mathematics faculty are increasingly incorporating both formal and informal group work in their courses. Implementing group work can be improved by an understanding of the extensive body of educational research studies on this topic. This essay describes an online, evidence-based teaching guide published by…

  11. Reflection groups

    International Nuclear Information System (INIS)

    Eggermont, G.

    2006-01-01

    In 2005, PISA organised proactive meetings of reflection groups on involvement in decision making, expert culture and ethical aspects of radiation protection.All reflection group meetings address particular targeted audiences while the output publication in book form is put forward

  12. Group theory

    CERN Document Server

    Scott, W R

    2010-01-01

    Here is a clear, well-organized coverage of the most standard theorems, including isomorphism theorems, transformations and subgroups, direct sums, abelian groups, and more. This undergraduate-level text features more than 500 exercises.

  13. Group Grammar

    Science.gov (United States)

    Adams, Karen

    2015-01-01

    In this article Karen Adams demonstrates how to incorporate group grammar techniques into a classroom activity. In the activity, students practice using the target grammar to do something they naturally enjoy: learning about each other.

  14. Computer group

    International Nuclear Information System (INIS)

    Bauer, H.; Black, I.; Heusler, A.; Hoeptner, G.; Krafft, F.; Lang, R.; Moellenkamp, R.; Mueller, W.; Mueller, W.F.; Schati, C.; Schmidt, A.; Schwind, D.; Weber, G.

    1983-01-01

    The computer groups has been reorganized to take charge for the general purpose computers DEC10 and VAX and the computer network (Dataswitch, DECnet, IBM - connections to GSI and IPP, preparation for Datex-P). (orig.)

  15. Group learning

    DEFF Research Database (Denmark)

    Pimentel, Ricardo; Noguira, Eloy Eros da Silva; Elkjær, Bente

    The article presents a study that aims at the apprehension of the group learning in a top management team composed by teachers in a Brazilian Waldorf school whose management is collective. After deciding to extend the school, they had problems recruiting teachers who were already trained based...... on the Steiner´s ideas, which created practical problems for conducting management activities. The research seeks to understand how that group of teachers collectively manage the school, facing the lack of resources, a significant heterogeneity in the relationships, and the conflicts and contradictions......, and they are interrelated to the group learning as the construction, maintenance and reconstruction of the intelligibility of practices. From this perspective, it can be said that learning is a practice and not an exceptional phenomenon. Building, maintaining and rebuilding the intelligibility is the group learning...

  16. Group technology

    International Nuclear Information System (INIS)

    Rome, C.P.

    1976-01-01

    Group Technology has been conceptually applied to the manufacture of batch-lots of 554 machined electromechanical parts which now require 79 different types of metal-removal tools. The products have been grouped into 7 distinct families which require from 8 to 22 machines in each machine-cell. Throughput time can be significantly reduced and savings can be realized from tooling, direct-labor, and indirect-labor costs

  17. Abelian groups

    CERN Document Server

    Fuchs, László

    2015-01-01

    Written by one of the subject’s foremost experts, this book focuses on the central developments and modern methods of the advanced theory of abelian groups, while remaining accessible, as an introduction and reference, to the non-specialist. It provides a coherent source for results scattered throughout the research literature with lots of new proofs. The presentation highlights major trends that have radically changed the modern character of the subject, in particular, the use of homological methods in the structure theory of various classes of abelian groups, and the use of advanced set-theoretical methods in the study of undecidability problems. The treatment of the latter trend includes Shelah’s seminal work on the undecidability in ZFC of Whitehead’s Problem; while the treatment of the former trend includes an extensive (but non-exhaustive) study of p-groups, torsion-free groups, mixed groups, and important classes of groups arising from ring theory. To prepare the reader to tackle these topics, th...

  18. Group dynamics.

    Science.gov (United States)

    Scandiffio, A L

    1990-12-01

    Group dynamics play a significant role within any organization, culture, or unit. The important thing to remember with any of these structures is that they are made up of people--people with different ideas, motivations, background, and sometimes different agendas. Most groups, formal or informal, look for a leader in an effort to maintain cohesiveness of the unit. At times, that cultural bond must be developed; once developed, it must be nurtured. There are also times that one of the group no longer finds the culture comfortable and begins to act out behaviorally. It is these times that become trying for the leader as she or he attempts to remain objective when that which was once in the building phase of group cohesiveness starts to fall apart. At all times, the manager must continue to view the employee creating the disturbance as an integral part of the group. It is at this time that it is beneficial to perceive the employee exhibiting problem behaviors as a special employee, as one who needs the benefit of your experience and skills, as one who is still part of the group. It is also during this time that the manager should focus upon her or his own views in the area of power, communication, and the corporate culture of the unit that one has established before attempting to understand another's point of view. Once we understand our own motivation and accept ourselves, it is then that we may move on to offer assistance to another. Once we understand our insecurities recognizing staff dysfunction as a symptom of system dysfunction will not be so threatening to the concept of the manager that we perceive ourselves to be. It takes a secure person to admit that she or he favors staff before deciding to do something to change things. The important thing to know is that it can be done. The favored staff can find a new way of relating to others, the special employee can find new modes of behavior (and even find self-esteem in the process), the group can find new ways

  19. Group representations

    CERN Document Server

    Karpilovsky, G

    1994-01-01

    This third volume can be roughly divided into two parts. The first part is devoted to the investigation of various properties of projective characters. Special attention is drawn to spin representations and their character tables and to various correspondences for projective characters. Among other topics, projective Schur index and projective representations of abelian groups are covered. The last topic is investigated by introducing a symplectic geometry on finite abelian groups. The second part is devoted to Clifford theory for graded algebras and its application to the corresponding theory

  20. Lego Group

    DEFF Research Database (Denmark)

    Møller Larsen, Marcus; Pedersen, Torben; Slepniov, Dmitrij

    2010-01-01

    The last years’ rather adventurous journey from 2004 to 2009 had taught the fifth-largest toy-maker in the world - the LEGO Group - the importance of managing the global supply chain effectively. In order to survive the largest internal financial crisis in its roughly 70 years of existence......, the management had, among many initiatives, decided to offshore and outsource a major chunk of its production to Flextronics. In this pursuit of rapid cost-cutting sourcing advantages, the LEGO Group planned to license out as much as 80 per cent of its production besides closing down major parts...

  1. Informal groups

    NARCIS (Netherlands)

    E. van den Berg; P. van Houwelingen; J. de Hart

    2011-01-01

    Original title: Informele groepen Going out running with a group of friends, rather than joining an official sports club. Individuals who decide to take action themselves rather than giving money to good causes. Maintaining contact with others not as a member of an association, but through an

  2. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2011-01-01

    The CMS Communications Group, established at the start of 2010, has been busy in all three areas of its responsibility: (1) Communications Infrastructure, (2) Information Systems, and (3) Outreach and Education. Communications Infrastructure There are now 55 CMS Centres worldwide that are well used by physicists working on remote CMS shifts, Computing operations, data quality monitoring, data analysis and outreach. The CMS Centre@CERN in Meyrin, is the centre of the CMS offline and computing operations, hosting dedicated analysis efforts such as during the CMS Heavy Ion lead-lead running. With a majority of CMS sub-detectors now operating in a “shifterless” mode, many monitoring operations are now routinely performed from there, rather than in the main Control Room at P5. The CMS Communications Group, CERN IT and the EVO team are providing excellent videoconferencing support for the rapidly-increasing number of CMS meetings. In parallel, CERN IT and ...

  3. Group therapy

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    Full text: In his review 'Genesis of Unified Gauge Theories' at the symposium in Honour of Abdus Salam (June, page 23), Tom Kibble of Imperial College, London, looked back to the physics events around Salam from 1959-67. He described how, in the early 1960s, people were pushing to enlarge the symmetry of strong interactions beyond the SU(2) of isospin and incorporate the additional strangeness quantum number. Kibble wrote - 'Salam had students working on every conceivable symmetry group. One of these was Yuval Ne'eman, who had the good fortune and/or prescience to work on SU(3). From that work, and of course from the independent work of Murray Gell- Mann, stemmed the Eightfold Way, with its triumphant vindication in the discovery of the omega-minus in 1964.' Yuval Ne'eman writes - 'I was the Defence Attaché at the Israeli Embassy in London and was admitted by Salam as a part-time graduate student when I arrived in 1958. I started research after resigning from the Embassy in May 1960. Salam suggested a problem: provide vector mesons with mass - the problem which was eventually solved by Higgs, Guralnik, Kibble,.... (as described by Kibble in his article). I explained to Salam that I had become interested in symmetry. Nobody at Imperial College at the time, other than Salam himself, was doing anything in groups, and attention further afield was focused on the rotation - SO(N) - groups. Reacting to my own half-baked schemes, Salam told me to forget about the rotation groups he taught us, and study group theory in depth, directing me to Eugene Dynkin's classification of Lie subalgebras, about which he had heard from Morton Hamermesh. I found Dynkin incomprehensible without first learning about Lie algebras from Henri Cartan's thesis, which luckily had been reproduced by Dynkin in his 1946 thesis, using his diagram method. From a copy of a translation of Dynkin's thesis which I found in the British Museum Library, I

  4. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2010-01-01

    The CMS Communications Group, established at the start of 2010, has been strengthening the activities in all three areas of its responsibility: (1) Communications Infrastructure, (2) Information Systems, and (3) Outreach and Education. Communications Infrastructure The Communications Group has invested a lot of effort to support the operations needs of CMS. Hence, the CMS Centres where physicists work on remote CMS shifts, Data Quality Monitoring, and Data Analysis are running very smoothly. There are now 55 CMS Centres worldwide, up from just 16 at the start of CMS data-taking. The latest to join are Imperial College London, the University of Iowa, and the Università di Napoli. The CMS Centre@CERN in Meyrin, which is now full repaired after the major flooding at the beginning of the year, has been at the centre of CMS offline and computing operations, most recently hosting a large fraction of the CMS Heavy Ion community during the lead-lead run. A number of sub-detector shifts can now take pla...

  5. Group play

    DEFF Research Database (Denmark)

    Tychsen, Anders; Hitchens, Michael; Brolund, Thea

    2008-01-01

    Role-playing games (RPGs) are a well-known game form, existing in a number of formats, including tabletop, live action, and various digital forms. Despite their popularity, empirical studies of these games are relatively rare. In particular there have been few examinations of the effects of the v......Role-playing games (RPGs) are a well-known game form, existing in a number of formats, including tabletop, live action, and various digital forms. Despite their popularity, empirical studies of these games are relatively rare. In particular there have been few examinations of the effects...... of the various formats used by RPGs on the gaming experience. This article presents the results of an empirical study, examining how multi-player tabletop RPGs are affected as they are ported to the digital medium. Issues examined include the use of disposition assessments to predict play experience, the effect...... of group dynamics, the influence of the fictional game characters and the comparative play experience between the two formats. The results indicate that group dynamics and the relationship between the players and their digital characters, are integral to the quality of the gaming experience in multiplayer...

  6. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2011-01-01

    The CMS Communications Group has been busy in all three areas of its responsibility: (1) Communications Infrastructure, (2) Information Systems, and (3) Outreach and Education. Communications Infrastructure The 55 CMS Centres worldwide are well used by physicists working on remote CMS shifts, Computing operations, data quality monitoring, data analysis and outreach. The CMS Centre@CERN in Meyrin, is the centre of the CMS Offline and Computing operations, and a number of subdetector shifts can now take place there, rather than in the main Control Room at P5. A new CMS meeting room has been equipped for videoconferencing in building 42, next to building 40. Our building 28 meeting room and the facilities at P5 will be refurbished soon and plans are underway to steadily upgrade the ageing equipment in all 15 CMS meeting rooms at CERN. The CMS evaluation of the Vidyo tool indicates that it is not yet ready to be considered as a potential replacement for EVO. The Communications Group provides the CMS-TV (web) cha...

  7. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2010-01-01

    The recently established CMS Communications Group, led by Lucas Taylor, has been busy in all three of its main are areas of responsibility: Communications Infrastructure, Information Systems, and Outreach and Education Communications Infrastructure The damage caused by the flooding of the CMS Centre@CERN on 21st December has been completely repaired and all systems are back in operation. Major repairs were made to the roofs, ceilings and one third of the floor had to be completely replaced. Throughout these works, the CMS Centre was kept operating and even hosted a major press event for first 7 TeV collisions, as described below. Incremental work behind the scenes is steadily improving the quality of the CMS communications infrastructure, particularly Webcasting, video conferencing, and meeting rooms at CERN. CERN/IT is also deploying a pilot service of a new videoconference tool called Vidyo, to assess whether it might provide an enhanced service at a lower cost, compared to the EVO tool currently in w...

  8. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2011-01-01

    Communications Infrastructure The 55 CMS Centres worldwide are well used by physicists working on remote CMS shifts, Computing operations, data quality monitoring, data analysis and outreach. The CMS Centre@CERN in Meyrin is particularly busy at the moment, hosting about 50 physicists taking part in the heavy-ion data-taking and analysis. Three new CMS meeting room will be equipped for videoconferencing in early 2012: 40/5B-08, 42/R-031, and 28/S-029. The CMS-TV service showing LHC Page 1, CMS Page 1, etc. (http://cmsdoc.cern.ch/cmscc/projector/index.jsp) is now also available for mobile devices: http://cern.ch/mcmstv. Figure 12: Screenshots of CMS-TV for mobile devices Information Systems CMS has a new web site: (http://cern.ch/cms) using a modern web Content Management System to ensure content and links are managed and updated easily and coherently. It covers all CMS sub-projects and groups, replacing the iCMS internal pages. It also incorporates the existing CMS public web site (http:/...

  9. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2012-01-01

      Outreach and Education We are fortunate that our research has captured the public imagination, even though this inevitably puts us under the global media spotlight, as we saw with the Higgs seminar at CERN in December, which had 110,000 distinct webcast viewers. The media interest was huge with 71 media organisations registering to come to CERN to cover the Higgs seminar, which was followed by a press briefing with the DG and Spokespersons. This event resulted in about 2,000 generally positive stories in the global media. For this seminar, the CMS Communications Group prepared up-to-date news and public material, including links to the CMS results, animations and event displays [http://cern.ch/go/Ch8thttp://cern.ch/go/Ch8t]. There were 44,000 page-views on the CMS public website, with the Higgs news article being by far the most popular item. CMS event displays from iSpy are fast becoming the iconic media images, featuring on numerous major news outlets (BBC, CNN, MSN...) as well as in the sci...

  10. Epigenetic modifications by Trithorax group proteins during early embryogenesis: do members of Trx-G function as maternal effect genes?

    Science.gov (United States)

    Andreu-Vieyra, Claudia; Matzuk, Martin M

    2007-02-01

    Maternal effect genes encode transcripts that are expressed during oogenesis. These gene products are stored in the oocyte and become functional during resumption of meiosis and zygote genome activation, and in embryonic stem cells. To date, a few maternal effect genes have been identified in mammals. Epigenetic modifications have been shown to be important during early embryonic development and involve DNA methylation and post-translational modification of core histones. During development, two families of proteins have been shown to be involved in epigenetic changes: Trithorax group (Trx-G) and Polycomb group (Pc-G) proteins. Trx-G proteins function as transcriptional activators and have been shown to accumulate in the oocyte. Deletion of Trx-G members using conventional knockout technology results in embryonic lethality in the majority of the cases analysed to date. Recent studies using conditional knockout mice have revealed that at least one family member is necessary for zygote genome activation. We propose that other Trx-G members may also regulate embryonic genome activation and that the use of oocyte-specific deletor mouse lines will help clarify their roles in this process.

  11. Evaluation of potential prognostic value of Bmi-1 gene product and selected markers of proliferation (Ki-67 and apoptosis (p53 in the neuroblastoma group of tumors

    Directory of Open Access Journals (Sweden)

    Katarzyna Taran

    2016-02-01

    Full Text Available Introduction: Cancer in children is a very important issue in pediatrics. The least satisfactory treatment outcome occurs among patients with clinically advanced neuroblastomas. Despite much research, the biology of this tumor still remains unclear, and new prognostic factors are sought. The Bmi-1 gene product is a currently highly investigated protein which belongs to the Polycomb group (PcG and has been identified as a regulator of primary neural crest cells. It is believed that Bmi‑1 and N-myc act together and are both involved in the pathogenesis of neuroblastoma. The aim of the study was to assess the potential prognostic value of Bmi-1 protein and its relations with mechanisms of proliferation and apoptosis in the neuroblastoma group of tumors.Material/Methods: 29 formalin-fixed and paraffin-embedded neuroblastoma tissue sections were examined using mouse monoclonal antibodies anti-Bmi-1, anti-p53 and anti-Ki-67 according to the manufacturer’s instructions.Results: There were found statistically significant correlations between Bmi-1 expression and tumor histology and age of patients.Conclusions: Bmi-1 seems to be a promising marker in the neuroblastoma group of tumors whose expression correlates with widely accepted prognostic parameters. The pattern of BMI-1 expression may indicate that the examined protein is also involved in maturation processes in tumor tissue.

  12. Which finite simple groups are unit groups?

    DEFF Research Database (Denmark)

    Davis, Christopher James; Occhipinti, Tommy

    2014-01-01

    We prove that if G is a finite simple group which is the unit group of a ring, then G is isomorphic to either (a) a cyclic group of order 2; (b) a cyclic group of prime order 2^k −1 for some k; or (c) a projective special linear group PSLn(F2) for some n ≥ 3. Moreover, these groups do all occur a...

  13. Group Cohesion in Experiential Growth Groups

    Science.gov (United States)

    Steen, Sam; Vasserman-Stokes, Elaina; Vannatta, Rachel

    2014-01-01

    This article explores the effect of web-based journaling on changes in group cohesion within experiential growth groups. Master's students were divided into 2 groups. Both used a web-based platform to journal after each session; however, only 1 of the groups was able to read each other's journals. Quantitative data collected before and…

  14. Group Work Publication-1991.

    Science.gov (United States)

    Zimpfer, David G.

    1992-01-01

    Lists 21 new publications in group work, of which 9 are reviewed. Those discussed include publications on group counseling and psychotherapy, structured groups, support groups, psychodrama, and social group work. (Author/NB)

  15. Quantum isometry groups

    Indian Academy of Sciences (India)

    Jyotishman Bhowmick

    2015-11-07

    Nov 7, 2015 ... Classical. Quantum. Background. Compact Hausdorff space. Unital C∗ algebra. Gelfand-Naimark. Compact Group. Compact Quantum Group. Woronowicz. Group Action. Coaction. Woronowicz. Riemannian manifold. Spectral triple. Connes. Isometry group. Quantum Isometry Group. To be discussed.

  16. Group typicality, group loyalty and cognitive development.

    Science.gov (United States)

    Patterson, Meagan M

    2014-09-01

    Over the course of childhood, children's thinking about social groups changes in a variety of ways. Developmental Subjective Group Dynamics (DSGD) theory emphasizes children's understanding of the importance of conforming to group norms. Abrams et al.'s study, which uses DSGD theory as a framework, demonstrates the social cognitive skills underlying young elementary school children's thinking about group norms. Future research on children's thinking about groups and group norms should explore additional elements of this topic, including aspects of typicality beyond loyalty. © 2014 The British Psychological Society.

  17. AREVA group overview; Presentation du groupe AREVA

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-02-08

    This document presents the Group Areva, a world nuclear industry leader, from a financial holding company to an industrial group, operating in two businesses: the nuclear energy and the components. The structure and the market of the group are discussed, as the financial assets. (A.L.B.)

  18. Overgroups of root groups in classical groups

    CERN Document Server

    Aschbacher, Michael

    2016-01-01

    The author extends results of McLaughlin and Kantor on overgroups of long root subgroups and long root elements in finite classical groups. In particular he determines the maximal subgroups of this form. He also determines the maximal overgroups of short root subgroups in finite classical groups and the maximal overgroups in finite orthogonal groups of c-root subgroups.

  19. Interagency mechanical operations group numerical systems group

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-09-01

    This report consists of the minutes of the May 20-21, 1971 meeting of the Interagency Mechanical Operations Group (IMOG) Numerical Systems Group. This group looks at issues related to numerical control in the machining industry. Items discussed related to the use of CAD and CAM, EIA standards, data links, and numerical control.

  20. Theory of Lie groups

    CERN Document Server

    Chevalley, Claude

    2018-01-01

    The standard text on the subject for many years, this introductory treatment covers classical linear groups, topological groups, manifolds, analytic groups, differential calculus of Cartan, and compact Lie groups and their representations. 1946 edition.

  1. Introduction to Sporadic Groups

    Directory of Open Access Journals (Sweden)

    Luis J. Boya

    2011-01-01

    Full Text Available This is an introduction to finite simple groups, in particular sporadic groups, intended for physicists. After a short review of group theory, we enumerate the 1+1+16=18 families of finite simple groups, as an introduction to the sporadic groups. These are described next, in three levels of increasing complexity, plus the six isolated ''pariah'' groups. The (old five Mathieu groups make up the first, smallest order level. The seven groups related to the Leech lattice, including the three Conway groups, constitute the second level. The third and highest level contains the Monster group M, plus seven other related groups. Next a brief mention is made of the remaining six pariah groups, thus completing the 5+7+8+6=26 sporadic groups. The review ends up with a brief discussion of a few of physical applications of finite groups in physics, including a couple of recent examples which use sporadic groups.

  2. Group Work: How to Use Groups Effectively

    Science.gov (United States)

    Burke, Alison

    2011-01-01

    Many students cringe and groan when told that they will need to work in a group. However, group work has been found to be good for students and good for teachers. Employers want college graduates to have developed teamwork skills. Additionally, students who participate in collaborative learning get better grades, are more satisfied with their…

  3. Free Boolean Topological Groups

    Directory of Open Access Journals (Sweden)

    Ol’ga Sipacheva

    2015-11-01

    Full Text Available Known and new results on free Boolean topological groups are collected. An account of the properties that these groups share with free or free Abelian topological groups and properties specific to free Boolean groups is given. Special emphasis is placed on the application of set-theoretic methods to the study of Boolean topological groups.

  4. Small Group Research

    Science.gov (United States)

    McGrath, Joseph E.

    1978-01-01

    Summarizes research on small group processes by giving a comprehensive account of the types of variables primarily studied in the laboratory. These include group structure, group composition, group size, and group relations. Considers effects of power, leadership, conformity to social norms, and role relationships. (Author/AV)

  5. Geometric group theory

    CERN Document Server

    Druţu, Cornelia

    2018-01-01

    The key idea in geometric group theory is to study infinite groups by endowing them with a metric and treating them as geometric spaces. This applies to many groups naturally appearing in topology, geometry, and algebra, such as fundamental groups of manifolds, groups of matrices with integer coefficients, etc. The primary focus of this book is to cover the foundations of geometric group theory, including coarse topology, ultralimits and asymptotic cones, hyperbolic groups, isoperimetric inequalities, growth of groups, amenability, Kazhdan's Property (T) and the Haagerup property, as well as their characterizations in terms of group actions on median spaces and spaces with walls. The book contains proofs of several fundamental results of geometric group theory, such as Gromov's theorem on groups of polynomial growth, Tits's alternative, Stallings's theorem on ends of groups, Dunwoody's accessibility theorem, the Mostow Rigidity Theorem, and quasiisometric rigidity theorems of Tukia and Schwartz. This is the f...

  6. Profinite graphs and groups

    CERN Document Server

    Ribes, Luis

    2017-01-01

    This book offers a detailed introduction to graph theoretic methods in profinite groups and applications to abstract groups. It is the first to provide a comprehensive treatment of the subject. The author begins by carefully developing relevant notions in topology, profinite groups and homology, including free products of profinite groups, cohomological methods in profinite groups, and fixed points of automorphisms of free pro-p groups. The final part of the book is dedicated to applications of the profinite theory to abstract groups, with sections on finitely generated subgroups of free groups, separability conditions in free and amalgamated products, and algorithms in free groups and finite monoids. Profinite Graphs and Groups will appeal to students and researchers interested in profinite groups, geometric group theory, graphs and connections with the theory of formal languages. A complete reference on the subject, the book includes historical and bibliographical notes as well as a discussion of open quest...

  7. Group purchasing: an overview.

    Science.gov (United States)

    Wetrich, J G

    1987-07-01

    The various types and operational methods of purchasing groups are described, and evaluation of groups is discussed. Since group purchasing is increasing in popularity as a method of controlling drug costs, community and hospital pharmacy managers may need to evaluate various groups to determine the appropriateness of their services. Groups are categorized as independent, system based, or alliance or association based. Instead of "purchasing," some groups develop contracts for hospitals, which then purchase directly from the vendor. Aside from this basic difference between groups that purchase and groups that contract, comparisons among groups are difficult because of the wide variation in sizes and services. Competition developing from diversification among groups has led to "super groups," formed from local and regional groups. In evaluating groups, advantages and disadvantages germane to accomplishing the member's objectives must be considered. To ensure a group's success, members must be committed and support the group's philosophies; hospital pharmacists must help to establish a strong formulary system. To select vendors, groups should develop formal qualification and selection criteria and should not base a decision solely on price. The method of solicitation (bidding or negotiating), as well as the role of the prime vendor, should be studied. Legal implications of group purchasing, especially in the areas of administrative fees and drug diversion, must also be considered. The most advantageous group for each organization will include members with common missions and will be able to implement strategies for future success.

  8. Ordered groups and infinite permutation groups

    CERN Document Server

    1996-01-01

    The subjects of ordered groups and of infinite permutation groups have long en­ joyed a symbiotic relationship. Although the two subjects come from very different sources, they have in certain ways come together, and each has derived considerable benefit from the other. My own personal contact with this interaction began in 1961. I had done Ph. D. work on sequence convergence in totally ordered groups under the direction of Paul Conrad. In the process, I had encountered "pseudo-convergent" sequences in an ordered group G, which are like Cauchy sequences, except that the differences be­ tween terms of large index approach not 0 but a convex subgroup G of G. If G is normal, then such sequences are conveniently described as Cauchy sequences in the quotient ordered group GIG. If G is not normal, of course GIG has no group structure, though it is still a totally ordered set. The best that can be said is that the elements of G permute GIG in an order-preserving fashion. In independent investigations around that t...

  9. ALIGNMENTS OF GROUP GALAXIES WITH NEIGHBORING GROUPS

    International Nuclear Information System (INIS)

    Wang Yougang; Chen Xuelei; Park, Changbom; Yang Xiaohu; Choi, Yun-Young

    2009-01-01

    Using a sample of galaxy groups found in the Sloan Digital Sky Survey Data Release 4, we measure the following four types of alignment signals: (1) the alignment between the distributions of the satellites of each group relative to the direction of the nearest neighbor group (NNG); (2) the alignment between the major axis direction of the central galaxy of the host group (HG) and the direction of the NNG; (3) the alignment between the major axes of the central galaxies of the HG and the NNG; and (4) the alignment between the major axes of the satellites of the HG and the direction of the NNG. We find strong signal of alignment between the satellite distribution and the orientation of central galaxy relative to the direction of the NNG, even when the NNG is located beyond 3r vir of the host group. The major axis of the central galaxy of the HG is aligned with the direction of the NNG. The alignment signals are more prominent for groups that are more massive and with early-type central galaxies. We also find that there is a preference for the two major axes of the central galaxies of the HG and NNG to be parallel for the system with both early central galaxies, however, not for the systems with both late-type central galaxies. For the orientation of satellite galaxies, we do not find any significant alignment signals relative to the direction of the NNG. From these four types of alignment measurements, we conclude that the large-scale environment traced by the nearby group affects primarily the shape of the host dark matter halo, and hence also affects the distribution of satellite galaxies and the orientation of central galaxies. In addition, the NNG directly affects the distribution of the satellite galaxies by inducing asymmetric alignment signals, and the NNG at very small separation may also contribute a second-order impact on the orientation of the central galaxy in the HG.

  10. Citizens' action group

    International Nuclear Information System (INIS)

    Andritzky, W.

    1978-01-01

    For the first empirical study of citizens' action groups 331 such groups were consulted. Important information was collected on the following aspects of these groups: their self-image, areas and forms of activities, objectives and their extent, how long the group has existed, successes and failures and their forms of organisation. (orig.) [de

  11. Communication in Organizational Groups

    OpenAIRE

    Monica RADU

    2007-01-01

    Organizational group can be defined as some persons between who exist interactive connections (functional, communication, affective, normative type). Classification of these groups can reflect the dimension, type of relationship or type of rules included. Organizational groups and their influence over the individual efficiency and the efficiency of the entire group are interconnected. Spontaneous roles in these groups sustain the structure of the relationship, and the personality of each indi...

  12. [Social crisis, spontaneous groups and group order].

    Science.gov (United States)

    Edelman, Lucila; Kordon, Diana

    2002-12-01

    Argentina has gone through very difficult times during the last years and, in particularly, new kinds of social practices have emerged in order to cope with the crisis. This situation demands and urges a new type of reflection upon the double role of groups, as tools to transform reality and as a way to elaborate those processes regarding subjectivity. In this paper we analyse some topics regarding the groupal field (considering spontaneous groups as well as groupal devices that allow to elaborate the crisis). We consider social bond to be the condition of possibility for the existence of the psyche and of time continuity, and that it also makes possible personal and social elaboration of trauma, crisis and social catastrophe. We develop some aspects of an specific device (the reflection group), which we have already depicted in another moment, showing it's usefulness to cope with social crisis and to promote the subjective elaboration of crisis.

  13. Introduction to topological groups

    CERN Document Server

    Husain, Taqdir

    2018-01-01

    Concise treatment covers semitopological groups, locally compact groups, Harr measure, and duality theory and some of its applications. The volume concludes with a chapter that introduces Banach algebras. 1966 edition.

  14. MSUD Family Support Group

    Science.gov (United States)

    ... The Treatment Of MSUD The MSUD Family Support Group has provided funds to Buck Institute for its ... of the membership of the MSUD Family Support Group, research for improved treatments and potential cure was ...

  15. Nilpotent -local finite groups

    Science.gov (United States)

    Cantarero, José; Scherer, Jérôme; Viruel, Antonio

    2014-10-01

    We provide characterizations of -nilpotency for fusion systems and -local finite groups that are inspired by known result for finite groups. In particular, we generalize criteria by Atiyah, Brunetti, Frobenius, Quillen, Stammbach and Tate.

  16. UPIN Group File

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Group Unique Physician Identifier Number (UPIN) File is the business entity file that contains the group practice UPIN and descriptive information. It does NOT...

  17. Group Decision Process Support

    DEFF Research Database (Denmark)

    Gøtze, John; Hijikata, Masao

    1997-01-01

    Introducing the notion of Group Decision Process Support Systems (GDPSS) to traditional decision-support theorists.......Introducing the notion of Group Decision Process Support Systems (GDPSS) to traditional decision-support theorists....

  18. Gestalt Interactional Groups

    Science.gov (United States)

    Harman, Robert L.; Franklin, Richard W.

    1975-01-01

    Gestalt therapy in groups is not limited to individual work in the presence of an audience. Describes several ways to involve gestalt groups interactionally. Interactions described focus on learning by doing and discovering, and are noninterpretive. (Author/EJT)

  19. Group B streptococcus - pregnancy

    Science.gov (United States)

    ... medlineplus.gov/ency/patientinstructions/000511.htm Group B streptococcus - pregnancy To use the sharing features on this page, please enable JavaScript. Group B streptococcus (GBS) is a type of bacteria that some ...

  20. Multicultural group work

    DEFF Research Database (Denmark)

    Hansen, Annette Skovsted

    2014-01-01

    Motivation for the activity I use this strategy for forming groups to ensure diverse/multicultural groups that combine a variety of different strengths and resources based on student's academic, disciplinary, linguistic, national, personal and work backgrounds.......Motivation for the activity I use this strategy for forming groups to ensure diverse/multicultural groups that combine a variety of different strengths and resources based on student's academic, disciplinary, linguistic, national, personal and work backgrounds....

  1. The Areva Group; Le groupe Areva

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2004-08-01

    This document provides information on the Areva Group, a world nuclear industry leader, offering solutions for nuclear power generation, electricity transmission and distribution and interconnect systems to the telecommunications, computer and automotive markets. It presents successively the front end division including the group business lines involved in producing nuclear fuel for electric power generation (uranium mining, concentration, conversion and enrichment and nuclear fuel fabrication); the reactors and services division which designs and builds PWR, BWR and research reactors; the back end division which encompasses the management of the fuel that has been used in nuclear power plants; the transmission and distribution division which provides products, systems and services to the medium and high voltage energy markets; the connectors division which designs and manufactures electrical, electronic and optical connectors, flexible micro circuitry and interconnection systems. Areva is implemented in Europe, north and south america, africa and asia-pacific. (A.L.B.)

  2. Groups, combinatorics and geometry

    CERN Document Server

    Ivanov, A A; Saxl, J

    2003-01-01

    Over the past 20 years, the theory of groups in particular simplegroups, finite and algebraic has influenced a number of diverseareas of mathematics. Such areas include topics where groups have beentraditionally applied, such as algebraic combinatorics, finitegeometries, Galois theory and permutation groups, as well as severalmore recent developments.

  3. Working Group 7 Summary

    Energy Technology Data Exchange (ETDEWEB)

    Nagaitsev S.; Berg J.

    2012-06-10

    The primary subject of working group 7 at the 2012 Advanced Accelerator Concepts Workshop was muon accelerators for a muon collider or neutrino factory. Additionally, this working group included topics that did not fit well into other working groups. Two subjects were discussed by more than one speaker: lattices to create a perfectly integrable nonlinear lattice, and a Penning trap to create antihydrogen.

  4. AREVA group overview

    International Nuclear Information System (INIS)

    2002-01-01

    This document presents the Group Areva, a world nuclear industry leader, from a financial holding company to an industrial group, operating in two businesses: the nuclear energy and the components. The structure and the market of the group are discussed, as the financial assets. (A.L.B.)

  5. Group Psychotherapy in Denmark.

    Science.gov (United States)

    Jørgensen, Lars Bo; Thygesen, Bente; Aagaard, Søren

    2015-10-01

    This is a short article on the history and training standards in the Institute of Group Analysis in Copenhagen (IGA-CPH). We describe theoretical orientations and influences in the long-term training program and new initiatives, like courses in mentalization-based group treatment and a dynamic short-term group therapy course, as well as research in group psychotherapy in Denmark. Some group analytic initiatives in relation to social issues and social welfare are presented, as well as initiatives concerning the school system and unemployment.

  6. Group theory I essentials

    CERN Document Server

    Milewski, Emil G

    2012-01-01

    REA's Essentials provide quick and easy access to critical information in a variety of different fields, ranging from the most basic to the most advanced. As its name implies, these concise, comprehensive study guides summarize the essentials of the field covered. Essentials are helpful when preparing for exams, doing homework and will remain a lasting reference source for students, teachers, and professionals. Group Theory I includes sets and mapping, groupoids and semi-groups, groups, isomorphisms and homomorphisms, cyclic groups, the Sylow theorems, and finite p-groups.

  7. Lectures on Chevalley groups

    CERN Document Server

    Steinberg, Robert

    2016-01-01

    Robert Steinberg's Lectures on Chevalley Groups were delivered and written during the author's sabbatical visit to Yale University in the 1967-1968 academic year. The work presents the status of the theory of Chevalley groups as it was in the mid-1960s. Much of this material was instrumental in many areas of mathematics, in particular in the theory of algebraic groups and in the subsequent classification of finite groups. This posthumous edition incorporates additions and corrections prepared by the author during his retirement, including a new introductory chapter. A bibliography and editorial notes have also been added. This is a great unsurpassed introduction to the subject of Chevalley groups that influenced generations of mathematicians. I would recommend it to anybody whose interests include group theory. -Efim Zelmanov, University of California, San Diego Robert Steinberg's lectures on Chevalley groups were given at Yale University in 1967. The notes for the lectures contain a wonderful exposition of ...

  8. E-groups training

    CERN Multimedia

    HR Department

    2012-01-01

    There will be an e-groups training course on 16 March 2012 which will cover the main e-groups functionalities i.e.: creating and managing e-groups, difference between static and dynamic e-groups, configuring posting restrictions and archives, examples of where e-groups can be used in daily work. Even if you have already worked with e-groups, this may be a good opportunity to learn about the best practices and security related recommendations when using e-groups. You can find more details as well as enrolment form for the training (it’s free) here. The number of places is limited, so enrolling early is recommended.   Technical Training Tel. 72844

  9. Group Psychotherapy in Italy.

    Science.gov (United States)

    Giannone, Francesca; Giordano, Cecilia; Di Blasi, Maria

    2015-10-01

    This article describes the history and the prevailing orientations of group psychotherapy in Italy (psychoanalytically oriented, psychodrama, CBT groups) and particularly group analysis. Provided free of charge by the Italian health system, group psychotherapy is growing, but its expansion is patchy. The main pathways of Italian training in the different group psychotherapy orientations are also presented. Clinical-theoretical elaboration on self development, psychopathology related to group experiences, and the methodological attention paid to objectives and methods in different clinical groups are issues related to group therapy in Italy. Difficulties in the relationship between research and clinical practice are discussed, as well as the empirical research network that tries to bridge the gap between research and clinical work in group psychotherapy. The economic crisis in Italy has led to massive cuts in health care and to an increasing demand for some forms of psychological treatment. For these reasons, and because of its positive cost-benefit ratio, group psychotherapy is now considered an important tool in the national health care system to expand the clinical response to different forms of psychological distress.

  10. Geometric group theory

    CERN Document Server

    Bestvina, Mladen; Vogtmann, Karen

    2014-01-01

    Geometric group theory refers to the study of discrete groups using tools from topology, geometry, dynamics and analysis. The field is evolving very rapidly and the present volume provides an introduction to and overview of various topics which have played critical roles in this evolution. The book contains lecture notes from courses given at the Park City Math Institute on Geometric Group Theory. The institute consists of a set of intensive short courses offered by leaders in the field, designed to introduce students to exciting, current research in mathematics. These lectures do not duplicate standard courses available elsewhere. The courses begin at an introductory level suitable for graduate students and lead up to currently active topics of research. The articles in this volume include introductions to CAT(0) cube complexes and groups, to modern small cancellation theory, to isometry groups of general CAT(0) spaces, and a discussion of nilpotent genus in the context of mapping class groups and CAT(0) gro...

  11. CLASSIFICATION OF CRIMINAL GROUPS

    OpenAIRE

    Natalia Romanova

    2013-01-01

    New types of criminal groups are emerging in modern society.  These types have their special criminal subculture. The research objective is to develop new parameters of classification of modern criminal groups, create a new typology of criminal groups and identify some features of their subculture. Research methodology is based on the system approach that includes using the method of analysis of documentary sources (materials of a criminal case), method of conversations with themembers of the...

  12. Group therapy for adolescents

    OpenAIRE

    Nada Hribar

    2001-01-01

    The group included adolescents from secondary school and some students. The group had weekly sessions or twice on mounth. The adolescents had varied simptoms: depressive, anxiety, psychosomatic disorders, learning difficulties, cunduct problems. All of adolescents were common on many problems in social interactions. The goal of therapeutic work were: to increase assertiveness skills and to reduce the anxious in social situations. The adolescents in group raised a self-esteem and developed som...

  13. Presentations of groups

    CERN Document Server

    Johnson, D L

    1997-01-01

    The aim of this book is to provide an introduction to combinatorial group theory. Any reader who has completed first courses in linear algebra, group theory and ring theory will find this book accessible. The emphasis is on computational techniques but rigorous proofs of all theorems are supplied. This new edition has been revised throughout, including new exercises and an additional chapter on proving that certain groups are infinite.

  14. Group-Server Queues

    OpenAIRE

    Li, Quan-Lin; Ma, Jing-Yu; Xie, Mingzhou; Xia, Li

    2017-01-01

    By analyzing energy-efficient management of data centers, this paper proposes and develops a class of interesting {\\it Group-Server Queues}, and establishes two representative group-server queues through loss networks and impatient customers, respectively. Furthermore, such two group-server queues are given model descriptions and necessary interpretation. Also, simple mathematical discussion is provided, and simulations are made to study the expected queue lengths, the expected sojourn times ...

  15. Environmental groups in politics

    International Nuclear Information System (INIS)

    Lowe, P.; Goyder, J.

    1983-01-01

    The subject is covered in chapters, entitled: introduction; (Part I) the environmental movement (environmental groups and the attentive public; the episodic development of the environmental movement; the underlying values of environmentalism; the roots of environmental concern; the social limits to growth; elite manipulation of values); the organisation of environmental groups; environmental groups in national politics; environmental groups in local politics; (Part II) the Henley Society; Friends of the Earth; the National Trust; the Royal Society for Nature Conservation; the European Environmental Bureau. (U.K.)

  16. Complex quantum groups

    International Nuclear Information System (INIS)

    Drabant, B.; Schlieker, M.

    1993-01-01

    The complex quantum groups are constructed. They are q-deformations of the real Lie groups which are obtained as the complex groups corresponding to the Lie algebras of type A n-1 , B n , C n . Following the ideas of Faddeev, Reshetikhin and Takhtajan Hopf algebras of regular functionals U R for these complexified quantum groups are constructed. One has thus in particular found a construction scheme for the q-Lorentz algebra to be identified as U(sl q (2,C). (orig.)

  17. Explosive Technology Group

    Data.gov (United States)

    Federal Laboratory Consortium — The Explosive Technology Group (ETG) provides diverse technical expertise and an agile, integrated approach to solve complex challenges for all classes of energetic...

  18. Study Groups in Denmark

    DEFF Research Database (Denmark)

    Hjorth, Poul G.

    2007-01-01

    Since 1998 European Study Groups have been held in Denmark, and Danish companies from LEGO and NOVO to very small high-tech firms have participated. I briefly describe the history, the organisation and the format of the Danish Study Groups, and highlight a few problem solutions.......Since 1998 European Study Groups have been held in Denmark, and Danish companies from LEGO and NOVO to very small high-tech firms have participated. I briefly describe the history, the organisation and the format of the Danish Study Groups, and highlight a few problem solutions....

  19. Lie groups for pedestrians

    CERN Document Server

    Lipkin, Harry J

    2002-01-01

    According to the author of this concise, high-level study, physicists often shy away from group theory, perhaps because they are unsure which parts of the subject belong to the physicist and which belong to the mathematician. However, it is possible for physicists to understand and use many techniques which have a group theoretical basis without necessarily understanding all of group theory. This book is designed to familiarize physicists with those techniques. Specifically, the author aims to show how the well-known methods of angular momentum algebra can be extended to treat other Lie group

  20. The normal holonomy group

    International Nuclear Information System (INIS)

    Olmos, C.

    1990-05-01

    The restricted holonomy group of a Riemannian manifold is a compact Lie group and its representation on the tangent space is a product of irreducible representations and a trivial one. Each one of the non-trivial factors is either an orthogonal representation of a connected compact Lie group which acts transitively on the unit sphere or it is the isotropy representation of a single Riemannian symmetric space of rank ≥ 2. We prove that, all these properties are also true for the representation on the normal space of the restricted normal holonomy group of any submanifold of a space of constant curvature. 4 refs

  1. EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer

    NARCIS (Netherlands)

    Pietersen, Alexandra M.; Horlings, Hugo M.; Hauptmann, Michael; Langerod, Anita; Ajouaou, Abderrahim; Cornelissen-Steijger, Paulien; Wessels, Lodewijk F.; Jonkers, Jos; van de Vijver, Marc J.; van Lohuizen, Maarten

    2008-01-01

    Introduction PolycombGroup (PcG) proteins maintain gene repression through histone modifications and have been implicated in stem cell regulation and cancer. EZH2 is part of Polycomb Repressive Complex 2 (PRC2) and trimethylates H3K27. This histone mark recruits the BMI1-containing PRC1 that

  2. Suz12 is essential for mouse development and for EZH2 histone methyltransferase activity

    DEFF Research Database (Denmark)

    Pasini, Diego; Bracken, Adrian P; Jensen, Michael R

    2004-01-01

    SUZ12 is a recently identified Polycomb group (PcG) protein, which together with EZH2 and EED forms different Polycomb repressive complexes (PRC2/3). These complexes contain histone H3 lysine (K) 27/9 and histone H1 K26 methyltransferase activity specified by the EZH2 SET domain. Here we show...

  3. Trajectory grouping structure

    Directory of Open Access Journals (Sweden)

    Maike Buchin

    2015-03-01

    Full Text Available The collective motion of a set of moving entities like people, birds, or other animals, is characterized by groups arising, merging, splitting, and ending. Given the trajectories of these entities, we define and model a structure that captures all of such changes using the Reeb graph, a concept from topology. The trajectory grouping structure has three natural parameters that allow more global views of the data in group size, group duration, and entity inter-distance. We prove complexity bounds on the maximum number of maximal groups that can be present, and give algorithms to compute the grouping structure efficiently. We also study how the trajectory grouping structure can be made robust, that is, how brief interruptions of groups can be disregarded in the global structure, adding a notion of persistence to the structure. Furthermore, we showcase the results of experiments using data generated by the NetLogo flocking model and from the Starkey project. The Starkey data describe the movement of elk, deer, and cattle. Although there is no ground truth for the grouping structure in this data, the experiments show that the trajectory grouping structure is plausible and has the desired effects when changing the essential parameters. Our research provides the first complete study of trajectory group evolvement, including combinatorial,algorithmic, and experimental results.

  4. Computational methods working group

    International Nuclear Information System (INIS)

    Gabriel, T.A.

    1997-09-01

    During the Cold Moderator Workshop several working groups were established including one to discuss calculational methods. The charge for this working group was to identify problems in theory, data, program execution, etc., and to suggest solutions considering both deterministic and stochastic methods including acceleration procedures.

  5. GroupFinder

    DEFF Research Database (Denmark)

    Bøgh, Kenneth Sejdenfaden; Skovsgaard, Anders; Jensen, Christian S.

    2013-01-01

    . Such groups are relevant to users who wish to conveniently explore several options before making a decision such as to purchase a specific product. Specifically, we demonstrate a practical proposal for finding top-k PoI groups in response to a query. We show how problem parameter settings can be mapped...

  6. Toleration, Groups, and Multiculturalism

    DEFF Research Database (Denmark)

    Lægaard, Sune

    2014-01-01

    have the ability to interfere with the group’s activities, an object of dislike or disapproval, an agent enjoying non-interference or a moral patient. This means that 'toleration of groups' can mean quite different things depending on the exact meaning of 'group' in relation to each component...

  7. Group B Strep Infection

    Science.gov (United States)

    ... IV) to kill the germs. If you take antibiotics while you’re in labor, the chances are very good that your baby won’t get this infection. What if my baby has group B strep? If your baby gets group B strep, he or she will be treated with IV antibiotics to kill the bacteria. Your baby will stay ...

  8. Group Process as Drama.

    Science.gov (United States)

    McLeod, John

    1984-01-01

    Suggests that drama, as well as training or therapy, may be employed as a useful research and practice paradigm in working with small groups. The implications of this view for group development as a whole, and for member and leader participation, are explored. (JAC)

  9. Group Work. Research Brief

    Science.gov (United States)

    Walker, Karen

    2010-01-01

    According to Johnson and Johnson, group work helps increase student retention and satisfaction, develops strong oral communication and social skills, as well as higher self-esteem (University of Minnesota, n.d.). Group work, when planned and implemented deliberately and thoughtfully helps students develop cognitive and leadership skills as well as…

  10. Physically detached 'compact groups'

    Science.gov (United States)

    Hernquist, Lars; Katz, Neal; Weinberg, David H.

    1995-01-01

    A small fraction of galaxies appear to reside in dense compact groups, whose inferred crossing times are much shorter than a Hubble time. These short crossing times have led to considerable disagreement among researchers attempting to deduce the dynamical state of these systems. In this paper, we suggest that many of the observed groups are not physically bound but are chance projections of galaxies well separated along the line of sight. Unlike earlier similar proposals, ours does not require that the galaxies in the compact group be members of a more diffuse, but physically bound entity. The probability of physically separated galaxies projecting into an apparent compact group is nonnegligible if most galaxies are distributed in thin filaments. We illustrate this general point with a specific example: a simulation of a cold dark matter universe, in which hydrodynamic effects are included to identify galaxies. The simulated galaxy distribution is filamentary and end-on views of these filaments produce apparent galaxy associations that have sizes and velocity dispersions similar to those of observed compact groups. The frequency of such projections is sufficient, in principle, to explain the observed space density of groups in the Hickson catalog. We discuss the implications of our proposal for the formation and evolution of groups and elliptical galaxies. The proposal can be tested by using redshift-independent distance estimators to measure the line-of-sight spatial extent of nearby compact groups.

  11. Introduction to quantum groups

    International Nuclear Information System (INIS)

    Sudbery, A.

    1996-01-01

    These pedagogical lectures contain some motivation for the study of quantum groups; a definition of ''quasi triangular Hopf algebra'' with explanations of all the concepts required to build it up; descriptions of quantised universal enveloping algebras and the quantum double; and an account of quantised function algebras and the action of quantum groups on quantum spaces. (author)

  12. Beam dynamics group summary

    International Nuclear Information System (INIS)

    Peggs, S.

    1994-01-01

    This paper summarizes the activities of the beam dynamics working group of the LHC Collective Effects Workshop that was held in Montreux in 1994. It reviews the presentations that were made to the group, the discussions that ensued, and the consensuses that evolved

  13. Our Deming Users' Group.

    Science.gov (United States)

    Dinklocker, Christina

    1992-01-01

    After training in the Total Quality Management concept, a suburban Ohio school district created a Deming Users' Group to link agencies, individuals, and ideas. The group has facilitated ongoing school/business collaboration, networking among individuals from diverse school systems, mentoring and cooperative learning activities, and resource…

  14. Asymmetry within social groups

    DEFF Research Database (Denmark)

    Barker, Jessie; Loope, Kevin J.; Reeve, H. Kern

    2016-01-01

    Social animals vary in their ability to compete with group members over shared resources and also vary in their cooperative efforts to produce these resources. Competition among groups can promote within-group cooperation, but many existing models of intergroup cooperation do not explicitly account...... of two roles, with relative competitive efficiency and the number of individuals varying between roles. Players in each role make simultaneous, coevolving decisions. The model predicts that although intergroup competition increases cooperative contributions to group resources by both roles, contributions...... are predominantly from individuals in the less competitively efficient role, whereas individuals in the more competitively efficient role generally gain the larger share of these resources. When asymmetry in relative competitive efficiency is greater, a group's per capita cooperation (averaged across both roles...

  15. Supervision and group dynamics

    DEFF Research Database (Denmark)

    Hansen, Søren; Jensen, Lars Peter

    2004-01-01

     An important aspect of the problem based and project organized study at Aalborg University is the supervision of the project groups. At the basic education (first year) it is stated in the curriculum that part of the supervisors' job is to deal with group dynamics. This is due to the experience...... that many students are having difficulties with practical issues such as collaboration, communication, and project management. Most supervisors either ignore this demand, because they do not find it important or they find it frustrating, because they do not know, how to supervise group dynamics...... as well as at Aalborg University. The first visible result has been participating supervisors telling us that the course has inspired them to try supervising group dynamics in the future. This paper will explore some aspects of supervising group dynamics as well as, how to develop the Aalborg model...

  16. Summary of group discussions

    International Nuclear Information System (INIS)

    2009-01-01

    A key aspect of the workshop was the interaction and exchange of ideas and information among the 40 participants. To facilitate this activity the workshop participants were divided into five discussions groups. These groups reviewed selected subjects and reported back to the main body with summaries of their considerations. Over the 3 days the 5 discussion groups were requested to focus on the following subjects: the characteristics and capabilities of 'good' organisations; how to ensure sufficient resources; how to ensure competence within the organisation; how to demonstrate organisational suitability; the regulatory oversight processes - including their strengths and weaknesses. A list of the related questions that were provided to the discussion groups can be found in Appendix 3. Also included in Appendix 3 are copies of the slides the groups prepared that summarised their considerations

  17. Natural analogue working group

    International Nuclear Information System (INIS)

    Come, B.; Chapman, N.

    1986-01-01

    A Natural Analogue Working Group was established by the Commission of the European Communities in 1985. The purpose of this group is to bring together modellers with earth scientists and others, so that maximum benefit can be obtained from natural analogue studies with a view to safe geological disposal of radioactive waste. The first meeting of this group was held in Brussels from November 5 to 7, 1985. The discussions mainly concerned the identification of the modellers' needs and of the earth scientists' capacity to provide for them. Following the debates, a written statement was produced by the Group; this document forms the core of the present Report. Notes and outlines of many of the presentations made are grouped in four appendixes. The valuable contribution of all those involved in the meeting is gratefully acknowledged

  18. Ordered groups and topology

    CERN Document Server

    Clay, Adam

    2016-01-01

    This book deals with the connections between topology and ordered groups. It begins with a self-contained introduction to orderable groups and from there explores the interactions between orderability and objects in low-dimensional topology, such as knot theory, braid groups, and 3-manifolds, as well as groups of homeomorphisms and other topological structures. The book also addresses recent applications of orderability in the studies of codimension-one foliations and Heegaard-Floer homology. The use of topological methods in proving algebraic results is another feature of the book. The book was written to serve both as a textbook for graduate students, containing many exercises, and as a reference for researchers in topology, algebra, and dynamical systems. A basic background in group theory and topology is the only prerequisite for the reader.

  19. Group prenatal care.

    Science.gov (United States)

    Mazzoni, Sara E; Carter, Ebony B

    2017-06-01

    Patients participating in group prenatal care gather together with women of similar gestational ages and 2 providers who cofacilitate an educational session after a brief medical assessment. The model was first described in the 1990s by a midwife for low-risk patients and is now practiced by midwives and physicians for both low-risk patients and some high-risk patients, such as those with diabetes. The majority of literature on group prenatal care uses CenteringPregnancy, the most popular model. The first randomized controlled trial of CenteringPregnancy showed that it reduced the risk of preterm birth in low-risk women. However, recent meta-analyses have shown similar rates of preterm birth, low birthweight, and neonatal intensive care unit admission between women participating in group prenatal care and individual prenatal care. There may be subgroups, such as African Americans, who benefit from this type of prenatal care with significantly lower rates of preterm birth. Group prenatal care seems to result in increased patient satisfaction and knowledge and use of postpartum family planning as well as improved weight gain parameters. The literature is inconclusive regarding breast-feeding, stress, depression, and positive health behaviors, although it is theorized that group prenatal care positively affects these outcomes. It is unclear whether group prenatal care results in cost savings, although it may in large-volume practices if each group consists of approximately 8-10 women. Group prenatal care requires a significant paradigm shift. It can be difficult to implement and sustain. More randomized trials are needed to ascertain the true benefits of the model, best practices for implementation, and subgroups who may benefit most from this innovative way to provide prenatal care. In short, group prenatal care is an innovative and promising model with comparable pregnancy outcomes to individual prenatal care in the general population and improved outcomes in some

  20. Critical groups - basic concepts

    International Nuclear Information System (INIS)

    Carter, M.W.

    1992-01-01

    The potential exposure pathways from the land application site to man are presented. It is emphasised that the critical group is not necessary the population group closest to the source. It could be the group impact by the most significant pathways(s). Only by assessing the importance of each of these pathways and then combining them can a proper choice of critical group be made. It would be wrong to select a critical group on the basis that it seems the most probable one, before the pathways have been properly assessed. A calculation in Carter (1983) suggested that for the operating mine site, the annual doses to an Aboriginal person, a service worker and a local housewife, were all about the same and were in the range 0.1 to 0.2 mSv per year. Thus it may be that for the land application area, the critical group turns out to be non-Aboriginal rather than the expected Aboriginal group. 6 refs., 3 figs

  1. Groups - Modular Mathematics Series

    CERN Document Server

    Jordan, David

    1994-01-01

    This text provides an introduction to group theory with an emphasis on clear examples. The authors present groups as naturally occurring structures arising from symmetry in geometrical figures and other mathematical objects. Written in a 'user-friendly' style, where new ideas are always motivated before being fully introduced, the text will help readers to gain confidence and skill in handling group theory notation before progressing on to applying it in complex situations. An ideal companion to any first or second year course on the topic.

  2. Introduction to quantum groups

    CERN Document Server

    Chaichian, Masud

    1996-01-01

    In the past decade there has been an extemely rapid growth in the interest and development of quantum group theory.This book provides students and researchers with a practical introduction to the principal ideas of quantum groups theory and its applications to quantum mechanical and modern field theory problems. It begins with a review of, and introduction to, the mathematical aspects of quantum deformation of classical groups, Lie algebras and related objects (algebras of functions on spaces, differential and integral calculi). In the subsequent chapters the richness of mathematical structure

  3. Group key management

    Energy Technology Data Exchange (ETDEWEB)

    Dunigan, T.; Cao, C.

    1997-08-01

    This report describes an architecture and implementation for doing group key management over a data communications network. The architecture describes a protocol for establishing a shared encryption key among an authenticated and authorized collection of network entities. Group access requires one or more authorization certificates. The implementation includes a simple public key and certificate infrastructure. Multicast is used for some of the key management messages. An application programming interface multiplexes key management and user application messages. An implementation using the new IP security protocols is postulated. The architecture is compared with other group key management proposals, and the performance and the limitations of the implementation are described.

  4. Group therapy for adolescents

    Directory of Open Access Journals (Sweden)

    Nada Hribar

    2001-03-01

    Full Text Available The group included adolescents from secondary school and some students. The group had weekly sessions or twice on mounth. The adolescents had varied simptoms: depressive, anxiety, psychosomatic disorders, learning difficulties, cunduct problems. All of adolescents were common on many problems in social interactions. The goal of therapeutic work were: to increase assertiveness skills and to reduce the anxious in social situations. The adolescents in group raised a self-esteem and developed some assertiveness skills: eye contact" and effective communication skills, persistence, refusing and requesting, giving and receiving critism, etc. The methods of work and techniques were based on principles of cognitive-behaviour therapy.

  5. Matrix groups for undergraduates

    CERN Document Server

    Tapp, Kristopher

    2005-01-01

    Matrix groups touch an enormous spectrum of the mathematical arena. This textbook brings them into the undergraduate curriculum. It makes an excellent one-semester course for students familiar with linear and abstract algebra and prepares them for a graduate course on Lie groups. Matrix Groups for Undergraduates is concrete and example-driven, with geometric motivation and rigorous proofs. The story begins and ends with the rotations of a globe. In between, the author combines rigor and intuition to describe basic objects of Lie theory: Lie algebras, matrix exponentiation, Lie brackets, and maximal tori.

  6. UnitedHealth Group

    Science.gov (United States)

    UnitedHealth Group provides accessible and affordable services, improved quality of care, coordinated health care efforts, and a supportive environment for shared decision making between patients and their physicians.

  7. Homogeneous group, research, institution

    Directory of Open Access Journals (Sweden)

    Francesca Natascia Vasta

    2014-09-01

    Full Text Available The work outlines the complex connection among empiric research, therapeutic programs and host institution. It is considered the current research state in Italy. Italian research field is analyzed and critic data are outlined: lack of results regarding both the therapeutic processes and the effectiveness of eating disorders group analytic treatment. The work investigates on an eating disorders homogeneous group, led into an eating disorder outpatient service. First we present the methodological steps the research is based on including the strong connection among theory and clinical tools. Secondly clinical tools are described and the results commented. Finally, our results suggest the necessity of validating some more specifical hypothesis: verifying the relationship between clinical improvement (sense of exclusion and painful emotions reduction and specific group therapeutic processes; verifying the relationship between depressive feelings, relapses and transition trough a more differentiated groupal field.Keywords: Homogeneous group; Eating disorders; Institutional field; Therapeutic outcome

  8. Color transparency study group

    International Nuclear Information System (INIS)

    Appel, J.A.; Pordes, S.; Botts, J.; Bunce, G.; Farrar, G.

    1990-01-01

    The group studied the relatively new notion of color transparency, discussed present experimental evidence for the effect, and explored several ideas for future experiments. This write-up summarizes these discussions. 11 refs., 1 fig

  9. Generalized quantum groups

    International Nuclear Information System (INIS)

    Leivo, H.P.

    1992-01-01

    The algebraic approach to quantum groups is generalized to include what may be called an anyonic symmetry, reflecting the appearance of phases more general than ±1 under transposition. (author). 6 refs

  10. Groups – Additive Notation

    Directory of Open Access Journals (Sweden)

    Coghetto Roland

    2015-06-01

    Full Text Available We translate the articles covering group theory already available in the Mizar Mathematical Library from multiplicative into additive notation. We adapt the works of Wojciech A. Trybulec [41, 42, 43] and Artur Korniłowicz [25].

  11. Groups – Additive Notation

    OpenAIRE

    Coghetto Roland

    2015-01-01

    We translate the articles covering group theory already available in the Mizar Mathematical Library from multiplicative into additive notation. We adapt the works of Wojciech A. Trybulec [41, 42, 43] and Artur Korniłowicz [25].

  12. Creativity and group innovation

    NARCIS (Netherlands)

    Nijstad, B.A.; de Dreu, C.K.W.

    2002-01-01

    Comments on M. West's article regarding the validity of an integrative model of creativity and innovation implementation in work groups. Variables affecting the level of team innovation; Relationship between predictors and team innovation; Promotion of constructive conflict.

  13. Truck shovel users group

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, J. [Surface Mining Association for Research and Technology, AB (Canada)

    2008-07-01

    The Truck Shovel Users Group (TSUG) was developed as part of the Surface Mining Association for Research and Technology (SMART), an association of companies that meet to coordinate technology developments for the mining industry. The TSUG meet regularly to discuss equipment upgrades, maintenance planning systems, and repair techniques. The group strives to maximize the value of its assets through increased safety, equipment performance and productivity. This presentation provided administrative details about the TSUG including contact details and admission costs. It was concluded that members of the group must be employed by companies that use heavy mining equipment, and must also be willing to host meetings, make presentations, and support the common goals of the group. tabs., figs.

  14. The theory of groups

    CERN Document Server

    Hall, Marshall

    2018-01-01

    This 1959 text offers an unsurpassed resource for learning and reviewing the basics of a fundamental and ever-expanding area. "This remarkable book undoubtedly will become a standard text on group theory." - American Scientist.

  15. Radiation Protection Group

    CERN Document Server

    2006-01-01

    The Radioactive Waste Section of the Radiation Protection Group wishes to inform you that the Radioactive Waste Treatment Centre will be closed on the afternoon of Tuesday 19 December 2006. Thank-you for your understanding.

  16. The Military Cooperation Group

    National Research Council Canada - National Science Library

    Renzi, Jr, Alfred E

    2006-01-01

    .... This thesis will describe a structure to assist with both those needs. The premise is that an expanded and improved network of US Military Groups is the weapon of choice for the war on terror, and beyond...

  17. Introduction to group theory

    Directory of Open Access Journals (Sweden)

    Canals B.

    2012-03-01

    Full Text Available This chapter is a concise mathematical introduction into the algebra of groups. It is build up in the way that definitions are followed by propositions and proofs. The concepts and the terminology introduced here will serve as a basis for the following chapters that deal with group theory in the stricter sense and its application to problems in physics. The mathematical prerequisites are at the bachelor level.1

  18. Groups, rings, modules

    CERN Document Server

    Auslander, Maurice

    2014-01-01

    This classic monograph is geared toward advanced undergraduates and graduate students. The treatment presupposes some familiarity with sets, groups, rings, and vector spaces. The four-part approach begins with examinations of sets and maps, monoids and groups, categories, and rings. The second part explores unique factorization domains, general module theory, semisimple rings and modules, and Artinian rings. Part three's topics include localization and tensor products, principal ideal domains, and applications of fundamental theorem. The fourth and final part covers algebraic field extensions

  19. Focus Group Guide

    Science.gov (United States)

    2017-07-01

    home for the arrival of school- aged children. TIP: Do not conduct focus groups in a command conference room in the command group area. Doing so...organizational effectiveness and equal opportunity/equal employment opportunity/fair treatment and sexual assault and response factors (which are listed on the... Sexual Harassment (C) Sex Harassment Retaliation (D) Discrimination - Sex (E) Discrimination - Race (F) Discrimination - Disability (G

  20. Choice Shifts in Groups

    OpenAIRE

    Kfir Eliaz; Debraj Ray

    2004-01-01

    The phenomenon of "choice shifts" in group decision-making is fairly ubiquitous in the social psychology literature. Faced with a choice between a ``safe" and ``risky" decision, group members appear to move to one extreme or the other, relative to the choices each member might have made on her own. Both risky and cautious shifts have been identified in different situations. This paper demonstrates that from an individual decision-making perspective, choice shifts may be viewed as a systematic...

  1. Group Capability Model

    Science.gov (United States)

    Olejarski, Michael; Appleton, Amy; Deltorchio, Stephen

    2009-01-01

    The Group Capability Model (GCM) is a software tool that allows an organization, from first line management to senior executive, to monitor and track the health (capability) of various groups in performing their contractual obligations. GCM calculates a Group Capability Index (GCI) by comparing actual head counts, certifications, and/or skills within a group. The model can also be used to simulate the effects of employee usage, training, and attrition on the GCI. A universal tool and common method was required due to the high risk of losing skills necessary to complete the Space Shuttle Program and meet the needs of the Constellation Program. During this transition from one space vehicle to another, the uncertainty among the critical skilled workforce is high and attrition has the potential to be unmanageable. GCM allows managers to establish requirements for their group in the form of head counts, certification requirements, or skills requirements. GCM then calculates a Group Capability Index (GCI), where a score of 1 indicates that the group is at the appropriate level; anything less than 1 indicates a potential for improvement. This shows the health of a group, both currently and over time. GCM accepts as input head count, certification needs, critical needs, competency needs, and competency critical needs. In addition, team members are categorized by years of experience, percentage of contribution, ex-members and their skills, availability, function, and in-work requirements. Outputs are several reports, including actual vs. required head count, actual vs. required certificates, CGI change over time (by month), and more. The program stores historical data for summary and historical reporting, which is done via an Excel spreadsheet that is color-coded to show health statistics at a glance. GCM has provided the Shuttle Ground Processing team with a quantifiable, repeatable approach to assessing and managing the skills in their organization. They now have a common

  2. Parton Distributions Working Group

    International Nuclear Information System (INIS)

    Barbaro, L. de; Keller, S. A.; Kuhlmann, S.; Schellman, H.; Tung, W.-K.

    2000-01-01

    This report summarizes the activities of the Parton Distributions Working Group of the QCD and Weak Boson Physics workshop held in preparation for Run II at the Fermilab Tevatron. The main focus of this working group was to investigate the different issues associated with the development of quantitative tools to estimate parton distribution functions uncertainties. In the conclusion, the authors introduce a Manifesto that describes an optimal method for reporting data

  3. Renormalization Group Theory

    International Nuclear Information System (INIS)

    Stephens, C. R.

    2006-01-01

    In this article I give a brief account of the development of research in the Renormalization Group in Mexico, paying particular attention to novel conceptual and technical developments associated with the tool itself, rather than applications of standard Renormalization Group techniques. Some highlights include the development of new methods for understanding and analysing two extreme regimes of great interest in quantum field theory -- the ''high temperature'' regime and the Regge regime

  4. Independents' group posts loss

    International Nuclear Information System (INIS)

    Sanders, V.; Price, R.B.

    1992-01-01

    Low oil gas prices and special charges caused the group of 50 U.S. independent producers Oil and Gas Journal tracks to post a combined loss in first half 1992. The group logged a net loss of $53 million in the first half compared with net earnings of $354 million in first half 1991, when higher oil prices during the Persian Gulf crisis buoyed earnings in spite of crude oil and natural gas production declines. The combined loss in the first half follows a 45% drop in the group's earnings in 1991 and compares with the OGJ group of integrated oil companies whose first half 1992 income fell 47% from the prior year. Special charges, generally related to asset writedowns, accounted for most of the almost $560 million in losses posted by about the third of the group. Nerco Oil and Gas Inc., Vancouver, Wash., alone accounted for almost half that total with charges related to an asset writedown of $238 million in the first quarter. Despite the poor first half performance, the outlook is bright for sharply improved group earnings in the second half, assuming reasonably healthy oil and gas prices and increased production resulting from acquisitions and in response to those prices

  5. Assessment of Group Preferences and Group Uncertainty for Decision Making

    Science.gov (United States)

    1976-06-01

    the individ- uals. decision making , group judgments should be preferred to individual judgments if obtaining group judgments costs more. -26- -YI IV... decision making group . IV. A. 3. Aggregation using conjugate distribution. Arvther procedure for combining indivi(jai probability judgments into a group...statisticized group group decision making group judgment subjective probability Delphi method expected utility nominal group 20. ABSTRACT (Continue on

  6. Cyclic Soft Groups and Their Applications on Groups

    Directory of Open Access Journals (Sweden)

    Hacı Aktaş

    2014-01-01

    Full Text Available In crisp environment the notions of order of group and cyclic group are well known due to many applications. In this paper, we introduce order of the soft groups, power of the soft sets, power of the soft groups, and cyclic soft group on a group. We also investigate the relationship between cyclic soft groups and classical groups.

  7. Coordinating Group report

    International Nuclear Information System (INIS)

    1994-01-01

    In December 1992, western governors and four federal agencies established a Federal Advisory Committee to Develop On-site Innovative Technologies for Environmental Restoration and Waste Management (the DOIT Committee). The purpose of the Committee is to advise the federal government on ways to improve waste cleanup technology development and the cleanup of federal sites in the West. The Committee directed in January 1993 that information be collected from a wide range of potential stakeholders and that innovative technology candidate projects be identified, organized, set in motion, and evaluated to test new partnerships, regulatory approaches, and technologies which will lead to improve site cleanup. Five working groups were organized, one to develop broad project selection and evaluation criteria and four to focus on specific contaminant problems. A Coordinating Group comprised of working group spokesmen and federal and state representatives, was set up to plan and organize the routine functioning of these working groups. The working groups were charged with defining particular contaminant problems; identifying shortcomings in technology development, stakeholder involvement, regulatory review, and commercialization which impede the resolution of these problems; and identifying candidate sites or technologies which could serve as regional innovative demonstration projects to test new approaches to overcome the shortcomings. This report from the Coordinating Group to the DOIT Committee highlights the key findings and opportunities uncovered by these fact-finding working groups. It provides a basis from which recommendations from the DOIT Committee to the federal government can be made. It also includes observations from two public roundtables, one on commercialization and another on regulatory and institutional barriers impeding technology development and cleanup

  8. Linear algebraic groups

    CERN Document Server

    Springer, T A

    1998-01-01

    "[The first] ten chapters...are an efficient, accessible, and self-contained introduction to affine algebraic groups over an algebraically closed field. The author includes exercises and the book is certainly usable by graduate students as a text or for self-study...the author [has a] student-friendly style… [The following] seven chapters... would also be a good introduction to rationality issues for algebraic groups. A number of results from the literature…appear for the first time in a text." –Mathematical Reviews (Review of the Second Edition) "This book is a completely new version of the first edition. The aim of the old book was to present the theory of linear algebraic groups over an algebraically closed field. Reading that book, many people entered the research field of linear algebraic groups. The present book has a wider scope. Its aim is to treat the theory of linear algebraic groups over arbitrary fields. Again, the author keeps the treatment of prerequisites self-contained. The material of t...

  9. Summary report: injection group

    International Nuclear Information System (INIS)

    Simpson, J.; Ankenbrandt, C.; Brown, B.

    1984-01-01

    The injector group attempted to define and address several problem areas related to the SSC injector as defined in the Reference Design Study (RDS). It also considered the topic of machine utilization, particularly the question of test beam requirements. Details of the work are given in individually contributed papers, but the general concerns and consensus of the group are presented within this note. The group recognized that the injector as outlined in the RDS was developed primarily for costing estimates. As such, it was not necessarily well optimized from the standpoint of insuring the required beam properties for the SSC. On the other hand, considering the extraordinary short time in which the RDS was prepared, it is an impressive document and a good basis from which to work. Because the documented SSC performance goals are ambitious, the group sought an injector solution which would more likely guarantee that SSC performance not be limited by its injectors. As will be seen, this leads to a somewhat different solution than that described in the RDS. Furthermore, it is the consensus of the group that the new, conservative approach represents only a modest cost increase of the overall project well worth the confidence gained and the risks avoided

  10. Matrix groups for undergraduates

    CERN Document Server

    Tapp, Kristopher

    2016-01-01

    Matrix groups touch an enormous spectrum of the mathematical arena. This textbook brings them into the undergraduate curriculum. It makes an excellent one-semester course for students familiar with linear and abstract algebra and prepares them for a graduate course on Lie groups. Matrix Groups for Undergraduates is concrete and example-driven, with geometric motivation and rigorous proofs. The story begins and ends with the rotations of a globe. In between, the author combines rigor and intuition to describe the basic objects of Lie theory: Lie algebras, matrix exponentiation, Lie brackets, maximal tori, homogeneous spaces, and roots. This second edition includes two new chapters that allow for an easier transition to the general theory of Lie groups. From reviews of the First Edition: This book could be used as an excellent textbook for a one semester course at university and it will prepare students for a graduate course on Lie groups, Lie algebras, etc. … The book combines an intuitive style of writing w...

  11. Frailty Across Age Groups.

    Science.gov (United States)

    Pérez-Zepeda, M U; Ávila-Funes, J A; Gutiérrez-Robledo, L M; García-Peña, C

    2016-01-01

    The implementation of an aging biomarker into clinical practice is under debate. The Frailty Index is a model of deficit accumulation and has shown to accurately capture frailty in older adults, thus bridging biological with clinical practice. To describe the association of socio-demographic characteristics and the Frailty Index in different age groups (from 20 to over one hundred years) in a representative sample of Mexican subjects. Cross-sectional analysis. Nationwide and population-representative survey. Adults 20-years and older interviewed during the last Mexican National Health and Nutrition Survey (2012). A 30-item Frailty Index following standard construction was developed. Multi-level regression models were performed to test the associations of the Frailty Index with multiple socio-demographic characteristics across age groups. A total of 29,504 subjects was analyzed. The 30-item Frailty Index showed the highest scores in the older age groups, especially in women. No sociodemographic variable was associated with the Frailty Index in all the studied age groups. However, employment, economic income, and smoking status were more consistently found across age groups. To our knowledge, this is the first report describing the Frailty Index in a representative large sample of a Latin American country. Increasing age and gender were closely associated with a higher score.

  12. Illinois Wind Workers Group

    Energy Technology Data Exchange (ETDEWEB)

    David G. Loomis

    2012-05-28

    The Illinois Wind Working Group (IWWG) was founded in 2006 with about 15 members. It has grown to over 200 members today representing all aspects of the wind industry across the State of Illinois. In 2008, the IWWG developed a strategic plan to give direction to the group and its activities. The strategic plan identifies ways to address critical market barriers to the further penetration of wind. The key to addressing these market barriers is public education and outreach. Since Illinois has a restructured electricity market, utilities no longer have a strong control over the addition of new capacity within the state. Instead, market acceptance depends on willing landowners to lease land and willing county officials to site wind farms. Many times these groups are uninformed about the benefits of wind energy and unfamiliar with the process. Therefore, many of the project objectives focus on conferences, forum, databases and research that will allow these stakeholders to make well-educated decisions.

  13. Focus group discussions

    CERN Document Server

    Hennink, Monique M

    2014-01-01

    The Understanding Research series focuses on the process of writing up social research. The series is broken down into three categories: Understanding Statistics, Understanding Measurement, and Understanding Qualitative Research. The books provide researchers with guides to understanding, writing, and evaluating social research. Each volume demonstrates how research should be represented, including how to write up the methodology as well as the research findings. Each volume also reviews how to appropriately evaluate published research. Focus Group Discussions addresses the challenges associated with conducting and writing focus group research. It provides detailed guidance on the practical and theoretical considerations in conducting focus group discussions including: designing the discussion guide, recruiting participants, training a field team, moderating techniques and ethical considerations. Monique Hennink describes how a methodology section is read and evaluated by others, such as journal reviewers or ...

  14. Bell, group and tangle

    International Nuclear Information System (INIS)

    Solomon, A. I.

    2010-01-01

    The 'Bell' of the title refers to bipartite Bell states, and their extensions to, for example, tripartite systems. The 'Group' of the title is the Braid Group in its various representations; while 'Tangle' refers to the property of entanglement which is present in both of these scenarios. The objective of this note is to explore the relation between Quantum Entanglement and Topological Links, and to show that the use of the language of entanglement in both cases is more than one of linguistic analogy.

  15. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  16. Introduction to quantum groups

    International Nuclear Information System (INIS)

    Monteiro, Marco A.R.

    1994-01-01

    An elementary introduction to quantum groups is presented. The example of Universal Enveloping Algebra of deformed SU(2) is analysed in detail. It is also discussed systems made up of bosonic q-oscillators at finite temperature within the formalism of Thermo-Field Dynamics. (author). 39 refs

  17. Lectures on Lie groups

    CERN Document Server

    Hsiang, Wu-Yi

    2017-01-01

    This volume consists of nine lectures on selected topics of Lie group theory. We provide the readers a concise introduction as well as a comprehensive 'tour of revisiting' the remarkable achievements of S Lie, W Killing, É Cartan and H Weyl on structural and classification theory of semi-simple Lie groups, Lie algebras and their representations; and also the wonderful duet of Cartans' theory on Lie groups and symmetric spaces.With the benefit of retrospective hindsight, mainly inspired by the outstanding contribution of H Weyl in the special case of compact connected Lie groups, we develop the above theory via a route quite different from the original methods engaged by most other books.We begin our revisiting with the compact theory which is much simpler than that of the general semi-simple Lie theory; mainly due to the well fittings between the Frobenius-Schur character theory and the maximal tori theorem of É Cartan together with Weyl's reduction (cf. Lectures 1-4). It is a wonderful reality of the Lie t...

  18. Gluten Intolerance Group

    Science.gov (United States)

    ... Intolerance Group (GIG), the industry leader in the certification of gluten-free products and food services, announced today that a wide ... of gluten-free products. One of the top certification programs in the world, GFCO inspects products and manufacturing facilities for gluten, in an effort ...

  19. With the Radiobiology Group

    CERN Multimedia

    CERN PhotoLab

    1980-01-01

    The Radiobiology Group carries out experiments to study the effect of radiation on living cells. The photo shows the apparatus for growing broad beans which have been irradiated by 250 GeV protons. The roots are immersed in a tank of running water (CERN Weekly Bulletin 26 January 1981 and Annual Report 1980 p. 160). Karen Panman, Marilena Streit-Bianchi, Roger Paris.

  20. Group control of elevators

    Energy Technology Data Exchange (ETDEWEB)

    Umeda, Yasukazu; Hikita, Shiro; Tuji, Sintaro (Mitsubishi Electric Corp., Tokyo (Japan))

    1988-09-05

    Items to be evaluated in the group control of elevators, and a typical control system are described. A new system in which the fuzzy rule base is employed is introduced together with the configuration. The items to be evaluated are waiting time, riding time, accuracy of forecasting, energy saving, and ease of usage. The everage waiting time of less than 20 seconds with less than 3% waiting rate of more than 60 seconds is accepted as a satisfactory service condition. There are many conflicting matters in group-controlling, and the study for the controlling must deal with the optimization of multi-purpose problems. The standards for group-control evaluation differ according to building structures and the tastes of users, and an important problem is where to give emphasis of the evaluation. The TRAFFIC PATTERN LEARNING METHOD has been applied in the system for careful control to accommodate the traffic. No specific function is provided for the evaluation, but the call allocation is made by fuzzy rule-base. The configuration of a new group-control system is introduced. 7 references, 7 figures, 1 table.

  1. Functional Group Analysis.

    Science.gov (United States)

    Smith, Walter T., Jr.; Patterson, John M.

    1984-01-01

    Literature on analytical methods related to the functional groups of 17 chemical compounds is reviewed. These compounds include acids, acid azides, alcohols, aldehydes, ketones, amino acids, aromatic hydrocarbons, carbodiimides, carbohydrates, ethers, nitro compounds, nitrosamines, organometallic compounds, peroxides, phenols, silicon compounds,…

  2. Moral motivation within groups

    NARCIS (Netherlands)

    Lee, Romy van der

    2013-01-01

    Morality is of particular importance to people: People want to be considered moral and want to belong to moral groups. Consequently, morality judgments have the potential to motivate individuals to behave in ways that are considered to be ‘good’. In the current dissertation, I examined the impact of

  3. Smoot Group Cosmology

    Science.gov (United States)

    the Universe About Cosmology Planck Satellite Launched Cosmology Videos Professor George Smoot's group conducts research on the early universe (cosmology) using the Cosmic Microwave Background radiation (CMB science goals regarding cosmology. George Smoot named Director of Korean Cosmology Institute The GRB

  4. Groups and Symmetry

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 4; Issue 10. Groups and Symmetry: A Guide to Discovering Mathematics. Geetha Venkataraman. Book Review Volume 4 Issue 10 October 1999 pp 91-92. Fulltext. Click here to view fulltext PDF. Permanent link:

  5. Public interest group involvement

    International Nuclear Information System (INIS)

    Shelley, P.

    1986-01-01

    Including public interest groups in the siting process for nuclear waste disposal facilities is of great importance. Controversial sitings often result in litigation, but involving public interest groups early in the process will lessen the change of this. They act as surrogates for the general public and should be considered as members of the team. It is important to remember though, that all public interest groups are different. In choosing public panels such as public advisory committees, members should not be chosen on the basis of some quota. Opposition groups should not be excluded. Also, it is important to put the right person in charge of the committee. The goal of public involvement is to identify the conflicts. This must be done during the decision process, because conflicts must be known before they can be eliminated. Regarding litigation, it is important to ease through and around legal battles. If the siting process has integrity and a good faith effort has been shown, the court should uphold the effort. In addition, it is important to be negotiable and to eliminate shortcuts

  6. Leukosis/Sarcoma Group

    Science.gov (United States)

    The leukosis/sarcoma (L/S) group of diseases designates a variety of transmissible benign and malignant neoplasms of chickens caused by members that belong to the family Retroviridae. Because the expansion of the literature on this disease, it is no longer feasible to cite all relevant publications ...

  7. Working Group Report: Neutrinos

    Energy Technology Data Exchange (ETDEWEB)

    de Gouvea, A.; Pitts, K.; Scholberg, K.; Zeller, G. P. [et al.

    2013-10-16

    This document represents the response of the Intensity Frontier Neutrino Working Group to the Snowmass charge. We summarize the current status of neutrino physics and identify many exciting future opportunities for studying the properties of neutrinos and for addressing important physics and astrophysics questions with neutrinos.

  8. Group: radiation dosimetry

    International Nuclear Information System (INIS)

    Caldas, L.V.E.

    1990-01-01

    The main activities of the radiation dosimetry group is described, including the calibration of instruments, sources and radioactive solutions and the determination of neutron flux; development, production and market dosimetric materials; development radiation sensor make the control of radiation dose received by IPEN workers; development new techniques for monitoring, etc. (C.G.C.)

  9. Categorization by Groups

    NARCIS (Netherlands)

    R.W. Hamilton (Rebecca); S. Puntoni (Stefano); N.T. Tavassoli (Nader)

    2006-01-01

    textabstractCategorization is a core psychological process central to consumer and managerial decision-making. While a substantial amount of research has been conducted to examine individual categorization behaviors, relatively little is known about the group categorization process. In two

  10. Gamma gamma technology group

    Indian Academy of Sciences (India)

    The purpose of the meeting was to form a group of people who ... able by looking at the energy deposited at the face of the final dipole, 4.5 m from ... A F Zarnecki has made a good start on background studies, V Telnov has proposed.

  11. Group theory in physics

    CERN Document Server

    Cornwell, J F

    1989-01-01

    Recent devopments, particularly in high-energy physics, have projected group theory and symmetry consideration into a central position in theoretical physics. These developments have taken physicists increasingly deeper into the fascinating world of pure mathematics. This work presents important mathematical developments of the last fifteen years in a form that is easy to comprehend and appreciate.

  12. Anaphylaxis vulnerable groups

    African Journals Online (AJOL)

    Ehab

    Age groups vulnerable to serious attacks of anaphylaxis include infants, teenagers, pregnant women, and the elderly. Concomitant diseases, such as severe or uncontrolled asthma, cardiovascular disease, mastocytosis or clonal mast cell disorders and the concurrent use of some medications such as beta adrenergic ...

  13. Special Interest Groups.

    Science.gov (United States)

    Degi, Bruce J.

    1999-01-01

    Offers a reflection on the shootings at Columbine High School in Littleton, Colorado, on April 20, 1999. Notes how every special-interest group has used the tragedy to support its own point of view, and concludes that teachers have become bystanders in the education of America's children. (SR)

  14. Ignalina Safety Analysis Group

    International Nuclear Information System (INIS)

    Ushpuras, E.

    1995-01-01

    The article describes the fields of activities of Ignalina NPP Safety Analysis Group (ISAG) in the Lithuanian Energy Institute and overview the main achievements gained since the group establishment in 1992. The group is working under the following guidelines: in-depth analysis of the fundamental physical processes of RBMK-1500 reactors; collection, systematization and verification of the design and operational data; simulation and analysis of potential accident consequences; analysis of thermohydraulic and neutronic characteristics of the plant; provision of technical and scientific consultations to VATESI, Governmental authorities, and also international institutions, participating in various projects aiming at Ignalina NPP safety enhancement. The ISAG is performing broad scientific co-operation programs with both Eastern and Western scientific groups, supplying engineering assistance for Ignalina NPP. ISAG is also participating in the joint Lithuanian - Swedish - Russian project - Barselina, the first Probabilistic Safety Assessment (PSA) study of Ignalina NPP. The work is underway together with Maryland University (USA) for assessment of the accident confinement system for a range of breaks in the primary circuit. At present the ISAG personnel is also involved in the project under the grant from the Nuclear Safety Account, administered by the European Bank for reconstruction and development for the preparation and review of an in-depth safety assessment of the Ignalina plant

  15. Gartner Group reports

    CERN Document Server

    Gartner Group. Stamford, CT

    Gartner Group is the one of the leading independent providers of research and analysis material for IT professionals. Their reports provide in-depth analysis of dominant trends, companies and products. CERN has obtained a licence making these reports available online to anyone within CERN. The database contains not only current reports, updated monthly, but also some going back over a year.

  16. Lattices in group manifolds

    International Nuclear Information System (INIS)

    Lisboa, P.; Michael, C.

    1982-01-01

    We address the question of designing optimum discrete sets of points to represent numerically a continuous group manifold. We consider subsets which are extensions of the regular discrete subgroups. Applications to Monte Carlo simulation of SU(2) and SU(3) gauge theory are discussed. (orig.)

  17. Teaching Badminton to Groups.

    Science.gov (United States)

    Nelson, Jonathan E.

    1980-01-01

    Numerous ideas for teaching badminton to large groups are presented. The focus is on drills and techniques for off the court instructional stations. Instead of having students waiting their turn to play, more students can participate actively as they rotate from one station to another. (JN)

  18. Group leaders optimization algorithm

    Science.gov (United States)

    Daskin, Anmer; Kais, Sabre

    2011-03-01

    We present a new global optimization algorithm in which the influence of the leaders in social groups is used as an inspiration for the evolutionary technique which is designed into a group architecture. To demonstrate the efficiency of the method, a standard suite of single and multi-dimensional optimization functions along with the energies and the geometric structures of Lennard-Jones clusters are given as well as the application of the algorithm on quantum circuit design problems. We show that as an improvement over previous methods, the algorithm scales as N 2.5 for the Lennard-Jones clusters of N-particles. In addition, an efficient circuit design is shown for a two-qubit Grover search algorithm which is a quantum algorithm providing quadratic speedup over the classical counterpart.

  19. Communication from ST Group

    CERN Document Server

    TS Department

    2008-01-01

    Please note that owing the preparations for the Open Days, the FM Group will not able to handle specific requests for waste collection from 2nd to 6th of April, nor removal or PC transport requests between the 31 March and 11 April. We kindly ask you to plan the collection of all types of waste and any urgent transport of office furniture or PCs before 31 March. Waste collection requests must be made by contacting FM Support on 77777 or at the e-mail address mailto:Fm.Support@cern.ch; removal of office furniture or PC transport requests must be made using the EDH ‘Transport request’ form (select "Removals" or "PC transport" from the drop-down menu). For any question concerning the sorting of waste, please consult the following web site: http://dechets-waste.web.cern.ch/dechets-waste/ Thank you for your understanding and collaboration. TS/FM Group

  20. Mindfulness for group facilitation

    DEFF Research Database (Denmark)

    Adriansen, Hanne Kirstine; Krohn, Simon

    2014-01-01

    In this paper, we argue that mindfulness techniques can be used for enhancing the outcome of group performance. The word mindfulness has different connotations in the academic literature. Broadly speaking there is ‘mindfulness without meditation’ or ‘Western’ mindfulness which involves active...... thinking and ‘Eastern’ mindfulness which refers to an open, accepting state of mind, as intended with Buddhist-inspired techniques such as meditation. In this paper, we are interested in the latter type of mindfulness and demonstrate how Eastern mindfulness techniques can be used as a tool for facilitation....... A brief introduction to the physiology and philosophy of Eastern mindfulness constitutes the basis for the arguments of the effect of mindfulness techniques. The use of mindfulness techniques for group facilitation is novel as it changes the focus from individuals’ mindfulness practice...

  1. Group and representation theory

    CERN Document Server

    Vergados, J D

    2017-01-01

    This volume goes beyond the understanding of symmetries and exploits them in the study of the behavior of both classical and quantum physical systems. Thus it is important to study the symmetries described by continuous (Lie) groups of transformations. We then discuss how we get operators that form a Lie algebra. Of particular interest to physics is the representation of the elements of the algebra and the group in terms of matrices and, in particular, the irreducible representations. These representations can be identified with physical observables. This leads to the study of the classical Lie algebras, associated with unitary, unimodular, orthogonal and symplectic transformations. We also discuss some special algebras in some detail. The discussion proceeds along the lines of the Cartan-Weyl theory via the root vectors and root diagrams and, in particular, the Dynkin representation of the roots. Thus the representations are expressed in terms of weights, which are generated by the application of the elemen...

  2. Working group 4: Terrestrial

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    A working group at a Canada/USA symposium on climate change and the Arctic identified major concerns and issues related to terrestrial resources. The group examined the need for, and the means of, involving resource managers and users at local and territorial levels in the process of identifying and examining the impacts and consequences of climatic change. Climatic change will be important to the Arctic because of the magnitude of the change projected for northern latitudes; the apparent sensitivity of its terrestrial ecosystems, natural resources, and human support systems; and the dependence of the social, cultural, and economic welfare of Arctic communities, businesses, and industries on the health and quality of their environment. Impacts of climatic change on the physical, biological, and associated socio-economic environment are outlined. Gaps in knowledge needed to quantify these impacts are listed along with their relationships with resource management. Finally, potential actions for response and adaptation are presented

  3. Duality and quantum groups

    International Nuclear Information System (INIS)

    Alvarez-Gaume, L.; Gomez, C.; Sierra, G.

    1990-01-01

    We show that the duality properties of Rational Conformal Field Theories follow from the defining relations and the representation theory of quantum groups. The fusion and braiding matrices are q-analogues of the 6j-symbols and the modular transformation matrices are obtained from the properties of the co-multiplication. We study in detail the Wess-Zumino-Witten models and the rational gaussian models as examples, but carry out the arguments in general. We point out the connections with the Chern-Simons approach. We give general arguments of why the general solution to the polynomial equations of Moore and Seiberg describing the duality properties of Rational Conformal Field Theories defines a Quantum Group acting on the space of conformal blocks. A direct connection between Rational Theories and knot invariants is also presented along the lines of Jones' original work. (orig.)

  4. The Areva Group

    International Nuclear Information System (INIS)

    2004-08-01

    This document provides information on the Areva Group, a world nuclear industry leader, offering solutions for nuclear power generation, electricity transmission and distribution and interconnect systems to the telecommunications, computer and automotive markets. It presents successively the front end division including the group business lines involved in producing nuclear fuel for electric power generation (uranium mining, concentration, conversion and enrichment and nuclear fuel fabrication); the reactors and services division which designs and builds PWR, BWR and research reactors; the back end division which encompasses the management of the fuel that has been used in nuclear power plants; the transmission and distribution division which provides products, systems and services to the medium and high voltage energy markets; the connectors division which designs and manufactures electrical, electronic and optical connectors, flexible micro circuitry and interconnection systems. Areva is implemented in Europe, north and south america, africa and asia-pacific. (A.L.B.)

  5. The Ombudperson Initiative Group

    CERN Multimedia

    Laura Stewart

    Following many discussions that took place at some of the ATLAS Women's Network lunch gatherings, a few ATLAS women joined forces with similarly concerned CERN staff women to form a small group last Fall to discuss the need for a CERN-wide Ombudsperson. This has since evolved into the Ombudsperson Initiative Group (OIG) currently composed of the following members: Barbro Asman, Stockholm University; Pierre Charrue, CERN AB; Anna Cook, CERN IT; Catherine Delamare, CERN and IT Ombudsperson; Paula Eerola, Lund University; Pauline Gagnon, Indiana University; Eugenia Hatziangeli, CERN AB; Doreen Klem, CERN IT; Bertrand Nicquevert, CERN TS and Laura Stewart, CERN AT. On June 12, members of the OIG met with representatives of Human Resources (HR) and the Equal Opportunity Advisory Panel (EOAP) to discuss the proposal drafted by the OIG. The meeting was very positive. Everybody agreed that the current procedures at CERN applicable in the event of conflict required a thorough review, and that a professionnally trai...

  6. Metrically universal abelian groups

    Czech Academy of Sciences Publication Activity Database

    Doucha, Michal

    2017-01-01

    Roč. 369, č. 8 (2017), s. 5981-5998 ISSN 0002-9947 R&D Projects: GA AV ČR IAA100190902 Institutional support: RVO:67985840 Keywords : Abelian group Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 1.426, year: 2016 http://www.ams.org/journals/tran/2017-369-08/S0002-9947-2017-07059-8/

  7. Storage ring group summary

    International Nuclear Information System (INIS)

    King, N.M.

    1980-01-01

    The Storage Ring Group set out to identify and pursue salient problems in accelerator physics for heavy ion fusion, divorced from any particular reference design concept. However, it became apparent that some basic parameter framework was required to correlate the different study topics. As the Workshop progressed, ring parameters were modified and updated. Consequently, the accompanying papers on individual topics will be found to refer to slightly varied parameters, according to the stage at which the different problems were tackled

  8. MAGIC user's group software

    International Nuclear Information System (INIS)

    Warren, G.; Ludeking, L.; McDonald, J.; Nguyen, K.; Goplen, B.

    1990-01-01

    The MAGIC User's Group has been established to facilitate the use of electromagnetic particle-in-cell software by universities, government agencies, and industrial firms. The software consists of a series of independent executables that are capable of inter-communication. MAGIC, SOS, μ SOS are used to perform electromagnetic simulations while POSTER is used to provide post-processing capabilities. Each is described in the paper. Use of the codes for Klystrode simulation is discussed

  9. Multibunch working group

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    The goal of this working group was to foment discussions about the use and limitations of multi-bunch, representatives from most operating or in-project synchrotron radiation sources (ALS, SPEAR, BESSY-2, SPRING-8, ANKA, DELTA, PEP-2, DIAMOND, ESRF...) have presented their experience. The discussions have been led around 3 topics: 1) resistive wall instabilities and ion instabilities, 2) higher harmonic cavities, and 3) multibunch feedback systems.

  10. Group 4. Containment

    International Nuclear Information System (INIS)

    McCauley, V.S.; Keiser, J.R.

    1992-01-01

    This paper summarizes the findings of the Containment Working Group which met at the Workshop on Radioactive, Hazardous, and/or Mixed Waste Sludge Management. The Containment Working Group (CWG) examined the problems associated with providing adequate containment of waste forms from both short- and long-term storage. By its nature, containment encompasses a wide variety of waste forms, storage conditions, container types, containment schemes, and handling activities. A containment system can be anything from a 55-gal drum to a 100-ft-long underground vault. Because of the diverse nature of containment systems, the CWG chose to focus its limited time on broad issues that are applicable to the design of any containment system, rather than attempting to address problems specific to a particular containment system or waste-form type. Four major issues were identified by the CWG. They relate to: (1) service conditions and required system performance; (2) ultimate disposition; (3) cost and schedule; and (4) acceptance criteria, including quality assurance/quality control (QA/QC) concerns. All of the issues raised by the group are similar in that they all help to define containment system requirements

  11. Technology working group

    International Nuclear Information System (INIS)

    Tsujikura, Y.

    2000-01-01

    The workshop of 26-27 june 2000, on nuclear power Plant LIfe Management (PLIM), also included working groups in which major issues facing PLIM activities for nuclear power plants were identified and discussed. The first group was on Technology. Utilities should consider required provisions capacity by properly maintaining and preserving the existing power plants to the extent practicable and taking into account growing demand, limits of energy conservation, and difficulties in finding new power plant sites. Generally, the extension of the life of nuclear power plant (e.g. from 40 years to 60 years) is an attractive option for utilities, as the marginal cost of most existing nuclear power plants is lower than that of almost all other power sources. It is also an attractive option for environmental protection. Consequently, PLIM has become an important issue in the context of the regulatory reform of the electricity markets. Therefore, the three main objectives of the Technology working group are: 1) Documenting how the safety of nuclear power plants being operated for the long-term has been confirmed, and suggesting ways of sharing this information. 2) Addressing development of advanced maintenance technologies necessary over the plant lifetime, and clarifying their technical challenges. 3) Suggesting potential areas of research and development that might, be necessary. Some potential examples of such research include: - improving the effectiveness of maintenance methods to assure detection of incipient faults; - providing cost effective preventive maintenance programmes; - furnishing systematic, cost-effective refurbishment programmes framed to be consistent with efforts to extend the time between re-fuelling; - developing a methodology that moves routine maintenance on-line without compromising safety. (author)

  12. Notes on quantum groups

    International Nuclear Information System (INIS)

    Pressley, A.; Chari, V.; Tata Inst. of Fundamental Research, Bombay

    1990-01-01

    The authors presents an introduction to quantum groups defined as a deformation of the universal enveloping algebra of a Lie algebra. After the description of Hopf algebras with some examples the approach of Drinfel'd and Jimbo is described, where the quantization of a Lie algebra represents a Hopf algebra, defined over the algebra of formal power series in an indetermined h. The authors show that this approach arises from a r-matrix, which satisfies the classical Yang-Baxter equation. As example quantum sl 2 is considered. Furthermore the approaches of Manin and Woroniwicz and the R-matrix approach are described. (HSI)

  13. Unilever Group : equity valuation

    OpenAIRE

    Pires, Susana Sofia Castelo

    2014-01-01

    The following dissertation has the purpose to value the Unilever Group, but more specifically Unilever N.V. being publicly traded in the Amsterdam Exchange Index. Unilever is seen as a global player and one of most successful and competitive fast-moving consumer goods companies. In order to valuate Unilever’s equity, a Discounted Cash Flow (DCF) approach is first carried out, since it is believed to be the most reliable methodology. The value estimated was €36.39, advising one to buy its s...

  14. Statistical Group Comparison

    CERN Document Server

    Liao, Tim Futing

    2011-01-01

    An incomparably useful examination of statistical methods for comparisonThe nature of doing science, be it natural or social, inevitably calls for comparison. Statistical methods are at the heart of such comparison, for they not only help us gain understanding of the world around us but often define how our research is to be carried out. The need to compare between groups is best exemplified by experiments, which have clearly defined statistical methods. However, true experiments are not always possible. What complicates the matter more is a great deal of diversity in factors that are not inde

  15. Renormalization Group Functional Equations

    CERN Document Server

    Curtright, Thomas L

    2011-01-01

    Functional conjugation methods are used to analyze the global structure of various renormalization group trajectories. With minimal assumptions, the methods produce continuous flows from step-scaling {\\sigma} functions, and lead to exact functional relations for the local flow {\\beta} functions, whose solutions may have novel, exotic features, including multiple branches. As a result, fixed points of {\\sigma} are sometimes not true fixed points under continuous changes in scale, and zeroes of {\\beta} do not necessarily signal fixed points of the flow, but instead may only indicate turning points of the trajectories.

  16. Grouping Notes Through Nodes

    DEFF Research Database (Denmark)

    Dove, Graham; Abildgaard, Sille Julie Jøhnk; Biskjær, Michael Mose

    , both individually and when grouped, and their role in categorisation in semantic long-term memory. To do this, we adopt a multimodal analytical approach focusing on interaction between humans, and between humans and artefacts, alongside language. We discuss in detail examples of four different...... externalisation functions served by Post-ItTM notes, and show how these functions are present in complex overlapping combinations rather than being discrete. We then show how the temporal development of Post-ItTM note interactions supports categorisation qualities of semantic long-term memory....

  17. Grouping Notes Through Nodes

    DEFF Research Database (Denmark)

    Dove, Graham; Abildgaard, Sille Julie; Biskjær, Michael Mose

    2017-01-01

    , both individually and when grouped, and their role in categorisation in semantic long-term memory. To do this, we adopt a multimodal analytical approach focusing on interaction between humans, and between humans and artefacts, alongside language. We discuss in detail examples of four different...... externalisation functions served by Post-ItTM notes, and show how these functions are present in complex overlapping combinations rather than being discrete. We then show how the temporal development of Post-ItTM note interactions supports categorisation qualities of semantic long-term memory....

  18. Groups and symmetry

    CERN Document Server

    Farmer, David W

    1995-01-01

    In most mathematics textbooks, the most exciting part of mathematics-the process of invention and discovery-is completely hidden from the reader. The aim of Groups and Symmetry is to change all that. By means of a series of carefully selected tasks, this book leads readers to discover some real mathematics. There are no formulas to memorize; no procedures to follow. The book is a guide: Its job is to start you in the right direction and to bring you back if you stray too far. Discovery is left to you. Suitable for a one-semester course at the beginning undergraduate level, there are no prerequ

  19. Theory and modeling group

    Science.gov (United States)

    Holman, Gordon D.

    1989-01-01

    The primary purpose of the Theory and Modeling Group meeting was to identify scientists engaged or interested in theoretical work pertinent to the Max '91 program, and to encourage theorists to pursue modeling which is directly relevant to data which can be expected to result from the program. A list of participants and their institutions is presented. Two solar flare paradigms were discussed during the meeting -- the importance of magnetic reconnection in flares and the applicability of numerical simulation results to solar flare studies.

  20. The OMERACT Ultrasound Group

    DEFF Research Database (Denmark)

    Terslev, Lene; Iagnocco, Annamaria; Bruyn, George A W

    2017-01-01

    OBJECTIVE: To provide an update from the Outcome Measures in Rheumatology (OMERACT) Ultrasound Working Group on the progress for defining ultrasound (US) minimal disease activity threshold at joint level in rheumatoid arthritis (RA) and for standardization of US application in juvenile idiopathic......) and power Doppler (PD). Synovial effusion (SE) was scored a binary variable. For JIA, a Delphi approach and subsequent validation in static images and patient-based exercises were used to developed preliminary definitions for synovitis and a scoring system. RESULTS: For minimal disease activity, 7% HC had...

  1. A village group, Trashibiola

    OpenAIRE

    Thomson, John, 1837-1921, photographer

    2003-01-01

    158 x 111 mm. Woodburytype. A view showing a group of villagers seated in a paved courtyard in front of a stonewalled house (the principal house in the village). The village is near the town of Paphos. The photograph appears in Thomson's 'Through Cyprus with the camera, in the autumn of 1878' (vol.2, London: Sampson Low, Marston, Searle, and Rivington, 1879). Thomson states that the purpose of the gathering was twofold: to welcome strangers to the village and to discuss a point of law c...

  2. Bevalac computer support group

    International Nuclear Information System (INIS)

    McParland, C.; Bronson, M.

    1985-01-01

    During the past year, a group was created and placed under the leadership of Charles McParland. This is an expansion of previous Bevalac software efforts and has responsibilities in three major hardware and software areas. The first area is the support of the existing data acquisition/analysis VAX 11/780s at the Bevalac. The second area is the continued support of present data acquisition programs. The third principal area of effort is the development of new data acquisition systems to meet the increasing needs of the Bevalac experimental program

  3. Social group utility maximization

    CERN Document Server

    Gong, Xiaowen; Yang, Lei; Zhang, Junshan

    2014-01-01

    This SpringerBrief explains how to leverage mobile users' social relationships to improve the interactions of mobile devices in mobile networks. It develops a social group utility maximization (SGUM) framework that captures diverse social ties of mobile users and diverse physical coupling of mobile devices. Key topics include random access control, power control, spectrum access, and location privacy.This brief also investigates SGUM-based power control game and random access control game, for which it establishes the socially-aware Nash equilibrium (SNE). It then examines the critical SGUM-b

  4. ATLAS Detector Interface Group

    CERN Multimedia

    Mapelli, L

    Originally organised as a sub-system in the DAQ/EF-1 Prototype Project, the Detector Interface Group (DIG) was an information exchange channel between the Detector systems and the Data Acquisition to provide critical detector information for prototype design and detector integration. After the reorganisation of the Trigger/DAQ Project and of Technical Coordination, the necessity to provide an adequate context for integration of detectors with the Trigger and DAQ lead to organisation of the DIG as one of the activities of Technical Coordination. Such an organisation emphasises the ATLAS wide coordination of the Trigger and DAQ exploitation aspects, which go beyond the domain of the Trigger/DAQ project itself. As part of Technical Coordination, the DIG provides the natural environment for the common work of Trigger/DAQ and detector experts. A DIG forum for a wide discussion of all the detector and Trigger/DAQ integration issues. A more restricted DIG group for the practical organisation and implementation o...

  5. Communication from ST Group

    CERN Multimedia

    TS Department

    2008-01-01

    In order to prepare the organization of the Open Days, please note that FM Group will not able to take into account either specific requests for waste collection from 2nd to 6th of April, either removal or PC transport requests between the 31st and the 11th of March. We kindly ask you to plan the collection of any type of waste and the urgent transport of office furniture or PC before the 31st of March. Waste collection requests shall be formulated contacting FM Support at 77777 or at the email address mailto:Fm.Support@cern.ch; removal of office furniture or PC transport requests must be made using the EDH ‘Transport request’ form selecting the "Removals" or the "PC transport" category from the drop-down menu. For any question concerning the waste sorting, please consult the following web address: http://dechets-waste.web.cern.ch/dechets-waste/. Thank you for your understanding and collaboration. TS/FM Group

  6. Social group and mobbing

    Directory of Open Access Journals (Sweden)

    Baltezarević Vesna

    2009-01-01

    Full Text Available Our reality, having been subject to the numerous social crises during the last decades of the 20th century, is characterized by frequent incidences of powerlessness and alienation. The man is more frequently a subject to loneliness and overcomes the feeling of worthlessness, no matter whether he considers himself an individual or a part of a whole larger social. Such an environment leads to development of aggression in all fields of ones life. This paper has as an objective the pointing out of the mental harassment that is manifested in the working environment. There is a prevalence of mobbing cases, as a mode of pathological communication. The result of this is that a person, subjected to this kind of abuse, is soon faced with social isolation. This research also aspires to initiate the need for social groups self-organization of which victims are part of. The reaction modality of a social group directly conditions the outcome of the deliberate social drama, one is subjected to it as a result of mobbing.

  7. Meningococcal group B vaccines.

    Science.gov (United States)

    Findlow, Jamie

    2013-06-01

    Meningococcal disease remains a devastating and feared infection with a significant morbidity and mortality profile. The successful impact of meningococcal capsular group C glyconconjugate vaccines introduced into the UK infant immunization schedule in 1999, has resulted in >80% of disease now being attributable to meningococcal capsular group B (MenB). MenB glyconconjugate vaccines are not immunogenic and hence, vaccine design has focused on sub-capsular antigens. Recently, a four component vaccine to combat MenB disease (4CMenB) has progressed through clinical development and was approved by the European Medicines Agency at the end of 2012. This vaccine has proven safe and immunogenic and has been predicted to provide protection against ~73% of the MenB disease from England and Wales. Recommendation/implementation of the vaccine into the UK infant schedule is currently being evaluated. 4CMenB has the potential to provide protection against a significant proportion of MenB disease in the UK which is currently unpreventable.

  8. Business working group

    International Nuclear Information System (INIS)

    Doroshuk, B.W.

    2000-01-01

    The workshop of 26-27 june 2000, on nuclear power Plant LIfe Management (PLIM), also included working groups in which major issues facing PLIM activities for nuclear power plants were identified and discussed. The third group was on Business. The discussion concerned the following points: There are concerns about retaining experienced/trained personnel, and maintaining a good working relationship among them, as well as about the closure of research facilities, the reduction in staff numbers under increasing economic pressure and the lack of new nuclear power plant constructions. The marginal cost of producing electricity is lower for most existing nuclear power plants than for almost all other energy sources. Refurbishment costs are usually relatively small compared with new investments. The ongoing regulatory reform of the electricity market will bring increasing competition. Although PLIM has been carried out in many countries with favourable results, there are still uncertainties which affect business decisions regarding financial and market risks in PLIM activities. Recommendations were made. (author)

  9. Group Life Insurance

    CERN Multimedia

    2013-01-01

    The CERN Administration would like to remind you that staff members and fellows have the possibility to take out a life insurance contract on favourable terms through a Group Life Insurance.   This insurance is provided by the company Helvetia and is available to you on a voluntary basis. The premium, which varies depending on the age and gender of the person insured, is calculated on the basis of the amount of the death benefit chosen by the staff member/fellow and can be purchased in slices of 10,000 CHF.    The contract normally ends at the retirement age (65/67 years) or when the staff member/fellow leaves the Organization. The premium is deducted monthly from the payroll.   Upon retirement, the staff member can opt to maintain his membership under certain conditions.   More information about Group Life Insurance can be found at: Regulations (in French) Table of premiums The Pension Fund Benefit Service &...

  10. On the Brauer group

    International Nuclear Information System (INIS)

    Tankeev, Sergei G

    2000-01-01

    For an arithmetic model X of a Fermat surface or a hyperkahler variety with Betti number b 2 (V otimes k-bar)>3 over a purely imaginary number field k, we prove the finiteness of the l-components of Br'(X) for all primes l>>0. This yields a variant of a conjecture of M. Artin. If V is a smooth projective irregular surface over a number field k and V(k)≠ nothing, then the l-primary component of Br(V)/Br(k) is an infinite group for every prime l. Let A 1 →M 1 be the universal family of elliptic curves with a Jacobian structure of level N>=3 over a number field k supset of Q(e 2πi/N ). Assume that M 1 (k) ≠ nothing. If V is a smooth projective compactification of the surface A 1 , then the l-primary component of Br(V)/Br(M-bar 1 ) is a finite group for each sufficiently large prime l

  11. Biology task group

    International Nuclear Information System (INIS)

    Anon.

    1981-01-01

    The accomplishments of the task group studies over the past year are reviewed. The purposes of biological investigations, in the context of subseabed disposal, are: an evaluation of the dose to man; an estimation of effects on the ecosystem; and an estimation of the influence of organisms on and as barriers to radionuclide migration. To accomplish these ends, the task group adopted the following research goals: (1) acquire more data on biological accumulation of specific radionuclides, such as those of Tc, Np, Ra, and Sr; (2) acquire more data on transfer coefficients from sediment to organism; (3) Calculate mass transfer rates, construct simple models using them, and estimate collective dose commitment; (4) Identify specific pathways or transfer routes, determine the rates of transfer, and make dose limit calculations with simple models; (5) Calculate dose rates to and estimate irradiation effects on the biota as a result of waste emplacement, by reference to background irradiation calculations. (6) Examine the effect of the biota on altering sediment/water radionuclide exchange; (7) Consider the biological data required to address different accident scenarios; (8) Continue to provide the basic biological information for all of the above, and ensure that the system analysis model is based on the most realistic and up-to-date concepts of marine biologists; and (9) Ensure by way of free exchange of information that the data used in any model are the best currently available

  12. Doing focus group research

    DEFF Research Database (Denmark)

    Lindegaard, Laura Bang

    2014-01-01

    Scholars of ethnomethodologically informed discourse studies are often sceptical of the use of interview data such as focus group data. Some scholars quite simply reject interview data with reference to a general preference for so-called naturally occurring data. Other scholars acknowledge...... that interview data can be of some use if the distinction between natural and contrived data is given up and replaced with a distinction between interview data as topic or as resource. In greater detail, such scholars argue that interview data are perfectly adequate if the researcher wants to study the topic...... of interview interaction, but inadequate as data for studying phenomena that go beyond the phenomenon of interview interaction. Neither of these more and less sceptical positions are, on the face of it, surprising due to the ethnomethodological commitment to study social order as accomplished in situ...

  13. Group life insurance

    CERN Multimedia

    2013-01-01

    The CERN Administration wishes to inform staff members and fellows having taken out optional life insurance under the group contract signed by CERN that the following changes to the rules and regulations entered into force on 1 January 2013:   The maximum age for an active member has been extended from 65 to 67 years. The beneficiary clause now allows insured persons to designate one or more persons of their choice to be their beneficiary(-ies), either at the time of taking out the insurance or at a later date, in which case the membership/modification form must be updated accordingly. Beneficiaries must be clearly identified (name, first name, date of birth, address).   The membership/modification form is available on the FP website: http://fp.web.cern.ch/helvetia-life-insurance For further information, please contact: Valentina Clavel (Tel. 73904) Peggy Pithioud (Tel. 72736)

  14. End Group Modification

    DEFF Research Database (Denmark)

    Jahnsen, Rasmus O; Sandberg-Schaal, Anne; Frimodt-Møller, Niels

    2015-01-01

    Increased incidence of infections with multidrug-resistant bacterial strains warrants an intensive search for novel potential antimicrobial agents. Here, an antimicrobial peptide analogue with a cationic/hydrophobic alternating design displaying only moderate activity against Gram-positive pathog......Increased incidence of infections with multidrug-resistant bacterial strains warrants an intensive search for novel potential antimicrobial agents. Here, an antimicrobial peptide analogue with a cationic/hydrophobic alternating design displaying only moderate activity against Gram......, the most favorable hydrophobic activity-inducing moieties were found to be cyclohexylacetyl and pentafluorophenylacetyl groups, while the presence of a short PEG-like chain had no significant effect on activity. Introduction of cationic moieties conferred no effect or merely a moderate activity...

  15. Optimised Renormalisation Group Flows

    CERN Document Server

    Litim, Daniel F

    2001-01-01

    Exact renormalisation group (ERG) flows interpolate between a microscopic or classical theory and the corresponding macroscopic or quantum effective theory. For most problems of physical interest, the efficiency of the ERG is constrained due to unavoidable approximations. Approximate solutions of ERG flows depend spuriously on the regularisation scheme which is determined by a regulator function. This is similar to the spurious dependence on the ultraviolet regularisation known from perturbative QCD. Providing a good control over approximated ERG flows is at the root for reliable physical predictions. We explain why the convergence of approximate solutions towards the physical theory is optimised by appropriate choices of the regulator. We study specific optimised regulators for bosonic and fermionic fields and compare the optimised ERG flows with generic ones. This is done up to second order in the derivative expansion at both vanishing and non-vanishing temperature. An optimised flow for a ``proper-time ren...

  16. Graphs, groups and surfaces

    CERN Document Server

    White, AT

    1985-01-01

    The field of topological graph theory has expanded greatly in the ten years since the first edition of this book appeared. The original nine chapters of this classic work have therefore been revised and updated. Six new chapters have been added, dealing with: voltage graphs, non-orientable imbeddings, block designs associated with graph imbeddings, hypergraph imbeddings, map automorphism groups and change ringing.Thirty-two new problems have been added to this new edition, so that there are now 181 in all; 22 of these have been designated as ``difficult'''' and 9 as ``unsolved''''. Three of the four unsolved problems from the first edition have been solved in the ten years between editions; they are now marked as ``difficult''''.

  17. Quantum Secure Group Communication.

    Science.gov (United States)

    Li, Zheng-Hong; Zubairy, M Suhail; Al-Amri, M

    2018-03-01

    We propose a quantum secure group communication protocol for the purpose of sharing the same message among multiple authorized users. Our protocol can remove the need for key management that is needed for the quantum network built on quantum key distribution. Comparing with the secure quantum network based on BB84, we show our protocol is more efficient and securer. Particularly, in the security analysis, we introduce a new way of attack, i.e., the counterfactual quantum attack, which can steal information by "invisible" photons. This invisible photon can reveal a single-photon detector in the photon path without triggering the detector. Moreover, the photon can identify phase operations applied to itself, thereby stealing information. To defeat this counterfactual quantum attack, we propose a quantum multi-user authorization system. It allows us to precisely control the communication time so that the attack can not be completed in time.

  18. Working Group Report: Sensors

    Energy Technology Data Exchange (ETDEWEB)

    Artuso, M.; et al.,

    2013-10-18

    Sensors play a key role in detecting both charged particles and photons for all three frontiers in Particle Physics. The signals from an individual sensor that can be used include ionization deposited, phonons created, or light emitted from excitations of the material. The individual sensors are then typically arrayed for detection of individual particles or groups of particles. Mounting of new, ever higher performance experiments, often depend on advances in sensors in a range of performance characteristics. These performance metrics can include position resolution for passing particles, time resolution on particles impacting the sensor, and overall rate capabilities. In addition the feasible detector area and cost frequently provides a limit to what can be built and therefore is often another area where improvements are important. Finally, radiation tolerance is becoming a requirement in a broad array of devices. We present a status report on a broad category of sensors, including challenges for the future and work in progress to solve those challenges.

  19. Representation Theory of Algebraic Groups and Quantum Groups

    CERN Document Server

    Gyoja, A; Shinoda, K-I; Shoji, T; Tanisaki, Toshiyuki

    2010-01-01

    Invited articles by top notch expertsFocus is on topics in representation theory of algebraic groups and quantum groupsOf interest to graduate students and researchers in representation theory, group theory, algebraic geometry, quantum theory and math physics

  20. Oklo working group meeting

    International Nuclear Information System (INIS)

    Von Maravic, H.

    1993-01-01

    Natural analogue studies have been carried out for several years in the framework of the European Community's R and D programme on radioactive waste; and within its recent fourth five-year programme on 'Management and storage of radioactive waste (1990-94)' the Community is participating in the Oklo study, natural analogue for transfer processes in a geological repository. The Oklo project is coordinated by CEA-IPSN (F) and involves laboratories from several CEA directorates (IPSN, DTA and DCC) which collaborate with other institutions from France: CREGU, Nancy; CNRS, Strasbourg and ENSMD, Fontainebleau. Moreover, institutes from non-EC member States are also taking part in the Oklo study. The second joint CEC-CEA progress meeting of the Oklo Working Group was held in April 1992 in Brussels and gave the possibility of reviewing and discussing progress made since its first meeting in February 1991 at CEA in Fontenay-aux-Roses. About 40 participants from 15 laboratories and organizations coming from France, Canada, Gabon, Japan, Sweden and the USA underline the great interest in the ongoing research activities. The meeting focused on the different tasks within the CEC-CEA Oklo project concerning (i) field survey and sampling, (ii) characterization of the source term, (iii) studies of the petrographical and geochemical system, and (iv) studies of the hydrogeological system and hydrodynamic modelling. (author) 17 papers are presented

  1. The Liabilities Management Group

    International Nuclear Information System (INIS)

    Whitehead, A.W.

    1998-01-01

    The Liabilities Management Group (LMG) was initiated by DTI. It is a cooperative forum which was set up in 1995. The current participants are DTI, UKAEA, NLM (for BNFL), MOD and Magnox Electric. The LMG was initiated to produce closer cooperation between public sector liability management organizations, achieve more cost-effective management of UK nuclear liabilities and enhance development of the UK nuclear decommissioning and waste management strategy. The objectives are to compare practices between liabilities management organizations discuss the scope for collaboration identify priority areas for possible collaboration agree action plans for exploring and undertaking such collaboration.Four task forces have been formed to look at specific areas (R and D, safety, contracts, and project management) and each reports separately to the LMG. The LMG has achieved its original aim of bringing together those with public sector liability management responsibilities. All participants feel that the LMG has been useful and that it should continue. Looking to the future, there is a continuing need for the LMG to facilitate removal of barriers to the achievement of best value for money. The LMG might also consider addressing the 'business process' elements that a liability management organization must be good at in order to define best practice in these. (author)

  2. CORRELATION BETWEEN GROUP LOCAL DENSITY AND GROUP LUMINOSITY

    Energy Technology Data Exchange (ETDEWEB)

    Deng Xinfa [School of Science, Nanchang University, Jiangxi 330031 (China); Yu Guisheng [Department of Natural Science, Nanchang Teachers College, Jiangxi 330103 (China)

    2012-11-10

    In this study, we investigate the correlation between group local number density and total luminosity of groups. In four volume-limited group catalogs, we can conclude that groups with high luminosity exist preferentially in high-density regions, while groups with low luminosity are located preferentially in low-density regions, and that in a volume-limited group sample with absolute magnitude limit M{sub r} = -18, the correlation between group local number density and total luminosity of groups is the weakest. These results basically are consistent with the environmental dependence of galaxy luminosity.

  3. Group Counseling in the Schools

    Science.gov (United States)

    Perusse, Rachelle; Goodnough, Gary E.; Lee, Vivian V.

    2009-01-01

    Group counseling is an effective intervention when working in a school setting. In this article, the authors discuss the different kinds of groups offered in schools, types of group interventions, strategies to use in forming groups, and how to collaborate with others in the school. Because leading groups in schools is a specialized skill, the…

  4. Naive Theories of Social Groups

    Science.gov (United States)

    Rhodes, Marjorie

    2012-01-01

    Four studies examined children's (ages 3-10, Total N = 235) naive theories of social groups, in particular, their expectations about how group memberships constrain social interactions. After introduction to novel groups of people, preschoolers (ages 3-5) reliably expected agents from one group to harm members of the other group (rather than…

  5. Making Cooperative Learning Groups Work.

    Science.gov (United States)

    Hawley, James; De Jong, Cherie

    1995-01-01

    Discusses the use of cooperative-learning groups with middle school students. Describes cooperative-learning techniques, including group roles, peer evaluation, and observation and monitoring. Considers grouping options, including group size and configuration, dyads, the think-pair-share lecture, student teams achievement divisions, jigsaw groups,…

  6. Fermilab Steering Group Report

    Energy Technology Data Exchange (ETDEWEB)

    Beier, Eugene; /Pennsylvania U.; Butler, Joel; /Fermilab; Dawson, Sally; /Brookhaven; Edwards, Helen; /Fermilab; Himel, Thomas; /SLAC; Holmes, Stephen; /Fermilab; Kim, Young-Kee; /Fermilab /Chicago U.; Lankford, Andrew; /UC, Irvine; McGinnis, David; /Fermilab; Nagaitsev, Sergei; /Fermilab; Raubenheimer, Tor; /SLAC /Fermilab

    2007-01-01

    The Fermilab Steering Group has developed a plan to keep U.S. accelerator-based particle physics on the pathway to discovery, both at the Terascale with the LHC and the ILC and in the domain of neutrinos and precision physics with a high-intensity accelerator. The plan puts discovering Terascale physics with the LHC and the ILC as Fermilab's highest priority. While supporting ILC development, the plan creates opportunities for exciting science at the intensity frontier. If the ILC remains near the Global Design Effort's technically driven timeline, Fermilab would continue neutrino science with the NOVA experiment, using the NuMI (Neutrinos at the Main Injector) proton plan, scheduled to begin operating in 2011. If ILC construction must wait somewhat longer, Fermilab's plan proposes SNuMI, an upgrade of NuMI to create a more powerful neutrino beam. If the ILC start is postponed significantly, a central feature of the proposed Fermilab plan calls for building an intense proton facility, Project X, consisting of a linear accelerator with the currently planned characteristics of the ILC combined with Fermilab's existing Recycler Ring and the Main Injector accelerator. The major component of Project X is the linac. Cryomodules, radio-frequency distribution, cryogenics and instrumentation for the linac are the same as or similar to those used in the ILC at a scale of about one percent of a full ILC linac. Project X's intense proton beams would open a path to discovery in neutrino science and in precision physics with charged leptons and quarks. World-leading experiments would allow physicists to address key questions of the Quantum Universe: How did the universe come to be? Are there undiscovered principles of nature: new symmetries, new physical laws? Do all the particles and forces become one? What happened to the antimatter? Building Project X's ILC-like linac would offer substantial support for ILC development by accelerating the

  7. Linear deformations of discrete groups and constructions of multivalued groups

    International Nuclear Information System (INIS)

    Yagodovskii, Petr V

    2000-01-01

    We construct deformations of discrete multivalued groups described as special deformations of their group algebras in the class of finite-dimensional associative algebras. We show that the deformations of ordinary groups producing multivalued groups are defined by cocycles with coefficients in the group algebra of the original group and obtain classification theorems on these deformations. We indicate a connection between the linear deformations of discrete groups introduced in this paper and the well-known constructions of multivalued groups. We describe the manifold of three-dimensional associative commutative algebras with identity element, fixed basis, and a constant number of values. The group algebras of n-valued groups of order three (three-dimensional n-group algebras) form a discrete set in this manifold

  8. Group B Streptococcus and Pregnancy

    Science.gov (United States)

    ... B Strep and Pregnancy • What is group B streptococcus (GBS)? • What does it mean to be colonized ... planned cesarean birth? •Glossary What is group B streptococcus (GBS)? Group B streptococcus is one of the ...

  9. Harmonic Analysis and Group Representation

    CERN Document Server

    Figa-Talamanca, Alessandro

    2011-01-01

    This title includes: Lectures - A. Auslander, R. Tolimeri - Nilpotent groups and abelian varieties, M Cowling - Unitary and uniformly bounded representations of some simple Lie groups, M. Duflo - Construction de representations unitaires d'un groupe de Lie, R. Howe - On a notion of rank for unitary representations of the classical groups, V.S. Varadarajan - Eigenfunction expansions of semisimple Lie groups, and R. Zimmer - Ergodic theory, group representations and rigidity; and, Seminars - A. Koranyi - Some applications of Gelfand pairs in classical analysis.

  10. Topological K-Kolmogorov groups

    International Nuclear Information System (INIS)

    Abd El-Sattar, A. Dabbour.

    1987-07-01

    The idea of the K-groups was used to define K-Kolmogorov homology and cohomology (over pairs of coefficient groups) which are descriptions of certain modifications of the Kolmogorov groups. The present work is devoted to the study of the topological properties of the K-Kolmogorov groups which lie at the root of the group duality based essentially upon Pontrjagin's concept of group multiplication. 14 refs

  11. Post-Disaster Social Justice Group Work and Group Supervision

    Science.gov (United States)

    Bemak, Fred; Chung, Rita Chi-Ying

    2011-01-01

    This article discusses post-disaster group counseling and group supervision using a social justice orientation for working with post-disaster survivors from underserved populations. The Disaster Cross-Cultural Counseling model is a culturally responsive group counseling model that infuses social justice into post-disaster group counseling and…

  12. Group Leader Development: Effects of Personal Growth and Psychoeducational Groups

    Science.gov (United States)

    Ohrt, Jonathan H.; Robinson, E. H., III; Hagedorn, W. Bryce

    2013-01-01

    The purpose of this quasi-experimental study was to compare the effects of personal growth groups and psychoeducational groups on counselor education students' (n = 74) empathy and group leader self-efficacy. Additionally, we compared the degree to which participants in each group valued: (a) cohesion, (b) catharsis, and (c) insight. There were no…

  13. Feminist Principles in Survivor's Groups: Out-of-Group Contact.

    Science.gov (United States)

    Rittenhouse, JoAn

    1997-01-01

    Illustrates the value of theoretical concepts from Feminist Therapy in the group treatment of women survivors. Theoretical underpinnings are supported using data taken from clinical experience and by examining group themes and out-of-group contact developed from the case sample. Principles regarding feminist groups are proposed. (RJM)

  14. Platinum-group elements

    Science.gov (United States)

    Zientek, Michael L.; Loferski, Patricia J.; Parks, Heather L.; Schulte, Ruth F.; Seal, Robert R.; Schulz, Klaus J.; DeYoung,, John H.; Seal, Robert R.; Bradley, Dwight C.

    2017-12-19

    The platinum-group elements (PGEs)—platinum, palladium, rhodium, ruthenium, iridium, and osmium—are metals that have similar physical and chemical properties and tend to occur together in nature. PGEs are indispensable to many industrial applications but are mined in only a few places. The availability and accessibility of PGEs could be disrupted by economic, environmental, political, and social events. The United States net import reliance as a percentage of apparent consumption is about 90 percent.PGEs have many industrial applications. They are used in catalytic converters to reduce carbon monoxide, hydrocarbon, and nitrous oxide emissions in automobile exhaust. The chemical industry requires platinum or platinum-rhodium alloys to manufacture nitric oxide, which is the raw material used to manufacture explosives, fertilizers, and nitric acid. In the petrochemical industry, platinum-supported catalysts are needed to refine crude oil and to produce aromatic compounds and high-octane gasoline. Alloys of PGEs are exceptionally hard and durable, making them the best known coating for industrial crucibles used in the manufacture of chemicals and synthetic materials. PGEs are used by the glass manufacturing industry in the production of fiberglass and flat-panel and liquid crystal displays. In the electronics industry, PGEs are used in computer hard disks, hybridized integrated circuits, and multilayer ceramic capacitors.Aside from their industrial applications, PGEs are used in such other fields as health, consumer goods, and finance. Platinum, for example, is used in medical implants, such as pacemakers, and PGEs are used in cancer-fighting drugs. Platinum alloys are an ideal choice for jewelry because of their white color, strength, and resistance to tarnish. Platinum, palladium, and rhodium in the form of coins and bars are also used as investment commodities, and various financial instruments based on the value of these PGEs are traded on major exchanges

  15. Emotional collectives: How groups shape emotions and emotions shape groups.

    Science.gov (United States)

    van Kleef, Gerben A; Fischer, Agneta H

    2016-01-01

    Group settings are epicentres of emotional activity. Yet, the role of emotions in groups is poorly understood. How do group-level phenomena shape group members' emotional experience and expression? How are emotional expressions recognised, interpreted and shared in group settings? And how do such expressions influence the emotions, cognitions and behaviours of fellow group members and outside observers? To answer these and other questions, we draw on relevant theoretical perspectives (e.g., intergroup emotions theory, social appraisal theory and emotions as social information theory) and recent empirical findings regarding the role of emotions in groups. We organise our review according to two overarching themes: how groups shape emotions and how emotions shape groups. We show how novel empirical approaches break important new ground in uncovering the role of emotions in groups. Research on emotional collectives is thriving and constitutes a key to understanding the social nature of emotions.

  16. Group performance and group learning at dynamic system control tasks

    International Nuclear Information System (INIS)

    Drewes, Sylvana

    2013-01-01

    Proper management of dynamic systems (e.g. cooling systems of nuclear power plants or production and warehousing) is important to ensure public safety and economic success. So far, research has provided broad evidence for systematic shortcomings in individuals' control performance of dynamic systems. This research aims to investigate whether groups manifest synergy (Larson, 2010) and outperform individuals and if so, what processes lead to these performance advantages. In three experiments - including simulations of a nuclear power plant and a business setting - I compare the control performance of three-person-groups to the average individual performance and to nominal groups (N = 105 groups per experiment). The nominal group condition captures the statistical advantage of aggregated group judgements not due to social interaction. First, results show a superior performance of groups compared to individuals. Second, a meta-analysis across all three experiments shows interaction-based process gains in dynamic control tasks: Interacting groups outperform the average individual performance as well as the nominal group performance. Third, group interaction leads to stable individual improvements of group members that exceed practice effects. In sum, these results provide the first unequivocal evidence for interaction-based performance gains of groups in dynamic control tasks and imply that employers should rely on groups to provide opportunities for individual learning and to foster dynamic system control at its best.

  17. Does group efficacy increase group identification? Resolving their paradoxical relationship

    NARCIS (Netherlands)

    van Zomeren, Martijn; Leach, Colin Wayne; Spears, Russell

    2010-01-01

    Although group identification and group efficacy are both important predictors of collective action against collective disadvantage, there is mixed evidence for their (causal) relationship. Meta-analytic and correlational evidence suggests an overall positive relationship that has been interpreted

  18. Secure Group Communications for Large Dynamic Multicast Group

    Institute of Scientific and Technical Information of China (English)

    Liu Jing; Zhou Mingtian

    2003-01-01

    As the major problem in multicast security, the group key management has been the focus of research But few results are satisfactory. In this paper, the problems of group key management and access control for large dynamic multicast group have been researched and a solution based on SubGroup Secure Controllers (SGSCs) is presented, which solves many problems in IOLUS system and WGL scheme.

  19. How to conduct focus groups: researching group priorities through discussion.

    Science.gov (United States)

    1992-01-01

    Focus groups serve to uncover priorities and beliefs of a target group, but health project designers do not always take the time to seek this information beforehand. Focus groups also allow various local subgroups to communicate their concerns before the project starts. Focus groups can also breed ideas and dialogue that individual interviews cannot and they provide baseline information so managers can determine if attitudes or priorities have resulted from the project. Diverse people have different beliefs, e.g., women who have young children view oral rehydration therapy differently from women with no children. Project designers can use these basic differences to arrive at some conclusions about general attitudes. Focus group facilitators should have a discussion outline to help keep the group on the topic of concern. They should limit sessions to 60-90 minutes. Each focus groups should include 8-10 people. It is important to have members of various community subgroups in each group. Yet group designers should be careful not to include within the same group, those who may intimidate other people in the group, e.g., in situations where farmers depend on middlemen, farmers may not be open if middlemen are also in the focus group. Facilitators should launch each session with an attempt to encourage the members to be open and to feel comfortable. For example, in Malawi, a facilitator leads her focus group discussions with songs. Stories are another icebreaker. It is important that all focus groups centering around a certain project discuss the same topics. Facilitators need to stress to the group that all discussions are to be kept confidential. The designers should also carefully word the questions so that facilitators will not impart their bias. Facilitators should not direct the group to certain conclusions, but instead keep the discussions focused.

  20. Group covariance and metrical theory

    International Nuclear Information System (INIS)

    Halpern, L.

    1983-01-01

    The a priori introduction of a Lie group of transformations into a physical theory has often proved to be useful; it usually serves to describe special simplified conditions before a general theory can be worked out. Newton's assumptions of absolute space and time are examples where the Euclidian group and translation group have been introduced. These groups were extended to the Galilei group and modified in the special theory of relativity to the Poincare group to describe physics under the given conditions covariantly in the simplest way. The criticism of the a priori character leads to the formulation of the general theory of relativity. The general metric theory does not really give preference to a particular invariance group - even the principle of equivalence can be adapted to a whole family of groups. The physical laws covariantly inserted into the metric space are however adapted to the Poincare group. 8 references

  1. Defining and Classifying Interest Groups

    DEFF Research Database (Denmark)

    Baroni, Laura; Carroll, Brendan; Chalmers, Adam

    2014-01-01

    The interest group concept is defined in many different ways in the existing literature and a range of different classification schemes are employed. This complicates comparisons between different studies and their findings. One of the important tasks faced by interest group scholars engaged...... in large-N studies is therefore to define the concept of an interest group and to determine which classification scheme to use for different group types. After reviewing the existing literature, this article sets out to compare different approaches to defining and classifying interest groups with a sample...... in the organizational attributes of specific interest group types. As expected, our comparison of coding schemes reveals a closer link between group attributes and group type in narrower classification schemes based on group organizational characteristics than those based on a behavioral definition of lobbying....

  2. What Is a Group? Young Children's Perceptions of Different Types of Groups and Group Entitativity.

    Directory of Open Access Journals (Sweden)

    Maria Plötner

    Full Text Available To date, developmental research on groups has focused mainly on in-group biases and intergroup relations. However, little is known about children's general understanding of social groups and their perceptions of different forms of group. In this study, 5- to 6-year-old children were asked to evaluate prototypes of four key types of groups: an intimacy group (friends, a task group (people who are collaborating, a social category (people who look alike, and a loose association (people who coincidently meet at a tram stop. In line with previous work with adults, the vast majority of children perceived the intimacy group, task group, and social category, but not the loose association, to possess entitativity, that is, to be a 'real group.' In addition, children evaluated group member properties, social relations, and social obligations differently in each type of group, demonstrating that young children are able to distinguish between different types of in-group relations. The origins of the general group typology used by adults thus appear early in development. These findings contribute to our knowledge about children's intuitive understanding of groups and group members' behavior.

  3. Effectiveness of Group Supervision versus Combined Group and Individual Supervision.

    Science.gov (United States)

    Ray, Dee; Altekruse, Michael

    2000-01-01

    Investigates the effectiveness of different types of supervision (large group, small group, combined group, individual supervision) with counseling students (N=64). Analyses revealed that all supervision formats resulted in similar progress in counselor effectiveness and counselor development. Participants voiced a preference for individual…

  4. Group Insight Versus Group Desensitization in Treating Speech Anxiety

    Science.gov (United States)

    Meichenbaum, Donald H.; And Others

    1971-01-01

    Results of this study indicated that the insight group was as effective as the desensitization group in significantly reducing speech anxiety over control group levels as assessed by behavioral, cognitive, and self-report measures given immediately after posttreatment and later at a three-month follow-up. (Author)

  5. Re-Examining Group Development in Adventure Therapy Groups.

    Science.gov (United States)

    DeGraaf, Don; Ashby, Jeff

    1998-01-01

    Small-group development is an important aspect of adventure therapy. Supplementing knowledge of sequential stages of group development with knowledge concerning within-stage nonsequential development yields a richer understanding of groups. Integrating elements of the individual counseling relationship (working alliance, transference, and real…

  6. Saving Face and Group Identity

    DEFF Research Database (Denmark)

    Eriksson, Tor; Mao, Lei; Villeval, Marie-Claire

    2015-01-01

    their self- but also other group members' image. This behavior is frequent even in the absence of group identity. When group identity is more salient, individuals help regardless of whether the least performer is an in-group or an out-group. This suggests that saving others' face is a strong social norm.......Are people willing to sacrifice resources to save one's and others' face? In a laboratory experiment, we study whether individuals forego resources to avoid the public exposure of the least performer in their group. We show that a majority of individuals are willing to pay to preserve not only...

  7. Enhancing Social Communication Between Groups

    NARCIS (Netherlands)

    T. Stevens; P. Hughes (Peter); D. Williams; I. Craigie; I. Kegel; P.S. Cesar Garcia (Pablo Santiago); A.J. Jansen (Jack); M.F. Usrsu; M. Frantzis; N. Farber; M. Lutzky; S. Vogel

    2010-01-01

    htmlabstractThis paper describes a prototype software platform that supports advanced communications services, specifically services enabling effective group-to-group communications with a social purpose, between remote homes. The architecture, the individual components, their interfaces, and the

  8. Coordinated Control of Vehicle Groups

    National Research Council Canada - National Science Library

    Kumar, Vijay

    2004-01-01

    .... There are three main objectives: (1) to develop a theoretical paradigm for formalizing the concepts of a group, a team, and control of groups, with specified tasks such as exploring, mapping, searching, and transporting objects; (2...

  9. Criminal groups and criminal subculture

    OpenAIRE

    Romanova N.M.

    2013-01-01

    The paper provides a classification of criminal groups, structured by the following parameters: a) operation mode (secret/open), b) law-enforcement and administrative support (presence/absence). We describe four types of criminal groups: a) legitimized criminal organization, b) secret criminal organization engaged in illegal business, c) secret general crime group, and d) general crime group operating openly. The four types differ in the content of criminal subculture. Modern criminal subcult...

  10. Group Cooperation in Outdoor Education

    Science.gov (United States)

    Matthews, Bruce E.

    1978-01-01

    Utilizing the Beatles' Yellow Submarine fantasy (e.g., the Blue Meanies), this outdoor education program is designed for sixth graders and special education students. Activities developed at the Cortland Resident Outdoor Education Camp include a series of group stress/challenge activities to be accomplished by everyone in the group, as a group.…

  11. Reinterpreting between-group inequality

    NARCIS (Netherlands)

    Elbers, C.T.M.; Lanjouw, P.F.; Mistiaen, J.; Özler, B

    2008-01-01

    We evaluate observed inequality between population groups against a benchmark of the maximum between-group inequality attainable given the number and relative sizes of those groups under examination. Because our measure is normalized by these parameters, drawing comparisons across different settings

  12. Ability Grouping in Social Studies.

    Science.gov (United States)

    Social Education, 1992

    1992-01-01

    Presents a position statement of the National Council for the Social Studies (NCSS). Reports that the NCSS objects to ability grouping in social studies. Argues that ability grouping disadvantages minority, handicapped, and low ability students. Suggests that ability grouping undermines the democratic ideals that should be the basis of the social…

  13. Conceptualizing Group Flow: A Framework

    Science.gov (United States)

    Duncan, Jana; West, Richard E.

    2018-01-01

    This literature review discusses the similarities in main themes between Csikszentmihályi theory of individual flow and Sawyer theory of group flow, and compares Sawyer's theory with existing concepts in the literature on group work both in education and business. Because much creativity and innovation occurs within groups, understanding group…

  14. Diagram Techniques in Group Theory

    Science.gov (United States)

    Stedman, Geoffrey E.

    2009-09-01

    Preface; 1. Elementary examples; 2. Angular momentum coupling diagram techniques; 3. Extension to compact simple phase groups; 4. Symmetric and unitary groups; 5. Lie groups and Lie algebras; 6. Polarisation dependence of multiphoton processes; 7. Quantum field theoretic diagram techniques for atomic systems; 8. Applications; Appendix; References; Indexes.

  15. Designing for informed group formation

    DEFF Research Database (Denmark)

    Nicolajsen, Hanne Westh; Juel Jacobsen, Alice; Riis, Marianne

    2012-01-01

    A new design ―project preparation‖ preparing for the group formation in problem based project work is proposed and investigated. The main problem is to overcome group formation based on existing relations. The hypothesis is that theme development and group formation are somewhat counterproductive...

  16. Working with Difficult Group Members.

    Science.gov (United States)

    Kottler, Jeffrey A.

    1994-01-01

    Describes types of group members who are challenging in group settings including entitled, manipulative, and character-disordered clients. Provides suggestions for working with these group members, either as isolated cases or as homogenous populations, emphasizing the protection of other clients' rights. Includes 31 references. (Author/CRR)

  17. K-Kolmogorov cohomology groups

    International Nuclear Information System (INIS)

    Abd El-Sattar, A. Dabbour.

    1986-07-01

    In the present work we use the idea of K-groups to give a description of certain modification of the Kolmogorov cohomology groups for the case of a pair (G,G') of discrete coefficient groups. Their induced homomorphisms and coboundary operators are also defined, and then we study the resulting construction from the point of view of Eilenberg-Steenrod axioms. (author)

  18. Ultrafilters and topologies on groups

    CERN Document Server

    Zelenyuk, Yevhen

    2011-01-01

    This book presents the relationship between ultrafilters and topologies on groups. It shows how ultrafilters are used in constructing topologies on groups with extremal properties and how topologies on groups serve in deriving algebraic results aboutultrafilters. Topics covered include: topological and left topological groups, ultrafilter semigroups, local homomorphisms and automorphisms, subgroups and ideal structure of ßG, almost maximal spaces and projectives of finite semigroups, resolvability of groups. This is a self-contained book aimed at graduate students and researchers working in to

  19. Group supervision for general practitioners

    DEFF Research Database (Denmark)

    Galina Nielsen, Helena; Sofie Davidsen, Annette; Dalsted, Rikke

    2013-01-01

    AIM: Group supervision is a sparsely researched method for professional development in general practice. The aim of this study was to explore general practitioners' (GPs') experiences of the benefits of group supervision for improving the treatment of mental disorders. METHODS: One long-establish......AIM: Group supervision is a sparsely researched method for professional development in general practice. The aim of this study was to explore general practitioners' (GPs') experiences of the benefits of group supervision for improving the treatment of mental disorders. METHODS: One long...... considered important prerequisites for disclosing and discussing professional problems. CONCLUSION: The results of this study indicate that participation in a supervision group can be beneficial for maintaining and developing GPs' skills in dealing with patients with mental health problems. Group supervision...... influenced other areas of GPs' professional lives as well. However, more studies are needed to assess the impact of supervision groups....

  20. Group percolation in interdependent networks

    Science.gov (United States)

    Wang, Zexun; Zhou, Dong; Hu, Yanqing

    2018-03-01

    In many real network systems, nodes usually cooperate with each other and form groups to enhance their robustness to risks. This motivates us to study an alternative type of percolation, group percolation, in interdependent networks under attack. In this model, nodes belonging to the same group survive or fail together. We develop a theoretical framework for this group percolation and find that the formation of groups can improve the resilience of interdependent networks significantly. However, the percolation transition is always of first order, regardless of the distribution of group sizes. As an application, we map the interdependent networks with intersimilarity structures, which have attracted much attention recently, onto the group percolation and confirm the nonexistence of continuous phase transitions.

  1. The "group" in obstetric psychoprophylaxis.

    Science.gov (United States)

    Volpe, B; Tenaglia, F; Fede, T; Cerutti, R

    1983-01-01

    In the practice of obstetric psychoprophylaxis every method employed considered always the group both from a psychological and a pedagogic point of view. Today the group of pregnant women (or couples) is considered under various aspects: - psychological: the group as a support for members with regard to maternal and parental emotional feelings; - anthropological: the group fills up an empty vital space and becomes a "rite de passage" from a state of social identity to another one; - social: the group is a significative cultural intermediary between health services and the women-patient. The knowledge of these aspects becomes an important methodological support for group conductors. We present an analysis of our experience with groups and how this has affected the Psychoprophylaxis in the last years.

  2. Group lending and the role of the group leader

    OpenAIRE

    Eijkel, van, R.; Hermes, N.; Lensink, B.W.

    2011-01-01

    This paper investigates strategic monitoring behavior within group lending. We show that monitoring efforts of group members differ in equilibrium due to the asymmetry between members in terms of future profits. In particular, we show that the entrepreneur with the highest future profits also puts in the highest monitoring effort. Moreover, monitoring efforts differ between group members due to free-riding: one member reduces her level of monitoring if the other increases her monitoring effor...

  3. Clifford algebras, spinors, spin groups and covering groups

    International Nuclear Information System (INIS)

    Magneville, C.; Pansart, J.P.

    1991-03-01

    The Dirac equation uses matrices named Υ matrices which are representations of general algebraic structures associated with a metric space. These algebras are the Clifford algebras. In the first past, these algebras are studied. Then the notion of spinor is developed. It is shown that Majorana and Weyl spinors only exist for some particular metric space. In the second part, Clifford and spinor groups are studied. They may be interpreted as the extension of the notion of orthogonal group for Clifford algebras and their spaces for representation. The rotation of a spinor is computed. In the last part, the connexion between the spinor groups and the Universal Covering Groups is presented [fr

  4. Group lending and the role of the group leader

    NARCIS (Netherlands)

    Eijkel, van R.; Hermes, N.; Lensink, B.W.

    2011-01-01

    This paper investigates strategic monitoring behavior within group lending. We show that monitoring efforts of group members differ in equilibrium due to the asymmetry between members in terms of future profits. In particular, we show that the entrepreneur with the highest future profits also puts

  5. Group lending and the role of the group leader

    NARCIS (Netherlands)

    van Eijkel, R.; Hermes, C.L.M.; Lensink, B.W.

    This paper investigates strategic monitoring behavior within group lending. We show that monitoring efforts of group members differ in equilibrium due to the asymmetry between members in terms of future profits. In particular, we show that the entrepreneur with the highest future profits also puts

  6. Working with Group-Tasks and Group Cohesiveness

    Science.gov (United States)

    Anwar, Khoirul

    2016-01-01

    This study aimed at exploring the connection between the use of group task and group cohesiveness. This study is very important because the nature of the learner's success is largely determined by the values of cooperation, interaction, and understanding of the learning objectives together. Subjects of this study are 28 students on the course…

  7. Group Journaling: A Tool for Reflection, Fun and Group Development

    Science.gov (United States)

    Asfeldt, Morten

    2012-01-01

    Personal journaling is common practice in outdoor programs and is an important means of reflection and meaning-making. For over 20 years the author has used group journals to promote reflection and understanding, raise important questions, explore difficult issues, develop writing and speaking skills, and enhance group development. In this…

  8. Group Milieu in systemic and psychodynamic group therapy

    DEFF Research Database (Denmark)

    Lau, Marianne Engelbrecht; Kristensen, Ellids

    Objectives: A recent meta-analysis also concluded that psychotherapeutic approaches are beneficial for adult with a history of CSA and maintained for at least six months follow-up. The results suggest that different characteristics of therapy moderate the therapeutic outcome. We found in a random......Objectives: A recent meta-analysis also concluded that psychotherapeutic approaches are beneficial for adult with a history of CSA and maintained for at least six months follow-up. The results suggest that different characteristics of therapy moderate the therapeutic outcome. We found...... in a randomized study of systemic versus psychodynamic group therapy, that the short-term outcome for patients who received systemic group psychotherapy was significantly better than the outcome for patients who received psychodynamic group psychotherapy. The current study assessed the group milieu in both groups....... Methods: This randomized prospective study included 106 women: 52 assigned to psychodynamic group psychotherapy and 54 assigned to systemic group psychotherapy. The Group Environment Scale (GES) was filled in the mid phase of therapy and analysed in three dimensions and 10 subscales. Results: The systemic...

  9. Geometric group theory an introduction

    CERN Document Server

    Löh, Clara

    2017-01-01

    Inspired by classical geometry, geometric group theory has in turn provided a variety of applications to geometry, topology, group theory, number theory and graph theory. This carefully written textbook provides a rigorous introduction to this rapidly evolving field whose methods have proven to be powerful tools in neighbouring fields such as geometric topology. Geometric group theory is the study of finitely generated groups via the geometry of their associated Cayley graphs. It turns out that the essence of the geometry of such groups is captured in the key notion of quasi-isometry, a large-scale version of isometry whose invariants include growth types, curvature conditions, boundary constructions, and amenability. This book covers the foundations of quasi-geometry of groups at an advanced undergraduate level. The subject is illustrated by many elementary examples, outlooks on applications, as well as an extensive collection of exercises.

  10. Group Analytic Psychotherapy in Brazil.

    Science.gov (United States)

    Penna, Carla; Castanho, Pablo

    2015-10-01

    Group analytic practice in Brazil began quite early. Highly influenced by the Argentinean Pichon-Rivière, it enjoyed a major development from the 1950s to the early 1980s. Beginning in the 1970s, different factors undermined its development and eventually led to its steep decline. From the mid 1980s on, the number of people looking for either group analytic psychotherapy or group analytic training decreased considerably. Group analytic psychotherapy societies struggled to survive and most of them had to close their doors in the 1990s and the following decade. Psychiatric reform and the new public health system have stimulated a new demand for groups in Brazil. Developments in the public and not-for-profit sectors, combined with theoretical and practical research in universities, present promising new perspectives for group analytic psychotherapy in Brazil nowadays.

  11. Modelling group dynamic animal movement

    DEFF Research Database (Denmark)

    Langrock, Roland; Hopcraft, J. Grant C.; Blackwell, Paul G.

    2014-01-01

    makes its movement decisions relative to the group centroid. The basic idea is framed within the flexible class of hidden Markov models, extending previous work on modelling animal movement by means of multi-state random walks. While in simulation experiments parameter estimators exhibit some bias......, to date, practical statistical methods which can include group dynamics in animal movement models have been lacking. We consider a flexible modelling framework that distinguishes a group-level model, describing the movement of the group's centre, and an individual-level model, such that each individual......Group dynamic movement is a fundamental aspect of many species' movements. The need to adequately model individuals' interactions with other group members has been recognised, particularly in order to differentiate the role of social forces in individual movement from environmental factors. However...

  12. Discrepancy in abo blood grouping

    International Nuclear Information System (INIS)

    Khan, M.N.; Ahmed, Z.; Khan, T.A.

    2013-01-01

    Discrepancies in blood typing is one of the major reasons in eliciting a transfusion reaction. These discrepancies can be avoided through detailed analysis for the blood typing. Here, we report a subgroup of blood group type-B in the ABO system. Donor's blood was analyzed by employing commercial antisera for blood grouping. The results of forward (known antisera) and reverse (known antigen) reaction were not complimentary. A detailed analysis using the standard protocols by American Association of Blood Banking revealed the blood type as a variant of blood group-B instead of blood group-O. This is suggestive of the fact that blood group typing should be performed with extreme care and any divergence, if identified, should be properly resolved to avoid transfusion reactions. Moreover, a major study to determine the blood group variants in Pakistani population is needed. (author)

  13. The didactics of group work

    DEFF Research Database (Denmark)

    Christensen, Gerd

    2017-01-01

    The aim of this paper is to discuss aims and means of group work as a teaching and learning method. In Denmark, group work has been implemented at all levels of education since the 1970s from primary school to university but also in training sessions in organizations. The discussion in this paper...... will take its point of departure in pedagogical textbook introductions where group work is often presented as a means to learning social skills and co-workability. However, as most students and teachers know, this is not always the case. Observations of long-term group work show that this can be a tough...... experience for the students (Christensen 2013). Contrary to expectations, the group work seemed to foster anti-social behavior and development of selfish skills. The paper will therefore conclude by suggesting how the (often) laissez-faire group pedagogy, which is dominant in Denmark, could be improved...

  14. Uniquely Strongly Clean Group Rings

    Institute of Scientific and Technical Information of China (English)

    WANG XIU-LAN

    2012-01-01

    A ring R is called clean if every element is the sum of an idempotent and a unit,and R is called uniquely strongly clean (USC for short) if every element is uniquely the sum of an idempotent and a unit that commute.In this article,some conditions on a ring R and a group G such that RG is clean are given.It is also shown that if G is a locally finite group,then the group ring RG is USC if and only if R is USC,and G is a 2-group.The left uniquely exchange group ring,as a middle ring of the uniquely clean ring and the USC ring,does not possess this property,and so does the uniquely exchange group ring.

  15. Group theory and its applications

    CERN Document Server

    Patra, Prasanta Kumar

    2018-01-01

    Every molecule possesses symmetry and hence has symmetry operations and symmetry elements. From symmetry properties of a system we can deduce its significant physical results. Consequently it is essential to operations of a system forms a group. Group theory is an abstract mathematical tool that underlies the study of symmetry and invariance. By using the concepts of symmetry and group theory, it is possible to obtain the members of complete set of known basis functions of the various irreducible representations of the group. I practice this is achieved by applying the projection operators to linear combinations of atomic orbital (LCAO) when the valence electrons are tightly bound to the ions, to orthogonalized plane waves (OPW) when valence electrons are nearly free and to the other given functions that are judged to the particular system under consideration. In solid state physics the group theory is indispensable in the context of finding the energy bands of electrons in solids. Group theory can be applied...

  16. Physics of the Lorentz Group

    Science.gov (United States)

    Başkal, Sibel

    2015-11-01

    This book explains the Lorentz mathematical group in a language familiar to physicists. While the three-dimensional rotation group is one of the standard mathematical tools in physics, the Lorentz group of the four-dimensional Minkowski space is still very strange to most present-day physicists. It plays an essential role in understanding particles moving at close to light speed and is becoming the essential language for quantum optics, classical optics, and information science. The book is based on papers and books published by the authors on the representations of the Lorentz group based on harmonic oscillators and their applications to high-energy physics and to Wigner functions applicable to quantum optics. It also covers the two-by-two representations of the Lorentz group applicable to ray optics, including cavity, multilayer and lens optics, as well as representations of the Lorentz group applicable to Stokes parameters and the Poincaré sphere on polarization optics.

  17. Groups, graphs and random walks

    CERN Document Server

    Salvatori, Maura; Sava-Huss, Ecaterina

    2017-01-01

    An accessible and panoramic account of the theory of random walks on groups and graphs, stressing the strong connections of the theory with other branches of mathematics, including geometric and combinatorial group theory, potential analysis, and theoretical computer science. This volume brings together original surveys and research-expository papers from renowned and leading experts, many of whom spoke at the workshop 'Groups, Graphs and Random Walks' celebrating the sixtieth birthday of Wolfgang Woess in Cortona, Italy. Topics include: growth and amenability of groups; Schrödinger operators and symbolic dynamics; ergodic theorems; Thompson's group F; Poisson boundaries; probability theory on buildings and groups of Lie type; structure trees for edge cuts in networks; and mathematical crystallography. In what is currently a fast-growing area of mathematics, this book provides an up-to-date and valuable reference for both researchers and graduate students, from which future research activities will undoubted...

  18. Group identity and positive deviance in work groups.

    Science.gov (United States)

    Kim, Moon Joung; Choi, Jin Nam

    2017-12-05

    This study examines why and how identity cognitions, including group identification and individual differentiation, influence the positive deviance of employees. We identify the risk-taking intention of employees as a critical psychological mechanism to overcome stigma-induced identity threat of positive deviance. The analysis of data collected from 293 members comprising 66 work teams reveals that the relationship between individual differentiation and positive deviance is partially mediated by risk-taking intention. The indirect effect of group identification on positive deviance through risk-taking intention is also significant and positive in groups with low conformity pressure, whereas the same indirect effect is neutralized in groups with high conformity pressure. The current analysis offers new insights into the way the group context and the identity cognition of members explain the development of positive deviance and workplace creativity.

  19. Social Identity and Group Contests

    OpenAIRE

    Zaunbrecher, Henrik; Riedl, Arno

    2016-01-01

    Social identity has been shown to successfully enhance cooperation and effort in cooperation and coordination games. Little is known about the causal effect of social identity on the propensity to engage in group conflict. In this paper we explore theoretically and experimentally whether social identity increases investments in group contests. We show theoretically that increased social identity with the own group implies higher investments in Tullock contests. Empirically we find that induce...

  20. Designing for informed group formation

    DEFF Research Database (Denmark)

    Nicolajsen, Hanne Westh; Juel Jacobsen, Alice; Riis, Marianne

    2012-01-01

    A new design ―project preparation‖ preparing for the group formation in problem based project work is proposed and investigated. The main problem is to overcome group formation based on existing relations. The hypothesis is that theme development and group formation are somewhat counterproductive....... Following research based design methodology an experiment separating the two was initiated.This was to provide for more openness and creativity in contrast to a design in which existing relations seem predominant....

  1. Group decision-making: Factors that affect group effectiveness

    Directory of Open Access Journals (Sweden)

    Juliana Osmani

    2016-03-01

    Full Text Available Organizations are operating in a dynamic and turbulent environment. In these conditions, they have to make decisions for new problems or situations. Most of decisions are therefore non-programmed and unstructured, accompanied by risk and uncertainty. Moreover, the problems and situations are complex. All organizations are oriented towards group decisionmaking processes, as useful tools to cope with uncertainty and complexity. Apart from the necessity, companies are turning towards participatory processes also to benefit from the important advantages that these processes offer. Organizations have realized the importance of group decision-making processes to contribute to the creation of sustainable competitive advantages. Main objective of this paper is to show that group decision-making processes do not offer guarantee for good decisions, because the effectiveness of group is affected by many factors. So, the first thing done in this paper is discussing about the benefits and limitations that accompany the use of groups with decision-making purpose. Afterwards, we stop on the different factors that influence the group’s ability to make good decisions. The aim is to emphasize that regardless of the many advantages of groups, some factors as group size, type of communication within the group, leadership style, the norms, the differentiation of roles and statuses, cohesion and compliance degree should be the main elements to keep into consideration because they affect the effectiveness of group. In this regard, is discussed how such factors influence the quality of decision and then we try to draw some conclusions that can improve and make better and easier group decision-making processes.

  2. Strategic Groups and Banks’ Performance

    Directory of Open Access Journals (Sweden)

    Gregorz Halaj

    2009-06-01

    Full Text Available The theory of strategic groups predicts the existence of stable groups of companies that adopt similar business strategies. The theory also predicts that groups will differ in performance and in their reaction to external shocks. We use cluster analysis to identify strategic groups in the Polish banking sector. We find stable groups in the Polish banking sector constituted after the year 2000 following the major privatisation and ownership changes connected with transition to the mostly-privately-owned banking sector in the late 90s. Using panel regression methods we show that the allocation of banks to groups is statistically significant in explaining the profitability of banks. Thus, breaking down the banks into strategic groups and allowing for the different reaction of the groups to external shocks helps in a more accurate explanation of profits of the banking sector as a whole.Therefore, a more precise ex ante assessment of the loss absorption capabilities of banks is possible, which is crucial for an analysis of banking sector stability. However, we did not find evidence of the usefulness of strategic groups in explaining the quality of bank portfolios as measured by irregular loans over total loans, which is a more direct way to assess risks to financial stability.

  3. Structure of a supergravity group

    International Nuclear Information System (INIS)

    Ogievetsky, V.; Sokatchev, E.

    1978-01-01

    The supergravity group is found to be the direct product of general covariance groups in complex conjugated left and right handed superspaces. The ordinary space-time coordinate and the axial gravitational superfield are the real and imaginary parts of the complex coordinate, respectively. It is pointed out that a number of questions concerning the formalism remains open. For instance how to define superfields with external indices, supercovariant derivatives and invariants of the group, etc. However, the extremely simple and clear geometrical picture of the supergravity group given here will provide an adequate basis for the supergravity theory

  4. The formalism of Lie groups

    Energy Technology Data Exchange (ETDEWEB)

    Salam, A. [Imperial College of Science and Technology, London (United Kingdom)

    1963-01-15

    Throughout the history of quantum theory, a battle has raged between the amateurs and professional group theorists. The amateurs have maintained that everything one needs in the theory of groups can be discovered by the light of nature provided one knows how to multiply two matrices. In support of this claim, they of course, justifiably, point to the successes of that prince of amateurs in this field, Dirac, particularly with the spinor representations of the Lorentz group. As an amateur myself, I strongly believe in the truth of the non-professionalist creed. I think perhaps there is not much one has to learn in the way of methodology from the group theorists except caution. But this does not mean one should not be aware of the riches which have been amassed over the course of years particularly in that most highly developed of all mathematical disciplines - the theory of Lie groups. My lectures then are an amateur's attempt to gather some of the fascinating results for compact simple Lie groups which are likely to be of physical interest. I shall state theorems; and with a physicist's typical unconcern rarely, if ever, shall I prove these. Throughout, the emphasis will be to show the close similarity of these general groups with that most familiar of all groups, the group of rotations in three dimensions.

  5. Leadership in moving human groups.

    Directory of Open Access Journals (Sweden)

    Margarete Boos

    2014-04-01

    Full Text Available How is movement of individuals coordinated as a group? This is a fundamental question of social behaviour, encompassing phenomena such as bird flocking, fish schooling, and the innumerable activities in human groups that require people to synchronise their actions. We have developed an experimental paradigm, the HoneyComb computer-based multi-client game, to empirically investigate human movement coordination and leadership. Using economic games as a model, we set monetary incentives to motivate players on a virtual playfield to reach goals via players' movements. We asked whether (I humans coordinate their movements when information is limited to an individual group member's observation of adjacent group member motion, (II whether an informed group minority can lead an uninformed group majority to the minority's goal, and if so, (III how this minority exerts its influence. We showed that in a human group--on the basis of movement alone--a minority can successfully lead a majority. Minorities lead successfully when (a their members choose similar initial steps towards their goal field and (b they are among the first in the whole group to make a move. Using our approach, we empirically demonstrate that the rules of swarming behaviour apply to humans. Even complex human behaviour, such as leadership and directed group movement, follow simple rules that are based on visual perception of local movement.

  6. EDF Group - Annual Report 2013

    International Nuclear Information System (INIS)

    2014-01-01

    The EDF Group is emerging as a global leader in electricity and an industrial benchmark spanning the entire business from generation and networks to sales and marketing. The group is growing stronger and changing. A long-term vision and relentless determination to provide a modern public service underpin its robust business model. This document is EDF Group's annual report for the year 2013. It contains information about Group profile, governance, business, development strategy, sales and marketing, positions in Europe and international activities. The document comprises the Activity Report and the Sustainable Development Indicators

  7. Stick with your group: young children's attitudes about group loyalty.

    Science.gov (United States)

    Misch, Antonia; Over, Harriet; Carpenter, Malinda

    2014-10-01

    For adults, loyalty to the group is highly valued, yet little is known about how children evaluate loyalty. We investigated children's attitudes about loyalty in a third-party context. In the first experiment, 4- and 5-year-olds watched a video of two groups competing. Two members of the losing group then spoke. The disloyal individual said she wanted to win and therefore would join the other group. The loyal individual said she also wanted to win but would stay with her group. Children were then asked five forced-choice questions about these two individuals' niceness, trustworthiness, morality, and deservingness of a reward. The 5-year-olds preferred the loyal person across all questions; results for the 4-year-olds were considerably weaker but in the same direction. The second experiment investigated the direction of the effect in 5-year-olds. In this experiment, children answered questions about either a loyal individual, a disloyal individual, or a neutral individual. Children rated both the loyal and neutral individuals more positively than the disloyal individual across a number of measures. Thus, whereas disloyal behavior is evaluated unfavorably by children, loyal behavior is the expected norm. These results suggest that, at least from 5 years of age, children understand that belonging to a group entails certain commitments. This marks an important step in their own ability to negotiate belonging and become trustworthy and reliable members of their social groups. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Perceptual grouping and attention: not all groupings are equal.

    Science.gov (United States)

    Kimchi, Ruth; Razpurker-Apfeld, Irene

    2004-08-01

    We examined grouping under inattention using Driver, Davis, Russell, Turatto, & Freeman's (2001) method. On each trial, two successive displays were briefly presented, each comprising a central target square surrounded by elements. The task was to judge whether the two targets were the same or different. The organization of the background elements stayed the same or changed, independently of the targets. In different conditions, background elements grouped into columns/rows by color similarity, a shape (a triangle/arrow, a square/cross, or a vertical/horizontal line) by color similarity, and a shape with no other elements in the background. We measured the influence of the background on the target same-different judgments. The results imply that background elements grouped into columns/rows by color similarity and into a shape when no segregation from other elements was involved and the shape was relatively "good." In contrast, no background grouping was observed when resolving figure-ground relations for segregated units was required, as in grouping into a shape by color similarity. These results suggest that grouping is a multiplicity of processes that vary in their attentional demands. Regardless of attentional demands, the products of grouping are not available to awareness without attention.

  9. 2002 annual report EDF group; 2002 rapport annuel groupe EDF

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-07-01

    This document is the 2002 annual report of Electricite de France (EdF) group, the French electric utility. Content: Introductory section (EDF at a glance, Chairman's message, 2002 Highlights); Corporate governance and Group strategy (Corporate governance, sustainable growth strategy, EDF branches); Financial performance (Reaching critical mass, Margins holding up well, Balance sheet); Human resources (Launching Group-wide synergies, Optimising human resources); Customers (Major customers, SMEs and professional customers, Local authorities, Residential customers, Ensuring quality access to electricity); Generation (A balanced energy mix, Nuclear generation, Fossil-fuelled generation, Renewable energies); Corporate social responsibility (Global and local partnerships, Promoting community development)

  10. Energy Innovation. IVO Group`s Research and Development Report

    Energy Technology Data Exchange (ETDEWEB)

    Salminen, P.; Laiho, Y.; Kaikkonen, H.; Leisio, C.; Hinkkanen, S. [eds.

    1996-11-01

    This annual booklet of the IVO Group`s research and development activities presents a number of articles, written by experts from IVO. The products described are examples of the environmentally-oriented selection made available by the IVO Group. In fact, the entire energy technology developed in Finland is environmentally oriented, if seen from the international perspective. The new business potential of environmental technology is great, and it is believed that in the year 2000, exportation of Finnish know-how in the field of energy-saving and efficiency will exceed the value of out energy imports

  11. Energy Innovation. IVO group`s research and development report

    Energy Technology Data Exchange (ETDEWEB)

    Salminen, P.; Laiho, Y.; Kaikkonen, H.; Leisio, C.; Hinkkanen, S.; Fletcher, R. [eds.

    1997-11-01

    This annual booklet of the IVO Group`s research and development activities presents a number of articles, written by experts from IVO. The products described are examples of the environmentally-oriented selection made available by the IVO Group. In fact, the entire energy technology developed in Finland is environmentally oriented, if seen from the international perspective. The new business potential of environmental technology is great, and it is believed that in the year 2000, exportation of Finnish know-how in the field of energy-saving and efficiency will exceed the value of out energy imports

  12. 2002 annual report EDF group; 2002 rapport annuel groupe EDF

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-07-01

    This document is the 2002 annual report of Electricite de France (EdF) group, the French electric utility. Content: Introductory section (EDF at a glance, Chairman's message, 2002 Highlights); Corporate governance and Group strategy (Corporate governance, sustainable growth strategy, EDF branches); Financial performance (Reaching critical mass, Margins holding up well, Balance sheet); Human resources (Launching Group-wide synergies, Optimising human resources); Customers (Major customers, SMEs and professional customers, Local authorities, Residential customers, Ensuring quality access to electricity); Generation (A balanced energy mix, Nuclear generation, Fossil-fuelled generation, Renewable energies); Corporate social responsibility (Global and local partnerships, Promoting community development)

  13. Group Work with Transgender Clients

    Science.gov (United States)

    Dickey, Lore M.; Loewy, Michael I.

    2010-01-01

    Drawing on the existing literature, the authors' research and clinical experiences, and the first author's personal journey as a member and leader of the transgender community, this article offers a brief history of group work with transgender clients followed by suggestions for group work with transgender clients from a social justice…

  14. Evaluating groups in learning disabilities.

    Science.gov (United States)

    Chia, S H

    Groupwork can be effective in meeting a range of needs presented by students with profound learning disabilities. This article describes the process involved in setting up groups for these students, and includes examples of a group session and methods for evaluating groupwork.

  15. Opechowski's theorem and commutator groups

    International Nuclear Information System (INIS)

    Caride, A.O.; Zanette, S.I.

    1985-01-01

    It is shown that the conditions of application of Opechowski's theorem for double groups of subgroups of O(3) are directly associated to the structure of their commutator groups. Some characteristics of the structure of classes are also discussed. (Author) [pt

  16. Group Activities for Math Enthusiasts

    Science.gov (United States)

    Holdener, J.; Milnikel, R.

    2016-01-01

    In this article we present three group activities designed for math students: a balloon-twisting workshop, a group proof of the irrationality of p, and a game of Math Bingo. These activities have been particularly successful in building enthusiasm for mathematics and camaraderie among math faculty and students at Kenyon College.

  17. Challenges Facing Group Work Online

    Science.gov (United States)

    Chang, Bo; Kang, Haijun

    2016-01-01

    Online group work can be complicated because of its asynchronous characteristics and lack of physical presence, and its requirements for skills in handling technology, human relationships, and content-related tasks. This study focuses on the administrative, logistical and relationship-related challenges in online group work. Challenges in areas…

  18. Factorial representations of path groups

    International Nuclear Information System (INIS)

    Albeverio, S.; Hoegh-Krohn, R.; Testard, D.; Vershik, A.

    1983-11-01

    We give the reduction of the energy representation of the group of mappings from I = [ 0,1 ], S 1 , IRsub(+) or IR into a compact semi simple Lie group G. For G = SU(2) we prove the factoriality of the representation, which is of type III in the case I = IR

  19. Understanding Nomadic Collaborative Learning Groups

    Science.gov (United States)

    Ryberg, Thomas; Davidsen, Jacob; Hodgson, Vivien

    2018-01-01

    The paper builds on the work of Rossitto "et al." on collaborative nomadic work to develop three categories of practice of nomadic collaborative learning groups. Our study is based on interviews, workshops and observations of two undergraduate student's group practices engaged in self-organised, long-term collaborations within the frame…

  20. The Globalization of Cooperative Groups.

    Science.gov (United States)

    Valdivieso, Manuel; Corn, Benjamin W; Dancey, Janet E; Wickerham, D Lawrence; Horvath, L Elise; Perez, Edith A; Urton, Alison; Cronin, Walter M; Field, Erica; Lackey, Evonne; Blanke, Charles D

    2015-10-01

    The National Cancer Institute (NCI)-supported adult cooperative oncology research groups (now officially Network groups) have a longstanding history of participating in international collaborations throughout the world. Most frequently, the US-based cooperative groups work reciprocally with the Canadian national adult cancer clinical trial group, NCIC CTG (previously the National Cancer Institute of Canada Clinical Trials Group). Thus, Canada is the largest contributor to cooperative groups based in the United States, and vice versa. Although international collaborations have many benefits, they are most frequently utilized to enhance patient accrual to large phase III trials originating in the United States or Canada. Within the cooperative group setting, adequate attention has not been given to the study of cancers that are unique to countries outside the United States and Canada, such as those frequently associated with infections in Latin America, Asia, and Africa. Global collaborations are limited by a number of barriers, some of which are unique to the countries involved, while others are related to financial support and to US policies that restrict drug distribution outside the United States. This article serves to detail the cooperative group experience in international research and describe how international collaboration in cancer clinical trials is a promising and important area that requires greater consideration in the future. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. The Globalization of Cooperative Groups

    Science.gov (United States)

    Valdivieso, Manuel; Corn, Benjamin W.; Dancey, Janet E.; Wickerham, D. Lawrence; Horvath, L. Elise; Perez, Edith A.; Urton, Alison; Cronin, Walter M.; Field, Erica; Lackey, Evonne; Blanke, Charles D.

    2015-01-01

    The National Cancer Institute-supported adult cooperative oncology research groups (now officially Network groups) have a long-standing history of participating in international collaborations throughout the world. Most frequently, the U.S. based cooperative groups work reciprocally with the Canadian national adult cancer clinical trial group, NCIC CTG (previously the National Cancer Institute of Canada Clinical Trials Group). Thus, Canada is the largest contributor to cooperative groups based in the U.S., and vice versa. Although international collaborations have many benefits, they are most frequently utilized to enhance patient accrual to large phase III trials originating in the U.S. or Canada. Within the cooperative group setting, adequate attention has not been given to the study of cancers that are unique to countries outside the U.S. and Canada, such as those frequently associated with infections in Latin America, Asia and Africa. Global collaborations are limited by a number of barriers, some of which are unique to the countries involved, while others are related to financial support and to U.S. policies that restrict drug distribution outside the U.S. This manuscript serves to detail the cooperative group experience in international research and describe how international collaboration in cancer clinical trials is a promising and important area that requires greater consideration in the future. PMID:26433551

  2. Future of energy managers groups

    Energy Technology Data Exchange (ETDEWEB)

    Henshaw, T.

    1979-07-01

    The objectives of the Energy Managers Groups, formed to provide a regular opportunity for industry and commerce to exchange views and experiences on energy conservation matters are discussed. Group procedure, liaison and cooperation, government support, and options for the future are discussed. (MCW)

  3. Group theoretical methods in Physics

    International Nuclear Information System (INIS)

    Olmo, M.A. del; Santander, M.; Mateos Guilarte, J.M.

    1993-01-01

    The meeting had 102 papers. These was distributed in following areas: -Quantum groups,-Integrable systems,-Physical Applications of Group Theory,-Mathematical Results,-Geometry, Topology and Quantum Field Theory,-Super physics,-Super mathematics,-Atomic, Molecular and Condensed Matter Physics. Nuclear and Particle Physics,-Symmetry and Foundations of classical and Quantum mechanics

  4. Measuring group climate in prison

    NARCIS (Netherlands)

    Peer van der Helm PhD; P.H. van der Laan; G.J.J.M. Stams

    2011-01-01

    The present study examines the construct validity and reliability of the Prison Group Climate Instrument (PGCI) in a sample of 77 adolescents placed in a Dutch youth prison and 49 adult prisoners living in a Dutch psychiatric prison with a therapeutic living group structure. Confirmatory factor

  5. Factorizable sheaves and quantum groups

    CERN Document Server

    Bezrukavnikov, Roman; Schechtman, Vadim

    1998-01-01

    The book is devoted to the geometrical construction of the representations of Lusztig's small quantum groups at roots of unity. These representations are realized as some spaces of vanishing cycles of perverse sheaves over configuration spaces. As an application, the bundles of conformal blocks over the moduli spaces of curves are studied. The book is intended for specialists in group representations and algebraic geometry.

  6. Theory of super LIE groups

    International Nuclear Information System (INIS)

    Prakash, M.

    1985-01-01

    The theory of supergravity has attracted increasing attention in the recent years as a unified theory of elementary particle interactions. The superspace formulation of the theory is highly suggestive of an underlying geometrical structure of superspace. It also incorporates the beautifully geometrical general theory of relativity. It leads us to believe that a better understanding of its geometry would result in a better understanding of the theory itself, and furthermore, that the geometry of superspace would also have physical consequences. As a first step towards that goal, we develop here a theory of super Lie groups. These are groups that have the same relation to a super Lie algebra as Lie groups have to a Lie algebra. More precisely, a super Lie group is a super-manifold and a group such that the group operations are super-analytic. The super Lie algebra of a super Lie group is related to the local properties of the group near the identity. This work develops the algebraic and super-analytical tools necessary for our theory, including proofs of a set of existence and uniqueness theorems for a class of super-differential equations

  7. Group Counseling for Navy Children.

    Science.gov (United States)

    Mitchum, Nancy Taylor

    1991-01-01

    Conducted six-session group counseling program for Navy children (n=22) enrolled in public schools whose fathers were on deployment. Pretest and posttest scores on the Coopersmith Self-Esteem Inventory suggest that participation in the group counseling unit positively affected self-esteem of Navy children whose fathers were on deployment. Found…

  8. Theoretical Issues in Clinical Social Group Work.

    Science.gov (United States)

    Randall, Elizabeth; Wodarski, John S.

    1989-01-01

    Reviews relevant issues in clinical social group practice including group versus individual treatment, group work advantages, approach rationale, group conditions for change, worker role in group, group composition, group practice technique and method, time as group work dimension, pretherapy training, group therapy precautions, and group work…

  9. Deviance and dissent in groups.

    Science.gov (United States)

    Jetten, Jolanda; Hornsey, Matthew J

    2014-01-01

    Traditionally, group research has focused more on the motivations that make people conform than on the motivations and conditions underpinning deviance and dissent. This has led to a literature that focuses on the value that groups place on uniformity and paints a relatively dark picture of dissent and deviance: as reflections of a lack of group loyalty, as signs of disengagement, or as delinquent behavior. An alternative point of view, which has gained momentum in recent years, focuses on deviance and dissent as normal and healthy aspects of group life. In this review, we focus on the motivations that group members have to deviate and dissent, and the functional as well as the dysfunctional effects of deviance and dissent. In doing so we aim for a balanced and complete account of deviance and dissent, highlighting when such behaviors will be encouraged as well as when they will be punished.

  10. Understanding nomadic collaborative learning groups

    DEFF Research Database (Denmark)

    Ryberg, Thomas; Davidsen, Jacob; Hodgson, Vivien

    2018-01-01

    -term collaborations within the frame of Problem and Project Based Learning. By analysing the patterns of nomadic collaborative learning we identify and discuss how the two groups of students incorporate mobile and digital technologies as well as physical and/or non-digital technologies into their group work......The paper builds on the work of Rossitto et al. on collaborative nomadic work to develop three categories of practice of nomadic collaborative learning groups. Our study is based on interviews, workshops and observations of two undergraduate student's group practices engaged in self-organised, long....... Specifically, we identify the following categories of nomadic collaborative learning practices: “orchestration of work phases, spaces and activities,” “the orchestration of multiple technologies” and “orchestration of togetherness.” We found that for both groups of students there was a fluidity, situatedness...

  11. Stereotypes of Norwegian social groups.

    Science.gov (United States)

    Bye, Hege H; Herrebrøden, Henrik; Hjetland, Gunnhild J; Røyset, Guro Ø; Westby, Linda L

    2014-10-01

    We present a pilot study and two main studies that address the nature of stereotypes of social groups in Norway within the framework of the Stereotype Content Model (SCM). The first study focused on stereotypes of a wide range of groups across categories such as gender, age, religious conviction, socioeconomic and health status. The second study focused on stereotypes of immigrant groups. Participants (n = 244 and n = 63, respectively) rated the groups on perceived warmth, competence, status, and competition. Results from both studies support the applicability of the SCM in Norway and provides a unique insight into stereotypes of Norwegian social groups. © 2014 The Authors. Scandinavian Journal of Psychology published by Scandinavian Psychological Associations and John Wiley & Sons Ltd.

  12. Group Music Therapy for Prisoners

    DEFF Research Database (Denmark)

    Chen, Xi Jing; Hannibal, Niels; Xu, Kevin

    2014-01-01

    The prevalence of psychological problems is high in prisons. Many prisoners have unmet needs for appropriate treatments. Although previous studies have suggested music therapy to be a successful treatment modality for prisoners, more rigorous evidence is needed. This parallel randomised controlled...... study aims to investigate the effectiveness of group music therapy to reduce anxiety and depression, and raise self-esteem in prisoners. One hundred and ninety two inmates from a Chinese prison will be allocated to two groups through randomisation. The experimental group will participate in biweekly...... group music therapy for 10 weeks (20 sessions) while the control group will be placed on a waitlist. Anxiety, depression and self-esteem will be measured by self-report scales three times: before, at the middle, and at the end of the intervention. Logs by the participants and their daily routine...

  13. Groups and Geometries : Siena Conference

    CERN Document Server

    Kantor, William; Lunardon, Guglielmo; Pasini, Antonio; Tamburini, Maria

    1998-01-01

    On September 1-7, 1996 a conference on Groups and Geometries took place in lovely Siena, Italy. It brought together experts and interested mathematicians from numerous countries. The scientific program centered around invited exposi­ tory lectures; there also were shorter research announcements, including talks by younger researchers. The conference concerned a broad range of topics in group theory and geometry, with emphasis on recent results and open problems. Special attention was drawn to the interplay between group-theoretic methods and geometric and combinatorial ones. Expanded versions of many of the talks appear in these Proceedings. This volume is intended to provide a stimulating collection of themes for a broad range of algebraists and geometers. Among those themes, represented within the conference or these Proceedings, are aspects of the following: 1. the classification of finite simple groups, 2. the structure and properties of groups of Lie type over finite and algebraically closed fields of f...

  14. Group as social microcosm: Within-group interpersonal style is congruent with outside group relational tendencies.

    Science.gov (United States)

    Goldberg, Simon B; Hoyt, William T

    2015-06-01

    The notion that individuals' interpersonal behaviors in the context of therapy reflects their interpersonal behaviors outside of therapy is a fundamental hypothesis underlying numerous systems of psychotherapy. The social microcosm hypothesis, in particular, claims the interpersonal therapy group becomes a reflection of group members' general tendencies, and can thus be used as information about members' interpersonal functioning as well as an opportunity for learning and behavior change. The current study tested this hypothesis using data drawn from 207 individuals participating in 22 interpersonal process groups. Ratings were made on 2 key interpersonal domains (Dominance and Affiliation) at baseline and at Weeks 2, 5, and 8 of the group. Two-level multilevel models (with participants nested within groups) were used to account for the hierarchical structure, and the social relations model (SRM; Kenny, 1994) was used to estimate peer ratings (target effects in SRM) unconfounded with rater bias. Participants showed consensus at all time points during the interpersonal process groups on one another's levels of dominance and affiliation. In addition, self- and peer ratings were stable across time and correlated with one another. Importantly, self-ratings made prior to group significantly predicted ratings (self- and peer) made within the group, with effect sizes within the medium range. Taken together, these results provide robust support for the social microcosm hypothesis and the conjecture that interpersonal style within-group therapy is reflective of broader interpersonal tendencies. (c) 2015 APA, all rights reserved).

  15. Dealer Group or Financial Planning Group? A Brief Technical Note

    Directory of Open Access Journals (Sweden)

    Lujer Santacruz

    2011-06-01

    Full Text Available This technical note examines whether the industry practice of using the term dealer group when referring to afinancial planning group contributes to the general perception that financial advisers are not objective whenmaking financial product recommendations. An experimental design carried out through an online survey isused. This is supplemented by a direct comparison survey on the two terminologies. The results provide acase for the industry to adopt a new terminology.

  16. EDF group - annual report 2003; Groupe EDF - rapport annuel 2003

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2004-07-01

    This document contains the magazine, the financial statements and the sustainable development report of Electricite de France (EdF) group for 2003: 1 - the magazine (chairman's statement, group profile, vision and strategy); 2 - the consolidated financial statements for the period ended 31 December 2003 (statutory auditors' report on the consolidated financial statements, EDF's summary annual financial statements); 3 - sustainable development report (transparency and dialogue, responsibility, commitment, partnerships for progress). (J.S.)

  17. EDF group - annual report 2003; Groupe EDF - rapport annuel 2003

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2004-07-01

    This document contains the magazine, the financial statements and the sustainable development report of Electricite de France (EdF) group for 2003: 1 - the magazine (chairman's statement, group profile, vision and strategy); 2 - the consolidated financial statements for the period ended 31 December 2003 (statutory auditors' report on the consolidated financial statements, EDF's summary annual financial statements); 3 - sustainable development report (transparency and dialogue, responsibility, commitment, partnerships for progress). (J.S.)

  18. Group theory approach to scattering

    International Nuclear Information System (INIS)

    Wu, J.

    1985-01-01

    For certain physical systems, there exists a dynamical group which contains the operators connecting states with the same energy but belonging to potentials with different strengths. This group is called the potential group of that system. The SO(2,1) potential groups structure is introduced to describe physical systems with mixed spectra, such as Morse and Poeschl-teller potentials. The discrete spectrum describes bound states and the continuous spectrum describes bound states and the continuous spectrum describes scattering states. A solvable class of one-dimensional potentials given by Natanzon belongs to this structure with an SO(2,2) potential group. The potential group structure provides us with an algebraic procedure generating the recursion relations for the scattering matrix, which can be formulated in a purely algebraic fashion, divorced from any differential realization. This procedure, when applied to the three-dimensional scattering problem with SO(3,1) symmetry, generates the scattering matrix of the Coulomb problem. Preliminary phenomenological models for elastic scattering in a heavy-ion collision are constructed on the basis. The results obtained here can be regarded as an important extension of the group theory techniques to scattering problems similar to that developed for bound state problems

  19. EDF group - Reference Document 2005

    International Nuclear Information System (INIS)

    2006-01-01

    The EDF Group is an integrated energy supplier operating in a wide range of electricity-related businesses: generation, transmission, distribution, sale and trading of energy. It is the main operator in the French electricity market and one of the leading electricity groups in Europe. With an installed capacity of 130.8 GW (123.9 GW in Europe), it contributes to the supply of energy and services to more than 40 million customers throughout the world (with approximately 36.7 million customers in Europe, more than 28 million of whom are in France). The EDF Group has built a business model balanced between deregulated and regulated operations in France and an international presence. In 2005, the Group recorded consolidated sales of euros 51,051 million, net income (Group share) of euros 3,242 million, and it achieved earnings before interests, taxes, depreciation and amortization of euros 13,010 million. This document is EDF Group's Reference Document for the year 2005. It contains information about: the Group activities, risk factors, Business Overview, Organizational Structure, Property, Plants and Equipment, Operating and Financial Review, Capital Resources, Research and Development, Patents and Licences, Trend Information, Financial Prospects, Administrative, Management, and Supervisory Bodies and Senior Management, Remuneration and Benefits, Board Practices, Employees/Human Resources, Major Shareholders, Related Party Transactions, Financial Information Concerning the Company's Assets and Liabilities, Financial Position and Profits and Losses, Material Contracts, Information on Holdings etc

  20. EDF group - Reference Document 2004

    International Nuclear Information System (INIS)

    2005-01-01

    The EDF Group is an integrated energy supplier operating in a wide range of electricity-related businesses: generation, transmission, distribution, sale and trading of energy. It is the main operator in the French electricity market and one of the leading electricity groups in Europe. With an installed capacity of 125,4 GW, it contributes to the supply of energy and services to more than 42 million customers throughout the world (with approximately 36 million customers in Europe, more than 28 million of whom are in France). The EDF Group has built a business model balanced between deregulated and regulated operations in France and an international presence. In 2004, the Group recorded consolidated sales of euros 46,928 million, net income (Group share) of euros 1,341 million, and it achieved earnings before interests, taxes, depreciation and amortization of euros 12,127 million. This document is EDF Group's Reference Document for the year 2004. It contains information about: the Group activities, capital, relations with Gaz de France utility, strategy, industrial environment, history, activity in France, international activity, transverse activities and functions, disputes, arbitration and risk factors, Property, Plants and Equipment, Operating and Financial Review, Administrative, Management, and Supervisory Bodies and Senior Management, Remuneration and Benefits, recent trends and perspectives

  1. EDF group - Reference Document 2006

    International Nuclear Information System (INIS)

    2007-01-01

    The EDF Group is an integrated energy supplier operating in a wide range of electricity-related businesses: generation, transmission, distribution, sale and trading of energy. It is the main operator in the French electricity market and holds strong positions in the other three principal European markets (Germany, the United Kingdom, Italy) making it one of the leading electricity groups in Europe, and a recognized actor in the gas market. With an installed capacity of 123.7 GW in Europe (128.2 GW worldwide) it holds, among the major European energy specialists, the largest production fleet and the one emitting the least CO 2 , owing to the share of nuclear technology and hydropower in its generation mix. The EDF group supplies electricity, gas and associated services to more than 37.8 million customers throughout the world and in Europe (more than 28 million of whom are in France). The EDF Group has built a business model balanced between France and the international markets, and between deregulated and regulated operations. In 2006, the Group recorded consolidated sales of euros 58,932 million, net income (Group share) of euros 5,605 million, and it achieved earnings before interest, taxes, depreciation and amortization of euros 13,930 million. From July 1, 2007, the EDF group will carry out its trading activities in a European energy market fully open to competition. This document is EDF Group's Reference Document for the year 2006. It contains information about: the Group activities, risk factors, Business overview, Organizational structure, Property, plants and equipment, Operating and financial review, Capital resources and cash flows, Research and Development, Patents and Licenses, Trend information, Financial forecasts or estimates, Administrative, management and supervisory bodies and senior management, Remuneration and benefits, Board practices, Employees/Human resources, Major shareholders, Related party transactions, Financial information

  2. Group theory and its applications

    CERN Document Server

    Loebl, Ernest M

    1975-01-01

    Group Theory and its Applications, Volume III covers the two broad areas of applications of group theory, namely, all atomic and molecular phenomena, as well as all aspects of nuclear structure and elementary particle theory.This volume contains five chapters and begins with an introduction to Wedderburn's theory to establish the structure of semisimple algebras, algebras of quantum mechanical interest, and group algebras. The succeeding chapter deals with Dynkin's theory for the embedding of semisimple complex Lie algebras in semisimple complex Lie algebras. These topics are followed by a rev

  3. Group B streptococcal metastatic endophthalmitis.

    Science.gov (United States)

    Nagelberg, H P; Petashnick, D E; To, K W; Woodcome, H A

    1994-04-15

    Reports of invasive Group B Streptococcus infection in adults with underlying medical conditions have been increasing. Ocular infection with this organism is unusual. Metastatic endophthalmitis in adults caused by this organism has been reported rarely and has only been associated with endocarditis. We encountered two cases of Group B streptococcal metastatic endophthalmitis in adults who did not have endocarditis. These cases reflect the increasing incidence of invasive Group B Streptococcus infection with its varying manifestations. Additionally, they emphasize the importance of considering this pathogen as a cause of metastatic endophthalmitis in adults with predisposing illnesses.

  4. Renormalization group in modern physics

    International Nuclear Information System (INIS)

    Shirkov, D.V.

    1988-01-01

    Renormalization groups used in diverse fields of theoretical physics are considered. The discussion is based upon functional formulation of group transformations. This attitude enables development of a general method by using the notion of functional self-similarity which generalizes the usual self-similarity connected with power similarity laws. From this point of view the authors present a simple derivation of the renorm-group (RG) in QFT liberated from ultra-violet divergences philosophy, discuss the RG approach in other fields of physics and compare different RG's

  5. Geometry, rigidity, and group actions

    CERN Document Server

    Farb, Benson; Zimmer, Robert J

    2011-01-01

    The study of group actions is more than a hundred years old but remains to this day a vibrant and widely studied topic in a variety of mathematic fields. A central development in the last fifty years is the phenomenon of rigidity, whereby one can classify actions of certain groups, such as lattices in semi-simple Lie groups. This provides a way to classify all possible symmetries of important spaces and all spaces admitting given symmetries. Paradigmatic results can be found in the seminal work of George Mostow, Gergory Margulis, and Robert J. Zimmer, among others.The p

  6. 2002 annual report EDF group

    International Nuclear Information System (INIS)

    2002-01-01

    This document is the 2002 annual report of Electricite de France (EdF) group, the French electric utility. Content: Introductory section (EDF at a glance, Chairman's message, 2002 Highlights); Corporate governance and Group strategy (Corporate governance, sustainable growth strategy, EDF branches); Financial performance (Reaching critical mass, Margins holding up well, Balance sheet); Human resources (Launching Group-wide synergies, Optimising human resources); Customers (Major customers, SMEs and professional customers, Local authorities, Residential customers, Ensuring quality access to electricity); Generation (A balanced energy mix, Nuclear generation, Fossil-fuelled generation, Renewable energies); Corporate social responsibility (Global and local partnerships, Promoting community development)

  7. Derived equivalences for group rings

    CERN Document Server

    König, Steffen

    1998-01-01

    A self-contained introduction is given to J. Rickard's Morita theory for derived module categories and its recent applications in representation theory of finite groups. In particular, Broué's conjecture is discussed, giving a structural explanation for relations between the p-modular character table of a finite group and that of its "p-local structure". The book is addressed to researchers or graduate students and can serve as material for a seminar. It surveys the current state of the field, and it also provides a "user's guide" to derived equivalences and tilting complexes. Results and proofs are presented in the generality needed for group theoretic applications.

  8. The Cogema group in Japan

    International Nuclear Information System (INIS)

    1998-12-01

    The partnership between the Cogema group and Japan in the domain of fuel cycle started about 20 years ago and the 10 Japanese nuclear operators are all clients of the Cogema group. The 1997 turnover realized with Japan reached 3.6 billions of francs (11% of the total turnover of the group). This short paper presents briefly the nuclear program of Japan (nuclear park, spent fuels reprocessing-recycling strategy) and the contracts between Cogema and the Japanese nuclear operators (natural uranium, uranium conversion and enrichment, spent fuel reprocessing, plutonium recycle and MOX fuel production markets). (J.S.)

  9. The Group Treatment of Bulimia.

    Science.gov (United States)

    Weinstein, Harvey M.; Richman, Ann

    1984-01-01

    Bulimia has become an increasing problem in the college population. This article describes a group psychotherapeutic treatment approach to the problem. A theoretical formulation of the psychodynamics that may underlie the development of bulimia is offered. (Author/DF)

  10. Metabolomics and Epidemiology Working Group

    Science.gov (United States)

    The Metabolomics and Epidemiology (MetEpi) Working Group promotes metabolomics analyses in population-based studies, as well as advancement in the field of metabolomics for broader biomedical and public health research.

  11. The theory of nilpotent groups

    CERN Document Server

    Clement, Anthony E; Zyman, Marcos

    2017-01-01

    This monograph presents both classical and recent results in the theory of nilpotent groups and provides a self-contained, comprehensive reference on the topic.  While the theorems and proofs included can be found throughout the existing literature, this is the first book to collect them in a single volume.  Details omitted from the original sources, along with additional computations and explanations, have been added to foster a stronger understanding of the theory of nilpotent groups and the techniques commonly used to study them.  Topics discussed include collection processes, normal forms and embeddings, isolators, extraction of roots, P-localization, dimension subgroups and Lie algebras, decision problems, and nilpotent groups of automorphisms.  Requiring only a strong undergraduate or beginning graduate background in algebra, graduate students and researchers in mathematics will find The Theory of Nilpotent Groups to be a valuable resource.

  12. Finite flavour groups of fermions

    International Nuclear Information System (INIS)

    Grimus, Walter; Ludl, Patrick Otto

    2012-01-01

    We present an overview of the theory of finite groups, with regard to their application as flavour symmetries in particle physics. In a general part, we discuss useful theorems concerning group structure, conjugacy classes, representations and character tables. In a specialized part, we attempt to give a fairly comprehensive review of finite subgroups of SO(3) and SU(3), in which we apply and illustrate the general theory. Moreover, we also provide a concise description of the symmetric and alternating groups and comment on the relationship between finite subgroups of U(3) and finite subgroups of SU(3). Although in this review we give a detailed description of a wide range of finite groups, the main focus is on the methods which allow the exploration of their different aspects. (topical review)

  13. On characters of finite groups

    CERN Document Server

    Broué, Michel

    2017-01-01

    This book explores the classical and beautiful character theory of finite groups. It does it by using some rudiments of the language of categories. Originally emerging from two courses offered at Peking University (PKU), primarily for third-year students, it is now better suited for graduate courses, and provides broader coverage than books that focus almost exclusively on groups. The book presents the basic tools, notions and theorems of character theory (including a new treatment of the control of fusion and isometries), and introduces readers to the categorical language at several levels. It includes and proves the major results on characteristic zero representations without any assumptions about the base field. The book includes a dedicated chapter on graded representations and applications of polynomial invariants of finite groups, and its closing chapter addresses the more recent notion of the Drinfeld double of a finite group and the corresponding representation of GL_2(Z).

  14. Working group report: Quantum chromodynamics

    Indian Academy of Sciences (India)

    3NIKHEF Theory Group, Kruislaan 409, 1098 SJ Amsterdam, The Netherlands. 4Harish-Chandra Research Institute, Chhatnag Road, Jhusi, Allahabad 211 ... tant to extend the resummation framework to polarised process to look at polarised.

  15. Group Work with Juvenile Delinquents.

    Science.gov (United States)

    Zimpfer, David G.

    1992-01-01

    Reviews group work literature on juvenile delinquents. Presents overview of interventions, including positive peer culture, cognitive-behavioral treatment, psychoeducational treatment, treatment of learned behavior, action-oriented treatment, milieu therapy, parental involvement, assertiveness training, and music therapy. Discusses outcome…

  16. Remainder Wheels and Group Theory

    Science.gov (United States)

    Brenton, Lawrence

    2008-01-01

    Why should prospective elementary and high school teachers study group theory in college? This paper examines applications of abstract algebra to the familiar algorithm for converting fractions to repeating decimals, revealing ideas of surprising substance beneath an innocent facade.

  17. Group Empowerment in Nursing Education.

    Science.gov (United States)

    Friend, Mary Louanne

    2015-12-01

    Nursing education is experiencing rapid changes, as nurses are expected to transform and lead health care delivery within the United States. The ability to produce exceptional graduates requires faculty who are empowered to achieve goals. The Sieloff-King Assessment of Group Empowerment Within Organizations (SKAGEO) was adapted and administered online to a stratified sample of administrators and faculty in American Association of Colleges of Nursing-member schools. Participants' scores were within high ranges in both empowerment capacity and capability; however, administrator group scores were higher. Data analyses indicated that administrator leadership competencies were associated with group empowerment. This study suggests that empowered faculty and administrator groups anticipate changing health care trends and effect student outcomes and competencies by their interventions. Also, it can be inferred that as a result of administrators' competencies, participants teach in empowered work environments where they can model ideal behaviors. Copyright 2015, SLACK Incorporated.

  18. Genodermatoses in paediatric age group

    Directory of Open Access Journals (Sweden)

    Kumar Sunil

    1996-01-01

    Full Text Available Pattern of genodermatoses in paediatric age group was studied. The relative incidence of genodermatoses in paediatric dermatology out patient department was 0.62%. The commonest genodermatoses observed was ichthyosis.

  19. Linear algebra and group theory

    CERN Document Server

    Smirnov, VI

    2011-01-01

    This accessible text by a Soviet mathematician features material not otherwise available to English-language readers. Its three-part treatment covers determinants and systems of equations, matrix theory, and group theory. 1961 edition.

  20. Report of Industry Panel Group

    Science.gov (United States)

    Gallimore, Simon; Gier, Jochen; Heitland, Greg; Povinelli, Louis; Sharma, Om; VandeWall, Allen

    2006-01-01

    A final report is presented from the industry panel group. The contents include: 1) General comments; 2) Positive progress since Minnowbrook IV; 3) Industry panel outcome; 4) Prioritized turbine projects; 5) Prioritized compressor projects; and 6) Miscellaneous.

  1. Medicaid Enrollment - New Adult Group

    Data.gov (United States)

    U.S. Department of Health & Human Services — Total Medicaid Enrollees - VIII Group Break Out Report Reported on the CMS-64 The enrollment information is a state-reported count of unduplicated individuals...

  2. Climate change and group dynamics

    NARCIS (Netherlands)

    Postmes, Tom

    2015-01-01

    The characteristics and views of people sceptical about climate change have been analysed extensively. A study now confirms that sceptics in the US have some characteristics of a social movement, but shows that the same group dynamics propel believers

  3. Essays in the history of Lie groups and algebraic groups

    CERN Document Server

    Borel, Armand

    2001-01-01

    Lie groups and algebraic groups are important in many major areas of mathematics and mathematical physics. We find them in diverse roles, notably as groups of automorphisms of geometric structures, as symmetries of differential systems, or as basic tools in the theory of automorphic forms. The author looks at their development, highlighting the evolution from the almost purely local theory at the start to the global theory that we know today. Starting from Lie's theory of local analytic transformation groups and early work on Lie algebras, he follows the process of globalization in its two main frameworks: differential geometry and topology on one hand, algebraic geometry on the other. Chapters II to IV are devoted to the former, Chapters V to VIII, to the latter. The essays in the first part of the book survey various proofs of the full reducibility of linear representations of \\mathbf{SL}_2{(\\mathbb{C})}, the contributions of H. Weyl to representations and invariant theory for semisimple Lie groups, and con...

  4. A Renormalisation Group Method. V. A Single Renormalisation Group Step

    Science.gov (United States)

    Brydges, David C.; Slade, Gordon

    2015-05-01

    This paper is the fifth in a series devoted to the development of a rigorous renormalisation group method applicable to lattice field theories containing boson and/or fermion fields, and comprises the core of the method. In the renormalisation group method, increasingly large scales are studied in a progressive manner, with an interaction parametrised by a field polynomial which evolves with the scale under the renormalisation group map. In our context, the progressive analysis is performed via a finite-range covariance decomposition. Perturbative calculations are used to track the flow of the coupling constants of the evolving polynomial, but on their own perturbative calculations are insufficient to control error terms and to obtain mathematically rigorous results. In this paper, we define an additional non-perturbative coordinate, which together with the flow of coupling constants defines the complete evolution of the renormalisation group map. We specify conditions under which the non-perturbative coordinate is contractive under a single renormalisation group step. Our framework is essentially combinatorial, but its implementation relies on analytic results developed earlier in the series of papers. The results of this paper are applied elsewhere to analyse the critical behaviour of the 4-dimensional continuous-time weakly self-avoiding walk and of the 4-dimensional -component model. In particular, the existence of a logarithmic correction to mean-field scaling for the susceptibility can be proved for both models, together with other facts about critical exponents and critical behaviour.

  5. LLNL Chemical Kinetics Modeling Group

    Energy Technology Data Exchange (ETDEWEB)

    Pitz, W J; Westbrook, C K; Mehl, M; Herbinet, O; Curran, H J; Silke, E J

    2008-09-24

    The LLNL chemical kinetics modeling group has been responsible for much progress in the development of chemical kinetic models for practical fuels. The group began its work in the early 1970s, developing chemical kinetic models for methane, ethane, ethanol and halogenated inhibitors. Most recently, it has been developing chemical kinetic models for large n-alkanes, cycloalkanes, hexenes, and large methyl esters. These component models are needed to represent gasoline, diesel, jet, and oil-sand-derived fuels.

  6. EDF group - annual report 2003

    International Nuclear Information System (INIS)

    2004-01-01

    This document contains the magazine, the financial statements and the sustainable development report of Electricite de France (EdF) group for 2003: 1 - the magazine (chairman's statement, group profile, vision and strategy); 2 - the consolidated financial statements for the period ended 31 December 2003 (statutory auditors' report on the consolidated financial statements, EDF's summary annual financial statements); 3 - sustainable development report (transparency and dialogue, responsibility, commitment, partnerships for progress). (J.S.)

  7. CEC natural analogue working group

    International Nuclear Information System (INIS)

    Come, B.; Chapman, N.A.

    1986-01-01

    The second meeting of the CEC Natural Analogue Working Group took place on June 17-19, 1986, hosted by the Swiss NAGRA in Interlaken (CH). A review of recent progress in natural analogue programmes was carried out, and complemented by detailed discussions about geomicrobiology, archaeological analogues, natural colloids, and use of analogues to increase confidence in safety assessments for radioactive waste disposal. A statement drafted by the Group, and the presentations made, are put together in this report

  8. Molecular invariants: atomic group valence

    International Nuclear Information System (INIS)

    Mundim, K.C.; Giambiagi, M.; Giambiagi, M.S. de.

    1988-01-01

    Molecular invariants may be deduced in a very compact way through Grassman algebra. In this work, a generalized valence is defined for an atomic group; it reduces to the Known expressions for the case of an atom in a molecule. It is the same of the correlations between the fluctions of the atomic charges qc and qd (C belongs to the group and D does not) around their average values. Numerical results agree with chemical expectation. (author) [pt

  9. Direct Bandgap Group IV Materials

    Science.gov (United States)

    2016-01-21

    AFRL-AFOSR-JP-TR-2017-0049 Direct Bandgap group IV Materials Hung Hsiang Cheng NATIONAL TAIWAN UNIVERSITY Final Report 01/21/2016 DISTRIBUTION A...NAME(S) AND ADDRESS(ES) NATIONAL TAIWAN UNIVERSITY 1 ROOSEVELT RD. SEC. 4 TAIPEI CITY, 10617 TW 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING...14. ABSTRACT Direct bandgap group IV materials have been long sought for in both academia and industry for the implementation of photonic devices

  10. Fifteenth LAMPF users group meeting

    International Nuclear Information System (INIS)

    Cochran, D.R.F.

    1982-03-01

    The Fifteenth LAMPF Users Group Meeting was held November 2-3, 1981 at the Clinton P. Anderson Meson Physical Facility. The program of papers scheduled to be presented was amended to include a Report from Washington by Clarence R. Richardson, US Department of Energy. The general meeting ended with a round-table working group discussion concerning the Planning for a Kaon Factory. Individual items from the meeting were prepared separately for the data base

  11. EDF Group - Annual Report 2012

    International Nuclear Information System (INIS)

    2013-01-01

    The EDF Group is one of the world's leading energy companies, active in all areas from generation to trading and network management. It has a sound business model, evenly balanced between regulated and deregulated activities. With its first-rate human resources, R and D capability, expertise in engineering and operating generation plants and networks, as well as its energy eco-efficiency offers, the Group delivers competitive solutions that help ensure sustainable economic development and climate protection. The EDF Group is the leader in the French and UK electricity markets and has solid positions in Italy and numerous other European countries, as well as industrial operations in Asia and the United States. Everywhere it operates, the Group is a model of quality public service for the energy sector. This document is EDF Group's annual report for the year 2012. It contains information about Group profile, governance, business, development strategy, sales and marketing, positions in Europe and international activities. The document is made of several reports: the Activity and Sustainable Development Report, the Financial Report, the 'EDF at a glance' report, and the Sustainable Development Indicators

  12. EDF Group - Annual Report 2009

    International Nuclear Information System (INIS)

    2010-01-01

    The EDF Group is a leading player in the energy industry, active in all areas of the electricity value chain, from generation to trading and network management, with expanding operations in the natural gas chain. It has a sound business model, evenly balanced between regulated and deregulated activities. The EDF Group is the leader in the French and British electricity markets and has solid positions in Germany and Italy and numerous other European countries, as well as industrial operations in Asia and the United States. Everywhere it operates, the EDF Group is a model of quality public service for the energy sector. With fi rst-rate human resources, R and D capability and generation expertise in nuclear, fossil-fired and renewable energies, particularly hydro, together with energy eco-efficiency offers, the EDF Group delivers competitive solutions that help ensure sustainable economic development and climate protection. This document is EDF Group's annual report for the year 2009. It contains information about Group profile, governance, business, development strategy, sales and marketing, positions in Europe and international activities. The document is made of several reports: the Activity and Sustainable Development Report, the Financial Report, the Management Report, the Report by the Chairman of EDF Board of Directors on corporate governance and internal control procedures, the Milestones report, the 'EDF at a glance' report, and the Sustainable Development Indicators

  13. Vaccination against group B streptococcus.

    Science.gov (United States)

    Heath, Paul T; Feldman, Robert G

    2005-04-01

    Streptococcus agalactiae (Group B streptococcus) is an important cause of disease in infants, pregnant women, the elderly and in immunosuppressed adults. An effective vaccine is likely to prevent the majority of infant disease (both early and late onset), as well as Group B streptococcus-related stillbirths and prematurity, to avoid the current real and theoretical limitations of intrapartum antibiotic prophylaxis, and to be cost effective. The optimal time to administer such a vaccine would be in the third trimester of pregnancy. The main limitations on the production of a Group B streptococcus vaccine are not technical or scientific, but regulatory and legal. A number of candidates including capsular conjugate vaccines using traditional carrier proteins such as tetanus toxoid and mutant diphtheria toxin CRM197, as well as Group B streptococcus-specific proteins such as C5a peptidase, protein vaccines using one or more Group B streptococcus surface proteins and mucosal vaccines, have the potential to be successful vaccines. The capsular conjugate vaccines using tetanus and CRM197 carrier proteins are the most advanced candidates, having already completed Phase II human studies including use in the target population of pregnant women (tetanus toxoid conjugate), however, no definitive protein conjugates have yet been trialed. However, unless the regulatory environment is changed specifically to allow the development of a Group B streptococcus vaccine, it is unlikely that one will ever reach the market.

  14. EDF Group - Annual Report 2010

    International Nuclear Information System (INIS)

    2011-01-01

    The EDF Group is one of the world's leading energy companies, active in all areas from generation to trading and network management. It has a sound business model, evenly balanced between regulated and deregulated activities. With its first-rate human resources, R and D capability, expertise in engineering and operating generation plants and networks, as well as its energy eco-efficiency offers, the Group delivers competitive solutions that help ensure sustainable economic development and climate protection. The EDF Group is the leader in the French and UK electricity markets and has solid positions in Italy and numerous other European countries, as well as industrial operations in Asia and the United States. Everywhere it operates, the Group is a model of quality public service for the energy sector. This document is EDF Group's annual report for the year 2010. It contains information about Group profile, governance, business, development strategy, sales and marketing, positions in Europe and international activities. The document is made of several reports: the Activity and Sustainable Development Report, the Financial Report, the Management Report, the Report by the Chairman of EDF Board of Directors on corporate governance and internal control procedures, the Milestones report, the 'EDF at a glance' report, and the Sustainable Development Indicators

  15. Applications of blood group genotyping

    Directory of Open Access Journals (Sweden)

    Mariza A. Mota

    2006-03-01

    Full Text Available Introduction: The determination of blood group polymorphism atthe genomic level facilitates the resolution of clinical problemsthat cannot be addressed by hemagglutination. They are useful to(a determine antigen types for which currently available antibodiesare weakly reactive; (b type patients who have been recentlytransfused; (c identify fetuses at risk for hemolytic disease of thenewborn; and (d to increase the reliability of repositories of antigennegative RBCs for transfusion. Objectives: This review assessedthe current applications of blood group genotyping in transfusionmedicine and hemolytic disease of the newborn. Search strategy:Blood group genotyping studies and reviews were searched ingeneral database (MEDLINE and references were reviewed.Selection criteria: All published data and reviews were eligible forinclusion provided they reported results for molecular basis ofblood group antigens, DNA analysis for blood group polymorphisms,determination of fetal group status and applications of blood groupgenotyping in blood transfusion. Data collection: All data werecollected based on studies and reviews of blood grouppolymorphisms and their clinical applications.

  16. Dynamics of small groups of galaxies. I. Virialized groups

    International Nuclear Information System (INIS)

    Mamon, G.A.; New York Univ., NY)

    1987-01-01

    The dynamical evolution of small groups of galaxies from an initial virial equilibrium state is investigated by means of numerical simulations. The basic scheme is a gravitational N-body code in which galaxies and diffuse background are treated as single particles with both external parameters and internal structure; collisional and tidal stripping, dynamical friction, mergers, and orbital braking are taken into account. The results are presented in extensive tables and graphs and characterized in detail. Eight-galaxy groups with surface densities like those of compact groups (as defined by Hickson, 1982) are found to be unstable to rapid mergers after 1/30 to 1/8 Hubble time. The effects of dark-matter distribution (in galactic halos or in a common intergalactic background) are considered. 79 references

  17. Group Milieu in systemic and psychodynamic group therapy

    DEFF Research Database (Denmark)

    Lau, Marianne Engelbrecht

    Objectives: A recent meta-analysis also concluded that psychotherapeutic approaches are beneficial for adult with a history of CSA and maintained for at least six months follow-up. The results suggest that different characteristics of therapy moderate the therapeutic outcome. We found in a random......Objectives: A recent meta-analysis also concluded that psychotherapeutic approaches are beneficial for adult with a history of CSA and maintained for at least six months follow-up. The results suggest that different characteristics of therapy moderate the therapeutic outcome. We found....... Methods: This randomized prospective study included 106 women: 52 assigned to psychodynamic group psychotherapy and 54 assigned to systemic group psychotherapy. The Group Environment Scale (GES) was filled in the mid phase of therapy and analysed in three dimensions and 10 subscales. Results: The systemic...... subscales: Cohesion (pLeader support (p=0.001), Expressiveness (p

  18. S3T working group. Report 1: group aims

    International Nuclear Information System (INIS)

    Pouey, M.

    1983-04-01

    The work group S3T which is aimed to designing and developing devices using unconventional holographic optics is presented. These devices find applications that are classified here in four items high resolution spectrometers, high definition imaging, high flux devices, metrology and interferometry. The problems to solve and the aims of the group in each of these cases are presented. Three synthesis of lectures are in this report. The main one concerns stigmatism conditions of concave holographic gratings used in normal incidence. This new process of focusing is very interesting for hot plasma diagnostics [fr

  19. Pride, Shame and Group Identification

    Directory of Open Access Journals (Sweden)

    Alessandro eSalice

    2016-04-01

    Full Text Available Self-conscious emotions such as shame and pride are emotions that typically focus on the self of the person who feels them. In other words, the intentional object of these emotions is assumed to be the subject that experiences them. Many reasons speak in its favor and yet this account seems to leave a question open: how to cash out those cases in which one genuinely feels ashamed or proud of what someone else does?This paper contends that such cases do not necessarily challenge the idea that shame and pride are about the emoting subject. Rather, we claim that some of the most paradigmatic scenarios of shame and pride induced by others can be accommodated by taking seriously the consideration that, in such cases, the subject group-identifies with the other. This is the idea that, in feeling these forms of shame or pride, the subject is conceiving of herself as a member of the same group as the subject acting shamefully or in an admirable way. In other words, these peculiar emotive responses are elicited in the subject insofar as, and to the extent that, she is (or sees herself as being a member of a group – the group to which those who act shamefully or admirably also belong.By looking into the way in which the notion of group identification can allow for an account of hetero-induced shame and pride, this paper attempts to achieve a sort of mutual enlightenment that brings to light not only an important and generally neglected form of self-conscious emotions, but also relevant features of group identification. In particular, it generates evidence for the idea that group identification is a psychological process that the subject does not have to carry out intentionally in the sense that it is not necessarily triggered by the subject’s conative states like desires or intentions.

  20. Pride, Shame, and Group Identification.

    Science.gov (United States)

    Salice, Alessandro; Montes Sánchez, Alba

    2016-01-01

    Self-conscious emotions such as shame and pride are emotions that typically focus on the self of the person who feels them. In other words, the intentional object of these emotions is assumed to be the subject that experiences them. Many reasons speak in its favor and yet this account seems to leave a question open: how to cash out those cases in which one genuinely feels ashamed or proud of what someone else does? This paper contends that such cases do not necessarily challenge the idea that shame and pride are about the emoting subject. Rather, we claim that some of the most paradigmatic scenarios of shame and pride induced by others can be accommodated by taking seriously the consideration that, in such cases, the subject "group-identifies" with the other. This is the idea that, in feeling these forms of shame or pride, the subject is conceiving of herself as a member of the same group as the subject acting shamefully or in an admirable way. In other words, these peculiar emotive responses are elicited in the subject insofar as, and to the extent that, she is (or sees herself as being) a member of a group - the group to which those who act shamefully or admirably also belong. By looking into the way in which the notion of group identification can allow for an account of hetero-induced shame and pride, this paper attempts to achieve a sort of mutual enlightenment that brings to light not only an important and generally neglected form of self-conscious emotions, but also relevant features of group identification. In particular, it generates evidence for the idea that group identification is a psychological process that the subject does not have to carry out intentionally in the sense that it is not necessarily triggered by the subject's conative states like desires or intentions.

  1. Unitary Representations of Gauge Groups

    Science.gov (United States)

    Huerfano, Ruth Stella

    I generalize to the case of gauge groups over non-trivial principal bundles representations that I. M. Gelfand, M. I. Graev and A. M. Versik constructed for current groups. The gauge group of the principal G-bundle P over M, (G a Lie group with an euclidean structure, M a compact, connected and oriented manifold), as the smooth sections of the associated group bundle is presented and studied in chapter I. Chapter II describes the symmetric algebra associated to a Hilbert space, its Hilbert structure, a convenient exponential and a total set that later play a key role in the construction of the representation. Chapter III is concerned with the calculus needed to make the space of Lie algebra valued 1-forms a Gaussian L^2-space. This is accomplished by studying general projective systems of finitely measurable spaces and the corresponding systems of sigma -additive measures, all of these leading to the description of a promeasure, a concept modeled after Bourbaki and classical measure theory. In the case of a locally convex vector space E, the corresponding Fourier transform, family of characters and the existence of a promeasure for every quadratic form on E^' are established, so the Gaussian L^2-space associated to a real Hilbert space is constructed. Chapter III finishes by exhibiting the explicit Hilbert space isomorphism between the Gaussian L ^2-space associated to a real Hilbert space and the complexification of its symmetric algebra. In chapter IV taking as a Hilbert space H the L^2-space of the Lie algebra valued 1-forms on P, the gauge group acts on the motion group of H defining in an straight forward fashion the representation desired.

  2. Quantum group and quantum symmetry

    International Nuclear Information System (INIS)

    Chang Zhe.

    1994-05-01

    This is a self-contained review on the theory of quantum group and its applications to modern physics. A brief introduction is given to the Yang-Baxter equation in integrable quantum field theory and lattice statistical physics. The quantum group is primarily introduced as a systematic method for solving the Yang-Baxter equation. Quantum group theory is presented within the framework of quantum double through quantizing Lie bi-algebra. Both the highest weight and the cyclic representations are investigated for the quantum group and emphasis is laid on the new features of representations for q being a root of unity. Quantum symmetries are explored in selected topics of modern physics. For a Hamiltonian system the quantum symmetry is an enlarged symmetry that maintains invariance of equations of motion and allows a deformation of the Hamiltonian and symplectic form. The configuration space of the integrable lattice model is analyzed in terms of the representation theory of quantum group. By means of constructing the Young operators of quantum group, the Schroedinger equation of the model is transformed to be a set of coupled linear equations that can be solved by the standard method. Quantum symmetry of the minimal model and the WZNW model in conformal field theory is a hidden symmetry expressed in terms of screened vertex operators, and has a deep interplay with the Virasoro algebra. In quantum group approach a complete description for vibrating and rotating diatomic molecules is given. The exact selection rules and wave functions are obtained. The Taylor expansion of the analytic formulas of the approach reproduces the famous Dunham expansion. (author). 133 refs, 20 figs

  3. Group Chaos Theory: A Metaphor and Model for Group Work

    Science.gov (United States)

    Rivera, Edil Torres; Wilbur, Michael; Frank-Saraceni, James; Roberts-Wilbur, Janice; Phan, Loan T.; Garrett, Michael T.

    2005-01-01

    Group phenomena and interactions are described through the use of the chaos theory constructs and characteristics of sensitive dependence on initial conditions, phase space, turbulence, emergence, self-organization, dissipation, iteration, bifurcation, and attractors and fractals. These constructs and theoretical tenets are presented as applicable…

  4. Risk behaviour and group formation in microcredit groups in Eritrea

    NARCIS (Netherlands)

    Lensink, Robert; Mehrteab, Habteab T.

    2003-01-01

    We conducted a survey in 2001 among members and group leaders of borrowers who accessed loans from two microcredit programs in Eritrea. Using the results from this survey, this paper aims to provide new insights into the empirical relevance of the homogeneous matching hypothesis for microcredit

  5. Risk Behaviour and Group Formation in Microcredit Groups in Eritrea

    NARCIS (Netherlands)

    Lensink, B.W.; Mehrteab, H.T.

    2006-01-01

    We conducted a survey in 2001 among members and group leaders of borrowers who accessed loans from two microcredit programs in Eritrea. Using the results from this survey, this paper aims to provide new insights into the empirical relevance of the homogeneous matching hypothesis for microcredit

  6. The anatomy of group dysfunction.

    Science.gov (United States)

    Hayes, David F

    2014-04-01

    The dysfunction of the radiology group has 2 components: (1) the thinking component-the governance structure of the radiology group; how we manage the group; and (2) the structural component-the group's business model and its conflict with the partner's personal business model. Of the 2 components, governance is more important. Governance must be structured on classic, immutable business management principles. The structural component, the business model, is not immutable. In fact, it must continually change in response to the marketplace. Changes in the business model should occur only if demanded or permitted by the marketplace; instituting changes for other reasons, including personal interests or deficient knowledge of the deciders, is fundamentally contrary to the long-term interests of the group and its owners. First, we must learn basic business management concepts to appreciate the function and necessity of standard business models and standard business governance. Peter Drucker's The Effective Executive is an excellent primer on the subjects of standard business practices and the importance of a functional, authorized, and fully accountable chief executive officer. Copyright © 2014 American College of Radiology. Published by Elsevier Inc. All rights reserved.

  7. Focus group report, Part I

    International Nuclear Information System (INIS)

    1997-07-01

    The Waste Policy Institute, through a cooperative agreement with the U.S. Department of Energy's (DOE) Office of Science and Technology (OST), conducted two focus groups with people who live or work near DOE sites. The purpose of the focus groups was to gain a better understanding of the general community's information needs about the development of innovative technologies that are used in the cleanup of the sites. The authors wanted to better understand of what role these people want to play in the development of new technologies, how OST communication products can help facilitate that role, and the usefulness of current OST communication products. WPI held the focus groups in communities near the Idaho National Engineering and Environmental Laboratory (INEEL) and the Savannah River Site (SRS) because they are among the DOE sites that cannot be cleaned up before 2006. To include many facets of the communities, WPI randomly selected participants from membership lists of organized groups in each community including: elected officials, school boards, unions, chambers of commerce, economic development organizations, environmental organizations, health and human service organizations, and area clergy. While in the communities, WPI also interviewed stakeholders such as tribal representatives and a Citizens Advisory Board (CAB) member. Qualitative data gathered during the focus group sessions give some indication of general stakeholder opinions. However, the authors caution readers not to make broad assumptions about the general stakeholder audience based on the opinions of a limited number of general community stakeholders

  8. EDF Group - Annual Report 2005

    International Nuclear Information System (INIS)

    2006-01-01

    The EDF Group is a leading player in the European energy industry, present in all areas of the electricity value chain, from generation to trading, and increasingly active in the gas chain in Europe. Leader in the French electricity market, the Group also has solid positions in the United Kingdom, Germany and Italy. In the electricity sector, it has the premier generation fleet and customer portfolio in Europe and operates in strategically targeted areas in the rest of the world. The Group is also the leading network operator in Europe, giving it a sound business model, equally balanced between regulated activities and those open to competition. This document is EDF Group's annual report for the year 2005. It contains information about Group profile, governance, business, development strategy, sales and marketing, positions in Europe and international activities. The document is made of several reports: the Activity and Sustainable Development report, the Financial Report, the Sustainable Development Report, the Sustainable Development Indicators, the Management Report, the Report by the Chairman of EDF Board of Directors on corporate governance and internal control procedures

  9. EDF Group - Annual Report 2006

    International Nuclear Information System (INIS)

    2007-01-01

    The EDF Group is a leading player in the European energy industry, present in all areas of the electricity value chain, from generation to trading, and increasingly active in the gas chain in Europe. Leader in the French electricity market, the Group also has solid positions in the United Kingdom, Germany and Italy. In the electricity sector, it has the premier generation fleet and customer portfolio in Europe and operates in strategically targeted areas in the rest of the world. The Group is also the leading network operator in Europe, giving it a sound business model, equally balanced between regulated activities and those open to competition. This document is EDF Group's annual report for the year 2006. It contains information about Group profile, governance, business, development strategy, sales and marketing, positions in Europe and international activities. The document is made of several reports: the Activity and Sustainable Development Report, the Financial Report, the Sustainable Development Report, the Sustainable Development Indicators, and the Report by the Chairman of EDF Board of Directors on corporate governance and internal control procedures

  10. EDF group - Reference Document 2007

    International Nuclear Information System (INIS)

    2008-01-01

    The EDF Group is a leading player in the European energy industry, active in all areas of the electricity value chain, from generation to trading and network management. The leader in the French electricity market, the Group also has solid positions in the United Kingdom, Germany and Italy, with a portfolio of 38.5 million European customers and a generation fleet which is unique in the world. It intends to play a major role in the global revival of nuclear and is increasingly active in the gas chain. The Group has a sound business model, evenly balanced between regulated and deregulated activities. Given its R and D capability, its track record and expertise in nuclear, fossil-fired and hydro generation and in renewable energies, together with its energy eco-efficiency offers, EDF is well placed to deliver competitive solutions to reconcile sustainable economic growth and climate preservation. This document is EDF Group's Reference Document and Annual Financial Report for the year 2007. It contains information about Group profile, governance, business, investments, property, plant and equipment, management, financial position, human resources, shareholders, etc. The document includes the 2008 half-year financial report and consolidated financial statements, and the report drafted by the Statutory Auditors

  11. Differential geometry of group lattices

    International Nuclear Information System (INIS)

    Dimakis, Aristophanes; Mueller-Hoissen, Folkert

    2003-01-01

    In a series of publications we developed ''differential geometry'' on discrete sets based on concepts of noncommutative geometry. In particular, it turned out that first-order differential calculi (over the algebra of functions) on a discrete set are in bijective correspondence with digraph structures where the vertices are given by the elements of the set. A particular class of digraphs are Cayley graphs, also known as group lattices. They are determined by a discrete group G and a finite subset S. There is a distinguished subclass of ''bicovariant'' Cayley graphs with the property ad(S)S subset of S. We explore the properties of differential calculi which arise from Cayley graphs via the above correspondence. The first-order calculi extend to higher orders and then allow us to introduce further differential geometric structures. Furthermore, we explore the properties of ''discrete'' vector fields which describe deterministic flows on group lattices. A Lie derivative with respect to a discrete vector field and an inner product with forms is defined. The Lie-Cartan identity then holds on all forms for a certain subclass of discrete vector fields. We develop elements of gauge theory and construct an analog of the lattice gauge theory (Yang-Mills) action on an arbitrary group lattice. Also linear connections are considered and a simple geometric interpretation of the torsion is established. By taking a quotient with respect to some subgroup of the discrete group, generalized differential calculi associated with so-called Schreier diagrams are obtained

  12. Pride, Shame and Group Identification

    DEFF Research Database (Denmark)

    Salice, Alessandro; Montes Sanchez, Alba

    2016-01-01

    into the way in which the notion of group identification can allow for an account of hetero-induced shame and pride, this paper attempts to achieve a sort of mutual enlightenment that brings to light not only an important and generally neglected form of self-conscious emotions, but also relevant features...... scenarios of shame and pride induced by others can be accommodated by taking seriously the consideration that, in such cases, the subject “group-identifies” with the other. This is the idea that, in feeling these forms of shame or pride, the subject is conceiving of herself as a member of the same group...... as the subject acting shamefully or in an admirable way. In other words, these peculiar emotive responses are elicited in the subject insofar as, and to the extent that, she is (or sees herself as being) a member of a group – the group to which those who act shamefully or admirably also belong. By looking...

  13. EDF Group - Annual Report 2016

    International Nuclear Information System (INIS)

    2017-01-01

    EDF group is the world's leading electricity company and global leader for low-carbon energy production. Particularly well established in Europe, especially France, the United-Kingdom, Italy and Belgium, as well as North and South America, the Group covers all businesses spanning the electricity value chain - from generation to distribution and including energy transmission and trading activities - to continuously balance supply. A marked increase in the use of renewables is bringing change to its electricity generation operations, which are underpinned by a diversified and complementary energy mix founded on nuclear power capacity. EDF offers products and advice to help residential customers manage their electricity consumption, to support the energy and financial performance of its business customers, and to help local authorities find sustainable solutions. This document is EDF Group's annual report for the year 2016. It contains information about Group profile, governance, business, development strategy, sales and marketing, positions in Europe and international activities. The document comprises the Group's activities and performances Report and the 'EDF at a glance' 2017 report

  14. Storytellers - a women group experience

    Directory of Open Access Journals (Sweden)

    Stela Nazareth Meneghel

    2014-12-01

    Full Text Available This paper reports some psychosocial interventions in which were exploited the “storytelling", in workshops aimed at social workers and women in situation of vulnerability. The workshops were organized from the demands of social movements to combat violence and other extreme situations. The group was the field of intervention, from the demands, lived experiences of participants, based on methodological choice of narratives, life histories and stories of oral culture. We believe that groups of storytellers performed with women allow an exercise of critical reflection and change, as well as being an option for methodological research and practice feminist. Storytellers groups performed with women allow an exercise of critical reflection and change, as well as being a methodological option for feminist practice and research.

  15. CFCC working group meeting: Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-12-31

    This report is a compilation of the vugraphs presented at this meeting. Presentations covered are: CFCC Working Group; Overview of study on applications for advanced ceramics in industries for the future; Design codes and data bases: The CFCC program and its involvement in ASTM, ISO, ASME, and military handbook 17 activities; CFCC Working Group meeting (McDermott Technology); CFCC Working Group meeting (Textron); CFCC program for DMO materials; Developments in PIP-derived CFCCs; Toughened Silcomp (SiC-Si) composites for gas turbine engine applications; CFCC program for CVI materials; Self-lubricating CFCCs for diesel engine applications; Overview of the CFCC program`s supporting technologies task; Life prediction methodologies for CFCC components; Environmental testing of CFCCs in combustion gas environments; High-temperature particle filtration ORNL/DCC CRADA; HSCT CMC combustor; and Case study -- CFCC shroud for industrial gas turbines.

  16. Euratom Neutron Radiography Working Group

    DEFF Research Database (Denmark)

    Domanus, Joseph Czeslaw

    1986-01-01

    reactor fuel as well as establish standards for radiographic image quality of neutron radiographs. The NRWG meets once a year in each of the neutron radiography centers to review the progress made and draw plans for the future. Besides, ad-hoc sub-groups or. different topics within the field of neutron......In 1979 a Neutron Radiography Working Group (NRWG) was constituted within Buratom with the participation of all centers within the European Community at which neutron facilities were available. The main purpose of NRWG was to standardize methods and procedures used in neutron radiography of nuclear...... radiography are constituted. This paper reviews the activities and achievements of the NRWG and its sub-groups....

  17. Intergenerational Groups: Rediscovering our Legacy

    Directory of Open Access Journals (Sweden)

    Scott P. Anstadt

    2009-03-01

    Full Text Available Intergenerational groups are a community-based group concept designed to engage and mobilize often untapped resources of older adults in effective interaction with younger populations. These groups support an atmosphere of synergistic interaction. Members of each generation share reflections on interpersonal strengths and capacities and rediscover emotional and spiritual anchors and bonding. Illustrated here is Community Connections (CC, developed using the phase driven participatory culture-specific intervention model (PCSIM; Nastasi, Moore & Varjas, 2004 that included self selected local older adults, caregivers, and multicultural exchange students. The program was structured to offer mutual opportunities for activities built around exchanging cultural and life experiences. The goals were: 1 to reduce social isolation due to age, culture, or disability 2 for international students to practice English and learn about local cultural traditions, and 3 to build intergenerational ‘extended family’ relationships.

  18. Sequences, groups, and number theory

    CERN Document Server

    Rigo, Michel

    2018-01-01

    This collaborative book presents recent trends on the study of sequences, including combinatorics on words and symbolic dynamics, and new interdisciplinary links to group theory and number theory. Other chapters branch out from those areas into subfields of theoretical computer science, such as complexity theory and theory of automata. The book is built around four general themes: number theory and sequences, word combinatorics, normal numbers, and group theory. Those topics are rounded out by investigations into automatic and regular sequences, tilings and theory of computation, discrete dynamical systems, ergodic theory, numeration systems, automaton semigroups, and amenable groups.  This volume is intended for use by graduate students or research mathematicians, as well as computer scientists who are working in automata theory and formal language theory. With its organization around unified themes, it would also be appropriate as a supplemental text for graduate level courses.

  19. Reflection group on 'Expert Culture'

    International Nuclear Information System (INIS)

    Eggermont, G.

    2000-01-01

    As part of SCK-CEN's social sciences and humanities programme, a reflection group on 'Expert Culture' was established. The objectives of the reflection group are: (1) to clarify the role of SCK-CEN experts; (2) to clarify the new role of expertise in the evolving context of risk society; (3) to confront external views and internal SCK-CEN experiences on expert culture; (4) to improve trust building of experts and credibility of SCK-CEN as a nuclear actor in society; (5) to develop a draft for a deontological code; (6) to integrate the approach in training on assertivity and communication; (7) to create an output for a topical day on the subject of expert culture. The programme, achievements and perspectives of the refection group are summarised

  20. Groups and clusters of galaxies

    International Nuclear Information System (INIS)

    Bijleveld, W.

    1984-01-01

    In this thesis, a correlative study is performed with respect to the radio and X-ray parameters of galaxy clusters and groups of galaxies (Msub(v)-Psub(1.4); Msub(v)-Lsub(x); Lsub(x)-Psub(1.4); R-Msub(v) correlations). Special attention is paid to correlations with cD and elliptical galaxies. It is concluded that in rich clusters massive cD galaxies form; massive galaxies are able to bind a large X-ray halo; strong X-ray emitters fuel their central radio sources at a high rate; the total gas content of groups is low, which implies that the contribution of groups to the total matter density in the universe is small. (Auth.)

  1. Fossil Groups as Cosmological Labs

    Science.gov (United States)

    D'Onghia, Elena

    Optical and X-ray measurements of fossil groups (FGs) suggest that they are old and relaxed systems. If FGs are assembled at higher redshift, there is enough time for intermediate-luminosity galaxies to merge, resulting in the formation of the brightest group galaxy (BGG). We carry out the first, systematic study of a large sample of FGs, the "FOssil Group Origins'' (FOGO) based on an International Time Project at the Roque de los Muchachos Observatory. For ten FOGO FGs we have been awarded time at SUZAKU Telescope to measure the temperature of the hot intragroup gas (IGM). For these systems we plan to evaluate and correlate their X-ray luminosity and X-ray temperature, Lx-Tx, optical luminosity and X-ray temperature, Lopt-Tx, and group velocity dispersion with their X-ray temperature, sigma V-Tx, as compared to the non fossil systems. By combining these observations with state-of-art cosmological hydrodynamical simulations we will open a new window into the study of the IGM and the nature of fossil systems. Our proposed work will be of direct relevance for the understanding and interpretation of data from several NASA science missions. Specifically, the scaling relations obtained from these data combined with our predictions obtained using state-of-the-art hydrodynamical simulation numerical adopting a new hydrodynamical scheme will motivate new proposal on CHANDRA X-ray telescope for fossil groups and clusters. We will additionally create a public Online Planetarium Show. This will be an educational site, containing an interactive program called: "A Voyage to our Universe''. In the show we will provide observed images of fossil groups and similar images and movies obtained from the numerical simulations showing their evolution. The online planetarium show will be a useful reference and an interactive educational tool for both students and the public.

  2. Leading Indian Business-Groups

    Directory of Open Access Journals (Sweden)

    Maria Alexandrovna Vorobyeva

    2016-01-01

    Full Text Available The goal of this paper is to investigate the evolution of the leading Indian business-groups under the conditions of economical liberalization. It is shown that the role of modern business-groups in the Indian economy is determined by their high rate in the gross domestic product (GDP, huge overall actives, substantial pert in the e[port of goods and services, as well as by their activities in modern branch structure formatting, and developing labor-intensive and high-tech branches. They strongly influence upon economical national strategies, they became a locomotive of internationalization and of transnationalization of India, the basis of the external economy factor system, the promoters of Indian "economical miracle" on the world scene, and the dynamical segment of economical and social development of modern India. The tendencies of the development of the leading Indian business groups are: gradual concentration of production in few clue sectors, "horizontal" structure, incorporation of the enterprises into joint-stock structure, attraction of hired top-managers and transnationaliziation. But against this background the leading Indian business-groups keep main traditional peculiarities: they mostly still belong to the families of their founders, even today they observe caste or communal relations which are the basis of their non-formal backbone tides, they still remain highly diversificated structures with weak interrelations. Specific national ambivalence and combination of traditions and innovations of the leading Indian business-groups provide their high vitality and stability in the controversial, multiform, overloaded with caste and confessional remains Indian reality. We conclude that in contrast to the dominant opinion transformation of these groups into multisectoral corporations of the western type is far from completion, and in the nearest perspective they will still possess all their peculiarities and incident social and economical

  3. Magnetic susceptibility of functional groups

    International Nuclear Information System (INIS)

    Herr, T.; Ferraro, M.B.; Contreras, R.H.

    1990-01-01

    Proceeding with a series of works where new criteria are applied to the the calculation of the contribution of molecular fragments to certain properties, results are presented for a group of 1-X-benzenes and 1-X-naphtalenes for the magnetic susceptibility constant. Both the diamagnetic and paramagnetic parts are taken into account. To reduce the problems associated with the Gauge dependence originated in the approximations made, Gauge independent atomic orbitals (GIAO) orbitals are used in the atomic orbital basis. Results are discussed in terms of functional groups. (Author). 17 refs., 1 fig., 3 tabs

  4. Molecular blood grouping of donors.

    Science.gov (United States)

    St-Louis, Maryse

    2014-04-01

    For many decades, hemagglutination has been the sole means to type blood donors. Since the first blood group gene cloning in the early 1990s, knowledge on the molecular basis of most red blood cell, platelet and neutrophil antigens brought the possibility of using nucleotide-based techniques to predict phenotype. This review will summarized methodologies available to genotype blood groups from laboratory developed assays to commercially available platforms, and how proficiency assays become more present. The author will also share her vision of the transfusion medicine future. The field is presently at the crossroads, bringing new perspectives to a century old practice. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Exceptional groups from open strings

    International Nuclear Information System (INIS)

    Gaberdiel, M.R.; Zwiebach, B.

    1998-01-01

    We consider type IIB theory compactified on a two-sphere in the presence of mutually non-local 7-branes. The BPS states associated with the gauge vectors of exceptional groups are seen to arise from open strings connecting the 7-branes, and multi-pronged open strings capable of ending on more than two 7-branes. These multi-pronged strings are built from open string junctions that arise naturally when strings cross 7-branes. The different string configurations can be multiplied as traditional open strings, and are shown to generate the structure of exceptional groups. (orig.)

  6. Induced modules over group algebras

    CERN Document Server

    Karpilovsky, Gregory

    1990-01-01

    In 1898 Frobenius discovered a construction which, in present terminology, associates with every module of a subgroup the induced module of a group. This construction proved to be of fundamental importance and is one of the basic tools in the entire theory of group representations.This monograph is designed for research mathematicians and advanced graduate students and gives a picture of the general theory of induced modules as it exists at present. Much of the material has until now been available only in research articles. The approach is not intended to be encyclopedic, rather each topic is

  7. Lego Group: An Outsourcing Journey

    DEFF Research Database (Denmark)

    Larsen, Marcus Møller; Pedersen, Torben; Slepniov, Dmitrij

    2010-01-01

    The last years’ rather adventurous journey from 2004 to 2009 had taught the fifth-largest toy-maker in the world - the LEGO Group - the importance of managing the global supply chain effectively. In order to survive the largest internal financial crisis in its roughly 70 years of existence......, the management had, among many initiatives, decided to offshore and outsource a major chunk of its production to Flextronics. In this pursuit of rapid cost-cutting sourcing advantages, the LEGO Group planned to license out as much as 80 per cent of its production besides closing down major parts...

  8. Automated analysis in generic groups

    Science.gov (United States)

    Fagerholm, Edvard

    This thesis studies automated methods for analyzing hardness assumptions in generic group models, following ideas of symbolic cryptography. We define a broad class of generic and symbolic group models for different settings---symmetric or asymmetric (leveled) k-linear groups --- and prove ''computational soundness'' theorems for the symbolic models. Based on this result, we formulate a master theorem that relates the hardness of an assumption to solving problems in polynomial algebra. We systematically analyze these problems identifying different classes of assumptions and obtain decidability and undecidability results. Then, we develop automated procedures for verifying the conditions of our master theorems, and thus the validity of hardness assumptions in generic group models. The concrete outcome is an automated tool, the Generic Group Analyzer, which takes as input the statement of an assumption, and outputs either a proof of its generic hardness or shows an algebraic attack against the assumption. Structure-preserving signatures are signature schemes defined over bilinear groups in which messages, public keys and signatures are group elements, and the verification algorithm consists of evaluating ''pairing-product equations''. Recent work on structure-preserving signatures studies optimality of these schemes in terms of the number of group elements needed in the verification key and the signature, and the number of pairing-product equations in the verification algorithm. While the size of keys and signatures is crucial for many applications, another aspect of performance is the time it takes to verify a signature. The most expensive operation during verification is the computation of pairings. However, the concrete number of pairings is not captured by the number of pairing-product equations considered in earlier work. We consider the question of what is the minimal number of pairing computations needed to verify structure-preserving signatures. We build an

  9. Transformation groups and Lie algebras

    CERN Document Server

    Ibragimov, Nail H

    2013-01-01

    This book is based on the extensive experience of teaching for mathematics, physics and engineering students in Russia, USA, South Africa and Sweden. The author provides students and teachers with an easy to follow textbook spanning a variety of topics. The methods of local Lie groups discussed in the book provide universal and effective method for solving nonlinear differential equations analytically. Introduction to approximate transformation groups also contained in the book helps to develop skills in constructing approximate solutions for differential equations with a small parameter.

  10. Group 4 metallocene complexes with pendant nitrile groups

    Czech Academy of Sciences Publication Activity Database

    Pinkas, Jiří; Gyepes, R.; Kubišta, Jiří; Horáček, Michal; Lamač, Martin

    2011-01-01

    Roč. 696, 11-12 (2011), s. 2364-2372 ISSN 0022-328X R&D Projects: GA ČR GPP207/10/P200; GA MŠk(CZ) LC06070 Institutional research plan: CEZ:AV0Z40400503 Keywords : metallocene * group 4 elements * nitrile Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.384, year: 2011

  11. Censorship: Pressure Groups and Boycotts

    Science.gov (United States)

    Silverman, Fred

    1978-01-01

    Records ABC President Fred Silverman's 1977 speech to the American Association of Advertising Agencies emphasizing the potential harm inherent in pressure groups and boycott's increasing power over broadcasters and advertisers. Available from: Vital Speeches of the Day, City News Publishing Company, Box 606, Southold, New York 11971. (MH)

  12. On framed simple Lie groups

    OpenAIRE

    MINAMI, Haruo

    2016-01-01

    For a compact simple Lie group $G$, we show that the element $[G, \\mathcal{L}] \\in \\pi^S_*(S^0)$ represented by the pair $(G, \\mathcal{L})$ is zero, where $\\mathcal{L}$ denotes the left invariant framing of $G$. The proof relies on the method of E. Ossa [Topology, 21 (1982), 315–323].

  13. Working group report: Collider Physics

    Indian Academy of Sciences (India)

    11KEK, Tsukuba, Japan. 12Cornell University ... This is summary of the activities of the working group on collider physics in the IXth ... In view of the requirements of the hour and the available skills and interests, it was decided to .... The actual computation, which is long and somewhat tedious, is currently under way and is ...

  14. An Alternative to Ability Grouping

    Science.gov (United States)

    Tomlinson, Carol Ann

    2006-01-01

    Ability grouping is a common approach to dealing with student variance in learning. In general, findings suggest that such an approach to dealing with student differences is disadvantageous to students who struggle in school and advantageous to advanced learners. The concept of differentiation suggests that there is another alternative to…

  15. String Topology for Lie Groups

    DEFF Research Database (Denmark)

    A. Hepworth, Richard

    2010-01-01

    In 1999 Chas and Sullivan showed that the homology of the free loop space of an oriented manifold admits the structure of a Batalin-Vilkovisky algebra. In this paper we give a direct description of this Batalin-Vilkovisky algebra in the case that the manifold is a compact Lie group G. Our answer ...

  16. Environmental groups in monopolistic markets

    NARCIS (Netherlands)

    Heijnen, P.; Schoonbeek, L.

    2008-01-01

    We examine a market in which a monopolistic firm supplies a good. The production of the good causes damage to the environment. Consumers are heterogeneous with respect to their disutility of the environmental damage. An environmental group can enter the market and set up a campaign in order to

  17. Environmental groups in monopolistic markets

    NARCIS (Netherlands)

    Heijnen, Pim; Schoonbeek, Lambert

    We examine a market in which a monopolistic firm supplies a good. The production of the good causes damage to the environment. Consumers are heterogeneous with respect to their disutility of the environmental damage. An environmental group can enter the market and set up a campaign in order to

  18. EDF group. Annual report 2001

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-05-01

    This document is the English version of the 2001 annual report of Electricite de France (EdF) Group, the French electric utility. It comprises 4 parts: introduction (statement of the chairman and chief executive officer, corporate governance, group key figures, sustainable growth indicators - parent company, energy for a sustainable future, EdF group worldwide); dynamics and balanced growth (financial results, EdF's strategy in building a competitive global group: consolidating the European network, moving forward in energy-related services, responding to increasing energy demand in emerging countries); sustainable solutions for all (empowering the customer: competitive solutions for industrial customers, anticipating the needs of residential customers and SMEs, environmental solutions to enhance urban life, upgrading the network and providing access to energy; a sound, sustainable and secure energy mix: a highly competitive nuclear fleet, the vital resource of fossil-fuelled plants, a proactive approach to renewable energies); a global commitment to corporate social responsibility (human resources and partnerships). (J.S.)

  19. Entry Facilitation by Environmental Groups

    NARCIS (Netherlands)

    van der Made, Allard; Schoonbeek, Lambert

    We consider a model of vertical product differentiation where consumers care about the environmental damage their consumption causes. An environmental group is capable of increasing consumers' environmental concern via a costly campaign. We show that the prospect of such a campaign can induce entry

  20. Differential equations and finite groups

    NARCIS (Netherlands)

    Put, Marius van der; Ulmer, Felix

    2000-01-01

    The classical solution of the Riemann-Hilbert problem attaches to a given representation of the fundamental group a regular singular linear differential equation. We present a method to compute this differential equation in the case of a representation with finite image. The approach uses Galois